#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MST1L	11223	broad.mit.edu	37	1	17084510	17084510	+	RNA	SNP	G	G	A	rs11260921	byFrequency	TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:17084510G>A	ENST00000455405.2	-	0	379							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.L525L(2)|p.L530L(2)									ACCCGCTGTAGGCCTGGCTCT	0.577																																							uc010ock.1		NA																	4	Substitution - coding silent(4)		endometrium(2)|kidney(2)		0						c.(1588-1590)CTA>TTA		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17084510G>A	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084510G>A			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Silent_p.L130L	p.L530L	NR_002729		WXS	Illumina HiSeq	Unspecified					12	1588	-								B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37	c.1588C>T																																																																																					0.577	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		5	83	0	0	0	0.001168	0	5	83				
RCC1	1104	broad.mit.edu	37	1	28863368	28863368	+	Silent	SNP	G	G	T	rs193096280		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:28863368G>T	ENST00000373833.6	+	12	1332	c.1047G>T	c.(1045-1047)tcG>tcT	p.S349S	RCC1_ENST00000373831.3_Silent_p.S380S|RCC1_ENST00000398958.2_Silent_p.S349S|RCC1_ENST00000373832.1_Silent_p.S349S			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	349					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CTGTCTCCTCGGTGGCTTGTG	0.622																																							uc001bqg.1		NA																	0				ovary(1)	1						c.(1045-1047)TCG>TCT		regulator of chromosome condensation 1 isoform							146.0	147.0	146.0					1																	28863368		2203	4300	6503	SO:0001819	synonymous_variant	1104				cell division|chromosome segregation|G1/S transition of mitotic cell cycle|mitosis|mitotic spindle organization|regulation of mitosis|regulation of S phase of mitotic cell cycle|spindle assembly|viral reproduction	condensed nuclear chromosome|cytoplasm|nuclear chromatin|nuclear membrane|nucleoplasm	histone binding|nucleosomal DNA binding|Ran guanyl-nucleotide exchange factor activity	g.chr1:28863368G>T	X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.1047G>T	1.37:g.28863368G>T			Somatic				SNHG3-RCC1_uc001bqa.1_Silent_p.S349S|SNHG3-RCC1_uc001bqb.1_Silent_p.S349S|SNHG3-RCC1_uc001bqc.1_Silent_p.S349S|RCC1_uc001bqe.1_Silent_p.S366S|RCC1_uc001bqf.1_Silent_p.S380S	p.S349S	NM_001269	NP_001260	WXS	Illumina HiSeq	Unspecified	P18754	RCC1_HUMAN		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)	9	1132	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)	349			RCC1 6.		Q16269|Q6NT97	Silent	SNP	ENST00000373833.6	37	c.1047G>T	CCDS323.1																																																																																				0.622	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010323.3	NM_001269		39	226	1	0	4.65455e-14	0.00361	7.01877e-14	39	226				
CSMD2	114784	broad.mit.edu	37	1	34003151	34003151	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:34003151G>A	ENST00000373381.4	-	61	9866	c.9690C>T	c.(9688-9690)ttC>ttT	p.F3230F		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3206	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ACCTGTAGGAGAAGCCTCGGT	0.602																																							uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(9256-9258)TTC>TTT		CUB and Sushi multiple domains 2							78.0	69.0	72.0					1																	34003151		2203	4300	6503	SO:0001819	synonymous_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34003151G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9690C>T	1.37:g.34003151G>A			Somatic				CSMD2_uc001bxm.1_Silent_p.F3230F	p.F3086F	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			60	9287	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	3086			Extracellular (Potential).|Sushi 24.		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37	c.9258C>T																																																																																					0.602	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		4	65	0	0	0	0.000248	0	4	65				
NTNG1	22854	broad.mit.edu	37	1	107866979	107866979	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:107866979G>C	ENST00000370068.1	+	3	1168	c.322G>C	c.(322-324)Gat>Cat	p.D108H	NTNG1_ENST00000370061.3_Missense_Mutation_p.D108H|NTNG1_ENST00000370070.2_Missense_Mutation_p.D108H|NTNG1_ENST00000370071.2_Missense_Mutation_p.D108H|NTNG1_ENST00000370072.3_Missense_Mutation_p.D108H|NTNG1_ENST00000370066.1_Missense_Mutation_p.D108H|NTNG1_ENST00000370065.1_Missense_Mutation_p.D108H|NTNG1_ENST00000370074.4_Missense_Mutation_p.D108H|NTNG1_ENST00000542803.1_Missense_Mutation_p.D108H|NTNG1_ENST00000370067.1_Missense_Mutation_p.D108H|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370073.2_Missense_Mutation_p.D108H			Q9Y2I2	NTNG1_HUMAN	netrin G1	108	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GCTGATGTTTGATTTTGAAGG	0.488																																							uc001dvh.3		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(322-324)GAT>CAT		netrin G1 isoform 1							172.0	173.0	173.0					1																	107866979		2203	4300	6503	SO:0001583	missense	22854				axonogenesis	anchored to plasma membrane	protein binding	g.chr1:107866979G>C	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.322G>C	1.37:g.107866979G>C	ENSP00000359085:p.Asp108His		Somatic				NTNG1_uc001dvf.3_Missense_Mutation_p.D108H|NTNG1_uc010out.1_Missense_Mutation_p.D108H|NTNG1_uc001dvc.3_Missense_Mutation_p.D108H|NTNG1_uc001dvd.1_Missense_Mutation_p.D108H	p.D108H	NM_001113226	NP_001106697	WXS	Illumina HiSeq	Unspecified	Q9Y2I2	NTNG1_HUMAN		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)	3	1040	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	108			Laminin N-terminal.		Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	c.322G>C	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143459	0.77888	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.83	5.83	0.93111	Laminin, N-terminal (3);	0.000000	0.64402	D	0.000006	D	0.91703	0.7377	H	0.95328	3.655	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.996;1.0	D	0.93231	0.6617	10	0.87932	D	0	.	20.1224	0.97967	0.0:0.0:1.0:0.0	.	108;108;108;108;108	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	H	108	ENSP00000359090:D108H;ENSP00000359088:D108H;ENSP00000440561:D108H;ENSP00000359078:D108H;ENSP00000359089:D108H;ENSP00000359087:D108H;ENSP00000359091:D108H;ENSP00000359085:D108H;ENSP00000359084:D108H;ENSP00000359083:D108H;ENSP00000359082:D108H	ENSP00000294649:D108H	D	+	1	0	NTNG1	107668502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.763000	0.94921	0.655000	0.94253	GAT		0.488	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917		4	212	0	0	0	0.000248	0	4	212				
CELF3	11189	broad.mit.edu	37	1	151681551	151681551	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:151681551A>T	ENST00000290583.4	-	5	1202	c.409T>A	c.(409-411)Tgc>Agc	p.C137S	RIIAD1_ENST00000326413.3_5'Flank|AL589765.1_ENST00000442233.2_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_5'Flank|CELF3_ENST00000290585.4_Missense_Mutation_p.C137S|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	137	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						ACGAAGGCGCAGCCTGGAGAG	0.667																																							uc001eys.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(409-411)TGC>AGC		trinucleotide repeat containing 4							82.0	88.0	86.0					1																	151681551		2203	4300	6503	SO:0001583	missense	11189				nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding	g.chr1:151681551A>T	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.409T>A	1.37:g.151681551A>T	ENSP00000290583:p.Cys137Ser		Somatic				CELF3_uc010pdh.1_5'Flank|CELF3_uc001eyr.2_Missense_Mutation_p.C136S|CELF3_uc009wmy.2_Missense_Mutation_p.C137S|CELF3_uc009wmx.1_Missense_Mutation_p.C137S|CELF3_uc001eyt.2_Missense_Mutation_p.C60S|CELF3_uc010pdi.1_Missense_Mutation_p.C137S|C1orf230_uc001eyu.2_5'Flank	p.C137S	NM_007185	NP_009116	WXS	Illumina HiSeq	Unspecified	Q5SZQ8	CELF3_HUMAN			5	1203	-			137			RRM 2.		B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	37	c.409T>A	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	19.38	3.817232	0.70912	.	.	ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000368833	T;T	0.05786	3.39;3.39	4.37	4.37	0.52481	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.11239	0.0274	L	0.49455	1.56	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.992;1.0;1.0	D;D;P;D;D	0.87578	0.964;0.985;0.786;0.998;0.996	T	0.00981	-1.1492	10	0.87932	D	0	-19.3038	11.566	0.50805	1.0:0.0:0.0:0.0	.	137;137;136;137;136	Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.;.;.;CELF3_HUMAN;.	S	137;137;136	ENSP00000290585:C137S;ENSP00000290583:C137S	ENSP00000290583:C137S	C	-	1	0	CELF3	149948175	1.000000	0.71417	0.999000	0.59377	0.328000	0.28507	6.869000	0.75521	1.829000	0.53265	0.368000	0.22195	TGC		0.667	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185		17	115	0	0	0	0.002299	0	17	115				
NES	10763	broad.mit.edu	37	1	156641024	156641024	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:156641024C>T	ENST00000368223.3	-	4	3088	c.2956G>A	c.(2956-2958)Gat>Aat	p.D986N		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	986	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGAAGCCATCCTGCTCCCTC	0.592																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(2956-2958)GAT>AAT		nestin							248.0	265.0	260.0					1																	156641024		2203	4300	6503	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156641024C>T	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2956G>A	1.37:g.156641024C>T	ENSP00000357206:p.Asp986Asn		Somatic					p.D986N	NM_006617	NP_006608	WXS	Illumina HiSeq	Unspecified	P48681	NEST_HUMAN			4	3089	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		986			Tail.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.2956G>A	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292912	0.60086	.	.	ENSG00000132688	ENST00000368223	D	0.86230	-2.09	5.22	4.2	0.49525	.	0.504809	0.14923	N	0.290566	T	0.68339	0.2990	L	0.51422	1.61	0.09310	N	1	P	0.43477	0.808	B	0.33960	0.173	T	0.63152	-0.6701	10	0.46703	T	0.11	.	5.7172	0.17966	0.1955:0.6749:0.0:0.1295	.	986	P48681	NEST_HUMAN	N	986	ENSP00000357206:D986N	ENSP00000357206:D986N	D	-	1	0	NES	154907648	0.000000	0.05858	0.028000	0.17463	0.099000	0.18886	0.856000	0.27818	2.454000	0.82982	0.563000	0.77884	GAT		0.592	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		11	525	0	0	0	0.004007	0	11	525				
FCRL5	83416	broad.mit.edu	37	1	157514290	157514290	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:157514290G>A	ENST00000361835.3	-	5	763	c.606C>T	c.(604-606)atC>atT	p.I202I	FCRL5_ENST00000356953.4_Silent_p.I202I|FCRL5_ENST00000368190.3_Silent_p.I202I|FCRL5_ENST00000368189.3_Silent_p.I202I|FCRL5_ENST00000368191.3_Silent_p.I117I	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	202	Ig-like C2-type 2.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GGTTCCCGCTGATGGGCTGGA	0.562																																							uc001fqu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)	6						c.(604-606)ATC>ATT		Fc receptor-like 5							94.0	93.0	94.0					1																	157514290		2203	4300	6503	SO:0001819	synonymous_variant	83416					integral to membrane|plasma membrane	receptor activity	g.chr1:157514290G>A	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.606C>T	1.37:g.157514290G>A			Somatic				FCRL5_uc009wsm.2_Silent_p.I202I|FCRL5_uc010phv.1_Silent_p.I202I|FCRL5_uc010phw.1_Silent_p.I117I|FCRL5_uc001fqv.1_Silent_p.I202I|FCRL5_uc010phx.1_5'UTR	p.I202I	NM_031281	NP_112571	WXS	Illumina HiSeq	Unspecified	Q96RD9	FCRL5_HUMAN			5	764	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)	202			Extracellular (Potential).|Ig-like C2-type 2.		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	37	c.606C>T	CCDS1165.1																																																																																				0.562	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		5	117	0	0	0	0.001168	0	5	117				
