#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MST1L	11223	broad.mit.edu	37	1	17084510	17084510	+	RNA	SNP	G	G	A	rs11260921	byFrequency	TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:17084510G>A	ENST00000455405.2	-	0	379							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.L525L(2)|p.L530L(2)									ACCCGCTGTAGGCCTGGCTCT	0.577																																							uc010ock.1		NA																	4	Substitution - coding silent(4)		endometrium(2)|kidney(2)		0						c.(1588-1590)CTA>TTA		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17084510G>A	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084510G>A			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Silent_p.L130L	p.L530L	NR_002729		WXS	Illumina HiSeq	Unspecified					12	1588	-								B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37	c.1588C>T																																																																																					0.577	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		14	147	0	0	0	0.001855	0	14	147				
MST1L	11223	broad.mit.edu	37	1	17085865	17085865	+	RNA	SNP	A	A	G	rs1057378		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:17085865A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.L319P(2)|p.L309P(2)									TGAGCCGTCGAGGTTCCAGCA	0.667																																							uc010ock.1		NA																	4	Substitution - Missense(4)		prostate(4)		0						c.(955-957)CTC>CCC		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085865A>G	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085865A>G			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.L319P	NR_002729		WXS	Illumina HiSeq	Unspecified					8	956	-								B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37	c.956T>C		.	.	.	.	.	.	.	.	.	.	.	0.025	-1.380835	0.01204	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.41823	N	0.000801	T	0.13243	0.0321	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.28202	-1.0051	6	0.02654	T	1	.	2.6652	0.05046	0.5:0.0:0.5:0.0	rs1057378;rs2092131;rs2446557;rs3206761;rs3982165;rs4052564;rs57482948	319	Q2TV78-2	.	P	309;319;319	.	ENSP00000439273:L319P	L	-	2	0	MST1P9	16958452	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	4.768000	0.62293	-0.000000	0.14550	0.000000	0.15137	CTC		0.667	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		4	27	0	0	0	0.001168	0	4	27				
MST1L	11223	broad.mit.edu	37	1	17085872	17085872	+	RNA	SNP	A	A	G	rs1806514		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:17085872A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.W307R(1)|p.W317R(1)									TCGAGGTTCCAGCAGAAGTTC	0.662																																							uc010ock.1		NA																	2	Substitution - Missense(2)		prostate(2)		0						c.(949-951)TGG>CGG		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085872A>G	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085872A>G			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.W317R	NR_002729		WXS	Illumina HiSeq	Unspecified					8	949	-								B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37	c.949T>C		.	.	.	.	.	.	.	.	.	.	.	0.008	-1.910101	0.00508	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.37857	N	0.001920	T	0.10809	0.0264	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.28073	-1.0055	6	0.02654	T	1	.	2.1243	0.03734	0.4998:2.0E-4:2.0E-4:0.4998	rs1806514;rs2021016;rs2761537;rs3982178;rs61595267	317	Q2TV78-2	.	R	307;317;317	.	ENSP00000439273:W317R	W	-	1	0	MST1P9	16958459	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.935000	0.40173	-0.000000	0.14550	0.000000	0.15137	TGG		0.662	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		4	28	0	0	0	0.001168	0	4	28				
NR0B2	8431	broad.mit.edu	37	1	27238432	27238432	+	Silent	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:27238432G>A	ENST00000254227.3	-	2	703	c.678C>T	c.(676-678)tcC>tcT	p.S226S		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	226	Ligand-binding. {ECO:0000250}.				cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TGGTCGGAATGGACTTGAGGG	0.602																																							uc001bnf.2		NA																	0					0						c.(676-678)TCC>TCT		short heterodimer partner							148.0	146.0	147.0					1																	27238432		2203	4300	6503	SO:0001819	synonymous_variant	8431				cholesterol metabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	DNA binding|protein domain specific binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity	g.chr1:27238432G>A	AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.678C>T	1.37:g.27238432G>A			Somatic					p.S226S	NM_021969	NP_068804	WXS	Illumina HiSeq	Unspecified	Q15466	NR0B2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)	2	814	-		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	226			Ligand-binding (By similarity).		F1D8P5|Q5QP36	Silent	SNP	ENST00000254227.3	37	c.678C>T	CCDS291.1																																																																																				0.602	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012185.1			73	181	0	0	0	0.00361	0	73	181				
SRSF4	6429	broad.mit.edu	37	1	29481238	29481238	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:29481238C>A	ENST00000373795.4	-	4	782	c.548G>T	c.(547-549)cGg>cTg	p.R183L	SRSF4_ENST00000546138.1_Intron|RP11-242O24.5_ENST00000450108.1_RNA|SRSF4_ENST00000466448.1_5'UTR	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	183	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						GGAGTAGGACCGGCGTCGTCT	0.398																																							uc001bro.2		NA																	0					0						c.(547-549)CGG>CTG		splicing factor, arginine/serine-rich 4							93.0	95.0	94.0					1																	29481238		2203	4300	6503	SO:0001583	missense	6429				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding	g.chr1:29481238C>A	BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.548G>T	1.37:g.29481238C>A	ENSP00000362900:p.Arg183Leu		Somatic				SFRS4_uc010ofy.1_Intron|SFRS4_uc009vtp.2_RNA	p.R183L	NM_005626	NP_005617	WXS	Illumina HiSeq	Unspecified	Q08170	SRSF4_HUMAN		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)	4	921	-		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)	183			Arg/Ser-rich (RS domain).		Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	ENST00000373795.4	37	c.548G>T	CCDS333.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373501	0.82573	.	.	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.42900	0.96	5.47	5.47	0.80525	.	0.052312	0.85682	D	0.000000	T	0.59115	0.2170	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.67548	0.952	T	0.54814	-0.8237	10	0.42905	T	0.14	.	18.678	0.91535	0.0:1.0:0.0:0.0	.	183	Q08170	SRSF4_HUMAN	L	183	ENSP00000362900:R183L	ENSP00000362900:R183L	R	-	2	0	SRSF4	29353825	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.358000	0.79466	2.708000	0.92522	0.650000	0.86243	CGG		0.398	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626		29	73	1	0	6.00712e-18	0.002445	1.51523e-17	29	73				
CYP4B1	1580	broad.mit.edu	37	1	47276491	47276491	+	Silent	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:47276491G>A	ENST00000271153.4	+	2	228	c.192G>A	c.(190-192)acG>acA	p.T64T	CYP4B1_ENST00000371919.4_Silent_p.T64T|CYP4B1_ENST00000546128.1_3'UTR|CYP4B1_ENST00000371923.4_Silent_p.T64T|CYP4B1_ENST00000452782.2_5'Flank			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	64					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	TCCAGGAGACGGGGAGCCTGG	0.577																																							uc001cqm.3		NA																	0				ovary(1)|skin(1)	2						c.(190-192)ACG>ACA		cytochrome P450, family 4, subfamily B,							88.0	77.0	81.0					1																	47276491		2203	4300	6503	SO:0001819	synonymous_variant	1580				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr1:47276491G>A	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.192G>A	1.37:g.47276491G>A			Somatic				CYP4B1_uc009vyl.1_5'UTR|CYP4B1_uc001cqn.3_Silent_p.T64T|CYP4B1_uc009vym.2_Silent_p.T64T|CYP4B1_uc010omk.1_Intron|CYP4B1_uc010oml.1_5'Flank	p.T64T	NM_000779	NP_000770	WXS	Illumina HiSeq	Unspecified	P13584	CP4B1_HUMAN			2	276	+	Acute lymphoblastic leukemia(166;0.155)		64					Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Silent	SNP	ENST00000271153.4	37	c.192G>A	CCDS542.1																																																																																				0.577	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779		38	78	0	0	0	0.007835	0	38	78				
RAB3B	5865	broad.mit.edu	37	1	52403001	52403001	+	Silent	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:52403001G>T	ENST00000371655.3	-	3	524	c.312C>A	c.(310-312)atC>atA	p.I104I		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	104					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						CTTCATTGGTGATGTCATACA	0.458																																							uc001cth.2		NA																	0				ovary(1)	1						c.(310-312)ATC>ATA		RAB3B, member RAS oncogene family							150.0	135.0	140.0					1																	52403001		2203	4300	6503	SO:0001819	synonymous_variant	5865				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr1:52403001G>T	BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.312C>A	1.37:g.52403001G>T			Somatic					p.I104I	NM_002867	NP_002858	WXS	Illumina HiSeq	Unspecified	P20337	RAB3B_HUMAN			3	437	-			104					Q5VUL2|Q9BSI1	Silent	SNP	ENST00000371655.3	37	c.312C>A	CCDS560.1																																																																																				0.458	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1	NM_002867		82	160	1	0	1.26458e-31	0.00361	3.59184e-31	82	160				
GDAP2	54834	broad.mit.edu	37	1	118454705	118454705	+	Splice_Site	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:118454705C>T	ENST00000369443.5	-	5	720		c.e5-1		GDAP2_ENST00000369442.3_Splice_Site	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2						response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		TGACTGCTCTCTGCAACAAAG	0.353																																							uc001ehf.2		NA																	0				ovary(2)	2						c.e5-1		ganglioside induced differentiation associated							91.0	84.0	87.0					1																	118454705		2203	4300	6503	SO:0001630	splice_region_variant	54834							g.chr1:118454705C>T	AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.471-1G>A	1.37:g.118454705C>T			Somatic				GDAP2_uc001ehg.2_Splice_Site_p.K157_splice	p.K157_splice	NM_017686	NP_060156	WXS	Illumina HiSeq	Unspecified	Q9NXN4	GDAP2_HUMAN		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)	5	770	-		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)						Q96DZ0	Splice_Site	SNP	ENST00000369443.5	37	c.471_splice	CCDS897.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327274	0.81690	.	.	ENSG00000196505	ENST00000369443;ENST00000369442	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0551	0.93059	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GDAP2	118256228	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.174000	0.77620	2.729000	0.93468	0.650000	0.86243	.		0.353	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033732.2	NM_017686	Intron	12	39	0	0	0	0.001855	0	12	39				
OR6N2	81442	broad.mit.edu	37	1	158746799	158746799	+	Silent	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:158746799G>T	ENST00000339258.1	-	1	626	c.627C>A	c.(625-627)atC>atA	p.I209I		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					AGAAGAAAGTGATAAGAATTA	0.408																																							uc010pir.1		NA																	0					0						c.(625-627)ATC>ATA		olfactory receptor, family 6, subfamily N,							54.0	54.0	54.0					1																	158746799		2203	4300	6503	SO:0001819	synonymous_variant	81442				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158746799G>T	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.627C>A	1.37:g.158746799G>T			Somatic					p.I209I	NM_001005278	NP_001005278	WXS	Illumina HiSeq	Unspecified	Q8NGY6	OR6N2_HUMAN			1	627	-	all_hematologic(112;0.0378)		209			Helical; Name=5; (Potential).		Q6IFR2	Silent	SNP	ENST00000339258.1	37	c.627C>A	CCDS30906.1																																																																																				0.408	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1			16	74	1	0	4.75885e-15	0.00499	1.13274e-14	16	74				
TNR	7143	broad.mit.edu	37	1	175334271	175334271	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:175334271G>A	ENST00000367674.2	-	12	3170	c.2462C>T	c.(2461-2463)tCc>tTc	p.S821F	TNR_ENST00000263525.2_Missense_Mutation_p.S821F			Q92752	TENR_HUMAN	tenascin R	821	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGCATCCAGGGAGACCTCCAT	0.537																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(2461-2463)TCC>TTC		tenascin R precursor							132.0	119.0	124.0					1																	175334271		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175334271G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2462C>T	1.37:g.175334271G>A	ENSP00000356646:p.Ser821Phe		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.S821F	p.S821F	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			10	2543	-	Renal(580;0.146)		821			Fibronectin type-III 6.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.2462C>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	9.903	1.207400	0.22205	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.58940	0.3;0.3	5.91	4.99	0.66335	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.275715	0.37906	N	0.001888	T	0.31702	0.0805	N	0.05351	-0.065	0.29505	N	0.854602	B	0.06786	0.001	B	0.09377	0.004	T	0.21008	-1.0258	10	0.10902	T	0.67	.	8.5553	0.33478	0.2335:0.0:0.7665:0.0	.	821	Q92752	TENR_HUMAN	F	821	ENSP00000356646:S821F;ENSP00000263525:S821F	ENSP00000263525:S821F	S	-	2	0	TNR	173600894	0.998000	0.40836	1.000000	0.80357	0.784000	0.44337	2.610000	0.46325	1.471000	0.48121	0.655000	0.94253	TCC		0.537	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		19	175	0	0	0	0.008871	0	19	175				
XPR1	9213	broad.mit.edu	37	1	180775265	180775265	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:180775265G>A	ENST00000367590.4	+	5	713	c.515G>A	c.(514-516)gGa>gAa	p.G172E	XPR1_ENST00000367589.3_Missense_Mutation_p.G172E	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	172	SPX. {ECO:0000255|PROSITE- ProRule:PRU00714}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						ACATCTCGTGGAGCAGATTGG	0.388																																							uc001goi.2		NA																	0					0						c.(514-516)GGA>GAA		xenotropic and polytropic retrovirus receptor							83.0	84.0	84.0					1																	180775265		2203	4300	6503	SO:0001583	missense	9213					integral to plasma membrane	G-protein coupled receptor activity	g.chr1:180775265G>A	AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.515G>A	1.37:g.180775265G>A	ENSP00000356562:p.Gly172Glu		Somatic				XPR1_uc009wxm.2_Missense_Mutation_p.G172E|XPR1_uc009wxn.2_Missense_Mutation_p.G172E	p.G172E	NM_004736	NP_004727	WXS	Illumina HiSeq	Unspecified	Q9UBH6	XPR1_HUMAN			5	707	+			172			SPX.|Cytoplasmic (Potential).		O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	ENST00000367590.4	37	c.515G>A	CCDS1340.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019734	0.93462	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T	0.44083	0.93	5.42	5.42	0.78866	SPX, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.77651	-0.2508	10	0.87932	D	0	-12.1397	18.7999	0.92011	0.0:0.0:1.0:0.0	.	172;172	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	E	172	ENSP00000356562:G172E	ENSP00000356561:G172E	G	+	2	0	XPR1	179041888	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.338000	0.96553	2.547000	0.85894	0.484000	0.47621	GGA		0.388	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	NM_004736		32	112	0	0	0	0.001786	0	32	112				
COLGALT2	23127	broad.mit.edu	37	1	183947644	183947644	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:183947644C>A	ENST00000361927.4	-	2	645	c.274G>T	c.(274-276)Gat>Tat	p.D92Y	COLGALT2_ENST00000546159.1_Missense_Mutation_p.D92Y	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	92					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										ACATTGTGATCAGTGGCTGCC	0.408																																						Esophageal Squamous(10;42 606 18489 38825)	uc001gqr.2		NA																	0				ovary(1)|breast(1)	2						c.(274-276)GAT>TAT		glycosyltransferase 25 domain containing 2							184.0	164.0	171.0					1																	183947644		2203	4300	6503	SO:0001583	missense	23127				lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity	g.chr1:183947644C>A	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.274G>T	1.37:g.183947644C>A	ENSP00000354960:p.Asp92Tyr		Somatic				GLT25D2_uc010poj.1_Missense_Mutation_p.D92Y|GLT25D2_uc001gqs.2_5'UTR	p.D92Y	NM_015101	NP_055916	WXS	Illumina HiSeq	Unspecified	Q8IYK4	GT252_HUMAN			2	646	-			92					O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	c.274G>T	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739591	0.89573	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.73469	-0.75;-0.75	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.89805	0.6821	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.983	D	0.92064	0.5659	10	0.87932	D	0	.	19.0907	0.93225	0.0:1.0:0.0:0.0	.	92;92	F5H3T5;Q8IYK4	.;GT252_HUMAN	Y	92	ENSP00000439112:D92Y;ENSP00000354960:D92Y	ENSP00000354960:D92Y	D	-	1	0	GLT25D2	182214267	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	7.507000	0.81676	2.517000	0.84864	0.650000	0.86243	GAT		0.408	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101		38	129	1	0	3.76114e-14	0.004289	8.82822e-14	38	129				
IVNS1ABP	10625	broad.mit.edu	37	1	185270131	185270131	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:185270131C>G	ENST00000367498.3	-	10	1715	c.1093G>C	c.(1093-1095)Gag>Cag	p.E365Q	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.E147Q	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	365	Sufficient for AHR interaction and signaling.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						CCATTCATCTCTGCTGTTCCC	0.423																																							uc001grl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1093-1095)GAG>CAG		influenza virus NS1A binding protein							131.0	122.0	125.0					1																	185270131		2203	4299	6502	SO:0001583	missense	10625				interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex		g.chr1:185270131C>G	AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1093G>C	1.37:g.185270131C>G	ENSP00000356468:p.Glu365Gln		Somatic				IVNS1ABP_uc001gri.2_Missense_Mutation_p.E25Q|IVNS1ABP_uc001grj.2_Missense_Mutation_p.E25Q|IVNS1ABP_uc009wyj.2_Missense_Mutation_p.E147Q|IVNS1ABP_uc009wyk.2_RNA|IVNS1ABP_uc001grm.2_Missense_Mutation_p.E25Q	p.E365Q	NM_006469	NP_006460	WXS	Illumina HiSeq	Unspecified	Q9Y6Y0	NS1BP_HUMAN			10	1716	-			365			Sufficient for AHR interaction and signaling.		A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	ENST00000367498.3	37	c.1093G>C	CCDS1368.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.079756	0.55753	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.77620	-1.11;-1.11	5.78	5.78	0.91487	Galactose oxidase, beta-propeller (1);	0.048345	0.85682	D	0.000000	T	0.82190	0.4983	L	0.45051	1.395	0.52099	D	0.999946	B;P;D	0.58970	0.316;0.631;0.984	B;B;P	0.55303	0.181;0.406;0.773	T	0.82993	-0.0181	10	0.66056	D	0.02	.	20.0139	0.97470	0.0:1.0:0.0:0.0	.	147;66;365	A8MVR0;Q6MZF3;Q9Y6Y0	.;.;NS1BP_HUMAN	Q	365;147	ENSP00000356468:E365Q;ENSP00000375864:E147Q	ENSP00000356468:E365Q	E	-	1	0	IVNS1ABP	183536754	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.510000	0.67018	2.724000	0.93272	0.563000	0.77884	GAG		0.423	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469		39	157	0	0	0	0.002522	0	39	157				
OR2L13	284521	broad.mit.edu	37	1	248153914	248153914	+	Intron	SNP	A	A	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:248153914A>G	ENST00000366478.2	+	1	194					NM_175911.2	NP_787107.1	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TGCTCCTGACATCAATGGCCT	0.443																																							uc001idv.1		NA																	0					0						c.(100-102)ACA>ACG		RecName: Full=Olfactory receptor 2L5; AltName: Full=Olfactory receptor OR1-53;																																				SO:0001627	intron_variant	26247							g.chr1:248153914A>G	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000366478.2:c.-144+53228A>G	1.37:g.248153914A>G			Somatic				OR2L13_uc001ids.2_Intron	p.T34T	NR_002145		WXS	Illumina HiSeq	Unspecified					1	346	+								Q5VUR5	Silent	SNP	ENST00000366478.2	37	c.102A>G	CCDS1637.1																																																																																				0.443	OR2L13-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_175911		58	168	0	0	0	0.00361	0	58	168				
PTCHD3	374308	broad.mit.edu	37	10	27702244	27702244	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr10:27702244C>A	ENST00000438700.3	-	1	1053	c.936G>T	c.(934-936)atG>atT	p.M312I		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	312					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GTAACTGGCCCATTCCTAGGC	0.602																																							uc001itu.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(934-936)ATG>ATT		patched domain containing 3							75.0	76.0	76.0					10																	27702244		2203	4300	6503	SO:0001583	missense	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27702244C>A	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.936G>T	10.37:g.27702244C>A	ENSP00000417658:p.Met312Ile		Somatic					p.M312I	NM_001034842	NP_001030014	WXS	Illumina HiSeq	Unspecified	Q3KNS1	PTHD3_HUMAN			1	1054	-			312			Helical; (Potential).		I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	c.936G>T	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	C	8.863	0.947430	0.18356	.	.	ENSG00000182077	ENST00000438700	D	0.85171	-1.95	3.98	-0.324	0.12706	.	3.638340	0.00397	N	0.000046	T	0.79233	0.4411	L	0.44542	1.39	0.09310	N	1	B	0.26400	0.148	B	0.23018	0.043	T	0.59679	-0.7409	10	0.37606	T	0.19	0.6542	5.0966	0.14737	0.0:0.4512:0.3002:0.2486	.	312	Q3KNS1	PTHD3_HUMAN	I	312	ENSP00000417658:M312I	ENSP00000417658:M312I	M	-	3	0	PTCHD3	27742250	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.135000	0.10420	-0.151000	0.11176	0.561000	0.74099	ATG		0.602	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		51	141	1	0	2.74695e-27	0.00361	7.54854e-27	51	141				
ASAH2	56624	broad.mit.edu	37	10	51978297	51978297	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr10:51978297C>T	ENST00000395526.4	-	7	986	c.987G>A	c.(985-987)gaG>gaA	p.E329E	ASAH2_ENST00000329428.6_Silent_p.E310E|ASAH2_ENST00000443575.1_Silent_p.E171E|ASAH2_ENST00000447815.1_Silent_p.E329E	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	329					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						CTTTGTTCTTCTCTTGCTCAA	0.423																																							uc001jjd.2		NA																	0					0						c.(985-987)GAG>GAA		N-acylsphingosine amidohydrolase 2 isoform a							37.0	27.0	33.0					10																	51978297		1951	1126	3077	SO:0001819	synonymous_variant	56624				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity	g.chr10:51978297C>T	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.987G>A	10.37:g.51978297C>T			Somatic				ASAH2_uc009xos.2_Silent_p.E329E	p.E329E	NM_019893	NP_063946	WXS	Illumina HiSeq	Unspecified	Q9NR71	ASAH2_HUMAN			7	987	-			329			Lumenal (Potential).		Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Silent	SNP	ENST00000395526.4	37	c.987G>A	CCDS7239.2																																																																																				0.423	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893		35	106	0	0	0	0.00361	0	35	106				
MBL2	4153	broad.mit.edu	37	10	54531287	54531287	+	Missense_Mutation	SNP	C	C	A	rs201511397		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr10:54531287C>A	ENST00000373968.3	-	1	173	c.109G>T	c.(109-111)Gcc>Tcc	p.A37S		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	37	Cys-rich.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						GAGCTACAGGCAATCACTGCA	0.552																																							uc001jjt.2		NA																	0				ovary(1)	1						c.(109-111)GCC>TCC		soluble mannose-binding lectin precursor							127.0	115.0	119.0					10																	54531287		2203	4300	6503	SO:0001583	missense	4153				acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding	g.chr10:54531287C>A	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.109G>T	10.37:g.54531287C>A	ENSP00000363079:p.Ala37Ser		Somatic					p.A37S	NM_000242	NP_000233	WXS	Illumina HiSeq	Unspecified	P11226	MBL2_HUMAN			1	174	-			37			Cys-rich.		Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	ENST00000373968.3	37	c.109G>T	CCDS7247.1	.	.	.	.	.	.	.	.	.	.	C	4.916	0.170145	0.09339	.	.	ENSG00000165471	ENST00000373968	T	0.71817	-0.6	4.54	1.44	0.22558	.	0.828493	0.10634	N	0.651806	T	0.49508	0.1561	N	0.14661	0.345	0.18873	N	0.999988	B	0.30281	0.275	B	0.31547	0.132	T	0.34601	-0.9822	10	0.23302	T	0.38	-7.2294	6.4277	0.21778	0.0:0.6616:0.0:0.3384	.	37	P11226	MBL2_HUMAN	S	37	ENSP00000363079:A37S	ENSP00000363079:A37S	A	-	1	0	MBL2	54201293	0.016000	0.18221	0.547000	0.28179	0.024000	0.10985	-0.779000	0.04659	0.312000	0.23038	0.655000	0.94253	GCC		0.552	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242		45	74	1	0	1.51926e-22	0.00361	4.04337e-22	45	74				
SORCS1	114815	broad.mit.edu	37	10	108536324	108536324	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr10:108536324C>T	ENST00000263054.6	-	4	860	c.853G>A	c.(853-855)Gac>Aac	p.D285N	SORCS1_ENST00000344440.6_Missense_Mutation_p.D285N	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	285					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGAATCCAGTCTTCTTGTTTG	0.413																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(853-855)GAC>AAC		SORCS receptor 1 isoform a							184.0	171.0	176.0					10																	108536324		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108536324C>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.853G>A	10.37:g.108536324C>T	ENSP00000263054:p.Asp285Asn		Somatic				SORCS1_uc001kyl.2_Missense_Mutation_p.D285N|SORCS1_uc009xxs.2_Missense_Mutation_p.D285N|SORCS1_uc001kyn.1_Missense_Mutation_p.D285N|SORCS1_uc001kyo.2_Missense_Mutation_p.D285N	p.D285N	NM_052918	NP_443150	WXS	Illumina HiSeq	Unspecified	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	4	861	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	285			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.853G>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685467	0.68157	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.21543	2.0;2.0	5.61	5.61	0.85477	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.21062	0.0507	L	0.33485	1.01	0.80722	D	1	B;B;B;B;B	0.33748	0.298;0.423;0.286;0.189;0.286	B;B;B;B;B	0.35859	0.105;0.212;0.212;0.105;0.212	T	0.02320	-1.1177	9	.	.	.	-29.8354	20.0044	0.97430	0.0:1.0:0.0:0.0	.	285;285;285;285;285	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	N	285	ENSP00000263054:D285N;ENSP00000345964:D285N	.	D	-	1	0	SORCS1	108526314	1.000000	0.71417	0.989000	0.46669	0.943000	0.58893	7.445000	0.80570	2.809000	0.96659	0.555000	0.69702	GAC		0.413	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		61	145	0	0	0	0.00361	0	61	145				
