#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
NPPB	4879	broad.mit.edu	37	1	11918520	11918520	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:11918520G>A	ENST00000376468.3	-	2	236	c.139C>T	c.(139-141)Cgc>Tgc	p.R47C		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	47			R -> H (in dbSNP:rs5229).		body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	AAATGGTTGCGCTGCTCCTGC	0.637																																							uc001atj.2		NA																	0				ovary(2)	2						c.(139-141)CGC>TGC		natriuretic peptide precursor B preproprotein	Carvedilol(DB01136)|Nesiritide(DB04899)|Testosterone(DB00624)						16.0	18.0	17.0					1																	11918520		2194	4295	6489	SO:0001583	missense	4879				body fluid secretion|cGMP biosynthetic process|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation	extracellular space	diuretic hormone activity	g.chr1:11918520G>A	BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.139C>T	1.37:g.11918520G>A	ENSP00000365651:p.Arg47Cys		Somatic					p.R47C	NM_002521	NP_002512	WXS	Illumina HiSeq	Unspecified	P16860	ANFB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	2	241	-	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	47					B0ZBE9|Q6FGY0|Q9P2Q7	Missense_Mutation	SNP	ENST00000376468.3	37	c.139C>T	CCDS140.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019462	0.35606	.	.	ENSG00000120937	ENST00000376468	T	0.23950	1.88	4.31	2.38	0.29361	.	.	.	.	.	T	0.09512	0.0234	N	0.08118	0	0.09310	N	0.999999	P	0.46277	0.875	B	0.28638	0.092	T	0.13415	-1.0510	9	0.87932	D	0	.	7.253	0.26160	0.2135:0.0:0.7865:0.0	.	47	P16860	ANFB_HUMAN	C	47	ENSP00000365651:R47C	ENSP00000365651:R47C	R	-	1	0	NPPB	11841107	0.148000	0.22702	0.003000	0.11579	0.020000	0.10135	1.095000	0.30964	0.387000	0.25024	0.561000	0.74099	CGC		0.637	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006854.1	NM_002521		7	17	0	0	0	0.001984	0	7	17				
SPEN	23013	broad.mit.edu	37	1	16262465	16262465	+	Missense_Mutation	SNP	A	A	C	rs374383017		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:16262465A>C	ENST00000375759.3	+	11	9934	c.9730A>C	c.(9730-9732)Acc>Ccc	p.T3244P		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3244	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AGCTgcccccacccccacccc	0.672																																							uc001axk.1		NA																	0				ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(9730-9732)ACC>CCC		spen homolog, transcriptional regulator							7.0	9.0	8.0					1																	16262465		2176	4250	6426	SO:0001583	missense	23013				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:16262465A>C		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.9730A>C	1.37:g.16262465A>C	ENSP00000364912:p.Thr3244Pro		Somatic				SPEN_uc010obp.1_Missense_Mutation_p.T3203P	p.T3244P	NM_015001	NP_055816	WXS	Illumina HiSeq	Unspecified	Q96T58	MINT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)	11	9934	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	3244			Pro-rich.		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	c.9730A>C	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.508798	0.00984	.	.	ENSG00000065526	ENST00000375759	T	0.09073	3.02	3.45	-0.36	0.12568	.	.	.	.	.	T	0.03477	0.0100	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.44436	-0.9328	9	0.28530	T	0.3	.	3.2977	0.06971	0.2804:0.0:0.3481:0.3716	.	3244	Q96T58	MINT_HUMAN	P	3244	ENSP00000364912:T3244P	ENSP00000364912:T3244P	T	+	1	0	SPEN	16135052	0.291000	0.24352	0.001000	0.08648	0.001000	0.01503	0.822000	0.27352	0.018000	0.15052	-1.044000	0.02363	ACC		0.672	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		5	13	0	0	0	0.006122	0	5	13				
MST1L	11223	broad.mit.edu	37	1	17085872	17085872	+	RNA	SNP	A	A	G	rs1806514		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:17085872A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.W307R(1)|p.W317R(1)									TCGAGGTTCCAGCAGAAGTTC	0.662																																							uc010ock.1		NA																	2	Substitution - Missense(2)		prostate(2)		0						c.(949-951)TGG>CGG		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085872A>G	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085872A>G			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.W317R	NR_002729		WXS	Illumina HiSeq	Unspecified					8	949	-								B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37	c.949T>C		.	.	.	.	.	.	.	.	.	.	.	0.008	-1.910101	0.00508	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.37857	N	0.001920	T	0.10809	0.0264	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.28073	-1.0055	6	0.02654	T	1	.	2.1243	0.03734	0.4998:2.0E-4:2.0E-4:0.4998	rs1806514;rs2021016;rs2761537;rs3982178;rs61595267	317	Q2TV78-2	.	R	307;317;317	.	ENSP00000439273:W317R	W	-	1	0	MST1P9	16958459	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.935000	0.40173	-0.000000	0.14550	0.000000	0.15137	TGG		0.662	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		4	24	0	0	0	0.009096	0	4	24				
YTHDF2	51441	broad.mit.edu	37	1	29069381	29069381	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:29069381C>T	ENST00000373812.3	+	4	961	c.599C>T	c.(598-600)gCa>gTa	p.A200V	YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000541996.1_Missense_Mutation_p.A150V|YTHDF2_ENST00000542507.1_Missense_Mutation_p.A200V	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	200	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGAAGTTGCAAGCAATGTT	0.483																																							uc001brc.2		NA																	0				ovary(1)|skin(1)	2						c.(598-600)GCA>GTA		high glucose-regulated protein 8							62.0	60.0	61.0					1																	29069381		1928	4133	6061	SO:0001583	missense	51441				humoral immune response			g.chr1:29069381C>T	AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.599C>T	1.37:g.29069381C>T	ENSP00000362918:p.Ala200Val		Somatic				YTHDF2_uc001brd.2_Missense_Mutation_p.A197V|YTHDF2_uc010ofx.1_Missense_Mutation_p.A150V|YTHDF2_uc001bre.2_Missense_Mutation_p.A150V	p.A200V	NM_016258	NP_057342	WXS	Illumina HiSeq	Unspecified	Q9Y5A9	YTHD2_HUMAN		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)	4	1096	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	200					A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Missense_Mutation	SNP	ENST00000373812.3	37	c.599C>T	CCDS41296.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.090022	0.36855	.	.	ENSG00000198492	ENST00000542507;ENST00000373812;ENST00000541996;ENST00000396232	T;T;T	0.43294	0.95;0.95;0.95	5.48	5.48	0.80851	.	0.165190	0.51477	D	0.000082	T	0.27866	0.0686	N	0.08118	0	0.41153	D	0.986042	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.05699	-1.0869	10	0.41790	T	0.15	-14.3015	18.5532	0.91073	0.0:1.0:0.0:0.0	.	200;200	B5BU99;Q9Y5A9	.;YTHD2_HUMAN	V	200;200;150;200	ENSP00000444660:A200V;ENSP00000362918:A200V;ENSP00000439394:A150V	ENSP00000362918:A200V	A	+	2	0	YTHDF2	28941968	0.874000	0.30092	1.000000	0.80357	0.996000	0.88848	0.847000	0.27696	2.748000	0.94277	0.650000	0.86243	GCA		0.483	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1	NM_016258		4	26	0	0	0	0.000602	0	4	26				
KIAA1522	57648	broad.mit.edu	37	1	33237928	33237928	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:33237928C>T	ENST00000373480.1	+	6	3074	c.2971C>T	c.(2971-2973)Cct>Tct	p.P991S	KIAA1522_ENST00000401073.2_Missense_Mutation_p.P1050S|KIAA1522_ENST00000373481.3_Missense_Mutation_p.P1002S|YARS_ENST00000469100.1_5'Flank|KIAA1522_ENST00000294521.3_Intron	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	991	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CCTTACTGCTCCTCCCACCAA	0.652																																							uc001bvv.2		NA																	0					0						c.(2971-2973)CCT>TCT		hypothetical protein LOC57648							34.0	38.0	37.0					1																	33237928		1932	4129	6061	SO:0001583	missense	57648							g.chr1:33237928C>T	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2971C>T	1.37:g.33237928C>T	ENSP00000362579:p.Pro991Ser		Somatic				KIAA1522_uc001bvu.1_Missense_Mutation_p.P1050S|KIAA1522_uc010ohm.1_Missense_Mutation_p.P1002S|KIAA1522_uc010ohn.1_Intron	p.P991S	NM_020888	NP_065939	WXS	Illumina HiSeq	Unspecified	Q9P206	K1522_HUMAN			6	3107	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)	991			Pro-rich.		B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	c.2971C>T	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.849643	0.71603	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.12879	2.64;2.66;2.68	4.66	3.74	0.42951	.	0.116822	0.38897	N	0.001521	T	0.15349	0.0370	L	0.27053	0.805	0.29534	N	0.852574	B;P;B	0.43633	0.154;0.813;0.347	B;P;B	0.53954	0.094;0.738;0.135	T	0.02064	-1.1220	10	0.29301	T	0.29	-9.464	8.0532	0.30589	0.0:0.8928:0.0:0.1072	.	1002;991;1050	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	S	1050;1002;991	ENSP00000383851:P1050S;ENSP00000362580:P1002S;ENSP00000362579:P991S	ENSP00000362579:P991S	P	+	1	0	KIAA1522	33010515	0.000000	0.05858	0.995000	0.50966	0.993000	0.82548	-0.413000	0.07123	2.568000	0.86640	0.557000	0.71058	CCT		0.652	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1			19	79	0	0	0	0.00278	0	19	79				
TMEM59	9528	broad.mit.edu	37	1	54509117	54509117	+	Missense_Mutation	SNP	C	C	A	rs568171641	byFrequency	TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:54509117C>A	ENST00000234831.5	-	4	721	c.472G>T	c.(472-474)Gca>Tca	p.A158S	TMEM59_ENST00000371348.1_Missense_Mutation_p.A27S|TMEM59_ENST00000371344.1_Missense_Mutation_p.A27S|TMEM59_ENST00000371341.1_Missense_Mutation_p.A27S	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59	158					autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						AAGCTCTGTGCGGAGTCCATC	0.393																																							uc001cwp.2		NA																	0					0						c.(472-474)GCA>TCA		thymic dendritic cell-derived factor 1							75.0	78.0	77.0					1																	54509117		2203	4300	6503	SO:0001583	missense	9528					Golgi membrane|integral to membrane		g.chr1:54509117C>A	AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.472G>T	1.37:g.54509117C>A	ENSP00000234831:p.Ala158Ser		Somatic				TMEM59_uc001cwn.2_Missense_Mutation_p.A21S|TMEM59_uc001cwo.2_Missense_Mutation_p.A21S|TMEM59_uc001cwq.2_Missense_Mutation_p.A158S|TMEM59_uc001cwr.2_Missense_Mutation_p.A91S|TMEM59_uc001cws.1_Missense_Mutation_p.A169S	p.A158S	NM_004872	NP_004863	WXS	Illumina HiSeq	Unspecified	Q9BXS4	TMM59_HUMAN			4	722	-			158			Extracellular (Potential).		B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	Missense_Mutation	SNP	ENST00000234831.5	37	c.472G>T	CCDS586.1	.	.	.	.	.	.	.	.	.	.	C	36	5.658873	0.96734	.	.	ENSG00000116209	ENST00000371348;ENST00000371344;ENST00000234831;ENST00000371341;ENST00000371338;ENST00000420738;ENST00000440019;ENST00000452421	T;T	0.54675	0.56;0.56	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.76407	0.3983	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	T	0.78011	-0.2371	10	0.62326	D	0.03	-19.7924	19.6101	0.95602	0.0:1.0:0.0:0.0	.	169;169;158;158	E9PGZ9;Q5T704;D3DQ48;Q9BXS4	.;.;.;TMM59_HUMAN	S	27;27;158;27;169;27;27;169	ENSP00000234831:A158S;ENSP00000397772:A169S	ENSP00000234831:A158S	A	-	1	0	TMEM59	54281705	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.651000	0.83577	2.868000	0.98415	0.557000	0.71058	GCA		0.393	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023254.2	NM_004872		9	70	1	0	2.17888e-05	0.006214	2.56099e-05	9	70				
USP1	7398	broad.mit.edu	37	1	62908936	62908936	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:62908936A>G	ENST00000339950.4	+	5	1318	c.503A>G	c.(502-504)gAg>gGg	p.E168G	USP1_ENST00000371146.1_Missense_Mutation_p.E168G	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	168	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		TTAAATCCAGAGAAATATACT	0.368																																					Ovarian(122;1846 2315 3982 19504)	Ovarian(122;1846 2315 3982 19504)	uc001daj.1		NA																	0				ovary(1)	1						c.(502-504)GAG>GGG		ubiquitin specific protease 1							84.0	84.0	84.0					1																	62908936		2203	4300	6503	SO:0001583	missense	7398				DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:62908936A>G		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.503A>G	1.37:g.62908936A>G	ENSP00000343526:p.Glu168Gly		Somatic				USP1_uc001dak.1_Missense_Mutation_p.E168G|USP1_uc001dal.1_Missense_Mutation_p.E168G	p.E168G	NM_001017415	NP_001017415	WXS	Illumina HiSeq	Unspecified	O94782	UBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)	5	831	+		all_neural(321;0.0281)	168					A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	c.503A>G	CCDS621.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.859754	0.91433	.	.	ENSG00000162607	ENST00000452143;ENST00000371146;ENST00000339950	T;T;T	0.52057	0.68;0.68;0.68	5.55	5.55	0.83447	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.101197	0.64402	D	0.000003	T	0.59500	0.2198	L	0.41824	1.3	0.58432	D	0.999999	D	0.65815	0.995	D	0.65443	0.935	T	0.61352	-0.7080	10	0.62326	D	0.03	-8.9602	15.8583	0.79000	1.0:0.0:0.0:0.0	.	168	O94782	UBP1_HUMAN	G	168	ENSP00000403662:E168G;ENSP00000360188:E168G;ENSP00000343526:E168G	ENSP00000343526:E168G	E	+	2	0	USP1	62681524	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.867000	0.87062	2.326000	0.78906	0.533000	0.62120	GAG		0.368	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415		4	49	0	0	0	0.000602	0	4	49				
ERICH3	127254	broad.mit.edu	37	1	75038164	75038164	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:75038164C>T	ENST00000326665.5	-	14	3448	c.3230G>A	c.(3229-3231)aGa>aAa	p.R1077K	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1077	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CACCTCTTCTCTCTCAGAGTC	0.408																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(3229-3231)AGA>AAA		hypothetical protein LOC127254							168.0	176.0	173.0					1																	75038164		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75038164C>T																												ENST00000326665.5:c.3230G>A	1.37:g.75038164C>T	ENSP00000322609:p.Arg1077Lys		Somatic					p.R1077K	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			14	3449	-			1077			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.3230G>A	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.603321	0.28534	.	.	ENSG00000178965	ENST00000326665	T	0.15487	2.42	5.0	2.08	0.27032	.	.	.	.	.	T	0.02571	0.0078	L	0.40543	1.245	0.09310	N	0.999999	B	0.24258	0.1	B	0.18263	0.021	T	0.45673	-0.9245	9	0.06494	T	0.89	0.0784	2.8106	0.05441	0.1492:0.539:0.145:0.1668	.	1077	Q5RHP9	CA173_HUMAN	K	1077	ENSP00000322609:R1077K	ENSP00000322609:R1077K	R	-	2	0	C1orf173	74810752	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.045000	0.14013	0.516000	0.28340	-0.304000	0.09214	AGA		0.408	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			6	168	0	0	0	0.001984	0	6	168				
FNBP1L	54874	broad.mit.edu	37	1	93998552	93998552	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:93998552G>A	ENST00000271234.7	+	8	864	c.713G>A	c.(712-714)cGc>cAc	p.R238H	FNBP1L_ENST00000370256.4_Missense_Mutation_p.R238H|FNBP1L_ENST00000370253.2_Missense_Mutation_p.R238H|FNBP1L_ENST00000604705.1_Missense_Mutation_p.R238H|FNBP1L_ENST00000260506.8_Missense_Mutation_p.R238H	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	238	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		GACTCAGAACGCAAAGTTATT	0.323																																							uc001dpw.2		NA																	0					0						c.(712-714)CGC>CAC		formin binding protein 1-like isoform 1							86.0	82.0	84.0					1																	93998552		1854	4106	5960	SO:0001583	missense	54874				endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding	g.chr1:93998552G>A		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.713G>A	1.37:g.93998552G>A	ENSP00000271234:p.Arg238His		Somatic				FNBP1L_uc001dpv.2_Missense_Mutation_p.R238H|FNBP1L_uc010otk.1_Missense_Mutation_p.R58H	p.R238H	NM_001024948	NP_001020119	WXS	Illumina HiSeq	Unspecified	Q5T0N5	FBP1L_HUMAN		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)	8	713	+		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)	238			Induction of membrane tubulation (By similarity).		J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	ENST00000271234.7	37	c.713G>A	CCDS53343.1	.	.	.	.	.	.	.	.	.	.	G	33	5.242783	0.95272	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253;ENST00000424449	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.80764	0.994;0.993;0.907	T	0.02301	-1.1180	10	0.35671	T	0.21	-31.3176	19.562	0.95375	0.0:0.0:1.0:0.0	.	58;238;238	B4DSI7;Q5T0N5-4;Q5T0N5-3	.;.;.	H	238;238;238;238;105	ENSP00000359278:R238H;ENSP00000271234:R238H;ENSP00000260506:R238H;ENSP00000359275:R238H	ENSP00000260506:R238H	R	+	2	0	FNBP1L	93771140	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.339000	0.79282	2.627000	0.88993	0.591000	0.81541	CGC		0.323	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737		3	66	0	0	0	0.004672	0	3	66				
WARS2	10352	broad.mit.edu	37	1	119575957	119575957	+	Silent	SNP	T	T	A	rs565066649		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:119575957T>A	ENST00000235521.4	-	6	686	c.660A>T	c.(658-660)ctA>ctT	p.L220L	WARS2_ENST00000537870.1_Silent_p.L126L|WARS2_ENST00000369426.5_3'UTR	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	220					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	AAGGATCACGTAGGGATTTTA	0.438																																							uc001ehn.2		NA																	0					0						c.(658-660)CTA>CTT		mitochondrial tryptophanyl tRNA synthetase 2	L-Tryptophan(DB00150)						182.0	179.0	180.0					1																	119575957		2203	4300	6503	SO:0001819	synonymous_variant	10352				tryptophanyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|tryptophan-tRNA ligase activity	g.chr1:119575957T>A	BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.660A>T	1.37:g.119575957T>A			Somatic				WARS2_uc010oxf.1_Silent_p.L126L|WARS2_uc001ehm.2_3'UTR|WARS2_uc010oxg.1_Silent_p.L163L|WARS2_uc010oxh.1_Missense_Mutation_p.T192S	p.L220L	NM_015836	NP_056651	WXS	Illumina HiSeq	Unspecified	Q9UGM6	SYWM_HUMAN		Lung(183;0.0629)	6	688	-	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)	220					B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Silent	SNP	ENST00000235521.4	37	c.660A>T	CCDS900.1																																																																																				0.438	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034362.1	NM_015836		41	152	0	0	0	0.01441	0	41	152				
LCE3E	353145	broad.mit.edu	37	1	152538434	152538434	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:152538434C>A	ENST00000368789.1	-	2	306	c.251G>T	c.(250-252)tGc>tTc	p.C84F		NM_178435.2	NP_848522.1	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	84					keratinization (GO:0031424)					lung(6)|ovary(1)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		ACCGTGGCAGCAGCCAGAGCC	0.617																																							uc001faa.2		NA																	0				ovary(1)	1						c.(250-252)TGC>TTC		late cornified envelope 3E							57.0	70.0	66.0					1																	152538434		2200	4298	6498	SO:0001583	missense	353145				keratinization			g.chr1:152538434C>A		CCDS1013.1	1q21.3	2008-02-05			ENSG00000185966	ENSG00000185966		"""Late cornified envelopes"""	29463	protein-coding gene	gene with protein product		612617				11698679	Standard	NM_178435		Approved	LEP17	uc001faa.4	Q5T5B0	OTTHUMG00000012393	ENST00000368789.1:c.251G>T	1.37:g.152538434C>A	ENSP00000357778:p.Cys84Phe		Somatic					p.C84F	NM_178435	NP_848522	WXS	Illumina HiSeq	Unspecified	Q5T5B0	LCE3E_HUMAN	Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)	2	307	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		84					A2RRM6	Missense_Mutation	SNP	ENST00000368789.1	37	c.251G>T	CCDS1013.1	.	.	.	.	.	.	.	.	.	.	C	0.670	-0.802403	0.02841	.	.	ENSG00000185966	ENST00000368789	T	0.11385	2.78	3.41	3.41	0.39046	.	.	.	.	.	T	0.14830	0.0358	.	.	.	0.09310	N	0.999994	D	0.76494	0.999	D	0.80764	0.994	T	0.04178	-1.0971	8	0.40728	T	0.16	.	10.5029	0.44817	0.0:1.0:0.0:0.0	.	84	Q5T5B0	LCE3E_HUMAN	F	84	ENSP00000357778:C84F	ENSP00000357778:C84F	C	-	2	0	LCE3E	150805058	0.180000	0.23148	0.050000	0.19076	0.025000	0.11179	3.008000	0.49544	1.888000	0.54679	0.460000	0.39030	TGC		0.617	LCE3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034513.1	NM_178435		36	129	1	0	1.57019e-19	0.007835	2.26886e-19	36	129				
DENND4B	9909	broad.mit.edu	37	1	153907309	153907309	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:153907309C>T	ENST00000361217.4	-	18	3118	c.2700G>A	c.(2698-2700)caG>caA	p.Q900Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	900	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q788Q(1)|p.Q900Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgttgctgctgctgct	0.642																																							uc001fdd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2698-2700)CAG>CAA		DENN/MADD domain containing 4B							33.0	42.0	39.0					1																	153907309		2187	4283	6470	SO:0001819	synonymous_variant	9909							g.chr1:153907309C>T	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2700G>A	1.37:g.153907309C>T			Somatic				uc001fdc.1_RNA	p.Q900Q	NM_014856	NP_055671	WXS	Illumina HiSeq	Unspecified	O75064	DEN4B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		18	3101	-	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		900			Gln-rich.		Q5T4K0	Silent	SNP	ENST00000361217.4	37	c.2700G>A	CCDS44228.1																																																																																				0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806		4	69	0	0	0	0.009096	0	4	69				
PYGO2	90780	broad.mit.edu	37	1	154931485	154931485	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:154931485C>T	ENST00000368457.2	-	3	1162	c.991G>A	c.(991-993)Ggt>Agt	p.G331S	PYGO2_ENST00000483463.1_5'Flank|PYGO2_ENST00000368456.1_Missense_Mutation_p.G294S|PBXIP1_ENST00000539880.1_5'Flank|PBXIP1_ENST00000368463.3_5'Flank|RP11-307C12.12_ENST00000605085.1_RNA|PBXIP1_ENST00000368460.3_5'Flank|PBXIP1_ENST00000542459.1_5'Flank|PBXIP1_ENST00000368465.1_5'Flank	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	331					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CGACAGGCACCACATGGGTAC	0.642																																					NSCLC(87;357 1460 1955 21029 23522)	NSCLC(87;357 1460 1955 21029 23522)	uc001fft.2		NA																	0				skin(1)	1						c.(991-993)GGT>AGT		pygopus homolog 2							57.0	47.0	50.0					1																	154931485		2203	4300	6503	SO:0001583	missense	90780				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding	g.chr1:154931485C>T	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.991G>A	1.37:g.154931485C>T	ENSP00000357442:p.Gly331Ser		Somatic				PBXIP1_uc001ffr.2_5'Flank|PBXIP1_uc001ffs.2_5'Flank|PBXIP1_uc010pep.1_5'Flank	p.G331S	NM_138300	NP_612157	WXS	Illumina HiSeq	Unspecified	Q9BRQ0	PYGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		3	1197	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		331			PHD-type.		Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	37	c.991G>A	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513178	0.85389	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.62788	-0.0;-0.0	4.71	4.71	0.59529	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.136499	0.48767	D	0.000175	T	0.78464	0.4287	M	0.87456	2.885	0.58432	D	0.999999	D	0.67145	0.996	D	0.75020	0.985	T	0.82594	-0.0380	10	0.72032	D	0.01	-6.1892	16.6132	0.84899	0.0:1.0:0.0:0.0	.	331	Q9BRQ0	PYGO2_HUMAN	S	331;294	ENSP00000357442:G331S;ENSP00000357441:G294S	ENSP00000357441:G294S	G	-	1	0	PYGO2	153198109	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.894000	0.69806	2.436000	0.82500	0.561000	0.74099	GGT		0.642	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300		7	51	0	0	0	0.004482	0	7	51				
CD1A	909	broad.mit.edu	37	1	158225793	158225793	+	Splice_Site	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:158225793G>C	ENST00000289429.5	+	3	858		c.e3-1			NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule						antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CATAACCCCAGATCCTTTTGA	0.423																																							uc001frt.2		NA																	0				pancreas(2)|skin(1)	3						c.e3-1		CD1A antigen precursor	Antithymocyte globulin(DB00098)						66.0	63.0	64.0					1																	158225793		2202	4299	6501	SO:0001630	splice_region_variant	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158225793G>C	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.326-1G>C	1.37:g.158225793G>C			Somatic					p.Y109_splice	NM_001763	NP_001754	WXS	Illumina HiSeq	Unspecified	P06126	CD1A_HUMAN			3	859	+	all_hematologic(112;0.0378)							D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Splice_Site	SNP	ENST00000289429.5	37	c.326_splice	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882091	0.33255	.	.	ENSG00000158477	ENST00000289429	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9376	0.52882	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD1A	156492417	0.834000	0.29399	0.913000	0.36048	0.148000	0.21650	2.398000	0.44486	2.260000	0.74910	0.579000	0.79373	.		0.423	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	Intron	6	101	0	0	0	0.001984	0	6	101				
OR6K2	81448	broad.mit.edu	37	1	158670335	158670335	+	Silent	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:158670335A>T	ENST00000359610.2	-	1	151	c.108T>A	c.(106-108)gcT>gcA	p.A36A		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					CAACAATGAAAGCATAGATGA	0.448																																							uc001fsu.1		NA																	0				pancreas(1)	1						c.(106-108)GCT>GCA		olfactory receptor, family 6, subfamily K,							110.0	108.0	109.0					1																	158670335		2203	4300	6503	SO:0001819	synonymous_variant	81448				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158670335A>T	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.108T>A	1.37:g.158670335A>T			Somatic					p.A36A	NM_001005279	NP_001005279	WXS	Illumina HiSeq	Unspecified	Q8NGY2	OR6K2_HUMAN			1	108	-	all_hematologic(112;0.0378)		36			Helical; Name=1; (Potential).		B9EH33|Q6IFR6	Silent	SNP	ENST00000359610.2	37	c.108T>A	CCDS30902.1																																																																																				0.448	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279		10	87	0	0	0	0.006214	0	10	87				
GLUL	2752	broad.mit.edu	37	1	182355392	182355392	+	Splice_Site	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:182355392C>T	ENST00000331872.6	-	4	1014	c.474G>A	c.(472-474)caG>caA	p.Q158Q	GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Splice_Site_p.Q158Q|GLUL_ENST00000311223.5_Splice_Site_p.Q158Q|GLUL_ENST00000339526.4_Splice_Site_p.Q158Q	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	158					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GAGACTTACCCTGGGGCCCTG	0.552																																							uc001gpa.1		NA																	0					0						c.(472-474)CAG>CAA		glutamine synthetase	Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)						76.0	81.0	79.0					1																	182355392		2203	4300	6503	SO:0001630	splice_region_variant	2752				cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding	g.chr1:182355392C>T	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.475+1G>A	1.37:g.182355392C>T			Somatic				GLUL_uc010pnt.1_5'Flank|GLUL_uc001gpb.1_Silent_p.Q158Q|GLUL_uc001gpc.1_Silent_p.Q158Q|GLUL_uc001gpd.1_Silent_p.Q158Q	p.Q158Q	NM_001033056	NP_001028228	WXS	Illumina HiSeq	Unspecified	P15104	GLNA_HUMAN			4	686	-			158					Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Silent	SNP	ENST00000331872.6	37	c.474G>A	CCDS1344.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.479902	0.26511	.	.	ENSG00000135821	ENST00000435013	.	.	.	5.29	2.98	0.34508	.	.	.	.	.	T	0.61813	0.2377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62172	-0.6910	5	0.72032	D	0.01	-14.9999	7.0156	0.24887	0.0:0.2994:0.0:0.7006	.	.	.	.	K	158	.	ENSP00000388535:R158K	R	-	2	0	GLUL	180622015	0.950000	0.32346	1.000000	0.80357	0.630000	0.37929	0.421000	0.21280	0.872000	0.35775	0.650000	0.86243	AGG		0.552	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091043.1	NM_002065	Silent	26	94	0	0	0	0.004656	0	26	94				
BRINP3	339479	broad.mit.edu	37	1	190234090	190234090	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:190234090C>A	ENST00000367462.3	-	4	754	c.523G>T	c.(523-525)Gag>Tag	p.E175*	BRINP3_ENST00000534846.1_Nonsense_Mutation_p.E73*|RP11-547I7.1_ENST00000452178.1_RNA	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	175	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TGTAGCGTCTCCAGAGTGACC	0.483																																							uc001gse.1		NA																	0				lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(523-525)GAG>TAG		family with sequence similarity 5, member C							133.0	116.0	122.0					1																	190234090		2203	4300	6503	SO:0001587	stop_gained	339479					extracellular region		g.chr1:190234090C>A	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.523G>T	1.37:g.190234090C>A	ENSP00000356432:p.Glu175*		Somatic				FAM5C_uc010pot.1_Nonsense_Mutation_p.E73*	p.E175*	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			4	755	-	Prostate(682;0.198)		175					B3KVP1|B7Z260|O95726|Q2M330	Nonsense_Mutation	SNP	ENST00000367462.3	37	c.523G>T	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	38	7.248534	0.98164	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	.	.	.	5.75	5.75	0.90469	.	0.052831	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4435	0.87572	0.0:1.0:0.0:0.0	.	.	.	.	X	175;73	.	ENSP00000356432:E175X	E	-	1	0	FAM5C	188500713	1.000000	0.71417	0.993000	0.49108	0.353000	0.29299	7.333000	0.79214	2.721000	0.93114	0.585000	0.79938	GAG		0.483	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		8	103	1	0	0.000157383	0.00308	0.000179622	8	103				
CR1	1378	broad.mit.edu	37	1	207790041	207790041	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:207790041G>A	ENST00000367049.4	+	41	6783	c.6783G>A	c.(6781-6783)atG>atA	p.M2261I	CR1_ENST00000400960.2_Missense_Mutation_p.M1811I|CR1_ENST00000367052.1_Missense_Mutation_p.M1811I|CR1_ENST00000367051.1_Missense_Mutation_p.M1811I|CR1_ENST00000367053.1_Missense_Mutation_p.M1811I	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1811					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ACAGAGGGATGACCTTCAACC	0.522																																							uc001hfy.2		NA																	0				ovary(3)	3						c.(5431-5433)ATG>ATA		complement receptor 1 isoform F precursor							158.0	156.0	157.0					1																	207790041		1961	4134	6095	SO:0001583	missense	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207790041G>A	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6783G>A	1.37:g.207790041G>A	ENSP00000356016:p.Met2261Ile		Somatic				CR1_uc001hfx.2_Missense_Mutation_p.M2261I	p.M1811I	NM_000573	NP_000564	WXS	Illumina HiSeq	Unspecified	P17927	CR1_HUMAN			33	5573	+			1811			Sushi 28.|Extracellular (Potential).		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	c.5433G>A	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365638	0.24684	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	4.15	3.21	0.36854	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.65709	0.2717	L	0.31926	0.97	0.09310	N	1	B;P	0.50943	0.169;0.94	B;D	0.67382	0.065;0.951	T	0.52056	-0.8626	9	0.37606	T	0.19	.	8.4387	0.32801	0.1081:0.0:0.8919:0.0	.	1811;2261	P17927;E9PDY4	CR1_HUMAN;.	I	1811;1811;1811;1811;2261	ENSP00000356019:M1811I;ENSP00000356018:M1811I;ENSP00000356020:M1811I;ENSP00000383744:M1811I;ENSP00000356016:M2261I	ENSP00000356016:M2261I	M	+	3	0	CR1	205856664	0.022000	0.18835	0.004000	0.12327	0.297000	0.27493	1.585000	0.36600	1.310000	0.45006	0.609000	0.83330	ATG		0.522	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		84	127	0	0	0	0.01441	0	84	127				
PROX1	5629	broad.mit.edu	37	1	214169983	214169983	+	Silent	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:214169983T>C	ENST00000366958.4	+	2	713	c.105T>C	c.(103-105)gcT>gcC	p.A35A	PROX1_ENST00000435016.1_Silent_p.A35A|PROX1_ENST00000498508.2_Silent_p.A35A|PROX1_ENST00000261454.4_Silent_p.A35A	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	35					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CATTTTTTGCTAAGGCAAGAG	0.478																																							uc001hkh.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(103-105)GCT>GCC		prospero homeobox 1							128.0	112.0	117.0					1																	214169983		2203	4300	6503	SO:0001819	synonymous_variant	5629				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding	g.chr1:214169983T>C	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.105T>C	1.37:g.214169983T>C			Somatic				PROX1_uc001hkg.1_Silent_p.A35A	p.A35A	NM_002763	NP_002754	WXS	Illumina HiSeq	Unspecified	Q92786	PROX1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)	2	377	+			35					A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	37	c.105T>C	CCDS31021.1																																																																																				0.478	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763		6	82	0	0	0	0.001168	0	6	82				
USH2A	7399	broad.mit.edu	37	1	216380727	216380727	+	Silent	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:216380727A>C	ENST00000307340.3	-	16	3590	c.3204T>G	c.(3202-3204)tcT>tcG	p.S1068S	USH2A_ENST00000366943.2_Silent_p.S1068S|USH2A_ENST00000366942.3_Silent_p.S1068S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1068	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATTGATAGCAGAAGAACTTT	0.418										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3202-3204)TCT>TCG		usherin isoform B							145.0	145.0	145.0					1																	216380727		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216380727A>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3204T>G	1.37:g.216380727A>C		HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Silent_p.S1068S	p.S1068S	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	16	3591	-			1068			Extracellular (Potential).|Fibronectin type-III 1.		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.3204T>G	CCDS31025.1																																																																																				0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		7	120	0	0	0	0.004482	0	7	120				
ACTA1	58	broad.mit.edu	37	1	229567839	229567839	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:229567839G>A	ENST00000366684.3	-	5	812	c.710C>T	c.(709-711)tCc>tTc	p.S237F	ACTA1_ENST00000366683.2_Missense_Mutation_p.S149F	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	237					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				CTTTTCCAGGGAGGAGGAGGA	0.637																																							uc001htm.2		NA																	0					0						c.(709-711)TCC>TTC		actin, alpha 1, skeletal muscle	Dornase Alfa(DB00003)						37.0	32.0	34.0					1																	229567839		2203	4297	6500	SO:0001583	missense	58				muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton	g.chr1:229567839G>A	J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.710C>T	1.37:g.229567839G>A	ENSP00000355645:p.Ser237Phe		Somatic					p.S237F	NM_001100	NP_001091	WXS	Illumina HiSeq	Unspecified	P68133	ACTS_HUMAN			5	815	-	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)	237					P02568|P99020|Q5T8M9	Missense_Mutation	SNP	ENST00000366684.3	37	c.710C>T	CCDS1578.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801451	0.31869	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000366682	D;D	0.94687	-3.49;-3.49	4.28	4.28	0.50868	.	0.150780	0.44902	D	0.000401	D	0.96555	0.8876	M	0.86028	2.79	0.80722	D	1	B	0.33748	0.423	P	0.47626	0.552	D	0.97742	1.0209	10	0.87932	D	0	.	16.8952	0.86098	0.0:0.0:1.0:0.0	.	237	P68133	ACTS_HUMAN	F	237;147;149;202	ENSP00000355645:S237F;ENSP00000355644:S149F	ENSP00000312351:S147F	S	-	2	0	ACTA1	227634462	1.000000	0.71417	0.999000	0.59377	0.165000	0.22458	9.477000	0.97925	2.201000	0.70794	0.563000	0.77884	TCC		0.637	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092781.1	NM_001100		3	24	0	0	0	0.004672	0	3	24				
OR2L2	26246	broad.mit.edu	37	1	248202245	248202245	+	Missense_Mutation	SNP	C	C	G	rs201798934		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:248202245C>G	ENST00000366479.2	+	1	772	c.676C>G	c.(676-678)Cgc>Ggc	p.R226G	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R226C(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TGCTGTCTACCGCATGCACTC	0.488																																							uc001idw.2		NA																	1	Substitution - Missense(1)		urinary_tract(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(676-678)CGC>GGC		olfactory receptor, family 2, subfamily L,							246.0	218.0	227.0					1																	248202245		2203	4300	6503	SO:0001583	missense	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248202245C>G	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.676C>G	1.37:g.248202245C>G	ENSP00000355435:p.Arg226Gly		Somatic				OR2L13_uc001ids.2_Intron	p.R226G	NM_001004686	NP_001004686	WXS	Illumina HiSeq	Unspecified	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	772	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		226			Cytoplasmic (Potential).		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	c.676C>G	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	5.974	0.363600	0.11296	.	.	ENSG00000203663	ENST00000366479	T	0.00253	8.43	1.9	0.79	0.18613	GPCR, rhodopsin-like superfamily (1);	0.845232	0.09637	U	0.775456	T	0.00241	0.0007	M	0.67397	2.05	0.09310	N	1	B	0.19331	0.035	B	0.27715	0.082	T	0.25882	-1.0119	10	0.62326	D	0.03	.	7.665	0.28426	0.5823:0.4177:0.0:0.0	.	226	Q8NH16	OR2L2_HUMAN	G	226	ENSP00000355435:R226G	ENSP00000355435:R226G	R	+	1	0	OR2L2	246268868	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-0.941000	0.03925	0.897000	0.36392	0.194000	0.17425	CGC		0.488	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		23	191	0	0	0	0.003954	0	23	191				
OR2M5	127059	broad.mit.edu	37	1	248308491	248308491	+	Silent	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:248308491C>G	ENST00000366476.1	+	1	42	c.42C>G	c.(40-42)ctC>ctG	p.L14L		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ACTTCATCCTCCTGGGAATCT	0.438																																							uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(40-42)CTC>CTG		olfactory receptor, family 2, subfamily M,							224.0	222.0	223.0					1																	248308491		2203	4300	6503	SO:0001819	synonymous_variant	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308491C>G		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.42C>G	1.37:g.248308491C>G			Somatic					p.L14L	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	42	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		14			Extracellular (Potential).			Silent	SNP	ENST00000366476.1	37	c.42C>G	CCDS31105.1																																																																																				0.438	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		36	288	0	0	0	0.01441	0	36	288				
OR2M2	391194	broad.mit.edu	37	1	248344224	248344224	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:248344224G>T	ENST00000359682.2	+	1	937	c.937G>T	c.(937-939)Gag>Tag	p.E313*		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTCTGAGAGTGAGTTACCTCA	0.388																																							uc010pzf.1		NA																	0				ovary(3)|skin(1)	4						c.(937-939)GAG>TAG		olfactory receptor, family 2, subfamily M,							237.0	237.0	237.0					1																	248344224		2203	4300	6503	SO:0001587	stop_gained	391194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248344224G>T	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.937G>T	1.37:g.248344224G>T	ENSP00000352710:p.Glu313*		Somatic					p.E313*	NM_001004688	NP_001004688	WXS	Illumina HiSeq	Unspecified	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	937	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		313			Cytoplasmic (Potential).		A3KFT4	Nonsense_Mutation	SNP	ENST00000359682.2	37	c.937G>T	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	g	10.04	1.241442	0.22711	.	.	ENSG00000198601	ENST00000359682	.	.	.	1.2	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	0.29685	N	0.841409	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	5.6666	0.17698	0.1888:0.0:0.8112:0.0	.	.	.	.	X	313	.	ENSP00000352710:E313X	E	+	1	0	OR2M2	246410847	0.030000	0.19436	0.000000	0.03702	0.011000	0.07611	0.055000	0.14229	0.110000	0.17919	0.184000	0.17185	GAG		0.388	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		24	263	1	0	1.85244e-09	0.00333	2.43133e-09	24	263				
OR2M3	127062	broad.mit.edu	37	1	248366612	248366612	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:248366612G>T	ENST00000456743.1	+	1	281	c.243G>T	c.(241-243)atG>atT	p.M81I		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TACCCAAGATGGCCTTCAACT	0.512																																							uc010pzg.1		NA																	0				ovary(1)|skin(1)	2						c.(241-243)ATG>ATT		olfactory receptor, family 2, subfamily M,							270.0	262.0	265.0					1																	248366612		2203	4297	6500	SO:0001583	missense	127062				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248366612G>T		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.243G>T	1.37:g.248366612G>T	ENSP00000389625:p.Met81Ile		Somatic					p.M81I	NM_001004689	NP_001004689	WXS	Illumina HiSeq	Unspecified	Q8NG83	OR2M3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	243	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		81			Extracellular (Potential).		B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	c.243G>T	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	G	9.737	1.163922	0.21538	.	.	ENSG00000228198	ENST00000456743	T	0.05513	3.43	2.44	0.278	0.15673	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38605	U	0.001631	T	0.08044	0.0201	M	0.68317	2.08	0.09310	N	1	P	0.37423	0.594	B	0.41723	0.365	T	0.18398	-1.0338	10	0.62326	D	0.03	.	2.5869	0.04832	0.1243:0.4199:0.2962:0.1596	.	81	Q8NG83	OR2M3_HUMAN	I	81	ENSP00000389625:M81I	ENSP00000389625:M81I	M	+	3	0	OR2M3	246433235	0.000000	0.05858	0.001000	0.08648	0.275000	0.26752	-1.056000	0.03489	-0.061000	0.13110	0.405000	0.27470	ATG		0.512	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689		138	312	1	0	1.27947e-65	0.01441	1.9011e-65	138	312				
OR2M3	127062	broad.mit.edu	37	1	248367064	248367064	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:248367064A>T	ENST00000456743.1	+	1	733	c.695A>T	c.(694-696)gAg>gTg	p.E232V		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGATCTGGAGAGGGTCGTCGC	0.448																																							uc010pzg.1		NA																	0				ovary(1)|skin(1)	2						c.(694-696)GAG>GTG		olfactory receptor, family 2, subfamily M,							271.0	260.0	263.0					1																	248367064		2203	4300	6503	SO:0001583	missense	127062				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248367064A>T		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.695A>T	1.37:g.248367064A>T	ENSP00000389625:p.Glu232Val		Somatic					p.E232V	NM_001004689	NP_001004689	WXS	Illumina HiSeq	Unspecified	Q8NG83	OR2M3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	695	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		232			Cytoplasmic (Potential).		B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	c.695A>T	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.767312	0.49574	.	.	ENSG00000228198	ENST00000456743	T	0.00220	8.52	2.54	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	0.536026	0.13798	U	0.362004	T	0.00524	0.0017	M	0.85777	2.775	0.19775	N	0.999957	P	0.46277	0.875	P	0.60068	0.868	T	0.31194	-0.9952	10	0.87932	D	0	.	10.4389	0.44452	1.0:0.0:0.0:0.0	.	232	Q8NG83	OR2M3_HUMAN	V	232	ENSP00000389625:E232V	ENSP00000389625:E232V	E	+	2	0	OR2M3	246433687	0.003000	0.15002	0.020000	0.16555	0.057000	0.15508	1.639000	0.37176	1.164000	0.42652	0.327000	0.21459	GAG		0.448	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689		6	365	0	0	0	0.001984	0	6	365				
OR2T12	127064	broad.mit.edu	37	1	248458039	248458039	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr1:248458039G>C	ENST00000317996.1	-	1	841	c.842C>G	c.(841-843)cCt>cGt	p.P281R		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			ATTTAGTAAAGGGGTGAACAT	0.458																																							uc010pzj.1		NA																	0				skin(2)|ovary(1)	3						c.(841-843)CCT>CGT		olfactory receptor, family 2, subfamily T,							155.0	154.0	154.0					1																	248458039		2203	4300	6503	SO:0001583	missense	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458039G>C	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.842C>G	1.37:g.248458039G>C	ENSP00000324583:p.Pro281Arg		Somatic					p.P281R	NM_001004692	NP_001004692	WXS	Illumina HiSeq	Unspecified	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	842	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		281			Helical; Name=7; (Potential).			Missense_Mutation	SNP	ENST00000317996.1	37	c.842C>G	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	g	14.93	2.683362	0.47991	.	.	ENSG00000177201	ENST00000317996	T	0.00346	8.01	1.71	1.71	0.24356	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33075	U	0.005308	T	0.01320	0.0043	H	0.98027	4.13	0.48341	D	0.999638	D	0.89917	1.0	D	0.87578	0.998	T	0.38824	-0.9643	10	0.87932	D	0	.	10.9522	0.47336	0.0:0.0:1.0:0.0	.	281	Q8NG77	O2T12_HUMAN	R	281	ENSP00000324583:P281R	ENSP00000324583:P281R	P	-	2	0	OR2T12	246524662	0.998000	0.40836	0.003000	0.11579	0.003000	0.03518	2.968000	0.49224	0.754000	0.32968	0.418000	0.28097	CCT		0.458	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		4	176	0	0	0	0.000602	0	4	176				
IL2RA	3559	broad.mit.edu	37	10	6067883	6067883	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:6067883C>G	ENST00000379959.3	-	2	343	c.170G>C	c.(169-171)aGa>aCa	p.R57T	IL2RA_ENST00000256876.6_Missense_Mutation_p.R57T|IL2RA_ENST00000379954.1_Missense_Mutation_p.R57T|RP11-536K7.5_ENST00000440436.1_RNA	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	57	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GCTTTTTATTCTGCGGAAACC	0.498																																							uc001iiz.1		NA																	0				ovary(1)|skin(1)	2						c.(169-171)AGA>ACA		interleukin 2 receptor, alpha chain precursor	Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)						140.0	123.0	129.0					10																	6067883		2203	4300	6503	SO:0001583	missense	3559				cell proliferation	integral to membrane	interleukin-2 receptor activity	g.chr10:6067883C>G	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.170G>C	10.37:g.6067883C>G	ENSP00000369293:p.Arg57Thr		Somatic				IL2RA_uc009xih.1_Missense_Mutation_p.R57T|IL2RA_uc001ija.1_Missense_Mutation_p.R19T	p.R57T	NM_000417	NP_000408	WXS	Illumina HiSeq	Unspecified	P01589	IL2RA_HUMAN			2	329	-			57			Sushi 1.|Extracellular (Potential).		Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	c.170G>C	CCDS7076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.87|13.87	2.364625|2.364625	0.41902|0.41902	.|.	.|.	ENSG00000134460|ENSG00000134460	ENST00000447847|ENST00000379959;ENST00000397240;ENST00000379954;ENST00000256876	.|T;T;T	.|0.63417	.|-0.04;-0.04;-0.04	4.72|4.72	4.72|4.72	0.59763|0.59763	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.64402	.|D	.|0.000007	T|T	0.75421|0.75421	0.3847|0.3847	M|M	0.64404|0.64404	1.975|1.975	0.36464|0.36464	D|D	0.866886|0.866886	.|B;D;D	.|0.89917	.|0.189;1.0;1.0	.|B;D;D	.|0.97110	.|0.119;1.0;0.999	T|T	0.81013|0.81013	-0.1125|-0.1125	5|10	.|0.72032	.|D	.|0.01	-20.2635|-20.2635	13.3619|13.3619	0.60661|0.60661	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|57;43;57	.|Q5W005;E9PF94;P01589	.|.;.;IL2RA_HUMAN	Q|T	28|57;43;57;57	.|ENSP00000369293:R57T;ENSP00000369287:R57T;ENSP00000256876:R57T	.|ENSP00000256876:R57T	E|R	-|-	1|2	0|0	IL2RA|IL2RA	6107889|6107889	0.960000|0.960000	0.32886|0.32886	0.763000|0.763000	0.31416|0.31416	0.018000|0.018000	0.09664|0.09664	3.001000|3.001000	0.49488|0.49488	2.601000|2.601000	0.87937|0.87937	0.585000|0.585000	0.79938|0.79938	GAA|AGA		0.498	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417		4	83	0	0	0	0.009096	0	4	83				
CUBN	8029	broad.mit.edu	37	10	16967685	16967685	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:16967685C>A	ENST00000377833.4	-	42	6425	c.6360G>T	c.(6358-6360)tgG>tgT	p.W2120C		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2120	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCAGGACGTGCCAAGAACAGT	0.502																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(6358-6360)TGG>TGT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						87.0	77.0	80.0					10																	16967685		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16967685C>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6360G>T	10.37:g.16967685C>A	ENSP00000367064:p.Trp2120Cys		Somatic					p.W2120C	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			42	6412	-			2120			CUB 15.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.6360G>T	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780539	0.70222	.	.	ENSG00000107611	ENST00000377833	T	0.52754	0.65	5.65	5.65	0.86999	CUB (5);	0.000000	0.41194	D	0.000926	D	0.82843	0.5125	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89673	0.3885	10	0.87932	D	0	.	19.7198	0.96137	0.0:1.0:0.0:0.0	.	2120	O60494	CUBN_HUMAN	C	2120	ENSP00000367064:W2120C	ENSP00000367064:W2120C	W	-	3	0	CUBN	17007691	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	7.461000	0.80834	2.668000	0.90789	0.655000	0.94253	TGG		0.502	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		15	64	1	0	1.67942e-08	0.006122	2.15925e-08	15	64				
CUBN	8029	broad.mit.edu	37	10	17110211	17110211	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:17110211G>T	ENST00000377833.4	-	21	2925	c.2860C>A	c.(2860-2862)Cac>Aac	p.H954N		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	954	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTGATACCGTGGGGGTAGACA	0.368																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(2860-2862)CAC>AAC		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						158.0	154.0	156.0					10																	17110211		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:17110211G>T	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2860C>A	10.37:g.17110211G>T	ENSP00000367064:p.His954Asn		Somatic					p.H954N	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			21	2912	-			954			CUB 5.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.2860C>A	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230784	0.58777	.	.	ENSG00000107611	ENST00000377833	T	0.25414	1.8	5.49	4.54	0.55810	CUB (5);	0.635768	0.13773	N	0.363797	T	0.22322	0.0538	N	0.19112	0.55	0.80722	D	1	B	0.26400	0.148	B	0.35931	0.214	T	0.05321	-1.0892	10	0.25106	T	0.35	.	14.6267	0.68626	0.0:0.0:0.8267:0.1733	.	954	O60494	CUBN_HUMAN	N	954	ENSP00000367064:H954N	ENSP00000367064:H954N	H	-	1	0	CUBN	17150217	1.000000	0.71417	0.147000	0.22382	0.897000	0.52465	5.884000	0.69729	1.179000	0.42884	0.609000	0.83330	CAC		0.368	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		16	185	1	0	5.01169e-05	0.00499	5.8254e-05	16	185				
GPR158	57512	broad.mit.edu	37	10	25885651	25885651	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:25885651G>T	ENST00000376351.3	+	10	2437	c.2078G>T	c.(2077-2079)gGa>gTa	p.G693V	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	693					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GGCCGATCTGGATCCTACCTG	0.438																																							uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(2077-2079)GGA>GTA		G protein-coupled receptor 158 precursor							144.0	115.0	125.0					10																	25885651		2203	4300	6503	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25885651G>T	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2078G>T	10.37:g.25885651G>T	ENSP00000365529:p.Gly693Val		Somatic				GPR158_uc001isk.2_Missense_Mutation_p.G68V	p.G693V	NM_020752	NP_065803	WXS	Illumina HiSeq	Unspecified	Q5T848	GP158_HUMAN			10	2138	+			693			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.2078G>T	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	33	5.248823	0.95305	.	.	ENSG00000151025	ENST00000376351	T	0.63255	-0.03	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000001	T	0.79741	0.4498	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.78889	-0.2026	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	693	Q5T848	GP158_HUMAN	V	693	ENSP00000365529:G693V	ENSP00000365529:G693V	G	+	2	0	GPR158	25925657	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGA		0.438	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		4	81	1	0	0.00024832	0.009096	0.000280361	4	81				
NRP1	8829	broad.mit.edu	37	10	33502610	33502610	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:33502610C>G	ENST00000265371.4	-	10	1843	c.1318G>C	c.(1318-1320)Gga>Cga	p.G440R	NRP1_ENST00000374875.1_Missense_Mutation_p.G259R|NRP1_ENST00000374867.2_Missense_Mutation_p.G440R|NRP1_ENST00000432372.2_Missense_Mutation_p.G440R|NRP1_ENST00000374821.5_Missense_Mutation_p.G440R|NRP1_ENST00000374822.4_Missense_Mutation_p.G440R|RP11-342D11.2_ENST00000451530.1_RNA|NRP1_ENST00000374823.5_Missense_Mutation_p.G440R|NRP1_ENST00000374816.3_Missense_Mutation_p.G440R|NRP1_ENST00000395995.1_Missense_Mutation_p.G440R			O14786	NRP1_HUMAN	neuropilin 1	440	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GAAATAAGTCCAGACACCATA	0.458																																					Melanoma(104;886 1489 44640 45944 51153)	Melanoma(104;886 1489 44640 45944 51153)	uc001iwx.3		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1318-1320)GGA>CGA		neuropilin 1 isoform a	Palifermin(DB00039)|Pegaptanib(DB04895)						108.0	101.0	104.0					10																	33502610		2203	4300	6503	SO:0001583	missense	8829				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity	g.chr10:33502610C>G	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1318G>C	10.37:g.33502610C>G	ENSP00000265371:p.Gly440Arg		Somatic				NRP1_uc001iwv.3_Missense_Mutation_p.G440R|NRP1_uc009xlz.2_Missense_Mutation_p.G440R|NRP1_uc001iww.3_Missense_Mutation_p.G259R|NRP1_uc001iwy.3_Missense_Mutation_p.G440R|NRP1_uc001iwz.2_Missense_Mutation_p.G440R|NRP1_uc001ixa.2_Missense_Mutation_p.G440R|NRP1_uc001ixb.1_Missense_Mutation_p.G440R|NRP1_uc001ixc.1_Missense_Mutation_p.G440R	p.G440R	NM_003873	NP_003864	WXS	Illumina HiSeq	Unspecified	O14786	NRP1_HUMAN			9	1841	-			440			Extracellular (Potential).|F5/8 type C 2.		B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	ENST00000265371.4	37	c.1318G>C	CCDS7177.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.835639	0.91117	.	.	ENSG00000099250	ENST00000265371;ENST00000374875;ENST00000374867;ENST00000395995;ENST00000374822;ENST00000374821;ENST00000374823;ENST00000374816;ENST00000432372	D;D;D;D;D;D;D;D;D	0.99129	-5.46;-5.46;-5.46;-5.46;-5.46;-5.46;-5.46;-5.46;-5.46	5.41	5.41	0.78517	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99293	0.9753	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.99541	1.0963	10	0.62326	D	0.03	-19.8786	19.1846	0.93637	0.0:1.0:0.0:0.0	.	440;440;440;440;440;440;440;259;440	A8K9V7;E7EX60;Q5T7F0;Q5T7F1;O14786-2;Q68DN3;O14786;Q5JWQ6;E9PEP6	.;.;.;.;.;.;NRP1_HUMAN;.;.	R	440;259;440;440;440;440;440;440;113	ENSP00000265371:G440R;ENSP00000364009:G259R;ENSP00000364001:G440R;ENSP00000379317:G440R;ENSP00000363955:G440R;ENSP00000363954:G440R;ENSP00000363956:G440R;ENSP00000363949:G440R;ENSP00000408911:G113R	ENSP00000265371:G440R	G	-	1	0	NRP1	33542616	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.814000	0.86154	2.529000	0.85273	0.491000	0.48974	GGA		0.458	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2			12	82	0	0	0	0.00245	0	12	82				
RASGEF1A	221002	broad.mit.edu	37	10	43691988	43691988	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:43691988C>T	ENST00000395809.1	-	12	3863	c.1357G>A	c.(1357-1359)Gtc>Atc	p.V453I	RASGEF1A_ENST00000374459.1_Missense_Mutation_p.V461I|RASGEF1A_ENST00000395810.1_Missense_Mutation_p.V453I			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	453	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.V453I(1)|p.V400I(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						AAGGAGGCGACGAAGAGAGCT	0.562																																							uc001jap.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1357-1359)GTC>ATC		RasGEF domain family, member 1A							126.0	116.0	119.0					10																	43691988		2203	4300	6503	SO:0001583	missense	221002				cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity	g.chr10:43691988C>T	AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.1357G>A	10.37:g.43691988C>T	ENSP00000379154:p.Val453Ile		Somatic				RASGEF1A_uc001jao.1_Missense_Mutation_p.V461I	p.V453I	NM_145313	NP_660356	WXS	Illumina HiSeq	Unspecified	Q8N9B8	RGF1A_HUMAN			12	1438	-			453			Ras-GEF.		Q8TBF1	Missense_Mutation	SNP	ENST00000395809.1	37	c.1357G>A	CCDS7202.2	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915181	0.33815	.	.	ENSG00000198915	ENST00000374459;ENST00000395810;ENST00000395809	T;T;T	0.29142	1.58;1.58;1.58	5.14	-7.89	0.01174	Guanine-nucleotide dissociation stimulator CDC25 (2);Ras guanine nucleotide exchange factor, domain (1);	0.614546	0.16166	N	0.226524	T	0.07503	0.0189	N	0.02539	-0.55	0.19300	N	0.999974	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.17379	-1.0371	10	0.24483	T	0.36	.	4.7322	0.12970	0.0967:0.4335:0.1971:0.2727	.	453;461	Q8N9B8;Q8N9B8-2	RGF1A_HUMAN;.	I	461;453;453	ENSP00000363583:V461I;ENSP00000379155:V453I;ENSP00000379154:V453I	ENSP00000363583:V461I	V	-	1	0	RASGEF1A	43011994	1.000000	0.71417	0.093000	0.20910	0.888000	0.51559	0.606000	0.24194	-1.286000	0.02384	-0.672000	0.03802	GTC		0.562	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313		10	110	0	0	0	0.008291	0	10	110				
ZNF487	642819	broad.mit.edu	37	10	43971290	43971290	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:43971290C>T	ENST00000431662.1	+	2	224	c.224C>T	c.(223-225)tCa>tTa	p.S75L	ZNF487_ENST00000437590.2_Missense_Mutation_p.S11L			B1APH4	ZN487_HUMAN	zinc finger protein 487	75	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CTCCTCCTCTCAGTGGGTAAG	0.458																																							uc010qfb.1		NA																	0					0						c.(31-33)TCA>TTA		SubName: Full=cDNA FLJ52643, weakly similar to Zinc finger protein 11B;																																				SO:0001583	missense	642819							g.chr10:43971290C>T			10q11.21	2013-06-03	2013-03-06	2013-03-06	ENSG00000243660	ENSG00000243660			23488	other	unknown			"""KRAB domain only 1"", ""zinc finger protein 487, pseudogene"""	KRBO1, ZNF487P			Standard	NR_026693		Approved			B1APH4	OTTHUMG00000185507	ENST00000431662.1:c.224C>T	10.37:g.43971290C>T	ENSP00000388421:p.Ser75Leu		Somatic					p.S11L	NR_026693		WXS	Illumina HiSeq	Unspecified					2	259	+								B1APH5|B7Z7S5	Missense_Mutation	SNP	ENST00000431662.1	37	c.32C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.17|12.17	1.857293|1.857293	0.32791|0.32791	.|.	.|.	ENSG00000243660|ENSG00000243660	ENST00000315429|ENST00000431662;ENST00000455398;ENST00000456416;ENST00000442349;ENST00000437590	.|T;T;T	.|0.18502	.|4.08;2.21;5.39	1.64|1.64	1.64|1.64	0.23874|0.23874	.|.	.|.	.|.	.|.	.|.	.|T	.|0.32194	.|0.0821	.|.	.|.	.|.	0.21915|0.21915	N|N	0.999475|0.999475	.|D	.|0.67145	.|0.996	.|P	.|0.62491	.|0.903	.|T	.|0.05007	.|-1.0912	.|8	.|0.62326	.|D	.|0.03	.|.	9.2391|9.2391	0.37484|0.37484	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|11	.|B7Z7S5	.|.	X|L	73|75;11;11;11;11	.|ENSP00000388421:S75L;ENSP00000395343:S11L;ENSP00000392335:S11L	.|ENSP00000388421:S75L	Q|S	+|+	1|2	0|0	ZNF487P|ZNF487P	43291296|43291296	0.005000|0.005000	0.15991|0.15991	0.774000|0.774000	0.31636|0.31636	0.046000|0.046000	0.14306|0.14306	0.027000|0.027000	0.13621|0.13621	1.208000|1.208000	0.43306|0.43306	0.467000|0.467000	0.42956|0.42956	CAG|TCA		0.458	ZNF487-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_926224		4	17	0	0	0	0.009096	0	4	17				