GPA33	10223	broad.mit.edu	37	1	167032927	167032927	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:167032927C>A	ENST00000367868.3	-	4	806	c.463G>T	c.(463-465)Ggg>Tgg	p.G155W	GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	155	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						ATGTTGTTCCCAATTATGGTC	0.547																																							uc001gea.1		NA																	0					0						c.(463-465)GGG>TGG		transmembrane glycoprotein A33 precursor							211.0	178.0	189.0					1																	167032927		2203	4300	6503	SO:0001583	missense	10223					integral to plasma membrane	receptor activity	g.chr1:167032927C>A	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.463G>T	1.37:g.167032927C>A	ENSP00000356842:p.Gly155Trp		Somatic					p.G155W	NM_005814	NP_005805	WXS	Illumina HiSeq	Unspecified	Q99795	GPA33_HUMAN			4	807	-			155			Ig-like C2-type.|Extracellular (Potential).		Q5VZP6	Missense_Mutation	SNP	ENST00000367868.3	37	c.463G>T	CCDS1258.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165098	0.57476	.	.	ENSG00000143167	ENST00000367868	T	0.34859	1.34	5.64	5.64	0.86602	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.103327	0.64402	D	0.000003	T	0.68723	0.3032	H	0.96943	3.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.79422	-0.1810	10	0.87932	D	0	.	15.281	0.73784	0.0:1.0:0.0:0.0	.	155	Q99795	GPA33_HUMAN	W	155	ENSP00000356842:G155W	ENSP00000356842:G155W	G	-	1	0	GPA33	165299551	0.994000	0.37717	0.926000	0.36857	0.259000	0.26198	4.406000	0.59748	2.670000	0.90874	0.638000	0.83543	GGG		0.547	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	NM_005814		21	145	1	0	6.32553e-13	0.004656	9.38946e-13	21	145				
TNR	7143	broad.mit.edu	37	1	175335167	175335167	+	Missense_Mutation	SNP	T	T	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:175335167T>G	ENST00000367674.2	-	11	2869	c.2161A>C	c.(2161-2163)Acc>Ccc	p.T721P	TNR_ENST00000263525.2_Missense_Mutation_p.T721P			Q92752	TENR_HUMAN	tenascin R	721	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GAGGATGGGGTAAAGGTAATT	0.552																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(2161-2163)ACC>CCC		tenascin R precursor							164.0	153.0	157.0					1																	175335167		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175335167T>G	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2161A>C	1.37:g.175335167T>G	ENSP00000356646:p.Thr721Pro		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.T721P	p.T721P	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			9	2242	-	Renal(580;0.146)		721			Fibronectin type-III 5.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.2161A>C	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.972558	0.74246	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.57273	0.41;0.41	5.92	5.92	0.95590	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73393	0.3581	M	0.84156	2.68	0.53688	D	0.999973	D	0.58268	0.982	D	0.63488	0.915	T	0.76564	-0.2913	10	0.54805	T	0.06	.	16.0148	0.80430	0.0:0.0:0.0:1.0	.	721	Q92752	TENR_HUMAN	P	721	ENSP00000356646:T721P;ENSP00000263525:T721P	ENSP00000263525:T721P	T	-	1	0	TNR	173601790	1.000000	0.71417	0.994000	0.49952	0.859000	0.49053	4.527000	0.60573	2.257000	0.74773	0.454000	0.30748	ACC		0.552	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		7	95	0	0	0	0.004482	0	7	95				
LINC00303	284573	broad.mit.edu	37	1	204009392	204009392	+	lincRNA	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:204009392C>A	ENST00000367207.3	-	0	304							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		CATATCCACACCAGTGAGAGC	0.448																																							uc001haj.2		NA																	0					0						c.e2+1		Homo sapiens cDNA FLJ40343 fis, clone TESTI2032774.							152.0	151.0	151.0					1																	204009392		2061	4233	6294			284573							g.chr1:204009392C>A	AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204009392C>A			Somatic				C1orf157_uc001hak.2_Splice_Site|C1orf157_uc010pqo.1_Splice_Site		NR_027902		WXS	Illumina HiSeq	Unspecified			KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0754)|Kidney(21;0.0934)|Epithelial(59;0.233)		2		-	all_cancers(21;0.083)|Breast(84;0.193)|all_epithelial(62;0.21)							Q3SY06|Q8N7U1	Splice_Site	SNP	ENST00000367207.3	37	c.303_splice																																																																																					0.448	LINC00303-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000087885.3	NR_027902		5	18	1	0	0.00198382	0.001984	0.00227064	5	18				