SORCS1	114815	broad.mit.edu	37	10	108923969	108923969	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr10:108923969C>A	ENST00000263054.6	-	1	323	c.316G>T	c.(316-318)Ggc>Tgc	p.G106C	SORCS1_ENST00000344440.6_Missense_Mutation_p.G106C	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	106					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTCCTCCGGCCGGAGCGTGCA	0.701																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(316-318)GGC>TGC		SORCS receptor 1 isoform a							18.0	19.0	19.0					10																	108923969		2199	4298	6497	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108923969C>A	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.316G>T	10.37:g.108923969C>A	ENSP00000263054:p.Gly106Cys		Somatic				SORCS1_uc001kyl.2_Missense_Mutation_p.G106C|SORCS1_uc009xxs.2_Missense_Mutation_p.G106C|SORCS1_uc001kyn.1_Missense_Mutation_p.G106C|SORCS1_uc001kyo.2_Missense_Mutation_p.G106C	p.G106C	NM_052918	NP_443150	WXS	Illumina HiSeq	Unspecified	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	1	324	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	106			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.316G>T	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	9.341	1.062954	0.19987	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.15017	2.46;2.48	4.45	-1.01	0.10169	.	0.678333	0.12335	N	0.477986	T	0.10680	0.0261	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.29552	0.161;0.248;0.248;0.161;0.248	B;B;B;B;B	0.41135	0.134;0.348;0.262;0.134;0.262	T	0.44757	-0.9307	9	.	.	.	-6.513	4.3046	0.10940	0.167:0.3215:0.0:0.5115	.	106;106;106;106;106	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	C	106	ENSP00000263054:G106C;ENSP00000345964:G106C	.	G	-	1	0	SORCS1	108913959	0.010000	0.17322	0.539000	0.28077	0.405000	0.30901	0.379000	0.20585	-0.073000	0.12842	-0.948000	0.02665	GGC		0.701	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		21	29	1	0	1.96292e-10	0.001523	4.48289e-10	21	29				
ADAM12	8038	broad.mit.edu	37	10	127705850	127705850	+	Nonstop_Mutation	SNP	A	A	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr10:127705850A>T	ENST00000368679.4	-	23	3037	c.2728T>A	c.(2728-2730)Tga>Aga	p.*910R		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	0					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TCGGCTTCTCACTTAATATAG	0.403																																							uc001ljk.2		NA																	0				breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9						c.(2728-2730)TGA>AGA		ADAM metallopeptidase domain 12 isoform 1							89.0	85.0	86.0					10																	127705850		2202	4300	6502	SO:0001578	stop_lost	8038				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding	g.chr10:127705850A>T	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2728T>A	10.37:g.127705850A>T			Somatic				ADAM12_uc010qul.1_Nonstop_Mutation_p.*861R|ADAM12_uc001ljj.1_5'Flank	p.*910R	NM_003474	NP_003465	WXS	Illumina HiSeq	Unspecified	O43184	ADA12_HUMAN		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)	23	3141	-		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)	910					O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Nonstop_Mutation	SNP	ENST00000368679.4	37	c.2728T>A	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908664	0.52439	.	.	ENSG00000148848	ENST00000368679	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2069	0.73186	1.0:0.0:0.0:0.0	.	.	.	.	R	910	.	.	X	-	1	0	ADAM12	127695840	1.000000	0.71417	0.999000	0.59377	0.820000	0.46376	2.310000	0.43708	1.982000	0.57802	0.533000	0.62120	TGA		0.403	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1			10	15	0	0	0	0.000978	0	10	15				
OR51S1	119692	broad.mit.edu	37	11	4870118	4870118	+	Silent	SNP	T	T	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr11:4870118T>A	ENST00000322101.2	-	1	396	c.321A>T	c.(319-321)ctA>ctT	p.L107L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAACCATCTGTAGAAGGCAGG	0.542																																							uc010qyo.1		NA																	0				skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(319-321)CTA>CTT		olfactory receptor, family 51, subfamily S,							102.0	92.0	96.0					11																	4870118		2201	4298	6499	SO:0001819	synonymous_variant	119692				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4870118T>A	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.321A>T	11.37:g.4870118T>A			Somatic					p.L107L	NM_001004758	NP_001004758	WXS	Illumina HiSeq	Unspecified	Q8NGJ8	O51S1_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	321	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	107			Extracellular (Potential).		B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	37	c.321A>T	CCDS31362.1																																																																																				0.542	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758		62	112	0	0	0	0.00361	0	62	112				
OR52N2	390077	broad.mit.edu	37	11	5842289	5842289	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr11:5842289A>G	ENST00000317037.2	+	1	746	c.724A>G	c.(724-726)Acc>Gcc	p.T242A	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCCTTCAGCACCTGCACATC	0.418																																							uc010qzp.1		NA																	0				ovary(1)|skin(1)	2						c.(724-726)ACC>GCC		olfactory receptor, family 52, subfamily N,							256.0	203.0	221.0					11																	5842289		2201	4296	6497	SO:0001583	missense	390077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5842289A>G	AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.724A>G	11.37:g.5842289A>G	ENSP00000322801:p.Thr242Ala		Somatic				TRIM5_uc001mbq.1_Intron	p.T242A	NM_001005174	NP_001005174	WXS	Illumina HiSeq	Unspecified	Q8NGI0	O52N2_HUMAN		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	724	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	242			Helical; Name=6; (Potential).		Q6IFF9	Missense_Mutation	SNP	ENST00000317037.2	37	c.724A>G	CCDS31399.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.987808	0.53934	.	.	ENSG00000180988	ENST00000317037	T	0.41065	1.01	6.11	6.11	0.99139	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000036	T	0.75961	0.3921	H	0.96080	3.765	0.42641	D	0.993418	D	0.89917	1.0	D	0.97110	1.0	D	0.84226	0.0464	10	0.87932	D	0	.	15.5261	0.75910	1.0:0.0:0.0:0.0	.	242	Q8NGI0	O52N2_HUMAN	A	242	ENSP00000322801:T242A	ENSP00000322801:T242A	T	+	1	0	OR52N2	5798865	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	8.971000	0.93419	2.343000	0.79666	0.533000	0.62120	ACC		0.418	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401143.1	NM_001005174		41	116	0	0	0	0.00361	0	41	116				
APIP	51074	broad.mit.edu	37	11	34904943	34904943	+	Silent	SNP	T	T	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr11:34904943T>A	ENST00000395787.3	-	6	784	c.570A>T	c.(568-570)gtA>gtT	p.V190V	APIP_ENST00000527830.1_5'UTR|APIP_ENST00000278359.5_Silent_p.V207V	NM_015957.2	NP_057041.2			APAF1 interacting protein											kidney(2)|lung(1)|skin(1)	4	all_epithelial(35;0.161)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.000425)			GTCTGACCAGTACTGCACAGG	0.448																																							uc001mvs.2		NA																	0					0						c.(568-570)GTA>GTT		APAF1 interacting protein							252.0	211.0	225.0					11																	34904943		2202	4296	6498	SO:0001819	synonymous_variant	51074				apoptosis|L-methionine salvage	cytoplasm	identical protein binding|metal ion binding|methylthioribulose 1-phosphate dehydratase activity	g.chr11:34904943T>A	AF132963	CCDS7895.1	11p13	2014-05-12				ENSG00000149089	4.2.1.109		17581	protein-coding gene	gene with protein product	"""methylthioribulose-1-phosphate dehydratase"""	612491				10810093, 15262985, 24367089	Standard	NM_015957		Approved	CGI-29, Mmrp19, APIP2	uc001mvs.2	Q96GX9		ENST00000395787.3:c.570A>T	11.37:g.34904943T>A			Somatic				APIP_uc010reo.1_Silent_p.V207V	p.V190V	NM_015957	NP_057041	WXS	Illumina HiSeq	Unspecified	Q96GX9	MTNB_HUMAN	STAD - Stomach adenocarcinoma(6;0.000425)		6	678	-	all_epithelial(35;0.161)	all_hematologic(20;0.107)	190						Silent	SNP	ENST00000395787.3	37	c.570A>T	CCDS7895.1																																																																																				0.448	APIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389864.1	NM_015957		99	212	0	0	0	0.00361	0	99	212				
SPTBN2	6712	broad.mit.edu	37	11	66455642	66455642	+	Silent	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr11:66455642G>A	ENST00000533211.1	-	32	6703	c.6372C>T	c.(6370-6372)gaC>gaT	p.D2124D	SPTBN2_ENST00000529997.1_Silent_p.D2124D|SPTBN2_ENST00000309996.2_Silent_p.D2124D			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2124					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GCTCTCACCCGTCCCAGGTGG	0.652																																							uc001ojd.2		NA																	0				large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(6370-6372)GAC>GAT		spectrin, beta, non-erythrocytic 2							50.0	54.0	53.0					11																	66455642		2200	4295	6495	SO:0001819	synonymous_variant	6712				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton	g.chr11:66455642G>A	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.6372C>T	11.37:g.66455642G>A			Somatic				SPTBN2_uc001ojc.1_5'Flank	p.D2124D	NM_006946	NP_008877	WXS	Illumina HiSeq	Unspecified	O15020	SPTN2_HUMAN			31	6444	-			2124					O14872|O14873	Silent	SNP	ENST00000533211.1	37	c.6372C>T	CCDS8150.1																																																																																				0.652	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946		15	47	0	0	0	0.00245	0	15	47				
ING4	51147	broad.mit.edu	37	12	6761453	6761453	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr12:6761453C>A	ENST00000396807.4	-	6	670	c.632G>T	c.(631-633)gGc>gTc	p.G211V	ING4_ENST00000341550.4_Missense_Mutation_p.G210V|ING4_ENST00000444704.2_Missense_Mutation_p.G187V|ING4_ENST00000486287.1_5'UTR|ING4_ENST00000446105.2_Missense_Mutation_p.G207V|ING4_ENST00000423703.2_Intron|ING4_ENST00000412586.2_Missense_Mutation_p.G208V	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	211					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						GTTGTCACAGCCAATCATCTC	0.507																																							uc001qpw.3		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(631-633)GGC>GTC		inhibitor of growth family, member 4 isoform 9							182.0	157.0	166.0					12																	6761453		2203	4300	6503	SO:0001583	missense	51147				apoptosis|cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell proliferation|negative regulation of growth|negative regulation of transcription, DNA-dependent|positive regulation of apoptosis	histone acetyltransferase complex	protein binding|transcription coactivator activity|zinc ion binding	g.chr12:6761453C>A	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.632G>T	12.37:g.6761453C>A	ENSP00000380024:p.Gly211Val		Somatic				ING4_uc001qpv.3_Missense_Mutation_p.G210V|ING4_uc001qpy.3_Missense_Mutation_p.G207V|ING4_uc001qpx.3_Missense_Mutation_p.G208V|ING4_uc009zes.2_Intron|ING4_uc009zet.2_Missense_Mutation_p.G187V|ING4_uc009zeu.2_RNA|ING4_uc009zev.2_RNA	p.G211V	NM_001127582	NP_001121054	WXS	Illumina HiSeq	Unspecified	Q9UNL4	ING4_HUMAN			6	673	-			211			PHD-type.		A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Missense_Mutation	SNP	ENST00000396807.4	37	c.632G>T	CCDS44813.1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591302	0.66219	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000412586	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	4.9	4.01	0.46588	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.73257	0.3564	H	0.95224	3.64	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;0.998;0.999;0.999	T	0.81799	-0.0767	10	0.87932	D	0	-2.5971	13.2938	0.60286	0.0:0.9239:0.0:0.0761	.	187;207;208;211;210	Q9UNL4-3;Q9UNL4-4;Q9UNL4-5;Q9UNL4;Q4VBQ6	.;.;.;ING4_HUMAN;.	V	210;211;207;187;208	ENSP00000343396:G210V;ENSP00000380024:G211V;ENSP00000415903:G207V;ENSP00000397343:G187V;ENSP00000412705:G208V	ENSP00000343396:G210V	G	-	2	0	ING4	6631714	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.294000	0.78760	1.296000	0.44742	0.561000	0.74099	GGC		0.507	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280467.2	NM_198287		51	110	1	0	3.39706e-21	0.00361	8.90081e-21	51	110				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		8	20	1	0	0.00448238	0.004482	0.00958889	8	20				
ARID2	196528	broad.mit.edu	37	12	46230571	46230571	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr12:46230571C>T	ENST00000334344.6	+	8	992	c.820C>T	c.(820-822)Cga>Tga	p.R274*	ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000422737.1_Nonsense_Mutation_p.R125*|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	274					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCATCCACCTCGAAAGCTGGG	0.363			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					0				ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(820-822)CGA>TGA		AT rich interactive domain 2 (ARID, RFX-like)							138.0	139.0	139.0					12																	46230571		2203	4300	6503	SO:0001587	stop_gained	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46230571C>T		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.820C>T	12.37:g.46230571C>T	ENSP00000335044:p.Arg274*		Somatic				ARID2_uc001ror.2_Nonsense_Mutation_p.R274*|ARID2_uc009zkg.1_5'UTR|ARID2_uc009zkh.1_5'Flank|ARID2_uc001rot.1_5'UTR	p.R274*	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	8	820	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	274					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	37	c.820C>T	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	39	7.777718	0.98483	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7579	14.9771	0.71283	0.1427:0.8573:0.0:0.0	.	.	.	.	X	274;125	.	ENSP00000335044:R274X	R	+	1	2	ARID2	44516838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.588000	0.67517	2.767000	0.95098	0.591000	0.81541	CGA		0.363	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		30	43	0	0	0	0.002445	0	30	43				
SENP1	29843	broad.mit.edu	37	12	48457499	48457499	+	Silent	SNP	A	A	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr12:48457499A>G	ENST00000004980.5	-	13	1879	c.1401T>C	c.(1399-1401)aaT>aaC	p.N467N	SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000551330.1_Silent_p.N467N|SENP1_ENST00000549518.1_Silent_p.N467N|SENP1_ENST00000549595.1_Silent_p.N467N|SENP1_ENST00000448372.1_Silent_p.N467N			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	467	Protease.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TTACCTCATCATTGAGCCAAT	0.348																																							uc001rqx.2		NA																	0				pancreas(2)|lung(1)	3						c.(1399-1401)AAT>AAC		sentrin/SUMO-specific protease 1							167.0	160.0	162.0					12																	48457499		1884	4119	6003	SO:0001819	synonymous_variant	29843				activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity	g.chr12:48457499A>G	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.1401T>C	12.37:g.48457499A>G			Somatic				SENP1_uc001rqw.2_Silent_p.N467N|SENP1_uc001rqy.2_Silent_p.N268N|SENP1_uc001rqz.2_Silent_p.N268N|SENP1_uc009zkx.2_Silent_p.N467N	p.N467N	NM_014554	NP_055369	WXS	Illumina HiSeq	Unspecified	Q9P0U3	SENP1_HUMAN			13	1847	-		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)	467			Protease.		A8K7P5|Q86XC8	Silent	SNP	ENST00000004980.5	37	c.1401T>C	CCDS44868.2																																																																																				0.348	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554		28	76	0	0	0	0.00632	0	28	76				
ACTN1	87	broad.mit.edu	37	14	69378902	69378902	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr14:69378902C>A	ENST00000193403.6	-	4	781	c.398G>T	c.(397-399)cGc>cTc	p.R133L	ACTN1_ENST00000394419.4_Missense_Mutation_p.R133L|ACTN1_ENST00000438964.2_Missense_Mutation_p.R133L|ACTN1_ENST00000538545.2_Missense_Mutation_p.R133L|ACTN1_ENST00000376839.3_Missense_Mutation_p.R68L|ACTN1_ENST00000554508.1_5'UTR	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	133	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GATGGCAAAGCGCAGGATGAT	0.552											OREG0022758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xkl.2		NA																	0				central_nervous_system(1)	1						c.(397-399)CGC>CTC		actinin, alpha 1 isoform b							280.0	198.0	226.0					14																	69378902		2203	4300	6503	SO:0001583	missense	87				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding	g.chr14:69378902C>A	M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.398G>T	14.37:g.69378902C>A	ENSP00000193403:p.Arg133Leu		Somatic	OREG0022758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1114	ACTN1_uc010ttb.1_Missense_Mutation_p.R68L|ACTN1_uc001xkm.2_Missense_Mutation_p.R133L|ACTN1_uc001xkn.2_Missense_Mutation_p.R133L|ACTN1_uc001xko.1_Missense_Mutation_p.R68L|ACTN1_uc010ttd.1_Missense_Mutation_p.R112L	p.R133L	NM_001102	NP_001093	WXS	Illumina HiSeq	Unspecified	P12814	ACTN1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)	4	708	-			133			CH 1.|Actin-binding.		B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	ENST00000193403.6	37	c.398G>T	CCDS9792.1	.	.	.	.	.	.	.	.	.	.	C	34	5.359220	0.95854	.	.	ENSG00000072110	ENST00000193403;ENST00000394419;ENST00000438964;ENST00000376839;ENST00000538545;ENST00000555616;ENST00000556433;ENST00000553370;ENST00000553779;ENST00000556571	T;T;T;T;T;T;T;D;D;T	0.95069	0.18;0.18;0.18;0.18;0.18;0.18;0.18;-3.6;-3.6;0.18	4.94	4.94	0.65067	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98175	0.9397	H	0.95260	3.645	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.79108	0.992;0.973;0.985;0.991	D	0.99120	1.0849	10	0.87932	D	0	.	18.7331	0.91742	0.0:1.0:0.0:0.0	.	133;133;133;133	B7TY16;P12814-2;Q1HE25;P12814	.;.;.;ACTN1_HUMAN	L	133;133;133;68;133;68;112;68;68;110	ENSP00000193403:R133L;ENSP00000377941:R133L;ENSP00000414272:R133L;ENSP00000366035:R68L;ENSP00000439828:R133L;ENSP00000450903:R68L;ENSP00000450764:R112L;ENSP00000450925:R68L;ENSP00000450618:R68L;ENSP00000452423:R110L	ENSP00000193403:R133L	R	-	2	0	ACTN1	68448655	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.517000	0.81783	2.724000	0.93272	0.561000	0.74099	CGC		0.552	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413233.3	NM_001102		52	151	1	0	1.95512e-22	0.00361	5.16274e-22	52	151				
CPSF2	53981	broad.mit.edu	37	14	92625582	92625582	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr14:92625582G>T	ENST00000298875.4	+	14	2362	c.2077G>T	c.(2077-2079)Gaa>Taa	p.E693*		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	693					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		AACAGGTGAAGAAAGTGAGAT	0.403																																					Ovarian(78;28 1788 18702 44111)	Ovarian(78;28 1788 18702 44111)	uc001yah.1		NA																	0				ovary(2)	2						c.(2077-2079)GAA>TAA		cleavage and polyadenylation specific factor 2							93.0	95.0	94.0					14																	92625582		2203	4300	6503	SO:0001587	stop_gained	53981				histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding	g.chr14:92625582G>T	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.2077G>T	14.37:g.92625582G>T	ENSP00000298875:p.Glu693*		Somatic					p.E693*	NM_017437	NP_059133	WXS	Illumina HiSeq	Unspecified	Q9P2I0	CPSF2_HUMAN		COAD - Colon adenocarcinoma(157;0.222)	14	2314	+		all_cancers(154;0.0766)	693					B3KME1|Q6NSJ1|Q9H3W7	Nonsense_Mutation	SNP	ENST00000298875.4	37	c.2077G>T	CCDS9902.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.02|19.02	3.746897|3.746897	0.69418|0.69418	.|.	.|.	ENSG00000165934|ENSG00000165934	ENST00000298875|ENST00000555244	.|.	.|.	.|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74527	.|0.3728	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74074	.|-0.3782	.|3	0.18710|.	T|.	0.47|.	.|.	18.4879|18.4879	0.90836|0.90836	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|N	693|209	.|.	ENSP00000298875:E693X|.	E|K	+|+	1|3	0|2	CPSF2|CPSF2	91695335|91695335	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.442000|0.442000	0.32017|0.32017	9.321000|9.321000	0.96353|0.96353	2.346000|2.346000	0.79739|0.79739	0.591000|0.591000	0.81541|0.81541	GAA|AAG		0.403	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1			18	77	1	0	2.39187e-15	0.008871	5.73371e-15	18	77				
UNC79	57578	broad.mit.edu	37	14	94107507	94107507	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr14:94107507C>T	ENST00000393151.2	+	34	5934	c.5934C>T	c.(5932-5934)agC>agT	p.S1978S	UNC79_ENST00000256339.4_Silent_p.S1801S|UNC79_ENST00000555664.1_Silent_p.S1939S|UNC79_ENST00000553484.1_Silent_p.S2000S			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1978					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CCAAATCCAGCCTGCTATCAG	0.522																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(5467-5469)AGC>AGT		hypothetical protein LOC57578							103.0	74.0	84.0					14																	94107507		2203	4300	6503	SO:0001819	synonymous_variant	57578					integral to membrane		g.chr14:94107507C>T	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5934C>T	14.37:g.94107507C>T			Somatic				KIAA1409_uc001ybs.1_Silent_p.S1801S	p.S1823S	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	32	5552	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1978					B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37	c.5469C>T																																																																																					0.522	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		10	30	0	0	0	0.008291	0	10	30				
NIPA1	123606	broad.mit.edu	37	15	23048975	23048975	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:23048975C>A	ENST00000337435.4	-	5	868	c.844G>T	c.(844-846)Gag>Tag	p.E282*	NIPA1_ENST00000561183.1_Nonsense_Mutation_p.E207*|NIPA1_ENST00000538684.1_Nonsense_Mutation_p.E112*|NIPA1_ENST00000437912.2_Nonsense_Mutation_p.E207*	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	282					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		TTGCTCCACTCCCGGAAGAGG	0.577																																							uc001yvc.2		NA																	0					0						c.(844-846)GAG>TAG		non-imprinted in Prader-Willi/Angelman syndrome							84.0	67.0	73.0					15																	23048975		2203	4300	6503	SO:0001587	stop_gained	123606				cell death	early endosome|integral to membrane|plasma membrane		g.chr15:23048975C>A	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.844G>T	15.37:g.23048975C>A	ENSP00000337452:p.Glu282*		Somatic				NIPA1_uc001yvd.2_Nonsense_Mutation_p.E112*|NIPA1_uc001yve.2_Nonsense_Mutation_p.E207*	p.E282*	NM_144599	NP_653200	WXS	Illumina HiSeq	Unspecified	Q7RTP0	NIPA1_HUMAN		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)	5	869	-		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	282			Extracellular (Potential).		B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Nonsense_Mutation	SNP	ENST00000337435.4	37	c.844G>T	CCDS10011.1	.	.	.	.	.	.	.	.	.	.	C	40	8.242022	0.98722	.	.	ENSG00000170113	ENST00000337435;ENST00000437912;ENST00000538684	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-27.8091	19.9111	0.97025	0.0:1.0:0.0:0.0	.	.	.	.	X	282;207;112	.	ENSP00000337452:E282X	E	-	1	0	NIPA1	20600416	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.748000	0.85085	2.722000	0.93159	0.591000	0.81541	GAG		0.577	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	NM_144599		15	21	1	0	4.14922e-12	0.004007	9.60572e-12	15	21				
NPAP1	23742	broad.mit.edu	37	15	24923547	24923547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:24923547G>T	ENST00000329468.2	+	1	3007	c.2533G>T	c.(2533-2535)Gag>Tag	p.E845*		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	845					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CTCCAGGAAGGAGGAGTACAT	0.498																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2533-2535)GAG>TAG		hypothetical protein LOC23742							103.0	94.0	97.0					15																	24923547		2203	4300	6503	SO:0001587	stop_gained	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923547G>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2533G>T	15.37:g.24923547G>T	ENSP00000333735:p.Glu845*		Somatic					p.E845*	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3007	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	845						Nonsense_Mutation	SNP	ENST00000329468.2	37	c.2533G>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	39	7.892717	0.98548	.	.	ENSG00000185823	ENST00000329468	.	.	.	1.2	-2.4	0.06583	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	2.0564	0.03582	0.3976:0.0:0.3496:0.2528	.	.	.	.	X	845	.	ENSP00000333735:E845X	E	+	1	0	C15orf2	22474640	0.014000	0.17966	0.003000	0.11579	0.125000	0.20455	0.638000	0.24674	-1.036000	0.03287	0.064000	0.15345	GAG		0.498	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		59	124	1	0	1.73933e-33	0.00361	5.06804e-33	59	124				
CTDSPL2	51496	broad.mit.edu	37	15	44789292	44789292	+	Silent	SNP	T	T	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:44789292T>C	ENST00000260327.4	+	7	1401	c.838T>C	c.(838-840)Ttg>Ctg	p.L280L	CTDSPL2_ENST00000396780.1_Silent_p.L208L|CTDSPL2_ENST00000561189.1_3'UTR|CTDSPL2_ENST00000558966.1_Silent_p.L280L|CTDSPL2_ENST00000558373.1_Silent_p.L208L	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	280							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TGCTCTTCCGTTGAAAACAAG	0.343																																							uc001ztr.2		NA																	0					0						c.(838-840)TTG>CTG		CTD (carboxy-terminal domain, RNA polymerase II,							70.0	70.0	70.0					15																	44789292		2198	4298	6496	SO:0001819	synonymous_variant	51496						phosphoprotein phosphatase activity	g.chr15:44789292T>C	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.838T>C	15.37:g.44789292T>C			Somatic				CTDSPL2_uc001zts.2_Silent_p.L280L|CTDSPL2_uc001ztt.2_Silent_p.L280L|CTDSPL2_uc010bdv.2_Silent_p.L208L	p.L280L	NM_016396	NP_057480	WXS	Illumina HiSeq	Unspecified	Q05D32	CTSL2_HUMAN		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)	7	1254	+		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)	280					Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Silent	SNP	ENST00000260327.4	37	c.838T>C	CCDS10110.1																																																																																				0.343	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396		24	73	0	0	0	0.00632	0	24	73				
UNC13C	440279	broad.mit.edu	37	15	54307911	54307911	+	Silent	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:54307911C>G	ENST00000260323.11	+	1	2811	c.2811C>G	c.(2809-2811)ccC>ccG	p.P937P	UNC13C_ENST00000537900.1_Silent_p.P937P|UNC13C_ENST00000545554.1_Silent_p.P937P	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	937					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGTTAGAACCCTTAAATGAAA	0.403																																							uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(2809-2811)CCC>CCG		unc-13 homolog C							76.0	74.0	74.0					15																	54307911		1857	4105	5962	SO:0001819	synonymous_variant	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54307911C>G	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2811C>G	15.37:g.54307911C>G			Somatic					p.P937P	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	1	2811	+			937					Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	c.2811C>G	CCDS45264.1																																																																																				0.403	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		30	53	0	0	0	0.00632	0	30	53				