PRKG1	5592	broad.mit.edu	37	10	52912943	52912944	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:52912943_52912944GA>AT	ENST00000401604.2	+	2	480_481	c.286_287GA>AT	c.(286-288)GAa>ATa	p.E96I	PRKG1_ENST00000373985.1_Missense_Mutation_p.E84I|PRKG1_ENST00000373980.4_Missense_Mutation_p.E111I			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	96	Required for dimerization.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TCTTATAAAGGAAGCTATCCTT	0.455																																							uc001jjm.2		NA																	0				lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6						c.(286-288)GAA>ATA		protein kinase, cGMP-dependent, type I isoform																																				SO:0001583	missense	5592				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr10:52912943_52912944GA>AT		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	Exception_encountered	10.37:g.52912943_52912944delinsAT	ENSP00000384200:p.Glu96Ile		Somatic				PRKG1_uc001jjn.2_Missense_Mutation_p.E111I|PRKG1_uc001jjo.2_Missense_Mutation_p.E111I|PRKG1_uc010qhp.1_Missense_Mutation_p.E96I	p.E96I	NM_001098512	NP_001091982	WXS	Illumina HiSeq	Unspecified	Q13976	KGP1_HUMAN		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)	2	480_481	+		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)	96			Dimerization.		A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	DNP	ENST00000401604.2	37	c.286_287GA>AT	CCDS44399.1																																																																																				0.455	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				42	103	0	0	0	0.004672	0	42	103				
PCDH15	65217	broad.mit.edu	37	10	55755468	55755468	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:55755468G>T	ENST00000320301.6	-	21	3203	c.2809C>A	c.(2809-2811)Ccg>Acg	p.P937T	PCDH15_ENST00000361849.3_Missense_Mutation_p.P937T|PCDH15_ENST00000395438.1_Missense_Mutation_p.P937T|PCDH15_ENST00000395432.2_Missense_Mutation_p.P900T|PCDH15_ENST00000395433.1_Missense_Mutation_p.P915T|PCDH15_ENST00000437009.1_Missense_Mutation_p.P866T|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.P548T|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.P944T|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.P944T|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.P937T|PCDH15_ENST00000414778.1_Missense_Mutation_p.P942T|PCDH15_ENST00000395430.1_Missense_Mutation_p.P937T	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	937	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ACTGCATCCGGAGCCACCATC	0.398										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(2809-2811)CCG>ACG		protocadherin 15 isoform CD1-4 precursor							140.0	126.0	131.0					10																	55755468		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55755468G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2809C>A	10.37:g.55755468G>T	ENSP00000322604:p.Pro937Thr	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.P942T|PCDH15_uc010qhr.1_Missense_Mutation_p.P937T|PCDH15_uc010qhs.1_Missense_Mutation_p.P949T|PCDH15_uc010qht.1_Missense_Mutation_p.P944T|PCDH15_uc010qhu.1_Missense_Mutation_p.P937T|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P937T|PCDH15_uc010qhw.1_Missense_Mutation_p.P900T|PCDH15_uc010qhx.1_Missense_Mutation_p.P866T|PCDH15_uc010qhy.1_Missense_Mutation_p.P942T|PCDH15_uc010qhz.1_Missense_Mutation_p.P937T|PCDH15_uc010qia.1_Missense_Mutation_p.P915T|PCDH15_uc010qib.1_Missense_Mutation_p.P915T|PCDH15_uc001jjw.2_Missense_Mutation_p.P937T	p.P937T	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			21	3204	-		Melanoma(3;0.117)|Lung SC(717;0.238)	937			Extracellular (Potential).|Cadherin 9.		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.2809C>A	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193700	0.78902	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T	0.60672	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;0.17	5.93	5.93	0.95920	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.74298	0.3698	L	0.55481	1.735	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.996;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.994;0.998;0.977;1.0;0.997;1.0;0.997;0.997;0.994;0.994;0.997;0.997;0.99	T	0.74337	-0.3698	9	0.72032	D	0.01	.	19.9262	0.97102	0.0:0.0:1.0:0.0	.	915;937;937;942;866;900;937;937;944;944;937;942;937;937	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	T	944;942;937;937;548;944;900;937;915;937;937;942;866;937	ENSP00000363076:P944T;ENSP00000410304:P942T;ENSP00000378826:P937T;ENSP00000386693:P548T;ENSP00000378832:P944T;ENSP00000378820:P900T;ENSP00000354950:P937T;ENSP00000378821:P915T;ENSP00000322604:P937T;ENSP00000378818:P937T;ENSP00000412628:P866T;ENSP00000363066:P937T	ENSP00000322604:P937T	P	-	1	0	PCDH15	55425474	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	8.974000	0.93433	2.797000	0.96272	0.655000	0.94253	CCG		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		12	86	1	0	1.08611e-07	0.010729	1.35763e-07	12	86				
ANXA7	310	broad.mit.edu	37	10	75147496	75147496	+	Missense_Mutation	SNP	T	T	C	rs369628555		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:75147496T>C	ENST00000372921.5	-	7	640	c.584A>G	c.(583-585)aAt>aGt	p.N195S	ANXA7_ENST00000492380.1_5'UTR|ANXA7_ENST00000535178.1_Missense_Mutation_p.N65S	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	217					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					CCTCTGATCATTGGAACGGTT	0.463																																							uc001jtz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(649-651)AAT>AGT		annexin VII isoform 2		T	SER/ASN,SER/ASN	0,4406		0,0,2203	230.0	215.0	220.0		584,650	6.0	1.0	10		220	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ANXA7	NM_001156.3,NM_004034.2	46,46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	195/467,217/489	75147496	1,13005	2203	4300	6503	SO:0001583	missense	310						calcium ion binding|calcium-dependent phospholipid binding|calcium-dependent protein binding	g.chr10:75147496T>C	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.584A>G	10.37:g.75147496T>C	ENSP00000362012:p.Asn195Ser		Somatic				ANXA7_uc001jua.2_Missense_Mutation_p.N195S|ANXA7_uc001jub.2_Missense_Mutation_p.N155S|ANXA7_uc010qki.1_Missense_Mutation_p.N105S|ANXA7_uc009xre.2_Missense_Mutation_p.N124S|ANXA7_uc009xrf.1_Missense_Mutation_p.N137S	p.N217S	NM_004034	NP_004025	WXS	Illumina HiSeq	Unspecified	P20073	ANXA7_HUMAN			8	723	-	Prostate(51;0.0119)		217			Annexin 1.		Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	37	c.650A>G	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.398372	0.83120	0.0	1.16E-4	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.03689	3.84;3.84;3.84	5.96	5.96	0.96718	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.07908	0.0198	L	0.28556	0.865	0.58432	D	0.99999	P;D;B;P;P	0.53312	0.819;0.959;0.343;0.783;0.855	P;P;B;P;P	0.54815	0.664;0.761;0.304;0.534;0.586	T	0.24225	-1.0166	10	0.52906	T	0.07	.	14.3967	0.67015	0.0:0.0:0.0:1.0	.	195;195;122;195;217	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	S	195;217;65	ENSP00000362012:N195S;ENSP00000362010:N217S;ENSP00000442864:N65S	ENSP00000362010:N217S	N	-	2	0	ANXA7	74817502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.573000	0.36472	2.284000	0.76573	0.528000	0.53228	AAT		0.463	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048646.2	NM_001156		51	148	0	0	0	0.01441	0	51	148				
SEC24C	9632	broad.mit.edu	37	10	75510968	75510968	+	Missense_Mutation	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:75510968A>C	ENST00000339365.2	+	4	437	c.275A>C	c.(274-276)cAg>cCg	p.Q92P	SEC24C_ENST00000546025.1_Intron|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.Q92P|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	92					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GGAGATGTACAGAATGGGCCA	0.542																																							uc001juw.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(274-276)CAG>CCG		SEC24-related protein C							85.0	68.0	73.0					10																	75510968		2203	4300	6503	SO:0001583	missense	9632				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding	g.chr10:75510968A>C	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.275A>C	10.37:g.75510968A>C	ENSP00000343405:p.Gln92Pro		Somatic				SEC24C_uc010qkn.1_Intron|SEC24C_uc009xrj.1_Intron|SEC24C_uc001jux.2_Missense_Mutation_p.Q92P|SEC24C_uc010qko.1_Intron|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	p.Q92P	NM_004922	NP_004913	WXS	Illumina HiSeq	Unspecified	P53992	SC24C_HUMAN			4	454	+	Prostate(51;0.0112)		92					B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	37	c.275A>C	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.971255	0.74246	.	.	ENSG00000176986	ENST00000345254;ENST00000339365	T;T	0.78707	-1.2;-1.2	5.56	5.56	0.83823	.	0.348677	0.35067	N	0.003469	T	0.72342	0.3448	L	0.59436	1.845	0.80722	D	1	P	0.38335	0.627	B	0.34489	0.184	T	0.70730	-0.4792	10	0.20046	T	0.44	-9.3908	15.6942	0.77481	1.0:0.0:0.0:0.0	.	92	P53992	SC24C_HUMAN	P	92	ENSP00000321845:Q92P;ENSP00000343405:Q92P	ENSP00000343405:Q92P	Q	+	2	0	SEC24C	75180974	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.830000	0.75319	2.240000	0.73641	0.533000	0.62120	CAG		0.542	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1			4	44	0	0	0	0.009096	0	4	44				
BTAF1	9044	broad.mit.edu	37	10	93757446	93757446	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:93757446G>C	ENST00000265990.6	+	25	3906	c.3598G>C	c.(3598-3600)Gac>Cac	p.D1200H	BTAF1_ENST00000544642.1_Missense_Mutation_p.D28H	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1200					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGATCAGACAGACAGTGTGAG	0.378																																							uc001khr.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(3598-3600)GAC>CAC		BTAF1 RNA polymerase II, B-TFIID transcription							169.0	140.0	150.0					10																	93757446		2203	4300	6503	SO:0001583	missense	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93757446G>C	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.3598G>C	10.37:g.93757446G>C	ENSP00000265990:p.Asp1200His		Somatic					p.D1200H	NM_003972	NP_003963	WXS	Illumina HiSeq	Unspecified	O14981	BTAF1_HUMAN			25	3696	+		Colorectal(252;0.0846)	1200			HEAT 8.		B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	c.3598G>C	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696582	0.48202	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	T;T	0.68765	-0.25;-0.35	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	N	0.20807	0.61	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.45687	-0.9244	10	0.39692	T	0.17	-14.9983	14.6405	0.68720	0.0713:0.0:0.9287:0.0	.	1200	O14981	BTAF1_HUMAN	H	1200;28;50	ENSP00000265990:D1200H;ENSP00000439924:D28H	ENSP00000265990:D1200H	D	+	1	0	BTAF1	93747426	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.558000	0.82253	2.835000	0.97688	0.591000	0.81541	GAC		0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		11	86	0	0	0	0.010729	0	11	86				
MKI67	4288	broad.mit.edu	37	10	129913773	129913773	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:129913773C>A	ENST00000368654.3	-	7	1274	c.899G>T	c.(898-900)gGc>gTc	p.G300V	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	300					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CACAGCGTGGCCGCTCCCACC	0.532																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(898-900)GGC>GTC		antigen identified by monoclonal antibody Ki-67							84.0	87.0	86.0					10																	129913773		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129913773C>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.899G>T	10.37:g.129913773C>A	ENSP00000357643:p.Gly300Val		Somatic				MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	p.G300V	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			7	1094	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	300					Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.899G>T	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	6.199	0.404852	0.11754	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.01287	5.05	3.44	-3.15	0.05233	.	1.479750	0.04074	N	0.308489	T	0.00936	0.0031	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.49072	-0.8977	10	0.87932	D	0	.	2.102	0.03682	0.2771:0.407:0.1884:0.1275	.	300	P46013	KI67_HUMAN	V	300	ENSP00000357643:G300V	ENSP00000357643:G300V	G	-	2	0	MKI67	129803763	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.034000	0.12225	-1.106000	0.03008	-2.944000	0.00085	GGC		0.532	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		5	67	1	0	2.0095e-06	0.001984	2.43458e-06	5	67				
MGMT	4255	broad.mit.edu	37	10	131334541	131334541	+	Missense_Mutation	SNP	C	C	T	rs141095230	byFrequency	TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr10:131334541C>T	ENST00000306010.7	+	2	150	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C		NM_002412.3	NP_002403.2	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	9					cellular response to ionizing radiation (GO:0071479)|cellular response to organic cyclic compound (GO:0071407)|cellular response to oxidative stress (GO:0034599)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA ligation (GO:0006266)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to toxic substance (GO:0009636)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methylated-DNA-[protein]-cysteine S-methyltransferase activity (GO:0003908)|methyltransferase activity (GO:0008168)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	10		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	L-Cysteine(DB00151)	TGAAATGAAACGCACCACACT	0.458								Direct reversal of damage																															uc001lkh.2		NA																	0				ovary(1)|breast(1)	2						c.(118-120)CGC>TGC	Direct_reversal_of_damage	O-6-methylguanine-DNA methyltransferase		C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	115.0	107.0	110.0		118	0.3	0.0	10	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MGMT	NM_002412.3	180	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	40/239	131334541	3,13003	2203	4300	6503	SO:0001583	missense	4255							g.chr10:131334541C>T	M29971	CCDS7660.2	10q26	2005-10-06			ENSG00000170430	ENSG00000170430			7059	protein-coding gene	gene with protein product		156569					Standard	NM_002412		Approved		uc001lkh.2	P16455	OTTHUMG00000019261	ENST00000306010.7:c.118C>T	10.37:g.131334541C>T	ENSP00000302111:p.Arg40Cys		Somatic					p.R40C	NM_002412	NP_002403	WXS	Illumina HiSeq	Unspecified	P16455	MGMT_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	2	144	+		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)	9					Q5VY78	Missense_Mutation	SNP	ENST00000306010.7	37	c.118C>T	CCDS7660.2	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406572	0.42715	4.54E-4	1.16E-4	ENSG00000170430	ENST00000306010	T	0.14022	2.54	5.46	0.351	0.16042	.	0.984329	0.08322	N	0.963735	T	0.19167	0.0460	L	0.36672	1.1	0.09310	N	1	D	0.67145	0.996	P	0.56612	0.802	T	0.29882	-0.9997	10	0.42905	T	0.14	.	7.8878	0.29661	0.0:0.501:0.0:0.499	.	40	B4DEE8	.	C	40	ENSP00000302111:R40C	ENSP00000302111:R40C	R	+	1	0	MGMT	131224531	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.089000	0.11180	0.297000	0.22615	-0.253000	0.11424	CGC		0.458	MGMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051009.3	NM_002412		25	76	0	0	0	0.009535	0	25	76				
ANO9	338440	broad.mit.edu	37	11	418979	418979	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:418979C>A	ENST00000332826.6	-	21	2029	c.1945G>T	c.(1945-1947)Ggc>Tgc	p.G649C	SIGIRR_ENST00000332725.3_5'Flank|SIGIRR_ENST00000382520.2_5'Flank|SIGIRR_ENST00000397632.3_5'Flank	NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	649					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TTGACGTAGCCCTTGAGGCAG	0.617																																							uc001lpi.2		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1945-1947)GGC>TGC		tumor protein p53 inducible protein 5							131.0	113.0	119.0					11																	418979		2203	4300	6503	SO:0001583	missense	338440					chloride channel complex	chloride channel activity	g.chr11:418979C>A	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.1945G>T	11.37:g.418979C>A	ENSP00000332788:p.Gly649Cys		Somatic				SIGIRR_uc001lpf.2_5'Flank|SIGIRR_uc001lpe.1_5'Flank|ANO9_uc001lph.2_Missense_Mutation_p.G342C|ANO9_uc010qvv.1_Missense_Mutation_p.G505C	p.G649C	NM_001012302	NP_001012302	WXS	Illumina HiSeq	Unspecified	A1A5B4	ANO9_HUMAN			21	2030	-			649			Extracellular (Potential).		B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	37	c.1945G>T	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	c	15.53	2.861467	0.51482	.	.	ENSG00000185101	ENST00000332826	T	0.65549	-0.16	4.44	2.47	0.30058	.	0.067921	0.56097	D	0.000024	T	0.80660	0.4665	M	0.91510	3.215	0.41508	D	0.988328	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.81597	-0.0860	10	0.87932	D	0	.	9.7982	0.40748	0.0:0.7798:0.1401:0.0801	.	350;649	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	C	649	ENSP00000332788:G649C	ENSP00000332788:G649C	G	-	1	0	ANO9	408979	0.982000	0.34865	0.011000	0.14972	0.362000	0.29581	3.890000	0.56220	0.405000	0.25532	0.478000	0.44815	GGC		0.617	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302		7	148	1	0	8.12818e-05	0.001984	9.41315e-05	7	148				
MUC6	4588	broad.mit.edu	37	11	1018718	1018718	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:1018718G>A	ENST00000421673.2	-	31	4133	c.4083C>T	c.(4081-4083)ggC>ggT	p.G1361G		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1361	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGGACGTGGGCCTGTCGTCT	0.542																																							uc001lsw.2		NA																	0				ovary(1)	1						c.(4081-4083)GGC>GGT		mucin 6, gastric							193.0	208.0	203.0					11																	1018718		2185	4281	6466	SO:0001819	synonymous_variant	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1018718G>A	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4083C>T	11.37:g.1018718G>A			Somatic					p.G1361G	NM_005961	NP_005952	WXS	Illumina HiSeq	Unspecified	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	31	4134	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	1361			Pro-rich.|Thr-rich.		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	c.4083C>T	CCDS44513.1																																																																																				0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		13	118	0	0	0	0.001855	0	13	118				
MUC5AC	4586	broad.mit.edu	37	11	1155162	1155162	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:1155162C>A	ENST00000356191.2	+	3	170	c.170C>A	c.(169-171)gCg>gAg	p.A57E				P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming	57					cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		CTCCGTGGGGCGACTGTCTTC	0.672																																							uc009ycr.1		NA																	0					0						c.(169-171)GCG>GAG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							26.0	28.0	28.0					11																	1155162		875	1990	2865	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1155162C>A	AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000356191.2:c.170C>A	11.37:g.1155162C>A	ENSP00000348519:p.Ala57Glu		Somatic					p.A57E	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	4	296	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	Missense_Mutation	SNP	ENST00000356191.2	37	c.170C>A		.	.	.	.	.	.	.	.	.	.	C	11.88	1.769994	0.31320	.	.	ENSG00000215182	ENST00000534821;ENST00000356191	T;T	0.18657	2.23;2.2	3.46	1.06	0.20224	.	.	.	.	.	T	0.09423	0.0232	N	0.22421	0.69	.	.	.	P	0.44429	0.835	B	0.27608	0.081	T	0.17471	-1.0368	8	0.66056	D	0.02	.	5.7801	0.18301	0.0:0.2362:0.0:0.7638	.	57	A7Y9J9	.	E	57	ENSP00000435591:A57E;ENSP00000348519:A57E	ENSP00000348519:A57E	A	+	2	0	MUC5AC	1145162	0.944000	0.32072	0.030000	0.17652	0.024000	0.10985	0.657000	0.24963	0.105000	0.17753	-0.915000	0.02750	GCG		0.672	MUC5AC-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_001130382		6	23	1	0	0.000157383	0.00308	0.000179622	6	23				
IGF2	3481	broad.mit.edu	37	11	2154748	2154748	+	Splice_Site	SNP	G	G	A	rs369122420		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:2154748G>A	ENST00000416167.2	-	3	1471	c.305C>T	c.(304-306)cCg>cTg	p.P102L	IGF2_ENST00000300632.5_Splice_Site_p.P102L|IGF2_ENST00000381406.4_Splice_Site_p.P105L|IGF2_ENST00000434045.2_Splice_Site_p.P158L|IGF2_ENST00000381392.1_Splice_Site_p.P105L|IGF2_ENST00000381395.1_Splice_Site_p.P102L|IGF2_ENST00000381389.1_Splice_Site_p.P102L|IGF2_ENST00000418738.2_Splice_Site_p.P102L|MIR483_ENST00000385070.1_RNA			P01344	IGF2_HUMAN	insulin-like growth factor 2	102					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)			central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		GACCCTCACCGGAAGCACGGT	0.642																																							uc009yde.2		NA																	0				central_nervous_system(1)	1						c.(304-306)CCG>CTG		insulin-like growth factor 2 isoform 1			LEU/PRO,LEU/PRO,LEU/PRO	0,4404		0,0,2202	36.0	34.0	35.0		305,305,473	2.7	1.0	11		35	1,8595	1.2+/-3.3	0,1,4297	no	missense-near-splice,missense-near-splice,missense-near-splice	IGF2	NM_000612.4,NM_001007139.4,NM_001127598.1	98,98,98	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	102/181,102/181,158/237	2154748	1,12999	2202	4298	6500	SO:0001630	splice_region_variant	3481				glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity	g.chr11:2154748G>A	M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000416167.2:c.306+1C>T	11.37:g.2154748G>A			Somatic				IGF2_uc001lvf.2_RNA|IGF2_uc001lvg.2_Missense_Mutation_p.P102L|IGF2_uc009ydf.2_Missense_Mutation_p.P158L|IGF2_uc001lvh.2_Missense_Mutation_p.P102L|INS-IGF2_uc001lvi.2_RNA	p.P102L	NM_001007139	NP_001007140	WXS	Illumina HiSeq	Unspecified	P01344	IGF2_HUMAN	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)	3	408	-		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	102					B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	Missense_Mutation	SNP	ENST00000416167.2	37	c.305C>T	CCDS7728.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239368	0.79800	0.0	1.16E-4	ENSG00000167244	ENST00000381395;ENST00000381406;ENST00000416167;ENST00000300632;ENST00000381319;ENST00000434045;ENST00000381392;ENST00000381389;ENST00000418738;ENST00000337883;ENST00000381379	D;D;D;D;D;D;D;D;D	0.92495	-2.98;-2.93;-2.98;-2.98;-3.05;-2.93;-2.98;-2.98;-2.98	2.7	2.7	0.31948	Insulin-like growth factor II E-peptide, C-terminal (1);	0.300603	0.29846	U	0.011049	D	0.90669	0.7073	M	0.86097	2.795	0.80722	D	1	P;D	0.61697	0.802;0.99	B;B	0.43123	0.176;0.409	D	0.88426	0.3032	10	0.13853	T	0.58	-8.3459	10.5386	0.45020	0.0:0.0:1.0:0.0	.	158;102	C9JAF2;P01344	.;IGF2_HUMAN	L	102;105;102;102;105;158;105;102;102;102;105	ENSP00000370802:P102L;ENSP00000370813:P105L;ENSP00000414497:P102L;ENSP00000300632:P102L;ENSP00000391826:P158L;ENSP00000370799:P105L;ENSP00000370796:P102L;ENSP00000402047:P102L;ENSP00000338297:P102L	ENSP00000300632:P102L	P	-	2	0	IGF2	2111324	0.998000	0.40836	0.996000	0.52242	0.960000	0.62799	-0.232000	0.09055	1.556000	0.49512	0.450000	0.29827	CCG		0.642	IGF2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026053.2	NM_000612	Missense_Mutation	4	27	0	0	0	0.009096	0	4	27				
CD81	975	broad.mit.edu	37	11	2398821	2398821	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:2398821C>T	ENST00000263645.5	+	1	298	c.42C>T	c.(40-42)ctC>ctT	p.L14L	AC129929.5_ENST00000413483.1_RNA	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	14					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		AGTACCTGCTCTTCGTCTTCA	0.741																																							uc001lwf.1		NA																	0					0						c.(40-42)CTC>CTT		CD81 antigen							27.0	19.0	22.0					11																	2398821		2168	4274	6442	SO:0001819	synonymous_variant	975				activation of MAPK activity|cell proliferation|phosphatidylinositol biosynthetic process|positive regulation of 1-phosphatidylinositol 4-kinase activity|positive regulation of cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization|regulation of immune response|virion attachment, binding of host cell surface receptor	integral to plasma membrane	protein binding	g.chr11:2398821C>T		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.42C>T	11.37:g.2398821C>T			Somatic				uc001lwe.2_RNA	p.L14L	NM_004356	NP_004347	WXS	Illumina HiSeq	Unspecified	P60033	CD81_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)	1	275	+		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)	14			Helical; (Potential).		P18582|Q5U0J6	Silent	SNP	ENST00000263645.5	37	c.42C>T	CCDS7734.1																																																																																				0.741	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027357.4	NM_004356		9	29	0	0	0	0.008291	0	9	29				
ZNF195	7748	broad.mit.edu	37	11	3380678	3380678	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:3380678C>T	ENST00000399602.4	-	6	1686	c.1560G>A	c.(1558-1560)aaG>aaA	p.K520K	ZNF195_ENST00000005082.9_Silent_p.K497K|ZNF195_ENST00000343338.7_Silent_p.K452K|ZNF195_ENST00000526601.1_Silent_p.K501K|ZNF195_ENST00000429541.2_Silent_p.K452K|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000354599.6_Silent_p.K448K	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATTTGTAGGGCTTCTCTCCAG	0.403																																							uc001lxt.2		NA																	0					0						c.(1558-1560)AAG>AAA		zinc finger protein 195 isoform 1							168.0	171.0	170.0					11																	3380678		2064	4218	6282	SO:0001819	synonymous_variant	7748				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:3380678C>T		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1560G>A	11.37:g.3380678C>T			Somatic				uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Silent_p.K497K|ZNF195_uc001lxs.2_Silent_p.K448K|ZNF195_uc010qxr.1_Silent_p.K501K|ZNF195_uc009ydz.2_Silent_p.K475K|ZNF195_uc001lxu.2_Silent_p.K452K	p.K520K	NM_001130520	NP_001123992	WXS	Illumina HiSeq	Unspecified	O14628	ZN195_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	6	1738	-		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)	520					A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	37	c.1560G>A	CCDS44522.1																																																																																				0.403	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			5	194	0	0	0	0.000602	0	5	194				
OR52M1	119772	broad.mit.edu	37	11	4566498	4566498	+	Missense_Mutation	SNP	C	C	G	rs559376682		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:4566498C>G	ENST00000360213.1	+	1	78	c.78C>G	c.(76-78)caC>caG	p.H26Q		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H26H(2)		endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGTCCCTACACGTCTGGCTCT	0.537																																							uc010qyf.1		NA																	2	Substitution - coding silent(2)		upper_aerodigestive_tract(1)|lung(1)		0						c.(76-78)CAC>CAG		olfactory receptor, family 52, subfamily M,							106.0	96.0	99.0					11																	4566498		2201	4298	6499	SO:0001583	missense	119772				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4566498C>G	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.78C>G	11.37:g.4566498C>G	ENSP00000353343:p.His26Gln		Somatic					p.H26Q	NM_001004137	NP_001004137	WXS	Illumina HiSeq	Unspecified	Q8NGK5	O52M1_HUMAN		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	78	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	26			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000360213.1	37	c.78C>G	CCDS31353.1	.	.	.	.	.	.	.	.	.	.	C	8.699	0.909165	0.17833	.	.	ENSG00000197790	ENST00000360213	T	0.00318	8.12	4.82	-8.14	0.01069	.	0.000000	0.49916	D	0.000140	T	0.00210	0.0006	N	0.12831	0.26	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.45220	-0.9276	10	0.39692	T	0.17	.	10.2001	0.43077	0.095:0.2926:0.0:0.6124	.	26	Q8NGK5	O52M1_HUMAN	Q	26	ENSP00000353343:H26Q	ENSP00000353343:H26Q	H	+	3	2	OR52M1	4523074	0.000000	0.05858	0.001000	0.08648	0.137000	0.21094	-3.441000	0.00470	-1.690000	0.01432	-0.741000	0.03529	CAC		0.537	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137		4	86	0	0	0	0.001168	0	4	86				
OR52A5	390054	broad.mit.edu	37	11	5153137	5153137	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:5153137C>T	ENST00000307388.1	-	1	735	c.736G>A	c.(736-738)Gcc>Acc	p.A246T		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	246					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A246T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		CAAATGTGGGCAATGCATGTA	0.398																																							uc010qyx.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|lung(1)|central_nervous_system(1)	4						c.(736-738)GCC>ACC		olfactory receptor, family 52, subfamily A,							138.0	123.0	128.0					11																	5153137		2201	4298	6499	SO:0001583	missense	390054				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5153137C>T	BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.736G>A	11.37:g.5153137C>T	ENSP00000303469:p.Ala246Thr		Somatic					p.A246T	NM_001005160	NP_001005160	WXS	Illumina HiSeq	Unspecified	Q9H2C5	O52A5_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)	1	736	-		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)	246			Helical; Name=6; (Potential).			Missense_Mutation	SNP	ENST00000307388.1	37	c.736G>A	CCDS31373.1	.	.	.	.	.	.	.	.	.	.	C	9.802	1.180892	0.21787	.	.	ENSG00000171944	ENST00000307388	T	0.37235	1.21	5.22	2.23	0.28157	GPCR, rhodopsin-like superfamily (1);	0.284436	0.25272	N	0.031870	T	0.27933	0.0688	L	0.37800	1.135	0.21740	N	0.999566	B	0.21071	0.051	B	0.30782	0.12	T	0.27706	-1.0066	10	0.72032	D	0.01	.	6.2373	0.20770	0.2224:0.6228:0.0:0.1548	.	246	Q9H2C5	O52A5_HUMAN	T	246	ENSP00000303469:A246T	ENSP00000303469:A246T	A	-	1	0	OR52A5	5109713	0.062000	0.20869	0.995000	0.50966	0.318000	0.28184	0.325000	0.19628	0.788000	0.33755	-0.140000	0.14226	GCC		0.398	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142823.1	NM_001005160		18	66	0	0	0	0.007413	0	18	66				
NLRP10	338322	broad.mit.edu	37	11	7981425	7981425	+	Silent	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:7981425A>T	ENST00000328600.2	-	2	1895	c.1734T>A	c.(1732-1734)ggT>ggA	p.G578G		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	578					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCATCTGAATACCTTTTACCA	0.343																																							uc001mfv.1		NA																	0				lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1732-1734)GGT>GGA		NLR family, pyrin domain containing 10							67.0	68.0	68.0					11																	7981425		2201	4296	6497	SO:0001819	synonymous_variant	338322						ATP binding	g.chr11:7981425A>T	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1734T>A	11.37:g.7981425A>T			Somatic					p.G578G	NM_176821	NP_789791	WXS	Illumina HiSeq	Unspecified	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1751	-			578					Q2M3C4|Q6JGT0	Silent	SNP	ENST00000328600.2	37	c.1734T>A	CCDS7784.1																																																																																				0.343	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		8	33	0	0	0	0.004482	0	8	33				
CKAP5	9793	broad.mit.edu	37	11	46831310	46831310	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:46831310C>A	ENST00000529230.1	-	6	791	c.745G>T	c.(745-747)Ggt>Tgt	p.G249C	CKAP5_ENST00000354558.3_Missense_Mutation_p.G249C|CKAP5_ENST00000312055.5_Missense_Mutation_p.G249C|CKAP5_ENST00000415402.1_Missense_Mutation_p.G249C			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	249					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GCATCTCCACCAGCAGACTGT	0.428																																					Ovarian(4;85 273 2202 4844 13323)	Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1		NA																	0				ovary(1)|skin(1)	2						c.(745-747)GGT>TGT		colonic and hepatic tumor over-expressed protein							213.0	203.0	207.0					11																	46831310		2201	4299	6500	SO:0001583	missense	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46831310C>A		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.745G>T	11.37:g.46831310C>A	ENSP00000432768:p.Gly249Cys		Somatic				CKAP5_uc009ylg.1_Missense_Mutation_p.G135C|CKAP5_uc001ndj.1_Missense_Mutation_p.G249C	p.G249C	NM_001008938	NP_001008938	WXS	Illumina HiSeq	Unspecified	Q14008	CKAP5_HUMAN			6	855	-			249					Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	c.745G>T	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616092	0.87359	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000378629;ENST00000354558	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	M	0.87097	2.86	0.80722	D	1	D;D;B	0.89917	0.977;1.0;0.037	P;D;B	0.72075	0.735;0.976;0.023	T	0.73678	-0.3907	10	0.54805	T	0.06	-35.0386	19.9844	0.97341	0.0:1.0:0.0:0.0	.	249;249;249	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	C	249	ENSP00000432768:G249C;ENSP00000395302:G249C;ENSP00000310227:G249C;ENSP00000346566:G249C	ENSP00000310227:G249C	G	-	1	0	CKAP5	46787886	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.720000	0.54933	2.724000	0.93272	0.650000	0.86243	GGT		0.428	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756		41	218	1	0	1.93748e-29	0.01441	2.86529e-29	41	218				
AGBL2	79841	broad.mit.edu	37	11	47681733	47681733	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:47681733A>G	ENST00000525123.1	-	19	2986	c.2701T>C	c.(2701-2703)Tac>Cac	p.Y901H	AGBL2_ENST00000298861.4_Missense_Mutation_p.Y901H|AGBL2_ENST00000357610.3_Missense_Mutation_p.Y903H	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	901						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						ACCTACGGGTATGTGTATATG	0.512																																							uc001ngg.2		NA																	0				ovary(2)	2						c.(2701-2703)TAC>CAC		carboxypeptidase 2, cytosolic							129.0	111.0	117.0					11																	47681733		2201	4298	6499	SO:0001583	missense	79841				proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding	g.chr11:47681733A>G		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.2701T>C	11.37:g.47681733A>G	ENSP00000435582:p.Tyr901His		Somatic				AGBL2_uc001ngf.2_RNA	p.Y901H	NM_024783	NP_079059	WXS	Illumina HiSeq	Unspecified	Q5U5Z8	CBPC2_HUMAN			18	2801	-			901					A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	c.2701T>C	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.976639	0.74360	.	.	ENSG00000165923	ENST00000528609;ENST00000525123;ENST00000357610;ENST00000298861	T;T;T	0.12569	2.67;2.67;2.67	4.79	4.79	0.61399	.	0.179764	0.27379	N	0.019637	T	0.24967	0.0606	L	0.32530	0.975	0.26836	N	0.968482	D	0.76494	0.999	D	0.83275	0.996	T	0.02385	-1.1167	10	0.87932	D	0	-18.4973	10.947	0.47306	1.0:0.0:0.0:0.0	.	901	Q5U5Z8	CBPC2_HUMAN	H	284;901;903;901	ENSP00000435582:Y901H;ENSP00000350228:Y903H;ENSP00000298861:Y901H	ENSP00000298861:Y901H	Y	-	1	0	AGBL2	47638309	0.991000	0.36638	0.971000	0.41717	0.197000	0.23852	3.912000	0.56386	2.146000	0.66826	0.378000	0.23410	TAC		0.512	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783		19	63	0	0	0	0.010504	0	19	63				
OR4X2	119764	broad.mit.edu	37	11	48266905	48266905	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:48266905A>G	ENST00000302329.3	+	1	298	c.250A>G	c.(250-252)Ata>Gta	p.I84V		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						AAGGAAAGTCATATCTTGGTG	0.502																																							uc001ngs.1		NA																	0					0						c.(250-252)ATA>GTA		olfactory receptor, family 4, subfamily X,							125.0	122.0	123.0					11																	48266905		2201	4298	6499	SO:0001583	missense	119764				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48266905A>G	AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.250A>G	11.37:g.48266905A>G	ENSP00000307751:p.Ile84Val		Somatic					p.I84V	NM_001004727	NP_001004727	WXS	Illumina HiSeq	Unspecified	Q8NGF9	OR4X2_HUMAN			1	250	+			84			Extracellular (Potential).		B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	ENST00000302329.3	37	c.250A>G	CCDS31486.1	.	.	.	.	.	.	.	.	.	.	A	9.377	1.071938	0.20147	.	.	ENSG00000172208	ENST00000302329	T	0.00469	7.21	5.37	5.37	0.77165	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000021	T	0.00637	0.0021	M	0.78637	2.42	0.27960	N	0.936795	P	0.35612	0.512	B	0.34038	0.174	T	0.29822	-0.9999	10	0.72032	D	0.01	.	13.3324	0.60495	1.0:0.0:0.0:0.0	.	84	Q8NGF9	OR4X2_HUMAN	V	84	ENSP00000307751:I84V	ENSP00000307751:I84V	I	+	1	0	OR4X2	48223481	0.982000	0.34865	0.019000	0.16419	0.070000	0.16714	2.908000	0.48750	2.020000	0.59435	0.528000	0.53228	ATA		0.502	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383376.2	NM_001004727		11	124	0	0	0	0.010729	0	11	124				
OR4A15	81328	broad.mit.edu	37	11	55136267	55136267	+	Missense_Mutation	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:55136267T>A	ENST00000314706.3	+	1	908	c.908T>A	c.(907-909)cTa>cAa	p.L303Q		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						ACTGTAGTTCTAACTTTTATA	0.383																																							uc010rif.1		NA																	0				ovary(1)|skin(1)	2						c.(907-909)CTA>CAA		olfactory receptor, family 4, subfamily A,							210.0	212.0	211.0					11																	55136267		2201	4296	6497	SO:0001583	missense	81328				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55136267T>A	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.908T>A	11.37:g.55136267T>A	ENSP00000325065:p.Leu303Gln		Somatic					p.L303Q	NM_001005275	NP_001005275	WXS	Illumina HiSeq	Unspecified	Q8NGL6	O4A15_HUMAN			1	908	+			303			Helical; Name=7; (Potential).		Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	c.908T>A	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	15.46	2.841620	0.51057	.	.	ENSG00000181958	ENST00000314706	T	0.00198	8.57	3.65	-7.29	0.01451	GPCR, rhodopsin-like superfamily (1);	0.525965	0.15822	N	0.242976	T	0.00178	0.0005	N	0.19112	0.55	0.09310	N	1	D	0.54207	0.965	P	0.57425	0.82	T	0.40213	-0.9575	10	0.87932	D	0	.	8.4545	0.32890	0.7134:0.0:0.103:0.1836	.	303	Q8NGL6	O4A15_HUMAN	Q	303	ENSP00000325065:L303Q	ENSP00000325065:L303Q	L	+	2	0	OR4A15	54892843	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.074000	0.14662	-1.837000	0.01189	0.403000	0.27427	CTA		0.383	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275		54	216	0	0	0	0.01441	0	54	216				
OR5I1	10798	broad.mit.edu	37	11	55703101	55703101	+	Missense_Mutation	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:55703101A>C	ENST00000301532.3	-	1	775	c.776T>G	c.(775-777)tTt>tGt	p.F259C		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	259					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TGAGTAAATAAAGAGGAGAGT	0.433																																							uc010ris.1		NA																	0				ovary(1)	1						c.(775-777)TTT>TGT		olfactory receptor, family 5, subfamily I,							73.0	72.0	72.0					11																	55703101		2201	4296	6497	SO:0001583	missense	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703101A>C	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.776T>G	11.37:g.55703101A>C	ENSP00000301532:p.Phe259Cys		Somatic					p.F259C	NM_006637	NP_006628	WXS	Illumina HiSeq	Unspecified	Q13606	OR5I1_HUMAN			1	776	-			259			Helical; Name=6; (Potential).		Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	c.776T>G	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115859	0.37339	.	.	ENSG00000167825	ENST00000301532	T	0.00287	8.29	5.16	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000158	T	0.00552	0.0018	M	0.71581	2.175	0.27662	N	0.947047	D	0.89917	1.0	D	0.87578	0.998	T	0.43032	-0.9416	10	0.52906	T	0.07	.	9.2349	0.37459	0.913:0.0:0.087:0.0	.	259	Q13606	OR5I1_HUMAN	C	259	ENSP00000301532:F259C	ENSP00000301532:F259C	F	-	2	0	OR5I1	55459677	0.001000	0.12720	0.504000	0.27639	0.454000	0.32378	1.394000	0.34509	0.898000	0.36418	0.523000	0.50628	TTT		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		5	29	0	0	0	0.001168	0	5	29				
OR7E5P	219445	broad.mit.edu	37	11	55747330	55747330	+	IGR	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:55747330C>A								OR10AG1 (11340 upstream) : OR5F1 (13826 downstream)																							GGGACCGTGGCCGAGGTGAAA	0.532																																							uc010riu.1		NA																	0					0						c.(127-129)GCC>TCC		SubName: Full=HCG2036849; SubName: Full=Seven transmembrane helix receptor;																																				SO:0001628	intergenic_variant	219445							g.chr11:55747330C>A																													11.37:g.55747330C>A			Somatic					p.A43S	NR_027688		WXS	Illumina HiSeq	Unspecified					4	682	-									Missense_Mutation	SNP		37	c.127G>T																																																																																				0	0.532									7	27	1	0	0.000157383	0.00308	0.000179622	7	27				
FCHSD2	9873	broad.mit.edu	37	11	72712069	72712069	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:72712069G>A	ENST00000409418.4	-	5	736	c.353C>T	c.(352-354)aCa>aTa	p.T118I	FCHSD2_ENST00000409314.1_Missense_Mutation_p.T118I|FCHSD2_ENST00000409853.1_Missense_Mutation_p.T62I|FCHSD2_ENST00000311172.7_Missense_Mutation_p.T62I|FCHSD2_ENST00000458644.2_Intron	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	118										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			GCTTCTCACTGTCCTTGCAGG	0.363																																							uc009ytl.2		NA																	0				ovary(1)	1						c.(352-354)ACA>ATA		FCH and double SH3 domains 2							72.0	72.0	72.0					11																	72712069		2200	4293	6493	SO:0001583	missense	9873						protein binding	g.chr11:72712069G>A	AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.353C>T	11.37:g.72712069G>A	ENSP00000386722:p.Thr118Ile		Somatic				FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Missense_Mutation_p.T62I|FCHSD2_uc001oti.2_Missense_Mutation_p.T77I	p.T118I	NM_014824	NP_055639	WXS	Illumina HiSeq	Unspecified	O94868	FCSD2_HUMAN	BRCA - Breast invasive adenocarcinoma(5;3.3e-05)		5	574	-			118					B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Missense_Mutation	SNP	ENST00000409418.4	37	c.353C>T	CCDS8218.2	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787372	0.49997	.	.	ENSG00000137478	ENST00000311172;ENST00000409314;ENST00000409418;ENST00000409853;ENST00000422375	T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51	5.97	5.97	0.96955	.	0.199298	0.51477	D	0.000081	T	0.12092	0.0294	L	0.27053	0.805	0.36590	D	0.874045	B;B	0.16396	0.017;0.002	B;B	0.12156	0.005;0.007	T	0.11567	-1.0582	10	0.35671	T	0.21	-12.3167	16.4495	0.83974	0.0:0.131:0.869:0.0	.	118;62	O94868;O94868-3	FCSD2_HUMAN;.	I	62;118;118;62;97	ENSP00000308978:T62I;ENSP00000386987:T118I;ENSP00000386722:T118I;ENSP00000386314:T62I;ENSP00000408706:T97I	ENSP00000308978:T62I	T	-	2	0	FCHSD2	72389717	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.324000	0.65863	2.835000	0.97688	0.591000	0.81541	ACA		0.363	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824		6	20	0	0	0	0.001168	0	6	20				
FZD4	8322	broad.mit.edu	37	11	86662523	86662523	+	Silent	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:86662523T>G	ENST00000531380.1	-	2	1580	c.1275A>C	c.(1273-1275)acA>acC	p.T425T	PRSS23_ENST00000533902.2_3'UTR|PRSS23_ENST00000531521.1_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	425					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGTCTGTCTTTGTCCCATCCT	0.413																																							uc001pce.2		NA																	0				large_intestine(1)	1						c.(1273-1275)ACA>ACC		frizzled 4 precursor							161.0	146.0	151.0					11																	86662523		2201	4299	6500	SO:0001819	synonymous_variant	8322				canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|negative regulation of cell-substrate adhesion|neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|progesterone secretion|regulation of vascular endothelial growth factor receptor signaling pathway|substrate adhesion-dependent cell spreading|vasculogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cell projection|cell surface|cytoplasm	cytokine binding|G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding	g.chr11:86662523T>G	AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1275A>C	11.37:g.86662523T>G			Somatic				PRSS23_uc001pcc.1_RNA	p.T425T	NM_012193	NP_036325	WXS	Illumina HiSeq	Unspecified	Q9ULV1	FZD4_HUMAN			2	1581	-		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	425			Cytoplasmic (Potential).		A8K9Q3|Q14C97|Q6S9E4	Silent	SNP	ENST00000531380.1	37	c.1275A>C	CCDS8279.1																																																																																				0.413	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2	NM_012193		27	109	0	0	0	0.004656	0	27	109				
TYR	7299	broad.mit.edu	37	11	88911689	88911689	+	Missense_Mutation	SNP	G	G	A	rs61754361|rs281865525		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:88911689G>A	ENST00000263321.5	+	1	1070	c.568G>A	c.(568-570)Ggg>Agg	p.G190R	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	190					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TGCACTGCTTGGGGGATCTGA	0.423																																							uc001pcs.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(568-570)GGG>AGG		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						193.0	180.0	185.0					11																	88911689		2201	4299	6500	SO:0001583	missense	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:88911689G>A	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.568G>A	11.37:g.88911689G>A	ENSP00000263321:p.Gly190Arg		Somatic					p.G190R	NM_000372	NP_000363	WXS	Illumina HiSeq	Unspecified	P14679	TYRO_HUMAN			1	650	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	190			Lumenal, melanosome (Potential).		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	c.568G>A	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475619	0.84640	.	.	ENSG00000077498	ENST00000263321	D	0.98987	-5.3	6.07	6.07	0.98685	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.99381	0.9782	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99282	1.0896	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	190	P14679	TYRO_HUMAN	R	190	ENSP00000263321:G190R	.	G	+	1	0	TYR	88551337	1.000000	0.71417	0.948000	0.38648	0.768000	0.43524	9.357000	0.97099	2.885000	0.99019	0.655000	0.94253	GGG		0.423	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		13	147	0	0	0	0.00245	0	13	147				
DSCAML1	57453	broad.mit.edu	37	11	117335702	117335702	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:117335702G>A	ENST00000321322.6	-	17	3402	c.3401C>T	c.(3400-3402)aCg>aTg	p.T1134M	DSCAML1_ENST00000527706.1_Missense_Mutation_p.T864M	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1074	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGAGGGCCCCGTGCCAGCCCG	0.622																																							uc001prh.1		NA																	0				ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(3400-3402)ACG>ATG		Down syndrome cell adhesion molecule like 1							93.0	76.0	82.0					11																	117335702		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117335702G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3401C>T	11.37:g.117335702G>A	ENSP00000315465:p.Thr1134Met		Somatic					p.T1134M	NM_020693	NP_065744	WXS	Illumina HiSeq	Unspecified	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	17	3403	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	1074			Extracellular (Potential).|Fibronectin type-III 2.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.3401C>T	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072527	0.55646	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.54071	0.59;0.59	4.78	4.78	0.61160	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53514	0.1801	L	0.39397	1.21	0.80722	D	1	B	0.34372	0.451	B	0.42112	0.376	T	0.56080	-0.8038	9	0.49607	T	0.09	.	18.0015	0.89199	0.0:0.0:1.0:0.0	.	1074	Q8TD84	DSCL1_HUMAN	M	864;1134;841	ENSP00000434335:T864M;ENSP00000315465:T1134M	ENSP00000315465:T1134M	T	-	2	0	DSCAML1	116840912	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.460000	0.73518	2.480000	0.83734	0.561000	0.74099	ACG		0.622	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		10	73	0	0	0	0.010729	0	10	73				
OR8B3	390271	broad.mit.edu	37	11	124266624	124266624	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:124266624C>A	ENST00000354597.3	-	1	640	c.624G>T	c.(622-624)atG>atT	p.M208I		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AACTGGGTACCATGATATTAA	0.418																																							uc010saj.1		NA																	0				ovary(1)|skin(1)	2						c.(622-624)ATG>ATT		olfactory receptor, family 8, subfamily B,							160.0	167.0	165.0					11																	124266624		2201	4299	6500	SO:0001583	missense	390271				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124266624C>A	AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.624G>T	11.37:g.124266624C>A	ENSP00000346611:p.Met208Ile		Somatic				OR8B2_uc001qab.3_Intron	p.M208I	NM_001005467	NP_001005467	WXS	Illumina HiSeq	Unspecified	Q8NGG8	OR8B3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	624	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	208			Helical; Name=5; (Potential).		Q6IFQ8|Q8NGH1	Missense_Mutation	SNP	ENST00000354597.3	37	c.624G>T	CCDS31709.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-3.297679	0.00019	.	.	ENSG00000196661	ENST00000354597	T	0.34275	1.37	3.62	-4.26	0.03755	GPCR, rhodopsin-like superfamily (1);	0.343133	0.26196	N	0.025780	T	0.06781	0.0173	N	0.01522	-0.82	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26052	-1.0114	10	0.02654	T	1	.	0.6419	0.00812	0.2825:0.2533:0.286:0.1782	.	208	Q8NGG8	OR8B3_HUMAN	I	208	ENSP00000346611:M208I	ENSP00000346611:M208I	M	-	3	0	OR8B3	123771834	0.000000	0.05858	0.245000	0.24217	0.001000	0.01503	-2.690000	0.00831	-0.748000	0.04753	-1.654000	0.00755	ATG		0.418	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387291.1	NM_001005467		4	173	1	0	0.00909568	0.009096	0.00974537	4	173				
SIAE	54414	broad.mit.edu	37	11	124509640	124509640	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr11:124509640T>C	ENST00000263593.3	-	8	1262	c.1090A>G	c.(1090-1092)Atg>Gtg	p.M364V	SIAE_ENST00000545756.1_Missense_Mutation_p.M329V			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	364					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		CAGAGATCCATAGCTACAGCC	0.468																																							uc001qan.2		NA																	0					0						c.(1090-1092)ATG>GTG		sialate O-acetylesterase precursor							191.0	159.0	170.0					11																	124509640		2201	4299	6500	SO:0001583	missense	54414					extracellular region|lysosome	carboxylesterase activity|sialate O-acetylesterase activity	g.chr11:124509640T>C	AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.1090A>G	11.37:g.124509640T>C	ENSP00000263593:p.Met364Val		Somatic					p.M364V	NM_170601	NP_733746	WXS	Illumina HiSeq	Unspecified	Q9HAT2	SIAE_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)	8	1203	-	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	364					B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	ENST00000263593.3	37	c.1090A>G	CCDS8449.1	.	.	.	.	.	.	.	.	.	.	T	1.525	-0.545867	0.04024	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	D;D	0.94497	-3.44;-3.44	5.92	3.45	0.39498	Esterase, SGNH hydrolase-type (1);	0.273189	0.41500	N	0.000871	D	0.86830	0.6027	N	0.21194	0.64	0.30507	N	0.76983	B	0.11235	0.004	B	0.09377	0.004	T	0.75241	-0.3387	10	0.13470	T	0.59	-4.5725	7.6968	0.28600	0.0:0.0771:0.1379:0.785	.	364	Q9HAT2	SIAE_HUMAN	V	364;329	ENSP00000263593:M364V;ENSP00000437877:M329V	ENSP00000263593:M364V	M	-	1	0	SIAE	124014850	0.345000	0.24835	0.802000	0.32245	0.074000	0.17049	0.470000	0.22084	0.422000	0.26005	0.528000	0.53228	ATG		0.468	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387070.1	NM_170601		14	131	0	0	0	0.003163	0	14	131				
B4GALNT3	283358	broad.mit.edu	37	12	662435	662435	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:662435A>T	ENST00000266383.5	+	14	1359	c.1346A>T	c.(1345-1347)aAt>aTt	p.N449I		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	449					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			AACAACCAGAATGCCAGGATG	0.547																																							uc001qii.1		NA																	0				ovary(1)|skin(1)	2						c.(1345-1347)AAT>ATT		beta							79.0	88.0	85.0					12																	662435		2203	4300	6503	SO:0001583	missense	283358					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity	g.chr12:662435A>T	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.1346A>T	12.37:g.662435A>T	ENSP00000266383:p.Asn449Ile		Somatic				B4GALNT3_uc001qij.1_Missense_Mutation_p.N352I|B4GALNT3_uc001qik.1_5'UTR	p.N449I	NM_173593	NP_775864	WXS	Illumina HiSeq	Unspecified	Q6L9W6	B4GN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)		14	1346	+	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		449			Lumenal (Potential).		Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	c.1346A>T	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	A	11.10	1.539829	0.27563	.	.	ENSG00000139044	ENST00000266383;ENST00000322843	T;T	0.32515	3.47;1.45	5.61	1.77	0.24775	.	0.989634	0.08253	N	0.974294	T	0.21387	0.0515	L	0.44542	1.39	0.09310	N	1	P;B	0.41265	0.744;0.201	B;B	0.35859	0.212;0.075	T	0.20273	-1.0280	10	0.39692	T	0.17	0.2811	3.258	0.06839	0.5325:0.2117:0.2557:0.0	.	352;449	E9PHD9;Q6L9W6	.;B4GN3_HUMAN	I	449;352	ENSP00000266383:N449I;ENSP00000322953:N352I	ENSP00000266383:N449I	N	+	2	0	B4GALNT3	532696	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.833000	0.27504	0.962000	0.38057	-0.256000	0.11100	AAT		0.547	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593		28	188	0	0	0	0.007291	0	28	188				
CACNA2D4	93589	broad.mit.edu	37	12	1955760	1955760	+	Splice_Site	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:1955760C>T	ENST00000382722.5	-	24	2704	c.2342G>A	c.(2341-2343)aGg>aAg	p.R781K	CACNA2D4_ENST00000539048.2_5'UTR|CACNA2D4_ENST00000588077.1_Splice_Site_p.R717K|CACNA2D4_ENST00000587995.1_Splice_Site_p.R756K|CACNA2D4_ENST00000585708.1_Splice_Site_p.R717K|CACNA2D4_ENST00000585732.1_Splice_Site_p.R642K|CACNA2D4_ENST00000586184.1_Splice_Site_p.R781K	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	781					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCCAACCCACCTGTCGGAGAC	0.662																																					Colon(2;101 179 21030 23310 28141)	Colon(2;101 179 21030 23310 28141)	uc001qjp.2		NA																	0				ovary(1)	1						c.(2341-2343)AGG>AAG		voltage-gated calcium channel alpha(2)delta-4							32.0	38.0	36.0					12																	1955760		2013	4161	6174	SO:0001630	splice_region_variant	93589					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr12:1955760C>T	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2342+1G>A	12.37:g.1955760C>T			Somatic				CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.R645K|CACNA2D4_uc009zdr.1_RNA	p.R781K	NM_172364	NP_758952	WXS	Illumina HiSeq	Unspecified	Q7Z3S7	CA2D4_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)	24	2573	-	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	781			Extracellular (Potential).		Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	c.2342G>A	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	6.562	0.471918	0.12461	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.05996	3.36	5.33	3.24	0.37175	.	0.149851	0.64402	N	0.000012	T	0.02767	0.0083	N	0.04724	-0.175	0.38406	D	0.945807	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.46400	-0.9194	9	.	.	.	.	7.0713	0.25179	0.0:0.8046:0.0:0.1954	.	781;781	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	K	717;781;781	ENSP00000372169:R781K	.	R	-	2	0	CACNA2D4	1826021	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	0.906000	0.28517	1.079000	0.41038	0.563000	0.77884	AGG		0.662	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		Missense_Mutation	3	14	0	0	0	0.009096	0	3	14				
VWF	7450	broad.mit.edu	37	12	6103686	6103686	+	Silent	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:6103686T>G	ENST00000261405.5	-	36	6405	c.6151A>C	c.(6151-6153)Aga>Cga	p.R2051R		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2051	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGATTGAATCTGACCTCATGC	0.473																																							uc001qnn.1		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(6151-6153)AGA>CGA		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						351.0	261.0	292.0					12																	6103686		2203	4300	6503	SO:0001819	synonymous_variant	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6103686T>G		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6151A>C	12.37:g.6103686T>G			Somatic				VWF_uc010set.1_Intron	p.R2051R	NM_000552	NP_000543	WXS	Illumina HiSeq	Unspecified	P04275	VWF_HUMAN			36	6401	-			2051			VWFD 4.		Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	c.6151A>C	CCDS8539.1																																																																																				0.473	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		23	129	0	0	0	0.00333	0	23	129				
PRB3	5544	broad.mit.edu	37	12	11421043	11421043	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:11421043G>A	ENST00000279573.7	-	3	275	c.140C>T	c.(139-141)cCc>cTc	p.P47L	PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000538488.1_Missense_Mutation_p.P47L|PRB3_ENST00000381842.3_Missense_Mutation_p.P47L			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	47	Pro-rich.			PQRTPPP -> SQGPPPR (in Ref. 1; CAA30728). {ECO:0000305}.	defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			GGTACGTTGGGGCTGGTTTCC	0.572																																							uc001qzs.2		NA																	0				skin(1)	1						c.(139-141)CCC>CTC		proline-rich protein BstNI subfamily 3							142.0	139.0	140.0					12																	11421043		2190	4292	6482	SO:0001583	missense	5544					extracellular region	Gram-negative bacterial cell surface binding	g.chr12:11421043G>A			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.140C>T	12.37:g.11421043G>A	ENSP00000279573:p.Pro47Leu		Somatic				PRB4_uc001qzf.1_Intron	p.P47L	NM_006249	NP_006240	WXS	Illumina HiSeq	Unspecified	Q04118	PRB3_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.201)		3	178	-			47	PQRTPPP -> SQGPPPR (in Ref. 1; CAA30728).		Pro-rich.		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	ENST00000279573.7	37	c.140C>T		.	.	.	.	.	.	.	.	.	.	.	5.213	0.224827	0.09916	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.04406	3.63;3.63	0.714	-1.43	0.08884	.	1.624350	0.05275	U	0.518350	T	0.04003	0.0112	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.45234	-0.9275	9	0.72032	D	0.01	.	1.6884	0.02846	0.2777:0.0:0.4013:0.321	.	47	Q04118	PRB3_HUMAN	L	47	ENSP00000371264:P47L;ENSP00000442626:P47L	ENSP00000279573:P47L	P	-	2	0	PRB3	11312310	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.510000	0.06328	-1.241000	0.02526	0.074000	0.15403	CCC		0.572	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249		16	219	0	0	0	0.003163	0	16	219				