RYR2	6262	broad.mit.edu	37	1	237813214	237813214	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:237813214A>T	ENST00000366574.2	+	50	7867	c.7550A>T	c.(7549-7551)aAt>aTt	p.N2517I	RYR2_ENST00000542537.1_Missense_Mutation_p.N2501I|RYR2_ENST00000360064.6_Missense_Mutation_p.N2515I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2517	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGGCCCTCAATCGGTACCTT	0.463																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(7549-7551)AAT>ATT		cardiac muscle ryanodine receptor							151.0	146.0	148.0					1																	237813214		2001	4161	6162	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237813214A>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7550A>T	1.37:g.237813214A>T	ENSP00000355533:p.Asn2517Ile		Somatic					p.N2517I	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		50	7670	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2517			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.7550A>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.820885	0.90873	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.90732	-2.72;-2.72;-2.72	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000005	D	0.95778	0.8626	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.96476	0.9352	10	0.87932	D	0	-19.4291	15.86	0.79014	1.0:0.0:0.0:0.0	.	2517	Q92736	RYR2_HUMAN	I	2517;2515;2501	ENSP00000355533:N2517I;ENSP00000353174:N2515I;ENSP00000443798:N2501I	ENSP00000353174:N2515I	N	+	2	0	RYR2	235879837	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.275000	0.95738	2.190000	0.69967	0.533000	0.62120	AAT		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		28	132	0	0	0	0.004289	0	28	132				
ADSS	159	broad.mit.edu	37	1	244580948	244580948	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:244580948A>G	ENST00000366535.3	-	10	1368	c.1052T>C	c.(1051-1053)aTg>aCg	p.M351T	ADSS_ENST00000462358.1_5'Flank	NM_001126.3	NP_001117.2			adenylosuccinate synthase											endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			TCCATTGATCATATGAGCATA	0.363																																							uc001iaj.2		NA																	0				ovary(2)|kidney(1)	3						c.(1051-1053)ATG>ACG		adenylosuccinate synthase	L-Aspartic Acid(DB00128)						105.0	101.0	102.0					1																	244580948		2203	4300	6503	SO:0001583	missense	159				AMP biosynthetic process|immune system process|purine base metabolic process	cytosol|plasma membrane	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding	g.chr1:244580948A>G	BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.1052T>C	1.37:g.244580948A>G	ENSP00000355493:p.Met351Thr		Somatic					p.M351T	NM_001126	NP_001117	WXS	Illumina HiSeq	Unspecified	P30520	PURA2_HUMAN	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)		10	1346	-	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	351						Missense_Mutation	SNP	ENST00000366535.3	37	c.1052T>C	CCDS1624.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.857499	0.51376	.	.	ENSG00000035687	ENST00000366535;ENST00000449326	T	0.40225	1.04	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	L	0.55213	1.73	0.80722	D	1	B	0.27882	0.192	B	0.37480	0.251	T	0.45411	-0.9263	10	0.51188	T	0.08	-19.7382	15.8729	0.79136	1.0:0.0:0.0:0.0	.	351	P30520	PURA2_HUMAN	T	351;330	ENSP00000355493:M351T	ENSP00000355493:M351T	M	-	2	0	ADSS	242647571	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.962000	0.93254	2.155000	0.67459	0.533000	0.62120	ATG		0.363	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096697.1	NM_001126		9	65	0	0	0	0.000978	0	9	65				
CDH23	64072	broad.mit.edu	37	10	73406352	73406352	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr10:73406352G>T	ENST00000224721.6	+	13	1447	c.1442G>T	c.(1441-1443)gGg>gTg	p.G481V	CDH23_ENST00000398842.3_Missense_Mutation_p.G476V|CDH23_ENST00000461841.3_Missense_Mutation_p.G521V|CDH23_ENST00000398809.4_Missense_Mutation_p.G476V|CDH23_ENST00000299366.7_Missense_Mutation_p.G521V	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	476	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GTCACCGTGGGGACCTCTGTG	0.562																																							uc001jrx.3		NA																	0				central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(1426-1428)GGG>GTG		cadherin-like 23 isoform 1 precursor							151.0	158.0	156.0					10																	73406352		2137	4246	6383	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73406352G>T	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.1442G>T	10.37:g.73406352G>T	ENSP00000224721:p.Gly481Val		Somatic				CDH23_uc001jrw.3_Missense_Mutation_p.G476V|CDH23_uc001jry.2_Missense_Mutation_p.G92V|CDH23_uc001jrz.2_Missense_Mutation_p.G92V	p.G476V	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			13	1804	+			476			Cadherin 5.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.1427G>T		.	.	.	.	.	.	.	.	.	.	G	25.7	4.663512	0.88251	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721;ENST00000416060	T;T	0.64085	-0.08;-0.08	5.69	5.69	0.88448	Cadherin (3);Cadherin-like (1);	0.067157	0.64402	D	0.000016	D	0.84705	0.5531	H	0.94582	3.555	0.80722	D	1	P;D;D;D	0.76494	0.786;0.997;0.999;0.983	P;P;D;P	0.79108	0.731;0.88;0.992;0.808	D	0.88563	0.3124	10	0.87932	D	0	.	16.1126	0.81273	0.0:0.1336:0.8664:0.0	.	476;479;476;476	Q6P152;G3XCN8;Q9H251;Q9H251-5	.;.;CAD23_HUMAN;.	V	481;476;476;476;476;479;479;391	ENSP00000381789:G476V;ENSP00000381822:G476V	ENSP00000224721:G481V	G	+	2	0	CDH23	73076358	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.885000	0.87282	2.684000	0.91462	0.650000	0.86243	GGG		0.562	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		24	167	1	0	1.99505e-19	0.002445	3.21237e-19	24	167				
PIPSL	266971	broad.mit.edu	37	10	95720433	95720433	+	RNA	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr10:95720433G>T	ENST00000480546.1	-	0	864					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										TCCAAAAAAAGACCATCAGGG	0.488																																							uc009xuj.2		NA																	0					0						c.(721-723)CTT>ATT		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																						266971							g.chr10:95720433G>T	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95720433G>T			Somatic					p.L241I	NR_002319		WXS	Illumina HiSeq	Unspecified					1	1240	-								Q6NUK8	Missense_Mutation	SNP	ENST00000480546.1	37	c.721C>A																																																																																					0.488	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319		9	46	1	0	1.58986e-06	0.008291	2.05493e-06	9	46				