EFTUD1	79631	broad.mit.edu	37	15	82533632	82533632	+	Silent	SNP	A	A	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:82533632A>T	ENST00000268206.7	-	5	525	c.357T>A	c.(355-357)gcT>gcA	p.A119A	EFTUD1_ENST00000359445.3_Silent_p.A68A	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	119	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						CTCCTTCCACAGCATCTACCA	0.443																																							uc002bgt.1		NA																	0				ovary(1)	1						c.(355-357)GCT>GCA		elongation factor Tu GTP binding domain							76.0	72.0	73.0					15																	82533632		1903	4124	6027	SO:0001819	synonymous_variant	79631				mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity	g.chr15:82533632A>T	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.357T>A	15.37:g.82533632A>T			Somatic				EFTUD1_uc002bgu.1_Silent_p.A68A	p.A119A	NM_024580	NP_078856	WXS	Illumina HiSeq	Unspecified	Q7Z2Z2	ETUD1_HUMAN			5	526	-			119					A6NKY5|B7Z6I0|Q9H8Z6	Silent	SNP	ENST00000268206.7	37	c.357T>A	CCDS42071.1																																																																																				0.443	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	NM_024580		31	74	0	0	0	0.002836	0	31	74				
AGBL1	123624	broad.mit.edu	37	15	86800211	86800211	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:86800211G>C	ENST00000441037.2	+	7	820	c.725G>C	c.(724-726)gGg>gCg	p.G242A	AGBL1_ENST00000421325.2_Missense_Mutation_p.G242A	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	242					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CCGGTCCCCGGGTGCATCACC	0.502																																							uc002blz.1		NA																	0					0						c.(724-726)GGG>GCG		ATP/GTP binding protein-like 1							69.0	70.0	69.0					15																	86800211		2032	4192	6224	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86800211G>C	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.725G>C	15.37:g.86800211G>C	ENSP00000413001:p.Gly242Ala		Somatic					p.G242A	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			7	805	+			242					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.725G>C	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	G	1.796	-0.478373	0.04414	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.39592	1.07	5.93	3.03	0.35002	Armadillo-type fold (1);	0.176297	0.35235	N	0.003352	T	0.33498	0.0865	M	0.71581	2.175	0.80722	D	1	B	0.32653	0.379	B	0.26517	0.07	T	0.07849	-1.0751	10	0.13470	T	0.59	-11.9721	7.0516	0.25075	0.1499:0.1417:0.7084:0.0	.	242	Q96MI9	CBPC4_HUMAN	A	271;242	ENSP00000397173:G242A	ENSP00000397173:G242A	G	+	2	0	AGBL1	84601215	0.942000	0.31987	0.039000	0.18376	0.047000	0.14425	1.547000	0.36190	0.396000	0.25283	0.655000	0.94253	GGG		0.502	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		21	40	0	0	0	0.00278	0	21	40				
LRRK1	79705	broad.mit.edu	37	15	101608898	101608898	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:101608898G>T	ENST00000388948.3	+	34	6252	c.5893G>T	c.(5893-5895)Gtg>Ttg	p.V1965L	LRRK1_ENST00000284395.5_Missense_Mutation_p.V1962L|LRRK1_ENST00000532145.1_3'UTR|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGCTGCCGTGGTGGCAAAGGA	0.597																																							uc002bwr.2		NA																	0				ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12						c.(5893-5895)GTG>TTG		leucine-rich repeat kinase 1							89.0	100.0	96.0					15																	101608898		2080	4228	6308	SO:0001583	missense	79705				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr15:101608898G>T	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5893G>T	15.37:g.101608898G>T	ENSP00000373600:p.Val1965Leu		Somatic				LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	p.V1965L	NM_024652	NP_078928	WXS	Illumina HiSeq	Unspecified	Q38SD2	LRRK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		34	6212	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		1965						Missense_Mutation	SNP	ENST00000388948.3	37	c.5893G>T	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867112	0.51588	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.76709	-0.99;-1.04	5.83	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.69495	0.3117	L	0.47716	1.5	0.32872	D	0.509365	B	0.16166	0.016	B	0.14023	0.01	T	0.71314	-0.4630	10	0.37606	T	0.19	.	9.7457	0.40446	0.0708:0.2555:0.6737:0.0	.	1965	Q38SD2	LRRK1_HUMAN	L	1965;1962	ENSP00000373600:V1965L;ENSP00000284395:V1962L	ENSP00000284395:V1962L	V	+	1	0	LRRK1	99426421	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.891000	0.56227	1.469000	0.48083	0.655000	0.94253	GTG		0.597	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		57	116	1	0	6.26901e-30	0.00361	1.76577e-29	57	116				
GNG13	51764	broad.mit.edu	37	16	849011	849012	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr16:849011_849012GG>TT	ENST00000248150.4	-	2	167_168	c.66_67CC>AA	c.(64-69)ttCCag>ttAAag	p.22_23FQ>LK		NM_016541.2	NP_057625.1	Q9P2W3	GBG13_HUMAN	guanine nucleotide binding protein (G protein), gamma 13	22					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|sensory perception of taste (GO:0050909)|small molecule metabolic process (GO:0044281)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)			ovary(1)	1		Hepatocellular(780;0.00335)				ATCTCCCGCTGGAAGGCCAGCT	0.609																																							uc002ckh.3		NA																	0					0						c.(64-69)TTCCAG>TTAAAG		guanine nucleotide binding protein (G protein),																																				SO:0001583	missense	51764				cellular response to glucagon stimulus|energy reserve metabolic process		signal transducer activity	g.chr16:849011_849012GG>TT	AB030207	CCDS10427.1	16p13.3	2008-08-01			ENSG00000127588	ENSG00000127588			14131	protein-coding gene	gene with protein product	"""G gamma subunit, clone:h2-35"""	607298				10570481	Standard	NM_016541		Approved	h2-35, G(gamma)13	uc002ckh.4	Q9P2W3	OTTHUMG00000047839	ENST00000248150.4:c.66_67delinsTT	16.37:g.849011_849012delinsTT	ENSP00000248150:p.F22_Q23delinsLK		Somatic					p.22_23FQ>LK	NM_016541	NP_057625	WXS	Illumina HiSeq	Unspecified	Q9P2W3	GBG13_HUMAN			2	168_169	-		Hepatocellular(780;0.00335)	22_23					B2R5C8|Q52LX0|Q9UJJ3	Missense_Mutation	DNP	ENST00000248150.4	37	c.66_67CC>AA	CCDS10427.1																																																																																				0.609	GNG13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109062.3	NM_016541		9	34	0	0	0	0.004672	0	9	34				
SRRM2	23524	broad.mit.edu	37	16	2814911	2814911	+	Missense_Mutation	SNP	G	G	T	rs149555495	byFrequency	TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr16:2814911G>T	ENST00000301740.8	+	11	4931	c.4382G>T	c.(4381-4383)gGg>gTg	p.G1461V		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1461	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGCCTGTCTGGGTCCTCTCCT	0.517													G|||	3	0.000599042	0.0	0.0014	5008	,	,		18831	0.0		0.002	False		,,,				2504	0.0						uc002crk.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(4381-4383)GGG>GTG		splicing coactivator subunit SRm300		G	VAL/GLY	3,4393	6.2+/-15.9	0,3,2195	83.0	84.0	84.0		4382	6.1	1.0	16	dbSNP_134	84	15,8585	9.8+/-36.6	0,15,4285	yes	missense	SRRM2	NM_016333.3	109	0,18,6480	TT,TG,GG		0.1744,0.0682,0.1385	probably-damaging	1461/2753	2814911	18,12978	2198	4300	6498	SO:0001583	missense	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2814911G>T	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4382G>T	16.37:g.2814911G>T	ENSP00000301740:p.Gly1461Val		Somatic				SRRM2_uc002crj.1_Missense_Mutation_p.G1365V|SRRM2_uc002crl.1_Missense_Mutation_p.G1461V|SRRM2_uc010bsu.1_Missense_Mutation_p.G1365V	p.G1461V	NM_016333	NP_057417	WXS	Illumina HiSeq	Unspecified	Q9UQ35	SRRM2_HUMAN			11	4931	+			1461			Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	c.4382G>T	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501078	0.44455	6.82E-4	0.001744	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.50548	0.74	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000007	T	0.67078	0.2855	L	0.58101	1.795	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.65899	-0.6056	10	0.62326	D	0.03	-18.8313	18.1147	0.89549	0.0:0.0:1.0:0.0	.	1461	Q9UQ35	SRRM2_HUMAN	V	1461;1461;713	ENSP00000301740:G1461V	ENSP00000301740:G1461V	G	+	2	0	SRRM2	2754912	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.660000	0.68018	2.882000	0.98803	0.655000	0.94253	GGG		0.517	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			68	149	1	0	7.93275e-45	0.00361	2.41556e-44	68	149				
CORO7	79585	broad.mit.edu	37	16	4408035	4408035	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr16:4408035C>A	ENST00000251166.4	-	25	2672	c.2527G>T	c.(2527-2529)Gcc>Tcc	p.A843S	CORO7_ENST00000537233.2_Missense_Mutation_p.A825S|CORO7_ENST00000539968.1_Missense_Mutation_p.A623S|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.A843S|PAM16_ENST00000576217.1_5'Flank|CORO7_ENST00000574025.1_Missense_Mutation_p.A758S|CORO7-PAM16_ENST00000572274.1_5'UTR	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	843					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						TGCAGCCAGGCCTCGGCACTG	0.627																																							uc002cwh.3		NA																	0					0						c.(2527-2529)GCC>TCC		coronin 7							48.0	51.0	50.0					16																	4408035		2197	4300	6497	SO:0001583	missense	79585					cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction		g.chr16:4408035C>A	AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2527G>T	16.37:g.4408035C>A	ENSP00000251166:p.Ala843Ser		Somatic				CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.A843S|CORO7_uc002cwg.3_Missense_Mutation_p.A623S|CORO7_uc010uxh.1_Missense_Mutation_p.A825S|CORO7_uc010uxi.1_Missense_Mutation_p.A758S|CORO7_uc002cwi.1_3'UTR	p.A843S	NM_024535	NP_078811	WXS	Illumina HiSeq	Unspecified	P57737	CORO7_HUMAN			25	2647	-			843					B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	ENST00000251166.4	37	c.2527G>T	CCDS10513.1	.	.	.	.	.	.	.	.	.	.	C	13.56	2.273140	0.40194	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T	0.31247	1.5;1.5	5.24	5.24	0.73138	Domain of unknown function DUF1900 (1);	0.441312	0.25377	N	0.031115	T	0.40743	0.1129	L	0.50333	1.59	0.80722	D	1	B;P;P;B	0.45715	0.343;0.865;0.775;0.395	B;P;P;B	0.47786	0.178;0.487;0.557;0.254	T	0.32107	-0.9919	10	0.72032	D	0.01	-25.3251	18.4142	0.90563	0.0:1.0:0.0:0.0	.	758;825;843;824	P57737-2;B4DFD6;P57737;B4DKU9	.;.;CORO7_HUMAN;.	S	843;758;623	ENSP00000251166:A843S;ENSP00000446221:A623S	ENSP00000251166:A843S	A	-	1	0	CORO7	4348036	1.000000	0.71417	0.990000	0.47175	0.056000	0.15407	4.471000	0.60182	2.449000	0.82847	0.573000	0.79308	GCC		0.627	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251628.2	NM_024535		32	84	1	0	5.90632e-09	0.002445	1.31338e-08	32	84				
MLKL	197259	broad.mit.edu	37	16	74709626	74709626	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr16:74709626T>A	ENST00000308807.7	-	8	1538	c.1075A>T	c.(1075-1077)Atg>Ttg	p.M359L	MLKL_ENST00000306247.7_Intron	NM_152649.2	NP_689862.1			mixed lineage kinase domain-like											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(6)|skin(1)|stomach(2)	19						CCCAAACTCATGGAAGTCTGT	0.408																																							uc002fdb.2		NA																	0				stomach(2)	2						c.(1075-1077)ATG>TTG		mixed lineage kinase domain-like isoform 1							140.0	132.0	135.0					16																	74709626		2198	4300	6498	SO:0001583	missense	197259						ATP binding|protein binding|protein kinase activity	g.chr16:74709626T>A	AK091708	CCDS32487.1, CCDS45528.1	16q22.3	2008-02-05				ENSG00000168404			26617	protein-coding gene	gene with protein product		615153				12477932	Standard	NM_152649		Approved	FLJ34389	uc002fdb.2	Q8NB16		ENST00000308807.7:c.1075A>T	16.37:g.74709626T>A	ENSP00000308351:p.Met359Leu		Somatic				MLKL_uc002fdc.2_Intron	p.M359L	NM_152649	NP_689862	WXS	Illumina HiSeq	Unspecified	Q8NB16	MLKL_HUMAN			8	1516	-			359			Protein kinase.			Missense_Mutation	SNP	ENST00000308807.7	37	c.1075A>T	CCDS32487.1	.	.	.	.	.	.	.	.	.	.	T	7.443	0.641141	0.14386	.	.	ENSG00000168404	ENST00000308807	D	0.82344	-1.6	4.74	4.74	0.60224	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.178914	0.49305	D	0.000154	T	0.62392	0.2424	N	0.10707	0.03	0.25130	N	0.990579	B	0.02656	0.0	B	0.04013	0.001	T	0.42865	-0.9426	10	0.05721	T	0.95	-11.4418	11.175	0.48595	0.0:0.0:0.0:1.0	.	359	Q8NB16	MLKL_HUMAN	L	359	ENSP00000308351:M359L	ENSP00000308351:M359L	M	-	1	0	MLKL	73267127	1.000000	0.71417	0.999000	0.59377	0.023000	0.10783	3.488000	0.53229	2.077000	0.62373	0.408000	0.27601	ATG		0.408	MLKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436403.3	NM_152649		38	94	0	0	0	0.005524	0	38	94				
TLDC1	57707	broad.mit.edu	37	16	84520279	84520279	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr16:84520279C>A	ENST00000343629.6	-	5	1098	c.916G>T	c.(916-918)Ggg>Tgg	p.G306W	TLDC1_ENST00000535580.1_Missense_Mutation_p.G279W|TLDC1_ENST00000561807.1_5'Flank	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	306	TLD.					lysosomal membrane (GO:0005765)											GAGGCAAACCCACCGAACACA	0.567																																							uc002fib.2		NA																	0				ovary(2)	2						c.(916-918)GGG>TGG		hypothetical protein LOC57707							93.0	80.0	84.0					16																	84520279		2200	4300	6500	SO:0001583	missense	57707						protein binding	g.chr16:84520279C>A	AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.916G>T	16.37:g.84520279C>A	ENSP00000343635:p.Gly306Trp		Somatic				KIAA1609_uc010vod.1_Missense_Mutation_p.G279W|KIAA1609_uc002fic.2_RNA	p.G306W	NM_020947	NP_065998	WXS	Illumina HiSeq	Unspecified	Q6P9B6	K1609_HUMAN			5	1023	-			306			TLD.		Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	c.916G>T	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.074829	0.55646	.	.	ENSG00000140950	ENST00000343629;ENST00000535580	T;T	0.49139	0.79;0.79	5.12	5.12	0.69794	TLDc (2);	0.049483	0.85682	D	0.000000	T	0.76644	0.4016	M	0.92880	3.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83336	-0.0010	10	0.87932	D	0	-44.6224	17.5476	0.87866	0.0:1.0:0.0:0.0	.	279;306	F5GWS3;Q6P9B6	.;K1609_HUMAN	W	306;279	ENSP00000343635:G306W;ENSP00000441997:G279W	ENSP00000343635:G306W	G	-	1	0	KIAA1609	83077780	1.000000	0.71417	0.636000	0.29352	0.082000	0.17680	7.173000	0.77612	2.369000	0.80426	0.655000	0.94253	GGG		0.567	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947		23	93	1	0	1.85244e-09	0.00333	4.17417e-09	23	93				
SHPK	23729	broad.mit.edu	37	17	3539511	3539511	+	Start_Codon_SNP	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr17:3539511C>T	ENST00000225519.3	-	1	105	c.3G>A	c.(1-3)atG>atA	p.M1I	CTNS_ENST00000414524.2_5'Flank|CTNS_ENST00000046640.3_5'Flank|CTNS_ENST00000399306.2_5'Flank|CTNS_ENST00000441220.2_5'Flank|CTNS_ENST00000381870.3_5'Flank	NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	1					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		GCCGCGCAGCCATTATCTCCC	0.711																																							uc002fvz.1		NA																	0				ovary(1)	1						c.(1-3)ATG>ATA		carbohydrate kinase-like							22.0	27.0	25.0					17																	3539511		2189	4269	6458	SO:0001582	initiator_codon_variant	23729				carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity	g.chr17:3539511C>T	AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.3G>A	17.37:g.3539511C>T	ENSP00000225519:p.Met1Ile		Somatic				CTNS_uc002fwa.2_5'Flank|CTNS_uc002fwb.2_5'Flank|CTNS_uc010ckj.2_5'Flank|CTNS_uc010vrv.1_5'Flank|CTNS_uc010vrw.1_5'Flank	p.M1I	NM_013276	NP_037408	WXS	Illumina HiSeq	Unspecified	Q9UHJ6	SHPK_HUMAN		COAD - Colon adenocarcinoma(5;0.0828)	1	106	-			1					B2R640|Q8WUH3	Missense_Mutation	SNP	ENST00000225519.3	37	c.3G>A	CCDS11030.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502251	0.64298	.	.	ENSG00000197417	ENST00000225519	T	0.24151	1.87	4.83	4.83	0.62350	.	0.286229	0.40144	N	0.001179	T	0.30293	0.0760	.	.	.	0.80722	D	1	P	0.52463	0.953	P	0.45099	0.469	T	0.08513	-1.0718	9	0.87932	D	0	-23.9883	14.1458	0.65349	0.0:1.0:0.0:0.0	.	1	Q9UHJ6	SHPK_HUMAN	I	1	ENSP00000225519:M1I	ENSP00000225519:M1I	M	-	3	0	SHPK	3486260	0.989000	0.36119	0.243000	0.24186	0.012000	0.07955	3.669000	0.54561	2.610000	0.88304	0.491000	0.48974	ATG		0.711	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2		Missense_Mutation	17	51	0	0	0	0.006122	0	17	51				
PIK3R6	146850	broad.mit.edu	37	17	8736345	8736345	+	Silent	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr17:8736345G>T	ENST00000311434.9	-	9	902	c.663C>A	c.(661-663)acC>acA	p.T221T	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	221					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										AGTGCTCCAGGGTGCGGCGAG	0.692																																							uc002glq.1		NA																	0					0						c.(661-663)ACC>ACA		phosphoinositide-3-kinase, regulatory subunit 6							13.0	18.0	16.0					17																	8736345		1990	4133	6123	SO:0001819	synonymous_variant	146850				platelet activation	cytosol		g.chr17:8736345G>T	AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.663C>A	17.37:g.8736345G>T			Somatic				PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_Intron	p.T221T	NM_001010855	NP_001010855	WXS	Illumina HiSeq	Unspecified	Q5UE93	PI3R6_HUMAN			9	903	-			221					Q658R3	Silent	SNP	ENST00000311434.9	37	c.663C>A																																																																																					0.692	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001010855		11	25	1	0	4.68919e-08	0.008291	1.02919e-07	11	25				
SOX9	6662	broad.mit.edu	37	17	70117604	70117604	+	Silent	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr17:70117604C>G	ENST00000245479.2	+	1	444	c.72C>G	c.(70-72)ccC>ccG	p.P24P		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	24					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CCCCCAGCCCCACCATGTCCG	0.711																																					Pancreas(42;83 1041 2320 35205 39456)	Pancreas(42;83 1041 2320 35205 39456)	uc002jiw.2		NA																	0					0						c.(70-72)CCC>CCG		transcription factor SOX9							15.0	18.0	17.0					17																	70117604		2197	4285	6482	SO:0001819	synonymous_variant	6662				cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr17:70117604C>G	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.72C>G	17.37:g.70117604C>G			Somatic				uc002jiv.2_5'Flank	p.P24P	NM_000346	NP_000337	WXS	Illumina HiSeq	Unspecified	P48436	SOX9_HUMAN	STAD - Stomach adenocarcinoma(260;0.119)		1	444	+		Colorectal(1115;0.245)	24					Q53Y80	Silent	SNP	ENST00000245479.2	37	c.72C>G	CCDS11689.1																																																																																				0.711	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346		10	44	0	0	0	0.000978	0	10	44				
KLHL14	57565	broad.mit.edu	37	18	30257294	30257294	+	Splice_Site	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr18:30257294C>G	ENST00000359358.4	-	8	2027		c.e8-1			NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14							endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						TGGGAGAAACCTAAGTGACAG	0.423																																							uc002kxm.1		NA																	0				ovary(1)	1						c.e8-1		kelch-like 14							75.0	65.0	69.0					18																	30257294		2203	4300	6503	SO:0001630	splice_region_variant	57565					cytosol|endoplasmic reticulum membrane		g.chr18:30257294C>G	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1589-1G>C	18.37:g.30257294C>G			Somatic				KLHL14_uc010dmd.1_Splice_Site_p.G79_splice	p.G530_splice	NM_020805	NP_065856	WXS	Illumina HiSeq	Unspecified	Q9P2G3	KLH14_HUMAN			8	1977	-								A6NNW1|B4DHA0|Q8WU41	Splice_Site	SNP	ENST00000359358.4	37	c.1589_splice	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455044	0.84209	.	.	ENSG00000197705	ENST00000359358	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL14	28511292	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.439000	0.80444	2.854000	0.98071	0.655000	0.94253	.		0.423	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		Intron	17	47	0	0	0	0.004007	0	17	47				
SETBP1	26040	broad.mit.edu	37	18	42531491	42531492	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr18:42531491_42531492GG>TT	ENST00000282030.5	+	4	2482_2483	c.2186_2187GG>TT	c.(2185-2187)aGG>aTT	p.R729I		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	729						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGCGGGGCAGGAAGCCAAGAG	0.574									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2185-2187)AGG>ATT		SET binding protein 1 isoform a																																				SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42531491_42531492GG>TT	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	Exception_encountered	18.37:g.42531491_42531492delinsTT	ENSP00000282030:p.Arg729Ile		Somatic					p.R729I	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	2482_2483	+			729					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	DNP	ENST00000282030.5	37	c.2186_2187GG>TT	CCDS11923.2																																																																																				0.574	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		21	53	0	0	0	0.004672	0	21	53				
MYO5B	4645	broad.mit.edu	37	18	47364056	47364056	+	Missense_Mutation	SNP	T	T	C	rs75537257		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr18:47364056T>C	ENST00000285039.7	-	37	5268	c.4969A>G	c.(4969-4971)Atc>Gtc	p.I1657V	MYO5B_ENST00000592688.1_Missense_Mutation_p.I227V|MYO5B_ENST00000324581.6_Missense_Mutation_p.I772V|SCARNA17_ENST00000589499.1_RNA|RP11-886H22.1_ENST00000590532.2_5'Flank	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1657	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGGCGGATGATAGCTTCCAGG	0.507																																							uc002leb.2		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(4969-4971)ATC>GTC		myosin VB							71.0	67.0	68.0					18																	47364056		1960	4148	6108	SO:0001583	missense	4645				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr18:47364056T>C	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.4969A>G	18.37:g.47364056T>C	ENSP00000285039:p.Ile1657Val		Somatic				MYO5B_uc002ldz.2_Missense_Mutation_p.I227V|MYO5B_uc002lea.2_Missense_Mutation_p.I772V	p.I1657V	NM_001080467	NP_001073936	WXS	Illumina HiSeq	Unspecified	Q9ULV0	MYO5B_HUMAN		READ - Rectum adenocarcinoma(32;0.103)	37	5257	-			1657			Dilute.		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	c.4969A>G	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	T	8.675	0.903737	0.17760	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	D;T	0.87809	-2.3;2.21	4.87	-3.21	0.05140	Dilute (1);	0.501755	0.21040	N	0.081190	T	0.74183	0.3683	N	0.20845	0.615	0.25142	N	0.990498	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.58912	-0.7552	10	0.40728	T	0.16	.	11.7417	0.51796	0.0:0.4144:0.0:0.5856	.	1657;772	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	V	1657;772	ENSP00000285039:I1657V;ENSP00000315531:I772V	ENSP00000285039:I1657V	I	-	1	0	MYO5B	45618054	0.000000	0.05858	0.934000	0.37439	0.588000	0.36517	-0.349000	0.07731	-0.662000	0.05338	-0.256000	0.11100	ATC		0.507	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			47	84	0	0	0	0.003214	0	47	84				
STK11	6794	broad.mit.edu	37	19	1221946	1221946	+	Splice_Site	SNP	A	A	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:1221946A>T	ENST00000326873.7	+	7	2035		c.e7-1			NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11						activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTCTCCTCAGGGATGCTTG	0.677		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		20	Whole gene deletion(20)	p.0?(19)	cervix(14)|lung(2)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CD055731	STK11	D		c.e7-2		serine/threonine protein kinase 11							13.0	17.0	16.0					19																	1221946		1912	4003	5915	SO:0001630	splice_region_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221946A>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.863-1A>T	19.37:g.1221946A>T		TSP Lung(3;<1E-08)	Somatic					p.G288_splice	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	7	1978	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)						B2RBX7|E7EW76	Splice_Site	SNP	ENST00000326873.7	37	c.863_splice	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.207435	0.39003	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	3.56	3.56	0.40772	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3291	0.55028	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STK11	1172946	1.000000	0.71417	0.999000	0.59377	0.171000	0.22731	6.752000	0.74898	1.857000	0.53885	0.459000	0.35465	.		0.677	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	Intron	4	0	0	0	0	0.000602	0	4	0				
SLC25A23	79085	broad.mit.edu	37	19	6457519	6457519	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:6457519C>A	ENST00000301454.4	-	3	472	c.366G>T	c.(364-366)ttG>ttT	p.L122F	SLC25A23_ENST00000414491.2_5'Flank|SLC25A23_ENST00000334510.5_Missense_Mutation_p.L122F	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	122	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CTCACCTGTGCAAAATTTTCT	0.562																																							uc002mex.1		NA																	0				ovary(1)|pancreas(1)	2						c.(364-366)TTG>TTT		solute carrier family 25, member 23							53.0	53.0	53.0					19																	6457519		2203	4300	6503	SO:0001583	missense	79085				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding	g.chr19:6457519C>A	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.366G>T	19.37:g.6457519C>A	ENSP00000301454:p.Leu122Phe		Somatic				SLC25A23_uc002mev.2_RNA|SLC25A23_uc010xjd.1_5'Flank	p.L122F	NM_024103	NP_077008	WXS	Illumina HiSeq	Unspecified	Q9BV35	SCMC3_HUMAN			3	508	-			122			EF-hand 3.|Mitochondrial intermembrane (Potential).		B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	c.366G>T	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.128546	0.37533	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000334510	T;T;T	0.64260	-0.09;-0.09;-0.09	4.69	-2.87	0.05700	EF-hand-like domain (1);	0.000000	0.64402	D	0.000002	T	0.63058	0.2479	L	0.59912	1.85	0.51233	D	0.999919	D	0.55605	0.972	P	0.59288	0.855	T	0.62388	-0.6865	10	0.15952	T	0.53	-14.0291	9.6516	0.39902	0.0:0.5315:0.0:0.4685	.	122	Q9BV35	SCMC3_HUMAN	F	122	ENSP00000264088:L122F;ENSP00000301454:L122F;ENSP00000334537:L122F	ENSP00000264088:L122F	L	-	3	2	SLC25A23	6408519	0.887000	0.30362	0.933000	0.37362	0.070000	0.16714	-0.034000	0.12225	-0.823000	0.04301	-0.657000	0.03884	TTG		0.562	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103		25	36	1	0	2.70662e-09	0.001786	6.05853e-09	25	36				
KEAP1	9817	broad.mit.edu	37	19	10610235	10610235	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:10610235C>G	ENST00000171111.5	-	2	1022	c.475G>C	c.(475-477)Gct>Cct	p.A159P	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.A159P	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	159					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TACATGACAGCACCGTTCATG	0.582																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(475-477)GCT>CCT		kelch-like ECH-associated protein 1							185.0	145.0	159.0					19																	10610235		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610235C>G	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.475G>C	19.37:g.10610235C>G	ENSP00000171111:p.Ala159Pro		Somatic				KEAP1_uc002mor.1_Missense_Mutation_p.A159P	p.A159P	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	631	-			159					B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.475G>C	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178019	0.78564	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.87809	-2.3;-2.3	4.81	4.81	0.61882	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.96160	0.8748	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97842	1.0269	10	0.87932	D	0	.	15.3825	0.74669	0.0:1.0:0.0:0.0	.	159	Q14145	KEAP1_HUMAN	P	159	ENSP00000171111:A159P;ENSP00000377245:A159P	ENSP00000171111:A159P	A	-	1	0	KEAP1	10471235	1.000000	0.71417	0.307000	0.25127	0.628000	0.37860	5.872000	0.69636	2.232000	0.73038	0.561000	0.74099	GCT		0.582	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		37	51	0	0	0	0.006999	0	37	51				