GPRC5A	9052	broad.mit.edu	37	12	13061538	13061538	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:13061538C>T	ENST00000014914.5	+	2	1245	c.355C>T	c.(355-357)Ctg>Ttg	p.L119L	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	119					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	TGCTGTCAGTCTGACCAAGCT	0.567																																							uc001rba.2		NA																	0					0						c.(355-357)CTG>TTG		G protein-coupled receptor, family C, group 5,	Tretinoin(DB00755)						149.0	147.0	148.0					12																	13061538		2203	4300	6503	SO:0001819	synonymous_variant	9052					cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity	g.chr12:13061538C>T	AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.355C>T	12.37:g.13061538C>T			Somatic				GPRC5A_uc001raz.2_Silent_p.L119L	p.L119L	NM_003979	NP_003970	WXS	Illumina HiSeq	Unspecified	Q8NFJ5	RAI3_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.0708)	2	1005	+		Prostate(47;0.141)	119			Cytoplasmic (Potential).		B3KV45|O95357	Silent	SNP	ENST00000014914.5	37	c.355C>T	CCDS8657.1																																																																																				0.567	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400682.1			6	259	0	0	0	0.001168	0	6	259				
SLCO1B7	338821	broad.mit.edu	37	12	21196312	21196312	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:21196312T>C	ENST00000421593.2	+	6	631	c.631T>C	c.(631-633)Tgg>Cgg	p.W211R	LST3_ENST00000540229.1_Intron|SLCO1B3_ENST00000553473.1_Intron|LST3_ENST00000381541.3_Missense_Mutation_p.W258R|SLCO1B7_ENST00000554957.1_Missense_Mutation_p.W258R	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						GGTTGGAGCTTGGTGGCTTGG	0.373																																							uc010sin.1		NA																	0					0						c.(631-633)TGG>CGG		liver-specific organic anion transporter 3TM12							191.0	194.0	193.0					12																	21196312		2203	4300	6503	SO:0001583	missense	338821					membrane	transporter activity	g.chr12:21196312T>C	AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.631T>C	12.37:g.21196312T>C	ENSP00000394168:p.Trp211Arg		Somatic				SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.W258R	p.W211R	NM_001009562	NP_001009562	WXS	Illumina HiSeq	Unspecified	Q71QF0	Q71QF0_HUMAN			6	631	+			211					Q71QF0	Missense_Mutation	SNP	ENST00000421593.2	37	c.631T>C	CCDS44843.1	.	.	.	.	.	.	.	.	.	.	.	13.55	2.271323	0.40194	.	.	ENSG00000257046;ENSG00000205754;ENSG00000205754	ENST00000381541;ENST00000554957;ENST00000421593	T;T;T	0.79940	-1.32;-1.32;-1.32	3.03	3.03	0.35002	.	0.000000	0.85682	D	0.000000	D	0.90607	0.7055	M	0.93550	3.43	0.41997	D	0.990879	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91215	0.5002	10	0.87932	D	0	.	9.0383	0.36302	0.0:0.0:0.0:1.0	.	211;258	G3V0H7;F5H094	.;.	R	258;258;211	ENSP00000370952:W258R;ENSP00000452013:W258R;ENSP00000394168:W211R	ENSP00000370952:W258R	W	+	1	0	SLCO1B7;RP11-545J16.1	21087579	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	5.848000	0.69458	1.374000	0.46228	0.254000	0.18369	TGG		0.373	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402066.1	NM_001009562		32	152	0	0	0	0.006999	0	32	152				
ITPR2	3709	broad.mit.edu	37	12	26807047	26807047	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:26807047C>A	ENST00000381340.3	-	21	3018	c.2602G>T	c.(2602-2604)Gct>Tct	p.A868S		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	868					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGATTCCGAGCCAAGTGGACC	0.368																																							uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(2602-2604)GCT>TCT		inositol 1,4,5-triphosphate receptor, type 2							36.0	36.0	36.0					12																	26807047		1793	4065	5858	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26807047C>A	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2602G>T	12.37:g.26807047C>A	ENSP00000370744:p.Ala868Ser		Somatic					p.A868S	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			21	3019	-	Colorectal(261;0.0847)		868			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.2602G>T	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	32	5.112695	0.94339	.	.	ENSG00000123104	ENST00000381340	D	0.93307	-3.2	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.96219	0.8767	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96291	0.9214	10	0.62326	D	0.03	.	19.2125	0.93763	0.0:1.0:0.0:0.0	.	868	Q14571	ITPR2_HUMAN	S	868	ENSP00000370744:A868S	ENSP00000370744:A868S	A	-	1	0	ITPR2	26698314	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.474000	0.81024	2.529000	0.85273	0.585000	0.79938	GCT		0.368	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		13	44	1	0	2.68362e-12	0.013537	3.74044e-12	13	44				
ADAMTS20	80070	broad.mit.edu	37	12	43846373	43846373	+	Missense_Mutation	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:43846373T>G	ENST00000389420.3	-	13	1885	c.1886A>C	c.(1885-1887)cAt>cCt	p.H629P	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.H629P	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	629	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GATGTCCAAATGTTTACCATT	0.408																																							uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(1885-1887)CAT>CCT		a disintegrin-like and metalloprotease with							92.0	80.0	84.0					12																	43846373		2203	4299	6502	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43846373T>G	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1886A>C	12.37:g.43846373T>G	ENSP00000374071:p.His629Pro		Somatic					p.H629P	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	13	1886	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	629			Cys-rich.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.1886A>C	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	15.73	2.918794	0.52546	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.58797	0.31;0.48	4.85	4.85	0.62838	.	0.000000	0.53938	D	0.000060	T	0.62563	0.2438	N	0.25789	0.76	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.59311	-0.7478	10	0.25106	T	0.35	.	15.141	0.72609	0.0:0.0:0.0:1.0	.	629	P59510	ATS20_HUMAN	P	629	ENSP00000374071:H629P;ENSP00000448341:H629P	ENSP00000374068:H629P	H	-	2	0	ADAMTS20	42132640	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	7.655000	0.83696	2.120000	0.65058	0.460000	0.39030	CAT		0.408	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		15	37	0	0	0	0.00499	0	15	37				
PRPF40B	25766	broad.mit.edu	37	12	50029039	50029039	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:50029039C>A	ENST00000380281.1	+	12	1157	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S	FMNL3_ENST00000550668.1_5'Flank|PRPF40B_ENST00000548825.2_Missense_Mutation_p.R387S|PRPF40B_ENST00000261897.1_Missense_Mutation_p.R359S			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	365	FF 2.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						CTCCACCACCCGCTACCGGTC	0.592																																							uc001rur.1		NA																	0				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						c.(1093-1095)CGC>AGC		Huntingtin interacting protein C isoform 1							50.0	53.0	52.0					12																	50029039		2203	4300	6503	SO:0001583	missense	25766				mRNA processing|RNA splicing	nuclear speck		g.chr12:50029039C>A	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.1093C>A	12.37:g.50029039C>A	ENSP00000369634:p.Arg365Ser		Somatic				PRPF40B_uc001rup.1_Missense_Mutation_p.R387S|PRPF40B_uc001ruq.1_Missense_Mutation_p.R359S|PRPF40B_uc001rus.1_Missense_Mutation_p.R308S	p.R365S	NM_001031698	NP_001026868	WXS	Illumina HiSeq	Unspecified	Q6NWY9	PR40B_HUMAN			12	1157	+			365					O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation	SNP	ENST00000380281.1	37	c.1093C>A		.	.	.	.	.	.	.	.	.	.	C	17.92	3.506286	0.64410	.	.	ENSG00000110844	ENST00000261897;ENST00000380281	T;T	0.27890	1.64;1.64	5.13	5.13	0.70059	FF domain (1);	0.000000	0.64402	D	0.000005	T	0.33760	0.0874	L	0.41236	1.265	0.54753	D	0.999984	B;B;P	0.41366	0.418;0.355;0.747	B;B;P	0.45071	0.278;0.205;0.468	T	0.01488	-1.1342	9	.	.	.	-11.3295	17.8835	0.88848	0.0:1.0:0.0:0.0	.	365;359;365	Q6NWY9;Q6NWY9-2;Q6NWY9-3	PR40B_HUMAN;.;.	S	359;365	ENSP00000261897:R359S;ENSP00000369634:R365S	.	R	+	1	0	PRPF40B	48315306	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.241000	0.43097	2.843000	0.97960	0.655000	0.94253	CGC		0.592	PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1	NM_012272		27	49	1	0	3.17567e-06	0.008361	3.80356e-06	27	49				
OR6C76	390326	broad.mit.edu	37	12	55820504	55820504	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:55820504C>G	ENST00000328314.3	+	1	467	c.467C>G	c.(466-468)cCa>cGa	p.P156R		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ATTTTTCCACCACTGGCCATG	0.443																																							uc010spm.1		NA																	0					0						c.(466-468)CCA>CGA		olfactory receptor, family 6, subfamily C,							85.0	81.0	82.0					12																	55820504		2203	4299	6502	SO:0001583	missense	390326				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55820504C>G		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.467C>G	12.37:g.55820504C>G	ENSP00000328402:p.Pro156Arg		Somatic					p.P156R	NM_001005183	NP_001005183	WXS	Illumina HiSeq	Unspecified	A6NM76	O6C76_HUMAN			1	467	+			156			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000328314.3	37	c.467C>G	CCDS31823.1	.	.	.	.	.	.	.	.	.	.	c	12.98	2.101645	0.37048	.	.	ENSG00000185821	ENST00000328314	T	0.00084	8.75	4.26	4.26	0.50523	GPCR, rhodopsin-like superfamily (1);	0.147880	0.31257	U	0.007968	T	0.00241	0.0007	M	0.70787	2.145	0.09310	N	1	B	0.34313	0.448	P	0.44860	0.462	T	0.18241	-1.0343	10	0.87932	D	0	.	4.3209	0.11016	0.2163:0.6398:0.0:0.1439	.	156	A6NM76	O6C76_HUMAN	R	156	ENSP00000328402:P156R	ENSP00000328402:P156R	P	+	2	0	OR6C76	54106771	0.000000	0.05858	0.396000	0.26296	0.845000	0.48019	-0.825000	0.04433	2.357000	0.79964	0.531000	0.56144	CCA		0.443	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406675.1	NM_001005183		7	124	0	0	0	0.00308	0	7	124				
IL23A	51561	broad.mit.edu	37	12	56733603	56733603	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:56733603C>T	ENST00000228534.4	+	3	556	c.390C>T	c.(388-390)ggC>ggT	p.G130G	STAT2_ENST00000556539.1_5'Flank	NM_016584.2	NP_057668.1	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19	130					defense response to Gram-negative bacterium (GO:0050829)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|T cell proliferation (GO:0042098)|tissue remodeling (GO:0048771)	interleukin-23 complex (GO:0070743)				kidney(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	5						CCCTACTGGGCCTCAGCCAAC	0.542																																							uc001sla.2		NA																	0					0						c.(388-390)GGC>GGT		interleukin 23, alpha subunit p19 precursor							60.0	64.0	63.0					12																	56733603		2201	4300	6501	SO:0001819	synonymous_variant	51561				defense response to Gram-negative bacterium|inflammatory response|innate immune response|negative regulation of interleukin-10 production|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to virus|tissue remodeling	interleukin-23 complex	cytokine activity	g.chr12:56733603C>T	AB030000	CCDS8916.1	12q13.13	2011-07-15				ENSG00000110944		"""Interleukins and interleukin receptors"""	15488	protein-coding gene	gene with protein product	"""interleukin-six, G-CSF related factor"""	605580				11114383	Standard	NM_016584		Approved	SGRF, IL23P19, IL-23, IL-23A, P19	uc001sla.3	Q9NPF7		ENST00000228534.4:c.390C>T	12.37:g.56733603C>T			Somatic					p.G130G	NM_016584	NP_057668	WXS	Illumina HiSeq	Unspecified	Q9NPF7	IL23A_HUMAN			3	556	+			130					Q6NZ80|Q6NZ82|Q9H2A5	Silent	SNP	ENST00000228534.4	37	c.390C>T	CCDS8916.1																																																																																				0.542	IL23A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_016584		10	88	0	0	0	0.008291	0	10	88				
ARHGEF25	115557	broad.mit.edu	37	12	58008537	58008537	+	Silent	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:58008537G>T	ENST00000286494.4	+	9	1342	c.882G>T	c.(880-882)cgG>cgT	p.R294R	AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Silent_p.R333R|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000356672.3_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	294	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Important for binding to Rho GTPases.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CTGTGCAGCGGATCATGAAAT	0.602																																							uc001spb.2		NA																	0					0						c.(880-882)CGG>CGT		RhoA/RAC/CDC42 exchange factor isoform 1							29.0	30.0	30.0					12																	58008537		2203	4300	6503	SO:0001819	synonymous_variant	115557				regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity	g.chr12:58008537G>T		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.882G>T	12.37:g.58008537G>T			Somatic				GEFT_uc009zpy.2_Silent_p.R333R|GEFT_uc001soz.1_Silent_p.R168R|GEFT_uc001spa.2_Silent_p.R188R|uc001spc.2_Intron|GEFT_uc001spd.2_5'UTR	p.R294R	NM_182947	NP_891992	WXS	Illumina HiSeq	Unspecified	Q86VW2	ARHGP_HUMAN			9	1342	+	Melanoma(17;0.122)		294			Important for binding to Rho GTPases.|DH.		A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Silent	SNP	ENST00000286494.4	37	c.882G>T	CCDS8947.1																																																																																				0.602	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483		11	17	1	0	2.80697e-09	0.010729	3.66887e-09	11	17				
RAB3IP	117177	broad.mit.edu	37	12	70149282	70149282	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:70149282G>A	ENST00000247833.7	+	2	470	c.94G>A	c.(94-96)Gag>Aag	p.E32K	RAB3IP_ENST00000378815.6_Missense_Mutation_p.E32K|RAB3IP_ENST00000550536.1_Missense_Mutation_p.E48K|RAB3IP_ENST00000483530.2_Missense_Mutation_p.E32K|RAB3IP_ENST00000362025.5_Missense_Mutation_p.E48K|RAB3IP_ENST00000325555.9_5'UTR					RAB3A interacting protein											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			AGGAACTCAAGAGCAGACTAC	0.458																																							uc001svp.2		NA																	0				ovary(1)	1						c.(142-144)GAG>AAG		RAB3A interacting protein isoform alpha 2							189.0	162.0	171.0					12																	70149282		2203	4300	6503	SO:0001583	missense	117177				cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding	g.chr12:70149282G>A		CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000247833.7:c.94G>A	12.37:g.70149282G>A	ENSP00000247833:p.Glu32Lys		Somatic				RAB3IP_uc001svl.1_Missense_Mutation_p.E32K|RAB3IP_uc001svm.2_Missense_Mutation_p.E32K|RAB3IP_uc001svn.2_Missense_Mutation_p.E32K|RAB3IP_uc001svo.2_RNA|RAB3IP_uc001svq.2_Missense_Mutation_p.E48K|RAB3IP_uc001svr.2_RNA|RAB3IP_uc001svs.2_RNA	p.E48K	NM_175623	NP_783322	WXS	Illumina HiSeq	Unspecified	Q96QF0	RAB3I_HUMAN	Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)		2	589	+	Esophageal squamous(21;0.187)		48						Missense_Mutation	SNP	ENST00000247833.7	37	c.142G>A	CCDS8995.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049730	0.55218	.	.	ENSG00000127328	ENST00000247833;ENST00000378815;ENST00000483530;ENST00000549760;ENST00000550536;ENST00000362025	T;T	0.42513	0.99;0.97	5.93	5.04	0.67666	.	0.124591	0.64402	D	0.000009	T	0.47911	0.1471	N	0.19112	0.55	0.80722	D	1	B;D;B;B	0.69078	0.11;0.997;0.11;0.11	B;D;B;B	0.73380	0.038;0.98;0.038;0.028	T	0.42616	-0.9441	10	0.27785	T	0.31	.	15.0321	0.71717	0.0679:0.0:0.9321:0.0	.	48;48;32;32	Q96QF0-4;Q96QF0;Q96QF0-3;Q96QF0-7	.;RAB3I_HUMAN;.;.	K	32;32;32;32;48;48	ENSP00000247833:E32K;ENSP00000447300:E48K	ENSP00000247833:E32K	E	+	1	0	RAB3IP	68435549	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	5.644000	0.67902	1.524000	0.49035	0.655000	0.94253	GAG		0.458	RAB3IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280671.2	NM_022456		11	244	0	0	0	0.010729	0	11	244				
RAB3IP	117177	broad.mit.edu	37	12	70150234	70150234	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:70150234G>A	ENST00000247833.7	+	3	677	c.301G>A	c.(301-303)Gga>Aga	p.G101R	RAB3IP_ENST00000378815.6_Missense_Mutation_p.G101R|RAB3IP_ENST00000550536.1_Missense_Mutation_p.G117R|RAB3IP_ENST00000483530.2_Missense_Mutation_p.G101R|RAB3IP_ENST00000362025.5_Missense_Mutation_p.G117R|RAB3IP_ENST00000325555.9_5'UTR					RAB3A interacting protein											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			AGTCACAGCTGGATTAACTAA	0.408																																							uc001svp.2		NA																	0				ovary(1)	1						c.(349-351)GGA>AGA		RAB3A interacting protein isoform alpha 2							139.0	136.0	137.0					12																	70150234		2203	4300	6503	SO:0001583	missense	117177				cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding	g.chr12:70150234G>A		CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000247833.7:c.301G>A	12.37:g.70150234G>A	ENSP00000247833:p.Gly101Arg		Somatic				RAB3IP_uc001svl.1_Missense_Mutation_p.G101R|RAB3IP_uc001svm.2_Missense_Mutation_p.G101R|RAB3IP_uc001svn.2_Missense_Mutation_p.G101R|RAB3IP_uc001svo.2_RNA|RAB3IP_uc001svq.2_Missense_Mutation_p.G117R|RAB3IP_uc001svr.2_RNA|RAB3IP_uc001svs.2_RNA	p.G117R	NM_175623	NP_783322	WXS	Illumina HiSeq	Unspecified	Q96QF0	RAB3I_HUMAN	Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)		3	796	+	Esophageal squamous(21;0.187)		117						Missense_Mutation	SNP	ENST00000247833.7	37	c.349G>A	CCDS8995.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721454	0.68959	.	.	ENSG00000127328	ENST00000247833;ENST00000378815;ENST00000483530;ENST00000549760;ENST00000550536;ENST00000362025	T;T	0.50548	0.76;0.74	5.6	4.71	0.59529	.	0.486738	0.24647	N	0.036750	T	0.49012	0.1532	L	0.27053	0.805	0.80722	D	1	P;D;P;D	0.67145	0.911;0.994;0.834;0.996	P;P;P;D	0.63877	0.483;0.844;0.483;0.919	T	0.39099	-0.9630	10	0.39692	T	0.17	.	8.9245	0.35632	0.0744:0.0:0.7767:0.1489	.	117;117;101;101	Q96QF0-4;Q96QF0;Q96QF0-3;Q96QF0-7	.;RAB3I_HUMAN;.;.	R	101;101;101;101;117;117	ENSP00000247833:G101R;ENSP00000447300:G117R	ENSP00000247833:G101R	G	+	1	0	RAB3IP	68436501	0.994000	0.37717	0.978000	0.43139	0.874000	0.50279	3.580000	0.53907	2.641000	0.89580	0.563000	0.77884	GGA		0.408	RAB3IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280671.2	NM_022456		17	284	0	0	0	0.004007	0	17	284				
ERP29	10961	broad.mit.edu	37	12	112460060	112460060	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr12:112460060C>T	ENST00000261735.3	+	3	540	c.390C>T	c.(388-390)gtC>gtT	p.V130V	ERP29_ENST00000455836.1_3'UTR|ERP29_ENST00000546477.1_Silent_p.V29V	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	130					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						AGAACCCAGTCCCATACACTG	0.552																																							uc001ttk.1		NA																	0					0						c.(388-390)GTC>GTT		endoplasmic reticulum protein 29 isoform 1							48.0	48.0	48.0					12																	112460060		2203	4300	6503	SO:0001819	synonymous_variant	10961				intracellular protein transport|protein folding|protein secretion	endoplasmic reticulum lumen|melanosome	protein disulfide isomerase activity	g.chr12:112460060C>T	X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.390C>T	12.37:g.112460060C>T			Somatic				ERP29_uc001ttl.1_3'UTR	p.V130V	NM_006817	NP_006808	WXS	Illumina HiSeq	Unspecified	P30040	ERP29_HUMAN			3	508	+			130					C9J183|Q3MJC3|Q6FHT4	Silent	SNP	ENST00000261735.3	37	c.390C>T	CCDS9158.1																																																																																				0.552	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405200.1			4	34	0	0	0	0.009096	0	4	34				
BRCA2	675	broad.mit.edu	37	13	32914937	32914937	+	Missense_Mutation	SNP	A	A	G	rs80359592|rs397507856|rs80359591|rs80359593		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr13:32914937A>G	ENST00000380152.3	+	11	6678	c.6445A>G	c.(6445-6447)Att>Gtt	p.I2149V	BRCA2_ENST00000544455.1_Missense_Mutation_p.I2149V			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2149					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TAATCACTCTATTAAAGTTTC	0.318			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	D|Mis|N|F|S	familial breast/ovarian cancer gene 2			"""L, E"""		breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		0				ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64	GRCh37	CD020560|CD044128	BRCA2	D	rs80359592	c.(6445-6447)ATT>GTT	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							33.0	35.0	34.0					13																	32914937		2201	4296	6497	SO:0001583	missense	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32914937A>G	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.6445A>G	13.37:g.32914937A>G	ENSP00000369497:p.Ile2149Val	TCGA Ovarian(8;0.087)	Somatic					p.I2149V	NM_000059	NP_000050	WXS	Illumina HiSeq	Unspecified	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	11	6672	+		Lung SC(185;0.0262)	2149					O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	c.6445A>G	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.502389	0.00992	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.78364	-1.17;-1.17	5.1	-6.4	0.01944	.	1.269890	0.05327	N	0.527548	T	0.57740	0.2074	N	0.17723	0.515	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43032	-0.9416	10	0.18276	T	0.48	.	7.7213	0.28733	0.3519:0.226:0.4221:0.0	.	2149	P51587	BRCA2_HUMAN	V	2149	ENSP00000369497:I2149V;ENSP00000439902:I2149V	ENSP00000369497:I2149V	I	+	1	0	BRCA2	31812937	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.945000	0.03909	-1.537000	0.01736	-0.353000	0.07706	ATT		0.318	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		4	24	0	0	0	0.001168	0	4	24				
LHFP	10186	broad.mit.edu	37	13	40175151	40175151	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr13:40175151C>T	ENST00000379589.3	-	2	665	c.203G>A	c.(202-204)tGt>tAt	p.C68Y	LHFP_ENST00000495922.1_5'Flank	NM_005780.2	NP_005771.1	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner	68						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)		HMGA2/LHFP(2)	breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(6)|prostate(2)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		ATAGCGCCCACATTCCTCCAC	0.602			T	HMGA2	lipoma																																		uc001uxf.2		NA		Dom	yes		13	13q12	10186	T	lipoma HMGIC fusion partner			M	HMGA2		lipoma	HMGA2/LHFP(2)	0				soft_tissue(2)|lung(1)|breast(1)	4						c.(202-204)TGT>TAT		lipoma HMGIC fusion partner precursor							210.0	182.0	191.0					13																	40175151		2203	4300	6503	SO:0001583	missense	10186					integral to membrane	DNA binding	g.chr13:40175151C>T	AF098807	CCDS9369.1	13q12	2008-07-18			ENSG00000183722	ENSG00000183722			6586	protein-coding gene	gene with protein product		606710				10329012	Standard	NM_005780		Approved	MGC22429	uc001uxf.3	Q9Y693	OTTHUMG00000016767	ENST00000379589.3:c.203G>A	13.37:g.40175151C>T	ENSP00000368908:p.Cys68Tyr		Somatic					p.C68Y	NM_005780	NP_005771	WXS	Illumina HiSeq	Unspecified	Q9Y693	LHFP_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)	2	714	-		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)	68					B2R7M2|Q53FC0|Q96SH5	Missense_Mutation	SNP	ENST00000379589.3	37	c.203G>A	CCDS9369.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731495	0.89390	.	.	ENSG00000183722	ENST00000379589	T	0.80480	-1.38	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.91116	0.7203	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91934	0.5557	9	.	.	.	.	18.101	0.89505	0.0:1.0:0.0:0.0	.	68	Q9Y693	LHFP_HUMAN	Y	68	ENSP00000368908:C68Y	.	C	-	2	0	LHFP	39073151	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.409000	0.80053	2.522000	0.85027	0.655000	0.94253	TGT		0.602	LHFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044619.1	NM_005780		45	160	0	0	0	0.01441	0	45	160				
DGKH	160851	broad.mit.edu	37	13	42795487	42795487	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr13:42795487T>C	ENST00000337343.4	+	29	3551	c.3530T>C	c.(3529-3531)aTc>aCc	p.I1177T	DGKH_ENST00000498255.2_Intron|DGKH_ENST00000538674.1_Intron|DGKH_ENST00000540693.1_Intron|DGKH_ENST00000536612.1_Missense_Mutation_p.I1041T|DGKH_ENST00000261491.5_Intron|DGKH_ENST00000379274.2_Missense_Mutation_p.I1041T	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	1177	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		CGTCATGACATCAGAGGGGCT	0.413																																							uc001uyl.1		NA																	0				ovary(2)	2						c.(3529-3531)ATC>ACC		diacylglycerol kinase, eta isoform 2							193.0	175.0	181.0					13																	42795487		2203	4300	6503	SO:0001583	missense	160851				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr13:42795487T>C	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.3530T>C	13.37:g.42795487T>C	ENSP00000337572:p.Ile1177Thr		Somatic				DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Missense_Mutation_p.I1032T|DGKH_uc001uyn.1_RNA|DGKH_uc001uyo.1_Missense_Mutation_p.I1032T|DGKH_uc001uyp.2_Intron	p.I1177T	NM_178009	NP_821077	WXS	Illumina HiSeq	Unspecified	Q86XP1	DGKH_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)	29	3551	+		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)	1177			SAM.		A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	c.3530T>C	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	T	19.97	3.924581	0.73213	.	.	ENSG00000102780	ENST00000337343;ENST00000379274;ENST00000536612	D;D;D	0.88509	-2.39;-2.39;-2.39	5.58	5.58	0.84498	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.459982	0.24187	N	0.040743	D	0.95915	0.8670	H	0.96970	3.915	0.80722	D	1	D;D	0.59767	0.958;0.986	P;P	0.59643	0.783;0.861	D	0.97315	0.9940	10	0.87932	D	0	.	15.7596	0.78067	0.0:0.0:0.0:1.0	.	1041;1177	Q86XP1-3;Q86XP1	.;DGKH_HUMAN	T	1177;1041;1041	ENSP00000337572:I1177T;ENSP00000368576:I1041T;ENSP00000445114:I1041T	ENSP00000337572:I1177T	I	+	2	0	DGKH	41693487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.396000	0.79891	2.130000	0.65690	0.459000	0.35465	ATC		0.413	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009		13	115	0	0	0	0.00245	0	13	115				
FAM155A	728215	broad.mit.edu	37	13	107862936	107862936	+	Silent	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr13:107862936A>G	ENST00000375915.2	-	2	1221	c.1083T>C	c.(1081-1083)tgT>tgC	p.C361C		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	361						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CTGTACCTGTACAGATGAAAC	0.458																																							uc001vql.2		NA																	0				skin(1)	1						c.(1081-1083)TGT>TGC		family with sequence similarity 155, member A							74.0	74.0	74.0					13																	107862936		2203	4300	6503	SO:0001819	synonymous_variant	728215					integral to membrane	binding	g.chr13:107862936A>G	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.1083T>C	13.37:g.107862936A>G			Somatic					p.C361C	NM_001080396	NP_001073865	WXS	Illumina HiSeq	Unspecified	B1AL88	F155A_HUMAN			2	1599	-			361					B2RUV1|B7Z334	Silent	SNP	ENST00000375915.2	37	c.1083T>C	CCDS32006.1																																																																																				0.458	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396		7	48	0	0	0	0.004482	0	7	48				
OR4Q3	441669	broad.mit.edu	37	14	20216160	20216160	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:20216160G>T	ENST00000331723.1	+	1	574	c.574G>T	c.(574-576)Gac>Tac	p.D192Y		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGCCTGCATGGACACCTATGT	0.488																																							uc010tkt.1		NA																	0				breast(3)	3						c.(574-576)GAC>TAC		olfactory receptor, family 4, subfamily Q,							188.0	150.0	163.0					14																	20216160		2203	4300	6503	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20216160G>T	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.574G>T	14.37:g.20216160G>T	ENSP00000330049:p.Asp192Tyr		Somatic					p.D192Y	NM_172194	NP_751944	WXS	Illumina HiSeq	Unspecified	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	574	+	all_cancers(95;0.00108)		192			Extracellular (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.574G>T	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	12.33	1.905850	0.33628	.	.	ENSG00000182652	ENST00000331723	T	0.00267	8.38	4.01	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41605	U	0.000851	T	0.00695	0.0023	M	0.93678	3.445	0.19775	N	0.999958	D	0.89917	1.0	D	0.87578	0.998	T	0.17899	-1.0354	10	0.87932	D	0	.	9.7486	0.40462	0.1055:0.0:0.8945:0.0	.	192	Q8NH05	OR4Q3_HUMAN	Y	192	ENSP00000330049:D192Y	ENSP00000330049:D192Y	D	+	1	0	OR4Q3	19286000	0.554000	0.26522	0.423000	0.26634	0.753000	0.42808	0.701000	0.25616	0.870000	0.35726	0.509000	0.49947	GAC		0.488	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			8	102	1	0	3.09899e-07	0.004482	3.82816e-07	8	102				
AKAP6	9472	broad.mit.edu	37	14	33016066	33016066	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:33016066A>T	ENST00000280979.4	+	4	2377	c.2207A>T	c.(2206-2208)tAt>tTt	p.Y736F	AKAP6_ENST00000557272.1_Missense_Mutation_p.Y736F|AKAP6_ENST00000557354.1_Missense_Mutation_p.Y736F	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	736					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ATGAAAAAGTATGCTGATGAG	0.443																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(2206-2208)TAT>TTT		A-kinase anchor protein 6							66.0	66.0	66.0					14																	33016066		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33016066A>T	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2207A>T	14.37:g.33016066A>T	ENSP00000280979:p.Tyr736Phe		Somatic				AKAP6_uc010aml.2_Missense_Mutation_p.Y733F	p.Y736F	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	4	2377	+	Breast(36;0.0388)|Prostate(35;0.15)		736					A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.2207A>T	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	1.009	-0.688373	0.03328	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.32753	1.44;1.44;1.44	6.17	-1.78	0.07957	.	0.503034	0.20137	N	0.098467	T	0.15955	0.0384	L	0.33485	1.01	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.17228	-1.0376	10	0.20519	T	0.43	-0.2614	4.6322	0.12507	0.5302:0.0:0.1678:0.3019	.	736;736	A7E242;Q13023	.;AKAP6_HUMAN	F	736	ENSP00000280979:Y736F;ENSP00000450531:Y736F;ENSP00000451247:Y736F	ENSP00000280979:Y736F	Y	+	2	0	AKAP6	32085817	0.158000	0.22850	0.032000	0.17829	0.023000	0.10783	0.645000	0.24782	-0.073000	0.12842	0.533000	0.62120	TAT		0.443	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		9	89	0	0	0	0.004482	0	9	89				
MIA2	117153	broad.mit.edu	37	14	39721990	39721990	+	Missense_Mutation	SNP	G	G	A	rs200876456		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:39721990G>A	ENST00000280082.3	+	5	1805	c.1606G>A	c.(1606-1608)Gaa>Aaa	p.E536K	RP11-407N17.3_ENST00000553728.1_Intron	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GAGAATTCACGAAGAAGTATA	0.378																																							uc001wux.2		NA																	0				ovary(1)|breast(1)	2						c.(1606-1608)GAA>AAA		melanoma inhibitory activity 2							73.0	81.0	78.0					14																	39721990		2202	4299	6501	SO:0001583	missense	117153					extracellular region		g.chr14:39721990G>A	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1606G>A	14.37:g.39721990G>A	ENSP00000280082:p.Glu536Lys		Somatic					p.E536K	NM_054024	NP_473365	WXS	Illumina HiSeq	Unspecified	Q96PC5	MIA2_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)	5	1800	+	Hepatocellular(127;0.213)		145					A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	c.1606G>A	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759974	0.31137	.	.	ENSG00000150526	ENST00000280082	T	0.59224	0.28	4.69	3.77	0.43336	.	1.103670	0.07166	N	0.851482	T	0.40423	0.1116	.	.	.	0.25528	N	0.987307	B	0.31989	0.35	B	0.26614	0.071	T	0.25117	-1.0141	8	.	.	.	.	6.7067	0.23254	0.1057:0.1781:0.7162:0.0	.	536	Q96PC5-2	.	K	536	ENSP00000280082:E536K	.	E	+	1	0	MIA2	38791741	0.861000	0.29849	0.095000	0.20976	0.014000	0.08584	1.750000	0.38329	1.240000	0.43803	0.585000	0.79938	GAA		0.378	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024		10	141	0	0	0	0.001855	0	10	141				
FSCB	84075	broad.mit.edu	37	14	44975456	44975456	+	Missense_Mutation	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:44975456T>G	ENST00000340446.4	-	1	1026	c.735A>C	c.(733-735)gaA>gaC	p.E245D	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	245						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CAGCAGAACCTTCTTGTACAA	0.413																																							uc001wvn.2		NA																	0				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(733-735)GAA>GAC		fibrous sheath CABYR binding protein							81.0	84.0	83.0					14																	44975456		2203	4300	6503	SO:0001583	missense	84075					cilium		g.chr14:44975456T>G	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.735A>C	14.37:g.44975456T>G	ENSP00000344579:p.Glu245Asp		Somatic					p.E245D	NM_032135	NP_115511	WXS	Illumina HiSeq	Unspecified	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	1044	-			245					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.735A>C	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.478858	0.44044	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.27557	1.66	3.23	-5.56	0.02529	.	.	.	.	.	T	0.16896	0.0406	L	0.29908	0.895	0.09310	N	1	P	0.34639	0.461	B	0.36418	0.224	T	0.19257	-1.0311	9	0.30854	T	0.27	3.48	4.0883	0.09957	0.2641:0.1779:0.0:0.558	.	245	Q5H9T9	FSCB_HUMAN	D	245	ENSP00000344579:E245D	ENSP00000344579:E245D	E	-	3	2	FSCB	44045206	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.781000	0.04648	-1.200000	0.02662	-0.408000	0.06270	GAA		0.413	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		10	148	0	0	0	0.006214	0	10	148				
KLHL28	54813	broad.mit.edu	37	14	45414803	45414803	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45414803G>A	ENST00000396128.4	-	2	448	c.329C>T	c.(328-330)cCa>cTa	p.P110L	KLHL28_ENST00000355081.2_Missense_Mutation_p.P124L	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	110										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GTTTGCTGCTGGCAGGAGAGA	0.408																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(328-330)CCA>CTA		BTB (POZ) domain containing 5							65.0	64.0	64.0					14																	45414803		2203	4300	6503	SO:0001583	missense	54813							g.chr14:45414803G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.329C>T	14.37:g.45414803G>A	ENSP00000379434:p.Pro110Leu		Somatic				KLHL28_uc001wvr.2_Missense_Mutation_p.P110L|KLHL28_uc001wvt.3_Missense_Mutation_p.P110L	p.P110L	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	575	-			110					Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	c.329C>T	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.413943	0.62511	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500	T;T;T	0.65549	-0.16;-0.16;-0.16	5.7	5.7	0.88788	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	L	0.45228	1.405	0.80722	D	1	P;D	0.76494	0.616;0.999	B;D	0.81914	0.343;0.995	T	0.76119	-0.3076	10	0.87932	D	0	.	19.4198	0.94716	0.0:0.0:1.0:0.0	.	110;110	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	L	110;124;110	ENSP00000379434:P110L;ENSP00000347193:P124L;ENSP00000452061:P110L	ENSP00000347193:P124L	P	-	2	0	KLHL28	44484553	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.388000	0.79795	2.696000	0.92011	0.655000	0.94253	CCA		0.408	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			4	140	0	0	0	0.008871	0	4	140				
KLHL28	54813	broad.mit.edu	37	14	45414807	45414807	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45414807G>A	ENST00000396128.4	-	2	444	c.325C>T	c.(325-327)Ctg>Ttg	p.L109L	KLHL28_ENST00000355081.2_Silent_p.L123L	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	109										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCTGCTGGCAGGAGAGATTCA	0.418																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(325-327)CTG>TTG		BTB (POZ) domain containing 5							66.0	66.0	66.0					14																	45414807		2203	4300	6503	SO:0001819	synonymous_variant	54813							g.chr14:45414807G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.325C>T	14.37:g.45414807G>A			Somatic				KLHL28_uc001wvr.2_Silent_p.L109L|KLHL28_uc001wvt.3_Silent_p.L109L	p.L109L	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	571	-			109					Q0VAL5	Silent	SNP	ENST00000396128.4	37	c.325C>T	CCDS9680.1																																																																																				0.418	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			5	145	0	0	0	0.012319	0	5	145				
KLHL28	54813	broad.mit.edu	37	14	45414812	45414812	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45414812G>A	ENST00000396128.4	-	2	439	c.320C>T	c.(319-321)tCt>tTt	p.S107F	KLHL28_ENST00000355081.2_Missense_Mutation_p.S121F	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	107										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGGCAGGAGAGATTCAACTGT	0.413																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(319-321)TCT>TTT		BTB (POZ) domain containing 5							68.0	67.0	67.0					14																	45414812		2203	4300	6503	SO:0001583	missense	54813							g.chr14:45414812G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.320C>T	14.37:g.45414812G>A	ENSP00000379434:p.Ser107Phe		Somatic				KLHL28_uc001wvr.2_Missense_Mutation_p.S107F|KLHL28_uc001wvt.3_Missense_Mutation_p.S107F	p.S107F	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	566	-			107					Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	c.320C>T	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354995	0.61293	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500	T;T;T	0.71934	-0.61;-0.61;-0.61	5.7	5.7	0.88788	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.84197	0.5419	M	0.72894	2.215	0.80722	D	1	P;D	0.67145	0.766;0.996	B;D	0.77557	0.211;0.99	D	0.84968	0.0881	10	0.72032	D	0.01	.	19.4198	0.94716	0.0:0.0:1.0:0.0	.	107;107	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	F	107;121;107	ENSP00000379434:S107F;ENSP00000347193:S121F;ENSP00000452061:S107F	ENSP00000347193:S121F	S	-	2	0	KLHL28	44484562	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.496000	0.81526	2.696000	0.92011	0.655000	0.94253	TCT		0.413	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			5	147	0	0	0	0.014323	0	5	147				
KLHL28	54813	broad.mit.edu	37	14	45415021	45415021	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45415021G>A	ENST00000396128.4	-	2	230	c.111C>T	c.(109-111)atC>atT	p.I37I	KLHL28_ENST00000355081.2_Silent_p.I51I	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	37	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CTCGAAGAATGATGTCACAGA	0.443																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(109-111)ATC>ATT		BTB (POZ) domain containing 5							98.0	89.0	92.0					14																	45415021		2203	4300	6503	SO:0001819	synonymous_variant	54813							g.chr14:45415021G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.111C>T	14.37:g.45415021G>A			Somatic				KLHL28_uc001wvr.2_Silent_p.I37I|KLHL28_uc001wvt.3_Silent_p.I37I	p.I37I	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	357	-			37			BTB.		Q0VAL5	Silent	SNP	ENST00000396128.4	37	c.111C>T	CCDS9680.1																																																																																				0.443	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			18	120	0	0	0	0.007413	0	18	120				
KLHL28	54813	broad.mit.edu	37	14	45415118	45415118	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45415118G>A	ENST00000396128.4	-	2	133	c.14C>T	c.(13-15)tCc>tTc	p.S5F	KLHL28_ENST00000355081.2_Missense_Mutation_p.S19F	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	5										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GTAGGTCGGGGATGTGTGGTC	0.378																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(13-15)TCC>TTC		BTB (POZ) domain containing 5							82.0	75.0	77.0					14																	45415118		2203	4300	6503	SO:0001583	missense	54813							g.chr14:45415118G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.14C>T	14.37:g.45415118G>A	ENSP00000379434:p.Ser5Phe		Somatic				KLHL28_uc001wvr.2_Missense_Mutation_p.S5F|KLHL28_uc001wvt.3_Missense_Mutation_p.S5F	p.S5F	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	260	-			5					Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	c.14C>T	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465118	0.43839	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500;ENST00000556239;ENST00000557468	T;T;T;T	0.76968	-0.38;-0.32;-1.06;-0.56	5.8	5.8	0.92144	.	0.327128	0.33792	N	0.004550	T	0.73961	0.3654	L	0.36672	1.1	0.38251	D	0.941618	B;B	0.25105	0.118;0.07	B;B	0.28011	0.046;0.085	T	0.72734	-0.4204	10	0.66056	D	0.02	.	19.6588	0.95855	0.0:0.0:1.0:0.0	.	5;5	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	F	5;19;5;5;5	ENSP00000379434:S5F;ENSP00000347193:S19F;ENSP00000452061:S5F;ENSP00000452591:S5F	ENSP00000347193:S19F	S	-	2	0	KLHL28	44484868	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.211000	0.77933	2.751000	0.94390	0.650000	0.86243	TCC		0.378	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			19	91	0	0	0	0.006122	0	19	91				
KLHL28	54813	broad.mit.edu	37	14	45415125	45415125	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45415125G>A	ENST00000396128.4	-	2	126	c.7C>T	c.(7-9)Cac>Tac	p.H3Y	KLHL28_ENST00000355081.2_Missense_Mutation_p.H17Y	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	3										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGGGATGTGTGGTCCATCTAC	0.373																																							uc001wvq.2		NA																	0				ovary(1)	1						c.(7-9)CAC>TAC		BTB (POZ) domain containing 5							76.0	70.0	72.0					14																	45415125		2203	4300	6503	SO:0001583	missense	54813							g.chr14:45415125G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.7C>T	14.37:g.45415125G>A	ENSP00000379434:p.His3Tyr		Somatic				KLHL28_uc001wvr.2_Missense_Mutation_p.H3Y|KLHL28_uc001wvt.3_Missense_Mutation_p.H3Y	p.H3Y	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	253	-			3					Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	c.7C>T	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.924167	0.52653	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500;ENST00000556239;ENST00000557468	T;T;T;T	0.75367	-0.24;-0.27;-0.93;-0.44	5.8	5.8	0.92144	.	0.163744	0.56097	D	0.000034	T	0.60444	0.2269	N	0.08118	0	0.46749	D	0.999189	B;B	0.12013	0.003;0.005	B;B	0.12837	0.008;0.007	T	0.55823	-0.8080	10	0.51188	T	0.08	.	19.6588	0.95855	0.0:0.0:1.0:0.0	.	3;3	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	Y	3;17;3;3;3	ENSP00000379434:H3Y;ENSP00000347193:H17Y;ENSP00000452061:H3Y;ENSP00000452591:H3Y	ENSP00000347193:H17Y	H	-	1	0	KLHL28	44484875	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.312000	0.78968	2.751000	0.94390	0.650000	0.86243	CAC		0.373	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			19	87	0	0	0	0.007413	0	19	87				
FANCM	57697	broad.mit.edu	37	14	45633573	45633573	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:45633573G>T	ENST00000267430.5	+	10	1678	c.1593G>T	c.(1591-1593)caG>caT	p.Q531H	FANCM_ENST00000542564.2_Missense_Mutation_p.Q505H|FANCM_ENST00000556036.1_Missense_Mutation_p.Q531H	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	531	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TAGTGAAACAGTTTCGTGACG	0.353								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc001wwd.3		NA																	0				ovary(3)|lung(2)|breast(2)	7						c.(1591-1593)CAG>CAT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							109.0	106.0	107.0					14																	45633573		2203	4300	6503	SO:0001583	missense	57697	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45633573G>T	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1593G>T	14.37:g.45633573G>T	ENSP00000267430:p.Gln531His		Somatic				FANCM_uc001wwc.2_Missense_Mutation_p.Q531H|FANCM_uc010anf.2_Missense_Mutation_p.Q505H|FANCM_uc001wwe.3_Intron	p.Q531H	NM_020937	NP_065988	WXS	Illumina HiSeq	Unspecified	Q8IYD8	FANCM_HUMAN			10	1692	+			531			Helicase C-terminal.		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	c.1593G>T	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331623	0.41297	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.77358	-1.09;-1.09;-1.09	6.04	-7.11	0.01542	Helicase, C-terminal (3);	0.720518	0.14094	N	0.341835	D	0.82935	0.5145	M	0.79011	2.435	0.22639	N	0.998901	P;B;P	0.49358	0.923;0.281;0.531	P;P;B	0.56343	0.796;0.489;0.357	T	0.80863	-0.1192	10	0.59425	D	0.04	.	17.3687	0.87370	0.1404:0.1089:0.7507:0.0	.	505;531;531	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	H	531;531;505	ENSP00000450596:Q531H;ENSP00000267430:Q531H;ENSP00000442493:Q505H	ENSP00000267430:Q531H	Q	+	3	2	FANCM	44703323	0.000000	0.05858	0.687000	0.30102	0.928000	0.56348	-1.761000	0.01805	-1.083000	0.03097	-0.303000	0.09236	CAG		0.353	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		23	68	1	0	2.44723e-14	0.004656	3.44142e-14	23	68				
LRR1	122769	broad.mit.edu	37	14	50081137	50081137	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:50081137G>T	ENST00000298288.6	+	4	1492	c.1168G>T	c.(1168-1170)Ggt>Tgt	p.G390C	LRR1_ENST00000318317.4_3'UTR	NM_152329.3	NP_689542.2	Q96L50	LLR1_HUMAN	leucine rich repeat protein 1	390					protein ubiquitination (GO:0016567)					kidney(2)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AGATAATTTGGGTGGTACTGA	0.373																																							uc001wwn.2		NA																	0					0						c.(1168-1170)GGT>TGT		peptidylprolyl isomerase (cyclophilin)-like 5							160.0	146.0	151.0					14																	50081137		2203	4300	6503	SO:0001583	missense	122769							g.chr14:50081137G>T	BC030142	CCDS9686.1, CCDS9687.1	14q21.3	2011-02-02	2011-02-02	2011-02-02	ENSG00000165501	ENSG00000165501			19742	protein-coding gene	gene with protein product	"""LRR-repeat protein 1"""	609193	"""peptidylprolyl isomerase (cyclophilin)-like 5"""	PPIL5		11804328, 21074724	Standard	NR_037792		Approved	MGC20689, LRR-1	uc001wwn.3	Q96L50	OTTHUMG00000140273	ENST00000298288.6:c.1168G>T	14.37:g.50081137G>T	ENSP00000298288:p.Gly390Cys		Somatic				SDCCAG1_uc010anj.1_Intron|PPIL5_uc001wwo.2_3'UTR|PPIL5_uc010ank.2_Missense_Mutation_p.G331C|PPIL5_uc001wwp.2_RNA	p.G390C	NM_152329	NP_689542	WXS	Illumina HiSeq	Unspecified	Q96L50	LLR1_HUMAN			4	1492	+	all_epithelial(31;0.0021)|Breast(41;0.0124)		390					A5D6X3|B4DDE0|Q52M24|Q86SZ1|Q8N6H9	Missense_Mutation	SNP	ENST00000298288.6	37	c.1168G>T	CCDS9686.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634528	0.87660	.	.	ENSG00000165501	ENST00000298288	T	0.46451	0.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.62171	0.2406	L	0.49126	1.545	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.62572	-0.6826	10	0.87932	D	0	-17.488	19.9413	0.97163	0.0:0.0:1.0:0.0	.	390	Q96L50	LLR1_HUMAN	C	390	ENSP00000298288:G390C	ENSP00000298288:G390C	G	+	1	0	LRR1	49150887	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.183000	0.94887	2.779000	0.95612	0.650000	0.86243	GGT		0.373	LRR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410790.1	NM_203467		3	72	1	0	0.004672	0.004672	0.00507476	3	72				
BMP4	652	broad.mit.edu	37	14	54417079	54417079	+	Missense_Mutation	SNP	G	G	A	rs182373336		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:54417079G>A	ENST00000245451.4	-	4	1291	c.898C>T	c.(898-900)Cgg>Tgg	p.R300W	BMP4_ENST00000417573.1_Missense_Mutation_p.R300W|BMP4_ENST00000559087.1_Missense_Mutation_p.R300W|MIR5580_ENST00000580850.1_RNA|BMP4_ENST00000558984.1_Missense_Mutation_p.R300W	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	300					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						TTCCTGGCCCGCTGTGAGTGA	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		18244	0.0		0.001	False		,,,				2504	0.0						uc001xal.3		NA																	0					0						c.(898-900)CGG>TGG		bone morphogenetic protein 4 preproprotein							38.0	38.0	38.0					14																	54417079		2203	4300	6503	SO:0001583	missense	652				activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity	g.chr14:54417079G>A	AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.898C>T	14.37:g.54417079G>A	ENSP00000245451:p.Arg300Trp		Somatic				BMP4_uc010aoh.2_Missense_Mutation_p.R300W|BMP4_uc001xao.3_Missense_Mutation_p.R300W|BMP4_uc001xan.3_Missense_Mutation_p.R300W	p.R300W	NM_130851	NP_570912	WXS	Illumina HiSeq	Unspecified	P12644	BMP4_HUMAN			3	1085	-			300					Q9UM80	Missense_Mutation	SNP	ENST00000245451.4	37	c.898C>T	CCDS9715.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.09	3.025626	0.54683	.	.	ENSG00000125378	ENST00000245451;ENST00000417573	T;T	0.74209	-0.82;-0.82	5.3	-0.0567	0.13804	Transforming growth factor-beta, C-terminal (1);	0.178710	0.49305	D	0.000144	T	0.81187	0.4770	M	0.85373	2.75	0.80722	D	1	D	0.65815	0.995	P	0.55455	0.776	T	0.80647	-0.1289	10	0.87932	D	0	.	9.6323	0.39787	0.0697:0.0:0.2995:0.6308	.	300	P12644	BMP4_HUMAN	W	300	ENSP00000245451:R300W;ENSP00000394165:R300W	ENSP00000245451:R300W	R	-	1	2	BMP4	53486829	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	1.083000	0.30815	-0.173000	0.10761	0.563000	0.77884	CGG		0.627	BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276894.2	NM_001202		3	44	0	0	0	0.004672	0	3	44				
DAAM1	23002	broad.mit.edu	37	14	59835440	59835440	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:59835440G>T	ENST00000395125.1	+	25	3123	c.3100G>T	c.(3100-3102)Gat>Tat	p.D1034Y	DAAM1_ENST00000360909.3_Missense_Mutation_p.D1024Y|DAAM1_ENST00000351081.1_Missense_Mutation_p.D1034Y|DAAM1_ENST00000553966.1_3'UTR	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	1034	DAD. {ECO:0000255|PROSITE- ProRule:PRU00577}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CGGAGAGTTTGATGACCTTGT	0.388																																							uc001xdz.1		NA																	0				ovary(1)	1						c.(3100-3102)GAT>TAT		dishevelled-associated activator of							124.0	118.0	120.0					14																	59835440		2203	4300	6503	SO:0001583	missense	23002				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding	g.chr14:59835440G>T	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.3100G>T	14.37:g.59835440G>T	ENSP00000378557:p.Asp1034Tyr		Somatic				DAAM1_uc001xea.1_Missense_Mutation_p.D1024Y|DAAM1_uc001xec.1_RNA	p.D1034Y	NM_014992	NP_055807	WXS	Illumina HiSeq	Unspecified	Q9Y4D1	DAAM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.165)	26	3225	+			1034			DAD.		Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	c.3100G>T	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250956	0.80135	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000395125	D;D;D	0.87650	-2.24;-2.28;-2.28	5.64	5.64	0.86602	Actin-binding FH2/DRF autoregulatory (1);Diaphanous autoregulatory (1);	0.000000	0.85682	D	0.000000	D	0.93831	0.8027	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94042	0.7310	10	0.87932	D	0	.	19.7154	0.96115	0.0:0.0:1.0:0.0	.	1024;1034	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	Y	1024;1034;1034	ENSP00000354162:D1024Y;ENSP00000247170:D1034Y;ENSP00000378557:D1034Y	ENSP00000247170:D1034Y	D	+	1	0	DAAM1	58905193	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	9.765000	0.98953	2.664000	0.90586	0.655000	0.94253	GAT		0.388	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992		4	67	1	0	0.00909568	0.009096	0.00974537	4	67				
ALDH6A1	4329	broad.mit.edu	37	14	74533589	74533589	+	Splice_Site	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr14:74533589C>T	ENST00000553458.1	-	9	1141	c.1043G>A	c.(1042-1044)gGa>gAa	p.G348E	ALDH6A1_ENST00000350259.4_Splice_Site_p.G335E|AC005484.5_ENST00000492026.1_RNA|CCDC176_ENST00000553773.1_Intron|ALDH6A1_ENST00000555126.1_Splice_Site_p.G65E	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	348					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		AGGCTGATCTCCTGTAAAACA	0.478																																							uc001xpo.2		NA																	0					0						c.(1042-1044)GGA>GAA		aldehyde dehydrogenase 6A1 precursor	NADH(DB00157)						55.0	56.0	56.0					14																	74533589		2203	4300	6503	SO:0001630	splice_region_variant	4329					mitochondrial matrix|nucleus	fatty-acyl-CoA binding|malonate-semialdehyde dehydrogenase (acetylating) activity|methylmalonate-semialdehyde dehydrogenase (acylating) activity	g.chr14:74533589C>T	M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.1043-1G>A	14.37:g.74533589C>T			Somatic				C14orf45_uc001xpm.1_Intron|ALDH6A1_uc010asa.2_Missense_Mutation_p.G193E|ALDH6A1_uc010tuq.1_Missense_Mutation_p.G335E	p.G348E	NM_005589	NP_005580	WXS	Illumina HiSeq	Unspecified	Q02252	MMSA_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00354)	9	1142	-			348					B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	ENST00000553458.1	37	c.1043G>A	CCDS9826.1	.	.	.	.	.	.	.	.	.	.	C	33	5.259624	0.95368	.	.	ENSG00000119711	ENST00000553458;ENST00000350259;ENST00000555126	T;T;T	0.76186	-1.0;-1.0;-1.0	5.38	5.38	0.77491	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.92753	0.7696	H	0.99225	4.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95534	0.8606	10	0.87932	D	0	.	19.4941	0.95064	0.0:1.0:0.0:0.0	.	335;348	B4DFS8;Q02252	.;MMSA_HUMAN	E	348;335;65	ENSP00000450436:G348E;ENSP00000342564:G335E;ENSP00000452081:G65E	ENSP00000342564:G348E	G	-	2	0	ALDH6A1	73603342	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.747000	0.85070	2.686000	0.91538	0.491000	0.48974	GGA		0.478	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412309.1		Missense_Mutation	10	23	0	0	0	0.008291	0	10	23				
GABRB3	2562	broad.mit.edu	37	15	26825499	26825499	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:26825499G>T	ENST00000311550.5	-	6	760	c.649C>A	c.(649-651)Cgt>Agt	p.R217S	GABRB3_ENST00000299267.4_Missense_Mutation_p.R217S|GABRB3_ENST00000541819.2_Missense_Mutation_p.R273S|GABRB3_ENST00000545868.1_Missense_Mutation_p.R132S|GABRB3_ENST00000400188.3_Missense_Mutation_p.R146S	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	217			R -> H (found in a subject suffering from insomnia; functional analysis reveals a slower rate of the fast phase of desensitization compared with alpha1beta3gamma2S GABA(A) receptors; current deactivation is faster in the mutated receptors). {ECO:0000269|PubMed:12189488}.		cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAGACCAGACGGTGCTCCACG	0.562																																							uc001zaz.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(649-651)CGT>AGT		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						125.0	112.0	117.0					15																	26825499		2203	4300	6503	SO:0001583	missense	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26825499G>T		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.649C>A	15.37:g.26825499G>T	ENSP00000308725:p.Arg217Ser		Somatic				GABRB3_uc010uae.1_Missense_Mutation_p.R132S|GABRB3_uc001zba.2_Missense_Mutation_p.R217S|GABRB3_uc001zbb.2_Missense_Mutation_p.R273S	p.R217S	NM_000814	NP_000805	WXS	Illumina HiSeq	Unspecified	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	6	791	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	217		R -> H (in insomnia; functional analysis reveals a slower rate of the fast phase of desensitization compared with alpha1beta3gamma2S GABA(A) receptors; current deactivation is faster in the mutated receptors).	Extracellular (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	c.649C>A	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198491	0.58126	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868;ENST00000555094	T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.06	5.35	4.32	0.51571	Neurotransmitter-gated ion-channel ligand-binding (3);	0.046767	0.85682	D	0.000000	T	0.65554	0.2702	L	0.28274	0.84	0.50467	D	0.999876	B;B;B	0.24963	0.115;0.038;0.047	B;B;B	0.26202	0.067;0.028;0.03	T	0.65228	-0.6219	10	0.54805	T	0.06	.	10.8045	0.46509	0.0:0.0:0.6421:0.3579	.	273;217;217	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	S	217;273;217;146;132;132	ENSP00000308725:R217S;ENSP00000442408:R273S;ENSP00000299267:R217S;ENSP00000383049:R146S;ENSP00000439169:R132S;ENSP00000452272:R132S	ENSP00000299267:R217S	R	-	1	0	GABRB3	24376592	1.000000	0.71417	0.862000	0.33874	0.987000	0.75469	4.531000	0.60602	2.667000	0.90743	0.655000	0.94253	CGT		0.562	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			15	85	1	0	5.03518e-11	0.007413	6.89601e-11	15	85				
GABRB3	2562	broad.mit.edu	37	15	26825521	26825521	+	Silent	SNP	C	C	A	rs146431931		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:26825521C>A	ENST00000311550.5	-	6	738	c.627G>T	c.(625-627)ccG>ccT	p.P209P	GABRB3_ENST00000299267.4_Silent_p.P209P|GABRB3_ENST00000541819.2_Silent_p.P265P|GABRB3_ENST00000545868.1_Silent_p.P124P|GABRB3_ENST00000400188.3_Silent_p.P138P	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	209					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGGAGAACTGCGGGAGCTCAA	0.562																																							uc001zaz.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(625-627)CCG>CCT		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						131.0	116.0	121.0					15																	26825521		2203	4300	6503	SO:0001819	synonymous_variant	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26825521C>A		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.627G>T	15.37:g.26825521C>A			Somatic				GABRB3_uc010uae.1_Silent_p.P124P|GABRB3_uc001zba.2_Silent_p.P209P|GABRB3_uc001zbb.2_Silent_p.P265P	p.P209P	NM_000814	NP_000805	WXS	Illumina HiSeq	Unspecified	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	6	769	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	209			Extracellular (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Silent	SNP	ENST00000311550.5	37	c.627G>T	CCDS10019.1																																																																																				0.562	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			15	82	1	0	0.000219431	0.00245	0.000249534	15	82				
GABRB3	2562	broad.mit.edu	37	15	26866463	26866463	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:26866463G>A	ENST00000311550.5	-	4	570	c.459C>T	c.(457-459)ctC>ctT	p.L153L	GABRB3_ENST00000299267.4_Silent_p.L153L|GABRB3_ENST00000541819.2_Silent_p.L209L|GABRB3_ENST00000545868.1_Silent_p.L68L|GABRB3_ENST00000400188.3_Silent_p.L82L	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	153					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACACAGACCTGAGCCCATACA	0.438																																							uc001zaz.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(457-459)CTC>CTT		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						130.0	108.0	116.0					15																	26866463		2203	4300	6503	SO:0001819	synonymous_variant	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26866463G>A		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.459C>T	15.37:g.26866463G>A			Somatic				GABRB3_uc010uae.1_Silent_p.L68L|GABRB3_uc001zba.2_Silent_p.L153L|GABRB3_uc001zbb.2_Silent_p.L209L|GABRB3_uc001zbc.2_RNA	p.L153L	NM_000814	NP_000805	WXS	Illumina HiSeq	Unspecified	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	4	601	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	153			Extracellular (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Silent	SNP	ENST00000311550.5	37	c.459C>T	CCDS10019.1																																																																																				0.438	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			13	64	0	0	0	0.00245	0	13	64				
FMN1	342184	broad.mit.edu	37	15	33359339	33359339	+	Intron	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:33359339C>A	ENST00000559047.1	-	3	2043				FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Missense_Mutation_p.Q249H|FMN1_ENST00000558197.1_Missense_Mutation_p.Q249H			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CACTCGAATTCTGGTTTGTTA	0.512																																							uc001zhf.3		NA																	0				ovary(1)	1						c.(745-747)CAG>CAT		formin 1							99.0	104.0	102.0					15																	33359339		2033	4192	6225	SO:0001627	intron_variant	342184				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding	g.chr15:33359339C>A	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2064G>T	15.37:g.33359339C>A			Somatic				FMN1_uc001zhg.2_Missense_Mutation_p.Q249H	p.Q249H	NM_001103184	NP_001096654	WXS	Illumina HiSeq	Unspecified	Q68DA7	FMN1_HUMAN		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	1	747	-		all_lung(180;1.14e-07)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37	c.747G>T		.	.	.	.	.	.	.	.	.	.	C	6.779	0.512665	0.12944	.	.	ENSG00000248905	ENST00000334528	T	0.38887	1.11	5.59	4.67	0.58626	.	.	.	.	.	T	0.32496	0.0831	.	.	.	.	.	.	B;B	0.18461	0.028;0.01	B;B	0.23150	0.044;0.015	T	0.38672	-0.9650	7	0.48119	T	0.1	.	7.3582	0.26731	0.1647:0.728:0.0:0.1073	.	249;249	Q68DA7-3;Q68DA7-5	.;.	H	249	ENSP00000333950:Q249H	ENSP00000333950:Q249H	Q	-	3	2	FMN1	31146631	0.151000	0.22747	0.005000	0.12908	0.186000	0.23388	2.128000	0.42045	1.349000	0.45751	0.655000	0.94253	CAG		0.512	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184		11	89	1	0	2.27111e-07	0.013537	2.81653e-07	11	89				