SHOC2	8036	broad.mit.edu	37	10	112696573	112696573	+	Intron	SNP	T	T	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr10:112696573T>C	ENST00000369452.4	+	1	111				SHOC2_ENST00000265277.5_Intron|SHOC2_ENST00000489390.1_Intron	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)						fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)	p.H140R(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		GTGAGCCAGGTGCCCCAGATA	0.537																																							uc010qrh.1		NA																	2	Substitution - Missense(2)		prostate(1)|kidney(1)		0						c.(418-420)CAC>CGC		SubName: Full=cDNA FLJ51256, highly similar to 60S ribosomal protein L13a;																																				SO:0001627	intron_variant	644511							g.chr10:112696573T>C	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.-235+17158T>C	10.37:g.112696573T>C			Somatic				SHOC2_uc001kzl.3_Intron|SHOC2_uc009xxx.2_Intron|SHOC2_uc010qrg.1_Intron	p.H140R	NR_026715		WXS	Illumina HiSeq	Unspecified					1	441	-								A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	ENST00000369452.4	37	c.419A>G	CCDS7568.1																																																																																				0.537	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050355.1	NM_007373		2	9	0	0	0	0.004672	0	2	9				
HMX2	3167	broad.mit.edu	37	10	124908149	124908149	+	Silent	SNP	T	T	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr10:124908149T>C	ENST00000339992.3	+	1	512	c.255T>C	c.(253-255)ccT>ccC	p.P85P		NM_005519.1	NP_005510.1	A2RU54	HMX2_HUMAN	H6 family homeobox 2	85					brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|lung(4)|prostate(1)	7		all_neural(114;0.169)|Colorectal(57;0.207)|Glioma(114;0.222)		Colorectal(40;0.123)|COAD - Colon adenocarcinoma(40;0.141)		CCCCCATCCCTTTTCCTTGCC	0.711																																							uc001lhc.1		NA																	0					0						c.(253-255)CCT>CCC		H6 family homeobox 2							31.0	40.0	37.0					10																	124908149		2203	4300	6503	SO:0001819	synonymous_variant	3167				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:124908149T>C		CCDS31305.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188816	ENSG00000188816		"""Homeoboxes / ANTP class : NKL subclass"""	5018	protein-coding gene	gene with protein product		600647	"""homeo box (H6 family) 2"""			7647458	Standard	XM_005269743		Approved	NKX5-2	uc001lhc.1	A2RU54	OTTHUMG00000019198	ENST00000339992.3:c.255T>C	10.37:g.124908149T>C			Somatic					p.P85P	NM_005519	NP_005510	WXS	Illumina HiSeq	Unspecified	A2RU54	HMX2_HUMAN		Colorectal(40;0.123)|COAD - Colon adenocarcinoma(40;0.141)	1	512	+		all_neural(114;0.169)|Colorectal(57;0.207)|Glioma(114;0.222)	85					B2RNV5	Silent	SNP	ENST00000339992.3	37	c.255T>C	CCDS31305.1																																																																																				0.711	HMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050841.1	XM_370580		3	64	0	0	0	0.000248	0	3	64				
MUC5B	727897	broad.mit.edu	37	11	1263477	1263477	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:1263477G>A	ENST00000529681.1	+	31	5425	c.5367G>A	c.(5365-5367)gaG>gaA	p.E1789E	MUC5B_ENST00000447027.1_Silent_p.E1792E|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1789	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGAAGTGTGAGTGGACAGAGT	0.587																																							uc009ycr.1		NA																	0					0						c.(7444-7446)GAG>GAA		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							57.0	66.0	63.0					11																	1263477		2114	4218	6332	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1263477G>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5367G>A	11.37:g.1263477G>A			Somatic				MUC5B_uc001ltb.2_Silent_p.E1792E	p.E2482E	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	47	7572	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	1789			7 X Cys-rich subdomain repeats.|Thr-rich.|Cys-rich subdomain 3.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.7446G>A	CCDS44515.2																																																																																				0.587	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		13	97	0	0	0	0.00245	0	13	97				
TRIM21	6737	broad.mit.edu	37	11	4409573	4409573	+	Missense_Mutation	SNP	T	T	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:4409573T>A	ENST00000254436.7	-	4	804	c.692A>T	c.(691-693)gAg>gTg	p.E231V	TRIM21_ENST00000543625.1_Missense_Mutation_p.E231V	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	231			E -> K (in dbSNP:rs2554934).		cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		TCGATCTAGCTCTGAGATGAG	0.557																																							uc001lyy.1		NA																	0				ovary(3)|lung(1)	4						c.(691-693)GAG>GTG		tripartite motif protein 21							84.0	85.0	85.0					11																	4409573		1992	4169	6161	SO:0001583	missense	6737				cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:4409573T>A	AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.692A>T	11.37:g.4409573T>A	ENSP00000254436:p.Glu231Val		Somatic					p.E231V	NM_003141	NP_003132	WXS	Illumina HiSeq	Unspecified	P19474	RO52_HUMAN		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)	4	805	-		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	231			Potential.		Q5XPV5|Q96RF8	Missense_Mutation	SNP	ENST00000254436.7	37	c.692A>T	CCDS44525.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.507217	0.44558	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.10192	2.9;2.9	4.34	4.34	0.51931	.	0.000000	0.52532	D	0.000068	T	0.33323	0.0859	M	0.91612	3.225	0.29082	N	0.88263	D	0.63880	0.993	P	0.58520	0.84	T	0.40059	-0.9583	10	0.87932	D	0	.	10.2109	0.43141	0.0:0.0:0.0:1.0	.	231	P19474	RO52_HUMAN	V	231	ENSP00000254436:E231V;ENSP00000444045:E231V	ENSP00000254436:E231V	E	-	2	0	TRIM21	4366149	0.994000	0.37717	0.908000	0.35775	0.138000	0.21146	5.433000	0.66520	2.180000	0.69256	0.533000	0.62120	GAG		0.557	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385842.1	NM_003141		10	67	0	0	0	0.000978	0	10	67				