CILP2	148113	broad.mit.edu	37	19	19655215	19655215	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:19655215G>T	ENST00000291495.5	+	8	1946	c.1861G>T	c.(1861-1863)Gcc>Tcc	p.A621S	CILP2_ENST00000586018.1_Missense_Mutation_p.A627S	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	621						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GGCGGCGTCTGCCCCCAGTGA	0.701																																							uc002nmv.3		NA																	0				ovary(1)	1						c.(1861-1863)GCC>TCC		cartilage intermediate layer protein 2							45.0	53.0	50.0					19																	19655215		2197	4293	6490	SO:0001583	missense	148113					proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity	g.chr19:19655215G>T	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1861G>T	19.37:g.19655215G>T	ENSP00000291495:p.Ala621Ser		Somatic				CILP2_uc002nmw.3_Missense_Mutation_p.A627S	p.A621S	NM_153221	NP_694953	WXS	Illumina HiSeq	Unspecified	Q8IUL8	CILP2_HUMAN			8	1946	+			621					Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	c.1861G>T	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602214	0.66445	.	.	ENSG00000160161	ENST00000291495	T	0.41065	1.01	4.37	4.37	0.52481	.	0.116409	0.64402	D	0.000020	T	0.60222	0.2252	M	0.64404	1.975	0.44462	D	0.997396	D;D	0.76494	0.98;0.999	P;D	0.70016	0.887;0.967	T	0.64546	-0.6382	10	0.66056	D	0.02	-31.5446	14.4655	0.67480	0.0:0.0:1.0:0.0	.	621;621	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	S	621	ENSP00000291495:A621S	ENSP00000291495:A621S	A	+	1	0	CILP2	19516215	1.000000	0.71417	0.856000	0.33681	0.679000	0.39708	3.153000	0.50685	1.994000	0.58287	0.485000	0.47835	GCC		0.701	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221		53	74	1	0	1.46156e-29	0.00361	4.0827e-29	53	74				
PSG4	5672	broad.mit.edu	37	19	43708259	43708259	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:43708259C>G	ENST00000405312.3	-	2	446	c.209G>C	c.(208-210)gGg>gCg	p.G70A	PSG4_ENST00000433626.2_Missense_Mutation_p.G70A|PSG4_ENST00000244295.9_Missense_Mutation_p.G70A	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	70	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				TGTCATTTGCCCTTTGTACCA	0.423																																							uc002ovy.2		NA																	0				ovary(1)	1						c.(208-210)GGG>GCG		pregnancy specific beta-1-glycoprotein 4 isoform							186.0	198.0	194.0					19																	43708259		2129	4269	6398	SO:0001583	missense	5672				defense response|female pregnancy	extracellular region		g.chr19:43708259C>G		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.209G>C	19.37:g.43708259C>G	ENSP00000384770:p.Gly70Ala		Somatic				PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Missense_Mutation_p.G70A|PSG4_uc002ovz.2_Missense_Mutation_p.G70A	p.G70A	NM_002780	NP_002771	WXS	Illumina HiSeq	Unspecified	Q00888	PSG4_HUMAN			2	311	-		Prostate(69;0.00682)	70			Ig-like V-type.		E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	37	c.209G>C	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	N	11.10	1.538712	0.27475	.	.	ENSG00000243137	ENST00000244295;ENST00000405312;ENST00000433626;ENST00000451895	T;T;T;T	0.01745	4.66;4.66;4.66;4.66	1.65	1.65	0.23941	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.11537	0.0281	M	0.92219	3.285	0.09310	N	1	D;D;P	0.89917	0.974;1.0;0.914	D;D;D	0.97110	0.982;1.0;0.949	T	0.03433	-1.1037	9	0.62326	D	0.03	.	6.8053	0.23774	0.0:1.0:0.0:0.0	.	70;70;70	E7EX79;Q00888-2;Q00888	.;.;PSG4_HUMAN	A	70;70;70;86	ENSP00000244295:G70A;ENSP00000384770:G70A;ENSP00000387864:G70A;ENSP00000388134:G86A	ENSP00000244295:G70A	G	-	2	0	PSG4	48400099	0.208000	0.23494	0.006000	0.13384	0.017000	0.09413	0.667000	0.25112	1.251000	0.43983	0.173000	0.16961	GGG		0.423	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633		135	106	0	0	0	0.00361	0	135	106				
SIGLEC11	114132	broad.mit.edu	37	19	50461674	50461674	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:50461674G>T	ENST00000447370.2	-	8	1607	c.1517C>A	c.(1516-1518)aCc>aAc	p.T506N	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Intron	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	506					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TGAGCTGGGGGTGACCTCGAA	0.701																																							uc010ybh.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(1516-1518)ACC>AAC		sialic acid binding Ig-like lectin 11 isoform 1							26.0	28.0	27.0					19																	50461674		2203	4299	6502	SO:0001583	missense	114132				cell adhesion	integral to membrane	sugar binding	g.chr19:50461674G>T	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1517C>A	19.37:g.50461674G>T	ENSP00000412361:p.Thr506Asn		Somatic				SIGLEC11_uc010ybi.1_Intron	p.T506N	NM_052884	NP_443116	WXS	Illumina HiSeq	Unspecified	Q96RL6	SIG11_HUMAN		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)	8	1608	-		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)	506			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000447370.2	37	c.1517C>A	CCDS12790.2	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497120	0.44352	.	.	ENSG00000161640	ENST00000447370	D	0.86497	-2.13	2.69	2.69	0.31865	.	0.382247	0.23032	N	0.052735	D	0.90048	0.6892	L	0.58510	1.815	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.88375	0.2997	9	.	.	.	.	9.4995	0.39008	0.0:0.0:1.0:0.0	.	506	Q96RL6	SIG11_HUMAN	N	506	ENSP00000412361:T506N	.	T	-	2	0	SIGLEC11	55153486	0.000000	0.05858	0.212000	0.23672	0.061000	0.15899	-0.026000	0.12392	1.459000	0.47892	0.556000	0.70494	ACC		0.701	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		16	35	1	0	3.41278e-10	0.00499	7.74175e-10	16	35				
ZNF677	342926	broad.mit.edu	37	19	53747009	53747009	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:53747009G>T	ENST00000598513.1	-	4	307	c.157C>A	c.(157-159)Cct>Act	p.P53T	ZNF677_ENST00000598806.1_Missense_Mutation_p.P53T|CTD-2245F17.6_ENST00000596041.1_RNA|ZNF677_ENST00000601413.1_Missense_Mutation_p.P53T|ZNF677_ENST00000599012.1_Missense_Mutation_p.P53T|ZNF677_ENST00000594681.1_Missense_Mutation_p.P53T|ZNF677_ENST00000601828.1_Missense_Mutation_p.P53T|ZNF677_ENST00000333952.4_Missense_Mutation_p.P53T	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TCTTCTGGAGGGATGTTATCC	0.507																																							uc002qbf.1		NA																	0				ovary(1)	1						c.(157-159)CCT>ACT		zinc finger protein 677							118.0	109.0	112.0					19																	53747009		2203	4300	6503	SO:0001583	missense	342926				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53747009G>T	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.157C>A	19.37:g.53747009G>T	ENSP00000469391:p.Pro53Thr		Somatic				ZNF677_uc002qbg.1_Missense_Mutation_p.P53T|ZNF677_uc002qbh.2_RNA	p.P53T	NM_182609	NP_872415	WXS	Illumina HiSeq	Unspecified	Q86XU0	ZN677_HUMAN		GBM - Glioblastoma multiforme(134;0.00352)	4	342	-			53			KRAB.			Missense_Mutation	SNP	ENST00000598513.1	37	c.157C>A	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	G	0.041	-1.283730	0.01398	.	.	ENSG00000197928	ENST00000416063;ENST00000333952	T	0.08008	3.14	2.02	-1.61	0.08399	Krueppel-associated box (3);	1.402880	0.05118	N	0.490069	T	0.04588	0.0125	N	0.16602	0.42	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.42085	-0.9472	10	0.35671	T	0.21	.	0.805	0.01082	0.1625:0.2339:0.366:0.2377	.	53	Q86XU0	ZN677_HUMAN	T	53	ENSP00000334394:P53T	ENSP00000334394:P53T	P	-	1	0	ZNF677	58438821	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.112000	0.15479	-0.318000	0.08665	0.561000	0.74099	CCT		0.507	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609		55	131	1	0	1.82294e-38	0.00361	5.45269e-38	55	131				
MYADM	91663	broad.mit.edu	37	19	54377408	54377408	+	Missense_Mutation	SNP	G	G	T	rs533715842		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:54377408G>T	ENST00000391769.2	+	3	905	c.625G>T	c.(625-627)Gtg>Ttg	p.V209L	MYADM_ENST00000391768.2_Missense_Mutation_p.V209L|MYADM_ENST00000336967.3_Missense_Mutation_p.V209L|MYADM_ENST00000391770.4_Missense_Mutation_p.V209L|MYADM_ENST00000391771.1_Missense_Mutation_p.V209L|AC008440.5_ENST00000413496.2_RNA	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	209	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		GTGCGTGGCGGTGTACGCCAT	0.627																																							uc002qcl.2		NA																	0				ovary(1)	1						c.(625-627)GTG>TTG		myeloid-associated differentiation marker							155.0	133.0	140.0					19																	54377408		2203	4300	6503	SO:0001583	missense	91663					integral to membrane		g.chr19:54377408G>T	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.625G>T	19.37:g.54377408G>T	ENSP00000375649:p.Val209Leu		Somatic				MYADM_uc002qcm.2_Missense_Mutation_p.V209L|MYADM_uc002qcn.2_Missense_Mutation_p.V209L|MYADM_uc002qco.2_Missense_Mutation_p.V209L|MYADM_uc002qcp.2_Missense_Mutation_p.V209L	p.V209L	NM_001020820	NP_001018656	WXS	Illumina HiSeq	Unspecified	Q96S97	MYADM_HUMAN		GBM - Glioblastoma multiforme(134;0.0488)	3	773	+	Ovarian(34;0.19)		209			MARVEL 2.|Helical; (Potential).		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	c.625G>T	CCDS12866.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220795	0.79464	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51	4.28	4.28	0.50868	Marvel (1);MARVEL-like domain (1);	0.000000	0.64402	D	0.000003	T	0.56746	0.2006	M	0.87456	2.885	0.58432	D	0.999999	D	0.61697	0.99	P	0.60886	0.88	T	0.66760	-0.5842	10	0.72032	D	0.01	-17.7329	14.6579	0.68847	0.0:0.0:1.0:0.0	.	209	Q96S97	MYADM_HUMAN	L	209;209;209;209;209;172;209;209	ENSP00000398269:V209L;ENSP00000337222:V209L;ENSP00000375650:V209L;ENSP00000416919:V209L;ENSP00000375651:V209L;ENSP00000375649:V209L;ENSP00000375648:V209L	ENSP00000337222:V209L	V	+	1	0	MYADM	59069220	1.000000	0.71417	0.179000	0.23059	0.686000	0.39977	9.742000	0.98846	2.133000	0.65898	0.306000	0.20318	GTG		0.627	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373		84	205	1	0	1.16668e-32	0.00361	3.3704e-32	84	205				
LILRA6	79168	broad.mit.edu	37	19	54745554	54745554	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:54745554C>T	ENST00000396365.2	-	4	595	c.556G>A	c.(556-558)Gtg>Atg	p.V186M	LILRA6_ENST00000391735.3_Missense_Mutation_p.V186M|LILRA6_ENST00000245621.5_Missense_Mutation_p.V186M|LILRA6_ENST00000440558.2_Missense_Mutation_p.V186M|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000270464.5_Missense_Mutation_p.V186M|LILRA6_ENST00000419410.2_Missense_Mutation_p.V186M	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	186					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGGGGGTCACGGGGCCCACA	0.602																																							uc002qeu.1		NA																	0				skin(2)	2						c.(556-558)GTG>ATG		leukocyte immunoglobulin-like receptor,							12.0	15.0	14.0					19																	54745554		1717	3815	5532	SO:0001583	missense	79168					integral to membrane	receptor activity	g.chr19:54745554C>T	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.556G>A	19.37:g.54745554C>T	ENSP00000379651:p.Val186Met		Somatic				LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Missense_Mutation_p.V186M|LILRA6_uc002qek.1_Missense_Mutation_p.V186M|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.V186M|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.V186M|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.V186M|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.V186M|LILRA6_uc010yep.1_Missense_Mutation_p.V186M|LILRA6_uc010yeq.1_Missense_Mutation_p.V186M|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.V47M	p.V186M	NM_024318	NP_077294	WXS	Illumina HiSeq	Unspecified	Q6PI73	LIRA6_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	4	680	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		186			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000396365.2	37	c.556G>A	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	C	9.748	1.166703	0.21621	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000391735;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T;T	0.16073	2.37;2.37;2.37;3.39;2.37;2.37	2.64	-1.1	0.09872	Immunoglobulin-like fold (1);	0.710370	0.12662	N	0.449570	T	0.19327	0.0464	L	0.45051	1.395	0.09310	N	1	D;P;D;D;D;D	0.76494	0.987;0.914;0.986;0.999;0.995;0.999	P;B;P;P;P;P	0.56042	0.514;0.158;0.468;0.79;0.649;0.721	T	0.11299	-1.0593	10	0.45353	T	0.12	.	2.9298	0.05795	0.0:0.4518:0.2414:0.3068	.	186;186;186;186;186;186	C9JFH3;Q6PI73-2;Q6PI73;F8WCY4;D3YTC4;F8W6G6	.;.;LIRA6_HUMAN;.;.;.	M	186	ENSP00000390120:V186M;ENSP00000270464:V186M;ENSP00000411227:V186M;ENSP00000375615:V186M;ENSP00000379651:V186M;ENSP00000245621:V186M	ENSP00000245621:V186M	V	-	1	0	LILRA6	59437366	0.000000	0.05858	0.001000	0.08648	0.360000	0.29518	-0.575000	0.05861	-0.112000	0.11979	0.162000	0.16502	GTG		0.602	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318		32	91	0	0	0	0.002852	0	32	91				
LILRA5	353514	broad.mit.edu	37	19	54823398	54823398	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:54823398G>T	ENST00000301219.3	-	4	264	c.145C>A	c.(145-147)Ctc>Atc	p.L49I	LILRA5_ENST00000346508.3_Missense_Mutation_p.L37I|LILRA5_ENST00000432233.3_Missense_Mutation_p.L49I|LILRA5_ENST00000446712.3_Missense_Mutation_p.L37I|AC008984.2_ENST00000507363.1_RNA	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	49					innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCAGCCCAGAGGGTGGCTTTG	0.622																																							uc002qfe.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(145-147)CTC>ATC		leukocyte immunoglobulin-like receptor subfamily							58.0	61.0	60.0					19																	54823398		2203	4300	6503	SO:0001583	missense	353514				innate immune response	extracellular region|integral to membrane	receptor activity	g.chr19:54823398G>T	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.145C>A	19.37:g.54823398G>T	ENSP00000301219:p.Leu49Ile		Somatic				LILRA5_uc002qff.2_Missense_Mutation_p.L37I|LILRA5_uc010yev.1_Missense_Mutation_p.L49I|LILRA5_uc010yew.1_Missense_Mutation_p.L37I|LILRA5_uc002qfh.1_Missense_Mutation_p.L37I|LILRA5_uc002qfg.1_Missense_Mutation_p.L49I	p.L49I	NM_021250	NP_067073	WXS	Illumina HiSeq	Unspecified	A6NI73	LIRA5_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	4	265	-	Ovarian(34;0.19)		49			Extracellular (Potential).		A6NHI3	Missense_Mutation	SNP	ENST00000301219.3	37	c.145C>A	CCDS12888.1	.	.	.	.	.	.	.	.	.	.	G	1.518	-0.547795	0.04024	.	.	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	2.84	-4.24	0.03777	Immunoglobulin-like fold (1);	0.221943	0.22431	N	0.060157	T	0.24928	0.0605	M	0.62209	1.925	0.09310	N	1	B;P;B;P	0.41214	0.058;0.491;0.287;0.742	B;B;B;P	0.58077	0.196;0.439;0.283;0.832	T	0.30880	-0.9963	10	0.07325	T	0.83	.	11.5863	0.50920	0.0:0.0:0.7609:0.2391	.	37;49;37;49	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	I	49;37;37;49	ENSP00000301219:L49I;ENSP00000302948:L37I;ENSP00000389499:L37I;ENSP00000404236:L49I	ENSP00000301219:L49I	L	-	1	0	LILRA5	59515210	0.004000	0.15560	0.076000	0.20297	0.002000	0.02628	-1.187000	0.03067	-0.583000	0.05921	0.411000	0.27672	CTC		0.622	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985		36	96	1	0	1.36161e-19	0.004289	3.48656e-19	36	96				
PPP6R1	22870	broad.mit.edu	37	19	55753857	55753857	+	Splice_Site	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:55753857C>G	ENST00000412770.2	-	6	1185		c.e6-1		PPP6R1_ENST00000587283.1_Splice_Site	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1						regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						TGGAATGTTGCTGGAACGGGG	0.622																																							uc002qjw.3		NA																	0					0						c.e6-1		SAPS domain family, member 1							71.0	78.0	76.0					19																	55753857		2097	4217	6314	SO:0001630	splice_region_variant	22870				regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding	g.chr19:55753857C>G	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.619-1G>C	19.37:g.55753857C>G			Somatic				SAPS1_uc002qjv.2_Splice_Site_p.Q269_splice	p.Q207_splice	NM_014931	NP_055746	WXS	Illumina HiSeq	Unspecified	Q9UPN7	PP6R1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)	6	861	-		Renal(1328;0.245)						Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Splice_Site	SNP	ENST00000412770.2	37	c.619_splice	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164484	0.78339	.	.	ENSG00000105063	ENST00000444538;ENST00000412770	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.226	0.82293	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PPP6R1	60445669	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.268000	0.78473	2.452000	0.82932	0.650000	0.86243	.		0.622	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	Intron	32	72	0	0	0	0.001786	0	32	72				
ZNF543	125919	broad.mit.edu	37	19	57835140	57835140	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:57835140G>T	ENST00000321545.4	+	2	454	c.109G>T	c.(109-111)Gtg>Ttg	p.V37L		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GTATCAGGAGGTGATGCTGGA	0.532																																							uc002qoi.1		NA																	0				skin(1)|pancreas(1)	2						c.(109-111)GTG>TTG		zinc finger protein 543							199.0	161.0	174.0					19																	57835140		2203	4300	6503	SO:0001583	missense	125919				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57835140G>T	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.109G>T	19.37:g.57835140G>T	ENSP00000322545:p.Val37Leu		Somatic					p.V37L	NM_213598	NP_998763	WXS	Illumina HiSeq	Unspecified	Q08ER8	ZN543_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	2	454	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	37			KRAB.		Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	37	c.109G>T	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172680	0.38413	.	.	ENSG00000178229	ENST00000321545	T	0.03801	3.8	1.68	1.68	0.24146	Krueppel-associated box (4);	.	.	.	.	T	0.28499	0.0705	H	0.96489	3.83	0.22531	N	0.999014	D	0.69078	0.997	D	0.80764	0.994	T	0.04976	-1.0914	9	0.62326	D	0.03	.	8.9663	0.35879	0.0:0.0:1.0:0.0	.	37	Q08ER8	ZN543_HUMAN	L	37	ENSP00000322545:V37L	ENSP00000322545:V37L	V	+	1	0	ZNF543	62526952	0.987000	0.35691	0.787000	0.31911	0.266000	0.26442	1.977000	0.40589	1.232000	0.43678	0.467000	0.42956	GTG		0.532	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865		55	151	1	0	1.10885e-35	0.00361	3.28764e-35	55	151				
ZNF814	730051	broad.mit.edu	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																							uc002qqo.2		NA																	2	Substitution - coding silent(2)		kidney(2)		0						c.(994-996)TCG>TCC		zinc finger protein 814							25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58385762C>G		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G			Somatic				ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	p.S332S	NM_001144989	NP_001138461	WXS	Illumina HiSeq	Unspecified	B7Z6K7	ZN814_HUMAN			3	1268	-			332			C2H2-type 5.		A6NF35	Silent	SNP	ENST00000435989.2	37	c.996G>C	CCDS46212.1																																																																																				0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708		3	7	0	0	0	0.004672	0	3	7				
NRXN1	9378	broad.mit.edu	37	2	50779780	50779780	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:50779780C>A	ENST00000406316.2	-	9	3180	c.1704G>T	c.(1702-1704)aaG>aaT	p.K568N	NRXN1_ENST00000402717.3_Missense_Mutation_p.K560N|NRXN1_ENST00000405472.3_Missense_Mutation_p.K560N|NRXN1_ENST00000404971.1_Missense_Mutation_p.K608N|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Missense_Mutation_p.K568N|NRXN1_ENST00000401669.2_Missense_Mutation_p.K568N	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	568	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CATTCACTTTCTTCAACAGGG	0.443																																							uc010fbq.2		NA																	0				ovary(2)	2						c.(1822-1824)AAG>AAT		neurexin 1 isoform alpha2 precursor							138.0	130.0	133.0					2																	50779780		1891	4098	5989	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50779780C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1704G>T	2.37:g.50779780C>A	ENSP00000384311:p.Lys568Asn		Somatic				NRXN1_uc002rxb.3_Missense_Mutation_p.K240N|NRXN1_uc002rxe.3_Missense_Mutation_p.K568N|NRXN1_uc002rxc.1_RNA	p.K608N	NM_001135659	NP_001129131	WXS	Illumina HiSeq	Unspecified	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		9	3301	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.1824G>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531142	0.45073	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.93	5.93	0.95920	.	0.047019	0.85682	D	0.000000	T	0.79269	0.4417	L	0.49350	1.555	0.38841	D	0.956058	B;D;P	0.58620	0.264;0.983;0.866	B;P;P	0.52793	0.16;0.709;0.665	T	0.77411	-0.2598	10	0.29301	T	0.29	.	13.5351	0.61643	0.0:0.9291:0.0:0.0709	.	608;568;560	Q9ULB1-3;F8WB18;A7E294	.;.;.	N	608;568;560;568;609;560;568	ENSP00000385142:K608N;ENSP00000384311:K568N;ENSP00000434015:K560N;ENSP00000385017:K568N;ENSP00000385434:K560N;ENSP00000385681:K568N	ENSP00000385017:K568N	K	-	3	2	NRXN1	50633284	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.019000	0.49635	2.814000	0.96858	0.591000	0.81541	AAG		0.443	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			58	169	1	0	1.08141e-31	0.00361	3.09759e-31	58	169				
XPO1	7514	broad.mit.edu	37	2	61706009	61706009	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:61706009C>A	ENST00000401558.2	-	25	3889	c.3162G>T	c.(3160-3162)atG>atT	p.M1054I	RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA|XPO1_ENST00000406957.1_Missense_Mutation_p.M1054I|RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000404992.2_Missense_Mutation_p.M1054I	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	1054					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			CAGGGACAGACATTTGACGTT	0.393			Mis		CLL																																		uc002sbj.2		NA	-'	Dom	yes		2	2p15	7514		"""exportin 1 (CRM1 homolog, yeast)"""			L					0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4						c.(3160-3162)ATG>ATT		exportin 1							159.0	157.0	158.0					2																	61706009		2203	4300	6503	SO:0001583	missense	7514				intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding	g.chr2:61706009C>A	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.3162G>T	2.37:g.61706009C>A	ENSP00000384863:p.Met1054Ile		Somatic				XPO1_uc010fcl.2_Missense_Mutation_p.M1050I|XPO1_uc010ypn.1_Missense_Mutation_p.M1050I|XPO1_uc002sbk.2_Missense_Mutation_p.M615I|XPO1_uc002sbg.2_Missense_Mutation_p.M251I|XPO1_uc002sbh.2_Missense_Mutation_p.M701I	p.M1054I	NM_003400	NP_003391	WXS	Illumina HiSeq	Unspecified	O14980	XPO1_HUMAN	LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)		25	3890	-			1054					A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	c.3162G>T	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697498	0.48307	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.71643	0.3364	M	0.83012	2.62	0.80722	D	1	B;B	0.15473	0.013;0.006	B;B	0.08055	0.003;0.002	T	0.67522	-0.5649	9	0.33940	T	0.23	-20.2572	19.8731	0.96858	0.0:1.0:0.0:0.0	.	701;1054	B3KWD0;O14980	.;XPO1_HUMAN	I	1054	.	ENSP00000384863:M1054I	M	-	3	0	XPO1	61559513	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.973000	0.70456	2.690000	0.91761	0.655000	0.94253	ATG		0.393	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400		25	89	1	0	7.92952e-12	0.003954	1.82325e-11	25	89				
XPO1	7514	broad.mit.edu	37	2	61729132	61729132	+	Splice_Site	SNP	T	T	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:61729132T>A	ENST00000401558.2	-	6	1134	c.407A>T	c.(406-408)cAg>cTg	p.Q136L	XPO1_ENST00000406957.1_Splice_Site_p.Q136L|XPO1_ENST00000404992.2_Splice_Site_p.Q136L	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	136	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AAAGCTTACCTGAACAAGGAT	0.269			Mis		CLL																																		uc002sbj.2		NA	-'	Dom	yes		2	2p15	7514		"""exportin 1 (CRM1 homolog, yeast)"""			L					0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4						c.(406-408)CAG>CTG		exportin 1							44.0	42.0	42.0					2																	61729132		2195	4290	6485	SO:0001630	splice_region_variant	7514				intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding	g.chr2:61729132T>A	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.408+1A>T	2.37:g.61729132T>A			Somatic				XPO1_uc010fcl.2_Missense_Mutation_p.Q132L|XPO1_uc010ypn.1_Missense_Mutation_p.Q132L|XPO1_uc002sbk.2_5'UTR	p.Q136L	NM_003400	NP_003391	WXS	Illumina HiSeq	Unspecified	O14980	XPO1_HUMAN	LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)		6	1135	-			136			Necessary for HTLV-1 Rex-mediated mRNA export.		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	c.407A>T	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279576	0.80692	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957;ENST00000451765	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	6.15	6.15	0.99193	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.50069	0.1594	M	0.77820	2.39	0.80722	D	1	B	0.28400	0.21	B	0.31946	0.138	T	0.48822	-0.9001	10	0.46703	T	0.11	-9.0338	16.45	0.83977	0.0:0.0:0.0:1.0	.	136	O14980	XPO1_HUMAN	L	136	ENSP00000384863:Q136L;ENSP00000385942:Q136L;ENSP00000385559:Q136L;ENSP00000413853:Q136L	ENSP00000384863:Q136L	Q	-	2	0	XPO1	61582636	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.765000	0.85310	2.363000	0.80096	0.523000	0.50628	CAG		0.269	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	Missense_Mutation	12	43	0	0	0	0.000978	0	12	43				
NEB	4703	broad.mit.edu	37	2	152383524	152383524	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:152383524G>T	ENST00000172853.10	-	120	16897	c.16750C>A	c.(16750-16752)Ctg>Atg	p.L5584M	NEB_ENST00000427231.2_Missense_Mutation_p.L7285M|NEB_ENST00000603639.1_Missense_Mutation_p.L7285M|NEB_ENST00000397345.3_Missense_Mutation_p.L7285M|NEB_ENST00000409198.1_Missense_Mutation_p.L5584M|NEB_ENST00000604864.1_Missense_Mutation_p.L7285M			P20929	NEBU_HUMAN	nebulin	5584					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCCCGGTCCAGCTTATATTCA	0.453																																							uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(16750-16752)CTG>ATG		nebulin isoform 3							57.0	59.0	58.0					2																	152383524		1905	4119	6024	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152383524G>T	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.16750C>A	2.37:g.152383524G>T	ENSP00000172853:p.Leu5584Met		Somatic				NEB_uc002txr.2_Missense_Mutation_p.L2007M|NEB_uc002txt.3_Missense_Mutation_p.L89M	p.L5584M	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	120	16941	-			5584			Nebulin 152.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.16750C>A		.	.	.	.	.	.	.	.	.	.	G	15.85	2.954783	0.53293	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.98	4.19	0.49359	.	0.137921	0.50627	D	0.000115	T	0.47432	0.1445	L	0.51422	1.61	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.77557	0.969;0.986;0.99	T	0.32322	-0.9911	10	0.40728	T	0.16	.	12.8281	0.57731	0.1205:0.0:0.8795:0.0	.	5584;7285;2015	P20929;F8WCP0;Q14215	NEBU_HUMAN;.;.	M	5584;7285;7285;1633;2015;5584	ENSP00000386259:L5584M;ENSP00000380505:L7285M;ENSP00000416578:L7285M;ENSP00000410961:L2015M;ENSP00000172853:L5584M	ENSP00000172853:L5584M	L	-	1	2	NEB	152091770	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.609000	0.67661	0.871000	0.35750	0.655000	0.94253	CTG		0.453	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		6	24	1	0	2.7689e-08	0.001984	6.11691e-08	6	24				