RPAP1	26015	broad.mit.edu	37	15	41829206	41829206	+	Missense_Mutation	SNP	C	C	A	rs368858057		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:41829206C>A	ENST00000304330.4	-	2	234	c.118G>T	c.(118-120)Ggt>Tgt	p.G40C	RPAP1_ENST00000561603.1_Missense_Mutation_p.G40C	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	40						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GCATCACCACCGCCCCTATTT	0.587																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(118-120)GGT>TGT		RNA polymerase II associated protein 1							157.0	136.0	143.0					15																	41829206		2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41829206C>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.118G>T	15.37:g.41829206C>A	ENSP00000306123:p.Gly40Cys		Somatic					p.G40C	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	2	242	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	40					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.118G>T	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977142	0.34848	.	.	ENSG00000103932	ENST00000304330	D	0.83755	-1.76	5.11	0.961	0.19638	.	0.853507	0.10697	N	0.644517	T	0.70937	0.3281	N	0.22421	0.69	0.09310	N	1	P	0.40107	0.703	B	0.40940	0.344	T	0.61262	-0.7098	10	0.66056	D	0.02	1.0432	4.5226	0.11966	0.0:0.3649:0.3124:0.3227	.	40	Q9BWH6	RPAP1_HUMAN	C	40	ENSP00000306123:G40C	ENSP00000306123:G40C	G	-	1	0	RPAP1	39616498	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.032000	0.12266	0.025000	0.15241	-0.254000	0.11334	GGT		0.587	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		11	127	1	0	7.03913e-09	0.013537	9.12479e-09	11	127				
TICRR	90381	broad.mit.edu	37	15	90168095	90168095	+	Silent	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:90168095T>A	ENST00000268138.7	+	20	4659	c.4554T>A	c.(4552-4554)ccT>ccA	p.P1518P	TICRR_ENST00000560985.1_Silent_p.P1517P|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1518					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										CTGGCTCTCCTCTGATGCCTT	0.577																																							uc002boe.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(4552-4554)CCT>CCA		leucine-rich repeat kinase 1							111.0	119.0	116.0					15																	90168095		2200	4299	6499	SO:0001819	synonymous_variant	90381				cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding	g.chr15:90168095T>A	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4554T>A	15.37:g.90168095T>A			Somatic				C15orf42_uc010upv.1_RNA	p.P1518P	NM_152259	NP_689472	WXS	Illumina HiSeq	Unspecified	Q7Z2Z1	TICRR_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.128)		20	4554	+	Lung NSC(78;0.0237)|all_lung(78;0.0478)		1518					B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	c.4554T>A	CCDS10352.2																																																																																				0.577	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259		57	54	0	0	0	0.01441	0	57	54				
ADAMTS17	170691	broad.mit.edu	37	15	100649223	100649223	+	Missense_Mutation	SNP	T	T	C	rs76569625		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr15:100649223T>C	ENST00000268070.4	-	14	2092	c.1987A>G	c.(1987-1989)Act>Gct	p.T663A		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	663	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CAGAGATCAGTCTCGTAGGGC	0.617																																							uc002bvv.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1987-1989)ACT>GCT		ADAM metallopeptidase with thrombospondin type 1							84.0	72.0	76.0					15																	100649223		2203	4300	6503	SO:0001583	missense	170691				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:100649223T>C	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1987A>G	15.37:g.100649223T>C	ENSP00000268070:p.Thr663Ala		Somatic				ADAMTS17_uc002bvx.1_Missense_Mutation_p.T420A	p.T663A	NM_139057	NP_620688	WXS	Illumina HiSeq	Unspecified	Q8TE56	ATS17_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)	14	2066	-	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		663			Cys-rich.		Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	c.1987A>G	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.238620	0.39598	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.58940	0.3	5.15	4.03	0.46877	.	0.196491	0.42964	N	0.000623	T	0.49966	0.1588	M	0.63843	1.955	0.26164	N	0.979959	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.37820	-0.9689	10	0.16896	T	0.51	.	9.8038	0.40781	0.0:0.0814:0.0:0.9186	.	420;663	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	A	663;420	ENSP00000268070:T663A	ENSP00000268070:T663A	T	-	1	0	ADAMTS17	98466746	1.000000	0.71417	0.941000	0.38009	0.951000	0.60555	3.780000	0.55386	0.813000	0.34350	0.533000	0.62120	ACT		0.617	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057		25	65	0	0	0	0.00632	0	25	65				
ERCC4	2072	broad.mit.edu	37	16	14015970	14015970	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr16:14015970G>T	ENST00000311895.7	+	2	299	c.290G>T	c.(289-291)cGc>cTc	p.R97L	ERCC4_ENST00000575156.1_Missense_Mutation_p.R97L	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	97	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						AGCAACAGTCGCTATGAAGTT	0.373			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc002dce.2		NA	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""			E		skin basal cell|skin squamous cell|melanoma			0				lung(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(289-291)CGC>CTC	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							96.0	78.0	84.0					16																	14015970		2197	4300	6497	SO:0001583	missense	2072	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity	g.chr16:14015970G>T	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.290G>T	16.37:g.14015970G>T	ENSP00000310520:p.Arg97Leu		Somatic				ERCC4_uc010bva.2_Missense_Mutation_p.R97L	p.R97L	NM_005236	NP_005227	WXS	Illumina HiSeq	Unspecified	Q92889	XPF_HUMAN			2	299	+			97					A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	37	c.290G>T	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	G	33	5.232892	0.95207	.	.	ENSG00000175595	ENST00000311895;ENST00000439007;ENST00000389138	T	0.78364	-1.17	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.91250	0.7242	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.917;0.995	D	0.93404	0.6763	10	0.87932	D	0	-22.3841	18.0135	0.89231	0.0:0.0:1.0:0.0	.	97;97	A5PKV6;Q92889	.;XPF_HUMAN	L	97;86;86	ENSP00000310520:R97L	ENSP00000310520:R97L	R	+	2	0	ERCC4	13923471	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.370000	0.97159	2.470000	0.83445	0.655000	0.94253	CGC		0.373	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236		6	39	1	0	2.0095e-06	0.001984	2.43458e-06	6	39				
TUBB8P7	197331	broad.mit.edu	37	16	90161578	90161578	+	RNA	SNP	G	G	A	rs13337896	byFrequency	TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr16:90161578G>A	ENST00000564451.1	+	0	931				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7									p.R105H(3)									GCCAAGGGACGCTACACCGAA	0.587													.|||	668	0.133387	0.0386	0.1499	5008	,	,		18807	0.4087		0.0537	False		,,,				2504	0.0481						uc002fqp.2		NA																	3	Substitution - Missense(3)		urinary_tract(1)|prostate(1)|kidney(1)		NA						c.(451-453)ACG>ACA		Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																																						0							g.chr16:90161578G>A			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90161578G>A			Somatic				uc002fqq.2_Silent_p.T168T	p.T151T			WXS	Illumina HiSeq	Unspecified					3	931	+									Silent	SNP	ENST00000564451.1	37	c.453G>A																																																																																					0.587	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000420856.1	NG_002334		3	54	0	0	0	0.004672	0	3	54				
CLDN7	1366	broad.mit.edu	37	17	7163726	7163726	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:7163726G>A	ENST00000360325.7	-	4	1037	c.603C>T	c.(601-603)taC>taT	p.Y201Y	CLDN7_ENST00000397317.4_Silent_p.Y201Y|CLDN7_ENST00000573745.1_5'Flank|CLDN7_ENST00000538261.3_3'UTR|RP1-4G17.5_ENST00000577138.1_Intron	NM_001307.5	NP_001298.3	O95471	CLD7_HUMAN	claudin 7	201					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	6						TGGACTTAGGGTAAGAGCGGG	0.592																																							uc002gfm.3		NA																	0				ovary(1)	1						c.(601-603)TAC>TAT		claudin 7							100.0	83.0	88.0					17																	7163726		2203	4300	6503	SO:0001819	synonymous_variant	1366				calcium-independent cell-cell adhesion	integral to membrane|lateral plasma membrane|tight junction	identical protein binding|structural molecule activity	g.chr17:7163726G>A	AJ011497	CCDS11096.1, CCDS54081.1	17p13.1	2013-09-20			ENSG00000181885	ENSG00000181885		"""Claudins"""	2049	protein-coding gene	gene with protein product		609131		CEPTRL2, CPETRL2		9892664	Standard	NM_001307		Approved	Hs.84359	uc002gfm.4	O95471	OTTHUMG00000178005	ENST00000360325.7:c.603C>T	17.37:g.7163726G>A			Somatic				CLDN7_uc010cmc.2_3'UTR|CLDN7_uc002gfn.3_Silent_p.Y201Y	p.Y201Y	NM_001307	NP_001298	WXS	Illumina HiSeq	Unspecified	O95471	CLD7_HUMAN			4	1036	-			201			Cytoplasmic (Potential).		B2R9X7|D3DTP0|Q6IPN3|Q7Z4Y7|Q9BVN0	Silent	SNP	ENST00000360325.7	37	c.603C>T	CCDS11096.1																																																																																				0.592	CLDN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440204.2	NM_001307		11	84	0	0	0	0.001855	0	11	84				
UBBP4	23666	broad.mit.edu	37	17	21731278	21731278	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:21731278G>T	ENST00000584755.1	+	2	977	c.580G>T	c.(580-582)Ggc>Tgc	p.G194C	UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000578713.1_Intron					ubiquitin B pseudogene 4									p.G194S(1)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						GATCAGCAGAGGCTCATCTTT	0.547																																							uc002gyy.3		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(580-582)GGC>TGC		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21731278G>T	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.580G>T	17.37:g.21731278G>T	ENSP00000463647:p.Gly194Cys		Somatic					p.G194C			WXS	Illumina HiSeq	Unspecified					2	705	+									Missense_Mutation	SNP	ENST00000584755.1	37	c.580G>T																																																																																					0.547	UBBP4-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000444585.1			8	65	1	0	1.12685e-05	0.004482	1.33443e-05	8	65				
PIGW	284098	broad.mit.edu	37	17	34894132	34894132	+	Silent	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:34894132T>A	ENST00000592983.1	+	2	1762	c.1182T>A	c.(1180-1182)atT>atA	p.I394I	PIGW_ENST00000328396.2_Silent_p.I394I|MYO19_ENST00000590081.1_Intron			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	394					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GTGATATAATTTTGAGTTTTG	0.343																																							uc002hmy.1		NA																	0					0						c.(1180-1182)ATT>ATA		phosphatidylinositol glycan, class W							62.0	67.0	65.0					17																	34894132		2194	4292	6486	SO:0001819	synonymous_variant	284098				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	O-acyltransferase activity	g.chr17:34894132T>A	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.1182T>A	17.37:g.34894132T>A			Somatic				MYO19_uc010wcy.1_5'Flank|MYO19_uc002hmx.2_5'Flank|PIGW_uc002hmz.1_Silent_p.I394I	p.I394I	NM_178517	NP_848612	WXS	Illumina HiSeq	Unspecified	Q7Z7B1	PIGW_HUMAN	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	1225	+		Breast(25;0.00957)|Ovarian(249;0.17)	394					Q8N9G3	Silent	SNP	ENST00000592983.1	37	c.1182T>A	CCDS11313.1																																																																																				0.343	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451318.1	NM_178517		10	54	0	0	0	0.008291	0	10	54				
KRT40	125115	broad.mit.edu	37	17	39135199	39135199	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:39135199G>A	ENST00000398486.2	-	8	1213	c.1053C>T	c.(1051-1053)atC>atT	p.I351I	KRT40_ENST00000377755.4_Silent_p.I351I	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	351	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				CCAGGTTATCGATCAGACACT	0.592																																							uc010cxh.1		NA																	0					0						c.(1051-1053)ATC>ATT		type I hair keratin KA36							90.0	99.0	96.0					17																	39135199		2202	4295	6497	SO:0001819	synonymous_variant	125115					intermediate filament	structural molecule activity	g.chr17:39135199G>A	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.1053C>T	17.37:g.39135199G>A			Somatic				KRT40_uc002hvq.1_RNA	p.I351I	NM_182497	NP_872303	WXS	Illumina HiSeq	Unspecified	Q6A162	K1C40_HUMAN			8	1214	-		Breast(137;0.00043)	351			Rod.|Coil 2.		Q6IFU5	Silent	SNP	ENST00000398486.2	37	c.1053C>T	CCDS42320.1																																																																																				0.592	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497		4	152	0	0	0	0.001168	0	4	152				
DNAJC7	7266	broad.mit.edu	37	17	40139846	40139846	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:40139846C>A	ENST00000457167.4	-	9	1237	c.1001G>T	c.(1000-1002)aGa>aTa	p.R334I	DNAJC7_ENST00000316603.7_Missense_Mutation_p.R278I|DNAJC7_ENST00000426588.3_Missense_Mutation_p.R278I	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	334					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				CCACTGAGCTCTTCTCAAGTA	0.493																																					Colon(63;618 1117 8600 10857 19751)	Colon(63;618 1117 8600 10857 19751)	uc002hyo.2		NA																	0				ovary(1)	1						c.(1000-1002)AGA>ATA		DnaJ (Hsp40) homolog, subfamily C, member 7							128.0	113.0	117.0					17																	40139846		1965	4143	6108	SO:0001583	missense	7266				chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding	g.chr17:40139846C>A	U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.1001G>T	17.37:g.40139846C>A	ENSP00000406463:p.Arg334Ile		Somatic				DNAJC7_uc010cxu.2_Missense_Mutation_p.R278I|DNAJC7_uc010cxv.2_Missense_Mutation_p.R278I|DNAJC7_uc010wgb.1_Missense_Mutation_p.R278I|DNAJC7_uc010wgc.1_Missense_Mutation_p.R192I|DNAJC7_uc002hyp.2_Missense_Mutation_p.R278I|DNAJC7_uc010cxw.2_RNA	p.R334I	NM_003315	NP_003306	WXS	Illumina HiSeq	Unspecified	Q99615	DNJC7_HUMAN			9	1238	-		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)	334			TPR 9.		Q7Z784	Missense_Mutation	SNP	ENST00000457167.4	37	c.1001G>T	CCDS45677.1	.	.	.	.	.	.	.	.	.	.	C	31	5.087074	0.94100	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.64803	-0.12;-0.12;-0.12	5.78	5.78	0.91487	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.082880	0.85682	D	0.000000	D	0.85961	0.5819	H	0.94771	3.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.89098	0.3487	10	0.87932	D	0	-13.4024	20.0203	0.97492	0.0:1.0:0.0:0.0	.	323;278;334	Q59EH7;Q7Z784;Q99615	.;.;DNJC7_HUMAN	I	334;278;278	ENSP00000406463:R334I;ENSP00000394327:R278I;ENSP00000313311:R278I	ENSP00000313311:R278I	R	-	2	0	DNAJC7	37393372	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.730000	0.93505	0.655000	0.94253	AGA		0.493	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453366.2			3	14	1	0	0.00909568	0.009096	0.00974537	3	14				
SLC16A5	9121	broad.mit.edu	37	17	73102069	73102069	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:73102069T>C	ENST00000450736.2	+	6	1874	c.1459T>C	c.(1459-1461)Tgg>Cgg	p.W487R	SLC16A5_ENST00000329783.4_Missense_Mutation_p.W487R|SLC16A5_ENST00000580123.1_Missense_Mutation_p.W487R			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	487					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	GTGGCTCTTATGGCCAAAGGC	0.587											OREG0024726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002jmr.2		NA																	0				central_nervous_system(1)	1						c.(1459-1461)TGG>CGG		solute carrier family 16, member 5	Pyruvic acid(DB00119)						38.0	34.0	35.0					17																	73102069		2203	4300	6503	SO:0001583	missense	9121				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr17:73102069T>C	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.1459T>C	17.37:g.73102069T>C	ENSP00000390564:p.Trp487Arg		Somatic	OREG0024726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1142	SLC16A5_uc002jmt.2_Missense_Mutation_p.W487R|SLC16A5_uc002jmu.2_Missense_Mutation_p.W487R	p.W487R	NM_004695	NP_004686	WXS	Illumina HiSeq	Unspecified	O15375	MOT6_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		7	1831	+	all_lung(278;0.226)		487			Cytoplasmic (Potential).		B4E288	Missense_Mutation	SNP	ENST00000450736.2	37	c.1459T>C	CCDS11713.1	.	.	.	.	.	.	.	.	.	.	T	1.809	-0.475051	0.04414	.	.	ENSG00000170190	ENST00000329783;ENST00000450736	T;T	0.07688	3.17;3.17	3.42	1.14	0.20703	.	.	.	.	.	T	0.04048	0.0113	N	0.08118	0	0.19775	N	0.999952	B	0.15473	0.013	B	0.20767	0.031	T	0.41016	-0.9532	9	0.66056	D	0.02	.	2.914	0.05746	0.2148:0.1206:0.0:0.6646	.	487	O15375	MOT6_HUMAN	R	487	ENSP00000330141:W487R;ENSP00000390564:W487R	ENSP00000330141:W487R	W	+	1	0	SLC16A5	70613664	0.811000	0.29063	0.117000	0.21633	0.004000	0.04260	1.649000	0.37281	0.192000	0.20272	-0.443000	0.05667	TGG		0.587	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695		3	20	0	0	0	0.004672	0	3	20				
CBX2	84733	broad.mit.edu	37	17	77758731	77758731	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr17:77758731C>A	ENST00000310942.4	+	5	1593	c.1489C>A	c.(1489-1491)Cgc>Agc	p.R497S		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	497					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GAAGCCCACCCGCAGCCTCAT	0.622																																							uc002jxc.2		NA																	0					0						c.(1489-1491)CGC>AGC		chromobox homolog 2 isoform 1							72.0	65.0	67.0					17																	77758731		2203	4300	6503	SO:0001583	missense	84733				cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	g.chr17:77758731C>A	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.1489C>A	17.37:g.77758731C>A	ENSP00000308750:p.Arg497Ser		Somatic					p.R497S	NM_005189	NP_005180	WXS	Illumina HiSeq	Unspecified	Q14781	CBX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	1531	+			497					Q0VDA5|Q9BTB1	Missense_Mutation	SNP	ENST00000310942.4	37	c.1489C>A	CCDS32757.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471778	0.84533	.	.	ENSG00000173894	ENST00000310942	.	.	.	5.46	4.46	0.54185	.	0.224878	0.47093	D	0.000253	T	0.67040	0.2851	L	0.41632	1.29	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.65944	-0.6045	9	0.41790	T	0.15	-4.1812	15.657	0.77144	0.1375:0.8625:0.0:0.0	.	497	Q14781	CBX2_HUMAN	S	497	.	ENSP00000308750:R497S	R	+	1	0	CBX2	75373326	0.998000	0.40836	0.998000	0.56505	0.968000	0.65278	3.726000	0.54977	2.573000	0.86826	0.655000	0.94253	CGC		0.622	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1	NM_032647		9	36	1	0	0.000274275	0.004482	0.000305289	9	36				
ADCYAP1	116	broad.mit.edu	37	18	905469	905469	+	Missense_Mutation	SNP	G	G	T	rs8192594		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr18:905469G>T	ENST00000579794.1	+	1	360	c.82G>T	c.(82-84)Gcc>Tcc	p.A28S	RP11-672L10.2_ENST00000577358.1_RNA|ADCYAP1_ENST00000450565.3_Missense_Mutation_p.A28S|RP11-672L10.3_ENST00000582554.1_RNA|RP11-672L10.2_ENST00000580612.1_RNA|RP11-672L10.2_ENST00000581719.2_RNA	NM_001117.3	NP_001108.2	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary)	28					activation of adenylate cyclase activity (GO:0007190)|ATP metabolic process (GO:0046034)|behavioral fear response (GO:0001662)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|cellular response to glucocorticoid stimulus (GO:0071385)|female pregnancy (GO:0007565)|histamine secretion (GO:0001821)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of acute inflammatory response to non-antigenic stimulus (GO:0002878)|negative regulation of cell cycle (GO:0045786)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of Rho GTPase activity (GO:0034259)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|pituitary gland development (GO:0021983)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of somatostatin secretion (GO:0090274)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)|regulation of postsynaptic membrane potential (GO:0060078)|regulation of protein localization (GO:0032880)|response to ethanol (GO:0045471)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|terminal bouton (GO:0043195)	neuropeptide hormone activity (GO:0005184)|peptide hormone receptor binding (GO:0051428)|pituitary adenylate cyclase activating polypeptide activity (GO:0016521)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						CTCACCTGCCGCCGCCGGACT	0.632																																							uc010dkg.2		NA																	0					0						c.(82-84)GCC>TCC		adenylate cyclase activating polypeptide							56.0	54.0	55.0					18																	905469		2203	4300	6503	SO:0001583	missense	116				activation of adenylate cyclase activity|cell-cell signaling|female pregnancy|nerve growth factor receptor signaling pathway|regulation of G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|peptide hormone receptor binding	g.chr18:905469G>T	S83513	CCDS11825.1	18p11	2013-02-28			ENSG00000141433	ENSG00000141433		"""Endogenous ligands"""	241	protein-coding gene	gene with protein product	"""prepro-PACAP"""	102980				1730060	Standard	NM_001099733		Approved	PACAP	uc010dkh.4	P18509	OTTHUMG00000131479	ENST00000579794.1:c.82G>T	18.37:g.905469G>T	ENSP00000462647:p.Ala28Ser		Somatic				ADCYAP1_uc010dkh.2_Missense_Mutation_p.A28S	p.A28S	NM_001099733	NP_001093203	WXS	Illumina HiSeq	Unspecified	P18509	PACA_HUMAN			2	201	+			28					B2R7N4|Q52LQ0	Missense_Mutation	SNP	ENST00000579794.1	37	c.82G>T	CCDS11825.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.496515	0.44352	.	.	ENSG00000141433	ENST00000450565;ENST00000400219;ENST00000269200	.	.	.	3.28	1.48	0.22813	.	0.101008	0.43416	D	0.000569	T	0.25457	0.0619	L	0.34521	1.04	0.33269	D	0.560767	P	0.47762	0.9	B	0.39660	0.306	T	0.34700	-0.9818	9	0.22109	T	0.4	-3.7971	7.4932	0.27473	0.2257:0.0:0.7743:0.0	.	28	P18509	PACA_HUMAN	S	167;28;28	.	ENSP00000269200:A28S	A	+	1	0	ADCYAP1	895469	0.977000	0.34250	0.998000	0.56505	0.994000	0.84299	0.324000	0.19610	0.405000	0.25532	0.563000	0.77884	GCC		0.632	ADCYAP1-003	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440765.3	NM_001117		13	89	1	0	2.27111e-07	0.013537	2.81653e-07	13	89				
ASXL3	80816	broad.mit.edu	37	18	31323630	31323630	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr18:31323630C>T	ENST00000269197.5	+	12	3818	c.3818C>T	c.(3817-3819)aCa>aTa	p.T1273I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1273	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCAAACACTACAATTTCTGCT	0.388																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3817-3819)ACA>ATA		additional sex combs like 3							77.0	73.0	74.0					18																	31323630		1877	4103	5980	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323630C>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3818C>T	18.37:g.31323630C>T	ENSP00000269197:p.Thr1273Ile		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.T980I	p.T1273I	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	3873	+			1273			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.3818C>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870772	0.51695	.	.	ENSG00000141431	ENST00000269197	T	0.48836	0.8	5.68	5.68	0.88126	.	.	.	.	.	T	0.41719	0.1171	L	0.27053	0.805	0.38187	D	0.93979	P	0.43477	0.808	B	0.41135	0.348	T	0.50338	-0.8840	9	0.87932	D	0	.	18.7841	0.91947	0.0:1.0:0.0:0.0	.	1273	Q9C0F0	ASXL3_HUMAN	I	1273	ENSP00000269197:T1273I	ENSP00000269197:T1273I	T	+	2	0	ASXL3	29577628	0.989000	0.36119	0.958000	0.39756	0.989000	0.77384	3.746000	0.55127	2.689000	0.91719	0.655000	0.94253	ACA		0.388	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			7	46	0	0	0	0.00308	0	7	46				
FHOD3	80206	broad.mit.edu	37	18	34298333	34298333	+	Silent	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr18:34298333A>C	ENST00000359247.4	+	15	2496	c.2496A>C	c.(2494-2496)ccA>ccC	p.P832P	FHOD3_ENST00000257209.4_Silent_p.P849P|FHOD3_ENST00000590592.1_Silent_p.P1024P|FHOD3_ENST00000445677.1_Silent_p.P811P|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000592128.1_5'Flank	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	832	FH1.|Pro-rich.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CACCTCCCCCACCCCCACCCA	0.607																																							uc002kzt.1		NA																	0				skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(2494-2496)CCA>CCC		formin homology 2 domain containing 3							11.0	13.0	12.0					18																	34298333		2189	4270	6459	SO:0001819	synonymous_variant	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34298333A>C	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2496A>C	18.37:g.34298333A>C			Somatic				FHOD3_uc002kzs.1_Silent_p.P849P|FHOD3_uc010dmz.1_Silent_p.P564P|FHOD3_uc010dna.1_Silent_p.P152P	p.P832P	NM_025135	NP_079411	WXS	Illumina HiSeq	Unspecified	Q2V2M9	FHOD3_HUMAN			15	2593	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	832			FH1.|Pro-rich.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37	c.2496A>C																																																																																					0.607	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		3	22	0	0	0	0.001855	0	3	22				
C18orf54	162681	broad.mit.edu	37	18	51887198	51887198	+	Missense_Mutation	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr18:51887198T>A	ENST00000300091.5	+	2	588	c.256T>A	c.(256-258)Tgc>Agc	p.C86S	STARD6_ENST00000581310.1_5'Flank|C18orf54_ENST00000578138.1_Intron|STARD6_ENST00000577499.1_5'Flank|STARD6_ENST00000584040.1_5'Flank|C18orf54_ENST00000382911.4_Missense_Mutation_p.C86S	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	86						extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		GTCACAGTTCTGCAACTATAT	0.323																																							uc002lfn.3		NA																	0				ovary(1)|skin(1)	2						c.(256-258)TGC>AGC		hypothetical protein LOC162681 precursor							73.0	78.0	76.0					18																	51887198		2202	4299	6501	SO:0001583	missense	162681					extracellular region		g.chr18:51887198T>A	AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.256T>A	18.37:g.51887198T>A	ENSP00000300091:p.Cys86Ser		Somatic				C18orf54_uc002lfo.3_Missense_Mutation_p.C86S	p.C86S	NM_173529	NP_775800	WXS	Illumina HiSeq	Unspecified	Q8IYD9	CR054_HUMAN		Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)	2	372	+			86					I7HFJ6|Q6MZU3|Q6ZTL6	Missense_Mutation	SNP	ENST00000300091.5	37	c.256T>A	CCDS11956.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.616001	0.00828	.	.	ENSG00000166845	ENST00000300091;ENST00000382911	D;D	0.96992	-4.2;-4.2	5.38	2.83	0.33086	.	0.331370	0.28821	N	0.014036	D	0.82403	0.5029	N	0.01134	-0.995	0.25607	N	0.986532	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.74051	-0.3789	10	0.02654	T	1	-5.6363	6.9369	0.24470	0.148:0.0:0.1548:0.6973	.	86;86	Q8IYD9-2;Q8IYD9	.;CR054_HUMAN	S	86	ENSP00000300091:C86S;ENSP00000372368:C86S	ENSP00000300091:C86S	C	+	1	0	C18orf54	50141196	0.996000	0.38824	0.981000	0.43875	0.031000	0.12232	1.096000	0.30976	0.861000	0.35504	0.528000	0.53228	TGC		0.323	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256001.1	NM_173529		11	100	0	0	0	0.010729	0	11	100				
CDH7	1005	broad.mit.edu	37	18	63526255	63526255	+	Silent	SNP	C	C	T	rs147764044		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr18:63526255C>T	ENST00000397968.2	+	9	1893	c.1467C>T	c.(1465-1467)acC>acT	p.T489T	CDH7_ENST00000323011.3_Silent_p.T489T|CDH7_ENST00000536984.2_Silent_p.T489T	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	489	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				ATGAGACCACCGTCTGTGAAA	0.433																																							uc002ljz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1465-1467)ACC>ACT		cadherin 7, type 2 preproprotein		C	,	1,4405		0,1,2202	79.0	77.0	77.0		1467,1467	-10.6	0.0	18	dbSNP_134	77	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CDH7	NM_004361.2,NM_033646.1	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	489/786,489/786	63526255	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63526255C>T	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1467C>T	18.37:g.63526255C>T			Somatic				CDH7_uc002lka.2_Silent_p.T489T|CDH7_uc002lkb.2_Silent_p.T489T	p.T489T	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			9	1792	+		Esophageal squamous(42;0.129)	489			Extracellular (Potential).|Cadherin 5.		Q9H157	Silent	SNP	ENST00000397968.2	37	c.1467C>T	CCDS11993.1																																																																																				0.433	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		8	65	0	0	0	0.006214	0	8	65				
NMRK2	27231	broad.mit.edu	37	19	3942134	3942134	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:3942134G>A	ENST00000168977.2	+	8	846	c.556G>A	c.(556-558)Gac>Aac	p.D186N	NMRK2_ENST00000599576.1_3'UTR|NMRK2_ENST00000593949.1_Missense_Mutation_p.D191N	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	186					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										AGTCCTGGAAGACATTCAGAA	0.637																																							uc002lyz.3		NA																	0				skin(2)	2						c.(556-558)GAC>AAC		integrin beta 1 binding protein 3							45.0	44.0	45.0					19																	3942134		2203	4300	6503	SO:0001583	missense	27231				pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|protein binding|ribosylnicotinamide kinase activity	g.chr19:3942134G>A	AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.556G>A	19.37:g.3942134G>A	ENSP00000168977:p.Asp186Asn		Somatic				ITGB1BP3_uc010xia.1_Missense_Mutation_p.D191N	p.D186N	NM_170678	NP_733778	WXS	Illumina HiSeq	Unspecified	Q9NPI5	NRK2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)	8	846	+		Hepatocellular(1079;0.137)	186					B7ZKR3|Q52M81|Q9NZK3	Missense_Mutation	SNP	ENST00000168977.2	37	c.556G>A	CCDS12115.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184235	0.38609	.	.	ENSG00000077009	ENST00000168977;ENST00000395034	T	0.32272	1.46	3.62	3.62	0.41486	.	0.128624	0.49916	U	0.000133	T	0.23926	0.0579	L	0.35414	1.06	0.45899	D	0.998749	B;B	0.34255	0.445;0.143	B;B	0.35813	0.211;0.041	T	0.07121	-1.0789	10	0.46703	T	0.11	-21.5602	10.8193	0.46595	0.0:0.0:1.0:0.0	.	191;186	B7ZKR3;Q9NPI5	.;NRK2_HUMAN	N	186;142	ENSP00000168977:D186N	ENSP00000168977:D186N	D	+	1	0	ITGB1BP3	3893134	1.000000	0.71417	0.611000	0.29010	0.030000	0.12068	6.031000	0.70911	1.577000	0.49804	0.485000	0.47835	GAC		0.637	NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457492.1	NM_014446, NM_170678		4	58	0	0	0	0.009096	0	4	58				
C3	718	broad.mit.edu	37	19	6680180	6680180	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:6680180T>C	ENST00000245907.6	-	36	4537	c.4445A>G	c.(4444-4446)tAt>tGt	p.Y1482C	C3_ENST00000599668.1_5'Flank	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1482					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CAGGTTGTAATAGGCGTAGAC	0.498																																							uc002mfm.2		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(4444-4446)TAT>TGT		complement component 3 precursor							96.0	92.0	93.0					19																	6680180		2203	4300	6503	SO:0001583	missense	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6680180T>C	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4445A>G	19.37:g.6680180T>C	ENSP00000245907:p.Tyr1482Cys		Somatic				C3_uc002mfl.2_Missense_Mutation_p.Y218C	p.Y1482C	NM_000064	NP_000055	WXS	Illumina HiSeq	Unspecified	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	36	4507	-			1482					A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	c.4445A>G	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.251841	0.39797	.	.	ENSG00000125730	ENST00000245907	T	0.60672	0.17	4.97	4.97	0.65823	Alpha-macroglobulin, receptor-binding (3);	0.000000	0.85682	D	0.000000	D	0.83298	0.5224	H	0.97077	3.935	0.51012	D	0.999903	D	0.89917	1.0	D	0.97110	1.0	D	0.88784	0.3273	10	0.87932	D	0	.	13.6573	0.62346	0.0:0.0:0.0:1.0	.	1482	P01024	CO3_HUMAN	C	1482	ENSP00000245907:Y1482C	ENSP00000245907:Y1482C	Y	-	2	0	C3	6631180	1.000000	0.71417	0.999000	0.59377	0.161000	0.22273	5.246000	0.65411	1.883000	0.54544	0.473000	0.43528	TAT		0.498	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		8	61	0	0	0	0.004482	0	8	61				
ZNF317	57693	broad.mit.edu	37	19	9271460	9271460	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:9271460A>G	ENST00000247956.6	+	7	1444	c.1139A>G	c.(1138-1140)cAc>cGc	p.H380R	ZNF317_ENST00000360385.3_Missense_Mutation_p.H348R	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						TTTAATTTGCACAAGAAGAAC	0.522																																							uc002mku.2		NA																	0					0						c.(1138-1140)CAC>CGC		zinc finger protein 317							46.0	47.0	47.0					19																	9271460		2203	4300	6503	SO:0001583	missense	57693				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9271460A>G	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1139A>G	19.37:g.9271460A>G	ENSP00000247956:p.His380Arg		Somatic				ZNF317_uc002mkv.2_Missense_Mutation_p.H239R|ZNF317_uc002mkw.2_Missense_Mutation_p.H348R|ZNF317_uc002mkx.2_Missense_Mutation_p.H295R|ZNF317_uc002mky.2_Missense_Mutation_p.H263R	p.H380R	NM_020933	NP_065984	WXS	Illumina HiSeq	Unspecified	Q96PQ6	ZN317_HUMAN			7	1414	+			380			C2H2-type 6.		Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	ENST00000247956.6	37	c.1139A>G	CCDS12210.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162230	0.57368	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	D;D	0.86865	-2.18;-2.18	2.91	2.91	0.33838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44483	D	0.000459	D	0.94561	0.8248	H	0.96239	3.79	0.35328	D	0.785386	D;D	0.63046	0.99;0.992	D;D	0.75020	0.961;0.985	D	0.96244	0.9178	10	0.87932	D	0	-27.6445	9.5473	0.39288	1.0:0.0:0.0:0.0	.	348;380	Q96PQ6-2;Q96PQ6	.;ZN317_HUMAN	R	380;348	ENSP00000247956:H380R;ENSP00000353554:H348R	ENSP00000247956:H380R	H	+	2	0	ZNF317	9132460	0.740000	0.28207	0.990000	0.47175	0.820000	0.46376	3.126000	0.50477	1.588000	0.49971	0.397000	0.26171	CAC		0.522	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933		8	11	0	0	0	0.00308	0	8	11				
ELAVL3	1995	broad.mit.edu	37	19	11565613	11565613	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:11565613C>A	ENST00000359227.3	-	7	1256	c.832G>T	c.(832-834)Ggc>Tgc	p.G278C	ELAVL3_ENST00000438662.2_Missense_Mutation_p.G271C	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	278					cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						cccgccgcgccccccgACAGG	0.682																																							uc002mry.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(832-834)GGC>TGC		ELAV-like protein 3 isoform 1							56.0	59.0	58.0					19																	11565613		2202	4298	6500	SO:0001583	missense	1995				cell differentiation|nervous system development		AU-rich element binding|nucleotide binding	g.chr19:11565613C>A		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.832G>T	19.37:g.11565613C>A	ENSP00000352162:p.Gly278Cys		Somatic				ELAVL3_uc002mrx.1_Missense_Mutation_p.G271C	p.G278C	NM_001420	NP_001411	WXS	Illumina HiSeq	Unspecified	Q14576	ELAV3_HUMAN			7	1212	-			278					Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	ENST00000359227.3	37	c.832G>T	CCDS32912.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938479	0.73557	.	.	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.09630	2.97;2.96	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.12008	0.0292	N	0.08118	0	0.45867	D	0.998722	D;D	0.58970	0.972;0.984	P;P	0.58013	0.682;0.831	T	0.22521	-1.0214	10	0.46703	T	0.11	.	12.5449	0.56193	0.0:0.8316:0.1684:0.0	.	278;271	Q14576;Q14576-2	ELAV3_HUMAN;.	C	278;271	ENSP00000352162:G278C;ENSP00000390878:G271C	ENSP00000352162:G278C	G	-	1	0	ELAVL3	11426613	0.357000	0.24938	0.967000	0.41034	0.792000	0.44763	2.169000	0.42434	2.231000	0.72958	0.505000	0.49811	GGC		0.682	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420		39	43	1	0	9.85521e-28	0.00623	1.45065e-27	39	43				
ZNF563	147837	broad.mit.edu	37	19	12429554	12429554	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:12429554C>T	ENST00000293725.5	-	4	1490	c.1285G>A	c.(1285-1287)Gcg>Acg	p.A429T		NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	429					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						TGAGATAACGCTTTCCCACAC	0.428																																					GBM(39;623 795 5132 29510 31476)	GBM(39;623 795 5132 29510 31476)	uc002mtp.2		NA																	0					0						c.(1285-1287)GCG>ACG		zinc finger protein 563							206.0	189.0	195.0					19																	12429554		2203	4300	6503	SO:0001583	missense	147837				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12429554C>T	BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.1285G>A	19.37:g.12429554C>T	ENSP00000293725:p.Ala429Thr		Somatic					p.A429T	NM_145276	NP_660319	WXS	Illumina HiSeq	Unspecified	Q8TA94	ZN563_HUMAN			4	1523	-			429			C2H2-type 11.		B2R9E7|Q8NAT7	Missense_Mutation	SNP	ENST00000293725.5	37	c.1285G>A	CCDS12270.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.839301	0.32513	.	.	ENSG00000188868	ENST00000293725	T	0.13778	2.56	0.688	-0.659	0.11424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16642	0.0400	N	0.25380	0.74	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.17137	-1.0379	9	0.33940	T	0.23	.	1.7206	0.02911	0.3214:0.414:0.0:0.2647	.	429	Q8TA94	ZN563_HUMAN	T	429	ENSP00000293725:A429T	ENSP00000293725:A429T	A	-	1	0	ZNF563	12290554	0.000000	0.05858	0.007000	0.13788	0.082000	0.17680	-2.352000	0.01091	-0.179000	0.10654	0.306000	0.20318	GCG		0.428	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344114.1	NM_145276		4	149	0	0	0	0.009096	0	4	149				
SYCE2	256126	broad.mit.edu	37	19	13015425	13015425	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:13015425G>A	ENST00000293695.7	-	3	205	c.187C>T	c.(187-189)Ctg>Ttg	p.L63L	SYCE2_ENST00000591229.1_5'UTR	NM_001105578.1	NP_001099048.1	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	63					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						CTTGAGTCCAGAGAGGAGAAG	0.532																																							uc002mvr.2		NA																	0					0						c.(187-189)CTG>TTG		synaptonemal complex central element protein 2							181.0	184.0	183.0					19																	13015425		2142	4264	6406	SO:0001819	synonymous_variant	256126				cell division	central element		g.chr19:13015425G>A	AK097443	CCDS42509.1	19p13.13	2008-02-05				ENSG00000161860			27411	protein-coding gene	gene with protein product	"""central element synaptonemal complex 1"""	611487				15944401	Standard	NM_001105578		Approved	CESC1	uc002mvr.2	Q6PIF2		ENST00000293695.7:c.187C>T	19.37:g.13015425G>A			Somatic					p.L63L	NM_001105578	NP_001099048	WXS	Illumina HiSeq	Unspecified	Q6PIF2	SYCE2_HUMAN			3	202	-			63			Potential.		B4DYD3	Silent	SNP	ENST00000293695.7	37	c.187C>T	CCDS42509.1																																																																																				0.532	SYCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451913.1	XM_497609		6	133	0	0	0	0.00308	0	6	133				
SMIM7	79086	broad.mit.edu	37	19	16764904	16764904	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:16764904T>C	ENST00000487416.2	-	4	200	c.154A>G	c.(154-156)Aga>Gga	p.R52G	CTC-429P9.4_ENST00000593962.1_5'UTR|CTC-429P9.4_ENST00000600705.1_Intron|SMIM7_ENST00000397349.2_5'UTR|SMIM7_ENST00000597711.1_Intron|SMIM7_ENST00000358726.6_Missense_Mutation_p.R52G	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7	52						integral component of membrane (GO:0016021)											CGAAAGTATCTGAGGCTCAGC	0.483																																							uc002ner.2		NA																	0					0						c.(154-156)AGA>GGA		hypothetical protein LOC79086 precursor							109.0	113.0	112.0					19																	16764904		2010	4177	6187	SO:0001583	missense	79086					integral to membrane		g.chr19:16764904T>C	AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.154A>G	19.37:g.16764904T>C	ENSP00000417147:p.Arg52Gly		Somatic				C19orf42_uc002neo.1_RNA|C19orf42_uc002nep.1_Intron	p.R52G	NM_024104	NP_077009	WXS	Illumina HiSeq	Unspecified	Q9BQ49	CS042_HUMAN			4	201	-			52			Extracellular (Potential).		A8MX44	Missense_Mutation	SNP	ENST00000487416.2	37	c.154A>G	CCDS12348.2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.255838	0.80135	.	.	ENSG00000214046	ENST00000487416;ENST00000358726	.	.	.	5.11	0.0463	0.14233	.	0.000000	0.48286	U	0.000193	T	0.76442	0.3988	.	.	.	0.44104	D	0.996872	D	0.57899	0.981	D	0.66351	0.943	T	0.79706	-0.1691	8	0.87932	D	0	-15.3947	14.2539	0.66038	0.0:0.0:0.6632:0.3368	.	52	Q9BQ49	CS042_HUMAN	G	52	.	ENSP00000351569:R52G	R	-	1	2	C19orf42	16625904	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.965000	0.40471	0.046000	0.15833	0.533000	0.62120	AGA		0.483	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313801.2	NM_024104		3	47	0	0	0	0.009096	0	3	47				
TMEM59L	25789	broad.mit.edu	37	19	18731311	18731311	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:18731311C>A	ENST00000600490.1	+	9	1179	c.994C>A	c.(994-996)Ccc>Acc	p.P332T	TMEM59L_ENST00000262817.3_Missense_Mutation_p.P332T			Q9UK28	TM59L_HUMAN	transmembrane protein 59-like	332						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(2)	13						CAGCCTACCACCCTACAAGCT	0.657																																							uc002njy.3		NA																	0				ovary(2)|skin(2)	4						c.(994-996)CCC>ACC		brain-specific membrane-anchored protein							74.0	67.0	70.0					19																	18731311		2203	4300	6503	SO:0001583	missense	25789					Golgi membrane|integral to membrane|membrane fraction		g.chr19:18731311C>A	AF186264	CCDS12383.1	19p12	2008-02-05	2007-03-14	2007-03-14		ENSG00000105696			13237	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 4"""	C19orf4		10527841	Standard	NM_012109		Approved	BSMAP	uc002njy.4	Q9UK28		ENST00000600490.1:c.994C>A	19.37:g.18731311C>A	ENSP00000470879:p.Pro332Thr		Somatic					p.P332T	NM_012109	NP_036241	WXS	Illumina HiSeq	Unspecified	Q9UK28	TM59L_HUMAN			8	1081	+			332						Missense_Mutation	SNP	ENST00000600490.1	37	c.994C>A	CCDS12383.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.002150	0.54254	.	.	ENSG00000105696	ENST00000262817	T	0.54279	0.58	3.86	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.60222	0.2252	L	0.32530	0.975	0.45718	D	0.998625	D	0.89917	1.0	D	0.91635	0.999	T	0.63985	-0.6513	10	0.87932	D	0	-23.7674	11.9953	0.53198	0.0:1.0:0.0:0.0	.	332	Q9UK28	TM59L_HUMAN	T	332	ENSP00000262817:P332T	ENSP00000262817:P332T	P	+	1	0	TMEM59L	18592311	0.257000	0.24022	0.985000	0.45067	0.620000	0.37586	1.564000	0.36375	2.082000	0.62665	0.561000	0.74099	CCC		0.657	TMEM59L-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465143.2			14	56	1	0	2.31682e-05	0.003163	2.71301e-05	14	56				
ZNF208	7757	broad.mit.edu	37	19	22155891	22155891	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:22155891C>A	ENST00000397126.4	-	4	2093	c.1945G>T	c.(1945-1947)Gtc>Ttc	p.V649F	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGGGTTGAGACCTTAATAAAG	0.388																																							uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(1645-1647)GTC>TTC		zinc finger protein 208							103.0	107.0	106.0					19																	22155891		2124	4259	6383	SO:0001583	missense	7757							g.chr19:22155891C>A	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1945G>T	19.37:g.22155891C>A	ENSP00000380315:p.Val649Phe		Somatic				ZNF208_uc002nqo.1_Intron	p.V549F	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					5	1794	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.1645G>T	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	0.193	-1.051815	0.01981	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.37235	1.21	2.49	-4.98	0.03019	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26991	0.0661	.	.	.	0.09310	N	1	D	0.63046	0.992	P	0.54590	0.756	T	0.06391	-1.0829	8	0.09338	T	0.73	.	2.1915	0.03900	0.1609:0.1155:0.4404:0.2832	.	549	O43345	ZN208_HUMAN	F	649;549	ENSP00000380315:V649F	ENSP00000380315:V649F	V	-	1	0	ZNF208	21947731	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.411000	0.01040	-2.923000	0.00303	-1.544000	0.00907	GTC		0.388	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		27	71	1	0	5.61819e-17	0.005443	8.04422e-17	27	71				
ZNF829	374899	broad.mit.edu	37	19	37406057	37406057	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:37406057G>A	ENST00000391711.3	-	2	377	c.13C>T	c.(13-15)Cct>Tct	p.P5S	ZNF568_ENST00000455427.2_5'Flank|ZNF568_ENST00000333987.7_5'Flank|ZNF568_ENST00000427117.1_5'Flank|ZNF829_ENST00000520965.1_Missense_Mutation_p.P86S|ZNF568_ENST00000415168.1_5'Flank	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAGATCAGAGGAGAATGGGGC	0.498																																							uc002ofa.1		NA																	0					0						c.(13-15)CCT>TCT		zinc finger protein 829							139.0	131.0	133.0					19																	37406057		1925	4136	6061	SO:0001583	missense	374899				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37406057G>A	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.13C>T	19.37:g.37406057G>A	ENSP00000429266:p.Pro5Ser		Somatic				ZNF568_uc010efg.2_5'Flank|ZNF568_uc010xtn.1_5'Flank|ZNF829_uc002ofb.2_Missense_Mutation_p.P5S|ZNF568_uc002ofc.2_5'Flank|ZNF568_uc002ofd.2_5'Flank|ZNF568_uc010efe.2_5'Flank|ZNF568_uc010eff.1_5'Flank	p.P5S	NM_001037232	NP_001032309	WXS	Illumina HiSeq	Unspecified	Q3KNS6	ZN829_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		2	375	-	Esophageal squamous(110;0.183)		5					Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	ENST00000391711.3	37	c.13C>T	CCDS42557.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.685440	0.29872	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.05081	3.5	3.93	-5.49	0.02584	.	.	.	.	.	T	0.02156	0.0067	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46247	-0.9205	9	0.18710	T	0.47	.	1.0445	0.01566	0.3578:0.2718:0.232:0.1384	.	5	Q3KNS6	ZN829_HUMAN	S	5	ENSP00000429266:P5S	ENSP00000429266:P5S	P	-	1	0	ZNF829	42097897	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.552000	0.06020	-0.925000	0.03775	-0.733000	0.03571	CCT		0.498	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232		6	41	0	0	0	0.001984	0	6	41				
ZNF578	147660	broad.mit.edu	37	19	53014565	53014565	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:53014565G>A	ENST00000421239.2	+	6	1175	c.931G>A	c.(931-933)Ggt>Agt	p.G311S	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ATGTCACACTGGTGAGAAACC	0.418																																							uc002pzp.3		NA																	0					0						c.(931-933)GGT>AGT		zinc finger protein 578							104.0	107.0	106.0					19																	53014565		2203	4300	6503	SO:0001583	missense	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53014565G>A	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.931G>A	19.37:g.53014565G>A	ENSP00000459216:p.Gly311Ser		Somatic					p.G311S	NM_001099694	NP_001093164	WXS	Illumina HiSeq	Unspecified	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	6	1175	+			86					B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	c.931G>A	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	16.30	3.084506	0.55861	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.37	1.37	0.22104	.	.	.	.	.	T	0.26048	0.0635	L	0.41492	1.28	0.22827	N	0.998689	P	0.37708	0.606	B	0.37833	0.259	T	0.12218	-1.0556	7	.	.	.	.	5.0884	0.14694	0.2005:0.0:0.7995:0.0	.	311	G3V4F6	.	S	311	.	.	G	+	1	0	ZNF578	57706377	0.608000	0.26966	0.249000	0.24280	0.125000	0.20455	3.734000	0.55037	0.767000	0.33267	0.297000	0.19635	GGT		0.418	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472		5	83	0	0	0	0.000602	0	5	83				
KIR3DL1	3811	broad.mit.edu	37	19	55341578	55341578	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:55341578G>T	ENST00000391728.4	+	9	1216	c.1183G>T	c.(1183-1185)Gag>Tag	p.E395*	KIR3DL1_ENST00000402254.2_Intron|KIR2DS4_ENST00000339924.8_RNA|KIR3DL1_ENST00000538269.1_Nonsense_Mutation_p.E395*|KIR3DL1_ENST00000541392.1_Nonsense_Mutation_p.E378*|KIR3DL1_ENST00000358178.4_Nonsense_Mutation_p.E300*|KIR3DL1_ENST00000326542.7_Nonsense_Mutation_p.E378*	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	395					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		AGACCCTGAGGAGGTGACATA	0.512																																							uc002qhk.3		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1183-1185)GAG>TAG		killer cell immunoglobulin-like receptor, three							241.0	222.0	229.0					19																	55341578		2171	4165	6336	SO:0001587	stop_gained	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55341578G>T	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.1183G>T	19.37:g.55341578G>T	ENSP00000375608:p.Glu395*		Somatic				KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Nonsense_Mutation_p.E320*|KIR3DL1_uc010esf.2_Nonsense_Mutation_p.E300*|KIR3DL1_uc010yfo.1_Nonsense_Mutation_p.E337*|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	p.E395*	NM_013289	NP_037421	WXS	Illumina HiSeq	Unspecified	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	9	1246	+			395			Cytoplasmic (Potential).		O43473|Q14946|Q16541	Nonsense_Mutation	SNP	ENST00000391728.4	37	c.1183G>T	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	-	10.16	1.273224	0.23221	.	.	ENSG00000167633	ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	.	.	.	0.719	-0.45	0.12223	.	.	.	.	.	.	.	.	.	.	.	0.47341	D	0.999391	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	395;378;373;395;378;300	.	ENSP00000326868:E378X	E	+	1	0	KIR3DL1	60033390	0.996000	0.38824	0.006000	0.13384	0.003000	0.03518	2.450000	0.44943	-0.110000	0.12022	-1.254000	0.01491	GAG		0.512	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		42	254	1	0	8.72198e-27	0.01441	1.27787e-26	42	254				
NLRP2	55655	broad.mit.edu	37	19	55493791	55493791	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr19:55493791C>A	ENST00000543010.1	+	6	868	c.725C>A	c.(724-726)gCg>gAg	p.A242E	NLRP2_ENST00000427260.2_Missense_Mutation_p.A219E|NLRP2_ENST00000538819.1_Missense_Mutation_p.A218E|NLRP2_ENST00000339757.7_Missense_Mutation_p.A220E|NLRP2_ENST00000263437.6_Missense_Mutation_p.A239E|NLRP2_ENST00000391721.4_Missense_Mutation_p.A218E|NLRP2_ENST00000537859.1_Missense_Mutation_p.A220E|NLRP2_ENST00000448584.2_Missense_Mutation_p.A242E	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	242	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.A242V(3)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TTCAAATATGCGTTCTACCTC	0.552																																							uc002qij.2		NA																	3	Substitution - Missense(3)		large_intestine(2)|prostate(1)	ovary(1)|skin(1)	2						c.(724-726)GCG>GAG		NLR family, pyrin domain containing 2							54.0	49.0	51.0					19																	55493791		2203	4300	6503	SO:0001583	missense	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55493791C>A	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.725C>A	19.37:g.55493791C>A	ENSP00000445135:p.Ala242Glu		Somatic				NLRP2_uc010yfp.1_Missense_Mutation_p.A219E|NLRP2_uc010esn.2_Missense_Mutation_p.A218E|NLRP2_uc010eso.2_Missense_Mutation_p.A239E|NLRP2_uc010esp.2_Missense_Mutation_p.A220E	p.A242E	NM_017852	NP_060322	WXS	Illumina HiSeq	Unspecified	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	6	811	+			242			NACHT.		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	c.725C>A	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.965630	0.34659	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	1.41	0.267	0.15622	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.84804	0.5553	M	0.81341	2.54	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.996;0.997;0.994;0.997	T	0.71331	-0.4625	9	0.87932	D	0	.	4.0691	0.09874	0.0:0.5874:0.0:0.4126	.	219;220;239;218;242	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	E	242;218;220;242;220;219;218;239	ENSP00000445135:A242E;ENSP00000375601:A218E;ENSP00000344074:A220E;ENSP00000409370:A242E;ENSP00000440601:A220E;ENSP00000402474:A219E;ENSP00000441133:A218E;ENSP00000263437:A239E	ENSP00000263437:A239E	A	+	2	0	NLRP2	60185603	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.873000	0.28052	0.148000	0.19059	0.485000	0.47835	GCG		0.552	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		13	9	1	0	0.000151284	0.001855	0.000174559	13	9				
XDH	7498	broad.mit.edu	37	2	31571173	31571173	+	Silent	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:31571173C>A	ENST00000379416.3	-	28	3156	c.3108G>T	c.(3106-3108)ggG>ggT	p.G1036G		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1036					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CCATCTCAGTCCCCCCGTGGG	0.507																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	0				skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(3106-3108)GGG>GGT		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						76.0	70.0	72.0					2																	31571173		2203	4300	6503	SO:0001819	synonymous_variant	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31571173C>A	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3108G>T	2.37:g.31571173C>A			Somatic					p.G1036G	NM_000379	NP_000370	WXS	Illumina HiSeq	Unspecified	P47989	XDH_HUMAN			28	3187	-	Acute lymphoblastic leukemia(172;0.155)		1036					Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	c.3108G>T	CCDS1775.1																																																																																				0.507	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		19	47	1	0	0.000229342	0.012319	0.000259866	19	47				
VIT	5212	broad.mit.edu	37	2	37035904	37035904	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:37035904T>C	ENST00000389975.3	+	14	1936	c.1634T>C	c.(1633-1635)cTg>cCg	p.L545P	VIT_ENST00000401530.1_Missense_Mutation_p.L524P|VIT_ENST00000497382.1_Missense_Mutation_p.L214P|VIT_ENST00000379241.3_Missense_Mutation_p.L523P|VIT_ENST00000404084.1_Missense_Mutation_p.L497P|VIT_ENST00000379242.3_Missense_Mutation_p.L560P	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	545	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				GAACAGCGGCTGGAGTTTGGG	0.592																																							uc002rpl.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1678-1680)CTG>CCG		vitrin							89.0	83.0	85.0					2																	37035904		2203	4300	6503	SO:0001583	missense	5212					proteinaceous extracellular matrix		g.chr2:37035904T>C	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1634T>C	2.37:g.37035904T>C	ENSP00000374625:p.Leu545Pro		Somatic				VIT_uc002rpm.2_Missense_Mutation_p.L538P|VIT_uc010ezv.2_Missense_Mutation_p.L516P|VIT_uc010ezw.2_Missense_Mutation_p.L517P	p.L560P	NM_053276	NP_444506	WXS	Illumina HiSeq	Unspecified	Q6UXI7	VITRN_HUMAN			15	1900	+		all_hematologic(82;0.248)	545			VWFA 2.		A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	37	c.1679T>C	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.614515	0.66672	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000497382;ENST00000404084;ENST00000379241;ENST00000401530	T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.27	4.12	0.48240	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.83741	0.5320	L	0.57130	1.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81004	-0.1129	10	0.33141	T	0.24	-11.7206	10.9287	0.47205	0.0:0.0736:0.0:0.9264	.	524;523;545;560	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4	.;.;VITRN_HUMAN;.	P	560;545;214;497;523;524	ENSP00000368544:L560P;ENSP00000374625:L545P;ENSP00000417874:L214P;ENSP00000384154:L497P;ENSP00000368543:L523P;ENSP00000385658:L524P	ENSP00000368543:L523P	L	+	2	0	VIT	36889408	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.259000	0.72494	0.850000	0.35239	0.455000	0.32223	CTG		0.592	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				3	83	0	0	0	0.009096	0	3	83				
PNPT1	87178	broad.mit.edu	37	2	55874559	55874559	+	Missense_Mutation	SNP	C	C	G	rs146571352	byFrequency	TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:55874559C>G	ENST00000447944.2	-	19	1611	c.1525G>C	c.(1525-1527)Gta>Cta	p.V509L		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	509					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CCTATTGCTACGCCTGCAACA	0.373																																							uc002rzf.2		NA																	0					0						c.(1525-1527)GTA>CTA		polyribonucleotide nucleotidyltransferase 1							79.0	81.0	80.0					2																	55874559		2203	4300	6503	SO:0001583	missense	87178				mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding	g.chr2:55874559C>G	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1525G>C	2.37:g.55874559C>G	ENSP00000400646:p.Val509Leu		Somatic				PNPT1_uc002rzg.2_RNA	p.V509L	NM_033109	NP_149100	WXS	Illumina HiSeq	Unspecified	Q8TCS8	PNPT1_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		19	1578	-			509					Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	c.1525G>C	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	C	32	5.148293	0.94603	.	.	ENSG00000138035	ENST00000447944	T	0.59083	0.29	5.53	5.53	0.82687	Exoribonuclease, phosphorolytic domain 2 (2);	0.000000	0.85682	D	0.000000	T	0.81408	0.4816	M	0.89715	3.055	0.80722	D	1	D	0.63046	0.992	D	0.70016	0.967	D	0.84623	0.0685	10	0.87932	D	0	-11.5957	19.8115	0.96547	0.0:1.0:0.0:0.0	.	509	Q8TCS8	PNPT1_HUMAN	L	509	ENSP00000400646:V509L	ENSP00000386075:V509L	V	-	1	0	PNPT1	55728063	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.789000	0.75110	2.745000	0.94114	0.563000	0.77884	GTA		0.373	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109		13	83	0	0	0	0.003163	0	13	83				
NAGK	55577	broad.mit.edu	37	2	71299832	71299832	+	Silent	SNP	C	C	T	rs150661812		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:71299832C>T	ENST00000244204.6	+	5	479	c.417C>T	c.(415-417)tcC>tcT	p.S139S	NAGK_ENST00000443938.2_Silent_p.S139S|NAGK_ENST00000443872.2_5'UTR|NAGK_ENST00000455662.2_Silent_p.S185S|NAGK_ENST00000428360.2_3'UTR|NAGK_ENST00000418807.3_Silent_p.S88S			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	139					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	CTGATGGCTCCGAGAGTGGCT	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		20375	0.0		0.001	False		,,,				2504	0.0						uc002shp.3		NA																	0					0						c.(415-417)TCC>TCT		N-Acetylglucosamine kinase	N-Acetyl-D-glucosamine(DB00141)						49.0	45.0	46.0					2																	71299832		2203	4300	6503	SO:0001819	synonymous_variant	55577				N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding	g.chr2:71299832C>T	AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.417C>T	2.37:g.71299832C>T			Somatic				NAGK_uc010fea.2_RNA|NAGK_uc002shq.3_5'UTR|NAGK_uc002shr.2_Silent_p.S88S	p.S139S	NM_017567	NP_060037	WXS	Illumina HiSeq	Unspecified	Q9UJ70	NAGK_HUMAN			5	823	+			139					B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Silent	SNP	ENST00000244204.6	37	c.417C>T		.	.	.	.	.	.	.	.	.	.	C	10.48	1.361713	0.24684	.	.	ENSG00000124357	ENST00000443938	.	.	.	5.44	-7.68	0.01268	.	.	.	.	.	T	0.36248	0.0960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44360	-0.9333	4	.	.	.	-34.4974	3.4752	0.07582	0.1041:0.3644:0.3049:0.2266	.	.	.	.	L	161	.	.	P	+	2	0	NAGK	71153340	0.000000	0.05858	0.965000	0.40720	0.974000	0.67602	-3.452000	0.00466	-0.912000	0.03837	-0.487000	0.04747	CCG		0.602	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1			4	51	0	0	0	0.009096	0	4	51				