OR51V1	283111	broad.mit.edu	37	11	5221240	5221240	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:5221240G>A	ENST00000321255.1	-	1	690	c.691C>T	c.(691-693)Ctt>Ttt	p.L231F		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	231					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTGACTTAAGAATCAGGATG	0.433																																							uc010qyz.1		NA																	0				skin(1)	1						c.(691-693)CTT>TTT		olfactory receptor, family 51, subfamily V,							84.0	81.0	82.0					11																	5221240		2201	4298	6499	SO:0001583	missense	283111				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5221240G>A	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.691C>T	11.37:g.5221240G>A	ENSP00000321729:p.Leu231Phe		Somatic					p.L231F	NM_001004760	NP_001004760	WXS	Illumina HiSeq	Unspecified	Q9H2C8	O51V1_HUMAN		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	691	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	231			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000321255.1	37	c.691C>T	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.271816	0.23221	.	.	ENSG00000176742	ENST00000321255	T	0.38887	1.11	5.27	-0.588	0.11687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	D	0.000824	T	0.42966	0.1226	M	0.73598	2.24	0.09310	N	1	P	0.35944	0.529	B	0.44163	0.443	T	0.42068	-0.9473	10	0.66056	D	0.02	.	3.7773	0.08665	0.3364:0.0:0.2653:0.3983	.	231	Q9H2C8	O51V1_HUMAN	F	231	ENSP00000321729:L231F	ENSP00000321729:L231F	L	-	1	0	OR51V1	5177816	0.000000	0.05858	0.013000	0.15412	0.065000	0.16274	-1.809000	0.01731	-0.267000	0.09325	0.655000	0.94253	CTT		0.433	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760		8	53	0	0	0	0.00308	0	8	53				
PSMA1	5682	broad.mit.edu	37	11	14526749	14526749	+	Missense_Mutation	SNP	T	T	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:14526749T>C	ENST00000396394.2	-	10	1177	c.781A>G	c.(781-783)Atg>Gtg	p.M261V	PSMA1_ENST00000530457.1_Missense_Mutation_p.M236V|PSMA1_ENST00000418988.2_Missense_Mutation_p.M267V|PSMA1_ENST00000419365.2_3'UTR|PSMA1_ENST00000524606.1_5'UTR|PSMA1_ENST00000396393.1_Missense_Mutation_p.M261V|PSMA1_ENST00000555531.1_3'UTR	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	261					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						TAATGTTCCATTGGTTCATCA	0.333																																							uc001mlk.2		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(781-783)ATG>GTG		proteasome alpha 1 subunit isoform 2							181.0	189.0	186.0					11																	14526749		2200	4294	6494	SO:0001583	missense	5682				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity	g.chr11:14526749T>C	X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.781A>G	11.37:g.14526749T>C	ENSP00000379676:p.Met261Val		Somatic				PSMA1_uc001mll.2_Missense_Mutation_p.M267V|PSMA1_uc010rcp.1_RNA|PSMA1_uc001mlj.2_Missense_Mutation_p.M236V	p.M261V	NM_002786	NP_002777	WXS	Illumina HiSeq	Unspecified	P25786	PSA1_HUMAN			10	927	-			261					A8K400|Q53YE8|Q9BRV9	Missense_Mutation	SNP	ENST00000396394.2	37	c.781A>G	CCDS7816.1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652131	0.47362	.	.	ENSG00000129084	ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	T;T;T;T	0.28895	1.61;1.61;1.59;1.6	5.35	5.35	0.76521	.	0.072816	0.85682	D	0.000000	T	0.34221	0.0890	L	0.45137	1.4	0.80722	D	1	B;B	0.14805	0.011;0.006	B;B	0.34652	0.187;0.019	T	0.19976	-1.0289	10	0.66056	D	0.02	-6.9785	13.8489	0.63485	0.0:0.0:0.0:1.0	.	267;261	P25786-2;P25786	.;PSA1_HUMAN	V	261;261;236;267	ENSP00000379676:M261V;ENSP00000379675:M261V;ENSP00000441166:M236V;ENSP00000414359:M267V	ENSP00000379675:M261V	M	-	1	0	PSMA1	14483325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.503000	0.66962	2.145000	0.66743	0.482000	0.46254	ATG		0.333	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386421.3	NM_002786		20	174	0	0	0	0.001786	0	20	174				
PTPN5	84867	broad.mit.edu	37	11	18755170	18755170	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:18755170C>G	ENST00000358540.2	-	10	1443	c.1013G>C	c.(1012-1014)aGa>aCa	p.R338T	PTPN5_ENST00000396170.1_Missense_Mutation_p.R306T|PTPN5_ENST00000396166.3_5'Flank|PTPN5_ENST00000396171.4_Missense_Mutation_p.R338T|PTPN5_ENST00000396168.1_Missense_Mutation_p.R314T|PTPN5_ENST00000396167.2_Missense_Mutation_p.R306T|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000477854.1_Missense_Mutation_p.R142T	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	338	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						CAGACACACTCTGCTGTGAGG	0.572																																							uc001mpd.2		NA																	0				ovary(2)	2						c.(1012-1014)AGA>ACA		protein-tyrosine-phosphatase non-receptor 5							162.0	150.0	154.0					11																	18755170		2199	4293	6492	SO:0001583	missense	84867					integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity	g.chr11:18755170C>G	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1013G>C	11.37:g.18755170C>G	ENSP00000351342:p.Arg338Thr		Somatic				PTPN5_uc001mpb.2_Missense_Mutation_p.R306T|PTPN5_uc001mpc.2_Missense_Mutation_p.R338T|PTPN5_uc001mpe.2_Missense_Mutation_p.R306T|PTPN5_uc010rdj.1_Missense_Mutation_p.R282T|PTPN5_uc001mpf.2_Missense_Mutation_p.R314T|PTPN5_uc010rdk.1_Missense_Mutation_p.R283T	p.R338T	NM_006906	NP_008837	WXS	Illumina HiSeq	Unspecified	P54829	PTN5_HUMAN			10	1444	-			338			Tyrosine-protein phosphatase.		