NEB	4703	broad.mit.edu	37	2	152432670	152432670	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:152432670T>C	ENST00000172853.10	-	78	11947	c.11800A>G	c.(11800-11802)Agt>Ggt	p.S3934G	NEB_ENST00000427231.2_Missense_Mutation_p.S5635G|NEB_ENST00000603639.1_Missense_Mutation_p.S5635G|NEB_ENST00000397345.3_Missense_Mutation_p.S5635G|NEB_ENST00000409198.1_Missense_Mutation_p.S3934G|NEB_ENST00000604864.1_Missense_Mutation_p.S5635G			P20929	NEBU_HUMAN	nebulin	3934					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTCACAATACTAATATTTTCA	0.318																																							uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(11800-11802)AGT>GGT		nebulin isoform 3							28.0	28.0	28.0					2																	152432670		1822	4080	5902	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152432670T>C	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11800A>G	2.37:g.152432670T>C	ENSP00000172853:p.Ser3934Gly		Somatic				NEB_uc002txr.2_Missense_Mutation_p.S357G	p.S3934G	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	78	11991	-			3934			Nebulin 107.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.11800A>G		.	.	.	.	.	.	.	.	.	.	T	16.54	3.150479	0.57151	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000413693;ENST00000172853	D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.91690	0.7373	M	0.82323	2.585	0.80722	D	1	D;D	0.71674	0.998;0.983	D;D	0.79108	0.981;0.992	D	0.92609	0.6098	10	0.72032	D	0.01	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	3934;365	P20929;Q14215	NEBU_HUMAN;.	G	3934;5635;5635;365;3934	ENSP00000386259:S3934G;ENSP00000380505:S5635G;ENSP00000416578:S5635G;ENSP00000410961:S365G;ENSP00000172853:S3934G	ENSP00000172853:S3934G	S	-	1	0	NEB	152140916	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	7.756000	0.85195	2.302000	0.77476	0.533000	0.62120	AGT		0.318	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		12	33	0	0	0	0.001368	0	12	33				
TTN	7273	broad.mit.edu	37	2	179594055	179594055	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:179594055T>A	ENST00000591111.1	-	62	18101	c.17877A>T	c.(17875-17877)gaA>gaT	p.E5959D	TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.E5032D|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E6276D|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12750	Ig-like 40.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTGCCGCCTTCATTGGATA	0.413																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(15094-15096)GAA>GAT		titin isoform N2-A							113.0	109.0	110.0					2																	179594055		1889	4128	6017	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179594055T>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17877A>T	2.37:g.179594055T>A	ENSP00000465570:p.Glu5959Asp		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E1693D	p.E5032D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		61	15320	-			5959					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.15096A>T		.	.	.	.	.	.	.	.	.	.	T	7.794	0.712236	0.15306	.	.	ENSG00000155657	ENST00000342992	T	0.69175	-0.38	5.92	2.29	0.28610	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);	.	.	.	.	T	0.69949	0.3168	L	0.33137	0.985	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.68040	-0.5514	9	0.87932	D	0	.	9.1658	0.37050	0.0:0.3427:0.0:0.6573	.	5959	Q8WZ42	TITIN_HUMAN	D	5032	ENSP00000343764:E5032D	ENSP00000343764:E5032D	E	-	3	2	TTN	179302300	1.000000	0.71417	0.978000	0.43139	0.287000	0.27160	0.547000	0.23299	0.157000	0.19338	-0.256000	0.11100	GAA		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		73	156	0	0	0	0.00361	0	73	156				
FAM117B	150864	broad.mit.edu	37	2	203591005	203591005	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:203591005T>A	ENST00000392238.2	+	4	879	c.879T>A	c.(877-879)agT>agA	p.S293R	FAM117B_ENST00000303116.6_Missense_Mutation_p.S49R			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	293										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						TGCAGAGAAGTAAACACAGCA	0.408																																							uc010zhx.1		NA																	0				ovary(1)	1						c.(877-879)AGT>AGA		amyotrophic lateral sclerosis 2 (juvenile)							147.0	139.0	142.0					2																	203591005		2203	4300	6503	SO:0001583	missense	150864							g.chr2:203591005T>A	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.879T>A	2.37:g.203591005T>A	ENSP00000376071:p.Ser293Arg		Somatic					p.S293R	NM_173511	NP_775782	WXS	Illumina HiSeq	Unspecified	Q6P1L5	F117B_HUMAN			4	889	+			293					Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	ENST00000392238.2	37	c.879T>A	CCDS33362.2	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949305	0.73787	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.71	3.39	0.38822	.	0.000000	0.85682	D	0.000000	T	0.62636	0.2444	L	0.36672	1.1	0.47778	D	0.99951	D	0.89917	1.0	D	0.85130	0.997	T	0.60541	-0.7243	9	0.45353	T	0.12	-16.3761	8.3656	0.32385	0.0:0.2254:0.0:0.7746	.	293	Q6P1L5	F117B_HUMAN	R	49;293	.	ENSP00000306299:S49R	S	+	3	2	FAM117B	203299250	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.740000	0.38228	1.004000	0.39156	0.460000	0.39030	AGT		0.408	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511		64	153	0	0	0	0.00361	0	64	153				
ERBB4	2066	broad.mit.edu	37	2	212589824	212589824	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:212589824C>A	ENST00000342788.4	-	6	1028	c.718G>T	c.(718-720)Gga>Tga	p.G240*	ERBB4_ENST00000436443.1_Nonsense_Mutation_p.G240*|ERBB4_ENST00000402597.1_Nonsense_Mutation_p.G240*|ERBB4_ENST00000484474.1_5'Flank	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	240	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TCCTTAGGTCCTGAGCAGCCT	0.478										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(718-720)GGA>TGA		v-erb-a erythroblastic leukemia viral oncogene							130.0	116.0	121.0					2																	212589824		2203	4300	6503	SO:0001587	stop_gained	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212589824C>A	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.718G>T	2.37:g.212589824C>A	ENSP00000342235:p.Gly240*	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Nonsense_Mutation_p.G240*|ERBB4_uc010zji.1_Nonsense_Mutation_p.G240*|ERBB4_uc010zjj.1_Nonsense_Mutation_p.G240*|ERBB4_uc010fut.1_Nonsense_Mutation_p.G240*	p.G240*	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	6	816	-		Renal(323;0.06)|Lung NSC(271;0.197)	240			Cys-rich.|Extracellular (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Nonsense_Mutation	SNP	ENST00000342788.4	37	c.718G>T	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.936280|4.936280	0.92458|0.92458	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	.|.	.|.	.|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79834	.|0.4514	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77699	.|-0.2490	.|3	0.87932|.	D|.	0|.	.|.	19.8973|19.8973	0.96972|0.96972	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|H	240|239	.|.	ENSP00000342235:G240X|.	G|Q	-|-	1|3	0|2	ERBB4|ERBB4	212298069|212298069	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	7.818000|7.818000	0.86416|0.86416	2.710000|2.710000	0.92621|0.92621	0.650000|0.650000	0.86243|0.86243	GGA|CAG		0.478	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		55	95	1	0	3.07002e-29	0.00361	8.50546e-29	55	95				
SLC11A1	6556	broad.mit.edu	37	2	219249006	219249006	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr2:219249006C>T	ENST00000233202.6	+	3	531	c.191C>T	c.(190-192)cCt>cTt	p.P64L	SLC11A1_ENST00000473367.1_Intron|SLC11A1_ENST00000539932.1_5'UTR	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	64	Pro/Ser-rich.				activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCACGGGGCCTGGCTTCCTC	0.597																																							uc002vhv.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(190-192)CCT>CTT		natural resistance-associated macrophage protein							107.0	103.0	104.0					2																	219249006		2203	4300	6503	SO:0001583	missense	6556				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity	g.chr2:219249006C>T	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.191C>T	2.37:g.219249006C>T	ENSP00000233202:p.Pro64Leu		Somatic				SLC11A1_uc010zkb.1_Missense_Mutation_p.P64L|SLC11A1_uc010fvp.1_Missense_Mutation_p.P64L|SLC11A1_uc010fvq.1_5'UTR|SLC11A1_uc010zkc.1_5'UTR|SLC11A1_uc002vhu.1_Intron|SLC11A1_uc002vhw.2_5'UTR|SLC11A1_uc010fvr.2_5'Flank	p.P64L	NM_000578	NP_000569	WXS	Illumina HiSeq	Unspecified	P49279	NRAM1_HUMAN		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	3	531	+		Renal(207;0.0474)	64			Helical; (Potential).|Pro/Ser-rich.		C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	c.191C>T	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	C	32	5.147904	0.94603	.	.	ENSG00000018280	ENST00000233202	T	0.63096	-0.02	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	D	0.85353	0.5677	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.89436	0.3720	10	0.87932	D	0	-19.7715	18.6237	0.91330	0.0:1.0:0.0:0.0	.	64;64;64	Q9HBK0;B4DQ73;P49279	.;.;NRAM1_HUMAN	L	64	ENSP00000233202:P64L	ENSP00000233202:P64L	P	+	2	0	SLC11A1	218957250	1.000000	0.71417	0.982000	0.44146	0.952000	0.60782	7.404000	0.79996	2.620000	0.88729	0.561000	0.74099	CCT		0.597	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		74	217	0	0	0	0.00361	0	74	217				
CST4	1472	broad.mit.edu	37	20	23666557	23666557	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr20:23666557C>G	ENST00000217423.3	-	3	470	c.400G>C	c.(400-402)Gtg>Ctg	p.V134L		NM_001899.2	NP_001890.1	P01036	CYTS_HUMAN	cystatin S	134					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	16	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					CTGGAATTCACCAGGGACATT	0.557																																							uc002wto.1		NA																	0				breast(1)	1						c.(400-402)GTG>CTG		cystatin S precursor							104.0	95.0	98.0					20																	23666557		2203	4300	6503	SO:0001583	missense	1472					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23666557C>G		CCDS13159.1	20p11.2	2008-04-15			ENSG00000101441	ENSG00000101441			2476	protein-coding gene	gene with protein product		123857				1801729	Standard	NM_001899		Approved		uc002wto.1	P01036	OTTHUMG00000032083	ENST00000217423.3:c.400G>C	20.37:g.23666557C>G	ENSP00000217423:p.Val134Leu		Somatic					p.V134L	NM_001899	NP_001890	WXS	Illumina HiSeq	Unspecified	P01036	CYTS_HUMAN			3	456	-	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)		134					Q9UBI5|Q9UCS9	Missense_Mutation	SNP	ENST00000217423.3	37	c.400G>C	CCDS13159.1	.	.	.	.	.	.	.	.	.	.	C	0.104	-1.147641	0.01714	.	.	ENSG00000101441	ENST00000217423	T	0.12774	2.65	1.94	-2.05	0.07321	Proteinase inhibitor I25, cystatin (1);	0.943966	0.08716	N	0.904257	T	0.05273	0.0140	N	0.10664	0.02	0.09310	N	1	B	0.13594	0.008	B	0.17722	0.019	T	0.45145	-0.9281	10	0.09084	T	0.74	.	5.6341	0.17526	0.0:0.3096:0.0:0.6904	.	134	P01036	CYTS_HUMAN	L	134	ENSP00000217423:V134L	ENSP00000217423:V134L	V	-	1	0	CST4	23614557	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.146000	0.10250	-0.536000	0.06298	0.205000	0.17691	GTG		0.557	CST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078349.2	NM_001899		23	66	0	0	0	0.00632	0	23	66				
ETS2	2114	broad.mit.edu	37	21	40194699	40194699	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr21:40194699G>T	ENST00000360214.3	+	11	1756	c.1296G>T	c.(1294-1296)aaG>aaT	p.K432N	ETS2_ENST00000360938.3_Missense_Mutation_p.K432N	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	432					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				TCATCCACAAGACGTCGGGGA	0.587																																							uc002yxg.2		NA																	0				ovary(1)|lung(1)|breast(1)|pancreas(1)	4						c.(1294-1296)AAG>AAT		v-ets erythroblastosis virus E26 oncogene							120.0	95.0	104.0					21																	40194699		2203	4300	6503	SO:0001583	missense	2114				positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr21:40194699G>T		CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.1296G>T	21.37:g.40194699G>T	ENSP00000353344:p.Lys432Asn		Somatic				ETS2_uc002yxf.2_Missense_Mutation_p.K572N	p.K432N	NM_005239	NP_005230	WXS	Illumina HiSeq	Unspecified	P15036	ETS2_HUMAN			10	1492	+		Prostate(19;6.33e-08)|all_epithelial(19;0.123)	432			ETS.		A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	ENST00000360214.3	37	c.1296G>T	CCDS13659.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875544	0.91664	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	T;T	0.39229	1.09;1.09	5.47	4.58	0.56647	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.100050	0.64402	D	0.000001	T	0.74741	0.3756	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83386	0.0015	10	0.87932	D	0	.	14.1224	0.65198	0.0735:0.0:0.9265:0.0	.	432	P15036	ETS2_HUMAN	N	432	ENSP00000353344:K432N;ENSP00000354194:K432N	ENSP00000353344:K432N	K	+	3	2	ETS2	39116569	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.645000	0.74343	1.291000	0.44653	0.655000	0.94253	AAG		0.587	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1			28	64	1	0	4.92203e-23	0.00623	1.32035e-22	28	64				
COL18A1	80781	broad.mit.edu	37	21	46917542	46917542	+	Missense_Mutation	SNP	G	G	A	rs539944051	byFrequency	TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr21:46917542G>A	ENST00000359759.4	+	31	3916	c.3895G>A	c.(3895-3897)Gcc>Acc	p.A1299T	COL18A1_ENST00000400337.2_Missense_Mutation_p.A884T|COL18A1_ENST00000459895.1_3'UTR|COL18A1_ENST00000355480.5_Missense_Mutation_p.A1064T			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1299	Triple-helical region 7 (COL7).			A -> P (in Ref. 5; AAA51864). {ECO:0000305}.	angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		ACCCAAGGGCGCCAAAGGAGA	0.652													G|||	2	0.000399361	0.0	0.0	5008	,	,		17261	0.0		0.0	False		,,,				2504	0.002						uc011afs.1		NA																	0				central_nervous_system(1)	1						c.(3895-3897)GCC>ACC		alpha 1 type XVIII collagen isoform 3 precursor							19.0	23.0	22.0					21																	46917542		1972	4126	6098	SO:0001583	missense	80781				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding	g.chr21:46917542G>A		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3895G>A	21.37:g.46917542G>A	ENSP00000352798:p.Ala1299Thr		Somatic				COL18A1_uc002zhg.2_Missense_Mutation_p.A884T|COL18A1_uc002zhi.2_Missense_Mutation_p.A1064T	p.A1299T	NM_130444	NP_569711	WXS	Illumina HiSeq	Unspecified	P39060	COIA1_HUMAN		Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)	31	3916	+			1299	A -> P (in Ref. 5; AAA51864).		Triple-helical region 7 (COL7).		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37	c.3895G>A		.	.	.	.	.	.	.	.	.	.	G	7.925	0.739345	0.15642	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	4.22	3.32	0.38043	.	0.196147	0.41938	N	0.000784	D	0.86104	0.5853	N	0.25485	0.75	0.80722	D	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.75402	-0.3330	10	0.16420	T	0.52	.	9.8606	0.41112	0.1908:0.0:0.8092:0.0	.	1299;1064;884	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	T	884;884;1064;1299;1299;231	ENSP00000383191:A884T;ENSP00000347665:A1064T;ENSP00000352798:A1299T;ENSP00000339118:A231T	ENSP00000339118:A231T	A	+	1	0	COL18A1	45741970	0.000000	0.05858	0.995000	0.50966	0.036000	0.12997	0.391000	0.20784	0.358000	0.24211	-1.119000	0.02030	GCC		0.652	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1			3	6	0	0	0	0.000248	0	3	6				
LZTR1	8216	broad.mit.edu	37	22	21336817	21336817	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr22:21336817C>T	ENST00000215739.8	+	1	516	c.157C>T	c.(157-159)Cgc>Tgc	p.R53C	LZTR1_ENST00000389355.3_Missense_Mutation_p.R53C|LZTR1_ENST00000479606.1_Intron|XXbac-B135H6.18_ENST00000610278.1_lincRNA	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	53					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AACAGTGCATCGCTGGCGGCG	0.662																																							uc002zto.2		NA																	0				ovary(2)|lung(2)	4						c.(157-159)CGC>TGC		leucine-zipper-like transcription regulator 1							30.0	27.0	28.0					22																	21336817		2203	4300	6503	SO:0001583	missense	8216				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity	g.chr22:21336817C>T	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.157C>T	22.37:g.21336817C>T	ENSP00000215739:p.Arg53Cys		Somatic				LZTR1_uc002ztn.2_Intron|LZTR1_uc011ahy.1_Missense_Mutation_p.R53C	p.R53C	NM_006767	NP_006758	WXS	Illumina HiSeq	Unspecified	Q8N653	LZTR1_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		1	260	+	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	53					Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	37	c.157C>T	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	C	36	5.763004	0.96906	.	.	ENSG00000099949	ENST00000215739;ENST00000389355	T;T	0.68624	-0.34;0.3	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.78084	0.4228	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.74023	0.893;0.982	T	0.78828	-0.2050	10	0.87932	D	0	-27.7497	17.0466	0.86505	0.0:1.0:0.0:0.0	.	53;53	B7Z3T9;Q8N653	.;LZTR1_HUMAN	C	53	ENSP00000215739:R53C;ENSP00000374006:R53C	ENSP00000215739:R53C	R	+	1	0	LZTR1	19666817	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.132000	0.64758	2.894000	0.99253	0.655000	0.94253	CGC		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767		14	32	0	0	0	0.003163	0	14	32				
C3orf20	84077	broad.mit.edu	37	3	14755649	14755649	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr3:14755649C>A	ENST00000253697.3	+	8	1748	c.1296C>A	c.(1294-1296)caC>caA	p.H432Q	C3orf20_ENST00000435614.1_Missense_Mutation_p.H310Q|C3orf20_ENST00000412910.1_Missense_Mutation_p.H310Q|C3orf20_ENST00000495387.1_3'UTR	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	432						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GCTGTGTTCACTACAACCTAA	0.517																																							uc003byy.2		NA																	0				ovary(3)|skin(1)	4						c.(1294-1296)CAC>CAA		hypothetical protein LOC84077							81.0	73.0	75.0					3																	14755649		2203	4300	6503	SO:0001583	missense	84077					cytoplasm|integral to membrane		g.chr3:14755649C>A	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1296C>A	3.37:g.14755649C>A	ENSP00000253697:p.His432Gln		Somatic				C3orf20_uc003byz.2_Missense_Mutation_p.H310Q|C3orf20_uc003bza.2_Missense_Mutation_p.H310Q|C3orf20_uc003bzb.1_5'UTR	p.H432Q	NM_032137	NP_115513	WXS	Illumina HiSeq	Unspecified	Q8ND61	CC020_HUMAN			8	1700	+			432					Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	c.1296C>A	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.324737	0.24080	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.12465	2.68;2.68;2.68	5.56	1.29	0.21616	.	0.683457	0.13467	N	0.385718	T	0.16342	0.0393	L	0.54323	1.7	0.27186	N	0.960531	B	0.10296	0.003	B	0.12156	0.007	T	0.26710	-1.0095	10	0.72032	D	0.01	-12.2541	14.929	0.70900	0.0:0.4063:0.5937:0.0	.	432	Q8ND61	CC020_HUMAN	Q	432;310;310	ENSP00000253697:H432Q;ENSP00000402933:H310Q;ENSP00000396081:H310Q	ENSP00000253697:H432Q	H	+	3	2	C3orf20	14730653	0.693000	0.27728	0.998000	0.56505	0.946000	0.59487	0.106000	0.15354	0.669000	0.31146	0.591000	0.81541	CAC		0.517	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		27	53	1	0	3.6726e-16	0.003954	8.86671e-16	27	53				
SLC9C1	285335	broad.mit.edu	37	3	111958724	111958724	+	Missense_Mutation	SNP	A	A	T	rs531199876		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr3:111958724A>T	ENST00000305815.5	-	12	1661	c.1409T>A	c.(1408-1410)aTg>aAg	p.M470K	SLC9C1_ENST00000487372.1_Missense_Mutation_p.M422K	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	470					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TTTCTCAATCATGTTCCAATC	0.338																																							uc003dyu.2		NA																	0				ovary(3)|breast(2)	5						c.(1408-1410)ATG>AAG		sperm-specific sodium proton exchanger							116.0	107.0	110.0					3																	111958724		2202	4300	6502	SO:0001583	missense	285335				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity	g.chr3:111958724A>T	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1409T>A	3.37:g.111958724A>T	ENSP00000306627:p.Met470Lys		Somatic				SLC9A10_uc011bhu.1_5'UTR|SLC9A10_uc010hqc.2_Missense_Mutation_p.M422K	p.M470K	NM_183061	NP_898884	WXS	Illumina HiSeq	Unspecified	Q4G0N8	S9A10_HUMAN			12	1631	-			470					Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	c.1409T>A	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	A	16.50	3.139911	0.56936	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.77229	-1.08;-1.04	5.68	4.53	0.55603	.	0.488999	0.21138	N	0.079528	T	0.59582	0.2204	L	0.27053	0.805	0.32788	N	0.501597	B;P	0.38335	0.12;0.627	B;B	0.28553	0.037;0.091	T	0.66077	-0.6013	10	0.38643	T	0.18	-20.8638	8.4088	0.32632	0.9115:0.0:0.0885:0.0	.	422;470	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	K	470;422	ENSP00000306627:M470K;ENSP00000420688:M422K	ENSP00000306627:M470K	M	-	2	0	SLC9A10	113441414	0.963000	0.33076	0.955000	0.39395	0.972000	0.66771	2.237000	0.43061	0.982000	0.38575	0.418000	0.28097	ATG		0.338	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		13	61	0	0	0	0.001855	0	13	61				
ESYT3	83850	broad.mit.edu	37	3	138191512	138191514	+	Missense_Mutation	TNP	AGA	AGA	GTC	rs200687042		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	AGA	AGA	-	-	AGA	AGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr3:138191512_138191514AGA>GTC	ENST00000389567.4	+	18	2234_2236	c.2048_2050AGA>GTC	c.(2047-2052)aAGAgt>aGTCgt	p.683_684KS>SR		NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	683					lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGGGAGAAGAAGAGTCCAGCCAC	0.596																																							uc003esk.2		NA																	0					0						c.(2047-2052)AAGAGT>AGTCGT		family with sequence similarity 62 (C2 domain																																				SO:0001583	missense	83850					integral to membrane|plasma membrane		g.chr3:138191512_138191514AGA>GTC	AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2048_2050AGA>GTC	3.37:g.138191512AGA>GTC	ENSP00000374218:p.K683_S684delinsSR		Somatic				ESYT3_uc010hug.2_RNA	p.683_684KS>SR	NM_031913	NP_114119	WXS	Illumina HiSeq	Unspecified	A0FGR9	ESYT3_HUMAN			18	2274_2276	+			683_684					A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	TNP	ENST00000389567.4	37	c.2048_2050AGA>GTC	CCDS3101.2																																																																																				0.596	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913		29	114	0	0	0	0.004672	0	29	114				
SI	6476	broad.mit.edu	37	3	164792419	164792419	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr3:164792419C>T	ENST00000264382.3	-	3	217	c.155G>A	c.(154-156)cGt>cAt	p.R52H		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	52	Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGTAGTCACACGAGTAGTAGC	0.338										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(154-156)CGT>CAT		sucrase-isomaltase	Acarbose(DB00284)						85.0	87.0	87.0					3																	164792419		2203	4299	6502	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164792419C>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.155G>A	3.37:g.164792419C>T	ENSP00000264382:p.Arg52His	HNSCC(35;0.089)	Somatic					p.R52H	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			3	217	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	52			Ser/Thr-rich.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.155G>A	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	1.229	-0.624555	0.03636	.	.	ENSG00000090402	ENST00000264382	D	0.89196	-2.48	1.92	-3.83	0.04269	.	3.240880	0.01220	N	0.008071	T	0.79845	0.4516	N	0.22421	0.69	0.09310	N	1	B	0.30824	0.296	B	0.20384	0.029	T	0.69098	-0.5235	10	0.42905	T	0.14	.	7.657	0.28381	0.0:0.6057:0.24:0.1542	.	52	P14410	SUIS_HUMAN	H	52	ENSP00000264382:R52H	ENSP00000264382:R52H	R	-	2	0	SI	166275113	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.412000	0.02476	-2.566000	0.00470	-2.042000	0.00416	CGT		0.338	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		25	109	0	0	0	0.007291	0	25	109				
TP63	8626	broad.mit.edu	37	3	189526252	189526252	+	Silent	SNP	A	A	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr3:189526252A>G	ENST00000264731.3	+	4	605	c.516A>G	c.(514-516)ccA>ccG	p.P172P	TP63_ENST00000449992.1_Intron|TP63_ENST00000392461.3_Silent_p.P78P|TP63_ENST00000440651.2_Silent_p.P172P|TP63_ENST00000392463.2_Silent_p.P78P|TP63_ENST00000456148.1_Silent_p.P78P|TP63_ENST00000392460.3_Silent_p.P172P|TP63_ENST00000382063.4_Intron|TP63_ENST00000320472.5_Silent_p.P172P|TP63_ENST00000354600.5_Silent_p.P78P|TP63_ENST00000418709.2_Silent_p.P172P|TP63_ENST00000437221.1_Silent_p.P78P	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	172					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CCGACTACCCAGGCCCGCACA	0.652										HNSCC(45;0.13)																													uc003fry.2		NA																	0				skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12						c.(514-516)CCA>CCG		tumor protein p63 isoform 1							155.0	118.0	130.0					3																	189526252		2203	4300	6503	SO:0001819	synonymous_variant	8626	Hay-Wells_syndrome			anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:189526252A>G	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.516A>G	3.37:g.189526252A>G		HNSCC(45;0.13)	Somatic				TP63_uc003frx.2_Silent_p.P172P|TP63_uc003frz.2_Silent_p.P172P|TP63_uc010hzc.1_Silent_p.P172P|TP63_uc003fsa.2_Silent_p.P78P|TP63_uc003fsb.2_Silent_p.P78P|TP63_uc003fsc.2_Silent_p.P78P|TP63_uc003fsd.2_Silent_p.P78P|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_Silent_p.P53P	p.P172P	NM_003722	NP_003713	WXS	Illumina HiSeq	Unspecified	Q9H3D4	P63_HUMAN	Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)	4	605	+	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		172					O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Silent	SNP	ENST00000264731.3	37	c.516A>G	CCDS3293.1																																																																																				0.652	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722		31	83	0	0	0	0.008361	0	31	83				
KIAA1109	84162	broad.mit.edu	37	4	123171706	123171706	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr4:123171706G>A	ENST00000264501.4	+	37	6273	c.5900G>A	c.(5899-5901)gGa>gAa	p.G1967E	KIAA1109_ENST00000455637.1_Missense_Mutation_p.G1967E|KIAA1109_ENST00000388738.3_Missense_Mutation_p.G1967E			Q2LD37	K1109_HUMAN	KIAA1109	1967					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GACTTAAATGGAAATTCTGTT	0.338																																							uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(5899-5901)GGA>GAA		fragile site-associated protein							95.0	88.0	90.0					4																	123171706		1856	4080	5936	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123171706G>A	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.5900G>A	4.37:g.123171706G>A	ENSP00000264501:p.Gly1967Glu		Somatic				KIAA1109_uc003iek.2_Missense_Mutation_p.G586E	p.G1967E	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			35	5945	+			1967					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.5900G>A	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.64|10.64	1.406052|1.406052	0.25378|0.25378	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000446180|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.24350	.|2.44;2.44;1.86	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.115063	.|0.34676	.|U	.|0.003768	T|T	0.17662|0.17662	0.0424|0.0424	N|N	0.14661|0.14661	0.345|0.345	0.34954|0.34954	D|D	0.751536|0.751536	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.08055	.|0.003;0.001	T|T	0.11275|0.11275	-1.0594|-1.0594	5|10	.|0.38643	.|T	.|0.18	.|.	15.975|15.975	0.80057|0.80057	0.0:0.1347:0.8653:0.0|0.0:0.1347:0.8653:0.0	.|.	.|1966;1967	.|Q2LD37-2;Q2LD37	.|.;K1109_HUMAN	K|E	540|1967	.|ENSP00000264501:G1967E;ENSP00000373390:G1967E;ENSP00000389925:G1967E	.|ENSP00000264501:G1967E	E|G	+|+	1|2	0|0	KIAA1109|KIAA1109	123391156|123391156	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.701000|5.701000	0.68325|0.68325	2.660000|2.660000	0.90430|0.90430	0.650000|0.650000	0.86243|0.86243	GAA|GGA		0.338	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		39	75	0	0	0	0.00874	0	39	75				