ALMS1	7840	broad.mit.edu	37	2	73635838	73635838	+	Missense_Mutation	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:73635838T>G	ENST00000264448.6	+	2	524	c.413T>G	c.(412-414)tTg>tGg	p.L138W	ALMS1_ENST00000409009.1_Intron|ALMS1_ENST00000377715.1_Missense_Mutation_p.L138W	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	138					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GTGGTCTGTTTGGAAACAACA	0.368																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(415-417)TTG>TGG		Alstrom syndrome 1							141.0	132.0	135.0					2																	73635838		1857	4106	5963	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73635838T>G	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.413T>G	2.37:g.73635838T>G	ENSP00000264448:p.Leu138Trp		Somatic				ALMS1_uc002sjf.1_Intron	p.L139W	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			3	527	+			138					Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.416T>G	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	T	10.15	1.270645	0.23221	.	.	ENSG00000116127	ENST00000264448;ENST00000377715	T;T	0.20463	2.94;2.07	3.6	-0.0691	0.13753	.	1.585170	0.04649	N	0.406836	T	0.22589	0.0545	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	D	0.63033	0.91	T	0.27365	-1.0076	10	0.87932	D	0	.	5.8738	0.18819	0.0:0.3543:0.0:0.6457	.	138	Q8TCU4	ALMS1_HUMAN	W	138	ENSP00000264448:L138W;ENSP00000366944:L138W	ENSP00000264448:L138W	L	+	2	0	ALMS1	73489346	0.119000	0.22226	0.005000	0.12908	0.010000	0.07245	0.531000	0.23052	-0.010000	0.14271	-0.385000	0.06624	TTG		0.368	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		3	156	0	0	0	0.009096	0	3	156				
REG3A	5068	broad.mit.edu	37	2	79385459	79385459	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:79385459G>C	ENST00000409839.3	-	4	362	c.326C>G	c.(325-327)cCc>cGc	p.P109R	REG3A_ENST00000393878.1_Missense_Mutation_p.P109R|REG3A_ENST00000305165.2_Missense_Mutation_p.P109R|AC011754.1_ENST00000415201.1_RNA	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	109	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						CACCTGTGTGGGGTCATGGAG	0.567																																							uc002sod.1		NA																	0				skin(1)	1						c.(325-327)CCC>CGC		pancreatitis-associated protein precursor							124.0	99.0	107.0					2																	79385459		2203	4300	6503	SO:0001583	missense	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79385459G>C	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.326C>G	2.37:g.79385459G>C	ENSP00000386630:p.Pro109Arg		Somatic				REG3A_uc002soe.1_Missense_Mutation_p.P109R|REG3A_uc002sof.1_Missense_Mutation_p.P109R	p.P109R	NM_138938	NP_620355	WXS	Illumina HiSeq	Unspecified	Q06141	REG3A_HUMAN			3	581	-			109			C-type lectin.			Missense_Mutation	SNP	ENST00000409839.3	37	c.326C>G	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241795	0.22711	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.13089	2.62;2.62;2.62	4.02	2.22	0.28083	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.53938	D	0.000048	T	0.26919	0.0659	M	0.62088	1.915	0.37453	D	0.914908	D	0.89917	1.0	D	0.81914	0.995	T	0.07966	-1.0745	10	0.35671	T	0.21	.	6.2665	0.20930	0.226:0.0:0.774:0.0	.	109	Q06141	REG3A_HUMAN	R	109	ENSP00000386630:P109R;ENSP00000377456:P109R;ENSP00000304311:P109R	ENSP00000304311:P109R	P	-	2	0	REG3A	79238967	1.000000	0.71417	0.998000	0.56505	0.019000	0.09904	2.453000	0.44970	0.661000	0.30985	-0.199000	0.12753	CCC		0.567	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		5	65	0	0	0	0.001168	0	5	65				
THSD7B	80731	broad.mit.edu	37	2	137814712	137814712	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:137814712C>G	ENST00000409968.1	+	3	1040	c.862C>G	c.(862-864)Cat>Gat	p.H288D	THSD7B_ENST00000272643.3_Missense_Mutation_p.H288D|THSD7B_ENST00000413152.2_Missense_Mutation_p.H257D|THSD7B_ENST00000543459.1_Missense_Mutation_p.H147D			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	288						integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAAAGCACATCATCATTCGAA	0.383																																							uc002tva.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(769-771)CAT>GAT		thrombospondin, type I, domain containing 7B							63.0	62.0	63.0					2																	137814712		1870	4105	5975	SO:0001583	missense	80731							g.chr2:137814712C>G			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.862C>G	2.37:g.137814712C>G	ENSP00000387145:p.His288Asp		Somatic				THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.H147D	p.H257D	NM_001080427	NP_001073896	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(221;0.19)	2	769	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.769C>G		.	.	.	.	.	.	.	.	.	.	C	15.78	2.935214	0.52866	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.23348	2.49;2.36;1.97;1.91	5.45	5.45	0.79879	.	0.254033	0.45606	D	0.000343	T	0.32194	0.0821	M	0.62723	1.935	0.54753	D	0.999981	P;P	0.47409	0.791;0.895	B;P	0.45753	0.334;0.492	T	0.02132	-1.1208	10	0.35671	T	0.21	.	13.5713	0.61847	0.0:0.9241:0.0:0.0759	.	288;257	Q9C0I4;C9JKN6	THS7B_HUMAN;.	D	288;288;257;147	ENSP00000387145:H288D;ENSP00000272643:H288D;ENSP00000413841:H257D;ENSP00000443370:H147D	ENSP00000272643:H288D	H	+	1	0	THSD7B	137531182	0.977000	0.34250	0.997000	0.53966	0.810000	0.45777	2.933000	0.48948	2.721000	0.93114	0.585000	0.79938	CAT		0.383	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		7	45	0	0	0	0.00308	0	7	45				
RIF1	55183	broad.mit.edu	37	2	152319779	152319779	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:152319779G>C	ENST00000243326.5	+	29	4228	c.3745G>C	c.(3745-3747)Gtg>Ctg	p.V1249L	RIF1_ENST00000428287.2_Missense_Mutation_p.V1249L|RIF1_ENST00000444746.2_Missense_Mutation_p.V1249L|RIF1_ENST00000453091.2_Missense_Mutation_p.V1249L|RIF1_ENST00000430328.2_Missense_Mutation_p.V1249L			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AACTGTTACAGTGAAAAATAA	0.333																																							uc002txm.2		NA																	0				ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15						c.(3745-3747)GTG>CTG		RAP1 interacting factor 1							62.0	69.0	67.0					2																	152319779		2203	4296	6499	SO:0001583	missense	55183				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding	g.chr2:152319779G>C	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.3745G>C	2.37:g.152319779G>C	ENSP00000243326:p.Val1249Leu		Somatic				RIF1_uc002txl.2_Missense_Mutation_p.V1249L|RIF1_uc002txn.2_Missense_Mutation_p.V1249L|RIF1_uc002txo.2_Missense_Mutation_p.V1249L|RIF1_uc002txp.2_RNA	p.V1249L	NM_018151	NP_060621	WXS	Illumina HiSeq	Unspecified	Q5UIP0	RIF1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0429)	30	3875	+			1249					A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	c.3745G>C	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	G	8.858	0.946292	0.18356	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.10477	2.87;2.87;2.87;2.87;2.87	5.33	0.386	0.16254	.	0.206543	0.32753	N	0.005700	T	0.08582	0.0213	M	0.64997	1.995	0.09310	N	0.999995	B;B	0.31548	0.117;0.328	B;B	0.26770	0.019;0.073	T	0.25187	-1.0139	10	0.31617	T	0.26	-0.178	3.3641	0.07197	0.2163:0.1091:0.563:0.1116	.	1249;1249	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	L	1249	ENSP00000390181:V1249L;ENSP00000414615:V1249L;ENSP00000415691:V1249L;ENSP00000243326:V1249L;ENSP00000416123:V1249L	ENSP00000243326:V1249L	V	+	1	0	RIF1	152028025	0.189000	0.23263	0.000000	0.03702	0.923000	0.55619	1.406000	0.34646	-0.234000	0.09782	0.563000	0.77884	GTG		0.333	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			10	75	0	0	0	0.008291	0	10	75				
ITGB6	3694	broad.mit.edu	37	2	161025799	161025799	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:161025799T>C	ENST00000283249.2	-	7	1178	c.941A>G	c.(940-942)cAa>cGa	p.Q314R	ITGB6_ENST00000409967.2_Missense_Mutation_p.Q314R|ITGB6_ENST00000409872.1_Missense_Mutation_p.Q314R|ITGB6_ENST00000428609.2_Missense_Mutation_p.Q272R|ITGB6_ENST00000485635.1_5'UTR	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	314	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						ATCAATGAGTTGTCCAATTGT	0.274																																							uc002ubh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(940-942)CAA>CGA		integrin, beta 6 precursor							108.0	107.0	107.0					2																	161025799		2202	4300	6502	SO:0001583	missense	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:161025799T>C		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.941A>G	2.37:g.161025799T>C	ENSP00000283249:p.Gln314Arg		Somatic				ITGB6_uc010fow.1_RNA|ITGB6_uc010fou.2_Missense_Mutation_p.Q314R|ITGB6_uc010zcq.1_Missense_Mutation_p.Q272R|ITGB6_uc010fov.1_Missense_Mutation_p.Q314R	p.Q314R	NM_000888	NP_000879	WXS	Illumina HiSeq	Unspecified	P18564	ITB6_HUMAN			7	957	-			314			Extracellular (Potential).|VWFA.		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	c.941A>G	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.061396	0.76187	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.98012	-4.66;-4.66;-4.66;-4.66	5.79	5.79	0.91817	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.98890	0.9624	M	0.90198	3.095	0.58432	D	0.999994	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.99568	1.0970	10	0.48119	T	0.1	.	16.123	0.81375	0.0:0.0:0.0:1.0	.	272;314	E9PEE8;P18564	.;ITB6_HUMAN	R	314;272;314;314	ENSP00000283249:Q314R;ENSP00000408024:Q272R;ENSP00000386828:Q314R;ENSP00000386367:Q314R	ENSP00000283249:Q314R	Q	-	2	0	ITGB6	160734045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.847000	0.62867	2.202000	0.70862	0.533000	0.62120	CAA		0.274	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		15	95	0	0	0	0.007413	0	15	95				
SCN1A	6323	broad.mit.edu	37	2	166892607	166892607	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:166892607A>G	ENST00000303395.4	-	16	3379	c.3380T>C	c.(3379-3381)tTa>tCa	p.L1127S	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.L1116S|SCN1A_ENST00000409050.1_Missense_Mutation_p.L1099S|SCN1A_ENST00000423058.2_Missense_Mutation_p.L1127S|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1127					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCCGTGTTTAAATTTTCAAA	0.338																																							uc010zcz.1		NA																	0				ovary(6)|skin(6)|large_intestine(1)	13						c.(3346-3348)TTA>TCA		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						156.0	159.0	158.0					2																	166892607		2203	4300	6503	SO:0001583	missense	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166892607A>G	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3380T>C	2.37:g.166892607A>G	ENSP00000303540:p.Leu1127Ser		Somatic				SCN1A_uc002udo.3_Missense_Mutation_p.L996S|SCN1A_uc010fpk.2_Missense_Mutation_p.L968S	p.L1116S	NM_006920	NP_008851	WXS	Illumina HiSeq	Unspecified	P35498	SCN1A_HUMAN			16	3365	-			1127					E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	c.3347T>C	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.538951	0.45176	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.44	5.44	0.79542	Sodium ion transport-associated (1);	0.000000	0.53938	D	0.000056	D	0.90349	0.6980	M	0.82823	2.61	0.49582	D	0.999801	P;D;B	0.58970	0.891;0.984;0.392	P;P;B	0.61070	0.612;0.883;0.261	D	0.90782	0.4680	10	0.46703	T	0.11	.	15.7833	0.78281	1.0:0.0:0.0:0.0	.	1116;1099;1127	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	S	1127;1127;1116;1099	ENSP00000407030:L1127S;ENSP00000303540:L1127S;ENSP00000364554:L1116S;ENSP00000386312:L1099S	ENSP00000303540:L1127S	L	-	2	0	SCN1A	166600853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.908000	0.63307	2.187000	0.69744	0.533000	0.62120	TTA		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		8	169	0	0	0	0.006214	0	8	169				
ATF2	1386	broad.mit.edu	37	2	175939413	175939413	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:175939413G>A	ENST00000264110.2	-	14	1740	c.1442C>T	c.(1441-1443)gCg>gTg	p.A481V	ATF2_ENST00000538946.1_3'UTR|ATF2_ENST00000409635.1_Missense_Mutation_p.A423V|ATF2_ENST00000426833.3_Missense_Mutation_p.A463V|ATF2_ENST00000409499.1_Missense_Mutation_p.A120V|ATF2_ENST00000487334.2_3'UTR|ATF2_ENST00000392544.1_Missense_Mutation_p.A481V|ATF2_ENST00000409437.1_Missense_Mutation_p.A365V|ATF2_ENST00000345739.5_Missense_Mutation_p.A423V|ATF2_ENST00000392543.2_Missense_Mutation_p.A102V	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	481					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	ACTCTGGTCCGCCATCTGGGT	0.498																																					Pancreas(17;87 705 4534 15538 30988)	Pancreas(17;87 705 4534 15538 30988)	uc002ujl.2		NA																	0				lung(1)|breast(1)|pancreas(1)	3						c.(1441-1443)GCG>GTG		activating transcription factor 2							76.0	67.0	70.0					2																	175939413		2203	4300	6503	SO:0001583	missense	1386				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding	g.chr2:175939413G>A	X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.1442C>T	2.37:g.175939413G>A	ENSP00000264110:p.Ala481Val		Somatic				ATF2_uc010fqv.2_Missense_Mutation_p.A432V|ATF2_uc002ujv.2_Missense_Mutation_p.A228V|ATF2_uc002ujm.2_Missense_Mutation_p.A423V|ATF2_uc002ujn.2_RNA|ATF2_uc002ujo.2_Missense_Mutation_p.A120V|ATF2_uc002ujp.2_RNA|ATF2_uc002ujq.2_Missense_Mutation_p.A481V|ATF2_uc002ujr.2_RNA|ATF2_uc010fqu.2_Missense_Mutation_p.A463V|ATF2_uc002ujs.2_Missense_Mutation_p.A423V|ATF2_uc002ujt.2_RNA|ATF2_uc002uju.2_RNA|ATF2_uc002ujw.1_3'UTR|ATF2_uc002ujx.1_RNA|uc002ujk.2_5'Flank	p.A481V	NM_001880	NP_001871	WXS	Illumina HiSeq	Unspecified	P15336	ATF2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.125)		14	1704	-			481					A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	ENST00000264110.2	37	c.1442C>T	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532712	0.45073	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409437;ENST00000409635;ENST00000392544;ENST00000409499;ENST00000426833;ENST00000392543	T;T;T;T;T;T	0.79033	-1.23;0.36;-0.59;0.36;-1.23;-1.21	5.83	5.83	0.93111	.	0.113302	0.64402	D	0.000013	D	0.85991	0.5826	L	0.53249	1.67	0.80722	D	1	P;D;P;P	0.89917	0.947;1.0;0.773;0.947	B;D;B;B	0.66351	0.236;0.943;0.121;0.236	D	0.86152	0.1588	10	0.72032	D	0.01	-48.6219	20.115	0.97926	0.0:0.0:1.0:0.0	.	463;120;423;481	A4D7U4;Q96JT8;Q3B7B7;P15336	.;.;.;ATF2_HUMAN	V	481;423;458;365;423;481;120;463;102	ENSP00000264110:A481V;ENSP00000340576:A423V;ENSP00000386326:A365V;ENSP00000387093:A423V;ENSP00000376327:A481V;ENSP00000407911:A463V	ENSP00000264110:A481V	A	-	2	0	ATF2	175647659	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.497000	0.90488	2.761000	0.94854	0.650000	0.86243	GCG		0.498	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255562.1	NM_001880		3	42	0	0	0	0.004672	0	3	42				
TTN	7273	broad.mit.edu	37	2	179395519	179395519	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:179395519C>T	ENST00000591111.1	-	308	101124	c.100900G>A	c.(100900-100902)Gag>Aag	p.E33634K	TTN_ENST00000589042.1_Missense_Mutation_p.E35275K|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E26335K|TTN_ENST00000342992.6_Missense_Mutation_p.E32707K|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E26402K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E26210K|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588716.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33634					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAACTTTCTCTGTTGGTGTT	0.468																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(98119-98121)GAG>AAG		titin isoform N2-A							139.0	137.0	138.0					2																	179395519		1923	4115	6038	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179395519C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100900G>A	2.37:g.179395519C>T	ENSP00000465570:p.Glu33634Lys		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E26402K|TTN_uc010zfi.1_Missense_Mutation_p.E26335K|TTN_uc010zfj.1_Missense_Mutation_p.E26210K|TTN_uc002umq.2_5'Flank	p.E32707K	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	98343	-			33634					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.98119G>A		.	.	.	.	.	.	.	.	.	.	C	12.11	1.839223	0.32513	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63255	-0.03;0.2;0.18;0.17	4.99	4.99	0.66335	Ribonuclease H-like (1);	.	.	.	.	T	0.50973	0.1647	L	0.27053	0.805	0.39550	D	0.96895	P;P;P;P	0.37781	0.608;0.608;0.608;0.608	B;B;B;B	0.32980	0.156;0.156;0.156;0.156	T	0.61267	-0.7097	9	0.87932	D	0	.	18.2867	0.90117	0.0:1.0:0.0:0.0	.	26210;26335;26402;33634	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	32707;26210;26402;26335;26207	ENSP00000343764:E32707K;ENSP00000434586:E26210K;ENSP00000340554:E26402K;ENSP00000352154:E26335K	ENSP00000340554:E26402K	E	-	1	0	TTN	179103765	0.990000	0.36364	0.988000	0.46212	0.045000	0.14185	3.427000	0.52785	2.321000	0.78463	0.455000	0.32223	GAG		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	44	0	0	0	0.009096	0	4	44				
TTN	7273	broad.mit.edu	37	2	179403902	179403902	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:179403902C>T	ENST00000591111.1	-	303	94061	c.93837G>A	c.(93835-93837)cgG>cgA	p.R31279R	TTN_ENST00000589042.1_Silent_p.R32920R|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Silent_p.R23980R|TTN_ENST00000342992.6_Silent_p.R30352R|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Silent_p.R24047R|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590932.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Silent_p.R23855R|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588716.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31279	Fibronectin type-III 128. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCTTTGGGCCGGGACCAGG	0.473																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(91054-91056)CGG>CGA		titin isoform N2-A							151.0	143.0	145.0					2																	179403902		1984	4162	6146	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179403902C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.93837G>A	2.37:g.179403902C>T			Somatic				uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.R24047R|TTN_uc010zfi.1_Silent_p.R23980R|TTN_uc010zfj.1_Silent_p.R23855R	p.R30352R	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		302	91280	-			31279					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.91056G>A																																																																																					0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	52	0	0	0	0.00308	0	7	52				
TTN	7273	broad.mit.edu	37	2	179439116	179439116	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:179439116G>T	ENST00000591111.1	-	276	67044	c.66820C>A	c.(66820-66822)Cca>Aca	p.P22274T	TTN_ENST00000589042.1_Missense_Mutation_p.P23915T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P14975T|TTN_ENST00000342992.6_Missense_Mutation_p.P21347T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P15042T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P14850T|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22274	Fibronectin type-III 61. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTCTGATGGCTTGCTTGGC	0.438																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(64039-64041)CCA>ACA		titin isoform N2-A							153.0	152.0	153.0					2																	179439116		1906	4119	6025	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179439116G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66820C>A	2.37:g.179439116G>T	ENSP00000465570:p.Pro22274Thr		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P15042T|TTN_uc010zfi.1_Missense_Mutation_p.P14975T|TTN_uc010zfj.1_Missense_Mutation_p.P14850T	p.P21347T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	64263	-			22274					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.64039C>A		.	.	.	.	.	.	.	.	.	.	G	3.783	-0.045160	0.07452	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.53	3.71	0.42584	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.43188	0.1236	L	0.45698	1.435	0.33609	D	0.603356	B;B;B;B	0.32573	0.22;0.22;0.22;0.376	B;B;B;B	0.30401	0.039;0.039;0.039;0.115	T	0.55341	-0.8156	9	0.87932	D	0	.	7.5614	0.27853	0.139:0.2552:0.6058:0.0	.	14850;14975;15042;22274	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	21347;14850;15042;14975;14848	ENSP00000343764:P21347T;ENSP00000434586:P14850T;ENSP00000340554:P15042T;ENSP00000352154:P14975T	ENSP00000340554:P15042T	P	-	1	0	TTN	179147362	1.000000	0.71417	0.998000	0.56505	0.423000	0.31445	2.275000	0.43399	0.682000	0.31407	0.455000	0.32223	CCA		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	178	1	0	1.33987e-11	0.008291	1.85114e-11	10	178				
TTN	7273	broad.mit.edu	37	2	179474087	179474087	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:179474087G>T	ENST00000591111.1	-	223	47251	c.47027C>A	c.(47026-47028)cCt>cAt	p.P15676H	TTN_ENST00000589042.1_Missense_Mutation_p.P17317H|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P8377H|TTN_ENST00000342992.6_Missense_Mutation_p.P14749H|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P8444H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P8252H|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15676	Ig-like 98.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTGTCAGAGGCAGGACAAA	0.448																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(44245-44247)CCT>CAT		titin isoform N2-A							123.0	123.0	123.0					2																	179474087		1973	4160	6133	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179474087G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.47027C>A	2.37:g.179474087G>T	ENSP00000465570:p.Pro15676His		Somatic				uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P8444H|TTN_uc010zfi.1_Missense_Mutation_p.P8377H|TTN_uc010zfj.1_Missense_Mutation_p.P8252H	p.P14749H	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		222	44470	-			15676					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.44246C>A		.	.	.	.	.	.	.	.	.	.	G	11.84	1.757283	0.31137	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.61980	0.06;0.3;0.28;0.27	5.72	5.72	0.89469	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70657	0.3249	M	0.72353	2.195	0.40466	D	0.980297	D;D;D;D	0.55172	0.97;0.97;0.97;0.97	P;P;P;P	0.50791	0.65;0.65;0.65;0.65	T	0.75693	-0.3229	9	0.87932	D	0	.	15.3716	0.74570	0.0:0.1388:0.8612:0.0	.	8252;8377;8444;15676	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	14749;8252;8444;8377;8252	ENSP00000343764:P14749H;ENSP00000434586:P8252H;ENSP00000340554:P8444H;ENSP00000352154:P8377H	ENSP00000340554:P8444H	P	-	2	0	TTN	179182332	0.875000	0.30112	0.996000	0.52242	0.857000	0.48899	4.551000	0.60740	2.684000	0.91462	0.563000	0.77884	CCT		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		8	42	1	0	9.70103e-10	0.008291	1.28938e-09	8	42				
TTN	7273	broad.mit.edu	37	2	179554545	179554545	+	Missense_Mutation	SNP	G	G	T	rs376754004		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:179554545G>T	ENST00000591111.1	-	120	31114	c.30890C>A	c.(30889-30891)gCt>gAt	p.A10297D	TTN_ENST00000589042.1_Missense_Mutation_p.A10614D|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.A9370D|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTACCTTTAGCTGGGGGAGC	0.368																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(28108-28110)GCT>GAT		titin isoform N2-A		G	,,,ASP/ALA	0,3668		0,0,1834	156.0	150.0	152.0		,,,28109	3.7	1.0	2		152	1,8169		0,1,4084	no	intron,intron,intron,missense	TTN	NM_003319.4,NM_133432.3,NM_133437.3,NM_133378.4	,,,126	0,1,5918	TT,TG,GG		0.0122,0.0,0.0084	,,,benign	,,,9370/33424	179554545	1,11837	1834	4085	5919	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179554545G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30890C>A	2.37:g.179554545G>T	ENSP00000465570:p.Ala10297Asp		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A6031D|TTN_uc010fre.1_Missense_Mutation_p.A481D	p.A9370D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		119	28333	-			10297					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.28109C>A		.	.	.	.	.	.	.	.	.	.	G	14.46	2.542684	0.45280	0.0	1.22E-4	ENSG00000155657	ENST00000342992;ENST00000414766;ENST00000473181	T;T	0.71934	-0.61;-0.61	5.53	3.7	0.42460	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.66046	0.2750	M	0.66297	2.02	0.80722	D	1	B;B	0.30361	0.174;0.277	B;B	0.32465	0.125;0.146	T	0.68300	-0.5445	9	0.87932	D	0	.	6.1607	0.20362	0.2077:0.0:0.6566:0.1357	.	10297;10297	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	D	9370;492;124	ENSP00000343764:A9370D;ENSP00000401501:A492D	ENSP00000343764:A9370D	A	-	2	0	TTN	179262790	0.881000	0.30235	1.000000	0.80357	0.886000	0.51366	2.152000	0.42272	1.457000	0.47850	0.655000	0.94253	GCT		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		16	142	1	0	6.94344e-10	0.006122	9.34694e-10	16	142				
TTN	7273	broad.mit.edu	37	2	179599266	179599266	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:179599266C>A	ENST00000591111.1	-	50	14558	c.14334G>T	c.(14332-14334)caG>caT	p.Q4778H	TTN_ENST00000589042.1_Missense_Mutation_p.Q5095H|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.Q3851H|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12160	Ig-like 28.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGACTTCACACTGAAGTAGAG	0.378																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(11551-11553)CAG>CAT		titin isoform N2-A							87.0	86.0	86.0					2																	179599266		1849	4103	5952	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179599266C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14334G>T	2.37:g.179599266C>A	ENSP00000465570:p.Gln4778His		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.Q512H	p.Q3851H	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		49	11777	-			4778					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.11553G>T		.	.	.	.	.	.	.	.	.	.	C	11.38	1.622268	0.28889	.	.	ENSG00000155657	ENST00000342992	T	0.68181	-0.31	5.76	1.75	0.24633	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51329	0.1668	L	0.28740	0.885	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.51060	-0.8753	9	0.87932	D	0	.	8.0406	0.30519	0.11:0.6133:0.2137:0.0629	.	4778	Q8WZ42	TITIN_HUMAN	H	3851	ENSP00000343764:Q3851H	ENSP00000343764:Q3851H	Q	-	3	2	TTN	179307511	0.992000	0.36948	1.000000	0.80357	0.918000	0.54935	0.392000	0.20801	0.772000	0.33382	0.563000	0.77884	CAG		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		14	75	1	0	3.27435e-08	0.00245	4.12568e-08	14	75				
COL5A2	1290	broad.mit.edu	37	2	189918906	189918906	+	Silent	SNP	C	C	T	rs200019093		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:189918906C>T	ENST00000374866.3	-	36	2698	c.2424G>A	c.(2422-2424)ccG>ccA	p.P808P		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	808					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TAGGACCTGCCGGACCTGGAG	0.398																																							uc002uqk.2		NA																	0				ovary(2)	2						c.(2422-2424)CCG>CCA		alpha 2 type V collagen preproprotein							72.0	73.0	73.0					2																	189918906		2203	4300	6503	SO:0001819	synonymous_variant	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189918906C>T	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2424G>A	2.37:g.189918906C>T			Somatic				COL5A2_uc010frx.2_Silent_p.P384P	p.P808P	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		36	2699	-			808					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	c.2424G>A	CCDS33350.1																																																																																				0.398	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		4	99	0	0	0	0.009096	0	4	99				
ERBB4	2066	broad.mit.edu	37	2	212989572	212989572	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:212989572G>C	ENST00000342788.4	-	2	449	c.139C>G	c.(139-141)Cga>Gga	p.R47G	ERBB4_ENST00000402597.1_Missense_Mutation_p.R47G|ERBB4_ENST00000436443.1_Missense_Mutation_p.R47G	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	47					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CGCAAGGCTCGGTACTGCTGT	0.473										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(139-141)CGA>GGA		v-erb-a erythroblastic leukemia viral oncogene							128.0	115.0	120.0					2																	212989572		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212989572G>C	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.139C>G	2.37:g.212989572G>C	ENSP00000342235:p.Arg47Gly	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.R47G|ERBB4_uc010zji.1_Missense_Mutation_p.R47G|ERBB4_uc010zjj.1_Missense_Mutation_p.R47G|ERBB4_uc010fut.1_Missense_Mutation_p.R47G	p.R47G	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	2	237	-		Renal(323;0.06)|Lung NSC(271;0.197)	47			Extracellular (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.139C>G	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887791	0.33348	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	D;D;D	0.82526	-1.62;-1.62;-1.62	5.28	4.39	0.52855	.	0.071047	0.56097	D	0.000028	T	0.69124	0.3076	N	0.19112	0.55	0.44234	D	0.99707	P;P;P;P	0.42993	0.797;0.647;0.797;0.694	B;B;B;B	0.37267	0.123;0.245;0.123;0.125	T	0.66756	-0.5843	10	0.23302	T	0.38	.	13.0076	0.58715	0.0:0.0:0.7061:0.2939	.	47;47;47;47	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	G	47	ENSP00000342235:R47G;ENSP00000403204:R47G;ENSP00000385565:R47G	ENSP00000342235:R47G	R	-	1	2	ERBB4	212697817	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.559000	0.73946	1.205000	0.43262	-0.181000	0.13052	CGA		0.473	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		5	49	0	0	0	0.000602	0	5	49				
DNAJB2	3300	broad.mit.edu	37	2	220146664	220146664	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:220146664C>T	ENST00000336576.5	+	5	521	c.233C>T	c.(232-234)aCt>aTt	p.T78I	DNAJB2_ENST00000463463.1_3'UTR|DNAJB2_ENST00000392086.4_Missense_Mutation_p.T78I	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	78					cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTTCCAGGAACTGGCCCATCT	0.622																																							uc002vkx.1		NA																	0					0						c.(232-234)ACT>ATT		DnaJ (Hsp40) homolog, subfamily B, member 2							49.0	47.0	47.0					2																	220146664		2203	4300	6503	SO:0001583	missense	3300				ER-associated protein catabolic process|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of inclusion body assembly|negative regulation of protein deubiquitination|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding|response to unfolded protein	inclusion body	heat shock protein binding|Hsp70 protein binding|polyubiquitin binding|proteasome binding|protein binding|unfolded protein binding	g.chr2:220146664C>T		CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.233C>T	2.37:g.220146664C>T	ENSP00000338019:p.Thr78Ile		Somatic				DNAJB2_uc010zla.1_Missense_Mutation_p.T78I|DNAJB2_uc002vkw.1_Missense_Mutation_p.T78I|DNAJB2_uc002vky.2_5'Flank|DNAJB2_uc010zlb.1_5'Flank	p.T78I	NM_006736	NP_006727	WXS	Illumina HiSeq	Unspecified	P25686	DNJB2_HUMAN		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	5	470	+		Renal(207;0.0474)	78					A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Missense_Mutation	SNP	ENST00000336576.5	37	c.233C>T	CCDS2439.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642851	0.67244	.	.	ENSG00000135924	ENST00000336576;ENST00000425450;ENST00000392086;ENST00000421532;ENST00000392087;ENST00000442681;ENST00000439026	T;T;T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76	4.55	3.64	0.41730	Heat shock protein DnaJ, N-terminal (1);	.	.	.	.	T	0.62588	0.2440	N	0.17082	0.46	0.27733	N	0.944743	B;B;B	0.26708	0.157;0.073;0.145	B;B;B	0.28916	0.096;0.042;0.045	T	0.60188	-0.7312	9	0.62326	D	0.03	.	14.2683	0.66135	0.0:0.8441:0.1559:0.0	.	78;78;78	B4DF16;P25686;P25686-2	.;DNJB2_HUMAN;.	I	78	ENSP00000338019:T78I;ENSP00000414796:T78I;ENSP00000375936:T78I;ENSP00000395173:T78I;ENSP00000375937:T78I;ENSP00000392790:T78I;ENSP00000387951:T78I	ENSP00000338019:T78I	T	+	2	0	DNAJB2	219854908	0.069000	0.21087	0.989000	0.46669	0.684000	0.39900	2.047000	0.41269	1.229000	0.43630	0.467000	0.42956	ACT		0.622	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256823.2			4	46	0	0	0	0.009096	0	4	46				
PTPRN	5798	broad.mit.edu	37	2	220167119	220167119	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:220167119C>T	ENST00000295718.2	-	6	974	c.734G>A	c.(733-735)aGc>aAc	p.S245N	PTPRN_ENST00000423636.2_Missense_Mutation_p.S155N|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000409251.3_Missense_Mutation_p.S245N	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	245					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GGCAGTTCTGCTGAAGAGGGC	0.632																																							uc002vkz.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(733-735)AGC>AAC		protein tyrosine phosphatase, receptor type, N							25.0	27.0	26.0					2																	220167119		2203	4300	6503	SO:0001583	missense	5798				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr2:220167119C>T		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.734G>A	2.37:g.220167119C>T	ENSP00000295718:p.Ser245Asn		Somatic				PTPRN_uc010zlc.1_Missense_Mutation_p.S155N|PTPRN_uc002vla.2_Missense_Mutation_p.S245N	p.S245N	NM_002846	NP_002837	WXS	Illumina HiSeq	Unspecified	Q16849	PTPRN_HUMAN		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)	6	823	-		Renal(207;0.0474)	245			Extracellular (Potential).		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	c.734G>A	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753185	0.49362	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.03889	3.77;3.84;3.84	4.85	3.95	0.45737	.	0.000000	0.64402	D	0.000019	T	0.08758	0.0217	L	0.27053	0.805	0.26011	N	0.981997	D;P	0.60160	0.987;0.688	D;B	0.63381	0.914;0.138	T	0.13415	-1.0510	10	0.39692	T	0.17	.	9.3407	0.38079	0.0:0.8368:0.0:0.1632	.	245;245	Q6NSL1;Q16849	.;PTPRN_HUMAN	N	245;245;245;155	ENSP00000386638:S245N;ENSP00000295718:S245N;ENSP00000444244:S155N	ENSP00000295718:S245N	S	-	2	0	PTPRN	219875363	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.410000	0.34691	2.514000	0.84764	0.561000	0.74099	AGC		0.632	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2			6	20	0	0	0	0.001984	0	6	20				
SPEG	10290	broad.mit.edu	37	2	220313108	220313108	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:220313108C>T	ENST00000312358.7	+	4	1360	c.1228C>T	c.(1228-1230)Cga>Tga	p.R410*	SPEG_ENST00000396695.2_5'UTR|SPEG_ENST00000396698.1_Nonsense_Mutation_p.R306*|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	410					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTTCGAGGAGCGACGGCGCAG	0.736																																							uc010fwg.2		NA																	0				stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(1228-1230)CGA>TGA		SPEG complex locus							2.0	3.0	3.0					2																	220313108		1432	3196	4628	SO:0001587	stop_gained	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220313108C>T	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.1228C>T	2.37:g.220313108C>T	ENSP00000311684:p.Arg410*		Somatic				SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_5'UTR|SPEG_uc002vln.1_5'UTR|SPEG_uc002vlp.1_5'Flank	p.R410*	NM_005876	NP_005867	WXS	Illumina HiSeq	Unspecified	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	4	1228	+		Renal(207;0.0183)	410					A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Nonsense_Mutation	SNP	ENST00000312358.7	37	c.1228C>T	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451918	0.84209	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000431523;ENST00000396698	.	.	.	4.85	4.85	0.62838	.	0.000000	0.34200	N	0.004169	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6881	0.56960	0.165:0.835:0.0:0.0	.	.	.	.	X	410;410;257;306	.	ENSP00000265327:R410X	R	+	1	2	SPEG	220021352	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.016000	0.49607	2.237000	0.73441	0.462000	0.41574	CGA		0.736	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		2	2	0	0	0	0.004672	0	2	2				
GIGYF2	26058	broad.mit.edu	37	2	233651927	233651927	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:233651927A>T	ENST00000409547.1	+	11	911	c.600A>T	c.(598-600)gaA>gaT	p.E200D	GIGYF2_ENST00000373566.3_Missense_Mutation_p.E222D|GIGYF2_ENST00000409451.3_Missense_Mutation_p.E222D|GIGYF2_ENST00000409480.1_Missense_Mutation_p.E222D|GIGYF2_ENST00000373563.4_Missense_Mutation_p.E200D|GIGYF2_ENST00000409196.3_Missense_Mutation_p.E200D|GIGYF2_ENST00000452341.2_Missense_Mutation_p.E31D	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	200	Arg-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TACGCTCAGAAAGTGAAAATT	0.423																																							uc002vti.3		NA																	0				ovary(4)|central_nervous_system(3)	7						c.(598-600)GAA>GAT		GRB10 interacting GYF protein 2 isoform b							115.0	118.0	117.0					2																	233651927		2203	4300	6503	SO:0001583	missense	26058				cell death		protein binding	g.chr2:233651927A>T	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.600A>T	2.37:g.233651927A>T	ENSP00000386537:p.Glu200Asp		Somatic				GIGYF2_uc010zmj.1_Missense_Mutation_p.E200D|GIGYF2_uc002vtg.2_Missense_Mutation_p.E200D|GIGYF2_uc002vtj.3_Missense_Mutation_p.E222D|GIGYF2_uc002vtk.3_Missense_Mutation_p.E200D|GIGYF2_uc002vth.3_Missense_Mutation_p.E200D|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Missense_Mutation_p.E31D	p.E200D	NM_015575	NP_056390	WXS	Illumina HiSeq	Unspecified	Q6Y7W6	PERQ2_HUMAN		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)	11	937	+		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)	200			Arg-rich.		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	c.600A>T	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.426793	0.43020	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000445650;ENST00000452341;ENST00000421778	T;T;T;T;T;T;T;T;T;T	0.74421	-0.56;-0.6;-0.56;-0.6;-0.67;-0.57;-0.56;-0.72;-0.84;-0.22	5.63	-0.914	0.10497	.	0.105878	0.64402	D	0.000006	T	0.47728	0.1461	N	0.03115	-0.41	0.31190	N	0.701091	B;B;B;B	0.32573	0.245;0.376;0.236;0.086	B;B;B;B	0.39094	0.29;0.159;0.031;0.082	T	0.53514	-0.8428	10	0.06494	T	0.89	-21.8995	11.639	0.51222	0.3978:0.0:0.6022:0.0	.	31;222;200;200	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	D	222;149;200;222;200;200;149;200;222;200;31;31;27	ENSP00000362667:E222D;ENSP00000362664:E200D;ENSP00000386765:E222D;ENSP00000386537:E200D;ENSP00000404195:E149D;ENSP00000387070:E200D;ENSP00000387170:E222D;ENSP00000410297:E200D;ENSP00000392218:E31D;ENSP00000411505:E31D	ENSP00000362664:E200D	E	+	3	2	GIGYF2	233360171	0.999000	0.42202	0.967000	0.41034	0.989000	0.77384	0.596000	0.24044	-0.071000	0.12886	0.533000	0.62120	GAA		0.423	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146		25	50	0	0	0	0.009535	0	25	50				
ACKR3	57007	broad.mit.edu	37	2	237489437	237489437	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:237489437G>C	ENST00000272928.3	+	2	639	c.329G>C	c.(328-330)tGg>tCg	p.W110S		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	110					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										CACAACCAGTGGCCCATGGGC	0.562																																							uc010fyq.2		NA																	0				large_intestine(1)|central_nervous_system(1)|skin(1)	3						c.(328-330)TGG>TCG		chemokine orphan receptor 1							205.0	178.0	187.0					2																	237489437		2203	4300	6503	SO:0001583	missense	57007				interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding	g.chr2:237489437G>C	BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.329G>C	2.37:g.237489437G>C	ENSP00000272928:p.Trp110Ser		Somatic				CXCR7_uc002vwd.2_Missense_Mutation_p.W110S	p.W110S	NM_020311	NP_064707	WXS	Illumina HiSeq	Unspecified	P25106	CXCR7_HUMAN		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)	3	559	+		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)	110			Extracellular (Potential).		A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	37	c.329G>C	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339977	0.81911	.	.	ENSG00000144476	ENST00000447924;ENST00000272928	T;T	0.77229	-1.08;-1.08	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94594	0.7790	10	0.87932	D	0	.	19.8471	0.96713	0.0:0.0:1.0:0.0	.	110	P25106	CXCR7_HUMAN	S	110	ENSP00000405945:W110S;ENSP00000272928:W110S	ENSP00000272928:W110S	W	+	2	0	CXCR7	237154176	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.611000	0.98342	2.688000	0.91661	0.655000	0.94253	TGG		0.562	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311		11	124	0	0	0	0.013537	0	11	124				
ANO7	50636	broad.mit.edu	37	2	242138778	242138778	+	Missense_Mutation	SNP	C	C	A	rs373363400		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:242138778C>A	ENST00000274979.8	+	5	622	c.519C>A	c.(517-519)agC>agA	p.S173R	ANO7_ENST00000402430.3_Missense_Mutation_p.S172R	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	173					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CCCTCCTCAGCGCCTCCTGGG	0.652																																							uc002wax.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(517-519)AGC>AGA		transmembrane protein 16G isoform NGEP long							137.0	113.0	121.0					2																	242138778		2203	4300	6503	SO:0001583	missense	50636					cell junction|chloride channel complex|cytosol	chloride channel activity	g.chr2:242138778C>A	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.519C>A	2.37:g.242138778C>A	ENSP00000274979:p.Ser173Arg		Somatic					p.S173R	NM_001001891	NP_001001891	WXS	Illumina HiSeq	Unspecified	Q6IWH7	ANO7_HUMAN			5	622	+			173			Cytoplasmic (Potential).		Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	c.519C>A	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	C	5.616	0.298306	0.10622	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.67345	-0.26;-0.26	3.47	-6.94	0.01633	.	0.511563	0.17560	N	0.169847	T	0.47040	0.1424	L	0.44542	1.39	0.20074	N	0.999936	B	0.23540	0.087	B	0.17433	0.018	T	0.20505	-1.0273	10	0.51188	T	0.08	.	6.4284	0.21782	0.0:0.1999:0.3516:0.4485	.	173	Q6IWH7	ANO7_HUMAN	R	173;172	ENSP00000274979:S173R;ENSP00000385418:S172R	ENSP00000274979:S173R	S	+	3	2	ANO7	241787451	0.007000	0.16637	0.008000	0.14137	0.159000	0.22180	-2.272000	0.01165	-1.420000	0.02009	-0.671000	0.03813	AGC		0.652	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891		7	70	1	0	5.18039e-06	0.00308	6.18115e-06	7	70				
D2HGDH	728294	broad.mit.edu	37	2	242690764	242690764	+	Silent	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr2:242690764G>C	ENST00000321264.4	+	8	1310	c.1101G>C	c.(1099-1101)gtG>gtC	p.V367V	D2HGDH_ENST00000403782.1_Silent_p.V233V|D2HGDH_ENST00000486953.1_Intron	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	367					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CCGGCCTGGTGACCGATGGGA	0.627																																							uc002wce.1		NA																	0					0						c.(1099-1101)GTG>GTC		D-2-hydroxyglutarate dehydrogenase precursor							47.0	44.0	45.0					2																	242690764		2203	4296	6499	SO:0001819	synonymous_variant	728294				2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding	g.chr2:242690764G>C	AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.1101G>C	2.37:g.242690764G>C			Somatic				D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Silent_p.V233V|D2HGDH_uc002wcg.1_Intron|D2HGDH_uc002wch.2_Intron|D2HGDH_uc002wci.2_Silent_p.V66V	p.V367V	NM_152783	NP_689996	WXS	Illumina HiSeq	Unspecified	Q8N465	D2HDH_HUMAN		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)	8	1274	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	367					B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Silent	SNP	ENST00000321264.4	37	c.1101G>C	CCDS33426.1	.	.	.	.	.	.	.	.	.	.	G	1.161	-0.643822	0.03531	.	.	ENSG00000180902	ENST00000432449	.	.	.	5.1	-0.705	0.11252	.	.	.	.	.	T	0.52224	0.1721	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42849	-0.9427	4	.	.	.	0.423	7.1766	0.25749	0.3124:0.2598:0.4279:0.0	.	.	.	.	H	121	.	.	D	+	1	0	D2HGDH	242339437	0.868000	0.29978	0.410000	0.26471	0.187000	0.23431	0.142000	0.16096	-0.063000	0.13065	-0.258000	0.10820	GAC		0.627	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322794.2	NM_152783		7	36	0	0	0	0.004482	0	7	36				
PLCB1	23236	broad.mit.edu	37	20	8745793	8745793	+	Missense_Mutation	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:8745793A>C	ENST00000338037.6	+	26	2745	c.2718A>C	c.(2716-2718)gaA>gaC	p.E906D	PLCB1_ENST00000378641.3_Missense_Mutation_p.E906D|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.E906D	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	906					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CAGAAGTGGAAGCACAGACCA	0.408																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2716-2718)GAA>GAC		phosphoinositide-specific phospholipase C beta 1							67.0	61.0	63.0					20																	8745793		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8745793A>C	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2718A>C	20.37:g.8745793A>C	ENSP00000338185:p.Glu906Asp		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.E805D|PLCB1_uc002wna.2_Missense_Mutation_p.E906D|PLCB1_uc002wnc.1_Missense_Mutation_p.E805D|PLCB1_uc002wnd.1_Missense_Mutation_p.E483D	p.E906D	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			26	2721	+			906					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.2718A>C	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.906208	0.52333	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.48201	0.82;0.82;0.82	5.78	-0.457	0.12186	Phosphatidylinositol-4, 5-bisphosphate phosphodiesterase beta, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.38799	0.1054	L	0.41710	1.295	0.42449	D	0.992742	P;P	0.40794	0.729;0.591	B;P	0.45037	0.425;0.467	T	0.11012	-1.0605	10	0.22109	T	0.4	.	10.149	0.42782	0.6629:0.0:0.3371:0.0	.	906;906	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	D	906;906;906;826;826	ENSP00000367908:E906D;ENSP00000338185:E906D;ENSP00000367904:E906D	ENSP00000338185:E906D	E	+	3	2	PLCB1	8693793	1.000000	0.71417	0.989000	0.46669	0.991000	0.79684	1.415000	0.34748	-0.267000	0.09325	-0.242000	0.12053	GAA		0.408	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			7	28	0	0	0	0.004482	0	7	28				
SNAP25	6616	broad.mit.edu	37	20	10273857	10273857	+	Missense_Mutation	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:10273857T>A	ENST00000254976.2	+	5	423	c.212T>A	c.(211-213)aTg>aAg	p.M71K	SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000304886.2_Intron	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa	71	Interaction with CENPF. {ECO:0000250}.|t-SNARE coiled-coil homology 1. {ECO:0000255|PROSITE-ProRule:PRU00202}.				energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	AATAAGGACATGAAAGAAGCA	0.438																																							uc002wnq.1		NA																	0				skin(2)	2						c.(211-213)ATG>AAG		synaptosomal-associated protein 25 isoform	Botulinum Toxin Type A(DB00083)						153.0	165.0	161.0					20																	10273857		2203	4300	6503	SO:0001583	missense	6616				energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome		g.chr20:10273857T>A		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.212T>A	20.37:g.10273857T>A	ENSP00000254976:p.Met71Lys		Somatic				SNAP25_uc002wnr.1_Intron|SNAP25_uc002wns.1_Missense_Mutation_p.M8K|SNAP25_uc010gca.1_Intron|SNAP25_uc010gcb.1_Missense_Mutation_p.M8K|SNAP25_uc010gcc.1_Intron	p.M71K	NM_130811	NP_570824	WXS	Illumina HiSeq	Unspecified	P60880	SNP25_HUMAN			5	424	+			71			Interaction with CENPF (By similarity).|t-SNARE coiled-coil homology 1.		B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Missense_Mutation	SNP	ENST00000254976.2	37	c.212T>A	CCDS13110.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419742	0.62622	.	.	ENSG00000132639	ENST00000254976;ENST00000430336	.	.	.	5.9	5.9	0.94986	Target SNARE coiled-coil domain (2);	0.000000	0.85682	D	0.000000	T	0.79975	0.4539	H	0.95328	3.655	0.80722	D	1	P	0.45078	0.85	B	0.43809	0.432	D	0.85902	0.1435	9	0.66056	D	0.02	-0.6944	16.3322	0.83039	0.0:0.0:0.0:1.0	.	71	P60880	SNP25_HUMAN	K	71	.	ENSP00000254976:M71K	M	+	2	0	SNAP25	10221857	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.251000	0.74343	0.528000	0.53228	ATG		0.438	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811		19	74	0	0	0	0.012319	0	19	74				
HCK	3055	broad.mit.edu	37	20	30689307	30689307	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:30689307C>A	ENST00000520553.1	+	13	1749	c.1503C>A	c.(1501-1503)taC>taA	p.Y501*	HCK_ENST00000518730.1_Nonsense_Mutation_p.Y500*|HCK_ENST00000375862.2_Nonsense_Mutation_p.Y521*|HCK_ENST00000538448.1_Nonsense_Mutation_p.Y501*|HCK_ENST00000375852.2_Nonsense_Mutation_p.Y522*|HCK_ENST00000534862.1_Nonsense_Mutation_p.Y502*	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	522	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	AGAGCCAGTACCAACAGCAGC	0.632																																							uc002wxh.2		NA																	0				lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9						c.(1564-1566)TAC>TAA		hemopoietic cell kinase isoform p61HCK							30.0	26.0	27.0					20																	30689307		2203	4299	6502	SO:0001587	stop_gained	3055				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr20:30689307C>A	AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.1503C>A	20.37:g.30689307C>A	ENSP00000429848:p.Tyr501*		Somatic				HCK_uc010gdy.2_Nonsense_Mutation_p.Y501*|HCK_uc002wxi.2_Nonsense_Mutation_p.Y500*	p.Y522*	NM_002110	NP_002101	WXS	Illumina HiSeq	Unspecified	P08631	HCK_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		13	1737	+			522					A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Nonsense_Mutation	SNP	ENST00000520553.1	37	c.1566C>A	CCDS54455.1	.	.	.	.	.	.	.	.	.	.	C	33	5.279542	0.95489	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	.	.	.	5.14	3.15	0.36227	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.50313	D	0.999861	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0654	0.30657	0.0:0.7455:0.0:0.2545	.	.	.	.	X	502;501;521;501;500;522	.	ENSP00000365012:Y522X	Y	+	3	2	HCK	30152968	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	0.410000	0.21098	1.370000	0.46153	0.561000	0.74099	TAC		0.632	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000375751.1			3	23	1	0	0.004672	0.004672	0.00507476	3	23				
CTSA	5476	broad.mit.edu	37	20	44527020	44527020	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:44527020G>T	ENST00000372459.2	+	14	1567	c.1374G>T	c.(1372-1374)atG>atT	p.M458I	CTSA_ENST00000354880.5_Missense_Mutation_p.M459I|CTSA_ENST00000372484.3_Missense_Mutation_p.M476I|CTSA_ENST00000191018.5_Missense_Mutation_p.M458I			P10619	PPGB_HUMAN	cathepsin A	458					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				CCGGCCACATGGTTCCCACCG	0.592																																							uc002xqj.3		NA																	0				ovary(1)	1						c.(1372-1374)ATG>ATT		cathepsin A isoform b precursor							69.0	52.0	58.0					20																	44527020		2203	4300	6503	SO:0001583	missense	5476				intracellular protein transport|proteolysis	endoplasmic reticulum|lysosome|nucleus	enzyme activator activity|protein binding|serine-type carboxypeptidase activity	g.chr20:44527020G>T	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.1374G>T	20.37:g.44527020G>T	ENSP00000361537:p.Met458Ile		Somatic				CTSA_uc002xqh.2_Missense_Mutation_p.M476I|CTSA_uc002xqi.2_RNA|CTSA_uc010zxi.1_Missense_Mutation_p.M459I|CTSA_uc002xqk.3_Missense_Mutation_p.M458I	p.M458I	NM_001127695	NP_001121167	WXS	Illumina HiSeq	Unspecified	P10619	PPGB_HUMAN			15	1848	+		Myeloproliferative disorder(115;0.0122)	458					B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Missense_Mutation	SNP	ENST00000372459.2	37	c.1374G>T	CCDS46609.1	.	.	.	.	.	.	.	.	.	.	G	32	5.136400	0.94517	.	.	ENSG00000064601	ENST00000354880;ENST00000372484;ENST00000191018	D;D;D	0.94046	-3.34;-3.34;-3.34	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.97102	0.9053	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.74348	0.983;0.959;0.959	D	0.96266	0.9195	10	0.39692	T	0.17	-22.0665	19.7626	0.96329	0.0:0.0:1.0:0.0	.	458;458;475	B4E324;P10619;Q59EV6	.;PPGB_HUMAN;.	I	459;476;458	ENSP00000346952:M459I;ENSP00000361562:M476I;ENSP00000191018:M458I	ENSP00000191018:M458I	M	+	3	0	CTSA	43960427	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.314000	0.96306	2.676000	0.91093	0.561000	0.74099	ATG		0.592	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308		5	51	1	0	1.23904e-05	0.000602	1.46179e-05	5	51				
BCAS4	55653	broad.mit.edu	37	20	49493042	49493042	+	Silent	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:49493042C>A	ENST00000358791.5	+	6	706	c.606C>A	c.(604-606)gcC>gcA	p.A202A	BCAS4_ENST00000371608.2_Missense_Mutation_p.P170H|BCAS4_ENST00000262591.5_Missense_Mutation_p.P125H|BCAS4_ENST00000609336.1_Silent_p.A172A	NM_017843.3	NP_060313.3	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4	202						cytoplasm (GO:0005737)				large_intestine(2)|lung(2)|pancreas(1)|upper_aerodigestive_tract(1)	6						GCACCGGTGCCCGTGACGTAC	0.562																																							uc002xvq.2		NA																	0					0						c.(604-606)GCC>GCA		breast carcinoma amplified sequence 4 isoform a							101.0	93.0	96.0					20																	49493042		2203	4300	6503	SO:0001819	synonymous_variant	55653					cytoplasm		g.chr20:49493042C>A	AK000502	CCDS13432.2, CCDS33487.1	20q13	2008-07-03			ENSG00000124243	ENSG00000124243			14367	protein-coding gene	gene with protein product		607471				12378525	Standard	NM_001010974		Approved	FLJ20495, CNOL	uc002xvq.3	Q8TDM0	OTTHUMG00000032735	ENST00000358791.5:c.606C>A	20.37:g.49493042C>A			Somatic				BCAS4_uc002xvr.2_Missense_Mutation_p.P170H|BCAS4_uc002xvs.2_Missense_Mutation_p.P125H	p.A202A	NM_017843	NP_060313	WXS	Illumina HiSeq	Unspecified	Q8TDM0	BCAS4_HUMAN			6	670	+			202					Q5TD52|Q5TD53|Q5TD54|Q5U5K7|Q5XKE8|Q8IXI7|Q8NEZ6|Q8TDL9|Q9NX13|Q9Y511	Silent	SNP	ENST00000358791.5	37	c.606C>A	CCDS33487.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.81|14.81	2.646372|2.646372	0.47258|0.47258	.|.	.|.	ENSG00000124243|ENSG00000124243	ENST00000262591;ENST00000371608|ENST00000445038	T;T|T	0.46063|0.41758	0.94;0.88|0.99	3.99|3.99	3.99|3.99	0.46301|0.46301	.|.	.|.	.|.	.|.	.|.	T|T	0.29093|0.29093	0.0723|0.0723	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D;D|.	0.69078|.	0.997;0.997|.	P;P|.	0.60345|.	0.873;0.873|.	T|T	0.12218|0.12218	-1.0556|-1.0556	8|6	0.42905|0.12103	T|T	0.14|0.63	.|.	11.7875|11.7875	0.52051|0.52051	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	125;170|.	Q8TDM0-2;Q8TDM0-3|.	.;.|.	H|T	125;170|100	ENSP00000262591:P125H;ENSP00000360669:P170H|ENSP00000392594:P100T	ENSP00000262591:P125H|ENSP00000392594:P100T	P|P	+|+	2|1	0|0	BCAS4|BCAS4	48926449|48926449	0.001000|0.001000	0.12720|0.12720	0.004000|0.004000	0.12327|0.12327	0.001000|0.001000	0.01503|0.01503	0.993000|0.993000	0.29680|0.29680	2.236000|2.236000	0.73375|0.73375	0.591000|0.591000	0.81541|0.81541	CCC|CCG		0.562	BCAS4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079700.1	NM_017843		6	206	1	0	0.00198382	0.001984	0.00217736	6	206				
ATP9A	10079	broad.mit.edu	37	20	50234086	50234086	+	Silent	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:50234086T>A	ENST00000338821.5	-	22	2622	c.2358A>T	c.(2356-2358)ggA>ggT	p.G786G	ATP9A_ENST00000402822.1_Silent_p.G665G|ATP9A_ENST00000311637.5_Silent_p.G650G	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	786					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CGTCATTGCCTCCGTCCCCTG	0.507																																							uc002xwg.1		NA																	0				ovary(4)	4						c.(2356-2358)GGA>GGT		ATPase, class II, type 9A							110.0	69.0	83.0					20																	50234086		2203	4300	6503	SO:0001819	synonymous_variant	10079				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr20:50234086T>A	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2358A>T	20.37:g.50234086T>A			Somatic				ATP9A_uc010gih.1_Silent_p.G650G|ATP9A_uc002xwf.1_Intron	p.G786G	NM_006045	NP_006036	WXS	Illumina HiSeq	Unspecified	O75110	ATP9A_HUMAN			22	2358	-			786			Cytoplasmic (Potential).		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	c.2358A>T	CCDS33489.1																																																																																				0.507	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045		5	36	0	0	0	0.000602	0	5	36				
ZNF512B	57473	broad.mit.edu	37	20	62592756	62592756	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr20:62592756G>T	ENST00000450537.1	-	16	2393	c.2333C>A	c.(2332-2334)gCc>gAc	p.A778D	ZNF512B_ENST00000369888.1_Missense_Mutation_p.A778D|ZNF512B_ENST00000217130.3_Missense_Mutation_p.A778D			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	778					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGCCAGGTGGGCCCCCTGCAA	0.597																																							uc002yhl.1		NA																	0					0						c.(2332-2334)GCC>GAC		zinc finger protein 512B							85.0	75.0	79.0					20																	62592756		2202	4300	6502	SO:0001583	missense	57473				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:62592756G>T	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2333C>A	20.37:g.62592756G>T	ENSP00000393795:p.Ala778Asp		Somatic					p.A778D	NM_020713	NP_065764	WXS	Illumina HiSeq	Unspecified	Q96KM6	Z512B_HUMAN			16	2387	-	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)		778					Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	c.2333C>A	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.682637	0.00745	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.21191	2.02;2.02;2.02	5.23	2.93	0.34026	.	0.325428	0.31884	N	0.006920	T	0.04407	0.0121	N	0.00841	-1.15	0.25940	N	0.982888	B	0.02656	0.0	B	0.01281	0.0	T	0.40979	-0.9534	10	0.02654	T	1	-16.9057	5.3562	0.16063	0.0:0.154:0.1784:0.6676	.	778	Q96KM6	Z512B_HUMAN	D	778	ENSP00000358904:A778D;ENSP00000393795:A778D;ENSP00000217130:A778D	ENSP00000217130:A778D	A	-	2	0	ZNF512B	62063200	0.955000	0.32602	0.999000	0.59377	0.105000	0.19272	0.832000	0.27490	0.801000	0.34066	-0.293000	0.09583	GCC		0.597	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713		13	228	1	0	9.31168e-06	0.001855	1.10686e-05	13	228				