B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	c.1013G>C	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046100	0.93740	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79	5.67	5.67	0.87782	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.83834	0.5340	H	0.99535	4.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90813	0.4703	10	0.87932	D	0	.	19.773	0.96379	0.0:1.0:0.0:0.0	.	338;306	P54829;B3KXG7	PTN5_HUMAN;.	T	142;338;306;338;306;314	ENSP00000435056:R142T;ENSP00000351342:R338T;ENSP00000379473:R306T;ENSP00000379474:R338T;ENSP00000379470:R306T;ENSP00000379471:R314T	ENSP00000351342:R338T	R	-	2	0	PTPN5	18711746	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.619000	0.67729	2.677000	0.91161	0.655000	0.94253	AGA		0.572	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970		5	116	0	0	0	0.000602	0	5	116				
OR4C15	81309	broad.mit.edu	37	11	55321821	55321821	+	Silent	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:55321821A>T	ENST00000314644.2	+	1	39	c.39A>T	c.(37-39)gcA>gcT	p.A13A		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						ATAATTTTGCACTTGGATGTA	0.323										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(37-39)GCA>GCT		olfactory receptor, family 4, subfamily C,							123.0	122.0	122.0					11																	55321821		2201	4296	6497	SO:0001819	synonymous_variant	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55321821A>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.39A>T	11.37:g.55321821A>T		HNSCC(20;0.049)	Somatic					p.A13A	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	39	+			Error:Variant_position_missing_in_Q8NGM1_after_alignment					Q6IFE2	Silent	SNP	ENST00000314644.2	37	c.39A>T	CCDS31501.1																																																																																				0.323	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		16	84	0	0	0	0.006122	0	16	84				
OR8H3	390152	broad.mit.edu	37	11	55890560	55890560	+	Missense_Mutation	SNP	T	T	A	rs143312423		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:55890560T>A	ENST00000313472.3	+	1	712	c.712T>A	c.(712-714)Ttc>Atc	p.F238I		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					GCAGAAAGCTTTCTCTACTTG	0.403																																							uc001nii.1		NA																	0				ovary(2)	2						c.(712-714)TTC>ATC		olfactory receptor, family 8, subfamily H,							128.0	121.0	123.0					11																	55890560		2201	4296	6497	SO:0001583	missense	390152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55890560T>A	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.712T>A	11.37:g.55890560T>A	ENSP00000323928:p.Phe238Ile		Somatic					p.F238I	NM_001005201	NP_001005201	WXS	Illumina HiSeq	Unspecified	Q8N146	OR8H3_HUMAN			1	712	+	Esophageal squamous(21;0.00693)		238			Helical; Name=6; (Potential).		Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	c.712T>A	CCDS31519.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.753039	0.49362	.	.	ENSG00000181761	ENST00000313472	T	0.00287	8.29	3.62	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000034	T	0.00695	0.0023	M	0.91249	3.19	0.34401	D	0.695324	P	0.50369	0.934	P	0.58172	0.834	T	0.53507	-0.8429	10	0.52906	T	0.07	.	12.565	0.56304	0.0:0.0:0.0:1.0	.	238	Q8N146	OR8H3_HUMAN	I	238	ENSP00000323928:F238I	ENSP00000323928:F238I	F	+	1	0	OR8H3	55647136	0.504000	0.26123	0.993000	0.49108	0.335000	0.28730	0.782000	0.26788	1.415000	0.47037	0.145000	0.16022	TTC		0.403	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		11	70	0	0	0	0.000978	0	11	70				
OR8J3	81168	broad.mit.edu	37	11	55904714	55904714	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:55904714G>T	ENST00000301529.1	-	1	480	c.481C>A	c.(481-483)Cct>Act	p.P161T		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					AATATACAAGGTGAAACCACA	0.423																																							uc010riz.1		NA																	0				skin(2)	2						c.(481-483)CCT>ACT		olfactory receptor, family 8, subfamily J,							93.0	91.0	92.0					11																	55904714		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904714G>T		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.481C>A	11.37:g.55904714G>T	ENSP00000301529:p.Pro161Thr		Somatic					p.P161T	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	481	-	Esophageal squamous(21;0.00693)		161			Extracellular (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.481C>A	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016699	0.35606	.	.	ENSG00000167822	ENST00000301529	T	0.36520	1.25	3.26	-3.59	0.04583	GPCR, rhodopsin-like superfamily (1);	0.524249	0.19198	N	0.120258	T	0.08846	0.0219	N	0.02142	-0.665	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.18935	-1.0321	10	0.22109	T	0.4	.	0.7761	0.01033	0.1608:0.1927:0.2614:0.3851	.	161	Q8NGG0	OR8J3_HUMAN	T	161	ENSP00000301529:P161T	ENSP00000301529:P161T	P	-	1	0	OR8J3	55661290	0.000000	0.05858	0.000000	0.03702	0.827000	0.46813	-1.485000	0.02314	-0.190000	0.10465	0.289000	0.19496	CCT		0.423	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		13	74	1	0	0.00010058	0.001368	0.000119439	13	74				