RASGRF2	5924	broad.mit.edu	37	5	80419539	80419539	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr5:80419539G>T	ENST00000265080.4	+	16	2616	c.2549G>T	c.(2548-2550)tGc>tTc	p.C850F		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	850					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CTTTCACCTTGCAGATCCCCC	0.517																																							uc003kha.1		NA																	0				breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(2548-2550)TGC>TTC		Ras protein-specific guanine							106.0	87.0	94.0					5																	80419539		2203	4300	6503	SO:0001583	missense	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80419539G>T	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2549G>T	5.37:g.80419539G>T	ENSP00000265080:p.Cys850Phe		Somatic				RASGRF2_uc011ctn.1_RNA	p.C850F	NM_006909	NP_008840	WXS	Illumina HiSeq	Unspecified	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	16	2549	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	850					B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	c.2549G>T	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636719	0.67130	.	.	ENSG00000113319	ENST00000265080	T	0.74737	-0.87	5.85	5.85	0.93711	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.125823	0.56097	D	0.000039	T	0.68979	0.3060	M	0.62723	1.935	0.80722	D	1	P	0.35383	0.498	B	0.27262	0.078	T	0.67558	-0.5640	10	0.09338	T	0.73	.	19.7469	0.96255	0.0:0.0:1.0:0.0	.	850	O14827	RGRF2_HUMAN	F	850	ENSP00000265080:C850F	ENSP00000265080:C850F	C	+	2	0	RASGRF2	80455295	1.000000	0.71417	0.853000	0.33588	0.929000	0.56500	8.687000	0.91255	2.769000	0.95229	0.491000	0.48974	TGC		0.517	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		29	81	1	0	1.88708e-17	0.008361	4.65573e-17	29	81				
GIN1	54826	broad.mit.edu	37	5	102432325	102432325	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr5:102432325C>T	ENST00000399004.2	-	7	1308	c.1214G>A	c.(1213-1215)aGa>aAa	p.R405K	GIN1_ENST00000508629.1_Intron	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	405					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		AGTGTTGTCTCTCAGGACAGC	0.418																																							uc003koa.1		NA																	0				ovary(1)|skin(1)	2						c.(1213-1215)AGA>AAA		zinc finger, H2C2 domain containing							231.0	216.0	221.0					5																	102432325		1873	4112	5985	SO:0001583	missense	54826				DNA integration		DNA binding	g.chr5:102432325C>T	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1214G>A	5.37:g.102432325C>T	ENSP00000381970:p.Arg405Lys		Somatic				GIN1_uc003kob.1_Missense_Mutation_p.R258K|GIN1_uc003koc.1_Intron	p.R405K	NM_017676	NP_060146	WXS	Illumina HiSeq	Unspecified	Q9NXP7	GIN1_HUMAN		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)	7	1296	-		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)	405					B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	37	c.1214G>A	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653488	0.88056	.	.	ENSG00000145723	ENST00000399004	T	0.16897	2.31	5.77	5.77	0.91146	.	0.000000	0.44902	U	0.000412	T	0.30103	0.0754	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.01298	-1.1392	10	0.22706	T	0.39	-20.1486	18.1786	0.89769	0.0:1.0:0.0:0.0	.	405	Q9NXP7	GIN1_HUMAN	K	405	ENSP00000381970:R405K	ENSP00000381970:R405K	R	-	2	0	GIN1	102460224	1.000000	0.71417	0.992000	0.48379	0.873000	0.50193	4.770000	0.62309	2.729000	0.93468	0.655000	0.94253	AGA		0.418	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676		99	240	0	0	0	0.00361	0	99	240				
SLC27A6	28965	broad.mit.edu	37	5	128362939	128362939	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr5:128362939G>T	ENST00000262462.4	+	7	2379	c.1369G>T	c.(1369-1371)Gat>Tat	p.D457Y	SLC27A6_ENST00000506176.1_Missense_Mutation_p.D457Y|SLC27A6_ENST00000395266.1_Missense_Mutation_p.D457Y			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	457					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		TAAGAAGGGAGATGTTTACCT	0.378																																							uc003kuy.2		NA																	0					0						c.(1369-1371)GAT>TAT		solute carrier family 27 (fatty acid							130.0	122.0	125.0					5																	128362939		2203	4300	6503	SO:0001583	missense	28965				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding	g.chr5:128362939G>T	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1369G>T	5.37:g.128362939G>T	ENSP00000262462:p.Asp457Tyr		Somatic				SLC27A6_uc003kuz.2_Missense_Mutation_p.D457Y	p.D457Y	NM_014031	NP_054750	WXS	Illumina HiSeq	Unspecified	Q9Y2P4	S27A6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)	8	1765	+		all_cancers(142;0.0483)|Prostate(80;0.055)	457					Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	ENST00000262462.4	37	c.1369G>T	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892270	0.72524	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.57595	0.39;0.39;0.39	4.52	4.52	0.55395	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.83723	0.5316	H	0.98577	4.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90096	0.4181	9	.	.	.	4.4627	18.5694	0.91129	0.0:0.0:1.0:0.0	.	457	Q9Y2P4	S27A6_HUMAN	Y	457	ENSP00000262462:D457Y;ENSP00000378684:D457Y;ENSP00000421024:D457Y	.	D	+	1	0	SLC27A6	128390838	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	9.176000	0.94839	2.805000	0.96524	0.460000	0.39030	GAT		0.378	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031		58	117	1	0	9.72345e-25	0.00361	2.65042e-24	58	117				
CTNNA1	1495	broad.mit.edu	37	5	138266210	138266210	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr5:138266210C>G	ENST00000302763.7	+	15	2149	c.2059C>G	c.(2059-2061)Cag>Gag	p.Q687E	CTNNA1_ENST00000540387.1_Missense_Mutation_p.Q317E|CTNNA1_ENST00000518825.1_Missense_Mutation_p.Q687E|CTNNA1_ENST00000355078.5_Missense_Mutation_p.Q584E	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	687					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GATTGCGGAACAGGTGGCCAG	0.483																																							uc003ldh.2		NA																	0				breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11						c.(2059-2061)CAG>GAG		catenin, alpha 1							106.0	103.0	104.0					5																	138266210		2203	4300	6503	SO:0001583	missense	1495				adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding	g.chr5:138266210C>G	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2059C>G	5.37:g.138266210C>G	ENSP00000304669:p.Gln687Glu		Somatic				CTNNA1_uc011cyx.1_Missense_Mutation_p.Q584E|CTNNA1_uc011cyy.1_Missense_Mutation_p.Q564E|CTNNA1_uc003ldi.2_Missense_Mutation_p.Q385E|CTNNA1_uc003ldj.2_Missense_Mutation_p.Q687E|CTNNA1_uc003ldl.2_Missense_Mutation_p.Q317E	p.Q687E	NM_001903	NP_001894	WXS	Illumina HiSeq	Unspecified	P35221	CTNA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		15	2154	+			687					Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	c.2059C>G	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792696	0.90453	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.77	5.77	0.91146	.	0.054184	0.85682	N	0.000000	T	0.48114	0.1482	M	0.62088	1.915	0.80722	D	1	P;B;P	0.38535	0.635;0.222;0.47	B;B;B	0.43623	0.347;0.291;0.425	T	0.28522	-1.0041	10	0.11485	T	0.65	-16.4817	19.9422	0.97170	0.0:1.0:0.0:0.0	.	687;564;687	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	E	584;687;687;672;687;317	ENSP00000347190:Q584E;ENSP00000304669:Q687E;ENSP00000427821:Q687E;ENSP00000438476:Q317E	ENSP00000304669:Q687E	Q	+	1	0	CTNNA1	138294109	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.587000	0.82613	2.884000	0.98904	0.655000	0.94253	CAG		0.483	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903		44	103	0	0	0	0.00874	0	44	103				
PCDHB8	56128	broad.mit.edu	37	5	140559724	140559724	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr5:140559724C>T	ENST00000239444.2	+	1	2354	c.2109C>T	c.(2107-2109)ctC>ctT	p.L703L	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	703					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTCTTCCTCTTCTCGGTGC	0.677																																							uc011dai.1		NA																	0				skin(4)	4						c.(2107-2109)CTC>CTT		protocadherin beta 8 precursor							98.0	97.0	97.0					5																	140559724		2201	4297	6498	SO:0001819	synonymous_variant	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140559724C>T	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.2109C>T	5.37:g.140559724C>T			Somatic				PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	p.L703L	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2295	+			703			Helical; (Potential).		B9EGV1	Silent	SNP	ENST00000239444.2	37	c.2109C>T	CCDS4250.1																																																																																				0.677	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		92	217	0	0	0	0.00361	0	92	217				
PCDHB13	56123	broad.mit.edu	37	5	140595072	140595072	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr5:140595072C>A	ENST00000341948.4	+	1	1564	c.1377C>A	c.(1375-1377)ttC>ttA	p.F459L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	459	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACACCCTGTTCGTCCGCGAGA	0.602																																							uc003lja.1		NA																	0				skin(2)|ovary(1)	3						c.(1375-1377)TTC>TTA		protocadherin beta 13 precursor							123.0	123.0	123.0					5																	140595072		2203	4298	6501	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140595072C>A	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1377C>A	5.37:g.140595072C>A	ENSP00000345491:p.Phe459Leu		Somatic					p.F459L	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1564	+			459			Extracellular (Potential).|Cadherin 5.		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.1377C>A	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	N	15.21	2.765675	0.49574	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.02974	4.09	3.5	-7.0	0.01599	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03263	0.0095	L	0.41079	1.255	0.09310	N	1	B	0.18968	0.032	B	0.33750	0.169	T	0.47947	-0.9077	9	0.62326	D	0.03	.	7.7858	0.29091	0.0:0.3837:0.258:0.3583	.	459	Q9Y5F0	PCDBD_HUMAN	L	459	ENSP00000345491:F459L	ENSP00000345491:F459L	F	+	3	2	PCDHB13	140575256	0.000000	0.05858	0.000000	0.03702	0.406000	0.30931	-3.514000	0.00445	-1.630000	0.01545	0.298000	0.19748	TTC		0.602	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		92	224	1	0	4.64247e-43	0.00361	1.40103e-42	92	224				
ZNRD1-AS1	80862	broad.mit.edu	37	6	29977327	29977327	+	RNA	SNP	T	T	C	rs200662795		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr6:29977327T>C	ENST00000376797.3	-	0	731				ZNRD1-AS1_ENST00000444051.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		GACAGCTGCCTTGTGTGGGAC	0.438																																							uc003rtl.3		NA																	0					0						c.(346-348)TTG>CTG		Homo sapiens major histocompatibility complex, class I, J (pseudogene), mRNA (cDNA clone IMAGE:4694038).																																						3137							g.chr6:29977327T>C	AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29977327T>C			Somatic				HLA-G_uc011dmb.1_3'UTR|NCRNA00171_uc011dme.1_Intron|HLA-J_uc003nou.3_RNA|HLA-J_uc003nov.3_RNA	p.L116L			WXS	Illumina HiSeq	Unspecified					5	708	+									Silent	SNP	ENST00000376797.3	37	c.346T>C																																																																																					0.438	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	antisense	OTTHUMT00000253083.1	NR_026751		3	105	0	0	0	0.004672	0	3	105				
EYS	346007	broad.mit.edu	37	6	66115164	66115164	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr6:66115164C>G	ENST00000370621.3	-	6	1485	c.959G>C	c.(958-960)tGc>tCc	p.C320S	EYS_ENST00000503581.1_Missense_Mutation_p.C320S|EYS_ENST00000342421.5_Missense_Mutation_p.C320S|EYS_ENST00000370616.2_Missense_Mutation_p.C320S|EYS_ENST00000370618.3_Missense_Mutation_p.C320S|EYS_ENST00000393380.2_Missense_Mutation_p.C320S			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	320					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCCTTTTGGGCATTCATAAGT	0.383																																							uc011dxu.1		NA																	0				lung(4)|ovary(1)|skin(1)	6						c.(958-960)TGC>TCC		eyes shut homolog isoform 1							157.0	161.0	160.0					6																	66115164		2203	4300	6503	SO:0001583	missense	346007				response to stimulus|visual perception	extracellular region	calcium ion binding	g.chr6:66115164C>G		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.959G>C	6.37:g.66115164C>G	ENSP00000359655:p.Cys320Ser		Somatic				EYS_uc003peq.2_Missense_Mutation_p.C320S|EYS_uc003per.1_Missense_Mutation_p.C320S	p.C320S	NM_001142800	NP_001136272	WXS	Illumina HiSeq	Unspecified	Q5T1H1	EYS_HUMAN			6	1497	-			320					A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37	c.959G>C		.	.	.	.	.	.	.	.	.	.	C	9.346	1.064225	0.20067	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.97303	-1.88;-1.86;-1.86;-4.33;-4.16;-4.16	4.89	0.477	0.16784	.	.	.	.	.	D	0.93812	0.8021	M	0.91561	3.22	0.09310	N	1	B;B;B	0.20671	0.047;0.021;0.035	B;B;B	0.21917	0.037;0.037;0.028	D	0.89657	0.3874	9	0.87932	D	0	.	4.0562	0.09818	0.3534:0.4536:0.0:0.1929	.	320;320;320	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	S	320	ENSP00000424243:C320S;ENSP00000359655:C320S;ENSP00000359650:C320S;ENSP00000377042:C320S;ENSP00000341818:C320S;ENSP00000359652:C320S	ENSP00000341818:C320S	C	-	2	0	EYS	66171885	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.328000	0.19681	0.050000	0.15949	-0.373000	0.07131	TGC		0.383	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050		58	144	0	0	0	0.00361	0	58	144				
HIVEP2	3097	broad.mit.edu	37	6	143094060	143094060	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr6:143094060C>A	ENST00000367604.1	-	4	2455	c.1816G>T	c.(1816-1818)Gtg>Ttg	p.V606L	HIVEP2_ENST00000367603.2_Missense_Mutation_p.V606L|HIVEP2_ENST00000012134.2_Missense_Mutation_p.V606L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	606					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TCGACTTCCACGTGGCCCTCC	0.532																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	Esophageal Squamous(107;843 1510 13293 16805 42198)	uc003qjd.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1816-1818)GTG>TTG		human immunodeficiency virus type I enhancer							100.0	99.0	99.0					6																	143094060		2054	4209	6263	SO:0001583	missense	3097				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:143094060C>A	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.1816G>T	6.37:g.143094060C>A	ENSP00000356576:p.Val606Leu		Somatic					p.V606L	NM_006734	NP_006725	WXS	Illumina HiSeq	Unspecified	P31629	ZEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)	5	2559	-			606					Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	c.1816G>T	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	C	0.388	-0.925017	0.02377	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.10763	2.84;2.84;2.84	5.48	-4.81	0.03180	.	1.148490	0.06132	N	0.670820	T	0.01353	0.0044	N	0.21282	0.65	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46871	-0.9160	10	0.16896	T	0.51	-5.7774	2.1678	0.03842	0.256:0.1926:0.0836:0.4678	.	606	P31629	ZEP2_HUMAN	L	606	ENSP00000356576:V606L;ENSP00000356575:V606L;ENSP00000012134:V606L	ENSP00000012134:V606L	V	-	1	0	HIVEP2	143135753	0.000000	0.05858	0.738000	0.30950	0.083000	0.17756	0.014000	0.13333	-0.801000	0.04427	0.655000	0.94253	GTG		0.532	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			53	74	1	0	9.16383e-17	0.00361	2.24448e-16	53	74				
MAP3K4	4216	broad.mit.edu	37	6	161508846	161508846	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr6:161508846G>T	ENST00000392142.4	+	10	2831	c.2683G>T	c.(2683-2685)Gta>Tta	p.V895L	MAP3K4_ENST00000348824.7_Missense_Mutation_p.V895L|MAP3K4_ENST00000366920.2_Missense_Mutation_p.V895L|MAP3K4_ENST00000366919.2_Missense_Mutation_p.V895L	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	895					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TTCAGATGACGTACTCATCGA	0.493																																							uc003qtn.2		NA																	0				ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(2683-2685)GTA>TTA		mitogen-activated protein kinase kinase kinase 4							162.0	139.0	147.0					6																	161508846		2203	4300	6503	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161508846G>T	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2683G>T	6.37:g.161508846G>T	ENSP00000375986:p.Val895Leu		Somatic				MAP3K4_uc010kkc.1_Missense_Mutation_p.V895L|MAP3K4_uc003qto.2_Missense_Mutation_p.V895L|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.V348L	p.V895L	NM_005922	NP_005913	WXS	Illumina HiSeq	Unspecified	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	10	2825	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	895					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.2683G>T	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	5.775	0.327430	0.10956	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	5.73	-2.04	0.07343	.	0.902049	0.09568	N	0.784505	T	0.26774	0.0655	L	0.40543	1.245	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.14172	-1.0482	10	0.08837	T	0.75	-2.5235	3.6623	0.08244	0.2154:0.3859:0.3:0.0987	.	895;895;895	F5H538;Q9Y6R4-2;Q9Y6R4	.;.;M3K4_HUMAN	L	895	ENSP00000355886:V895L;ENSP00000375986:V895L;ENSP00000355887:V895L;ENSP00000297332:V895L	ENSP00000297332:V895L	V	+	1	0	MAP3K4	161428836	0.001000	0.12720	0.001000	0.08648	0.022000	0.10575	0.428000	0.21395	-0.662000	0.05338	0.655000	0.94253	GTA		0.493	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			47	54	1	0	1.61004e-24	0.00361	4.35354e-24	47	54				
THBS2	7058	broad.mit.edu	37	6	169634978	169634978	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr6:169634978G>C	ENST00000366787.3	-	11	1751	c.1502C>G	c.(1501-1503)tCc>tGc	p.S501C	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	501	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CGACCACGGGGACCAGGGGCT	0.677																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	0				ovary(5)	5						c.(1501-1503)TCC>TGC		thrombospondin 2 precursor							32.0	35.0	34.0					6																	169634978		2203	4300	6503	SO:0001583	missense	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169634978G>C		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1502C>G	6.37:g.169634978G>C	ENSP00000355751:p.Ser501Cys		Somatic					p.S501C	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	11	1750	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	501			TSP type-1 3.		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	c.1502C>G	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625942	0.87560	.	.	ENSG00000186340	ENST00000366787	T	0.24350	1.86	4.38	4.38	0.52667	.	0.000000	0.40818	U	0.001007	T	0.45418	0.1341	H	0.94423	3.535	0.53688	D	0.999971	D	0.59357	0.985	P	0.51016	0.656	T	0.66555	-0.5894	10	0.87932	D	0	-53.2451	17.2925	0.87160	0.0:0.0:1.0:0.0	.	501	P35442	TSP2_HUMAN	C	501	ENSP00000355751:S501C	ENSP00000355751:S501C	S	-	2	0	THBS2	169376903	1.000000	0.71417	0.999000	0.59377	0.803000	0.45373	9.211000	0.95120	2.150000	0.67090	0.590000	0.80494	TCC		0.677	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		3	75	0	0	0	0.004672	0	3	75				
ABCB5	340273	broad.mit.edu	37	7	20778674	20778674	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr7:20778674C>G	ENST00000404938.2	+	24	3588	c.2936C>G	c.(2935-2937)tCc>tGc	p.S979C	ABCB5_ENST00000258738.6_Missense_Mutation_p.S534C	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	979	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CCTGAATATTCCAAAGCCAAA	0.428																																							uc003suw.3		NA																	0				skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(1600-1602)TCC>TGC		ATP-binding cassette, sub-family B, member 5							59.0	57.0	58.0					7																	20778674		2203	4300	6503	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20778674C>G	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2936C>G	7.37:g.20778674C>G	ENSP00000384881:p.Ser979Cys		Somatic				ABCB5_uc010kuh.2_Missense_Mutation_p.S979C	p.S534C	NM_178559	NP_848654	WXS	Illumina HiSeq	Unspecified	Q2M3G0	ABCB5_HUMAN			15	2147	+			534			Cytoplasmic (Potential).|ABC transmembrane type-1.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.1601C>G	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714097	0.89112	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.72282	-0.64;-0.64	4.99	4.99	0.66335	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.64402	D	0.000016	T	0.77260	0.4104	L	0.43152	1.355	0.47547	D	0.999458	D;D	0.76494	0.999;0.975	P;P	0.61800	0.894;0.848	T	0.79200	-0.1901	10	0.87932	D	0	.	16.1633	0.81734	0.0:1.0:0.0:0.0	.	979;534	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	C	979;534	ENSP00000384881:S979C;ENSP00000258738:S534C	ENSP00000258738:S534C	S	+	2	0	ABCB5	20745199	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.709000	0.54853	2.774000	0.95407	0.484000	0.47621	TCC		0.428	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		16	35	0	0	0	0.004007	0	16	35				
IGF2BP3	10643	broad.mit.edu	37	7	23358808	23358808	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr7:23358808C>G	ENST00000258729.3	-	11	1625	c.1269G>C	c.(1267-1269)aaG>aaC	p.K423N		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	423	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						GCTGGCCCTGCTTGCCGATGA	0.458																																							uc003swg.2		NA																	0				ovary(2)	2						c.(1267-1269)AAG>AAC		insulin-like growth factor 2 mRNA binding							121.0	110.0	114.0					7																	23358808		2203	4300	6503	SO:0001583	missense	10643				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr7:23358808C>G	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1269G>C	7.37:g.23358808C>G	ENSP00000258729:p.Lys423Asn		Somatic				IGF2BP3_uc003swf.2_Missense_Mutation_p.K42N	p.K423N	NM_006547	NP_006538	WXS	Illumina HiSeq	Unspecified	O00425	IF2B3_HUMAN			11	1535	-			423			KH 3.		A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	37	c.1269G>C	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.879059	0.72294	.	.	ENSG00000136231	ENST00000258729	T	0.44881	0.91	5.87	4.08	0.47627	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.68109	0.2965	M	0.91406	3.205	0.58432	D	0.999994	D	0.63880	0.993	D	0.64595	0.927	T	0.74028	-0.3796	10	0.59425	D	0.04	-11.7257	12.5433	0.56184	0.0:0.8655:0.0:0.1345	.	423	O00425	IF2B3_HUMAN	N	423	ENSP00000258729:K423N	ENSP00000258729:K423N	K	-	3	2	IGF2BP3	23325333	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.584000	0.46102	0.829000	0.34733	-0.140000	0.14226	AAG		0.458	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547		43	117	0	0	0	0.007835	0	43	117				
HECW1	23072	broad.mit.edu	37	7	43360233	43360233	+	Splice_Site	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr7:43360233G>A	ENST00000395891.2	+	5	957		c.e5-1		HECW1_ENST00000453890.1_Splice_Site	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TGGGAATATAGATGAGGTCTT	0.428																																							uc003tid.1		NA																	0				ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.e5-1		NEDD4-like ubiquitin-protein ligase 1							95.0	90.0	92.0					7																	43360233		1862	4104	5966	SO:0001630	splice_region_variant	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43360233G>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.353-1G>A	7.37:g.43360233G>A			Somatic				HECW1_uc011kbi.1_Splice_Site_p.D118_splice|HECW1_uc003tie.1_Splice_Site_p.D150_splice	p.D118_splice	NM_015052	NP_055867	WXS	Illumina HiSeq	Unspecified	Q76N89	HECW1_HUMAN			5	958	+								A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Splice_Site	SNP	ENST00000395891.2	37	c.353_splice	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	31	5.076697	0.94000	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3736	0.98901	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HECW1	43326758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.696000	0.98695	2.820000	0.97059	0.650000	0.86243	.		0.428	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	Intron	24	59	0	0	0	0.00333	0	24	59				
ANKIB1	54467	broad.mit.edu	37	7	91980320	91980320	+	Missense_Mutation	SNP	A	A	T	rs369834494		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr7:91980320A>T	ENST00000265742.3	+	8	1518	c.1142A>T	c.(1141-1143)tAt>tTt	p.Y381F		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	381							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGCCCTGCATATGATTGCTTC	0.348																																							uc003ulw.2		NA																	0				lung(1)	1						c.(1141-1143)TAT>TTT		ankyrin repeat and IBR domain containing 1		A	PHE/TYR	1,3707		0,1,1853	119.0	112.0	114.0		1142	5.6	1.0	7		114	0,8202		0,0,4101	no	missense	ANKIB1	NM_019004.1	22	0,1,5954	TT,TA,AA		0.0,0.027,0.0084	benign	381/1090	91980320	1,11909	1854	4101	5955	SO:0001583	missense	54467						protein binding|zinc ion binding	g.chr7:91980320A>T	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1142A>T	7.37:g.91980320A>T	ENSP00000265742:p.Tyr381Phe		Somatic					p.Y381F	NM_019004	NP_061877	WXS	Illumina HiSeq	Unspecified	Q9P2G1	AKIB1_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		8	1518	+	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		381			RING-type 1; atypical.		Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	c.1142A>T	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	A	13.11	2.140626	0.37825	2.7E-4	0.0	ENSG00000001629	ENST00000265742	T	0.09911	2.93	5.59	5.59	0.84812	Zinc finger, RING-type (1);	0.134612	0.52532	D	0.000076	T	0.08313	0.0207	N	0.17345	0.48	0.42493	D	0.992902	B	0.02656	0.0	B	0.04013	0.001	T	0.30357	-0.9981	10	0.25751	T	0.34	.	16.0698	0.80914	1.0:0.0:0.0:0.0	.	381	Q9P2G1	AKIB1_HUMAN	F	381	ENSP00000265742:Y381F	ENSP00000265742:Y381F	Y	+	2	0	ANKIB1	91818256	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.211000	0.58507	2.245000	0.73994	0.455000	0.32223	TAT		0.348	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1			13	35	0	0	0	0.001855	0	13	35				
RELN	5649	broad.mit.edu	37	7	103202009	103202009	+	Silent	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr7:103202009G>T	ENST00000428762.1	-	36	5658	c.5499C>A	c.(5497-5499)atC>atA	p.I1833I	RELN_ENST00000424685.2_Silent_p.I1833I|RELN_ENST00000343529.5_Silent_p.I1833I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1833					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTCCAGATTTGATGGTTTCAC	0.408																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(5497-5499)ATC>ATA		reelin isoform a							116.0	118.0	117.0					7																	103202009		2203	4300	6503	SO:0001819	synonymous_variant	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103202009G>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5499C>A	7.37:g.103202009G>T			Somatic				RELN_uc010liz.2_Silent_p.I1833I	p.I1833I	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	36	5659	-			1833					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	c.5499C>A	CCDS47680.1																																																																																				0.408	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		35	96	1	0	1.60099e-16	0.004878	3.89304e-16	35	96				