SGOL1	151648	broad.mit.edu	37	3	20215786	20215786	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:20215786C>T	ENST00000263753.4	-	6	1376	c.1237G>A	c.(1237-1239)Gat>Aat	p.D413N	SGOL1-AS1_ENST00000441442.1_RNA|SGOL1_ENST00000452020.1_Intron|SGOL1_ENST00000425061.1_Intron|SGOL1-AS1_ENST00000448208.1_RNA|SGOL1_ENST00000383774.1_Intron|SGOL1_ENST00000412997.1_Missense_Mutation_p.D413N|SGOL1_ENST00000412868.1_Missense_Mutation_p.D413N|SGOL1_ENST00000429446.3_Intron|SGOL1_ENST00000443724.1_Intron|SGOL1_ENST00000437051.1_Intron|SGOL1_ENST00000306698.2_Intron|SGOL1_ENST00000417364.1_Intron|SGOL1_ENST00000419233.2_Intron|SGOL1_ENST00000442720.1_Intron|SGOL1_ENST00000421451.1_Missense_Mutation_p.D413N	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)	413					attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)			kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						TCTTTTTCATCTGTGTATTTC	0.408																																							uc003cbs.2		NA																	0					0						c.(1237-1239)GAT>AAT		shugoshin-like 1 isoform A2							111.0	118.0	116.0					3																	20215786		2203	4300	6503	SO:0001583	missense	151648				attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding	g.chr3:20215786C>T	BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.1237G>A	3.37:g.20215786C>T	ENSP00000263753:p.Asp413Asn		Somatic				SGOL1_uc003cbr.2_Intron|SGOL1_uc010hfa.2_Intron|SGOL1_uc003cbt.2_Intron|SGOL1_uc003cbu.2_Missense_Mutation_p.D413N|SGOL1_uc003cbv.2_Intron|SGOL1_uc003cbw.2_Intron|SGOL1_uc003cbx.2_Intron|SGOL1_uc003cby.2_Intron|SGOL1_uc003cbz.2_Missense_Mutation_p.D413N|SGOL1_uc003cca.2_Missense_Mutation_p.D413N|SGOL1_uc003ccb.2_Intron|SGOL1_uc003ccc.2_Intron	p.D413N	NM_001012410	NP_001012410	WXS	Illumina HiSeq	Unspecified	Q5FBB7	SGOL1_HUMAN			6	1424	-			413					Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	Missense_Mutation	SNP	ENST00000263753.4	37	c.1237G>A	CCDS33716.1	.	.	.	.	.	.	.	.	.	.	C	8.013	0.757870	0.15846	.	.	ENSG00000129810	ENST00000263753;ENST00000421451;ENST00000412997;ENST00000412868	T;T;T;T	0.30448	1.53;1.53;1.55;1.55	5.47	1.11	0.20524	.	0.549739	0.19901	N	0.103515	T	0.16428	0.0395	N	0.19112	0.55	0.09310	N	1	B;B	0.15473	0.013;0.006	B;B	0.12156	0.007;0.003	T	0.15122	-1.0448	10	0.41790	T	0.15	.	5.8008	0.18412	0.0:0.4466:0.1463:0.4071	.	413;413	B5BUA4;Q5FBB7	.;SGOL1_HUMAN	N	413	ENSP00000263753:D413N;ENSP00000414129:D413N;ENSP00000410458:D413N;ENSP00000406880:D413N	ENSP00000263753:D413N	D	-	1	0	SGOL1	20190790	0.000000	0.05858	0.001000	0.08648	0.521000	0.34408	-0.654000	0.05354	0.286000	0.22352	0.561000	0.74099	GAT		0.408	SGOL1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340498.1	NM_138484		29	109	0	0	0	0.010818	0	29	109				
RARB	5915	broad.mit.edu	37	3	25502745	25502745	+	Silent	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:25502745T>C	ENST00000404969.1	+	2	240	c.240T>C	c.(238-240)ccT>ccC	p.P80P	RARB_ENST00000437042.2_5'UTR|RARB_ENST00000458646.1_5'UTR|RARB_ENST00000330688.4_Silent_p.P73P|RARB_ENST00000462272.1_3'UTR			P10826	RARB_HUMAN	retinoic acid receptor, beta	80	Modulating.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CTCCACTTCCTCCCCCTCGAG	0.507																																							uc011awl.1		NA																	0				ovary(1)|large_intestine(1)|pancreas(1)	3						c.(238-240)CCT>CCC		retinoic acid receptor, beta isoform 2	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)						103.0	107.0	106.0					3																	25502745		2203	4300	6503	SO:0001819	synonymous_variant	5915				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr3:25502745T>C	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.240T>C	3.37:g.25502745T>C			Somatic				RARB_uc003cdi.1_5'UTR|RARB_uc003cdh.2_Silent_p.P73P	p.P80P	NM_016152	NP_057236	WXS	Illumina HiSeq	Unspecified	P10826	RARB_HUMAN			2	306	+			80			Modulating.		P12891|Q00989|Q15298|Q9UN48	Silent	SNP	ENST00000404969.1	37	c.240T>C																																																																																					0.507	RARB-201	KNOWN	basic	protein_coding	protein_coding		NM_000965, NM_016152		3	122	0	0	0	0.004672	0	3	122				
TOP2B	7155	broad.mit.edu	37	3	25675377	25675377	+	Silent	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:25675377T>C	ENST00000264331.4	-	8	980	c.981A>G	c.(979-981)aaA>aaG	p.K327K	TOP2B_ENST00000435706.2_Silent_p.K322K	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	327					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GCTGGAATCCTTTTTCACTCA	0.348																																							uc011awn.1		NA																	0				breast(2)|ovary(1)|lung(1)|skin(1)	5						c.(979-981)AAA>AAG		DNA topoisomerase II, beta isozyme							162.0	156.0	158.0					3																	25675377		1848	4087	5935	SO:0001819	synonymous_variant	7155				DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity	g.chr3:25675377T>C	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.981A>G	3.37:g.25675377T>C			Somatic				TOP2B_uc003cdj.2_Silent_p.K322K	p.K327K	NM_001068	NP_001059	WXS	Illumina HiSeq	Unspecified	Q02880	TOP2B_HUMAN			8	1024	-			327					Q13600|Q9UMG8|Q9UQP8	Silent	SNP	ENST00000264331.4	37	c.981A>G																																																																																					0.348	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				3	175	0	0	0	0.001168	0	3	175				
ARPP21	10777	broad.mit.edu	37	3	35770882	35770882	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:35770882T>C	ENST00000187397.4	+	15	1769	c.1313T>C	c.(1312-1314)gTg>gCg	p.V438A	ARPP21_ENST00000337271.5_Missense_Mutation_p.V384A|ARPP21_ENST00000458225.1_Missense_Mutation_p.V404A|ARPP21_ENST00000444190.1_Missense_Mutation_p.V384A|ARPP21_ENST00000417925.1_Missense_Mutation_p.V404A	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	438					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GTCTCAGGTGTGGCAGCTGGC	0.592																																							uc003cgb.2		NA																	0				ovary(2)|skin(1)	3						c.(1312-1314)GTG>GCG		cyclic AMP-regulated phosphoprotein, 21 kD							59.0	59.0	59.0					3																	35770882		2203	4300	6503	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35770882T>C	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1313T>C	3.37:g.35770882T>C	ENSP00000187397:p.Val438Ala		Somatic				ARPP21_uc003cga.2_Missense_Mutation_p.V384A|ARPP21_uc011axy.1_Missense_Mutation_p.V404A|ARPP21_uc003cgf.2_Missense_Mutation_p.V239A|ARPP21_uc003cgg.2_5'UTR	p.V438A	NM_016300	NP_057384	WXS	Illumina HiSeq	Unspecified	Q9UBL0	ARP21_HUMAN			15	1577	+			438					B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.1313T>C	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	T	8.602	0.887091	0.17540	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	6.06	3.59	0.41128	.	1.048340	0.07407	N	0.891803	T	0.28499	0.0705	N	0.13235	0.315	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.002	T	0.15235	-1.0444	10	0.15066	T	0.55	-1.109	6.9238	0.24403	0.0:0.1289:0.1307:0.7404	.	404;438;384	Q9UBL0-3;Q9UBL0;Q9UBL0-4	.;ARP21_HUMAN;.	A	404;384;384;438;404	ENSP00000414351:V404A;ENSP00000337792:V384A;ENSP00000405276:V384A;ENSP00000187397:V438A;ENSP00000412326:V404A	ENSP00000187397:V438A	V	+	2	0	ARPP21	35745886	0.166000	0.22962	0.835000	0.33067	0.636000	0.38137	1.946000	0.40283	2.323000	0.78572	0.528000	0.53228	GTG		0.592	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		17	65	0	0	0	0.007413	0	17	65				
GOLGA4	2803	broad.mit.edu	37	3	37379191	37379191	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:37379191A>T	ENST00000361924.2	+	19	6736	c.6362A>T	c.(6361-6363)gAt>gTt	p.D2121V	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.D2136V	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	2121					Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTAATCAGTGATTCGAAATTG	0.378																																							uc003cgv.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(6361-6363)GAT>GTT		golgi autoantigen, golgin subfamily a, 4							104.0	96.0	98.0					3																	37379191		2203	4300	6503	SO:0001583	missense	2803				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding	g.chr3:37379191A>T	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6362A>T	3.37:g.37379191A>T	ENSP00000354486:p.Asp2121Val		Somatic				GOLGA4_uc003cgw.2_Missense_Mutation_p.D2136V|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.D2002V	p.D2121V	NM_002078	NP_002069	WXS	Illumina HiSeq	Unspecified	Q13439	GOGA4_HUMAN			19	6666	+			2121			Potential.		F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	c.6362A>T	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.457141	0.84317	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.27557	1.72;1.78;1.66	5.56	5.56	0.83823	.	0.000000	0.37577	N	0.002039	T	0.44912	0.1316	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.988;0.988;0.996	T	0.42949	-0.9421	10	0.66056	D	0.02	.	15.6705	0.77270	1.0:0.0:0.0:0.0	.	2121;2136;2121	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	V	2121;2136;1992	ENSP00000354486:D2121V;ENSP00000349305:D2136V;ENSP00000405842:D1992V	ENSP00000349305:D2136V	D	+	2	0	GOLGA4	37354195	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	7.712000	0.84684	2.240000	0.73641	0.533000	0.62120	GAT		0.378	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078		16	47	0	0	0	0.006122	0	16	47				
SCN10A	6336	broad.mit.edu	37	3	38764951	38764951	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:38764951G>T	ENST00000449082.2	-	18	3321	c.3322C>A	c.(3322-3324)Ctg>Atg	p.L1108M		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1108					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGTTCTTCCAGGTCATCTGCC	0.557																																							uc003ciq.2		NA																	0				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(3322-3324)CTG>ATG		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						110.0	93.0	99.0					3																	38764951		2203	4300	6503	SO:0001583	missense	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38764951G>T	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3322C>A	3.37:g.38764951G>T	ENSP00000390600:p.Leu1108Met		Somatic					p.L1108M	NM_006514	NP_006505	WXS	Illumina HiSeq	Unspecified	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	18	3322	-			1108					A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	c.3322C>A	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	7.984	0.751732	0.15778	.	.	ENSG00000185313	ENST00000449082	D	0.83992	-1.79	4.65	3.69	0.42338	Sodium ion transport-associated (1);	0.540867	0.18969	N	0.126189	D	0.84392	0.5462	L	0.46157	1.445	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.72782	-0.4189	10	0.38643	T	0.18	.	5.384	0.16208	0.1499:0.0:0.6564:0.1937	.	1108	Q9Y5Y9	SCNAA_HUMAN	M	1108	ENSP00000390600:L1108M	ENSP00000390600:L1108M	L	-	1	2	SCN10A	38739955	0.000000	0.05858	0.982000	0.44146	0.169000	0.22640	0.172000	0.16704	2.429000	0.82318	0.555000	0.69702	CTG		0.557	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		11	38	1	0	3.07112e-06	0.010729	3.69237e-06	11	38				
ALS2CL	259173	broad.mit.edu	37	3	46712527	46712527	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:46712527C>T	ENST00000318962.4	-	26	2892	c.2809G>A	c.(2809-2811)Gac>Aac	p.D937N	ALS2CL_ENST00000415953.1_Missense_Mutation_p.D937N|ALS2CL_ENST00000383742.3_Missense_Mutation_p.D284N	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	937	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		AGCCTCATGTCTTCTTTCTGG	0.592																																							uc003cqa.1		NA																	0				breast(2)|central_nervous_system(2)|skin(1)	5						c.(2809-2811)GAC>AAC		ALS2 C-terminal like isoform 1							188.0	161.0	170.0					3																	46712527		2203	4300	6503	SO:0001583	missense	259173				endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr3:46712527C>T	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2809G>A	3.37:g.46712527C>T	ENSP00000313670:p.Asp937Asn		Somatic				ALS2CL_uc003cpx.1_Missense_Mutation_p.D284N|ALS2CL_uc003cpy.1_RNA|ALS2CL_uc003cpz.1_Missense_Mutation_p.D452N|ALS2CL_uc003cqb.1_Missense_Mutation_p.D937N|ALS2CL_uc003cqc.1_RNA	p.D937N	NM_147129	NP_667340	WXS	Illumina HiSeq	Unspecified	Q60I27	AL2CL_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)	26	2999	-			937			VPS9.		Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	c.2809G>A	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843423	0.91197	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.32023	1.47;1.47;1.47	4.61	4.61	0.57282	Vacuolar sorting protein 9 (1);	0.346259	0.24350	N	0.039293	T	0.26557	0.0649	N	0.08118	0	0.34509	D	0.706933	P	0.47484	0.896	P	0.53224	0.721	T	0.29518	-1.0009	10	0.23891	T	0.37	.	14.9899	0.71377	0.0:1.0:0.0:0.0	.	937	Q60I27	AL2CL_HUMAN	N	937;937;284	ENSP00000313670:D937N;ENSP00000413223:D937N;ENSP00000373248:D284N	ENSP00000313670:D937N	D	-	1	0	ALS2CL	46687531	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	3.033000	0.49743	2.383000	0.81215	0.655000	0.94253	GAC		0.592	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129		4	143	0	0	0	0.009096	0	4	143				
SCAP	22937	broad.mit.edu	37	3	47468957	47468957	+	Missense_Mutation	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:47468957T>G	ENST00000265565.5	-	5	1023	c.611A>C	c.(610-612)cAg>cCg	p.Q204P	SCAP_ENST00000545718.1_Intron|SCAP_ENST00000441517.2_Intron	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	204					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GGCTGAAGTCTGCAGGGTTTT	0.527																																					Pancreas(149;978 1908 29304 37806 46700)	Pancreas(149;978 1908 29304 37806 46700)	uc003crh.1		NA																	0				ovary(1)	1						c.(610-612)CAG>CCG		SREBF chaperone protein							159.0	133.0	142.0					3																	47468957		2203	4300	6503	SO:0001583	missense	22937				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding	g.chr3:47468957T>G	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.611A>C	3.37:g.47468957T>G	ENSP00000265565:p.Gln204Pro		Somatic				SCAP_uc011baz.1_Intron|SCAP_uc003crg.2_Intron	p.Q204P	NM_012235	NP_036367	WXS	Illumina HiSeq	Unspecified	Q12770	SCAP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)	5	866	-			204			Lumenal (By similarity).		Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	c.611A>C	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	T	20.8	4.052678	0.75960	.	.	ENSG00000114650	ENST00000339815;ENST00000265565	T	0.80653	-1.4	5.24	5.24	0.73138	.	0.128686	0.53938	D	0.000050	T	0.73410	0.3583	L	0.44542	1.39	0.80722	D	1	P	0.40534	0.72	B	0.36030	0.216	T	0.74334	-0.3699	10	0.36615	T	0.2	-24.2681	14.9643	0.71179	0.0:0.0:0.0:1.0	.	204	Q12770	SCAP_HUMAN	P	204	ENSP00000265565:Q204P	ENSP00000265565:Q204P	Q	-	2	0	SCAP	47443961	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.674000	0.83992	2.199000	0.70637	0.533000	0.62120	CAG		0.527	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235		3	139	0	0	0	0.009096	0	3	139				
GMPPB	29925	broad.mit.edu	37	3	49756821	49756821	+	3'UTR	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:49756821G>A	ENST00000480687.1	-	0	3563				AMIGO3_ENST00000320431.7_Silent_p.F26F|RNF123_ENST00000497099.1_Intron|RNF123_ENST00000327697.6_Intron|RNF123_ENST00000433785.1_Intron|AMIGO3_ENST00000535833.1_Silent_p.F26F			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CACGGGGCGGGAAACCCTCGG	0.642											OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003cxj.2		NA																	0				pancreas(1)	1						c.(76-78)TTC>TTT		adhesion molecule with Ig-like domain 3							54.0	60.0	58.0					3																	49756821		2203	4300	6503	SO:0001624	3_prime_UTR_variant	386724				heterophilic cell-cell adhesion	integral to membrane		g.chr3:49756821G>A	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2364C>T	3.37:g.49756821G>A			Somatic	OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	964	RNF123_uc003cxh.2_Intron|RNF123_uc003cxi.2_Intron	p.F26F	NM_198722	NP_942015	WXS	Illumina HiSeq	Unspecified	Q86WK7	AMGO3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	1	418	-			26			Extracellular (Potential).|LRRNT.		A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	37	c.78C>T	CCDS2803.1																																																																																				0.642	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334		4	85	0	0	0	0.000602	0	4	85				
IP6K1	9807	broad.mit.edu	37	3	49764843	49764843	+	Silent	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:49764843A>T	ENST00000321599.4	-	6	1339	c.1038T>A	c.(1036-1038)gcT>gcA	p.A346A	IP6K1_ENST00000460540.1_Silent_p.A181A|IP6K1_ENST00000468463.1_3'UTR|IP6K1_ENST00000395238.1_Silent_p.A181A	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	346					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						GGCAGGACTCAGCCCGGCACT	0.627																																							uc003cxm.1		NA																	0					0						c.(1036-1038)GCT>GCA		inositol hexakisphosphate kinase 1 isoform 1							37.0	38.0	38.0					3																	49764843		2203	4300	6503	SO:0001819	synonymous_variant	9807				phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity	g.chr3:49764843A>T	D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.1038T>A	3.37:g.49764843A>T			Somatic				IP6K1_uc003cxn.1_Silent_p.A181A|IP6K1_uc011bcv.1_Silent_p.A181A|IP6K1_uc003cxo.2_3'UTR	p.A346A	NM_153273	NP_695005	WXS	Illumina HiSeq	Unspecified	Q92551	IP6K1_HUMAN			6	1353	-			346					A8K157|A8MUX4|Q7L3I7|Q96E38	Silent	SNP	ENST00000321599.4	37	c.1038T>A	CCDS33760.1																																																																																				0.627	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273		10	37	0	0	0	0.008291	0	10	37				
RBM5	10181	broad.mit.edu	37	3	50147085	50147085	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:50147085G>A	ENST00000347869.3	+	15	1417	c.1242G>A	c.(1240-1242)caG>caA	p.Q414Q	RBM5_ENST00000441812.2_3'UTR	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	414	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGAGTCCTCAGCTGTATAATC	0.488																																							uc003cyg.2		NA																	0				lung(1)	1						c.(1240-1242)CAG>CAA		RNA binding motif protein 5							200.0	177.0	185.0					3																	50147085		2203	4300	6503	SO:0001819	synonymous_variant	10181				apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding	g.chr3:50147085G>A	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1242G>A	3.37:g.50147085G>A			Somatic				RBM5_uc011bdj.1_Silent_p.Q358Q|RBM5_uc011bdk.1_Silent_p.Q242Q	p.Q414Q	NM_005778	NP_005769	WXS	Illumina HiSeq	Unspecified	P52756	RBM5_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	15	1390	+			414			Required for interaction with U2AF2.		B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Silent	SNP	ENST00000347869.3	37	c.1242G>A	CCDS2810.1																																																																																				0.488	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778		56	131	0	0	0	0.01441	0	56	131				
ACY1	95	broad.mit.edu	37	3	52022801	52022801	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:52022801G>C	ENST00000404366.2	+	14	1167	c.1021G>C	c.(1021-1023)Gag>Cag	p.E341Q	ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.E442Q|ACY1_ENST00000476854.1_Missense_Mutation_p.E276Q|ACY1_ENST00000494103.1_Missense_Mutation_p.E269Q|ACY1_ENST00000476351.1_Missense_Mutation_p.E306Q|ACY1_ENST00000458031.2_Missense_Mutation_p.E431Q	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	341					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	TCTGGAGCCTGAGATCATGCC	0.562																																							uc003dcp.2		NA																	0				breast(1)|skin(1)	2						c.(1021-1023)GAG>CAG		aminoacylase 1	L-Aspartic Acid(DB00128)						164.0	179.0	174.0					3																	52022801		2203	4300	6503	SO:0001583	missense	95				cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity	g.chr3:52022801G>C	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.1021G>C	3.37:g.52022801G>C	ENSP00000384296:p.Glu341Gln		Somatic				ACY1_uc011bea.1_Missense_Mutation_p.E431Q|ACY1_uc003dcq.2_Missense_Mutation_p.E341Q	p.E341Q	NM_000666	NP_000657	WXS	Illumina HiSeq	Unspecified	Q03154	ACY1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	14	1082	+			341					C9J6I6|C9J9D8|C9JWD4	Missense_Mutation	SNP	ENST00000404366.2	37	c.1021G>C	CCDS2844.1	.	.	.	.	.	.	.	.	.	.	G	8.738	0.918321	0.17982	.	.	ENSG00000114786;ENSG00000114786;ENSG00000114786;ENSG00000243989;ENSG00000243989;ENSG00000243989;ENSG00000243989	ENST00000458031;ENST00000463937;ENST00000232907;ENST00000476854;ENST00000476351;ENST00000494103;ENST00000404366	T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67	5.69	2.52	0.30459	.	0.157982	0.56097	D	0.000038	T	0.48223	0.1488	L	0.52759	1.655	0.54753	D	0.999982	P;D	0.59767	0.898;0.986	P;P	0.58391	0.823;0.838	T	0.49744	-0.8907	10	0.08381	T	0.77	-14.3916	7.3008	0.26420	0.176:0.1324:0.6916:0.0	.	431;341	B4DNW0;Q03154	.;ACY1_HUMAN	Q	431;442;341;276;306;269;341	ENSP00000390557:E431Q;ENSP00000420487:E442Q;ENSP00000419262:E276Q;ENSP00000417056:E306Q;ENSP00000417618:E269Q;ENSP00000384296:E341Q	ENSP00000384296:E341Q	E	+	1	0	ACY1;RP11-155D18.11	51997841	1.000000	0.71417	0.239000	0.24122	0.013000	0.08279	3.767000	0.55288	0.185000	0.20105	-0.150000	0.13652	GAG		0.562	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666		12	328	0	0	0	0.00499	0	12	328				
CACNA1D	776	broad.mit.edu	37	3	53808688	53808688	+	Silent	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:53808688G>T	ENST00000350061.5	+	34	4696	c.4185G>T	c.(4183-4185)gcG>gcT	p.A1395A	CACNA1D_ENST00000540742.1_Silent_p.A287A|CACNA1D_ENST00000288139.4_Silent_p.A1415A|CACNA1D_ENST00000422281.2_Silent_p.A1380A	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1395					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCCCCAGGCGGTGCTGCTGC	0.542																																							uc003dgv.3		NA																	0				ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(4183-4185)GCG>GCT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						111.0	110.0	110.0					3																	53808688		2203	4300	6503	SO:0001819	synonymous_variant	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53808688G>T	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4185G>T	3.37:g.53808688G>T			Somatic				CACNA1D_uc003dgu.3_Silent_p.A1415A|CACNA1D_uc003dgy.3_Silent_p.A1380A|CACNA1D_uc003dgw.3_Silent_p.A1062A|CACNA1D_uc003dgx.1_Silent_p.A571A	p.A1395A	NM_001128840	NP_001122312	WXS	Illumina HiSeq	Unspecified	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	34	4348	+			1395			IV.|Extracellular (Potential).		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	ENST00000350061.5	37	c.4185G>T	CCDS46848.1																																																																																				0.542	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		13	50	1	0	1.37285e-15	0.004007	1.93923e-15	13	50				
CBLB	868	broad.mit.edu	37	3	105439010	105439010	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:105439010C>T	ENST00000264122.4	-	10	1609	c.1288G>A	c.(1288-1290)Gat>Aat	p.D430N	CBLB_ENST00000405772.1_Missense_Mutation_p.D430N|CBLB_ENST00000403724.1_Missense_Mutation_p.D430N|CBLB_ENST00000394027.3_Missense_Mutation_p.D452N|CBLB_ENST00000545639.1_3'UTR	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	430					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GAGCCTTCATCTCTTGGATCA	0.483			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	GBM(93;588 1337 9788 29341 43499)	uc003dwc.2		NA		Rec	yes		3	3q13.11	868	Mis S	Cas-Br-M (murine) ecotropic retroviral transforming sequence b			L			AML		0				lung(4)|ovary(3)|breast(1)|skin(1)	9						c.(1288-1290)GAT>AAT		Cas-Br-M (murine) ecotropic retroviral							106.0	91.0	96.0					3																	105439010		2203	4300	6503	SO:0001583	missense	868				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding	g.chr3:105439010C>T	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1288G>A	3.37:g.105439010C>T	ENSP00000264122:p.Asp430Asn		Somatic				CBLB_uc011bhi.1_Missense_Mutation_p.D452N|CBLB_uc003dwd.1_Missense_Mutation_p.D430N|CBLB_uc003dwe.1_Missense_Mutation_p.D430N|CBLB_uc011bhj.1_RNA	p.D430N	NM_170662	NP_733762	WXS	Illumina HiSeq	Unspecified	Q13191	CBLB_HUMAN			10	1610	-			430					A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	c.1288G>A	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320486	0.41096	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.83837	-1.73;-1.76;-1.77;-1.76	6.03	5.17	0.71159	.	0.088844	0.85682	D	0.000000	T	0.77765	0.4179	L	0.38175	1.15	0.80722	D	1	B;B;B	0.19200	0.034;0.021;0.005	B;B;B	0.16722	0.012;0.016;0.009	T	0.74609	-0.3608	10	0.87932	D	0	-20.3921	15.3153	0.74069	0.0:0.9334:0.0:0.0666	.	452;430;430	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	N	430;452;430;430	ENSP00000264122:D430N;ENSP00000377595:D452N;ENSP00000384816:D430N;ENSP00000384938:D430N	ENSP00000264122:D430N	D	-	1	0	CBLB	106921700	0.937000	0.31787	0.898000	0.35279	0.907000	0.53573	1.900000	0.39828	1.574000	0.49760	-0.262000	0.10625	GAT		0.483	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662		3	20	0	0	0	0.009096	0	3	20				
ATP6V1A	523	broad.mit.edu	37	3	113517288	113517288	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:113517288G>T	ENST00000273398.3	+	12	1597	c.1489G>T	c.(1489-1491)Gga>Tga	p.G497*	ATP6V1A_ENST00000538620.1_Nonsense_Mutation_p.G464*	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	497					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	ACAGCTTGTGGGAAAGGTGAG	0.428																																							uc003eao.2		NA																	0				ovary(2)|skin(1)	3						c.(1489-1491)GGA>TGA		ATPase, H+ transporting, lysosomal V1 subunit A							70.0	71.0	71.0					3																	113517288		2203	4300	6503	SO:0001587	stop_gained	523				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr3:113517288G>T	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1489G>T	3.37:g.113517288G>T	ENSP00000273398:p.Gly497*		Somatic				ATP6V1A_uc011bik.1_Nonsense_Mutation_p.G464*	p.G497*	NM_001690	NP_001681	WXS	Illumina HiSeq	Unspecified	P38606	VATA_HUMAN			12	1555	+			497					B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Nonsense_Mutation	SNP	ENST00000273398.3	37	c.1489G>T	CCDS2976.1	.	.	.	.	.	.	.	.	.	.	G	37	6.299301	0.97453	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.5126	18.5093	0.90910	0.0:0.0:1.0:0.0	.	.	.	.	X	214;497;464	.	ENSP00000273398:G497X	G	+	1	0	ATP6V1A	114999978	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	9.394000	0.97261	2.451000	0.82905	0.561000	0.74099	GGA		0.428	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690		12	59	1	0	1.5842e-08	0.001855	2.04518e-08	12	59				
SLITRK3	22865	broad.mit.edu	37	3	164908563	164908563	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:164908563A>T	ENST00000475390.1	-	2	499	c.56T>A	c.(55-57)cTt>cAt	p.L19H	SLITRK3_ENST00000241274.3_Missense_Mutation_p.L19H			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	19					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TGTGCTTAGAAGAATTATCCA	0.418										HNSCC(40;0.11)																													uc003fej.3		NA																	0				ovary(6)|skin(3)|pancreas(1)	10						c.(55-57)CTT>CAT		slit and trk like 3 protein precursor							91.0	84.0	87.0					3																	164908563		2202	4300	6502	SO:0001583	missense	22865					integral to membrane		g.chr3:164908563A>T	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.56T>A	3.37:g.164908563A>T	ENSP00000420091:p.Leu19His	HNSCC(40;0.11)	Somatic				SLITRK3_uc003fek.2_Missense_Mutation_p.L19H	p.L19H	NM_014926	NP_055741	WXS	Illumina HiSeq	Unspecified	O94933	SLIK3_HUMAN			2	500	-			19					Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.56T>A	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.298595	0.60195	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.72167	0.37;0.37;-0.63	6.01	6.01	0.97437	.	0.000000	0.34133	N	0.004231	T	0.81093	0.4751	L	0.52011	1.625	0.46981	D	0.999278	D	0.76494	0.999	D	0.79784	0.993	T	0.82589	-0.0382	10	0.87932	D	0	-16.3635	16.5237	0.84324	1.0:0.0:0.0:0.0	.	19	O94933	SLIK3_HUMAN	H	19	ENSP00000420091:L19H;ENSP00000241274:L19H;ENSP00000419611:L19H	ENSP00000241274:L19H	L	-	2	0	SLITRK3	166391257	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.850000	0.92190	2.306000	0.77630	0.533000	0.62120	CTT		0.418	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		24	44	0	0	0	0.003954	0	24	44				
PRKCI	5584	broad.mit.edu	37	3	169998966	169998966	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr3:169998966G>A	ENST00000295797.4	+	10	1200	c.895G>A	c.(895-897)Gta>Ata	p.V299I		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	299	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	TATTGATTGGGTACAGACAGA	0.368																																							uc003fgs.2		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(895-897)GTA>ATA		protein kinase C, iota							144.0	134.0	137.0					3																	169998966		2203	4300	6503	SO:0001583	missense	5584				anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding	g.chr3:169998966G>A		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.895G>A	3.37:g.169998966G>A	ENSP00000295797:p.Val299Ile		Somatic					p.V299I	NM_002740	NP_002731	WXS	Illumina HiSeq	Unspecified	P41743	KPCI_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		10	1133	+	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		299			Protein kinase.		D3DNQ4|Q8WW06	Missense_Mutation	SNP	ENST00000295797.4	37	c.895G>A	CCDS3212.2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324203	0.81580	.	.	ENSG00000163558	ENST00000295797	T	0.23950	1.88	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.27663	0.0680	N	0.16567	0.415	0.80722	D	1	B	0.20164	0.042	B	0.40636	0.335	T	0.13953	-1.0490	9	.	.	.	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	299	P41743	KPCI_HUMAN	I	299	ENSP00000295797:V299I	.	V	+	1	0	PRKCI	171481660	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	9.444000	0.97578	2.885000	0.99019	0.655000	0.94253	GTA		0.368	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740		3	117	0	0	0	0.009096	0	3	117				
PROM1	8842	broad.mit.edu	37	4	16025961	16025961	+	Silent	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:16025961G>T	ENST00000510224.1	-	7	899	c.651C>A	c.(649-651)gcC>gcA	p.A217A	PROM1_ENST00000505450.1_Silent_p.A208A|PROM1_ENST00000543373.1_Silent_p.A208A|PROM1_ENST00000540805.1_Silent_p.A217A|PROM1_ENST00000447510.2_Silent_p.A217A|PROM1_ENST00000539194.1_Silent_p.A217A|PROM1_ENST00000502943.1_5'UTR|PROM1_ENST00000508167.1_Silent_p.A208A			O43490	PROM1_HUMAN	prominin 1	217					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						TGTTGTACTGGGCCAATATAT	0.358																																							uc003goo.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						c.(649-651)GCC>GCA		prominin 1 isoform 1							128.0	117.0	120.0					4																	16025961		1835	4099	5934	SO:0001819	synonymous_variant	8842				camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding	g.chr4:16025961G>T	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.651C>A	4.37:g.16025961G>T			Somatic				PROM1_uc003gor.2_Silent_p.A217A|PROM1_uc003gos.2_Silent_p.A208A|PROM1_uc003got.2_Silent_p.A217A|PROM1_uc003gou.2_Silent_p.A208A|PROM1_uc003gop.2_Silent_p.A208A|PROM1_uc003goq.3_Silent_p.A208A|PROM1_uc010iec.1_Silent_p.A95A	p.A217A	NM_006017	NP_006008	WXS	Illumina HiSeq	Unspecified	O43490	PROM1_HUMAN			6	863	-			217			Extracellular (Potential).		Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Silent	SNP	ENST00000510224.1	37	c.651C>A	CCDS47029.1																																																																																				0.358	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017		7	58	1	0	9.70103e-10	0.008291	1.28938e-09	7	58				
UCHL1	7345	broad.mit.edu	37	4	41270013	41270013	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:41270013A>G	ENST00000284440.4	+	9	739	c.595A>G	c.(595-597)Aag>Gag	p.K199E	UCHL1_ENST00000503431.1_Missense_Mutation_p.K199E|UCHL1_ENST00000508768.1_Missense_Mutation_p.K183E|UCHL1_ENST00000512788.1_Silent_p.P208P	NM_004181.4	NP_004172.2	P09936	UCHL1_HUMAN	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)	199					adult walking behavior (GO:0007628)|axon target recognition (GO:0007412)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|cell proliferation (GO:0008283)|eating behavior (GO:0042755)|muscle fiber development (GO:0048747)|negative regulation of MAP kinase activity (GO:0043407)|neuromuscular process (GO:0050905)|protein deubiquitination (GO:0016579)|response to ischemia (GO:0002931)|sensory perception of pain (GO:0019233)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	alpha-2A adrenergic receptor binding (GO:0031694)|cysteine-type endopeptidase activity (GO:0004197)|ligase activity (GO:0016874)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(2)	8						GGACGCTGCCAAGGTCTGCAG	0.493																																							uc003gvo.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(595-597)AAG>GAG		ubiquitin carboxyl-terminal esterase L1							69.0	63.0	65.0					4																	41270013		2203	4300	6503	SO:0001583	missense	7345				cell death|negative regulation of MAP kinase activity|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus|plasma membrane	alpha-2A adrenergic receptor binding|cysteine-type endopeptidase activity|ligase activity|omega peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity	g.chr4:41270013A>G	BC000332	CCDS3462.1	4p13	2011-07-21			ENSG00000154277	ENSG00000154277	3.4.19.12	"""Parkinson disease"""	12513	protein-coding gene	gene with protein product		191342		PARK5		1840236	Standard	NM_004181		Approved	PGP9.5, Uch-L1	uc003gvo.3	P09936	OTTHUMG00000099377	ENST00000284440.4:c.595A>G	4.37:g.41270013A>G	ENSP00000284440:p.Lys199Glu		Somatic				UCHL1_uc003gvp.2_Missense_Mutation_p.K118E|UCHL1_uc003gvq.2_Missense_Mutation_p.K118E|UCHL1_uc003gvr.2_Missense_Mutation_p.K118E|UCHL1_uc003gvs.2_Missense_Mutation_p.K118E	p.K199E	NM_004181	NP_004172	WXS	Illumina HiSeq	Unspecified	P09936	UCHL1_HUMAN			9	691	+			199					Q4W5K6|Q71UM0	Missense_Mutation	SNP	ENST00000284440.4	37	c.595A>G	CCDS3462.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.460494	0.26248	.	.	ENSG00000154277	ENST00000503431;ENST00000284440;ENST00000508768	T;T;T	0.62639	0.01;0.01;0.01	5.12	3.95	0.45737	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.098289	0.64402	D	0.000002	T	0.50069	0.1594	L	0.46947	1.48	0.80722	D	1	B	0.13594	0.008	B	0.12837	0.008	T	0.40813	-0.9543	10	0.11485	T	0.65	-40.1378	11.0918	0.48121	0.9169:0.0:0.0831:0.0	.	199	P09936	UCHL1_HUMAN	E	199;199;183	ENSP00000422542:K199E;ENSP00000284440:K199E;ENSP00000426895:K183E	ENSP00000284440:K199E	K	+	1	0	UCHL1	40964770	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.403000	0.59729	2.149000	0.67028	0.460000	0.39030	AAG		0.493	UCHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216827.1	NM_004181		7	36	0	0	0	0.001984	0	7	36				
GRXCR1	389207	broad.mit.edu	37	4	42895397	42895397	+	Silent	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:42895397G>T	ENST00000399770.2	+	1	114	c.114G>T	c.(112-114)ccG>ccT	p.P38P	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	38			P -> L (in DFNB25). {ECO:0000269|PubMed:20137774}.		auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						ATGGGCAACCGTCAGGCTCTC	0.517																																							uc003gwt.2		NA																	0				ovary(1)	1						c.(112-114)CCG>CCT		glutaredoxin, cysteine rich 1							165.0	170.0	169.0					4																	42895397		1985	4172	6157	SO:0001819	synonymous_variant	389207				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity	g.chr4:42895397G>T		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.114G>T	4.37:g.42895397G>T			Somatic					p.P38P	NM_001080476	NP_001073945	WXS	Illumina HiSeq	Unspecified	A8MXD5	GRCR1_HUMAN			1	114	+			38		P -> L (in DFNB25).				Silent	SNP	ENST00000399770.2	37	c.114G>T	CCDS43225.1																																																																																				0.517	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476		18	181	1	0	2.94398e-08	0.007413	3.75447e-08	18	181				
SMR3A	26952	broad.mit.edu	37	4	71232466	71232466	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:71232466C>G	ENST00000226460.4	+	3	256	c.160C>G	c.(160-162)Cat>Gat	p.H54D		NM_012390.3	NP_036522.3	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3A	54	Pro-rich.					extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)	15		all_hematologic(202;0.196)				TCCACCACCCCATCCTCCACC	0.572																																							uc003hfg.1		NA																	0					0						c.(160-162)CAT>GAT		submaxillary gland androgen regulated protein 3							123.0	116.0	118.0					4																	71232466		2203	4300	6503	SO:0001583	missense	26952					extracellular region		g.chr4:71232466C>G	D89501	CCDS34000.1	4q13.3	2009-04-17	2008-02-27	2005-02-07	ENSG00000109208	ENSG00000109208			19216	protein-coding gene	gene with protein product			"""proline rich 5 (salivary)"", ""submaxillary gland androgen regulated protein 3 homolog A (mouse)"""	PROL5		9354371, 17512016	Standard	NM_012390		Approved	PBI, PRL5	uc003hfg.1	Q99954	OTTHUMG00000160839	ENST00000226460.4:c.160C>G	4.37:g.71232466C>G	ENSP00000226460:p.His54Asp		Somatic				SMR3B_uc011cas.1_Intron	p.H54D	NM_012390	NP_036522	WXS	Illumina HiSeq	Unspecified	Q99954	SMR3A_HUMAN			3	241	+		all_hematologic(202;0.196)	54			Pro-rich.			Missense_Mutation	SNP	ENST00000226460.4	37	c.160C>G	CCDS34000.1	.	.	.	.	.	.	.	.	.	.	C	1.386	-0.582068	0.03827	.	.	ENSG00000109208	ENST00000226460	T	0.27402	1.67	1.95	-0.161	0.13371	.	.	.	.	.	T	0.12220	0.0297	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.12156	0.007	T	0.32322	-0.9911	9	0.19147	T	0.46	.	3.9335	0.09296	0.2736:0.4574:0.269:0.0	.	54	Q99954	SMR3A_HUMAN	D	54	ENSP00000226460:H54D	ENSP00000226460:H54D	H	+	1	0	SMR3A	71267055	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.467000	0.06664	-0.080000	0.12685	-0.500000	0.04577	CAT		0.572	SMR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362574.1	NM_012390		50	118	0	0	0	0.01441	0	50	118				
MUC7	4589	broad.mit.edu	37	4	71347185	71347185	+	Missense_Mutation	SNP	T	T	C	rs79807294	byFrequency	TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:71347185T>C	ENST00000304887.5	+	3	914	c.724T>C	c.(724-726)Tct>Cct	p.S242P	MUC7_ENST00000456088.1_Missense_Mutation_p.S242P|MUC7_ENST00000413702.1_Missense_Mutation_p.S242P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	242	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCCACACCTTCTGCAACTAC	0.592																																							uc011cat.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(724-726)TCT>CCT		mucin 7, secreted precursor							422.0	341.0	368.0					4																	71347185		2203	4300	6503	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71347185T>C	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.724T>C	4.37:g.71347185T>C	ENSP00000302021:p.Ser242Pro		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.S242P|MUC7_uc003hfj.2_Missense_Mutation_p.S242P|uc011cav.1_Intron	p.S242P	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	1012	+			242			Thr-rich.|4.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.724T>C	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	T	9.595	1.127046	0.20959	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.52754	0.65;0.65;0.65	1.88	-3.76	0.04359	.	.	.	.	.	T	0.26048	0.0635	N	0.24115	0.695	0.09310	N	1	B	0.24823	0.112	B	0.17722	0.019	T	0.17837	-1.0356	8	.	.	.	0.6471	6.6904	0.23167	0.7198:0.0:0.0:0.2802	.	242	Q8TAX7	MUC7_HUMAN	P	242	ENSP00000407422:S242P;ENSP00000400585:S242P;ENSP00000302021:S242P	.	S	+	1	0	MUC7	71381774	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.151000	0.01289	-0.798000	0.04444	-0.438000	0.05819	TCT		0.592	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		12	223	0	0	0	0.003163	0	12	223				
CDS1	1040	broad.mit.edu	37	4	85566417	85566417	+	Silent	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:85566417A>C	ENST00000295887.5	+	12	1618	c.1195A>C	c.(1195-1197)Aga>Cga	p.R399R		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		GATAATGGACAGATTTGATTG	0.299																																							uc011ccv.1		NA																	0				large_intestine(2)|ovary(1)|breast(1)	4						c.(1195-1197)AGA>CGA		CDP-diacylglycerol synthase 1							217.0	209.0	212.0					4																	85566417		2203	4299	6502	SO:0001819	synonymous_variant	1040				signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity	g.chr4:85566417A>C	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.1195A>C	4.37:g.85566417A>C			Somatic				CDS1_uc010ike.1_Silent_p.R163R	p.R399R	NM_001263	NP_001254	WXS	Illumina HiSeq	Unspecified	Q92903	CDS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00101)	12	1693	+		Hepatocellular(203;0.114)	399					A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000295887.5	37	c.1195A>C	CCDS3608.1																																																																																				0.299	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2			30	76	0	0	0	0.004289	0	30	76				
PTPN13	5783	broad.mit.edu	37	4	87694047	87694047	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:87694047C>G	ENST00000411767.2	+	32	5348	c.5285C>G	c.(5284-5286)aCt>aGt	p.T1762S	PTPN13_ENST00000436978.1_Missense_Mutation_p.T1767S|PTPN13_ENST00000511467.1_Missense_Mutation_p.T1767S|PTPN13_ENST00000427191.2_Missense_Mutation_p.T1743S|PTPN13_ENST00000316707.6_Missense_Mutation_p.T1571S			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1762					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TCTGAACCAACTAGACAAGAA	0.373																																							uc003hpz.2		NA																	0				ovary(4)|breast(1)|kidney(1)	6						c.(5284-5286)ACT>AGT		protein tyrosine phosphatase, non-receptor type							93.0	90.0	91.0					4																	87694047		1827	4076	5903	SO:0001583	missense	5783					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity	g.chr4:87694047C>G		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5285C>G	4.37:g.87694047C>G	ENSP00000407249:p.Thr1762Ser		Somatic				PTPN13_uc003hpy.2_Missense_Mutation_p.T1767S|PTPN13_uc003hqa.2_Missense_Mutation_p.T1743S|PTPN13_uc003hqb.2_Missense_Mutation_p.T1571S|PTPN13_uc003hqc.1_Missense_Mutation_p.T128S	p.T1762S	NM_080683	NP_542414	WXS	Illumina HiSeq	Unspecified	Q12923	PTN13_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00082)	32	5765	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	1762					B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	c.5285C>G	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	0.879	-0.729277	0.03135	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.52526	0.66;0.67;0.8;0.66;0.67	5.77	-0.312	0.12758	PDZ/DHR/GLGF (1);	1.768380	0.03345	N	0.195387	T	0.26195	0.0639	N	0.16478	0.41	0.09310	N	1	B;B;B;B	0.09022	0.0;0.002;0.002;0.001	B;B;B;B	0.09377	0.002;0.004;0.002;0.002	T	0.14587	-1.0467	10	0.05436	T	0.98	.	4.4704	0.11710	0.1142:0.4231:0.3327:0.13	.	1571;1743;1762;1767	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	S	1743;1767;1571;1762;1767;1711	ENSP00000408368:T1743S;ENSP00000394794:T1767S;ENSP00000322675:T1571S;ENSP00000407249:T1762S;ENSP00000426626:T1767S	ENSP00000322675:T1571S	T	+	2	0	PTPN13	87913071	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-0.636000	0.05465	-0.147000	0.11254	-0.310000	0.09108	ACT		0.373	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			12	38	0	0	0	0.013537	0	12	38				
STPG2	285555	broad.mit.edu	37	4	98480259	98480259	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:98480259C>G	ENST00000295268.3	-	11	1419	c.1330G>C	c.(1330-1332)Gag>Cag	p.E444Q	STPG2_ENST00000506482.1_Intron|RP11-681L8.1_ENST00000518105.1_RNA	NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	444																	TTCTTTTTCTCCTGGGATATC	0.274																																							uc003htt.1		NA																	0					0						c.(1330-1332)GAG>CAG		hypothetical protein LOC285555							72.0	81.0	78.0					4																	98480259		2201	4292	6493	SO:0001583	missense	285555							g.chr4:98480259C>G	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.1330G>C	4.37:g.98480259C>G	ENSP00000295268:p.Glu444Gln		Somatic					p.E444Q	NM_174952	NP_777612	WXS	Illumina HiSeq	Unspecified	Q8N412	CD037_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)	11	1420	-			444						Missense_Mutation	SNP	ENST00000295268.3	37	c.1330G>C	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	C	3.296	-0.143936	0.06627	.	.	ENSG00000163116	ENST00000295268	T	0.12255	2.7	2.13	1.23	0.21249	.	3.320280	0.02038	N	0.049109	T	0.08179	0.0204	N	0.08118	0	0.09310	N	1	B	0.24823	0.112	B	0.28232	0.087	T	0.32052	-0.9921	10	0.16896	T	0.51	-3.1487	6.4526	0.21912	0.0:0.6924:0.3076:0.0	.	444	Q8N412	CD037_HUMAN	Q	444	ENSP00000295268:E444Q	ENSP00000295268:E444Q	E	-	1	0	C4orf37	98699282	0.001000	0.12720	0.003000	0.11579	0.041000	0.13682	0.296000	0.19083	0.412000	0.25729	0.563000	0.77884	GAG		0.274	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952		10	88	0	0	0	0.010729	0	10	88				
ADH1A	124	broad.mit.edu	37	4	100208053	100208053	+	Silent	SNP	G	G	T	rs367795983		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:100208053G>T	ENST00000209668.2	-	3	326	c.213C>A	c.(211-213)gcC>gcA	p.A71A	ADH1A_ENST00000511656.1_5'UTR|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	71					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	CCACGATGCCGGCTGCCTCAT	0.507																																							uc003hur.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(211-213)GCC>GCA		class I alcohol dehydrogenase, alpha subunit	Fomepizole(DB01213)|NADH(DB00157)						202.0	184.0	190.0					4																	100208053		2203	4300	6503	SO:0001819	synonymous_variant	124				ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding	g.chr4:100208053G>T	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.213C>A	4.37:g.100208053G>T			Somatic				uc003hum.1_RNA|ADH1A_uc011ceg.1_Silent_p.A71A|ADH1A_uc010ilf.1_5'Flank|ADH1A_uc010ilg.1_Silent_p.A71A	p.A71A	NM_000667	NP_000658	WXS	Illumina HiSeq	Unspecified	P07327	ADH1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	3	284	-			71					A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	37	c.213C>A	CCDS3648.1																																																																																				0.507	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667		37	173	1	0	4.92203e-23	0.00623	7.17795e-23	37	173				
DKK2	27123	broad.mit.edu	37	4	107845352	107845352	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:107845352C>G	ENST00000285311.3	-	4	1244	c.539G>C	c.(538-540)gGa>gCa	p.G180A	DKK2_ENST00000513208.1_Missense_Mutation_p.G80A|DKK2_ENST00000510463.1_Missense_Mutation_p.G134A	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	180					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		GCAGGGGTCTCCTTCATGCCC	0.423																																							uc003hyi.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(538-540)GGA>GCA		dickkopf homolog 2 precursor							80.0	77.0	78.0					4																	107845352		2203	4300	6503	SO:0001583	missense	27123				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		g.chr4:107845352C>G	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.539G>C	4.37:g.107845352C>G	ENSP00000285311:p.Gly180Ala		Somatic				DKK2_uc003hyj.1_3'UTR	p.G180A	NM_014421	NP_055236	WXS	Illumina HiSeq	Unspecified	Q9UBU2	DKK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)	4	1244	-		Hepatocellular(203;0.217)	180					A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	c.539G>C	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747404	0.89663	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.57273	0.41;0.73;0.55	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.75722	0.3888	M	0.82056	2.57	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.78061	-0.2351	10	0.72032	D	0.01	-12.0199	19.6876	0.95986	0.0:1.0:0.0:0.0	.	180	Q9UBU2	DKK2_HUMAN	A	180;80;134	ENSP00000285311:G180A;ENSP00000421255:G80A;ENSP00000423797:G134A	ENSP00000285311:G180A	G	-	2	0	DKK2	108064801	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.487000	0.81328	2.657000	0.90304	0.585000	0.79938	GGA		0.423	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			3	31	0	0	0	0.009096	0	3	31				
ANK2	287	broad.mit.edu	37	4	114275689	114275689	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:114275689A>T	ENST00000357077.4	+	38	5968	c.5915A>T	c.(5914-5916)cAa>cTa	p.Q1972L	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.Q1939L|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1972	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACAGAAAAGCAACCACCTGTA	0.498																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(5914-5916)CAA>CTA		ankyrin 2 isoform 1							95.0	101.0	99.0					4																	114275689		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114275689A>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5915A>T	4.37:g.114275689A>T	ENSP00000349588:p.Gln1972Leu		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Missense_Mutation_p.Q1987L	p.Q1972L	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	6015	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	1939			Repeat-rich region.|Repeat A.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.5915A>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	13.83	2.353063	0.41700	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.67698	-0.27;-0.28	6.17	5.0	0.66597	.	0.472859	0.19580	N	0.110896	T	0.51295	0.1666	L	0.29908	0.895	0.80722	D	1	B;P	0.37276	0.255;0.589	B;B	0.30855	0.038;0.121	T	0.44907	-0.9297	9	.	.	.	.	13.5421	0.61681	0.8576:0.1424:0.0:0.0	.	1939;1972	Q01484;Q01484-4	ANK2_HUMAN;.	L	1972;1939	ENSP00000349588:Q1972L;ENSP00000264366:Q1939L	.	Q	+	2	0	ANK2	114495138	0.984000	0.35163	0.761000	0.31378	0.889000	0.51656	2.761000	0.47589	1.137000	0.42214	0.533000	0.62120	CAA		0.498	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		6	139	0	0	0	0.001168	0	6	139				
ANKRD50	57182	broad.mit.edu	37	4	125590612	125590612	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:125590612C>G	ENST00000504087.1	-	4	4857	c.3820G>C	c.(3820-3822)Gaa>Caa	p.E1274Q	ANKRD50_ENST00000515641.1_Missense_Mutation_p.E1095Q	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1274	Ser-rich.									NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GCAGAATTTTCTGATTTCCCC	0.388																																							uc003ifg.3		NA																	0				central_nervous_system(1)	1						c.(3820-3822)GAA>CAA		ankyrin repeat domain 50							149.0	160.0	156.0					4																	125590612		2203	4300	6503	SO:0001583	missense	57182							g.chr4:125590612C>G	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3820G>C	4.37:g.125590612C>G	ENSP00000425658:p.Glu1274Gln		Somatic				ANKRD50_uc011cgo.1_Missense_Mutation_p.E1095Q|ANKRD50_uc010inw.2_Missense_Mutation_p.E1274Q	p.E1274Q	NM_020337	NP_065070	WXS	Illumina HiSeq	Unspecified	Q9ULJ7	ANR50_HUMAN			3	4086	-			1274			Ser-rich.		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	c.3820G>C	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742921	0.30865	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.66638	-0.22;-0.19	5.14	5.14	0.70334	.	0.381225	0.29260	N	0.012666	T	0.52517	0.1739	N	0.14661	0.345	0.31294	N	0.68903	B	0.14438	0.01	B	0.15484	0.013	T	0.51188	-0.8737	10	0.33141	T	0.24	.	18.8052	0.92034	0.0:1.0:0.0:0.0	.	1274	Q9ULJ7	ANR50_HUMAN	Q	1274;1095	ENSP00000425658:E1274Q;ENSP00000425355:E1095Q	ENSP00000425658:E1274Q	E	-	1	0	ANKRD50	125810062	0.948000	0.32251	0.994000	0.49952	0.990000	0.78478	1.691000	0.37721	2.676000	0.91093	0.561000	0.74099	GAA		0.388	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337		54	217	0	0	0	0.01441	0	54	217				
C4orf27	54969	broad.mit.edu	37	4	170674954	170674954	+	Missense_Mutation	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr4:170674954T>A	ENST00000393381.2	-	2	156	c.81A>T	c.(79-81)aaA>aaT	p.K27N		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	27						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		CTTCACAGAATTTACTTTTCT	0.348																																							uc003isl.3		NA																	0				ovary(1)|pancreas(1)	2						c.(79-81)AAA>AAT		hypothetical protein LOC54969							80.0	72.0	75.0					4																	170674954		2203	4299	6502	SO:0001583	missense	54969					nucleus		g.chr4:170674954T>A	BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.81A>T	4.37:g.170674954T>A	ENSP00000406598:p.Lys27Asn		Somatic					p.K27N	NM_017867	NP_060337	WXS	Illumina HiSeq	Unspecified	Q9NWY4	CD027_HUMAN		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)	2	146	-		Prostate(90;0.00601)|Renal(120;0.0183)	27						Missense_Mutation	SNP	ENST00000393381.2	37	c.81A>T	CCDS3813.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.419276	0.25552	.	.	ENSG00000056050	ENST00000393381	T	0.33438	1.41	4.81	-0.495	0.12030	.	0.537455	0.21046	N	0.081100	T	0.22627	0.0546	L	0.56769	1.78	0.09310	N	0.999997	B	0.32245	0.361	B	0.24006	0.05	T	0.09400	-1.0676	10	0.46703	T	0.11	3.6754	6.9352	0.24463	0.0:0.4372:0.1344:0.4284	.	27	Q9NWY4	CD027_HUMAN	N	27	ENSP00000406598:K27N	ENSP00000406598:K27N	K	-	3	2	C4orf27	170911529	0.022000	0.18835	0.952000	0.39060	0.375000	0.29983	-0.269000	0.08596	-0.300000	0.08895	0.379000	0.24179	AAA		0.348	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363140.1	NM_017867		4	47	0	0	0	0.000602	0	4	47				
ADCY2	108	broad.mit.edu	37	5	7724663	7724663	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:7724663G>C	ENST00000338316.4	+	13	1798	c.1709G>C	c.(1708-1710)tGg>tCg	p.W570S	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Missense_Mutation_p.W390S	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	570					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCCAGGCAATGGCTCAAGTCT	0.333																																							uc003jdz.1		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(1708-1710)TGG>TCG		adenylate cyclase 2							77.0	76.0	76.0					5																	7724663		2203	4300	6503	SO:0001583	missense	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7724663G>C	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1709G>C	5.37:g.7724663G>C	ENSP00000342952:p.Trp570Ser		Somatic				ADCY2_uc011cmo.1_Missense_Mutation_p.W390S	p.W570S	NM_020546	NP_065433	WXS	Illumina HiSeq	Unspecified	Q08462	ADCY2_HUMAN			13	1776	+			570			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	c.1709G>C	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.155607	0.78114	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.81247	-1.0;-1.47	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.88429	0.6434	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.87578	0.998;0.937	D	0.88765	0.3260	10	0.72032	D	0.01	.	16.8964	0.86101	0.0:0.0:1.0:0.0	.	390;570	B7Z2C1;Q08462	.;ADCY2_HUMAN	S	570;403;390	ENSP00000342952:W570S;ENSP00000444803:W390S	ENSP00000342952:W570S	W	+	2	0	ADCY2	7777663	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.359000	0.90093	2.788000	0.95919	0.650000	0.86243	TGG		0.333	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		6	72	0	0	0	0.00308	0	6	72				
PRDM9	56979	broad.mit.edu	37	5	23509169	23509169	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:23509169G>T	ENST00000296682.3	+	2	209	c.27G>T	c.(25-27)gaG>gaT	p.E9D		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	9					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CCCAAGAGGAGAGCCCAGAAG	0.567										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(25-27)GAG>GAT		PR domain containing 9							78.0	85.0	83.0					5																	23509169		1923	4139	6062	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23509169G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.27G>T	5.37:g.23509169G>T	ENSP00000296682:p.Glu9Asp	HNSCC(3;0.000094)	Somatic					p.E9D	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			2	209	+			9					B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.27G>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	3.260	-0.151427	0.06585	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.10192	2.9;3.0	1.77	-1.92	0.07618	.	.	.	.	.	T	0.05502	0.0145	N	0.19112	0.55	0.09310	N	1	B	0.20887	0.049	B	0.10450	0.005	T	0.37549	-0.9701	9	0.49607	T	0.09	.	2.0997	0.03676	0.3574:0.0:0.3922:0.2503	.	9	Q9NQV7	PRDM9_HUMAN	D	9	ENSP00000425471:E9D;ENSP00000296682:E9D	ENSP00000296682:E9D	E	+	3	2	PRDM9	23544926	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	-0.360000	0.07622	-0.557000	0.06126	-1.336000	0.01259	GAG		0.567	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		15	38	1	0	1.50039e-11	0.012319	2.06386e-11	15	38				
TTC33	23548	broad.mit.edu	37	5	40730380	40730380	+	Missense_Mutation	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:40730380T>A	ENST00000337702.4	-	3	439	c.287A>T	c.(286-288)tAc>tTc	p.Y96F	TTC33_ENST00000503936.2_Intron	NM_012382.2	NP_036514.1	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	96										NS(1)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TTTCATCTCGTATAGGGTAGC	0.358																																							uc003jma.2		NA																	0				ovary(1)	1						c.(286-288)TAC>TTC		tetratricopeptide repeat domain 33							157.0	146.0	150.0					5																	40730380		2203	4300	6503	SO:0001583	missense	23548						binding	g.chr5:40730380T>A	BC015701	CCDS3931.1	5p13.1	2013-01-11			ENSG00000113638	ENSG00000113638		"""Tetratricopeptide (TTC) repeat domain containing"""	29959	protein-coding gene	gene with protein product	"""osmosis responsive factor"""					12477932	Standard	NM_012382		Approved	OSRF	uc003jma.3	Q6PID6	OTTHUMG00000131142	ENST00000337702.4:c.287A>T	5.37:g.40730380T>A	ENSP00000338533:p.Tyr96Phe		Somatic				TTC33_uc011cpm.1_Intron|TTC33_uc010ivg.2_Intron	p.Y96F	NM_012382	NP_036514	WXS	Illumina HiSeq	Unspecified	Q6PID6	TTC33_HUMAN			3	435	-			96			TPR 2.		B2R6G0|O95105	Missense_Mutation	SNP	ENST00000337702.4	37	c.287A>T	CCDS3931.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.831603	0.91036	.	.	ENSG00000113638	ENST00000337702	T	0.64260	-0.09	5.84	5.84	0.93424	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.057507	0.64402	D	0.000001	T	0.72882	0.3516	M	0.71036	2.16	0.80722	D	1	P	0.46706	0.883	P	0.53102	0.718	T	0.75482	-0.3302	10	0.59425	D	0.04	-12.2642	14.7877	0.69816	0.0:0.0:0.0:1.0	.	96	Q6PID6	TTC33_HUMAN	F	96	ENSP00000338533:Y96F	ENSP00000338533:Y96F	Y	-	2	0	TTC33	40766137	1.000000	0.71417	0.994000	0.49952	0.957000	0.61999	6.664000	0.74437	2.231000	0.72958	0.533000	0.62120	TAC		0.358	TTC33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253831.1	NM_012382		5	86	0	0	0	0.000602	0	5	86				
FST	10468	broad.mit.edu	37	5	52779494	52779494	+	Silent	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:52779494A>G	ENST00000256759.3	+	3	821	c.438A>G	c.(436-438)ctA>ctG	p.L146L	FST_ENST00000396947.3_Silent_p.L146L	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	146	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				GTGCACTCCTAAAGGCAAGAT	0.542																																							uc003jpd.2		NA																	0					0						c.(436-438)CTA>CTG		follistatin isoform FST344 precursor							70.0	65.0	67.0					5																	52779494		2203	4300	6503	SO:0001819	synonymous_variant	10468				hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity	g.chr5:52779494A>G	M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.438A>G	5.37:g.52779494A>G			Somatic				FST_uc003jpc.2_Silent_p.L146L	p.L146L	NM_013409	NP_037541	WXS	Illumina HiSeq	Unspecified	P19883	FST_HUMAN			3	465	+		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)	146			Kazal-like 1.		B5BU94|Q9BTH0	Silent	SNP	ENST00000256759.3	37	c.438A>G	CCDS3959.1																																																																																				0.542	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253906.1	NM_013409		9	46	0	0	0	0.008291	0	9	46				