SH2D4A	63898	broad.mit.edu	37	8	19221702	19221702	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr8:19221702C>A	ENST00000265807.3	+	7	1237	c.826C>A	c.(826-828)Ccc>Acc	p.P276T	SH2D4A_ENST00000519207.1_Missense_Mutation_p.P276T|SH2D4A_ENST00000518040.1_Missense_Mutation_p.P231T	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	276					negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		GCTGCAAAGCCCCTTGCGTGT	0.527																																							uc003wzb.2		NA																	0					0						c.(826-828)CCC>ACC		SH2 domain containing 4A							82.0	82.0	82.0					8																	19221702		2203	4300	6503	SO:0001583	missense	63898					cytoplasm|nucleus	protein binding	g.chr8:19221702C>A	AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.826C>A	8.37:g.19221702C>A	ENSP00000265807:p.Pro276Thr		Somatic				SH2D4A_uc011kym.1_Missense_Mutation_p.P231T|SH2D4A_uc003wzc.2_Missense_Mutation_p.P276T	p.P276T	NM_022071	NP_071354	WXS	Illumina HiSeq	Unspecified	Q9H788	SH24A_HUMAN		Colorectal(111;0.0732)	7	1162	+			276					B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	ENST00000265807.3	37	c.826C>A	CCDS6009.1	.	.	.	.	.	.	.	.	.	.	C	7.269	0.606845	0.14002	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207	T;T;T	0.13089	2.62;2.62;2.62	5.17	3.08	0.35506	.	0.561776	0.18358	N	0.143672	T	0.09291	0.0229	L	0.46157	1.445	0.09310	N	1	B;B	0.31680	0.335;0.049	B;B	0.25140	0.058;0.026	T	0.23261	-1.0193	10	0.22109	T	0.4	.	4.1262	0.10128	0.0:0.6049:0.2457:0.1494	.	231;276	B4DDR1;Q9H788	.;SH24A_HUMAN	T	276;231;276	ENSP00000265807:P276T;ENSP00000429482:P231T;ENSP00000428684:P276T	ENSP00000265807:P276T	P	+	1	0	SH2D4A	19265982	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	-0.385000	0.07379	1.158000	0.42547	0.563000	0.77884	CCC		0.527	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214094.1	NM_022071		30	90	1	0	9.04072e-19	0.003271	2.29757e-18	30	90				
NRG1	3084	broad.mit.edu	37	8	32611924	32611924	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr8:32611924C>T	ENST00000405005.3	+	8	735	c.735C>T	c.(733-735)acC>acT	p.T245T	NRG1_ENST00000519301.1_Silent_p.T195T|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000356819.4_Silent_p.T250T|NRG1_ENST00000287842.3_Silent_p.T242T|NRG1_ENST00000523079.1_Silent_p.T242T|NRG1_ENST00000521670.1_Silent_p.T245T|NRG1_ENST00000338921.4_Silent_p.T253T|NRG1_ENST00000539990.1_Silent_p.T88T|NRG1_ENST00000287845.5_Silent_p.T216T			Q02297	NRG1_HUMAN	neuregulin 1	245					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GAGTGCTGACCATAACCGGCA	0.522																																							uc003xiv.2		NA																	0					0						c.(733-735)ACC>ACT		neuregulin 1 isoform HRG-alpha							234.0	155.0	182.0					8																	32611924		2203	4300	6503	SO:0001819	synonymous_variant	3084				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr8:32611924C>T	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.735C>T	8.37:g.32611924C>T			Somatic				NRG1_uc011lbf.1_Silent_p.T242T|NRG1_uc010lvo.2_Silent_p.T242T|NRG1_uc003xiu.2_Silent_p.T250T|NRG1_uc003xiw.2_Silent_p.T242T|NRG1_uc003xit.2_Silent_p.T245T|NRG1_uc010lvr.2_5'UTR|NRG1_uc010lvs.2_5'UTR|NRG1_uc010lvp.2_Silent_p.T199T|NRG1_uc010lvq.2_Silent_p.T182T|NRG1_uc011lbg.1_Silent_p.T91T|NRG1_uc011lbh.1_Silent_p.T88T|NRG1_uc003xiz.1_RNA|NRG1_uc003xja.2_Silent_p.T56T	p.T245T	NM_013964	NP_039258	WXS	Illumina HiSeq	Unspecified	Q02297	NRG1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)	8	1252	+		Breast(100;0.203)	245			Helical; Note=Internal signal sequence; (Potential).		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	ENST00000405005.3	37	c.735C>T	CCDS6085.1																																																																																				0.522	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			28	83	0	0	0	0.00632	0	28	83				
FAM110B	90362	broad.mit.edu	37	8	59059008	59059008	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr8:59059008G>C	ENST00000361488.3	+	5	1099	c.219G>C	c.(217-219)gaG>gaC	p.E73D	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	73						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				CCAAGCAGGAGCCCGTGAAGC	0.677																																							uc003xtj.1		NA																	0				large_intestine(1)	1						c.(217-219)GAG>GAC		hypothetical protein LOC90362							34.0	41.0	39.0					8																	59059008		2202	4300	6502	SO:0001583	missense	90362					microtubule organizing center|mitochondrion|nucleus		g.chr8:59059008G>C	U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.219G>C	8.37:g.59059008G>C	ENSP00000355204:p.Glu73Asp		Somatic					p.E73D	NM_147189	NP_671722	WXS	Illumina HiSeq	Unspecified	Q8TC76	F110B_HUMAN			5	1099	+		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)	73					Q5BM08|Q9Y4K2	Missense_Mutation	SNP	ENST00000361488.3	37	c.219G>C	CCDS6170.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230111	0.58777	.	.	ENSG00000169122	ENST00000361488	T	0.52983	0.64	5.23	3.4	0.38934	.	0.000000	0.85682	D	0.000000	T	0.61135	0.2323	M	0.73217	2.22	0.53688	D	0.999974	D	0.89917	1.0	D	0.83275	0.996	T	0.60566	-0.7238	9	.	.	.	-27.7231	5.5203	0.16929	0.2114:0.0:0.6462:0.1424	.	73	Q8TC76	F110B_HUMAN	D	73	ENSP00000355204:E73D	.	E	+	3	2	FAM110B	59221562	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.120000	0.50430	1.175000	0.42826	0.462000	0.41574	GAG		0.677	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189		30	61	0	0	0	0.002836	0	30	61				
ZFHX4	79776	broad.mit.edu	37	8	77767692	77767693	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr8:77767692_77767693GG>TT	ENST00000521891.2	+	10	8983_8984	c.8535_8536GG>TT	c.(8533-8538)ctGGat>ctTTat	p.D2846Y	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D2801Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D2801Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D2820Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2801					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAAAAACTCTGGATACTCTGCC	0.49										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(8398-8403)CTGGAT>CTTTAT		zinc finger homeodomain 4																																				SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77767692_77767693GG>TT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	Exception_encountered	8.37:g.77767692_77767693delinsTT	ENSP00000430497:p.Asp2846Tyr	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.D2846Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.D2801Y	p.D2801Y	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	8787_8788	+			2801					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	DNP	ENST00000521891.2	37	c.8400_8401GG>TT	CCDS47878.2																																																																																				0.490	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		35	66	0	0	0	0.004672	0	35	66				
FAM135B	51059	broad.mit.edu	37	8	139164870	139164870	+	Silent	SNP	A	A	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr8:139164870A>G	ENST00000395297.1	-	13	2018	c.1848T>C	c.(1846-1848)agT>agC	p.S616S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	616										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTCCTAGAGTACTTAATTCAT	0.463										HNSCC(54;0.14)																													uc003yuy.2		NA																	0				ovary(7)|skin(2)	9						c.(1846-1848)AGT>AGC		hypothetical protein LOC51059							140.0	136.0	137.0					8																	139164870		1889	4124	6013	SO:0001819	synonymous_variant	51059							g.chr8:139164870A>G	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1848T>C	8.37:g.139164870A>G		HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Silent_p.S517S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.S178S|FAM135B_uc003yvb.2_Silent_p.S178S	p.S616S	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	2019	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		616					B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	c.1848T>C	CCDS6375.2																																																																																				0.463	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		59	154	0	0	0	0.00361	0	59	154				
MFSD3	113655	broad.mit.edu	37	8	145735371	145735371	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr8:145735371G>C	ENST00000301327.4	+	1	915	c.655G>C	c.(655-657)Gca>Cca	p.A219P	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'Flank	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	219	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CGTGTGGACGGCAGGCTTTGT	0.687											OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003zdi.1		NA																	0				central_nervous_system(2)	2						c.(655-657)GCA>CCA		major facilitator superfamily domain containing							23.0	20.0	21.0					8																	145735371		2146	4165	6311	SO:0001583	missense	113655				transmembrane transport	integral to membrane		g.chr8:145735371G>C		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.655G>C	8.37:g.145735371G>C	ENSP00000301327:p.Ala219Pro		Somatic	OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1696		p.A219P	NM_138431	NP_612440	WXS	Illumina HiSeq	Unspecified	Q96ES6	MFSD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		1	820	+	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		219			Leu-rich.|Helical; (Potential).			Missense_Mutation	SNP	ENST00000301327.4	37	c.655G>C	CCDS6431.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135425	0.56828	.	.	ENSG00000167700	ENST00000301327	T	0.60171	0.21	5.54	4.66	0.58398	Major facilitator superfamily domain, general substrate transporter (1);	0.183319	0.47455	D	0.000226	T	0.59046	0.2165	L	0.46157	1.445	0.27407	N	0.954689	D	0.52996	0.957	P	0.50405	0.64	T	0.57619	-0.7780	10	0.66056	D	0.02	-29.7872	12.1478	0.54034	0.0837:0.0:0.9163:0.0	.	219	Q96ES6	MFSD3_HUMAN	P	219	ENSP00000301327:A219P	ENSP00000301327:A219P	A	+	1	0	MFSD3	145706179	0.510000	0.26171	0.024000	0.17045	0.241000	0.25554	3.479000	0.53165	1.341000	0.45600	0.561000	0.74099	GCA		0.687	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431		8	19	0	0	0	0.006214	0	8	19				
KDM4C	23081	broad.mit.edu	37	9	6986603	6986603	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr9:6986603C>T	ENST00000381309.3	+	11	2179	c.1614C>T	c.(1612-1614)ggC>ggT	p.G538G	KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000536108.1_Silent_p.G357G|KDM4C_ENST00000428870.2_Silent_p.G225G|KDM4C_ENST00000535193.1_Silent_p.G560G|KDM4C_ENST00000381306.3_Silent_p.G538G|KDM4C_ENST00000543771.1_Silent_p.G538G	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	538					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATGGGAATGGCCTTGAACCTG	0.468																																							uc003zkh.2		NA																	0				ovary(1)	1						c.(1612-1614)GGC>GGT		jumonji domain containing 2C isoform 1							87.0	79.0	82.0					9																	6986603		2203	4300	6503	SO:0001819	synonymous_variant	23081				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:6986603C>T	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1614C>T	9.37:g.6986603C>T			Somatic				KDM4C_uc010mhu.2_Silent_p.G560G|KDM4C_uc011lmi.1_Silent_p.G538G|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Silent_p.G538G|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Silent_p.G225G	p.G538G	NM_015061	NP_055876	WXS	Illumina HiSeq	Unspecified	Q9H3R0	KDM4C_HUMAN			11	2194	+			538					B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	ENST00000381309.3	37	c.1614C>T	CCDS6471.1																																																																																				0.468	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061		27	49	0	0	0	0.005443	0	27	49				
POMT1	10585	broad.mit.edu	37	9	134385140	134385140	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr9:134385140C>T	ENST00000372228.3	+	7	729	c.550C>T	c.(550-552)Ctg>Ttg	p.L184L	POMT1_ENST00000423007.1_Silent_p.L184L|POMT1_ENST00000354713.4_Silent_p.L154L|POMT1_ENST00000402686.3_Silent_p.L184L|POMT1_ENST00000541219.1_Intron|POMT1_ENST00000419118.2_Silent_p.L32L|POMT1_ENST00000341012.7_Silent_p.L130L|POMT1_ENST00000404875.2_Silent_p.L67L	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	184					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		CCCTTTTTCTCTGAGCTGGTG	0.483																																							uc004cav.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(550-552)CTG>TTG		protein-O-mannosyltransferase 1 isoform a							179.0	164.0	169.0					9																	134385140		2203	4300	6503	SO:0001819	synonymous_variant	10585				multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding	g.chr9:134385140C>T	AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.550C>T	9.37:g.134385140C>T			Somatic				POMT1_uc011mci.1_Silent_p.L146L|POMT1_uc004cax.2_Silent_p.L184L|POMT1_uc011mcj.1_Intron|POMT1_uc004cau.2_Silent_p.L184L|POMT1_uc004caw.2_Silent_p.L130L|POMT1_uc011mck.1_Silent_p.L67L|POMT1_uc011mcl.1_Silent_p.L32L|POMT1_uc011mcm.1_Silent_p.L154L|POMT1_uc011mcn.1_5'Flank	p.L184L	NM_007171	NP_009102	WXS	Illumina HiSeq	Unspecified	Q9Y6A1	POMT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)	7	752	+		Myeloproliferative disorder(178;0.204)	184			Helical; (Potential).		B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Silent	SNP	ENST00000372228.3	37	c.550C>T	CCDS6943.1																																																																																				0.483	POMT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054737.1	NM_007171		61	148	0	0	0	0.00361	0	61	148				
MXRA5	25878	broad.mit.edu	37	X	3240968	3240968	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:3240968G>C	ENST00000217939.6	-	5	2912	c.2758C>G	c.(2758-2760)Cca>Gca	p.P920A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	920						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTAGGAGATGGTTCATAAGGC	0.493																																							uc004crg.3		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(2758-2760)CCA>GCA		adlican precursor							109.0	86.0	94.0					X																	3240968		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3240968G>C	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2758C>G	X.37:g.3240968G>C	ENSP00000217939:p.Pro920Ala		Somatic					p.P920A	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			5	2915	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	920					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.2758C>G	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	g	0.693	-0.793734	0.02862	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.61859	0.07	3.33	-1.08	0.09936	.	0.676115	0.12175	U	0.492604	T	0.26882	0.0658	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11421	-1.0588	10	0.23891	T	0.37	.	0.8967	0.01265	0.3552:0.3365:0.137:0.1714	.	920	Q9NR99	MXRA5_HUMAN	A	920	ENSP00000217939:P920A	ENSP00000217939:P920A	P	-	1	0	MXRA5	3250968	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.246000	0.08878	-0.103000	0.12175	-1.242000	0.01536	CCA		0.493	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		61	135	0	0	0	0.00361	0	61	135				
DCAF8L2	347442	broad.mit.edu	37	X	27766230	27766230	+	Silent	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:27766230C>G	ENST00000451261.2	+	5	1617	c.1218C>G	c.(1216-1218)ggC>ggG	p.G406G		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	406										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						AAAACAATGGCGTGCTCAAGA	0.438																																							uc011mjy.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1216-1218)GGC>GGG		DDB1 and CUL4 associated factor 8-like 2							203.0	141.0	160.0					X																	27766230		692	1591	2283	SO:0001819	synonymous_variant	347442							g.chrX:27766230C>G		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1218C>G	X.37:g.27766230C>G			Somatic					p.G406G	NM_001136533	NP_001130005	WXS	Illumina HiSeq	Unspecified					1	1305	+								B2RXH9|J3KT06	Silent	SNP	ENST00000451261.2	37	c.1218C>G	CCDS59162.1																																																																																				0.438	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354		31	66	0	0	0	0.008361	0	31	66				
FAM47B	170062	broad.mit.edu	37	X	34961951	34961951	+	Missense_Mutation	SNP	C	C	A	rs371133015		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:34961951C>A	ENST00000329357.5	+	1	1039	c.1003C>A	c.(1003-1005)Cct>Act	p.P335T		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	335										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						CTGCCTGGAACCTCCCAACAC	0.592																																							uc004ddi.1		NA																	0				ovary(3)|breast(1)	4						c.(1003-1005)CCT>ACT		hypothetical protein LOC170062							56.0	54.0	54.0					X																	34961951		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34961951C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1003C>A	X.37:g.34961951C>A	ENSP00000328307:p.Pro335Thr		Somatic					p.P335T	NM_152631	NP_689844	WXS	Illumina HiSeq	Unspecified	Q8NA70	FA47B_HUMAN			1	1021	+			335					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.1003C>A	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	0.405	-0.916264	0.02415	.	.	ENSG00000189132	ENST00000329357	T	0.22539	1.95	0.235	0.235	0.15431	.	.	.	.	.	T	0.16514	0.0397	L	0.51914	1.62	0.09310	N	1	P	0.41313	0.745	B	0.40659	0.336	T	0.19160	-1.0314	8	0.10902	T	0.67	.	.	.	.	.	335	Q8NA70	FA47B_HUMAN	T	335	ENSP00000328307:P335T	ENSP00000328307:P335T	P	+	1	0	FAM47B	34871872	0.253000	0.23982	0.051000	0.19133	0.051000	0.14879	1.000000	0.29770	0.288000	0.22398	0.292000	0.19580	CCT		0.592	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		39	89	1	0	6.5261e-18	0.00874	1.62193e-17	39	89				
PRICKLE3	4007	broad.mit.edu	37	X	49035674	49035674	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:49035674G>A	ENST00000376317.3	-	5	584	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W	PRICKLE3_ENST00000536904.1_Missense_Mutation_p.R83W|PRICKLE3_ENST00000538114.1_Missense_Mutation_p.R151W|PRICKLE3_ENST00000540849.1_Missense_Mutation_p.R96W	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	164	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.						zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						TCCCGCTTCCGCTGCTGGCTA	0.612																																							uc004dmy.1		NA																	0				breast(1)	1						c.(490-492)CGG>TGG		LIM domain only 6							89.0	69.0	76.0					X																	49035674		2203	4300	6503	SO:0001583	missense	4007						protein binding|zinc ion binding	g.chrX:49035674G>A	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.490C>T	X.37:g.49035674G>A	ENSP00000365494:p.Arg164Trp		Somatic				PRICKLE3_uc011mmv.1_Missense_Mutation_p.R96W|PRICKLE3_uc011mmw.1_Missense_Mutation_p.R83W|PRICKLE3_uc011mmx.1_Missense_Mutation_p.R126W|PRICKLE3_uc011mmy.1_Missense_Mutation_p.R151W	p.R164W	NM_006150	NP_006141	WXS	Illumina HiSeq	Unspecified	O43900	PRIC3_HUMAN			5	516	-			164			PET.		B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	ENST00000376317.3	37	c.490C>T	CCDS14320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.39|17.39	3.377593|3.377593	0.61735|0.61735	.|.	.|.	ENSG00000012211|ENSG00000012211	ENST00000453382;ENST00000432913|ENST00000376317;ENST00000536904;ENST00000540849;ENST00000538114	.|D;D;D;D	.|0.87412	.|-2.25;-2.25;-2.25;-2.25	4.37|4.37	1.15|1.15	0.20763|0.20763	.|PET domain (2);	.|.	.|.	.|.	.|.	D|D	0.94235|0.94235	0.8149|0.8149	H|H	0.94462|0.94462	3.54|3.54	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.995;1.0;1.0;0.979	D|D	0.93227|0.93227	0.6614|0.6614	5|9	.|0.72032	.|D	.|0.01	0.3809|0.3809	10.3325|10.3325	0.43831|0.43831	0.0:0.0:0.4853:0.5147|0.0:0.0:0.4853:0.5147	.|.	.|164;126;83;164	.|B2RBS3;B7Z6S4;B7Z8F2;O43900	.|.;.;.;PRIC3_HUMAN	V|W	176;174|164;83;96;151	.|ENSP00000365494:R164W;ENSP00000441385:R83W;ENSP00000446051:R96W;ENSP00000441743:R151W	.|ENSP00000365494:R164W	A|R	-|-	2|1	0|2	PRICKLE3|PRICKLE3	48922618|48922618	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.889000|0.889000	0.51656|0.51656	0.854000|0.854000	0.27791|0.27791	0.224000|0.224000	0.20940|0.20940	0.292000|0.292000	0.19580|0.19580	GCG|CGG		0.612	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150		13	34	0	0	0	0.001855	0	13	34				
SYP	6855	broad.mit.edu	37	X	49047923	49047923	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:49047923C>T	ENST00000263233.4	-	6	985	c.913G>A	c.(913-915)Gca>Aca	p.A305T	SYP_ENST00000538567.1_Missense_Mutation_p.A187T|SYP_ENST00000479808.1_Missense_Mutation_p.A305T	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	305	Repeats, Gly-rich.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				GAGGTGGGTGCACCCTGCGGG	0.647																																							uc004dmz.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(913-915)GCA>ACA		synaptophysin							20.0	19.0	19.0					X																	49047923		2203	4297	6500	SO:0001583	missense	6855				regulation of long-term neuronal synaptic plasticity|regulation of short-term neuronal synaptic plasticity|synaptic vesicle maturation|synaptic vesicle membrane organization	cell junction|integral to synaptic vesicle membrane|synaptosome	calcium ion binding|cholesterol binding|transporter activity	g.chrX:49047923C>T	X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.913G>A	X.37:g.49047923C>T	ENSP00000263233:p.Ala305Thr		Somatic				SYP_uc011mmz.1_Missense_Mutation_p.A187T|SYP_uc004dna.1_Missense_Mutation_p.A299T	p.A305T	NM_003179	NP_003170	WXS	Illumina HiSeq	Unspecified	P08247	SYPH_HUMAN			6	929	-		all_lung(315;0.00016)	305			Cytoplasmic (Potential).|Repeats, Gly-rich.		B2R7L6|B7Z359|Q6P2F7	Missense_Mutation	SNP	ENST00000263233.4	37	c.913G>A	CCDS14321.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074985	0.76415	.	.	ENSG00000102003	ENST00000263233;ENST00000538567;ENST00000479808	T;T;T	0.24350	2.17;1.86;2.17	5.5	5.5	0.81552	.	0.247542	0.38959	N	0.001503	T	0.21631	0.0521	L	0.34521	1.04	0.35311	D	0.783864	B	0.33694	0.421	B	0.27608	0.081	T	0.24799	-1.0150	10	0.56958	D	0.05	-5.1856	17.1004	0.86648	0.0:1.0:0.0:0.0	.	305	P08247	SYPH_HUMAN	T	305;187;305	ENSP00000263233:A305T;ENSP00000437456:A187T;ENSP00000418169:A305T	ENSP00000263233:A305T	A	-	1	0	SYP	48934867	0.988000	0.35896	1.000000	0.80357	0.997000	0.91878	4.836000	0.62789	2.303000	0.77524	0.600000	0.82982	GCA		0.647	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083625.2	NM_003179		12	38	0	0	0	0.001855	0	12	38				
CLCN5	1184	broad.mit.edu	37	X	49840596	49840596	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:49840596G>A	ENST00000307367.2	+	4	643	c.352G>A	c.(352-354)Gag>Aag	p.E118K	CLCN5_ENST00000376091.3_Missense_Mutation_p.E188K|CLCN5_ENST00000376108.3_Missense_Mutation_p.E118K|CLCN5_ENST00000376088.3_Missense_Mutation_p.E188K			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	118					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					CAAATGTCCAGAGTGGAATAG	0.388																																							uc004dos.1		NA																	0				ovary(2)|lung(1)|central_nervous_system(1)	4	GRCh37	CM983858	CLCN5	M		c.(352-354)GAG>AAG		chloride channel 5 isoform b							129.0	103.0	112.0					X																	49840596		2203	4300	6503	SO:0001583	missense	1184				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding	g.chrX:49840596G>A	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.352G>A	X.37:g.49840596G>A	ENSP00000304257:p.Glu118Lys		Somatic				CLCN5_uc004dor.1_Missense_Mutation_p.E188K|CLCN5_uc004doq.1_Missense_Mutation_p.E188K|CLCN5_uc004dot.1_Missense_Mutation_p.E118K	p.E118K	NM_000084	NP_000075	WXS	Illumina HiSeq	Unspecified	P51795	CLCN5_HUMAN			4	600	+	Ovarian(276;0.236)		118					A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	c.352G>A	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064031	0.36373	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.12	4.26	0.50523	Chloride channel, core (1);	0.224191	0.45606	D	0.000342	T	0.79776	0.4504	L	0.33668	1.02	0.37920	D	0.931678	B;B	0.09022	0.002;0.001	B;B	0.08055	0.002;0.003	T	0.70432	-0.4873	10	0.11485	T	0.65	0.5217	7.9816	0.30188	0.0899:0.1568:0.7533:0.0	.	118;188	P51795;P51795-2	CLCN5_HUMAN;.	K	188;20;188;118;118	ENSP00000365256:E188K;ENSP00000365259:E188K;ENSP00000365276:E118K;ENSP00000304257:E118K	ENSP00000304257:E118K	E	+	1	0	CLCN5	49727336	0.995000	0.38212	0.997000	0.53966	0.959000	0.62525	2.600000	0.46240	1.074000	0.40909	0.529000	0.55759	GAG		0.388	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1			31	75	0	0	0	0.008361	0	31	75				
ITIH6	347365	broad.mit.edu	37	X	54783622	54783622	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:54783622G>T	ENST00000218436.6	-	8	2914	c.2885C>A	c.(2884-2886)cCa>cAa	p.P962Q		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	962	Pro-rich.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										TGGAACTCCTGGCCTAGATGG	0.577																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(2884-2886)CCA>CAA		inter-alpha (globulin) inhibitor H5-like							95.0	85.0	88.0					X																	54783622		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54783622G>T	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.2885C>A	X.37:g.54783622G>T	ENSP00000218436:p.Pro962Gln		Somatic					p.P962Q	NM_198510	NP_940912	WXS	Illumina HiSeq	Unspecified	Q6UXX5	ITH5L_HUMAN			8	2915	-			962			Pro-rich.		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.2885C>A	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	4.193	0.034425	0.08101	.	.	ENSG00000102313	ENST00000218436	T	0.02301	4.35	3.37	3.37	0.38596	.	11.588600	0.00741	N	0.001019	T	0.02083	0.0065	N	0.14661	0.345	0.09310	N	1	P	0.41041	0.736	B	0.33196	0.159	T	0.43426	-0.9392	10	0.46703	T	0.11	.	10.0831	0.42401	0.0:0.0:1.0:0.0	.	962	Q6UXX5	ITH5L_HUMAN	Q	962	ENSP00000218436:P962Q	ENSP00000218436:P962Q	P	-	2	0	ITIH5L	54800347	0.084000	0.21492	0.015000	0.15790	0.013000	0.08279	0.873000	0.28052	1.627000	0.50400	0.594000	0.82650	CCA		0.577	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		44	68	1	0	1.31131e-34	0.003214	3.8541e-34	44	68				
OGT	8473	broad.mit.edu	37	X	70782790	70782790	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:70782790C>A	ENST00000373719.3	+	16	2288	c.2071C>A	c.(2071-2073)Cag>Aag	p.Q691K	OGT_ENST00000373701.3_Missense_Mutation_p.Q681K	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	691					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					AGTTGCTGAGCAGTATTCCGA	0.438																																							uc004eaa.1		NA																	0				ovary(3)|kidney(1)|pancreas(1)	5						c.(2071-2073)CAG>AAG		O-linked GlcNAc transferase isoform 1							132.0	120.0	124.0					X																	70782790		2203	4300	6503	SO:0001583	missense	8473				cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity	g.chrX:70782790C>A	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2071C>A	X.37:g.70782790C>A	ENSP00000362824:p.Gln691Lys		Somatic				BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.Q681K|OGT_uc004eac.2_Missense_Mutation_p.Q552K|OGT_uc004ead.2_Missense_Mutation_p.Q310K	p.Q691K	NM_181672	NP_858058	WXS	Illumina HiSeq	Unspecified	O15294	OGT1_HUMAN			16	2288	+	Renal(35;0.156)		691					Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	c.2071C>A	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178752	0.57692	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.16324	2.35;2.35	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	L	0.49513	1.565	0.80722	D	1	P;D;B	0.58970	0.48;0.984;0.049	B;D;B	0.70227	0.351;0.968;0.158	T	0.02491	-1.1151	10	0.15066	T	0.55	.	18.1023	0.89509	0.0:1.0:0.0:0.0	.	565;681;691	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	K	691;681	ENSP00000362824:Q691K;ENSP00000362805:Q681K	ENSP00000362805:Q681K	Q	+	1	0	OGT	70699515	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.626000	0.83164	2.466000	0.83321	0.594000	0.82650	CAG		0.438	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		48	132	1	0	7.05377e-20	0.00361	1.81998e-19	48	132				
FAM199X	139231	broad.mit.edu	37	X	103411604	103411604	+	Silent	SNP	C	C	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:103411604C>T	ENST00000493442.1	+	1	304	c.138C>T	c.(136-138)ttC>ttT	p.F46F		NM_207318.3	NP_997201.1	Q6PEV8	F199X_HUMAN	family with sequence similarity 199, X-linked	46								p.F46F(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						TCAGCGACTTCGGCTGCCAGC	0.657																																							uc004elw.2		NA																	1	Substitution - coding silent(1)		breast(1)	ovary(1)	1						c.(136-138)TTC>TTT		hypothetical protein LOC139231							36.0	31.0	33.0					X																	103411604		2203	4299	6502	SO:0001819	synonymous_variant	139231							g.chrX:103411604C>T	BC016683	CCDS35364.1	Xq22	2010-02-11	2010-02-11	2010-02-11	ENSG00000123575	ENSG00000123575			25195	protein-coding gene	gene with protein product			"""chromosome X open reading frame 39"""	CXorf39			Standard	NM_207318		Approved		uc004elw.3	Q6PEV8	OTTHUMG00000022126	ENST00000493442.1:c.138C>T	X.37:g.103411604C>T			Somatic					p.F46F	NM_207318	NP_997201	WXS	Illumina HiSeq	Unspecified	Q6PEV8	F199X_HUMAN			1	304	+			46					Q8WVP6|Q96AV3	Silent	SNP	ENST00000493442.1	37	c.138C>T	CCDS35364.1																																																																																				0.657	FAM199X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057764.1	NM_207318		12	46	0	0	0	0.00499	0	12	46				
COL4A5	1287	broad.mit.edu	37	X	107869498	107869498	+	Silent	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:107869498C>G	ENST00000361603.2	+	36	3409	c.3165C>G	c.(3163-3165)tcC>tcG	p.S1055S	COL4A5_ENST00000328300.6_Silent_p.S1055S	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1055	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.S1055S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AACCTGGCTCCCCAGGATTAC	0.458									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(3163-3165)TCC>TCG		type IV collagen alpha 5 isoform 2 precursor							94.0	85.0	88.0					X																	107869498		2203	4300	6503	SO:0001819	synonymous_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107869498C>G	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3165C>G	X.37:g.107869498C>G			Somatic				COL4A5_uc011mso.1_Silent_p.S1055S|COL4A5_uc004eob.1_Silent_p.S663S	p.S1055S	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			36	3367	+			1055			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	c.3165C>G	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	9.122	1.009271	0.19277	.	.	ENSG00000188153	ENST00000505728	.	.	.	5.76	2.23	0.28157	.	.	.	.	.	T	0.42607	0.1210	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.25502	-1.0130	4	.	.	.	.	1.0975	0.01676	0.1352:0.3131:0.2592:0.2925	.	.	.	.	R	133	.	.	P	+	2	0	COL4A5	107756154	0.006000	0.16342	0.998000	0.56505	0.964000	0.63967	-0.187000	0.09656	0.272000	0.22027	0.600000	0.82982	CCC		0.458	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			46	125	0	0	0	0.00361	0	46	125				
UTP14A	10813	broad.mit.edu	37	X	129055497	129055497	+	Silent	SNP	C	C	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:129055497C>A	ENST00000394422.3	+	11	1310	c.1282C>A	c.(1282-1284)Cga>Aga	p.R428R	UTP14A_ENST00000498179.1_3'UTR|UTP14A_ENST00000371042.3_Silent_p.R260R|UTP14A_ENST00000425117.2_Silent_p.R376R|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Silent_p.R374R	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	428					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TGAGGAAAGGCGATCCCTTAG	0.463																																							uc004euz.2		NA																	0				ovary(2)	2						c.(1282-1284)CGA>AGA		UTP14, U3 small nucleolar ribonucleoprotein,							51.0	48.0	49.0					X																	129055497		2202	4300	6502	SO:0001819	synonymous_variant	10813				rRNA processing	nucleolus|small-subunit processome	protein binding	g.chrX:129055497C>A	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1282C>A	X.37:g.129055497C>A			Somatic				UTP14A_uc011mup.1_Silent_p.R376R|UTP14A_uc011muq.1_Silent_p.R374R|UTP14A_uc004eva.1_Silent_p.R134R	p.R428R	NM_006649	NP_006640	WXS	Illumina HiSeq	Unspecified	Q9BVJ6	UT14A_HUMAN			11	1310	+			428					A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	37	c.1282C>A	CCDS14615.1																																																																																				0.463	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649		34	82	1	0	9.65021e-13	0.002096	2.2495e-12	34	82				
ATP11C	286410	broad.mit.edu	37	X	138871610	138871610	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:138871610G>T	ENST00000327569.3	-	13	1351	c.1253C>A	c.(1252-1254)aCt>aAt	p.T418N	ATP11C_ENST00000370557.1_Missense_Mutation_p.T415N|ATP11C_ENST00000370543.1_Missense_Mutation_p.T418N|ATP11C_ENST00000359686.2_Missense_Mutation_p.T418N|ATP11C_ENST00000361648.2_Missense_Mutation_p.T418N|ATP11C_ENST00000460773.1_5'UTR	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	418					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GCTGTTTTCAGTGAGTGTTCC	0.343																																							uc004faz.2		NA																	0				ovary(5)|large_intestine(3)	8						c.(1252-1254)ACT>AAT		ATPase, class VI, type 11C isoform a							178.0	138.0	152.0					X																	138871610		2203	4299	6502	SO:0001583	missense	286410				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chrX:138871610G>T	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1253C>A	X.37:g.138871610G>T	ENSP00000332756:p.Thr418Asn		Somatic				ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.T418N	p.T418N	NM_173694	NP_775965	WXS	Illumina HiSeq	Unspecified	Q8NB49	AT11C_HUMAN			13	1352	-	Acute lymphoblastic leukemia(192;0.000127)		418			Cytoplasmic (Potential).		Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	c.1253C>A	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746936	0.89663	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41;-4.41	5.84	5.84	0.93424	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.048574	0.85682	D	0.000000	D	0.98720	0.9570	H	0.99425	4.56	0.80722	D	1	B;B	0.26512	0.124;0.151	B;B	0.36766	0.149;0.232	D	0.98143	1.0437	10	0.87932	D	0	.	18.0124	0.89227	0.0:0.0:1.0:0.0	.	418;418	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	N	415;418;418;418;418	ENSP00000359588:T415N;ENSP00000355165:T418N;ENSP00000332756:T418N;ENSP00000359574:T418N;ENSP00000352715:T418N	ENSP00000332756:T418N	T	-	2	0	ATP11C	138699276	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.475000	0.83589	0.529000	0.55759	ACT		0.343	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694		25	79	1	0	5.45024e-15	0.00333	1.28824e-14	25	79				
SLITRK4	139065	broad.mit.edu	37	X	142718322	142718322	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:142718322G>T	ENST00000381779.4	-	2	828	c.603C>A	c.(601-603)caC>caA	p.H201Q	SLITRK4_ENST00000338017.4_Missense_Mutation_p.H201Q|SLITRK4_ENST00000356928.1_Missense_Mutation_p.H201Q	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	201						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CACGGCCAATGTGTTCCAGAA	0.438																																							uc004fbx.2		NA																	0				upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(601-603)CAC>CAA		slit and trk like 4 protein precursor							84.0	81.0	82.0					X																	142718322		2203	4300	6503	SO:0001583	missense	139065					integral to membrane		g.chrX:142718322G>T	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.603C>A	X.37:g.142718322G>T	ENSP00000371198:p.His201Gln		Somatic				SLITRK4_uc004fby.2_Missense_Mutation_p.H201Q	p.H201Q	NM_173078	NP_775101	WXS	Illumina HiSeq	Unspecified	Q8IW52	SLIK4_HUMAN			2	979	-	Acute lymphoblastic leukemia(192;6.56e-05)		201			Extracellular (Potential).		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	c.603C>A	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455046	0.26161	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.51817	0.69;0.69;0.69	5.59	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.37839	0.1018	N	0.04994	-0.135	0.58432	D	0.999999	P	0.49635	0.926	P	0.55667	0.781	T	0.31166	-0.9953	10	0.39692	T	0.17	-10.6849	8.7509	0.34616	0.1764:0.0:0.8236:0.0	.	201	Q8IW52	SLIK4_HUMAN	Q	201	ENSP00000371198:H201Q;ENSP00000349400:H201Q;ENSP00000336627:H201Q	ENSP00000336627:H201Q	H	-	3	2	SLITRK4	142545988	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.408000	0.52651	1.131000	0.42111	0.600000	0.82982	CAC		0.438	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		51	117	1	0	6.08268e-21	0.00361	1.5815e-20	51	117				
BCAP31	10134	broad.mit.edu	37	X	152967486	152967486	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:152967486C>G	ENST00000345046.6	-	7	1085	c.678G>C	c.(676-678)ttG>ttC	p.L226F	BCAP31_ENST00000441714.1_Missense_Mutation_p.L226F|BCAP31_ENST00000458587.2_Missense_Mutation_p.L293F	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	226					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTCCTCCAGCAAGCGGTCGT	0.587																																							uc011myz.1		NA																	0					0						c.(676-678)TTG>TTC		B-cell receptor-associated protein 31 isoform b							50.0	42.0	45.0					X																	152967486		2203	4300	6503	SO:0001583	missense	10134				cellular component disassembly involved in apoptosis|immune response|intracellular protein transport|vesicle-mediated transport	cytosol|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to plasma membrane	receptor binding	g.chrX:152967486C>G	X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.678G>C	X.37:g.152967486C>G	ENSP00000343458:p.Leu226Phe		Somatic				BCAP31_uc011myy.1_Missense_Mutation_p.L138F|BCAP31_uc004fid.2_Missense_Mutation_p.L293F|BCAP31_uc011mza.1_Missense_Mutation_p.L226F|BCAP31_uc004fie.2_Missense_Mutation_p.L226F	p.L226F	NM_001139441	NP_001132913	WXS	Illumina HiSeq	Unspecified	P51572	BAP31_HUMAN			7	834	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		226			Cytoplasmic (Potential).		B3KQ79|D3DWV5|Q13836|Q96CF0	Missense_Mutation	SNP	ENST00000345046.6	37	c.678G>C	CCDS14727.1	.	.	.	.	.	.	.	.	.	.	c	17.31	3.358127	0.61403	.	.	ENSG00000185825	ENST00000441714;ENST00000345046;ENST00000426131;ENST00000458587	T;T;T	0.29397	1.57;1.57;1.57	5.38	2.55	0.30701	.	0.000000	0.64402	D	0.000001	T	0.58250	0.2109	M	0.89658	3.05	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.59112	-0.7515	10	0.87932	D	0	-9.8627	8.984	0.35983	0.0:0.6461:0.2738:0.0801	.	226;293	P51572;B3KQ79	BAP31_HUMAN;.	F	226;226;293;293	ENSP00000405417:L226F;ENSP00000343458:L226F;ENSP00000392330:L293F	ENSP00000343458:L226F	L	-	3	2	BCAP31	152620680	1.000000	0.71417	0.931000	0.37212	0.562000	0.35680	2.013000	0.40942	0.106000	0.17784	0.525000	0.51046	TTG		0.587	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061071.1	NM_005745		21	59	0	0	0	0.001882	0	21	59				
MECP2	4204	broad.mit.edu	37	X	153296461	153296461	+	Missense_Mutation	SNP	C	C	A	rs61750242|rs63749012		TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chrX:153296461C>A	ENST00000303391.6	-	4	1067	c.818G>T	c.(817-819)gGg>gTg	p.G273V	MECP2_ENST00000453960.2_Missense_Mutation_p.G285V|MECP2_ENST00000460227.1_5'Flank	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	273					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCACACTCCCCGGCTTTCG	0.607																																							uc004fjv.2		NA																	0					0	GRCh37	CD035726	MECP2	D	rs61750242	c.(817-819)GGG>GTG		methyl CpG binding protein 2 isoform 1							49.0	52.0	51.0					X																	153296461		2191	4271	6462	SO:0001583	missense	4204				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity	g.chrX:153296461C>A	AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.818G>T	X.37:g.153296461C>A	ENSP00000301948:p.Gly273Val		Somatic				MECP2_uc004fjw.2_Missense_Mutation_p.G285V	p.G273V	NM_004992	NP_004983	WXS	Illumina HiSeq	Unspecified	P51608	MECP2_HUMAN			4	1044	-	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		273			A.T hook 2.		O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	ENST00000303391.6	37	c.818G>T	CCDS14741.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606494	0.46527	.	.	ENSG00000169057	ENST00000303391;ENST00000545451;ENST00000453960	D;D	0.90385	-2.65;-2.66	5.59	5.59	0.84812	AT hook, DNA-binding motif (1);	0.148584	0.64402	D	0.000014	D	0.88973	0.6583	N	0.24115	0.695	0.80722	D	1	P;P	0.50528	0.936;0.895	P;B	0.50934	0.654;0.373	D	0.90244	0.4288	10	0.56958	D	0.05	-19.1536	17.2652	0.87085	0.0:1.0:0.0:0.0	.	285;273	P51608-2;P51608	.;MECP2_HUMAN	V	273;273;285	ENSP00000301948:G273V;ENSP00000395535:G285V	ENSP00000301948:G273V	G	-	2	0	MECP2	152949655	0.975000	0.34042	0.986000	0.45419	0.810000	0.45777	2.400000	0.44504	2.344000	0.79699	0.600000	0.82982	GGG		0.607	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061144.1	NM_004992		80	189	1	0	3.26865e-45	0.00361	1.00437e-44	80	189				
RPL5	6125	broad.mit.edu	37	1	93306104	93306126	+	Splice_Site	DEL	TCAGATGGAGGAGATGTATAAGA	TCAGATGGAGGAGATGTATAAGA	-			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	TCAGATGGAGGAGATGTATAAGA	TCAGATGGAGGAGATGTATAAGA	-	-	TCAGATGGAGGAGATGTATAAGA	TCAGATGGAGGAGATGTATAAGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr1:93306104_93306126delTCAGATGGAGGAGATGTATAAGA	ENST00000370321.3	+	7	795_814	c.705_724delTCAGATGGAGGAGATGTATAAGA	c.(703-726)attcagatggaggagatgtataag>atag	p.QMEEMYK236fs	SNORA66_ENST00000384792.1_RNA|SNORA66_ENST00000515986.1_RNA	NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5	236					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.E238*(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		TTCCTTTGTTTCAGATGGAGGAGATGTATAAGAAAGCTCATGC	0.363																																							uc001doz.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.e7-1		ribosomal protein L5																																				SO:0001630	splice_region_variant	6125				endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome	g.chr1:93306104_93306126delTCAGATGGAGGAGATGTATAAGA	U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.706-1TCAGATGGAGGAGATGTATAAGA>-	1.37:g.93306104_93306126delTCAGATGGAGGAGATGTATAAGA			Somatic				FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_Splice_Site|RPL5_uc001dpb.2_Splice_Site_p.M186_splice|RPL5_uc001dpd.2_Splice_Site_p.M37_splice|SNORA66_uc009wdi.1_5'Flank	p.M236_splice	NM_000969	NP_000960	WXS	Illumina HiSeq	Unspecified	P46777	RL5_HUMAN		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)	7	784	+		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)						Q32LZ3|Q53HH6|Q9H3F4	Splice_Site	DEL	ENST00000370321.3	37	c.706_splice	CCDS741.1																																																																																				0.363	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030058.2	NM_000969	Frame_Shift_Del	11	162	NA	NA	NA	NA	NA	11	162	---	---	---	---
SLC22A12	116085	broad.mit.edu	37	11	64360272	64360273	+	Frame_Shift_Ins	INS	-	-	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr11:64360272_64360273insA	ENST00000377574.1	+	2	1171_1172	c.424_425insA	c.(424-426)catfs	p.H142fs	SLC22A12_ENST00000473690.1_De_novo_Start_InFrame|SLC22A12_ENST00000377572.1_Frame_Shift_Ins_p.H142fs|SLC22A12_ENST00000377567.2_Frame_Shift_Ins_p.H142fs|SLC22A12_ENST00000336464.7_Frame_Shift_Ins_p.H142fs	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	142					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GTGTGACTCTCATGCTCTGAAG	0.634																																							uc001oam.1		NA																	0				ovary(1)	1						c.(424-426)CATfs		urate anion exchanger 1 isoform a																																				SO:0001589	frameshift_variant	116085				cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity	g.chr11:64360272_64360273insA	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.425dupA	11.37:g.64360273_64360273dupA	ENSP00000366797:p.His142fs		Somatic				SLC22A12_uc009ypr.1_Frame_Shift_Ins_p.H142fs|SLC22A12_uc001oal.1_Translation_Start_Site|SLC22A12_uc009yps.1_Frame_Shift_Ins_p.H142fs|SLC22A12_uc001oan.1_Frame_Shift_Ins_p.H142fs|SLC22A12_uc009ypt.2_5'Flank	p.H142fs	NM_144585	NP_653186	WXS	Illumina HiSeq	Unspecified	Q96S37	S22AC_HUMAN			2	1171_1172	+			142					B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Frame_Shift_Ins	INS	ENST00000377574.1	37	c.424_425insA	CCDS8075.1																																																																																				0.634	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585		85	224	NA	NA	NA	NA	NA	85	224	---	---	---	---
FMN1	342184	broad.mit.edu	37	15	33261122	33261123	+	In_Frame_Ins	INS	-	-	CAA			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr15:33261122_33261123insCAA	ENST00000559047.1	-	5	2778_2779	c.2779_2780insTTG	c.(2779-2781)cca>cTTGca	p.927_927P>LA	FMN1_ENST00000561249.1_In_Frame_Ins_p.829_829P>LA|FMN1_ENST00000334528.9_In_Frame_Ins_p.704_704P>LA|SNORD77_ENST00000391113.1_RNA			Q68DA7	FMN1_HUMAN	formin 1	927	FH1.|Pro-rich.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		AAgtgggggtgggggtgggggt	0.673																																							uc001zhf.3		NA																	0				ovary(1)	1						c.(2110-2112)CCA>CTTGCA		formin 1																																				SO:0001652	inframe_insertion	342184				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding	g.chr15:33261122_33261123insCAA	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2779_2780insTTG	15.37:g.33261122_33261123insCAA	ENSP00000454047:p.Pro927delinsLeuAla		Somatic					p.704_704P>LA	NM_001103184	NP_001096654	WXS	Illumina HiSeq	Unspecified	Q68DA7	FMN1_HUMAN		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	4	2110_2111	-		all_lung(180;1.14e-07)	927			FH1.|Pro-rich.		Q3B7I6|Q3ZAR4|Q6ZSY1	In_Frame_Ins	INS	ENST00000559047.1	37	c.2110_2111insTTG																																																																																					0.673	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
SLC8A2	6543	broad.mit.edu	37	19	47935681	47935683	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	TCC	TCC	-	-	TCC	TCC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr19:47935681_47935683delTCC	ENST00000236877.6	-	9	2525_2527	c.2130_2132delGGA	c.(2128-2133)gaggac>gac	p.E710del	SLC8A2_ENST00000601757.1_5'UTR|SLC8A2_ENST00000539381.1_In_Frame_Del_p.E173del|SLC8A2_ENST00000542837.1_In_Frame_Del_p.E466del	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	710					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CCGGGACCCGTCCTCCTCCTCCT	0.616																																							uc002pgx.2		NA																	0				skin(3)|ovary(1)	4						c.(2128-2133)GAGGAC>GAC		solute carrier family 8 member 2 precursor																																				SO:0001651	inframe_deletion	6543				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr19:47935681_47935683delTCC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.2130_2132delGGA	19.37:g.47935690_47935692delTCC	ENSP00000236877:p.Glu710del		Somatic				SLC8A2_uc010xyq.1_In_Frame_Del_p.E466del|SLC8A2_uc010xyr.1_In_Frame_Del_p.E173del|SLC8A2_uc010ele.2_In_Frame_Del_p.E710del	p.E710del	NM_015063	NP_055878	WXS	Illumina HiSeq	Unspecified	Q9UPR5	NAC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)	9	2408_2410	-		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)	710			Cytoplasmic (Potential).		B4DYQ9	In_Frame_Del	DEL	ENST00000236877.6	37	c.2130_2132delGGA	CCDS33065.1																																																																																				0.616	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1			7	244	NA	NA	NA	NA	NA	7	244	---	---	---	---
BBS7	55212	broad.mit.edu	37	4	122749557	122749557	+	Splice_Site	DEL	T	T	-			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr4:122749557delT	ENST00000264499.4	-	17	2073	c.1890delA	c.(1888-1890)aaa>aa	p.K630fs	BBS7_ENST00000506636.1_Splice_Site_p.K630fs	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	630					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						ATGTACTTACTTTTAAAGCAT	0.323									Bardet-Biedl syndrome																														uc003ied.2		NA																	0				ovary(1)	1						c.(1888-1890)AAAfs		Bardet-Biedl syndrome 7 protein isoform a							111.0	109.0	110.0					4																	122749557		2203	4300	6503	SO:0001630	splice_region_variant	55212	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding	g.chr4:122749557delT	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.1890+1A>-	4.37:g.122749557delT			Somatic				BBS7_uc003iee.1_Frame_Shift_Del_p.K630fs	p.K630fs	NM_176824	NP_789794	WXS	Illumina HiSeq	Unspecified	Q8IWZ6	BBS7_HUMAN			17	2064	-			630					Q4W5P8|Q8N581|Q9NVI4	Frame_Shift_Del	DEL	ENST00000264499.4	37	c.1890delA	CCDS3724.1																																																																																				0.323	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1		Frame_Shift_Del	35	102	NA	NA	NA	NA	NA	35	102	---	---	---	---
PHACTR2	9749	broad.mit.edu	37	6	144081695	144081696	+	Frame_Shift_Ins	INS	-	-	A			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr6:144081695_144081696insA	ENST00000427704.2	+	5	709_710	c.579_580insA	c.(580-582)aaafs	p.K194fs	PHACTR2_ENST00000440869.2_Frame_Shift_Ins_p.K205fs|PHACTR2_ENST00000367582.3_Intron|PHACTR2_ENST00000367584.4_Intron|PHACTR2_ENST00000305766.6_Intron	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	194							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		TGCCTCCCATTAAAAAAAATAC	0.569																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	uc003qjq.3		NA																	0				ovary(2)	2						c.(577-582)ATTAAAfs		phosphatase and actin regulator 2 isoform 3																																				SO:0001589	frameshift_variant	9749						actin binding|protein phosphatase inhibitor activity	g.chr6:144081695_144081696insA	AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.587dupA	6.37:g.144081703_144081703dupA	ENSP00000391763:p.Lys194fs		Somatic				PHACTR2_uc010khh.2_Intron|PHACTR2_uc010khi.2_Frame_Shift_Ins_p.I204fs|PHACTR2_uc003qjr.3_Intron	p.I193fs	NM_014721	NP_055536	WXS	Illumina HiSeq	Unspecified	O75167	PHAR2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)	5	709_710	+			193_194					A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Frame_Shift_Ins	INS	ENST00000427704.2	37	c.579_580insA	CCDS47492.1																																																																																				0.569	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721		8	113	NA	NA	NA	NA	NA	8	113	---	---	---	---
C7orf25	79020	broad.mit.edu	37	7	42950377	42950377	+	Frame_Shift_Del	DEL	T	T	-			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr7:42950377delT	ENST00000350427.4	-	2	398	c.123delA	c.(121-123)aaafs	p.K41fs	C7orf25_ENST00000438029.1_Frame_Shift_Del_p.K41fs|PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000431882.2_Frame_Shift_Del_p.K99fs|C7orf25_ENST00000447342.1_Frame_Shift_Del_p.K41fs			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	41										endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						CTGCCTTCAATTTGCTGCACA	0.423																																							uc003thw.2		NA																	0				skin(1)	1						c.(121-123)AAAfs		hypothetical protein LOC79020 b							162.0	161.0	162.0					7																	42950377		2203	4300	6503	SO:0001589	frameshift_variant	79020							g.chr7:42950377delT	BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.123delA	7.37:g.42950377delT	ENSP00000343364:p.Lys41fs		Somatic				C7orf25_uc010kxq.2_Frame_Shift_Del_p.K41fs|C7orf25_uc003thx.3_Frame_Shift_Del_p.K99fs|C7orf25_uc010kxr.2_Frame_Shift_Del_p.K99fs	p.K41fs	NM_024054	NP_076959	WXS	Illumina HiSeq	Unspecified	Q9BPX7	CG025_HUMAN			2	587	-			41					A4D1V2|J3KR36|Q9H779	Frame_Shift_Del	DEL	ENST00000350427.4	37	c.123delA	CCDS5466.1																																																																																				0.423	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250814.2	NM_024054		108	253	NA	NA	NA	NA	NA	108	253	---	---	---	---
TBC1D2	55357	broad.mit.edu	37	9	100965613	100965614	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	AT	AT	-	-	AT	AT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr9:100965613_100965614delAT	ENST00000375064.1	-	10	2265_2266	c.2227_2228delAT	c.(2227-2229)atcfs	p.I743fs	TBC1D2_ENST00000375063.1_Frame_Shift_Del_p.I283fs|TBC1D2_ENST00000342112.5_Frame_Shift_Del_p.I525fs|TBC1D2_ENST00000375066.5_Frame_Shift_Del_p.I743fs	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	743	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		AGCGGGCATGATGGTCTCCACA	0.614																																							uc011lvb.1		NA																	0				ovary(3)	3						c.(2227-2229)ATCfs		TBC1 domain family, member 2																																				SO:0001589	frameshift_variant	55357					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity	g.chr9:100965613_100965614delAT	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.2227_2228delAT	9.37:g.100965613_100965614delAT	ENSP00000364205:p.Ile743fs		Somatic				TBC1D2_uc004ayp.2_Frame_Shift_Del_p.I283fs|TBC1D2_uc004ayq.2_Frame_Shift_Del_p.I743fs|TBC1D2_uc004ayr.2_Frame_Shift_Del_p.I525fs|TBC1D2_uc004ayo.3_Frame_Shift_Del_p.I743fs	p.I743fs	NM_018421	NP_060891	WXS	Illumina HiSeq	Unspecified	Q9BYX2	TBD2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)	10	2407_2408	-		Myeloproliferative disorder(762;0.0255)	743			Rab-GAP TBC.		B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Frame_Shift_Del	DEL	ENST00000375064.1	37	c.2227_2228delAT																																																																																					0.614	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421		78	205	NA	NA	NA	NA	NA	78	205	---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120476595	120476595	+	Frame_Shift_Del	DEL	G	G	-			TCGA-91-6849-01A-11D-1945-08	TCGA-91-6849-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e35f07c4-bc27-4f85-bc74-acb00e8445bd	21fa02d1-a56c-4fe0-80eb-780083e6a889	g.chr9:120476595delG	ENST00000355622.6	+	3	2290	c.2189delG	c.(2188-2190)agcfs	p.S730fs	TLR4_ENST00000394487.4_Frame_Shift_Del_p.S690fs|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	730	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TTCCATAAAAGCCGAAAGGTG	0.493																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(2188-2190)AGCfs		toll-like receptor 4 precursor							86.0	89.0	88.0					9																	120476595		2203	4300	6503	SO:0001589	frameshift_variant	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476595delG	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2189delG	9.37:g.120476595delG	ENSP00000363089:p.Ser730fs		Somatic				TLR4_uc004bka.2_Frame_Shift_Del_p.S690fs|TLR4_uc004bkb.2_Frame_Shift_Del_p.S530fs	p.S730fs	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	2480	+			730			Cytoplasmic (Potential).|TIR.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Frame_Shift_Del	DEL	ENST00000355622.6	37	c.2189delG	CCDS6818.1																																																																																				0.493	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		52	139	NA	NA	NA	NA	NA	52	139	---	---	---	---