MAST4	375449	broad.mit.edu	37	5	66462786	66462786	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:66462786C>T	ENST00000403625.2	+	29	8074	c.7779C>T	c.(7777-7779)cgC>cgT	p.R2593R	MAST4_ENST00000404260.3_Silent_p.R2596R|MAST4_ENST00000403666.1_Silent_p.R2404R|MAST4_ENST00000261569.7_Silent_p.R2399R|MAST4_ENST00000405643.1_Silent_p.R2414R	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2596						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ACACTGACCGCCCCATCTCTC	0.587																																							uc003jut.1		NA																	0				lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.(7210-7212)CGC>CGT		microtubule associated serine/threonine kinase							17.0	20.0	19.0					5																	66462786		1950	4134	6084	SO:0001819	synonymous_variant	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66462786C>T	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.7779C>T	5.37:g.66462786C>T			Somatic				MAST4_uc003juw.2_Silent_p.R2332R|MAST4_uc003jux.2_Silent_p.R157R	p.R2404R	NM_015183	NP_055998	WXS	Illumina HiSeq	Unspecified	O15021	MAST4_HUMAN		Lung(70;0.011)	28	7280	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	2596					A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	c.7212C>T	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	2.581	-0.297369	0.05532	.	.	ENSG00000069020	ENST00000443808	.	.	.	5.06	2.22	0.28083	.	.	.	.	.	T	0.45756	0.1358	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27365	-1.0076	4	.	.	.	-12.2697	3.1232	0.06398	0.1302:0.4508:0.2741:0.1449	.	.	.	.	S	1650	.	.	P	+	1	0	MAST4	66498542	0.089000	0.21612	0.985000	0.45067	0.233000	0.25261	-0.057000	0.11768	0.359000	0.24239	0.561000	0.74099	CCC		0.587	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			3	31	0	0	0	0.004672	0	3	31				
RASA1	5921	broad.mit.edu	37	5	86645175	86645175	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:86645175A>G	ENST00000274376.6	+	8	1811	c.1247A>G	c.(1246-1248)tAt>tGt	p.Y416C	RASA1_ENST00000506290.1_Missense_Mutation_p.Y250C|RASA1_ENST00000512763.1_Missense_Mutation_p.Y249C|RASA1_ENST00000456692.2_Missense_Mutation_p.Y239C	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	416	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GGCCGGTATTATAACAGGTAA	0.303																																							uc003kiw.2		NA																	0				upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5						c.(1246-1248)TAT>TGT		RAS p21 protein activator 1 isoform 1							54.0	58.0	57.0					5																	86645175		2201	4296	6497	SO:0001583	missense	5921				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding	g.chr5:86645175A>G		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1247A>G	5.37:g.86645175A>G	ENSP00000274376:p.Tyr416Cys		Somatic				RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Missense_Mutation_p.Y239C|RASA1_uc011ctv.1_Missense_Mutation_p.Y249C|RASA1_uc011ctw.1_Missense_Mutation_p.Y250C|RASA1_uc010jaw.2_Missense_Mutation_p.Y238C	p.Y416C	NM_002890	NP_002881	WXS	Illumina HiSeq	Unspecified	P20936	RASA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)	8	1365	+		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)	416			SH2 2.		B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	c.1247A>G	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.461954	0.84425	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.78	5.78	0.91487	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.87838	0.6278	L	0.41710	1.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.996;0.995;0.996;0.995;0.995	D	0.89087	0.3480	10	0.87932	D	0	.	16.1143	0.81295	1.0:0.0:0.0:0.0	.	250;249;250;239;416	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	C	416;449;239;249;250	ENSP00000274376:Y416C;ENSP00000411221:Y239C;ENSP00000422008:Y249C;ENSP00000420905:Y250C	ENSP00000274376:Y416C	Y	+	2	0	RASA1	86680931	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.305000	0.96197	2.198000	0.70561	0.477000	0.44152	TAT		0.303	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890		3	68	0	0	0	0.004672	0	3	68				
CAMK4	814	broad.mit.edu	37	5	110819868	110819868	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:110819868G>C	ENST00000282356.4	+	11	1524	c.1126G>C	c.(1126-1128)Gag>Cag	p.E376Q	CAMK4_ENST00000512890.1_3'UTR|CAMK4_ENST00000512453.1_Missense_Mutation_p.E376Q	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	376					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TCCAGAAGGAGAGAAAATTCA	0.522																																							uc011cvj.1		NA																	0				ovary(3)|lung(2)	5						c.(1126-1128)GAG>CAG		calcium/calmodulin-dependent protein kinase IV							62.0	66.0	65.0					5																	110819868		2202	4300	6502	SO:0001583	missense	814				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr5:110819868G>C	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.1126G>C	5.37:g.110819868G>C	ENSP00000282356:p.Glu376Gln		Somatic				CAMK4_uc003kpf.2_Missense_Mutation_p.E376Q|CAMK4_uc010jbv.2_Missense_Mutation_p.E179Q|CAMK4_uc003kpg.2_Missense_Mutation_p.E67Q	p.E376Q	NM_001744	NP_001735	WXS	Illumina HiSeq	Unspecified	Q16566	KCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)	12	1225	+		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)	376					D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	c.1126G>C	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.317686	0.60524	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.68181	-0.31;-0.31	5.49	3.34	0.38264	.	1.805900	0.02702	N	0.111823	T	0.49355	0.1552	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.14023	0.01	T	0.37842	-0.9688	10	0.07644	T	0.81	.	8.9883	0.36008	0.2764:0.0:0.7236:0.0	.	376	Q16566	KCC4_HUMAN	Q	376	ENSP00000422634:E376Q;ENSP00000282356:E376Q	ENSP00000282356:E376Q	E	+	1	0	CAMK4	110847767	0.089000	0.21612	0.002000	0.10522	0.876000	0.50452	1.117000	0.31234	1.299000	0.44798	0.591000	0.81541	GAG		0.522	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		8	83	0	0	0	0.004482	0	8	83				
PCDHA5	56143	broad.mit.edu	37	5	140202891	140202891	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:140202891G>T	ENST00000529859.1	+	1	1531	c.1531G>T	c.(1531-1533)Gcg>Tcg	p.A511S	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.A511S|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.A511S|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	511	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGGTGCACGCGGAGAGCGG	0.706																																							uc003lhl.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1531-1533)GCG>TCG		protocadherin alpha 5 isoform 1 precursor							51.0	56.0	54.0					5																	140202891		2203	4299	6502	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140202891G>T	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1531G>T	5.37:g.140202891G>T	ENSP00000436557:p.Ala511Ser		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.A511S|PCDHA5_uc003lhj.1_Missense_Mutation_p.A511S	p.A511S	NM_018908	NP_061731	WXS	Illumina HiSeq	Unspecified	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1531	+			511			Extracellular (Potential).|Cadherin 5.		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.1531G>T	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	1.225	-0.625859	0.03610	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.51325	0.71;0.71;0.71	3.86	2.9	0.33743	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.19886	0.0478	N	0.02103	-0.685	0.20821	N	0.999841	B;B;B	0.30914	0.224;0.3;0.3	B;B;B	0.36030	0.205;0.216;0.13	T	0.26189	-1.0110	9	0.06365	T	0.9	.	8.3123	0.32080	0.0:0.1385:0.6094:0.2521	.	511;511;511	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	S	511	ENSP00000433416:A511S;ENSP00000436557:A511S;ENSP00000367366:A511S	ENSP00000367366:A511S	A	+	1	0	PCDHA5	140183075	0.000000	0.05858	1.000000	0.80357	0.880000	0.50808	-0.991000	0.03728	1.864000	0.54056	0.461000	0.40582	GCG		0.706	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		13	120	1	0	1.05317e-09	0.00245	1.38807e-09	13	120				
PCDHGA1	56114	broad.mit.edu	37	5	140710575	140710575	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:140710575C>G	ENST00000517417.1	+	1	324	c.324C>G	c.(322-324)atC>atG	p.I108M	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.I108M	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	108	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTTAATATCCTTGTTGAGG	0.443																																							uc003lji.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(322-324)ATC>ATG		protocadherin gamma subfamily A, 1 isoform 1							100.0	114.0	109.0					5																	140710575		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140710575C>G	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.324C>G	5.37:g.140710575C>G	ENSP00000431083:p.Ile108Met		Somatic				PCDHGA1_uc011dan.1_Missense_Mutation_p.I108M	p.I108M	NM_018912	NP_061735	WXS	Illumina HiSeq	Unspecified	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	324	+			108			Cadherin 1.|Extracellular (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.324C>G	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663289	0.29515	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.30714	1.52;1.52	4.37	2.55	0.30701	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.49916	D	0.000125	T	0.46190	0.1380	M	0.87038	2.855	0.09310	N	1	P;P	0.50066	0.765;0.931	P;P	0.54544	0.598;0.755	T	0.40627	-0.9553	10	0.87932	D	0	.	3.8932	0.09128	0.2849:0.4918:0.139:0.0843	.	108;108	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	M	108	ENSP00000431083:I108M;ENSP00000367345:I108M	ENSP00000367345:I108M	I	+	3	3	PCDHGA1	140690759	0.000000	0.05858	0.994000	0.49952	0.802000	0.45316	-0.531000	0.06171	1.177000	0.42855	-0.181000	0.13052	ATC		0.443	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		19	144	0	0	0	0.012319	0	19	144				
PRELID2	153768	broad.mit.edu	37	5	145176111	145176111	+	Splice_Site	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:145176111C>A	ENST00000334744.4	-	6	457		c.e6-1		PRELID2_ENST00000505416.1_Splice_Site|PRELID2_ENST00000394450.2_Splice_Site|PRELID2_ENST00000358004.2_Splice_Site|PRELID2_ENST00000511435.1_Splice_Site|PRELID2_ENST00000510594.1_5'Flank	NM_182960.2	NP_892005.1	Q8N945	PRLD2_HUMAN	PRELI domain containing 2						phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAACTCTGTCCTGCAAAAAAA	0.368																																							uc003lnp.1		NA																	0					0						c.e6-1		PRELI domain containing 2 isoform a							77.0	83.0	81.0					5																	145176111		2203	4300	6503	SO:0001630	splice_region_variant	153768							g.chr5:145176111C>A	AK095695	CCDS34261.1, CCDS34262.1, CCDS43377.1	5q32	2012-04-23			ENSG00000186314	ENSG00000186314			28306	protein-coding gene	gene with protein product						12477932	Standard	NM_182960		Approved	MGC21644, FLJ38376	uc003lnq.1	Q8N945	OTTHUMG00000163384	ENST00000334744.4:c.405-1G>T	5.37:g.145176111C>A			Somatic				PRELID2_uc003lnq.1_Splice_Site_p.W123_splice|PRELID2_uc003lno.1_Splice_Site_p.W94_splice|PRELID2_uc003lnr.1_Intron	p.W135_splice	NM_182960	NP_892005	WXS	Illumina HiSeq	Unspecified	Q8N945	PRLD2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	458	-								G5EA01|Q96EQ3	Splice_Site	SNP	ENST00000334744.4	37	c.405_splice	CCDS34262.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213547	0.58452	.	.	ENSG00000186314	ENST00000358004;ENST00000334744;ENST00000394450;ENST00000505416;ENST00000511435	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1102	0.81259	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRELID2	145156304	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	4.243000	0.58721	2.536000	0.85505	0.561000	0.74099	.		0.368	PRELID2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000372970.1	NM_182960	Intron	10	87	1	0	1.76689e-08	0.006214	2.26249e-08	10	87				
MED7	9443	broad.mit.edu	37	5	156566362	156566362	+	Missense_Mutation	SNP	T	T	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:156566362T>A	ENST00000286317.5	-	2	462	c.81A>T	c.(79-81)caA>caT	p.Q27H	MED7_ENST00000420343.1_Missense_Mutation_p.Q27H	NM_004270.4	NP_004261.1	O43513	MED7_HUMAN	mediator complex subunit 7	27					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(1)|lung(3)|urinary_tract(2)	7	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTAAGCCTTCTTGAATATTTT	0.428																																							uc010jik.2		NA																	0					0						c.(79-81)CAA>CAT		mediator complex subunit 7							87.0	83.0	84.0					5																	156566362		2203	4300	6503	SO:0001583	missense	9443				regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity	g.chr5:156566362T>A	AF104251	CCDS4334.1	5q33.3	2008-02-05	2007-07-30	2007-07-30	ENSG00000155868	ENSG00000155868			2378	protein-coding gene	gene with protein product		605045	"""cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa"""	CRSP9		9989412	Standard	NM_004270		Approved	CRSP33	uc003lwm.4	O43513	OTTHUMG00000130243	ENST00000286317.5:c.81A>T	5.37:g.156566362T>A	ENSP00000286317:p.Gln27His		Somatic				MED7_uc003lwm.3_Missense_Mutation_p.Q27H	p.Q27H	NM_001100816	NP_001094286	WXS	Illumina HiSeq	Unspecified	O43513	MED7_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	473	-	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	27						Missense_Mutation	SNP	ENST00000286317.5	37	c.81A>T	CCDS4334.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.015971	0.35606	.	.	ENSG00000155868	ENST00000286317;ENST00000420343;ENST00000524289	.	.	.	5.7	4.82	0.62117	.	0.056068	0.64402	D	0.000001	T	0.41096	0.1144	N	0.24115	0.695	0.35115	D	0.766509	B	0.27264	0.173	B	0.37387	0.248	T	0.52808	-0.8526	9	0.66056	D	0.02	-10.7882	5.6775	0.17757	0.1488:0.6455:0.1283:0.0774	.	27	O43513	MED7_HUMAN	H	27	.	ENSP00000286317:Q27H	Q	-	3	2	MED7	156498940	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.853000	0.27777	1.381000	0.46364	-0.242000	0.12053	CAA		0.428	MED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252567.2	NM_004270		7	78	0	0	0	0.00308	0	7	78				
SLIT3	6586	broad.mit.edu	37	5	168244397	168244397	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr5:168244397C>A	ENST00000519560.1	-	8	1120	c.701G>T	c.(700-702)cGg>cTg	p.R234L	SLIT3_ENST00000404867.3_Missense_Mutation_p.R234L|SLIT3_ENST00000332966.8_Missense_Mutation_p.R234L	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	234	LRRCT 1.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCAACTGTCCGTCGCTGTCG	0.612																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	0				ovary(3)|skin(1)	4						c.(700-702)CGG>CTG		slit homolog 3 precursor							78.0	70.0	73.0					5																	168244397		2203	4300	6503	SO:0001583	missense	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168244397C>A	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.701G>T	5.37:g.168244397C>A	ENSP00000430333:p.Arg234Leu		Somatic				SLIT3_uc010jjg.2_Missense_Mutation_p.R234L|SLIT3_uc010jji.2_Missense_Mutation_p.R234L|SLIT3_uc003mac.1_Missense_Mutation_p.R31L	p.R234L	NM_003062	NP_003053	WXS	Illumina HiSeq	Unspecified	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		8	1121	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	234			LRRCT 1.		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	c.701G>T	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428643	0.62844	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.76968	-1.06;-1.05;-1.06	5.62	4.75	0.60458	Cysteine-rich flanking region, C-terminal (1);	0.169770	0.49305	D	0.000159	T	0.67896	0.2942	L	0.36672	1.1	0.33262	D	0.559891	P;P;B	0.43578	0.811;0.706;0.264	B;B;B	0.40009	0.254;0.316;0.111	T	0.78513	-0.2175	10	0.66056	D	0.02	.	10.2067	0.43118	0.0:0.853:0.0:0.147	.	234;234;234	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	L	234	ENSP00000430333:R234L;ENSP00000332164:R234L;ENSP00000384890:R234L	ENSP00000332164:R234L	R	-	2	0	SLIT3	168176975	0.975000	0.34042	0.989000	0.46669	0.989000	0.77384	1.668000	0.37481	2.644000	0.89710	0.561000	0.74099	CGG		0.612	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		4	60	1	0	5.9392e-07	0.001168	7.308e-07	4	60				
FOXQ1	94234	broad.mit.edu	37	6	1313369	1313369	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:1313369G>A	ENST00000296839.2	+	1	695	c.430G>A	c.(430-432)Gag>Aag	p.E144K		NM_033260.3	NP_150285.3	Q9C009	FOXQ1_HUMAN	forkhead box Q1	144					hair follicle morphogenesis (GO:0031069)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|urinary_tract(1)	2	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		GACGCTGGCGGAGATCAACGA	0.642																																							uc003mtl.3		NA																	0					0						c.(430-432)GAG>AAG		forkhead box Q1							29.0	31.0	30.0					6																	1313369		2196	4281	6477	SO:0001583	missense	94234				DNA fragmentation involved in apoptotic nuclear change|embryo development|hair follicle morphogenesis|pattern specification process|positive regulation of caspase activity|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	caspase regulator activity|DNA bending activity|double-stranded DNA binding|estrogen receptor binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin conjugating enzyme binding	g.chr6:1313369G>A	AF153341	CCDS4471.1	6p25	2008-02-05			ENSG00000164379	ENSG00000164379		"""Forkhead boxes"""	20951	protein-coding gene	gene with protein product		612788				11747606, 12011061	Standard	NM_033260		Approved	HFH1	uc003mtl.4	Q9C009	OTTHUMG00000016160	ENST00000296839.2:c.430G>A	6.37:g.1313369G>A	ENSP00000296839:p.Glu144Lys		Somatic					p.E144K	NM_033260	NP_150285	WXS	Illumina HiSeq	Unspecified	Q9C009	FOXQ1_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)	1	695	+	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)	144			Fork-head.		Q9NS06	Missense_Mutation	SNP	ENST00000296839.2	37	c.430G>A	CCDS4471.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250852	0.59212	.	.	ENSG00000164379	ENST00000296839	D	0.96265	-3.96	3.87	2.99	0.34606	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.64402	U	0.000001	D	0.94775	0.8313	M	0.86178	2.8	0.51233	D	0.999918	P	0.49635	0.926	P	0.44772	0.46	D	0.93178	0.6572	10	0.54805	T	0.06	.	12.0167	0.53317	0.0:0.0:0.828:0.172	.	144	Q9C009	FOXQ1_HUMAN	K	144	ENSP00000296839:E144K	ENSP00000296839:E144K	E	+	1	0	FOXQ1	1258369	1.000000	0.71417	0.464000	0.27143	0.306000	0.27790	8.884000	0.92432	0.606000	0.29965	-1.296000	0.01341	GAG		0.642	FOXQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043410.1	NM_033260		6	49	0	0	0	0.001984	0	6	49				
GMPR	2766	broad.mit.edu	37	6	16254832	16254832	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:16254832G>A	ENST00000259727.4	+	4	445	c.331G>A	c.(331-333)Gaa>Aaa	p.E111K		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	111					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				GAATGATCTGGAAAAGATGAC	0.453																																							uc003nbs.2		NA																	0				ovary(1)	1						c.(331-333)GAA>AAA		guanosine monophosphate reductase							209.0	197.0	201.0					6																	16254832		2203	4300	6503	SO:0001583	missense	2766				nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding	g.chr6:16254832G>A		CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.331G>A	6.37:g.16254832G>A	ENSP00000259727:p.Glu111Lys		Somatic					p.E111K	NM_006877	NP_006868	WXS	Illumina HiSeq	Unspecified	P36959	GMPR1_HUMAN			4	445	+	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	111			NADP (By similarity).		Q96HQ6	Missense_Mutation	SNP	ENST00000259727.4	37	c.331G>A	CCDS4537.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003261	0.74932	.	.	ENSG00000137198	ENST00000259727	T	0.80033	-1.33	5.65	5.65	0.86999	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.183733	0.56097	D	0.000023	T	0.69548	0.3123	L	0.60455	1.87	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.67522	-0.5649	10	0.44086	T	0.13	1.061	14.8905	0.70606	0.0703:0.0:0.9297:0.0	.	111	P36959	GMPR1_HUMAN	K	111	ENSP00000259727:E111K	ENSP00000259727:E111K	E	+	1	0	GMPR	16362811	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.623000	0.83113	2.655000	0.90218	0.655000	0.94253	GAA		0.453	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039942.2			53	91	0	0	0	0.01441	0	53	91				
HIST1H2BO	8348	broad.mit.edu	37	6	27861512	27861512	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:27861512C>A	ENST00000303806.4	+	1	310	c.272C>A	c.(271-273)aCc>aAc	p.T91N	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	91					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										TCGACCATCACCTCCAGGGAG	0.627																																							uc003nkc.1		NA																	0					0						c.(271-273)ACC>AAC		histone cluster 1, H2bo							75.0	76.0	76.0					6																	27861512		2203	4296	6499	SO:0001583	missense	8348				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27861512C>A	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.272C>A	6.37:g.27861512C>A	ENSP00000303408:p.Thr91Asn		Somatic				HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	p.T91N	NM_003527	NP_003518	WXS	Illumina HiSeq	Unspecified	P23527	H2B1O_HUMAN			1	310	+			91					Q3KPI7|Q8TCV6	Missense_Mutation	SNP	ENST00000303806.4	37	c.272C>A	CCDS4640.1	.	.	.	.	.	.	.	.	.	.	C	31	5.065562	0.93898	.	.	ENSG00000196331	ENST00000303806	T	0.37915	1.17	3.24	3.24	0.37175	Histone-fold (2);Histone core (1);	0.000000	0.35555	U	0.003130	T	0.60418	0.2267	M	0.92317	3.295	0.42019	D	0.990977	D	0.76494	0.999	D	0.71414	0.973	T	0.72503	-0.4273	10	0.87932	D	0	.	14.3102	0.66410	0.0:1.0:0.0:0.0	.	91	P23527	H2B1O_HUMAN	N	91	ENSP00000303408:T91N	ENSP00000303408:T91N	T	+	2	0	HIST1H2BO	27969491	1.000000	0.71417	0.946000	0.38457	0.994000	0.84299	4.448000	0.60027	2.127000	0.65507	0.556000	0.70494	ACC		0.627	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1	NM_003527		10	115	1	0	9.70103e-10	0.008291	1.28938e-09	10	115				
B3GAT2	135152	broad.mit.edu	37	6	71665781	71665781	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:71665781C>A	ENST00000230053.6	-	1	960	c.352G>T	c.(352-354)Gac>Tac	p.D118Y		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	118					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCGCCGCGTCCTCCACCAGG	0.731																																							uc003pfv.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(352-354)GAC>TAC		beta-1,3-glucuronyltransferase 2							15.0	16.0	16.0					6																	71665781		2193	4288	6481	SO:0001583	missense	135152				carbohydrate biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding	g.chr6:71665781C>A	AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.352G>T	6.37:g.71665781C>A	ENSP00000230053:p.Asp118Tyr		Somatic				B3GAT2_uc011dxz.1_RNA|B3GAT2_uc003pfw.2_Missense_Mutation_p.D118Y	p.D118Y	NM_080742	NP_542780	WXS	Illumina HiSeq	Unspecified	Q9NPZ5	B3GA2_HUMAN			1	1008	-			118			Lumenal (Potential).		Q5JS09|Q8TF38|Q96NK4	Missense_Mutation	SNP	ENST00000230053.6	37	c.352G>T	CCDS4974.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713216	0.68730	.	.	ENSG00000112309	ENST00000230053	T	0.69306	-0.39	4.37	2.53	0.30540	.	0.100743	0.64402	D	0.000002	T	0.81578	0.4852	M	0.93328	3.405	0.80722	D	1	P;D	0.89917	0.594;1.0	B;D	0.97110	0.259;1.0	D	0.86068	0.1536	10	0.72032	D	0.01	-30.0278	13.8264	0.63352	0.0:0.7066:0.2934:0.0	.	118;118	Q29RV3;Q9NPZ5	.;B3GA2_HUMAN	Y	118	ENSP00000230053:D118Y	ENSP00000230053:D118Y	D	-	1	0	B3GAT2	71722502	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	7.477000	0.81069	0.443000	0.26582	-0.182000	0.12963	GAC		0.731	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742		5	31	1	0	0.000602214	0.000602	0.000667949	5	31				
ME1	4199	broad.mit.edu	37	6	83963432	83963432	+	Missense_Mutation	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:83963432A>C	ENST00000369705.3	-	7	846	c.730T>G	c.(730-732)Ttt>Gtt	p.F244V	ME1_ENST00000543031.1_Missense_Mutation_p.F169V|ME1_ENST00000541327.1_Missense_Mutation_p.F78V	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	244					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		AAATCTTCAAACTGAATAAGG	0.308																																							uc003pjy.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(730-732)TTT>GTT		cytosolic malic enzyme 1	NADH(DB00157)						132.0	120.0	124.0					6																	83963432		2203	4299	6502	SO:0001583	missense	4199				carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding	g.chr6:83963432A>C	X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.730T>G	6.37:g.83963432A>C	ENSP00000358719:p.Phe244Val		Somatic				ME1_uc011dzb.1_Missense_Mutation_p.F169V|ME1_uc011dzc.1_Missense_Mutation_p.F78V	p.F244V	NM_002395	NP_002386	WXS	Illumina HiSeq	Unspecified	P48163	MAOX_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0641)	7	836	-		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)	244					B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	ENST00000369705.3	37	c.730T>G	CCDS34492.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.582609	0.86748	.	.	ENSG00000065833	ENST00000369705;ENST00000541327;ENST00000543031	T;T;T	0.53857	0.6;0.6;0.6	5.53	5.53	0.82687	Malic enzyme, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.72732	0.3497	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79992	-0.1569	10	0.87932	D	0	-16.3053	14.6411	0.68726	1.0:0.0:0.0:0.0	.	244	P48163	MAOX_HUMAN	V	244;78;169	ENSP00000358719:F244V;ENSP00000439912:F78V;ENSP00000446114:F169V	ENSP00000358719:F244V	F	-	1	0	ME1	84020151	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.288000	0.96055	2.104000	0.64026	0.377000	0.23210	TTT		0.308	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041350.1			14	95	0	0	0	0.003163	0	14	95				
SCML4	256380	broad.mit.edu	37	6	108066250	108066250	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:108066250G>T	ENST00000369020.3	-	5	830	c.585C>A	c.(583-585)agC>agA	p.S195R	SCML4_ENST00000479803.1_5'Flank|SCML4_ENST00000369021.3_Missense_Mutation_p.S166R|SCML4_ENST00000369022.2_Missense_Mutation_p.S137R	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		CGCACAGGAGGCTTCGGCACA	0.592																																							uc010kdf.2		NA																	0				ovary(1)	1						c.(583-585)AGC>AGA		sex comb on midleg-like 4							68.0	59.0	62.0					6																	108066250		2203	4300	6503	SO:0001583	missense	256380				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr6:108066250G>T		CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.585C>A	6.37:g.108066250G>T	ENSP00000358016:p.Ser195Arg		Somatic				SCML4_uc003prz.3_Missense_Mutation_p.S137R|SCML4_uc011eam.1_Missense_Mutation_p.S195R|SCML4_uc003psa.3_Missense_Mutation_p.S166R	p.S195R	NM_198081	NP_932347	WXS	Illumina HiSeq	Unspecified	Q8N228	SCML4_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)	5	836	-		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)	195					B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	c.585C>A	CCDS5060.2	.	.	.	.	.	.	.	.	.	.	G	19.37	3.813817	0.70912	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.38	1.67	0.24075	.	0.000000	0.85682	D	0.000000	T	0.50154	0.1599	M	0.79475	2.455	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.985;0.999	T	0.53078	-0.8489	10	0.51188	T	0.08	.	10.5482	0.45072	0.2495:0.0:0.7505:0.0	.	195;195;166	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	R	137;195;166;166	ENSP00000358018:S137R;ENSP00000358016:S195R;ENSP00000358017:S166R;ENSP00000404688:S166R	ENSP00000358016:S195R	S	-	3	2	SCML4	108172943	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	1.713000	0.37951	0.122000	0.18314	0.655000	0.94253	AGC		0.592	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128		9	46	1	0	0.000274275	0.004482	0.000305289	9	46				
NKAIN2	154215	broad.mit.edu	37	6	124979407	124979407	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:124979407G>C	ENST00000368417.1	+	4	409	c.349G>C	c.(349-351)Gtg>Ctg	p.V117L	NKAIN2_ENST00000368416.1_Missense_Mutation_p.V117L|NKAIN2_ENST00000545433.1_Missense_Mutation_p.V102L|NKAIN2_ENST00000546092.1_Intron	NM_001040214.1	NP_001035304.1	Q5VXU1	NKAI2_HUMAN	Na+/K+ transporting ATPase interacting 2	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|large_intestine(3)|lung(12)|skin(2)	19				GBM - Glioblastoma multiforme(226;0.104)		AGGATGTACGGTGACGTCAGT	0.493																																							uc003pzo.2		NA																	0					0						c.(349-351)GTG>CTG		T-cell lymphoma breakpoint-associated target 1							162.0	139.0	147.0					6																	124979407		2203	4300	6503	SO:0001583	missense	154215					integral to membrane|plasma membrane		g.chr6:124979407G>C	AB070452	CCDS34526.1	6q21	2008-02-05	2007-10-04	2007-10-04	ENSG00000188580	ENSG00000188580		"""Na+/K+ transporting ATPase interacting"""	16443	protein-coding gene	gene with protein product		609758	"""T-cell lymphoma breakpoint associated target 1"""	TCBA1		17606467	Standard	XM_005266833		Approved	FAM77B	uc003pzo.3	Q5VXU1	OTTHUMG00000015500	ENST00000368417.1:c.349G>C	6.37:g.124979407G>C	ENSP00000357402:p.Val117Leu		Somatic				NKAIN2_uc003pzn.1_Missense_Mutation_p.V117L|NKAIN2_uc003pzp.2_Missense_Mutation_p.V116L|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Missense_Mutation_p.V27L	p.V117L	NM_001040214	NP_001035304	WXS	Illumina HiSeq	Unspecified	Q5VXU1	NKAI2_HUMAN		GBM - Glioblastoma multiforme(226;0.104)	4	626	+			117					Q8IYR4|Q8TF67	Missense_Mutation	SNP	ENST00000368417.1	37	c.349G>C	CCDS34526.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264241	0.39995	.	.	ENSG00000188580	ENST00000368416;ENST00000368417;ENST00000539866;ENST00000545433	T;T;T	0.14391	2.51;2.51;2.51	5.71	5.71	0.89125	.	0.060289	0.64402	N	0.000003	T	0.19967	0.0480	L	0.50919	1.6	0.49389	D	0.999784	B;P;B;P	0.47910	0.008;0.902;0.008;0.692	B;D;B;P	0.64595	0.019;0.927;0.019;0.448	T	0.01935	-1.1244	10	0.11182	T	0.66	-7.432	19.9132	0.97031	0.0:0.0:1.0:0.0	.	102;116;117;117	B3KNZ0;Q5VXU1-3;Q5VXU1;Q5VXU1-2	.;.;NKAI2_HUMAN;.	L	117;117;116;102	ENSP00000357401:V117L;ENSP00000357402:V117L;ENSP00000437798:V102L	ENSP00000357401:V117L	V	+	1	0	NKAIN2	125021106	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	9.405000	0.97313	2.710000	0.92621	0.644000	0.83932	GTG		0.493	NKAIN2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042057.1	NM_001040214		8	73	0	0	0	0.004482	0	8	73				
MYB	4602	broad.mit.edu	37	6	135515583	135515583	+	Silent	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:135515583A>T	ENST00000367814.4	+	8	1119	c.933A>T	c.(931-933)ggA>ggT	p.G311G	MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000533624.1_Intron|MYB_ENST00000528774.1_Silent_p.G311G|MYB_ENST00000420123.2_Silent_p.G287G|MYB_ENST00000341911.5_Silent_p.G311G|MYB_ENST00000534044.1_Silent_p.G311G|MYB_ENST00000525369.1_Silent_p.G311G|MYB_ENST00000442647.2_Silent_p.G311G|MYB_ENST00000527615.1_Silent_p.G311G|MYB_ENST00000534121.1_Silent_p.G311G|MYB_ENST00000316528.8_Silent_p.G311G|MYB_ENST00000531845.1_3'UTR	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	311	Transcription activation domain (PubMed:2189102). {ECO:0000269|PubMed:2189102}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AGCTAAAAGGACAGCAGGTGC	0.408			T	NFIB	adenoid cystic carcinoma																																		uc003qfc.2		NA		Dom	yes		6	6q22-23	4602	T	v-myb myeloblastosis viral oncogene homolog			E	NFIB		adenoid cystic carcinoma		0				lung(1)	1						c.(931-933)GGA>GGT		v-myb myeloblastosis viral oncogene homolog							89.0	84.0	86.0					6																	135515583		2203	4300	6503	SO:0001819	synonymous_variant	4602				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding	g.chr6:135515583A>T		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.933A>T	6.37:g.135515583A>T			Somatic				MYB_uc003qfh.2_Silent_p.G311G|MYB_uc003qfi.2_Silent_p.G311G|MYB_uc010kgi.2_Silent_p.G311G|MYB_uc003qfq.2_Silent_p.G311G|MYB_uc010kgj.2_Intron|MYB_uc003qfo.2_Silent_p.G311G|MYB_uc003qfu.2_Silent_p.G311G|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_5'UTR|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Silent_p.G123G|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Silent_p.G311G|MYB_uc003qgd.1_Silent_p.G123G|MYB_uc003qge.1_5'Flank	p.G311G	NM_005375	NP_005366	WXS	Illumina HiSeq	Unspecified	P10242	MYB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)	8	1132	+	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)	311			Transcriptional activation domain.		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Silent	SNP	ENST00000367814.4	37	c.933A>T	CCDS5174.1																																																																																				0.408	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042347.4			4	51	0	0	0	0.009096	0	4	51				
BCLAF1	9774	broad.mit.edu	37	6	136599520	136599520	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:136599520T>C	ENST00000531224.1	-	4	751	c.499A>G	c.(499-501)Aaa>Gaa	p.K167E	BCLAF1_ENST00000353331.4_Missense_Mutation_p.K165E|BCLAF1_ENST00000527536.1_Missense_Mutation_p.K167E|BCLAF1_ENST00000392348.2_Missense_Mutation_p.K165E|BCLAF1_ENST00000530767.1_Missense_Mutation_p.K167E|BCLAF1_ENST00000527759.1_Missense_Mutation_p.K165E	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	167					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCAGCTTTTTTGGTTTGTTTT	0.423																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	0				ovary(1)	1						c.(499-501)AAA>GAA		BCL2-associated transcription factor 1 isoform							189.0	199.0	196.0					6																	136599520		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599520T>C	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.499A>G	6.37:g.136599520T>C	ENSP00000435210:p.Lys167Glu		Somatic				BCLAF1_uc003qgw.1_Missense_Mutation_p.K167E|BCLAF1_uc003qgy.1_Missense_Mutation_p.K165E|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.K165E	p.K167E	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	752	-	Colorectal(23;0.24)		167					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.499A>G	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443231	0.63067	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37;2.37	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000002	T	0.04724	0.0128	N	0.08118	0	0.80722	D	1	P;P;P;P	0.41784	0.612;0.762;0.612;0.612	B;B;B;B	0.39379	0.186;0.298;0.186;0.186	T	0.22312	-1.0220	10	0.66056	D	0.02	-17.1458	11.7991	0.52116	0.0:0.0:0.1465:0.8534	.	165;165;167;167	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	E	167;165;167;167;165;165;167	ENSP00000435210:K167E;ENSP00000229446:K165E;ENSP00000435441:K167E;ENSP00000436501:K167E;ENSP00000434826:K165E;ENSP00000376159:K165E;ENSP00000431734:K167E	ENSP00000229446:K165E	K	-	1	0	BCLAF1	136641213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.064000	0.57506	2.148000	0.66965	0.455000	0.32223	AAA		0.423	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		7	198	0	0	0	0.00308	0	7	198				
NMBR	4829	broad.mit.edu	37	6	142399902	142399902	+	Silent	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:142399902G>T	ENST00000258042.1	-	2	701	c.561C>A	c.(559-561)atC>atA	p.I187I	NMBR_ENST00000480652.1_5'Flank	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	187					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		CCAAGCTACTGATGCGAGCCA	0.488																																							uc003qiu.2		NA																	0				central_nervous_system(3)|breast(1)	4						c.(559-561)ATC>ATA		neuromedin B receptor							129.0	122.0	125.0					6																	142399902		2203	4300	6503	SO:0001819	synonymous_variant	4829				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity	g.chr6:142399902G>T		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.561C>A	6.37:g.142399902G>T			Somatic					p.I187I	NM_002511	NP_002502	WXS	Illumina HiSeq	Unspecified	P28336	NMBR_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)	2	702	-	Breast(32;0.155)		187			Extracellular (Potential).		E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	c.561C>A	CCDS5196.1																																																																																				0.488	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1			8	165	1	0	0.00448238	0.004482	0.0049026	8	165				
STXBP5	134957	broad.mit.edu	37	6	147581767	147581767	+	Silent	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:147581767C>T	ENST00000321680.6	+	5	448	c.448C>T	c.(448-450)Ctg>Ttg	p.L150L	STXBP5_ENST00000179882.6_5'UTR|STXBP5_ENST00000546097.1_Silent_p.L150L|STXBP5_ENST00000367480.3_Silent_p.L150L|STXBP5_ENST00000367481.3_Silent_p.L150L	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	150					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		ATTTTGCCATCTGCCTTTCCA	0.363																																							uc003qlz.2		NA																	0					0						c.(448-450)CTG>TTG		syntaxin binding protein 5 (tomosyn) isoform b							95.0	92.0	93.0					6																	147581767		2203	4300	6503	SO:0001819	synonymous_variant	134957				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding	g.chr6:147581767C>T	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.448C>T	6.37:g.147581767C>T			Somatic				STXBP5_uc010khz.1_Silent_p.L150L|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_5'UTR	p.L150L	NM_001127715	NP_001121187	WXS	Illumina HiSeq	Unspecified	Q5T5C0	STXB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)	5	609	+		Ovarian(120;0.0164)	150			WD 3.		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	ENST00000321680.6	37	c.448C>T	CCDS47499.1																																																																																				0.363	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1			4	74	0	0	0	0.000602	0	4	74				
TAB2	23118	broad.mit.edu	37	6	149699976	149699976	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr6:149699976C>G	ENST00000367456.1	+	4	1502	c.925C>G	c.(925-927)Cat>Gat	p.H309D	TAB2_ENST00000536230.1_Missense_Mutation_p.H277D|TAB2_ENST00000392282.1_Missense_Mutation_p.H309D|TAB2_ENST00000538427.1_Missense_Mutation_p.H309D|TAB2_ENST00000286332.5_Missense_Mutation_p.H309D			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	309					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						GTCTTCTGCCCATAGCCAATA	0.418																																							uc003qmj.2		NA																	0					0						c.(925-927)CAT>GAT		mitogen-activated protein kinase kinase kinase 7							126.0	116.0	119.0					6																	149699976		2203	4300	6503	SO:0001583	missense	23118				activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding	g.chr6:149699976C>G	AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.925C>G	6.37:g.149699976C>G	ENSP00000356426:p.His309Asp		Somatic				TAB2_uc011eec.1_Missense_Mutation_p.H277D|TAB2_uc010kia.1_Missense_Mutation_p.H309D|TAB2_uc010kib.1_Missense_Mutation_p.H309D|TAB2_uc003qmk.3_RNA	p.H309D	NM_015093	NP_055908	WXS	Illumina HiSeq	Unspecified	Q9NYJ8	TAB2_HUMAN			3	1103	+			309					B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	ENST00000367456.1	37	c.925C>G	CCDS5214.1	.	.	.	.	.	.	.	.	.	.	C	3.534	-0.095127	0.07010	.	.	ENSG00000055208	ENST00000536230;ENST00000392282;ENST00000538427;ENST00000367456;ENST00000286332	T;T;T;T;T	0.72505	-0.66;-0.65;-0.65;-0.65;-0.65	6.03	5.17	0.71159	.	0.331960	0.37095	N	0.002243	T	0.38532	0.1044	N	0.14661	0.345	0.40897	D	0.984126	B;B	0.19817	0.039;0.039	B;B	0.14578	0.011;0.007	T	0.36040	-0.9764	10	0.40728	T	0.16	-16.1084	13.6262	0.62165	0.0:0.9289:0.0:0.0711	.	277;309	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	D	277;309;309;309;309	ENSP00000443206:H277D;ENSP00000376106:H309D;ENSP00000445752:H309D;ENSP00000356426:H309D;ENSP00000286332:H309D	ENSP00000286332:H309D	H	+	1	0	TAB2	149741669	1.000000	0.71417	0.999000	0.59377	0.030000	0.12068	2.262000	0.43285	1.574000	0.49760	-0.262000	0.10625	CAT		0.418	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042633.3			18	80	0	0	0	0.008871	0	18	80				
UNCX	340260	broad.mit.edu	37	7	1275566	1275566	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:1275566C>A	ENST00000316333.8	+	3	660	c.549C>A	c.(547-549)agC>agA	p.S183R		NM_001080461.1	NP_001073930.1	A6NJT0	UNC4_HUMAN	UNC homeobox	183					cartilage condensation (GO:0001502)|common myeloid progenitor cell proliferation (GO:0035726)|dorsal spinal cord development (GO:0021516)|olfactory bulb interneuron differentiation (GO:0021889)|pattern specification process (GO:0007389)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|skin(1)|upper_aerodigestive_tract(1)	4		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CCACGTGCAGCGGCGAGCCCA	0.637																																							uc011jvw.1		NA																	0				skin(1)	1						c.(547-549)AGC>AGA		UNC homeobox							18.0	21.0	20.0					7																	1275566		2190	4292	6482	SO:0001583	missense	340260				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:1275566C>A		CCDS34583.1	7p22.3	2011-06-20			ENSG00000164853	ENSG00000164853		"""Homeoboxes / PRD class"""	33194	protein-coding gene	gene with protein product							Standard	NM_001080461		Approved	Uncx4.1	uc011jvw.2	A6NJT0	OTTHUMG00000152022	ENST00000316333.8:c.549C>A	7.37:g.1275566C>A	ENSP00000314480:p.Ser183Arg		Somatic					p.S183R	NM_001080461	NP_001073930	WXS	Illumina HiSeq	Unspecified	A6NJT0	UNC4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)	3	549	+		Ovarian(82;0.11)	183					A4D221	Missense_Mutation	SNP	ENST00000316333.8	37	c.549C>A	CCDS34583.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566065	0.27915	.	.	ENSG00000164853	ENST00000316333	D	0.91792	-2.91	3.79	1.54	0.23209	.	0.162186	0.38720	U	0.001595	D	0.93517	0.7931	L	0.56769	1.78	0.38730	D	0.953643	D	0.76494	0.999	D	0.79784	0.993	D	0.91823	0.5469	10	0.62326	D	0.03	-7.0116	8.2469	0.31693	0.0:0.7495:0.0:0.2505	.	183	A6NJT0	UNC4_HUMAN	R	183	ENSP00000314480:S183R	ENSP00000314480:S183R	S	+	3	2	UNCX	1242092	0.548000	0.26473	0.998000	0.56505	0.991000	0.79684	0.101000	0.15251	0.111000	0.17947	0.400000	0.26472	AGC		0.637	UNCX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324910.2	NM_001080461		4	20	1	0	0.00909568	0.009096	0.00974537	4	20				
MEOX2	4223	broad.mit.edu	37	7	15652018	15652018	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:15652018G>A	ENST00000262041.5	-	3	1318	c.909C>T	c.(907-909)caC>caT	p.H303H		NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	303					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		TATATCATAAGTGCGCATGCT	0.483																																					Esophageal Squamous(140;197 1769 16409 18257 29929)	Esophageal Squamous(140;197 1769 16409 18257 29929)	uc003stc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(907-909)CAC>CAT		mesenchyme homeobox 2							118.0	101.0	107.0					7																	15652018		2203	4300	6503	SO:0001819	synonymous_variant	4223				blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:15652018G>A		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.909C>T	7.37:g.15652018G>A			Somatic				MEOX2_uc011jxw.1_Silent_p.H303H	p.H303H	NM_005924	NP_005915	WXS	Illumina HiSeq	Unspecified	P50222	MEOX2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)	3	1190	-			303					B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	37	c.909C>T	CCDS34605.1																																																																																				0.483	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924		29	65	0	0	0	0.012213	0	29	65				
GBAS	2631	broad.mit.edu	37	7	56045919	56045919	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:56045919C>G	ENST00000322090.3	+	2	222	c.193C>G	c.(193-195)Cta>Gta	p.L65V	GBAS_ENST00000446778.1_Missense_Mutation_p.L65V|GBAS_ENST00000487370.1_3'UTR	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	65					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTCCAATCTCCTAGCCAAAAA	0.398																																							uc003tre.1		NA																	0				central_nervous_system(1)	1						c.(193-195)CTA>GTA		nipsnap homolog 2							195.0	178.0	184.0					7																	56045919		2203	4300	6503	SO:0001583	missense	2631					integral to plasma membrane|membrane fraction|mitochondrion	protein binding	g.chr7:56045919C>G	AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.193C>G	7.37:g.56045919C>G	ENSP00000313050:p.Leu65Val		Somatic				GBAS_uc003trf.1_Missense_Mutation_p.L65V	p.L65V	NM_001483	NP_001474	WXS	Illumina HiSeq	Unspecified	O75323	NIPS2_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		2	201	+	Breast(14;0.214)		65					C9IYJ3|O43801|Q53X96	Missense_Mutation	SNP	ENST00000322090.3	37	c.193C>G	CCDS5521.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792413	0.90453	.	.	ENSG00000146729	ENST00000322090;ENST00000446778	T;D	0.84944	-0.15;-1.92	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.93485	0.7921	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.955	D	0.92835	0.6283	10	0.44086	T	0.13	-1.0025	19.0588	0.93078	0.0:1.0:0.0:0.0	.	65;65	C9IYJ3;O75323	.;NIPS2_HUMAN	V	65	ENSP00000313050:L65V;ENSP00000406855:L65V	ENSP00000313050:L65V	L	+	1	2	GBAS	56013413	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.402000	0.79972	2.744000	0.94065	0.655000	0.94253	CTA		0.398	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483		7	114	0	0	0	0.006214	0	7	114				
PCLO	27445	broad.mit.edu	37	7	82546079	82546079	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:82546079G>T	ENST00000333891.9	-	7	11560	c.11223C>A	c.(11221-11223)agC>agA	p.S3741R	PCLO_ENST00000423517.2_Missense_Mutation_p.S3741R|PCLO_ENST00000437081.1_Missense_Mutation_p.S461R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGCCCATTGTGCTGAATGTGG	0.468																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(11221-11223)AGC>AGA		piccolo isoform 1							138.0	122.0	127.0					7																	82546079		1878	4130	6008	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82546079G>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11223C>A	7.37:g.82546079G>T	ENSP00000334319:p.Ser3741Arg		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.S3741R|PCLO_uc010lec.2_Missense_Mutation_p.S706R	p.S3741R	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			7	11512	-			3672						Missense_Mutation	SNP	ENST00000333891.9	37	c.11223C>A	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802317	0.50315	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.18810	2.19;2.19	5.67	3.82	0.43975	.	.	.	.	.	T	0.18551	0.0445	L	0.59436	1.845	0.37982	D	0.933642	B;B;B	0.28850	0.007;0.225;0.225	B;B;B	0.26517	0.006;0.07;0.07	T	0.13150	-1.0520	9	0.87932	D	0	.	3.6955	0.08362	0.2257:0.0:0.4639:0.3104	.	3672;3741;3741	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	R	3741;3741;461	ENSP00000334319:S3741R;ENSP00000388393:S3741R	ENSP00000334319:S3741R	S	-	3	2	PCLO	82384015	1.000000	0.71417	0.893000	0.35052	0.970000	0.65996	1.913000	0.39956	0.724000	0.32296	0.558000	0.71614	AGC		0.468	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		9	77	1	0	0.000274275	0.004482	0.000305289	9	77				
CLDN12	9069	broad.mit.edu	37	7	90042108	90042108	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:90042108A>T	ENST00000287916.4	+	3	405	c.118A>T	c.(118-120)Aca>Tca	p.T40S	CTB-13L3.1_ENST00000480135.1_RNA|CLDN12_ENST00000535571.1_Missense_Mutation_p.T40S|CLDN12_ENST00000394605.2_Missense_Mutation_p.T40S	NM_001185073.2|NM_012129.4	NP_001172002.1|NP_036261.1	P56749	CLD12_HUMAN	claudin 12	40					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)	15						ACGATTGATCACATTCAACAG	0.517																																							uc003ukp.2		NA																	0					0						c.(118-120)ACA>TCA		claudin 12							104.0	93.0	97.0					7																	90042108		2203	4300	6503	SO:0001583	missense	9069				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr7:90042108A>T	AJ250713	CCDS5618.1	7q21	2008-07-18			ENSG00000157224	ENSG00000157224		"""Claudins"""	2034	protein-coding gene	gene with protein product		611232					Standard	NM_001185072		Approved		uc003ukr.3	P56749	OTTHUMG00000156612	ENST00000287916.4:c.118A>T	7.37:g.90042108A>T	ENSP00000287916:p.Thr40Ser		Somatic				CLDN12_uc003ukq.2_Missense_Mutation_p.T40S|CLDN12_uc010leq.2_Missense_Mutation_p.T40S|CLDN12_uc003ukr.2_Missense_Mutation_p.T40S|CLDN12_uc003uks.2_Missense_Mutation_p.T40S	p.T40S	NM_012129	NP_036261	WXS	Illumina HiSeq	Unspecified	P56749	CLD12_HUMAN			5	754	+			40			Extracellular (Potential).		D6W5Q4|Q7LDZ0	Missense_Mutation	SNP	ENST00000287916.4	37	c.118A>T	CCDS5618.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.253831	0.80135	.	.	ENSG00000157224	ENST00000422604;ENST00000416322;ENST00000496677;ENST00000287916;ENST00000535571;ENST00000394604;ENST00000394605;ENST00000427904	T;T;T;T;T;T;T	0.77620	-0.57;-0.8;-0.8;-0.8;-0.56;-0.8;-1.11	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.78604	0.4309	L	0.29908	0.895	0.80722	D	1	D	0.60575	0.988	D	0.75484	0.986	T	0.72887	-0.4156	10	0.06099	T	0.92	-13.4294	14.8561	0.70338	1.0:0.0:0.0:0.0	.	40	P56749	CLD12_HUMAN	S	40	ENSP00000411399:T40S;ENSP00000419053:T40S;ENSP00000287916:T40S;ENSP00000443476:T40S;ENSP00000378102:T40S;ENSP00000378103:T40S;ENSP00000391062:T40S	ENSP00000287916:T40S	T	+	1	0	CLDN12	89880044	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	8.390000	0.90175	2.110000	0.64415	0.459000	0.35465	ACA		0.517	CLDN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059221.1	NM_012129		4	43	0	0	0	0.009096	0	4	43				
CPSF4	10898	broad.mit.edu	37	7	99051639	99051639	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:99051639G>A	ENST00000292476.5	+	7	631	c.621G>A	c.(619-621)acG>acA	p.T207T	CPSF4_ENST00000441580.1_Intron|ATP5J2_ENST00000466753.1_Intron|CPSF4_ENST00000451876.1_Intron|ATP5J2-PTCD1_ENST00000437572.1_Intron|CPSF4_ENST00000471455.1_3'UTR|ATP5J2-PTCD1_ENST00000413834.1_Intron|PTCD1_ENST00000555673.1_Intron|CPSF4_ENST00000436336.2_Intron			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa	207					modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TCCAGTTAACGAGTCAGAACT	0.537																																							uc003uqj.2		NA																	0				central_nervous_system(1)	1						c.(619-621)ACG>ACA		cleavage and polyadenylation specific factor 4,							215.0	225.0	221.0					7																	99051639		2203	4300	6503	SO:0001819	synonymous_variant	10898				modification by virus of host mRNA processing|mRNA processing|viral infectious cycle	mRNA cleavage and polyadenylation specificity factor complex	RNA binding|zinc ion binding	g.chr7:99051639G>A		CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.621G>A	7.37:g.99051639G>A			Somatic				PTCD1_uc011kiw.1_Intron|CPSF4_uc003uqi.2_Intron|CPSF4_uc003uqk.2_Intron|CPSF4_uc011kix.1_Intron	p.T207T	NM_006693	NP_006684	WXS	Illumina HiSeq	Unspecified	O95639	CPSF4_HUMAN			7	764	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		207					D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Silent	SNP	ENST00000292476.5	37	c.621G>A	CCDS5664.1	.	.	.	.	.	.	.	.	.	.	G	8.462	0.855560	0.17106	.	.	ENSG00000160917	ENST00000440514	.	.	.	5.67	4.78	0.61160	.	.	.	.	.	T	0.60157	0.2247	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58329	-0.7655	4	.	.	.	-10.19	9.3729	0.38266	0.2165:0.0:0.7835:0.0	.	.	.	.	K	89	.	.	E	+	1	0	CPSF4	98889575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.397000	0.34543	1.393000	0.46605	0.655000	0.94253	GAG		0.537	CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336254.1			9	290	0	0	0	0.008291	0	9	290				
FOXP2	93986	broad.mit.edu	37	7	114270000	114270000	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:114270000G>A	ENST00000393494.2	+	5	816	c.537G>A	c.(535-537)caG>caA	p.Q179Q	FOXP2_ENST00000393491.3_Silent_p.Q87Q|FOXP2_ENST00000393498.2_Silent_p.Q159Q|FOXP2_ENST00000360232.4_Silent_p.Q179Q|FOXP2_ENST00000350908.4_Silent_p.Q179Q|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000408937.3_Silent_p.Q204Q|FOXP2_ENST00000393489.3_Silent_p.Q87Q|FOXP2_ENST00000393500.3_Silent_p.Q104Q|FOXP2_ENST00000378237.3_Silent_p.Q179Q|FOXP2_ENST00000403559.4_Silent_p.Q196Q|FOXP2_ENST00000390668.3_Silent_p.Q203Q			O15409	FOXP2_HUMAN	forkhead box P2	179	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q204Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						agcaacaacagcagcagcagc	0.498																																							uc003vhb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						c.(535-537)CAG>CAA		forkhead box P2 isoform I							41.0	38.0	39.0					7																	114270000		2199	4282	6481	SO:0001819	synonymous_variant	93986				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	g.chr7:114270000G>A	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.537G>A	7.37:g.114270000G>A			Somatic				FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.Q204Q|FOXP2_uc003vha.2_Silent_p.Q87Q|FOXP2_uc011kmu.1_Silent_p.Q196Q|FOXP2_uc011kmv.1_Silent_p.Q179Q|FOXP2_uc010ljz.1_Silent_p.Q87Q|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Silent_p.Q179Q|FOXP2_uc003vgx.2_Silent_p.Q179Q|FOXP2_uc003vhd.2_Silent_p.Q179Q|FOXP2_uc003vhc.2_Silent_p.Q204Q	p.Q179Q	NM_014491	NP_055306	WXS	Illumina HiSeq	Unspecified	O15409	FOXP2_HUMAN			5	911	+			179			Gln-rich.		A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	ENST00000393494.2	37	c.537G>A	CCDS5760.1																																																																																				0.498	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491		3	32	0	0	0	0.004672	0	3	32				
CFTR	1080	broad.mit.edu	37	7	117267754	117267754	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:117267754C>A	ENST00000003084.6	+	22	3779	c.3647C>A	c.(3646-3648)aCa>aAa	p.T1216K	CFTR_ENST00000454343.1_Missense_Mutation_p.T1155K|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1216	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	AAAGATCTCACAGCAAAATAC	0.423									Cystic Fibrosis																														uc003vjd.2		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)	5						c.(3646-3648)ACA>AAA		cystic fibrosis transmembrane conductance	Bumetanide(DB00887)|Glibenclamide(DB01016)						86.0	80.0	82.0					7																	117267754		2203	4300	6503	SO:0001583	missense	1080	Cystic_Fibrosis	Familial Cancer Database	CF	respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding	g.chr7:117267754C>A	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3647C>A	7.37:g.117267754C>A	ENSP00000003084:p.Thr1216Lys		Somatic				CFTR_uc011knq.1_Missense_Mutation_p.T622K	p.T1216K	NM_000492	NP_000483	WXS	Illumina HiSeq	Unspecified	P13569	CFTR_HUMAN	STAD - Stomach adenocarcinoma(10;0.000534)		22	3779	+	Lung NSC(10;0.00148)|all_lung(10;0.00171)		1216			Cytoplasmic (Potential).|ABC transporter 2.		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	c.3647C>A	CCDS5773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.00|15.00	2.704327|2.704327	0.48412|0.48412	.|.	.|.	ENSG00000001626|ENSG00000001626	ENST00000468795|ENST00000003084;ENST00000454343;ENST00000426809	.|D;D;D	.|0.90620	.|-2.7;-2.7;-2.7	5.86|5.86	5.86|5.86	0.93980|0.93980	.|ABC transporter-like (1);	.|0.089642	.|0.85682	.|D	.|0.000000	D|D	0.91324|0.91324	0.7264|0.7264	M|M	0.63208|0.63208	1.945|1.945	0.58432|0.58432	D|D	0.999998|0.999998	.|B	.|0.30634	.|0.288	.|B	.|0.37047	.|0.24	D|D	0.88407|0.88407	0.3019|0.3019	5|10	.|0.44086	.|T	.|0.13	-23.9156|-23.9156	20.5632|20.5632	0.99335|0.99335	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1216	.|P13569	.|CFTR_HUMAN	K|K	158|1216;1155;1186	.|ENSP00000003084:T1216K;ENSP00000403677:T1155K;ENSP00000389119:T1186K	.|ENSP00000003084:T1216K	Q|T	+|+	1|2	0|0	CFTR|CFTR	117054990|117054990	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.652000|0.652000	0.38707|0.38707	6.534000|6.534000	0.73833|0.73833	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CAG|ACA		0.423	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492		3	59	1	0	2.56e-06	0.009096	3.08966e-06	3	59				
TMEM139	135932	broad.mit.edu	37	7	142983074	142983074	+	Silent	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:142983074G>C	ENST00000359333.3	+	2	537	c.24G>C	c.(22-24)ggG>ggC	p.G8G	TMEM139_ENST00000409244.1_Silent_p.G8G|TMEM139_ENST00000409541.1_Silent_p.G8G|CASP2_ENST00000310447.5_5'Flank|TMEM139_ENST00000409102.1_Silent_p.G8G|AC073342.12_ENST00000446192.1_RNA|TMEM139_ENST00000471161.1_Intron|AC073342.12_ENST00000427392.1_RNA|TMEM139_ENST00000410004.1_Silent_p.G8G|CASP2_ENST00000392925.2_5'Flank	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	8						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					ACTTACTGGGGAGACTGGAGA	0.552																																							uc010lov.2		NA																	0					0						c.(22-24)GGG>GGC		transmembrane protein 139 precursor							98.0	89.0	92.0					7																	142983074		2203	4300	6503	SO:0001819	synonymous_variant	135932					integral to membrane		g.chr7:142983074G>C	AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.24G>C	7.37:g.142983074G>C			Somatic				CASP2_uc003wco.2_5'Flank|CASP2_uc003wcp.2_5'Flank|CASP2_uc011kta.1_5'Flank|TMEM139_uc003wck.3_Silent_p.G8G|TMEM139_uc003wcl.2_Silent_p.G8G|TMEM139_uc003wcm.2_Silent_p.G8G|TMEM139_uc003wcn.2_Intron	p.G8G	NM_153345	NP_699176	WXS	Illumina HiSeq	Unspecified	Q8IV31	TM139_HUMAN			3	163	+	Melanoma(164;0.059)		8					B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Silent	SNP	ENST00000359333.3	37	c.24G>C	CCDS5878.1																																																																																				0.552	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327145.1	NM_153345		8	54	0	0	0	0.00308	0	8	54				
CTAGE4	100128553	broad.mit.edu	37	7	143882715	143882715	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:143882715C>A	ENST00000486333.1	+	1	2157	c.2119C>A	c.(2119-2121)Cca>Aca	p.P707T		NM_198495.2	NP_940897.2	Q8IX94	CTGE4_HUMAN	CTAGE family, member 4	707	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(1)|ovary(2)	3						TCCATTGTTTCCAGTGGATAC	0.502																																							uc010lpc.2		NA																	0					0						c.(2119-2121)CCA>ACA		CTAGE family, member 4							12.0	14.0	13.0					7																	143882715		658	1506	2164	SO:0001583	missense	100128553					integral to membrane		g.chr7:143882715C>A	AF338232	CCDS55176.1	7q35	2009-10-15			ENSG00000225932	ENSG00000225932			24772	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 4"""	608910				12839582, 11149944	Standard	NM_198495		Approved	FLJ43692, cTAGE-4	uc010lpc.3	Q8IX94	OTTHUMG00000157997	ENST00000486333.1:c.2119C>A	7.37:g.143882715C>A	ENSP00000419539:p.Pro707Thr		Somatic					p.P707T	NM_198495	NP_940897	WXS	Illumina HiSeq	Unspecified	Q8IX94	CTGE4_HUMAN			1	2168	+			707			Pro-rich.		A8K871|O95046	Missense_Mutation	SNP	ENST00000486333.1	37	c.2119C>A	CCDS55176.1	.	.	.	.	.	.	.	.	.	.	.	7.876	0.729142	0.15507	.	.	ENSG00000225932	ENST00000486333	T	0.10763	2.84	.	.	.	.	.	.	.	.	T	0.30634	0.0771	M	0.87456	2.885	0.09310	N	1	D	0.65815	0.995	D	0.64410	0.925	T	0.05954	-1.0854	7	0.87932	D	0	.	.	.	.	.	707	Q8IX94	CTGE4_HUMAN	T	707	ENSP00000419539:P707T	ENSP00000419539:P707T	P	+	1	0	CTAGE4	143513648	0.968000	0.33430	0.018000	0.16275	0.018000	0.09664	2.109000	0.41863	0.172000	0.19760	0.175000	0.17021	CCA		0.502	CTAGE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349970.1	NM_198495		9	359	1	0	1.08611e-07	0.010729	1.35763e-07	9	359				
CNTNAP2	26047	broad.mit.edu	37	7	146536856	146536856	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:146536856G>C	ENST00000361727.3	+	3	778	c.262G>C	c.(262-264)Gac>Cac	p.D88H		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	88	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.D88N(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GCTTCAGGTTGACTTTGGCAA	0.483										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(262-264)GAC>CAC		cell recognition molecule Caspr2 precursor							91.0	79.0	83.0					7																	146536856		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146536856G>C	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.262G>C	7.37:g.146536856G>C	ENSP00000354778:p.Asp88His	HNSCC(39;0.1)	Somatic					p.D88H	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		3	778	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	88			F5/8 type C.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.262G>C	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190047	0.78789	.	.	ENSG00000174469	ENST00000361727	D	0.99167	-5.51	5.83	5.83	0.93111	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.56097	D	0.000023	D	0.99622	0.9862	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97772	1.0227	10	0.87932	D	0	.	18.6885	0.91574	0.0:0.0:1.0:0.0	.	88	Q9UHC6	CNTP2_HUMAN	H	88	ENSP00000354778:D88H	ENSP00000354778:D88H	D	+	1	0	CNTNAP2	146167789	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.781000	0.75068	2.760000	0.94817	0.650000	0.86243	GAC		0.483	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			10	48	0	0	0	0.010729	0	10	48				
ASB10	136371	broad.mit.edu	37	7	150883748	150883748	+	Splice_Site	SNP	T	T	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:150883748T>G	ENST00000420175.2	-	2	341		c.e2-2		ASB10_ENST00000434669.1_Splice_Site|ASB10_ENST00000377867.3_Splice_Site|ASB10_ENST00000422024.1_Splice_Site|ASB10_ENST00000275838.1_Splice_Site			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACCAGAGTCCTAGGGAGGGGA	0.652																																							uc003wjm.1		NA																	0					0						c.e2-1		ankyrin repeat and SOCS box-containing 10							14.0	16.0	15.0					7																	150883748		2201	4291	6492	SO:0001630	splice_region_variant	136371				intracellular signal transduction			g.chr7:150883748T>G	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.317-2A>C	7.37:g.150883748T>G			Somatic				ASB10_uc003wjl.1_Splice_Site_p.R151_splice|ASB10_uc003wjn.1_Splice_Site_p.G91_splice	p.R151_splice	NM_001142459	NP_001135931	WXS	Illumina HiSeq	Unspecified	Q8WXI3	ASB10_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	2	578	-								A0AVH0|Q6ZUL6	Splice_Site	SNP	ENST00000420175.2	37	c.452_splice	CCDS47750.2	.	.	.	.	.	.	.	.	.	.	T	12.14	1.848659	0.32699	.	.	ENSG00000146926	ENST00000275838;ENST00000377867;ENST00000422024;ENST00000434669;ENST00000420175	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7415	0.62852	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASB10	150514681	1.000000	0.71417	0.958000	0.39756	0.311000	0.27955	7.574000	0.82434	1.834000	0.53371	0.402000	0.26972	.		0.652	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	Intron	4	20	0	0	0	0.000602	0	4	20				
NCAPG2	54892	broad.mit.edu	37	7	158449054	158449054	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr7:158449054G>A	ENST00000409423.1	-	20	2458	c.2286C>T	c.(2284-2286)gtC>gtT	p.V762V	NCAPG2_ENST00000541468.1_Silent_p.V263V|NCAPG2_ENST00000409339.3_Silent_p.V762V|NCAPG2_ENST00000449727.2_Silent_p.V762V|NCAPG2_ENST00000275830.10_Silent_p.V554V|NCAPG2_ENST00000356309.3_Silent_p.V762V	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	762					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		ACTCAATGTAGACCAATGCCA	0.453																																							uc003wnv.1		NA																	0				ovary(1)|breast(1)|kidney(1)	3						c.(2284-2286)GTC>GTT		leucine zipper protein 5							158.0	163.0	161.0					7																	158449054		2014	4181	6195	SO:0001819	synonymous_variant	54892				cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding	g.chr7:158449054G>A	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.2286C>T	7.37:g.158449054G>A			Somatic				NCAPG2_uc010lqu.1_Silent_p.V554V|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Silent_p.V762V|NCAPG2_uc011kwe.1_Silent_p.V762V|NCAPG2_uc011kwc.1_Silent_p.V263V|NCAPG2_uc011kwd.1_Silent_p.V205V	p.V762V	NM_017760	NP_060230	WXS	Illumina HiSeq	Unspecified	Q86XI2	CNDG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)	19	2431	-	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	762					A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Silent	SNP	ENST00000409423.1	37	c.2286C>T	CCDS43686.1	.	.	.	.	.	.	.	.	.	.	G	9.714	1.157970	0.21454	.	.	ENSG00000146918	ENST00000441982	.	.	.	5.91	-10.1	0.00402	.	.	.	.	.	T	0.32436	0.0829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40590	-0.9555	4	.	.	.	-1.7588	2.0451	0.03559	0.2237:0.4009:0.1872:0.1881	.	.	.	.	F	564	.	.	S	-	2	0	NCAPG2	158141815	0.201000	0.23410	0.001000	0.08648	0.357000	0.29423	-0.109000	0.10840	-1.709000	0.01399	-0.302000	0.09304	TCT		0.453	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760		9	75	0	0	0	0.008291	0	9	75				
PLEKHA2	59339	broad.mit.edu	37	8	38810885	38810885	+	Splice_Site	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:38810885G>T	ENST00000420274.1	+	9	1007	c.773G>T	c.(772-774)gGt>gTt	p.G258V	PLEKHA2_ENST00000521746.1_Intron|PLEKHA2_ENST00000388745.4_3'UTR	NM_021623.1	NP_067636.1	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	258	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			GTCAAGTCTGGGTAATTGTGT	0.428																																							uc003xmi.3		NA																	0					0						c.(772-774)GGT>GTT		pleckstrin homology domain containing, family A							232.0	219.0	223.0					8																	38810885		1906	4124	6030	SO:0001630	splice_region_variant	59339				positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding	g.chr8:38810885G>T	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000420274.1:c.773+1G>T	8.37:g.38810885G>T			Somatic				PLEKHA2_uc011lce.1_Missense_Mutation_p.G208V	p.G258V	NM_021623	NP_067636	WXS	Illumina HiSeq	Unspecified	Q9HB19	PKHA2_HUMAN	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)		9	1007	+		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	258			PH 2.			Missense_Mutation	SNP	ENST00000420274.1	37	c.773G>T		.	.	.	.	.	.	.	.	.	.	G	23.2	4.384864	0.82792	.	.	ENSG00000169499	ENST00000420274;ENST00000535929	T	0.12879	2.64	5.56	5.56	0.83823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.30696	0.0773	L	0.46947	1.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00290	-1.1843	10	0.28530	T	0.3	.	16.7947	0.85598	0.0:0.0:1.0:0.0	.	258;258	Q9HB19;A8K727	PKHA2_HUMAN;.	V	258;208	ENSP00000393860:G258V	ENSP00000393860:G258V	G	+	2	0	PLEKHA2	38930042	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.830000	0.75319	2.778000	0.95560	0.655000	0.94253	GGT		0.428	PLEKHA2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021623	Missense_Mutation	12	141	1	0	1.05317e-09	0.00245	1.38807e-09	12	141				
IKBKB	3551	broad.mit.edu	37	8	42183567	42183567	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:42183567C>G	ENST00000520810.1	+	20	2252	c.2066C>G	c.(2065-2067)tCt>tGt	p.S689C	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.S687C|IKBKB_ENST00000379708.3_Missense_Mutation_p.S466C|IKBKB_ENST00000416505.2_Missense_Mutation_p.S630C	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	689					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CAGCTGATGTCTCAGCCCTCC	0.562																																							uc003xow.1		NA																	0				breast(3)|ovary(2)|lung(1)|skin(1)	7						c.(2065-2067)TCT>TGT		inhibitor of nuclear factor kappa B kinase beta	Arsenic trioxide(DB01169)|Auranofin(DB00995)						106.0	91.0	96.0					8																	42183567		2203	4300	6503	SO:0001583	missense	3551				anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity	g.chr8:42183567C>G	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.2066C>G	8.37:g.42183567C>G	ENSP00000430684:p.Ser689Cys		Somatic				IKBKB_uc010lxj.1_Missense_Mutation_p.S466C|IKBKB_uc003xox.1_Missense_Mutation_p.S410C|IKBKB_uc011lcp.1_RNA|IKBKB_uc011lcq.1_Missense_Mutation_p.S687C|IKBKB_uc010lxi.1_RNA|IKBKB_uc011lcr.1_Missense_Mutation_p.S630C	p.S689C	NM_001556	NP_001547	WXS	Illumina HiSeq	Unspecified	O14920	IKKB_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		20	2243	+	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	689					B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	c.2066C>G	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030206	0.54790	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.76709	-0.96;-1.04;-0.86;2.77	5.59	4.69	0.59074	.	0.378221	0.28187	N	0.016280	T	0.76169	0.3950	L	0.46157	1.445	0.37920	D	0.931672	D;B;P;D	0.60575	0.988;0.02;0.856;0.969	P;B;B;P	0.51866	0.635;0.031;0.299;0.682	T	0.79009	-0.1978	10	0.56958	D	0.05	-11.1794	8.4655	0.32953	0.0:0.7414:0.1496:0.1091	.	630;687;466;689	B4E0U4;O14920-2;B3KRB7;O14920	.;.;.;IKKB_HUMAN	C	689;630;687;466	ENSP00000430684:S689C;ENSP00000404920:S630C;ENSP00000430868:S687C;ENSP00000369030:S466C	ENSP00000369030:S466C	S	+	2	0	IKBKB	42302724	0.985000	0.35326	0.985000	0.45067	0.629000	0.37895	1.657000	0.37366	2.640000	0.89533	0.462000	0.41574	TCT		0.562	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1			27	29	0	0	0	0.005443	0	27	29				
NCOA2	10499	broad.mit.edu	37	8	71068640	71068640	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:71068640G>C	ENST00000452400.2	-	11	2141	c.1960C>G	c.(1960-1962)Ccc>Gcc	p.P654A	NCOA2_ENST00000524223.1_5'UTR	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	654					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AAGGGCGAGGGCTCCATCTGA	0.547			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																		uc003xyn.1		NA		Dom	yes		8	8q13.1	10499	T	nuclear receptor coactivator 2 (TIF2)			L	RUNXBP2		AML	PAX3/NCOA2(4)	0				lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16						c.(1960-1962)CCC>GCC		nuclear receptor coactivator 2							98.0	96.0	96.0					8																	71068640		1990	4171	6161	SO:0001583	missense	10499				cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity	g.chr8:71068640G>C	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1960C>G	8.37:g.71068640G>C	ENSP00000399968:p.Pro654Ala		Somatic					p.P654A	NM_006540	NP_006531	WXS	Illumina HiSeq	Unspecified	Q15596	NCOA2_HUMAN	Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)		11	2122	-	Breast(64;0.201)		654					Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	37	c.1960C>G	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590830	0.46214	.	.	ENSG00000140396	ENST00000452400	T	0.44482	0.92	5.77	5.77	0.91146	Steroid receptor coactivator (1);	0.000000	0.85682	D	0.000000	T	0.53546	0.1803	L	0.59436	1.845	0.80722	D	1	P	0.50369	0.934	P	0.50934	0.654	T	0.46190	-0.9209	10	0.38643	T	0.18	.	19.9981	0.97395	0.0:0.0:1.0:0.0	.	654	Q15596	NCOA2_HUMAN	A	654	ENSP00000399968:P654A	ENSP00000399968:P654A	P	-	1	0	NCOA2	71231194	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.159000	0.64923	2.729000	0.93468	0.655000	0.94253	CCC		0.547	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1			38	61	0	0	0	0.007835	0	38	61				
EYA1	2138	broad.mit.edu	37	8	72211347	72211347	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:72211347G>T	ENST00000340726.3	-	9	1400	c.761C>A	c.(760-762)gCc>gAc	p.A254D	EYA1_ENST00000388740.3_Missense_Mutation_p.A221D|EYA1_ENST00000388742.4_Missense_Mutation_p.A254D|EYA1_ENST00000388741.2_Missense_Mutation_p.A220D|EYA1_ENST00000303824.7_Missense_Mutation_p.A248D|EYA1_ENST00000419131.1_Missense_Mutation_p.A249D|EYA1_ENST00000388743.2_Missense_Mutation_p.A253D	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	254					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			CTGGTAAGTGGCATTGGTGGA	0.483																																							uc003xys.3		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5						c.(760-762)GCC>GAC		eyes absent 1 isoform b							289.0	240.0	257.0					8																	72211347		2203	4300	6503	SO:0001583	missense	2138				double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr8:72211347G>T	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.761C>A	8.37:g.72211347G>T	ENSP00000342626:p.Ala254Asp		Somatic				EYA1_uc003xyr.3_Missense_Mutation_p.A249D|EYA1_uc003xyt.3_Missense_Mutation_p.A221D|EYA1_uc010lzf.2_Missense_Mutation_p.A181D|EYA1_uc003xyu.2_Missense_Mutation_p.A254D|EYA1_uc011lfe.1_Missense_Mutation_p.A248D|EYA1_uc003xyv.2_Missense_Mutation_p.A132D	p.A254D	NM_172058	NP_742055	WXS	Illumina HiSeq	Unspecified	Q99502	EYA1_HUMAN	Epithelial(68;0.0837)|all cancers(69;0.247)		8	1048	-	Breast(64;0.046)		254					A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	c.761C>A	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768942	0.90020	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	5.33	5.33	0.75918	.	0.047543	0.85682	D	0.000000	D	0.84465	0.5478	L	0.39898	1.24	0.80722	D	1	P;P;P;P;B	0.42620	0.785;0.609;0.609;0.785;0.38	P;B;B;P;B	0.45276	0.475;0.425;0.425;0.475;0.425	D	0.85812	0.1380	10	0.62326	D	0.03	-11.4965	19.38	0.94529	0.0:0.0:1.0:0.0	.	248;181;221;254;249	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	D	254;254;222;221;248;220;253;249	ENSP00000373394:A254D;ENSP00000342626:A254D;ENSP00000373392:A221D;ENSP00000303221:A248D;ENSP00000373393:A220D;ENSP00000373395:A253D;ENSP00000410176:A249D	ENSP00000303221:A248D	A	-	2	0	EYA1	72373901	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.420000	0.97426	2.654000	0.90174	0.585000	0.79938	GCC		0.483	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		10	232	1	0	4.36969e-10	0.001855	5.93298e-10	10	232				
HNF4G	3174	broad.mit.edu	37	8	76470800	76470800	+	Missense_Mutation	SNP	C	C	T	rs201625743		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:76470800C>T	ENST00000354370.1	+	8	910	c.640C>T	c.(640-642)Cgt>Tgt	p.R214C	HNF4G_ENST00000396423.2_Missense_Mutation_p.R251C			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	214					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			TGAGATTAGCCGTGTGGCCAA	0.378																																							uc003yaq.2		NA																	0				ovary(1)	1						c.(640-642)CGT>TGT		hepatocyte nuclear factor 4, gamma		C	CYS/ARG	0,4406		0,0,2203	160.0	157.0	158.0		751	5.9	1.0	8		158	2,8598	2.2+/-6.3	0,2,4298	yes	missense	HNF4G	NM_004133.4	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	251/446	76470800	2,13004	2203	4300	6503	SO:0001583	missense	3174				endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr8:76470800C>T		CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.640C>T	8.37:g.76470800C>T	ENSP00000346339:p.Arg214Cys		Somatic				HNF4G_uc003yar.2_Missense_Mutation_p.R251C	p.R214C	NM_004133	NP_004124	WXS	Illumina HiSeq	Unspecified	Q14541	HNF4G_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.161)		8	910	+	Breast(64;0.0448)		214					Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	ENST00000354370.1	37	c.640C>T		.	.	.	.	.	.	.	.	.	.	C	23.0	4.367007	0.82463	0.0	2.33E-4	ENSG00000164749	ENST00000354370;ENST00000396423	D;D	0.96685	-4.09;-4.09	5.92	5.92	0.95590	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.045200	0.85682	D	0.000000	D	0.98544	0.9514	M	0.91612	3.225	0.80722	D	1	P;D	0.76494	0.879;0.999	B;D	0.66716	0.341;0.946	D	0.98971	1.0801	10	0.87932	D	0	.	20.3206	0.98668	0.0:1.0:0.0:0.0	.	251;214	F1D8Q4;Q14541	.;HNF4G_HUMAN	C	214;251	ENSP00000346339:R214C;ENSP00000379701:R251C	ENSP00000346339:R214C	R	+	1	0	HNF4G	76633355	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.538000	0.60650	2.809000	0.96659	0.655000	0.94253	CGT		0.378	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133		23	757	0	0	0	0.00333	0	23	757				
ADCY8	114	broad.mit.edu	37	8	131792846	131792846	+	Silent	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:131792846G>T	ENST00000286355.5	-	18	5638	c.3546C>A	c.(3544-3546)ccC>ccA	p.P1182P	ADCY8_ENST00000377928.3_Silent_p.P1051P	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1182					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GTCTTCTTGGGGGCAAGATGA	0.512										HNSCC(32;0.087)																													uc003ytd.3		NA																	0				skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(3544-3546)CCC>CCA		adenylate cyclase 8							160.0	169.0	166.0					8																	131792846		2203	4300	6503	SO:0001819	synonymous_variant	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:131792846G>T	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3546C>A	8.37:g.131792846G>T		HNSCC(32;0.087)	Somatic				ADCY8_uc010mds.2_Silent_p.P1051P	p.P1182P	NM_001115	NP_001106	WXS	Illumina HiSeq	Unspecified	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		18	3802	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		1182			Cytoplasmic (Potential).			Silent	SNP	ENST00000286355.5	37	c.3546C>A	CCDS6363.1																																																																																				0.512	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			6	133	1	0	3.59834e-05	0.001168	4.19806e-05	6	133				
EPPK1	83481	broad.mit.edu	37	8	144946569	144946569	+	Missense_Mutation	SNP	C	C	T	rs370774174		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr8:144946569C>T	ENST00000525985.1	-	2	924	c.853G>A	c.(853-855)Ggc>Agc	p.G285S				P58107	EPIPL_HUMAN	epiplakin 1	285						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCACGCTGCCGGTACCCTCC	0.682																																							uc003zaa.1		NA																	0				pancreas(1)|skin(1)	2						c.(853-855)GGC>AGC		epiplakin 1		C	SER/GLY	1,4301		0,1,2150	21.0	27.0	25.0		853	3.0	0.0	8		25	0,8450		0,0,4225	no	missense	EPPK1	NM_031308.1	56	0,1,6375	TT,TC,CC		0.0,0.0232,0.0078	probably-damaging	285/2420	144946569	1,12751	2151	4225	6376	SO:0001583	missense	83481					cytoplasm|cytoskeleton	protein binding|structural molecule activity	g.chr8:144946569C>T	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.853G>A	8.37:g.144946569C>T	ENSP00000436337:p.Gly285Ser		Somatic					p.G285S	NM_031308	NP_112598	WXS	Illumina HiSeq	Unspecified	P58107	EPIPL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		1	866	-	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		285			Plectin 6.		Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37	c.853G>A		.	.	.	.	.	.	.	.	.	.	C	4.747	0.138911	0.09083	2.32E-4	0.0	ENSG00000227184	ENST00000525985	T	0.68765	-0.35	4.81	3.01	0.34805	.	.	.	.	.	T	0.31263	0.0791	N	0.04018	-0.295	0.09310	N	1	P	0.42248	0.774	B	0.29176	0.099	T	0.30650	-0.9971	9	0.02654	T	1	.	8.7852	0.34816	0.0:0.8152:0.0:0.1848	.	285	E9PPU0	.	S	285	ENSP00000436337:G285S	ENSP00000436337:G285S	G	-	1	0	EPPK1	145018557	0.000000	0.05858	0.013000	0.15412	0.169000	0.22640	-0.209000	0.09358	0.627000	0.30340	0.511000	0.50034	GGC		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		5	68	0	0	0	0.000602	0	5	68				
KANK1	23189	broad.mit.edu	37	9	732477	732477	+	Silent	SNP	G	G	A	rs569686873|rs370051574		TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:732477G>A	ENST00000382303.1	+	10	3757	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	KANK1_ENST00000382297.2_Silent_p.E1035E|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Silent_p.E877E	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1035					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGAAGAAGAGGAGGAGGAGG	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.0		0.0	False		,,,				2504	0.001						uc003zgl.1		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(3103-3105)GAG>GAA		KN motif and ankyrin repeat domains 1 isoform a							153.0	134.0	140.0					9																	732477		2203	4300	6503	SO:0001819	synonymous_variant	23189				negative regulation of actin filament polymerization	cytoplasm		g.chr9:732477G>A	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3105G>A	9.37:g.732477G>A			Somatic				KANK1_uc003zgm.2_3'UTR|KANK1_uc003zgn.1_Silent_p.E1035E|KANK1_uc003zgs.1_Silent_p.E877E|KANK1_uc010mgx.1_5'UTR|KANK1_uc010mgy.1_5'UTR|KANK1_uc003zgt.1_5'Flank	p.E1035E	NM_015158	NP_055973	WXS	Illumina HiSeq	Unspecified	Q14678	KANK1_HUMAN		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)	10	3754	+		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)	1035					A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	c.3105G>A	CCDS34976.1																																																																																				0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158		4	117	0	0	0	0.000602	0	4	117				
BNC2	54796	broad.mit.edu	37	9	16738407	16738407	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:16738407G>T	ENST00000380672.4	-	2	137	c.80C>A	c.(79-81)cCa>cAa	p.P27Q	BNC2_ENST00000380667.2_Missense_Mutation_p.P27Q|BNC2_ENST00000380666.2_Missense_Mutation_p.P27Q|BNC2_ENST00000545497.1_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GAAATATGCTGGCCAGTCTTG	0.443																																							uc003zml.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(79-81)CCA>CAA		basonuclin 2							179.0	146.0	158.0					9																	16738407		2203	4300	6503	SO:0001583	missense	54796				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding	g.chr9:16738407G>T	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.80C>A	9.37:g.16738407G>T	ENSP00000370047:p.Pro27Gln		Somatic				BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Missense_Mutation_p.P41Q|BNC2_uc003zmr.1_Missense_Mutation_p.P27Q|BNC2_uc003zmp.1_Missense_Mutation_p.P27Q|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_RNA|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron	p.P27Q	NM_017637	NP_060107	WXS	Illumina HiSeq	Unspecified	Q6ZN30	BNC2_HUMAN		GBM - Glioblastoma multiforme(50;9.01e-08)	2	220	-			27						Missense_Mutation	SNP	ENST00000380672.4	37	c.80C>A	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	G	8.563	0.878315	0.17395	.	.	ENSG00000173068	ENST00000380672;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000380666;ENST00000540340	T;T;T	0.03094	4.05;4.05;4.05	3.85	-1.44	0.08856	.	0.702639	0.11666	N	0.541373	T	0.01661	0.0053	N	0.08118	0	0.18873	N	0.999983	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.10450	0.005;0.0;0.0	T	0.48592	-0.9022	10	0.07325	T	0.83	-1.091	6.8491	0.24005	0.0:0.1057:0.5797:0.3146	.	27;27;27	Q06HC4;Q6ZN30-2;Q6ZN30	.;.;BNC2_HUMAN	Q	27	ENSP00000370047:P27Q;ENSP00000370042:P27Q;ENSP00000370041:P27Q	ENSP00000370041:P27Q	P	-	2	0	BNC2	16728407	0.000000	0.05858	0.715000	0.30552	0.798000	0.45092	-0.048000	0.11944	-0.243000	0.09653	-0.503000	0.04515	CCA		0.443	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637		6	40	1	0	0.00116845	0.001168	0.00128692	6	40				
RPS6	6194	broad.mit.edu	37	9	19379600	19379600	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:19379600G>A	ENST00000380394.4	-	2	81	c.23C>T	c.(22-24)cCa>cTa	p.P8L	RPS6_ENST00000380384.1_5'UTR|RPS6_ENST00000498815.1_5'Flank|RPS6_ENST00000380381.3_Missense_Mutation_p.P8L|RPS6_ENST00000315377.4_5'UTR	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	8					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		GCCAGTGGCTGGGAAGGAGAT	0.443																																							uc003znv.1		NA																	0				ovary(1)	1						c.(22-24)CCA>CTA		ribosomal protein S6							72.0	69.0	70.0					9																	19379600		2203	4300	6503	SO:0001583	missense	6194				endocrine pancreas development|glucose homeostasis|insulin receptor signaling pathway|positive regulation of apoptosis|rRNA processing|TOR signaling cascade|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding	g.chr9:19379600G>A		CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.23C>T	9.37:g.19379600G>A	ENSP00000369757:p.Pro8Leu		Somatic				RPS6_uc003znu.1_5'UTR|RPS6_uc003znw.1_5'UTR	p.P8L	NM_001010	NP_001001	WXS	Illumina HiSeq	Unspecified	P62753	RS6_HUMAN		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)	2	65	-		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)	8					P08227|P10660|Q4VBY7|Q8N6Z7	Missense_Mutation	SNP	ENST00000380394.4	37	c.23C>T	CCDS6492.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.903953	0.92035	.	.	ENSG00000137154	ENST00000380394;ENST00000380381	T	0.64260	-0.09	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.78201	0.4246	H	0.95539	3.685	0.80722	D	1	P	0.42735	0.788	P	0.44394	0.448	D	0.85164	0.0994	9	.	.	.	-12.1179	18.5432	0.91037	0.0:0.0:1.0:0.0	.	8	P62753	RS6_HUMAN	L	8	ENSP00000369757:P8L	.	P	-	2	0	RPS6	19369600	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.529000	0.98049	2.687000	0.91594	0.462000	0.41574	CCA		0.443	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051858.1	NM_001010		5	118	0	0	0	0.00308	0	5	118				
IFNB1	3456	broad.mit.edu	37	9	21077496	21077496	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:21077496C>A	ENST00000380232.2	-	1	447	c.373G>T	c.(373-375)Gaa>Taa	p.E125*		NM_002176.2	NP_002167.1	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast	125					adaptive immune response (GO:0002250)|B cell activation involved in immune response (GO:0002312)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of viral genome replication (GO:0045071)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	12				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)		TCCAGTTTTTCTTCCAGGACT	0.433																																							uc003zok.2		NA																	0				ovary(1)|breast(1)|kidney(1)	3						c.(373-375)GAA>TAA		interferon, beta 1, fibroblast precursor	Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)						184.0	189.0	187.0					9																	21077496		2203	4300	6503	SO:0001587	stop_gained	3456				activation of caspase activity|B cell proliferation|blood coagulation|cellular response to exogenous dsRNA|defense response to virus|induction of apoptosis|natural killer cell activation|negative regulation of cell proliferation|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of viral genome replication|negative regulation of viral transcription|negative regulation of virion penetration into host cell|positive regulation of innate immune response|positive regulation of transcription from RNA polymerase II promoter|regulation of MHC class I biosynthetic process|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding|transcription corepressor activity	g.chr9:21077496C>A		CCDS6495.1	9p22	2008-07-21			ENSG00000171855	ENSG00000171855		"""Interferons"""	5434	protein-coding gene	gene with protein product		147640		IFNB			Standard	NM_002176		Approved	IFB, IFF	uc003zok.3	P01574	OTTHUMG00000019652	ENST00000380232.2:c.373G>T	9.37:g.21077496C>A	ENSP00000369581:p.Glu125*		Somatic					p.E125*	NM_002176	NP_002167	WXS	Illumina HiSeq	Unspecified	P01574	IFNB_HUMAN		GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)	1	448	-			125					Q5VWC9	Nonsense_Mutation	SNP	ENST00000380232.2	37	c.373G>T	CCDS6495.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065508	0.55539	.	.	ENSG00000171855	ENST00000380232	.	.	.	5.32	3.42	0.39159	.	0.580602	0.19295	N	0.117798	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.0756	8.2079	0.31467	0.0:0.8065:0.0:0.1935	.	.	.	.	X	125	.	ENSP00000369581:E125X	E	-	1	0	IFNB1	21067496	0.003000	0.15002	0.001000	0.08648	0.015000	0.08874	0.488000	0.22371	0.756000	0.33013	0.650000	0.86243	GAA		0.433	IFNB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051881.1	NM_002176		47	156	1	0	5.82388e-19	0.01441	8.37682e-19	47	156				
C9orf24	84688	broad.mit.edu	37	9	34379708	34379708	+	Missense_Mutation	SNP	G	G	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:34379708G>C	ENST00000297623.2	-	6	923	c.725C>G	c.(724-726)cCg>cGg	p.P242R	C9orf24_ENST00000379127.1_Missense_Mutation_p.R109G|C9orf24_ENST00000379124.1_Missense_Mutation_p.R109G|C9orf24_ENST00000481295.1_5'UTR|KIAA1161_ENST00000297625.7_5'Flank|C9orf24_ENST00000379133.3_Missense_Mutation_p.P107R|C9orf24_ENST00000379126.3_Missense_Mutation_p.R56G	NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	242					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		ATTCCGGGCCGGTGCTCGTAG	0.567											OREG0019150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003zuh.1		NA																	0				ovary(1)	1						c.(724-726)CCG>CGG		testes development-related NYD-SP22 isoform 1							111.0	101.0	104.0					9																	34379708		2203	4300	6503	SO:0001583	missense	84688							g.chr9:34379708G>C	BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.725C>G	9.37:g.34379708G>C	ENSP00000297623:p.Pro242Arg		Somatic	OREG0019150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	847	KIAA1161_uc003zue.3_5'Flank|C9orf24_uc003zug.1_Missense_Mutation_p.P107R|C9orf24_uc003zuf.1_Missense_Mutation_p.R56G|C9orf24_uc003zui.1_3'UTR	p.P242R	NM_032596	NP_115985	WXS	Illumina HiSeq	Unspecified	Q8NCR6	CI024_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)	6	943	-			242					Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Missense_Mutation	SNP	ENST00000297623.2	37	c.725C>G	CCDS6554.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.24|17.24	3.339465|3.339465	0.60963|0.60963	.|.	.|.	ENSG00000164972|ENSG00000164972	ENST00000297623;ENST00000379133|ENST00000379126;ENST00000379127;ENST00000379112;ENST00000379124	T;T|T;T;T	0.41400|0.53857	1.0;1.0|0.6;0.71;0.71	4.73|4.73	1.56|1.56	0.23342|0.23342	.|.	1.600770|.	0.03689|.	N|.	0.246757|.	T|T	0.64616|0.64616	0.2614|0.2614	.|.	.|.	.|.	0.21256|0.21256	N|N	0.999743|0.999743	D|D	0.58970|0.59767	0.984|0.986	P|P	0.52672|0.60068	0.706|0.868	T|T	0.54866|0.54866	-0.8229|-0.8229	9|8	0.72032|0.66056	D|D	0.01|0.02	-5.5066|-5.5066	10.9173|10.9173	0.47144|0.47144	0.0:0.0:0.413:0.587|0.0:0.0:0.413:0.587	.|.	242|56	Q8NCR6|Q8NCR6-3	CI024_HUMAN|.	R|G	242;107|56;109;39;109	ENSP00000297623:P242R;ENSP00000368428:P107R|ENSP00000368421:R56G;ENSP00000368422:R109G;ENSP00000368419:R109G	ENSP00000297623:P242R|ENSP00000368407:R39G	P|R	-|-	2|1	0|2	C9orf24|C9orf24	34369708|34369708	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.743000|0.743000	0.42351|0.42351	2.218000|2.218000	0.42889|0.42889	0.677000|0.677000	0.31305|0.31305	-0.310000|-0.310000	0.09108|0.09108	CCG|CGG		0.567	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001098.3	NM_147169		6	96	0	0	0	0.004482	0	6	96				
UBQLN1	29979	broad.mit.edu	37	9	86294696	86294696	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:86294696C>T	ENST00000376395.4	-	4	1228	c.705G>A	c.(703-705)atG>atA	p.M235I	UBQLN1_ENST00000257468.7_Missense_Mutation_p.M235I	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	235					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						ATACTTGTCTCATTATATCTG	0.323																																					Melanoma(186;1284 2073 12755 14558 18426)	Melanoma(186;1284 2073 12755 14558 18426)	uc004amv.2		NA																	0					0						c.(703-705)ATG>ATA		ubiquilin 1 isoform 1							73.0	74.0	73.0					9																	86294696		2203	4300	6503	SO:0001583	missense	29979				apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding	g.chr9:86294696C>T	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.705G>A	9.37:g.86294696C>T	ENSP00000365576:p.Met235Ile		Somatic				UBQLN1_uc004amw.2_Missense_Mutation_p.M235I	p.M235I	NM_013438	NP_038466	WXS	Illumina HiSeq	Unspecified	Q9UMX0	UBQL1_HUMAN			4	1279	-			235					Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Missense_Mutation	SNP	ENST00000376395.4	37	c.705G>A	CCDS6663.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.712042	0.68730	.	.	ENSG00000135018	ENST00000376395;ENST00000257468	T;T	0.28069	1.63;1.63	5.37	5.37	0.77165	Heat shock chaperonin-binding (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.39436	0.1078	L	0.42632	1.34	0.54753	D	0.999984	P;P	0.45531	0.562;0.86	P;B	0.49829	0.623;0.426	T	0.03555	-1.1025	10	0.32370	T	0.25	.	19.132	0.93412	0.0:1.0:0.0:0.0	.	235;235	Q9UMX0-2;Q9UMX0	.;UBQL1_HUMAN	I	235	ENSP00000365576:M235I;ENSP00000257468:M235I	ENSP00000257468:M235I	M	-	3	0	UBQLN1	85484516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.905000	0.69893	2.510000	0.84645	0.650000	0.86243	ATG		0.323	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438		11	54	0	0	0	0.008291	0	11	54				
SPATA31C1	441452	broad.mit.edu	37	9	90535394	90535394	+	RNA	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:90535394C>T	ENST00000602681.1	+	0	1298							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACCTCAGTCTCCTCCCTAAGT	0.612																																							uc010mqi.2		NA																	0					0						c.(571-573)TCC>TTC		family with sequence similarity 75, member C1							23.0	28.0	27.0					9																	90535394		692	1590	2282			441452							g.chr9:90535394C>T	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90535394C>T			Somatic				FAM75C1_uc004apq.3_Missense_Mutation_p.S174F	p.S191F	NM_001145124	NP_001138596	WXS	Illumina HiSeq	Unspecified					4	601	+									Missense_Mutation	SNP	ENST00000602681.1	37	c.572C>T																																																																																					0.612	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124		21	193	0	0	0	0.010818	0	21	193				
ECM2	1842	broad.mit.edu	37	9	95264875	95264875	+	Silent	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:95264875G>A	ENST00000344604.5	-	8	1673	c.1524C>T	c.(1522-1524)acC>acT	p.T508T	ECM2_ENST00000444490.2_Silent_p.T486T|CENPP_ENST00000375587.3_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	508					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.T486T(1)|p.T508T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						TGATCTTTCTGGTATGATTGA	0.274																																							uc004ash.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(1522-1524)ACC>ACT		extracellular matrix protein 2 precursor							124.0	123.0	123.0					9																	95264875		2202	4300	6502	SO:0001819	synonymous_variant	1842				cell-matrix adhesion		integrin binding	g.chr9:95264875G>A	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1524C>T	9.37:g.95264875G>A			Somatic				CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Silent_p.T486T|ECM2_uc011lty.1_Silent_p.T508T|ECM2_uc004asg.2_Silent_p.T486T|ECM2_uc010mqz.1_Intron	p.T508T	NM_001393	NP_001384	WXS	Illumina HiSeq	Unspecified	O94769	ECM2_HUMAN			8	1589	-			508					B2R730|E2PU11|Q5T9F2|Q7Z3D0	Silent	SNP	ENST00000344604.5	37	c.1524C>T	CCDS6698.1																																																																																				0.274	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393		6	25	0	0	0	0.001168	0	6	25				
PTCH1	5727	broad.mit.edu	37	9	98220516	98220516	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:98220516C>T	ENST00000331920.6	-	18	3246	c.2947G>A	c.(2947-2949)Gac>Aac	p.D983N	PTCH1_ENST00000437951.1_Missense_Mutation_p.D917N|PTCH1_ENST00000418258.1_Missense_Mutation_p.D832N|PTCH1_ENST00000429896.2_Missense_Mutation_p.D832N|PTCH1_ENST00000421141.1_Missense_Mutation_p.D832N|PTCH1_ENST00000430669.2_Missense_Mutation_p.D917N|PTCH1_ENST00000375274.2_Missense_Mutation_p.D982N	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	983					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.I963fs*2(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TCTGAGGTGTCCCGCAAGCCG	0.567																																							uc004avk.3		NA																	1	Deletion - Frameshift(1)	p.I963fs*2(1)	central_nervous_system(1)	skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379						c.(2947-2949)GAC>AAC		patched isoform L							45.0	39.0	41.0					9																	98220516		2203	4300	6503	SO:0001583	missense	5727	Basal_Cell_Nevus_syndrome			embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	g.chr9:98220516C>T	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2947G>A	9.37:g.98220516C>T	ENSP00000332353:p.Asp983Asn		Somatic				PTCH1_uc010mro.2_Missense_Mutation_p.D832N|PTCH1_uc010mrp.2_Missense_Mutation_p.D832N|PTCH1_uc010mrq.2_Missense_Mutation_p.D832N|PTCH1_uc004avl.3_Missense_Mutation_p.D832N|PTCH1_uc010mrr.2_Missense_Mutation_p.D917N|PTCH1_uc004avm.3_Missense_Mutation_p.D982N	p.D983N	NM_000264	NP_000255	WXS	Illumina HiSeq	Unspecified	Q13635	PTC1_HUMAN			18	3135	-		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)	983			Extracellular (Potential).		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	c.2947G>A	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780259	0.70222	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	5.21	5.21	0.72293	.	0.044405	0.85682	D	0.000000	T	0.77837	0.4190	N	0.17764	0.52	0.80722	D	1	B;B;B	0.19073	0.006;0.032;0.033	B;B;B	0.26094	0.009;0.066;0.043	T	0.70270	-0.4918	10	0.18276	T	0.48	-39.8501	19.314	0.94204	0.0:1.0:0.0:0.0	.	917;982;983	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	N	983;917;832;832;419;917;832;982	ENSP00000332353:D983N;ENSP00000389744:D917N;ENSP00000399981:D832N;ENSP00000396135:D832N;ENSP00000410287:D917N;ENSP00000414823:D832N;ENSP00000364423:D982N	ENSP00000332353:D983N	D	-	1	0	PTCH1	97260337	0.997000	0.39634	0.983000	0.44433	0.881000	0.50899	3.644000	0.54381	2.873000	0.98535	0.561000	0.74099	GAC		0.567	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		5	22	0	0	0	0.000602	0	5	22				
NCBP1	4686	broad.mit.edu	37	9	100433388	100433388	+	Missense_Mutation	SNP	G	G	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:100433388G>T	ENST00000375147.3	+	23	2536	c.2280G>T	c.(2278-2280)caG>caT	p.Q760H		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	760					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				TAATCCAGCAGTACATGGTGA	0.483																																					Ovarian(36;879 898 2893 44212 50307)	Ovarian(36;879 898 2893 44212 50307)	uc004axq.2		NA																	0				central_nervous_system(1)	1						c.(2278-2280)CAG>CAT		nuclear cap binding protein subunit 1, 80kDa							156.0	139.0	145.0					9																	100433388		2203	4300	6503	SO:0001583	missense	4686				gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA cleavage|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of mRNA 3'-end processing|positive regulation of viral transcription|regulation of translational initiation|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm|ribonucleoprotein complex	protein binding|RNA cap binding	g.chr9:100433388G>T	BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.2280G>T	9.37:g.100433388G>T	ENSP00000364289:p.Gln760His		Somatic					p.Q760H	NM_002486	NP_002477	WXS	Illumina HiSeq	Unspecified	Q09161	NCBP1_HUMAN			23	2739	+		Acute lymphoblastic leukemia(62;0.158)	760					B2R718|Q59G76|Q5T1V0|Q5T7X2	Missense_Mutation	SNP	ENST00000375147.3	37	c.2280G>T	CCDS6728.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213505	0.79352	.	.	ENSG00000136937	ENST00000375147	.	.	.	5.33	3.51	0.40186	Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.47581	0.1453	L	0.36672	1.1	0.80722	D	1	D	0.57257	0.979	P	0.47981	0.563	T	0.46091	-0.9216	9	0.56958	D	0.05	-14.863	11.1285	0.48333	0.1531:0.0:0.8469:0.0	.	760	Q09161	NCBP1_HUMAN	H	760	.	ENSP00000364289:Q760H	Q	+	3	2	NCBP1	99473209	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.106000	0.50322	0.760000	0.33108	0.655000	0.94253	CAG		0.483	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486		9	72	1	0	1.61879e-10	0.013537	2.20744e-10	9	72				
TBC1D2	55357	broad.mit.edu	37	9	101014085	101014085	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:101014085C>T	ENST00000375064.1	-	2	531	c.493G>A	c.(493-495)Gtc>Atc	p.V165I	TBC1D2_ENST00000375066.5_Missense_Mutation_p.V165I|TBC1D2_ENST00000342112.5_Intron	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	165	Interaction with CADH1.				positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		AGGTGCAGGACGGGCCCATTC	0.637																																							uc011lvb.1		NA																	0				ovary(3)	3						c.(493-495)GTC>ATC		TBC1 domain family, member 2							64.0	56.0	59.0					9																	101014085		2203	4300	6503	SO:0001583	missense	55357					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity	g.chr9:101014085C>T	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.493G>A	9.37:g.101014085C>T	ENSP00000364205:p.Val165Ile		Somatic				TBC1D2_uc004ayq.2_Missense_Mutation_p.V165I|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Missense_Mutation_p.V165I	p.V165I	NM_018421	NP_060891	WXS	Illumina HiSeq	Unspecified	Q9BYX2	TBD2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)	2	673	-		Myeloproliferative disorder(762;0.0255)	165			Interaction with CADH1.		B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	ENST00000375064.1	37	c.493G>A		.	.	.	.	.	.	.	.	.	.	C	8.954	0.968930	0.18659	.	.	ENSG00000095383	ENST00000375064;ENST00000375066	T;T	0.08807	3.35;3.05	5.22	-0.207	0.13189	.	1.033580	0.07637	N	0.929650	T	0.04003	0.0112	N	0.08118	0	0.26473	N	0.975249	B;B	0.19200	0.034;0.023	B;B	0.17098	0.011;0.017	T	0.46414	-0.9193	10	0.25751	T	0.34	.	4.7358	0.12988	0.0:0.3797:0.2027:0.4176	.	165;165	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	I	165	ENSP00000364205:V165I;ENSP00000364207:V165I	ENSP00000364205:V165I	V	-	1	0	TBC1D2	100053906	0.000000	0.05858	0.113000	0.21522	0.073000	0.16967	-1.286000	0.02788	-0.029000	0.13827	-0.680000	0.03767	GTC		0.637	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421		31	48	0	0	0	0.012213	0	31	48				
OR13C9	286362	broad.mit.edu	37	9	107380196	107380196	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:107380196C>G	ENST00000259362.1	-	1	289	c.290G>C	c.(289-291)tGt>tCt	p.C97S		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						CTGCACTGCACAGCCAGAAAA	0.517																																							uc011lvr.1		NA																	0					0						c.(289-291)TGT>TCT		olfactory receptor, family 13, subfamily C,							122.0	134.0	130.0					9																	107380196		2203	4300	6503	SO:0001583	missense	286362				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107380196C>G		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.290G>C	9.37:g.107380196C>G	ENSP00000259362:p.Cys97Ser		Somatic					p.C97S	NM_001001956	NP_001001956	WXS	Illumina HiSeq	Unspecified	Q8NGT0	O13C9_HUMAN			1	290	-			97			Extracellular (Potential).		Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	c.290G>C	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982162	0.74474	.	.	ENSG00000136839	ENST00000259362	T	0.00540	6.7	4.64	4.64	0.57946	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000048	T	0.04952	0.0133	H	0.98446	4.235	0.43218	D	0.995094	D	0.89917	1.0	D	0.74674	0.984	T	0.01093	-1.1454	10	0.87932	D	0	.	15.0493	0.71854	0.0:1.0:0.0:0.0	.	97	Q8NGT0	O13C9_HUMAN	S	97	ENSP00000259362:C97S	ENSP00000259362:C97S	C	-	2	0	OR13C9	106420017	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.566000	0.67372	2.393000	0.81446	0.637000	0.83480	TGT		0.517	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1			19	111	0	0	0	0.008871	0	19	111				
ADAMTS13	11093	broad.mit.edu	37	9	136310829	136310829	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:136310829A>G	ENST00000371929.3	+	21	3064	c.2620A>G	c.(2620-2622)Acc>Gcc	p.T874A	ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.T874A|ADAMTS13_ENST00000536611.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.T843A	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	874					cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCTGGATGCCACCTCTGCAGG	0.647																																							uc004cdv.3		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(2620-2622)ACC>GCC		ADAM metallopeptidase with thrombospondin type 1							41.0	38.0	39.0					9																	136310829		2203	4300	6503	SO:0001583	missense	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136310829A>G	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2620A>G	9.37:g.136310829A>G	ENSP00000360997:p.Thr874Ala		Somatic				ADAMTS13_uc004cdp.3_Missense_Mutation_p.T101A|ADAMTS13_uc004cdt.1_Missense_Mutation_p.T874A|ADAMTS13_uc004cdu.1_Missense_Mutation_p.T843A|ADAMTS13_uc004cdw.3_Missense_Mutation_p.T874A|ADAMTS13_uc004cdx.3_Missense_Mutation_p.T843A|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Missense_Mutation_p.T544A|ADAMTS13_uc004cds.1_Missense_Mutation_p.T399A|ADAMTS13_uc004cdr.1_RNA	p.T874A	NM_139025	NP_620594	WXS	Illumina HiSeq	Unspecified	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	21	3064	+			874					Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	c.2620A>G	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	A	1.422	-0.572630	0.03882	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.67345	-0.23;-0.26;-0.24	4.49	-0.866	0.10659	.	.	.	.	.	T	0.45856	0.1363	N	0.19112	0.55	0.09310	N	1	B;B;B	0.17852	0.014;0.024;0.024	B;B;B	0.17979	0.009;0.02;0.02	T	0.26292	-1.0107	9	0.23302	T	0.38	.	7.7327	0.28796	0.4225:0.0:0.5775:0.0	.	874;843;874	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	A	874;874;843	ENSP00000360997:T874A;ENSP00000347927:T874A;ENSP00000348997:T843A	ENSP00000347927:T874A	T	+	1	0	ADAMTS13	135300650	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.319000	0.19522	-0.141000	0.11374	-0.290000	0.09829	ACC		0.647	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		12	19	0	0	0	0.010729	0	12	19				
LCN1	3933	broad.mit.edu	37	9	138413352	138413352	+	Silent	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:138413352C>G	ENST00000263598.2	+	1	69	c.9C>G	c.(7-9)ccC>ccG	p.P3P	LCN1_ENST00000371781.3_Silent_p.P3P	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	3					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		AGATGAAGCCCCTGCTCCTGG	0.652																																							uc004cfz.1		NA																	0					0						c.(7-9)CCC>CCG		lipocalin 1 precursor							27.0	28.0	28.0					9																	138413352		2203	4300	6503	SO:0001819	synonymous_variant	3933				proteolysis|response to stimulus|sensory perception of taste	extracellular region	cysteine-type endopeptidase inhibitor activity|transporter activity	g.chr9:138413352C>G		CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.9C>G	9.37:g.138413352C>G			Somatic				LCN1_uc004cga.1_Silent_p.P3P	p.P3P	NM_002297	NP_002288	WXS	Illumina HiSeq	Unspecified	P31025	LCN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)	1	67	+		Myeloproliferative disorder(178;0.0511)	3					Q5T8A1	Silent	SNP	ENST00000263598.2	37	c.9C>G	CCDS6991.1																																																																																				0.652	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1	NM_002297		6	20	0	0	0	0.004482	0	6	20				
QSOX2	169714	broad.mit.edu	37	9	139110934	139110934	+	Missense_Mutation	SNP	G	G	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chr9:139110934G>A	ENST00000358701.5	-	7	935	c.898C>T	c.(898-900)Cct>Tct	p.P300S		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	300					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		GGCTTTTCAGGCAAGGGAAGC	0.488																																							uc010nbi.2		NA																	0				ovary(1)	1						c.(898-900)CCT>TCT		quiescin Q6 sulfhydryl oxidase 2 precursor							109.0	112.0	111.0					9																	139110934		2203	4300	6503	SO:0001583	missense	169714				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity	g.chr9:139110934G>A	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.898C>T	9.37:g.139110934G>A	ENSP00000351536:p.Pro300Ser		Somatic					p.P300S	NM_181701	NP_859052	WXS	Illumina HiSeq	Unspecified	Q6ZRP7	QSOX2_HUMAN		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)	7	936	-		Myeloproliferative disorder(178;0.0511)	300					A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	c.898C>T	CCDS35178.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.275|8.275	0.814263|0.814263	0.16537|0.16537	.|.	.|.	ENSG00000165661|ENSG00000165661	ENST00000455222|ENST00000358701;ENST00000389471	.|T	.|0.16597	.|2.33	4.61|4.61	3.69|3.69	0.42338|0.42338	.|.	.|0.277211	.|0.36134	.|N	.|0.002761	T|T	0.15305|0.15305	0.0369|0.0369	M|M	0.62154|0.62154	1.92|1.92	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.28378	.|0.209	.|B	.|0.20767	.|0.031	T|T	0.23476|0.23476	-1.0187|-1.0187	5|10	.|0.08381	.|T	.|0.77	-17.5216|-17.5216	12.662|12.662	0.56820|0.56820	0.0864:0.0:0.9136:0.0|0.0864:0.0:0.9136:0.0	.|.	.|300	.|Q6ZRP7	.|QSOX2_HUMAN	V|S	67|300;99	.|ENSP00000351536:P300S	.|ENSP00000351536:P300S	A|P	-|-	2|1	0|0	QSOX2|QSOX2	138250755|138250755	0.995000|0.995000	0.38212|0.38212	0.188000|0.188000	0.23233|0.23233	0.542000|0.542000	0.35054|0.35054	3.380000|3.380000	0.52448|0.52448	2.264000|2.264000	0.75181|0.75181	0.313000|0.313000	0.20887|0.20887	GCC|CCT		0.488	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701		21	30	0	0	0	0.012319	0	21	30				
RAI2	10742	broad.mit.edu	37	X	17820044	17820044	+	Missense_Mutation	SNP	C	C	A			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrX:17820044C>A	ENST00000545871.1	-	3	547	c.87G>T	c.(85-87)atG>atT	p.M29I	RAI2_ENST00000451717.1_Missense_Mutation_p.M29I|RAI2_ENST00000415486.3_Missense_Mutation_p.M29I|RAI2_ENST00000360011.1_Missense_Mutation_p.M29I|RAI2_ENST00000331511.1_Missense_Mutation_p.M29I	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	29					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					TCAGCTGAGCCATGCCATTCT	0.567																																							uc004cyf.2		NA																	0				ovary(1)|breast(1)	2						c.(85-87)ATG>ATT		retinoic acid induced 2							150.0	138.0	142.0					X																	17820044		2203	4300	6503	SO:0001583	missense	10742				embryo development			g.chrX:17820044C>A	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.87G>T	X.37:g.17820044C>A	ENSP00000444210:p.Met29Ile		Somatic				RAI2_uc004cyg.2_Missense_Mutation_p.M29I|RAI2_uc010nfa.2_Missense_Mutation_p.M29I|RAI2_uc004cyh.3_Missense_Mutation_p.M29I|RAI2_uc011miy.1_Missense_Mutation_p.M29I	p.M29I	NM_021785	NP_068557	WXS	Illumina HiSeq	Unspecified	Q9Y5P3	RAI2_HUMAN			3	657	-	Hepatocellular(33;0.183)		29					B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	c.87G>T	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.796811	0.31777	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	5.49	5.49	0.81192	.	0.086817	0.48767	D	0.000179	T	0.15912	0.0383	N	0.08118	0	0.28319	N	0.92231	B;B	0.24920	0.114;0.114	B;B	0.17979	0.02;0.02	T	0.11542	-1.0583	10	0.25751	T	0.34	-24.7776	12.1909	0.54270	0.298:0.702:0.0:0.0	.	29;29	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	I	29	ENSP00000333456:M29I;ENSP00000353106:M29I;ENSP00000444210:M29I;ENSP00000401323:M29I;ENSP00000392578:M29I	ENSP00000333456:M29I	M	-	3	0	RAI2	17729965	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	0.542000	0.23222	2.317000	0.78254	0.529000	0.55759	ATG		0.567	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785		27	89	1	0	1.08312e-15	0.009535	1.53686e-15	27	89				
HUWE1	10075	broad.mit.edu	37	X	53612061	53612061	+	Missense_Mutation	SNP	T	T	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrX:53612061T>C	ENST00000342160.3	-	39	5369	c.4912A>G	c.(4912-4914)Att>Gtt	p.I1638V	HUWE1_ENST00000218328.8_Missense_Mutation_p.I1638V|HUWE1_ENST00000262854.6_Missense_Mutation_p.I1638V			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1638	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GCAGAATCAATAGTGCTATTG	0.473																																							uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(4912-4914)ATT>GTT		HECT, UBA and WWE domain containing 1							237.0	182.0	201.0					X																	53612061		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53612061T>C	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.4912A>G	X.37:g.53612061T>C	ENSP00000340648:p.Ile1638Val		Somatic				HUWE1_uc004dsn.2_Missense_Mutation_p.I463V	p.I1638V	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			40	5314	-			1638			WWE.		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.4912A>G	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.3|25.3	4.621625|4.621625	0.87460|0.87460	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328|ENST00000427052	T;T;T|.	0.62941|.	-0.01;-0.01;-0.01|.	5.61|5.61	5.61|5.61	0.85477|0.85477	WWE domain (2);|.	0.556195|.	0.18323|.	N|.	0.144734|.	T|T	0.69024|0.69024	0.3065|0.3065	L|L	0.58428|0.58428	1.81|1.81	0.53005|0.53005	D|D	0.999968|0.999968	P;D|.	0.67145|.	0.947;0.996|.	P;D|.	0.77557|.	0.897;0.99|.	T|T	0.68059|0.68059	-0.5509|-0.5509	10|5	0.87932|.	D|.	0|.	.|.	13.7357|13.7357	0.62815|0.62815	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1638;1638|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	V|C	1638|671	ENSP00000340648:I1638V;ENSP00000262854:I1638V;ENSP00000218328:I1638V|.	ENSP00000218328:I1638V|.	I|Y	-|-	1|2	0|0	HUWE1|HUWE1	53628786|53628786	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.979000|0.979000	0.70002|0.70002	7.653000|7.653000	0.83643|0.83643	1.887000|1.887000	0.54652|0.54652	0.486000|0.486000	0.48141|0.48141	ATT|TAT		0.473	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		24	95	0	0	0	0.00278	0	24	95				
RLIM	51132	broad.mit.edu	37	X	73815767	73815767	+	Missense_Mutation	SNP	C	C	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrX:73815767C>T	ENST00000332687.6	-	2	264	c.46G>A	c.(46-48)Gca>Aca	p.A16T	RLIM_ENST00000349225.2_Missense_Mutation_p.A16T	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	16					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CGCTGTGCTGCAGACTGATCA	0.378																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)	Esophageal Squamous(169;1899 1923 14997 18818 32118)	uc004ebu.2		NA																	0				ovary(2)	2						c.(46-48)GCA>ACA		ring finger protein, LIM domain interacting							71.0	63.0	66.0					X																	73815767		2203	4300	6503	SO:0001583	missense	51132				random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chrX:73815767C>T	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.46G>A	X.37:g.73815767C>T	ENSP00000328059:p.Ala16Thr		Somatic				RLIM_uc004ebw.2_Missense_Mutation_p.A16T	p.A16T	NM_183353	NP_899196	WXS	Illumina HiSeq	Unspecified	Q9NVW2	RNF12_HUMAN			3	336	-			16					B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	c.46G>A	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407478	0.62399	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.06449	3.3;3.3	5.32	4.46	0.54185	.	0.055956	0.64402	D	0.000001	T	0.06462	0.0166	L	0.34521	1.04	0.31460	N	0.669688	B	0.02656	0.0	B	0.04013	0.001	T	0.03043	-1.1079	10	0.66056	D	0.02	-4.5267	11.6286	0.51160	0.0:0.9151:0.0:0.0849	.	16	Q9NVW2	RNF12_HUMAN	T	16	ENSP00000328059:A16T;ENSP00000253571:A16T	ENSP00000328059:A16T	A	-	1	0	RLIM	73732492	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.767000	0.68850	1.018000	0.39521	0.506000	0.49869	GCA		0.378	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120		9	31	0	0	0	0.013537	0	9	31				
ZCCHC5	203430	broad.mit.edu	37	X	77912743	77912743	+	Missense_Mutation	SNP	A	A	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrX:77912743A>G	ENST00000321110.1	-	2	1470	c.1175T>C	c.(1174-1176)cTg>cCg	p.L392P		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	392							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CTTCTCTTCCAGGCTGATGCA	0.493																																							uc004edc.1		NA																	0				ovary(1)	1						c.(1174-1176)CTG>CCG		zinc finger, CCHC domain containing 5							107.0	95.0	99.0					X																	77912743		2203	4300	6503	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77912743A>G	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1175T>C	X.37:g.77912743A>G	ENSP00000316794:p.Leu392Pro		Somatic					p.L392P	NM_152694	NP_689907	WXS	Illumina HiSeq	Unspecified	Q8N8U3	ZCHC5_HUMAN			2	1471	-			392					B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.1175T>C	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	A	8.606	0.888100	0.17540	.	.	ENSG00000179300	ENST00000321110	T	0.22336	1.96	2.95	2.95	0.34219	.	0.260117	0.18510	U	0.139089	T	0.34048	0.0884	L	0.46157	1.445	0.30184	N	0.800131	D	0.89917	1.0	D	0.83275	0.996	T	0.11966	-1.0566	10	0.87932	D	0	.	6.7642	0.23558	1.0:0.0:0.0:0.0	.	392	Q8N8U3	ZCHC5_HUMAN	P	392	ENSP00000316794:L392P	ENSP00000316794:L392P	L	-	2	0	ZCCHC5	77799399	0.587000	0.26791	0.304000	0.25085	0.194000	0.23727	2.314000	0.43743	1.398000	0.46701	0.417000	0.27973	CTG		0.493	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		15	58	0	0	0	0.00499	0	15	58				
GPR174	84636	broad.mit.edu	37	X	78427266	78427266	+	Missense_Mutation	SNP	C	C	G			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrX:78427266C>G	ENST00000276077.1	+	1	798	c.762C>G	c.(760-762)ttC>ttG	p.F254L		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CTTTAGATTTCCTGGTGAAGT	0.388										HNSCC(63;0.18)																													uc004edg.1		NA																	0				lung(1)|central_nervous_system(1)	2						c.(760-762)TTC>TTG		putative purinergic receptor FKSG79							115.0	102.0	106.0					X																	78427266		2203	4300	6503	SO:0001583	missense	84636					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78427266C>G	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.762C>G	X.37:g.78427266C>G	ENSP00000276077:p.Phe254Leu	HNSCC(63;0.18)	Somatic					p.F254L	NM_032553	NP_115942	WXS	Illumina HiSeq	Unspecified	Q9BXC1	GP174_HUMAN			1	798	+			254			Extracellular (Potential).		Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	c.762C>G	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	c	0.088	-1.172484	0.01646	.	.	ENSG00000147138	ENST00000276077	T	0.35789	1.29	5.25	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.19005	0.0456	N	0.20610	0.595	0.40607	D	0.981639	B	0.10296	0.003	B	0.16289	0.015	T	0.10268	-1.0637	10	0.11485	T	0.65	.	7.5876	0.28002	0.0:0.6479:0.0:0.3521	.	254	Q9BXC1	GP174_HUMAN	L	254	ENSP00000276077:F254L	ENSP00000276077:F254L	F	+	3	2	GPR174	78313922	0.863000	0.29885	0.977000	0.42913	0.890000	0.51754	1.567000	0.36407	0.106000	0.17784	-0.312000	0.09012	TTC		0.388	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		9	35	0	0	0	0.006214	0	9	35				
COL4A6	1288	broad.mit.edu	37	X	107404937	107404937	+	Silent	SNP	A	A	C			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrX:107404937A>C	ENST00000372216.4	-	42	4348	c.4248T>G	c.(4246-4248)ggT>ggG	p.G1416G	COL4A6_ENST00000545689.1_Silent_p.G1391G|COL4A6_ENST00000394872.2_Silent_p.G1416G|COL4A6_ENST00000334504.7_Silent_p.G1415G|COL4A6_ENST00000538570.1_Silent_p.G1358G|COL4A6_ENST00000418180.1_5'Flank	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1416	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GGCCATCTTTACCGGGGATGC	0.597									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	Melanoma(87;1895 1945 2589 7165)	uc004enw.3		NA																	0				ovary(6)|urinary_tract(1)|large_intestine(1)	8						c.(4246-4248)GGT>GGG		type IV alpha 6 collagen isoform A precursor							23.0	24.0	24.0					X																	107404937		2203	4300	6503	SO:0001819	synonymous_variant	1288	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107404937A>C	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4248T>G	X.37:g.107404937A>C			Somatic				COL4A6_uc004env.3_Silent_p.G1415G|COL4A6_uc011msn.1_Silent_p.G1391G|COL4A6_uc010npk.2_Silent_p.G1358G|COL4A6_uc011msm.1_5'Flank|COL4A6_uc010npj.2_Intron	p.G1416G	NM_001847	NP_001838	WXS	Illumina HiSeq	Unspecified	Q14031	CO4A6_HUMAN			42	4351	-			1416			Triple-helical region.		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	c.4248T>G	CCDS14541.1																																																																																				0.597	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			2	13	0	0	0	0.004672	0	2	13				
ZFY	7544	broad.mit.edu	37	Y	2829423	2829423	+	Missense_Mutation	SNP	A	A	T			TCGA-91-7771-01A-11D-2167-08	TCGA-91-7771-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	969b8cc9-2632-4be2-9358-681312a36c34	36de470c-ab00-4a9b-8ce8-c3751ef9278e	g.chrY:2829423A>T	ENST00000155093.3	+	3	691	c.370A>T	c.(370-372)Att>Ttt	p.I124F	ZFY_ENST00000431102.1_Intron|ZFY_ENST00000383052.1_Missense_Mutation_p.I124F|ZFY_ENST00000449237.1_Missense_Mutation_p.I98F	NM_003411.3	NP_003402.2	P08048	ZFY_HUMAN	zinc finger protein, Y-linked	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|kidney(3)|large_intestine(1)|lung(3)	8						AGCTTCTGACATTACTTCAAC	0.403																																							uc004fqj.2		NA																	0					0						c.(370-372)ATT>TTT		zinc finger protein, Y-linked isoform 1																																				SO:0001583	missense	7544				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrY:2829423A>T	L10393	CCDS14774.1, CCDS48200.1, CCDS48201.1	Yp11.3	2013-01-08			ENSG00000067646	ENSG00000067646		"""Zinc fingers, C2H2-type"""	12870	protein-coding gene	gene with protein product		490000				2497060	Standard	NM_001145275		Approved	ZNF911	uc004fqj.3	P08048	OTTHUMG00000036159	ENST00000155093.3:c.370A>T	Y.37:g.2829423A>T	ENSP00000155093:p.Ile124Phe		Somatic				ZFY_uc010nwd.1_Missense_Mutation_p.I124F|ZFY_uc011nan.1_Intron|ZFY_uc010nwe.2_Missense_Mutation_p.I98F	p.I124F	NM_003411	NP_003402	WXS	Illumina HiSeq	Unspecified	P08048	ZFY_HUMAN			3	691	+			124					B4DVF7|Q14021|Q15558|Q1RME9|Q24JR0|Q96TF3	Missense_Mutation	SNP	ENST00000155093.3	37	c.370A>T	CCDS14774.1																																																																																				0.403	ZFY-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088063.1	NM_003411		24	132	0	0	0	0.007291	0	24	132				