OR6Q1	219952	broad.mit.edu	37	11	57799060	57799060	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:57799060G>A	ENST00000302622.3	+	1	659	c.636G>A	c.(634-636)ctG>ctA	p.L212L	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				CTGTGCTACTGGCCTCCTCTA	0.547																																							uc010rjz.1		NA																	0				kidney(1)	1						c.(634-636)CTG>CTA		olfactory receptor, family 6, subfamily Q,							198.0	170.0	180.0					11																	57799060		2201	4296	6497	SO:0001819	synonymous_variant	219952				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57799060G>A	AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.636G>A	11.37:g.57799060G>A			Somatic				OR9Q1_uc001nmj.2_Intron	p.L212L	NM_001005186	NP_001005186	WXS	Illumina HiSeq	Unspecified	Q8NGQ2	OR6Q1_HUMAN			1	636	+		Breast(21;0.0707)|all_epithelial(135;0.142)	212			Helical; Name=5; (Potential).		B9EKW1|Q6IFH1|Q96R34	Silent	SNP	ENST00000302622.3	37	c.636G>A	CCDS31541.1																																																																																				0.547	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186		16	73	0	0	0	0.006122	0	16	73				
TAF6L	10629	broad.mit.edu	37	11	62554190	62554190	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:62554190C>T	ENST00000294168.3	+	11	1492	c.1291C>T	c.(1291-1293)Cct>Tct	p.P431S	TMEM179B_ENST00000533861.1_5'Flank|TMEM179B_ENST00000333449.4_5'Flank|RP11-727F15.12_ENST00000601484.1_RNA|TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	431					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						GCCGGAGGACCCTTCTCTTTC	0.677											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001nvc.2		NA																	0				ovary(3)	3						c.(1291-1293)CCT>TCT		TAF6-like RNA polymerase II							16.0	19.0	18.0					11																	62554190		2192	4290	6482	SO:0001583	missense	10629				chromatin remodeling|histone H3 acetylation|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	histone deacetylase complex|STAGA complex	DNA binding|protein binding|transcription coactivator activity	g.chr11:62554190C>T	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.1291C>T	11.37:g.62554190C>T	ENSP00000294168:p.Pro431Ser		Somatic	OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1062	TMEM179B_uc001nvd.3_5'Flank	p.P431S	NM_006473	NP_006464	WXS	Illumina HiSeq	Unspecified	Q9Y6J9	TAF6L_HUMAN			11	1392	+			431					B2RAT0|Q96HA6	Missense_Mutation	SNP	ENST00000294168.3	37	c.1291C>T	CCDS8035.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560837	0.45590	.	.	ENSG00000162227	ENST00000294168	T	0.44881	0.91	4.67	4.67	0.58626	.	0.164390	0.42821	D	0.000652	T	0.23249	0.0562	N	0.19112	0.55	0.80722	D	1	P	0.43750	0.816	B	0.32980	0.156	T	0.04360	-1.0957	10	0.44086	T	0.13	-10.9277	10.4966	0.44780	0.1935:0.8065:0.0:0.0	.	431	Q9Y6J9	TAF6L_HUMAN	S	431	ENSP00000294168:P431S	ENSP00000294168:P431S	P	+	1	0	TAF6L	62310766	0.000000	0.05858	0.177000	0.23020	0.606000	0.37113	0.612000	0.24283	2.585000	0.87301	0.655000	0.94253	CCT		0.677	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395352.1	NM_006473		5	33	0	0	0	0.001984	0	5	33				
MUS81	80198	broad.mit.edu	37	11	65631311	65631311	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:65631311A>T	ENST00000308110.4	+	10	1347	c.998A>T	c.(997-999)gAg>gTg	p.E333V	CFL1_ENST00000534769.1_5'Flank|MUS81_ENST00000533035.1_Missense_Mutation_p.E258V|EFEMP2_ENST00000532648.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	333	ERCC4.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		CACATTGTGGAGCGCAAGCGA	0.607								Homologous recombination																															uc001ofv.3		NA																	0					0						c.(997-999)GAG>GTG	Homologous_recombination	MUS81 endonuclease homolog							101.0	102.0	101.0					11																	65631311		2201	4296	6497	SO:0001583	missense	80198				DNA recombination|DNA repair	nucleolus	3'-flap endonuclease activity|DNA binding|metal ion binding|protein binding	g.chr11:65631311A>T		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.998A>T	11.37:g.65631311A>T	ENSP00000307853:p.Glu333Val		Somatic				MUS81_uc001ofw.3_RNA|MUS81_uc001ofx.3_5'UTR	p.E333V	NM_025128	NP_079404	WXS	Illumina HiSeq	Unspecified	Q96NY9	MUS81_HUMAN		READ - Rectum adenocarcinoma(159;0.166)	10	1351	+			333	ER->AG: Loss of activity.		ERCC4.		Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	37	c.998A>T	CCDS8115.1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.921795	0.52653	.	.	ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855	T;T	0.59772	0.24;0.24	5.42	4.28	0.50868	DNA repair nuclease, XPF-type/Helicase (1);Restriction endonuclease, type II-like (1);ERCC4 domain (2);	0.103825	0.64402	D	0.000004	D	0.82421	0.5033	H	0.97291	3.975	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.85670	0.1294	10	0.87932	D	0	-29.7059	9.9843	0.41832	0.8484:0.0:0.0:0.1516	.	333	Q96NY9	MUS81_HUMAN	V	258;333;333	ENSP00000432287:E258V;ENSP00000307853:E333V	ENSP00000307853:E333V	E	+	2	0	MUS81	65387887	1.000000	0.71417	0.997000	0.53966	0.027000	0.11550	5.931000	0.70113	1.047000	0.40274	-0.336000	0.08194	GAG		0.607	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128		24	92	0	0	0	0.001786	0	24	92				
FAM181B	220382	broad.mit.edu	37	11	82443620	82443620	+	Silent	SNP	C	C	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:82443620C>G	ENST00000329203.3	-	1	1286	c.1152G>C	c.(1150-1152)ccG>ccC	p.P384P		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	384	Pro-rich.									large_intestine(1)|lung(2)|prostate(1)	4						GCGGCGGCGGCGGGGGCAGGG	0.701																																							uc001ozp.2		NA																	0				large_intestine(1)	1						c.(1150-1152)CCG>CCC		hypothetical protein LOC220382							5.0	7.0	6.0					11																	82443620		1845	3941	5786	SO:0001819	synonymous_variant	220382							g.chr11:82443620C>G	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.1152G>C	11.37:g.82443620C>G			Somatic					p.P384P	NM_175885	NP_787081	WXS	Illumina HiSeq	Unspecified	A6NEQ2	F181B_HUMAN			1	1287	-			384			Pro-rich.		B2RWP1	Silent	SNP	ENST00000329203.3	37	c.1152G>C	CCDS31648.1																																																																																				0.701	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391626.1	NM_175885		2	13	0	0	0	0.004672	0	2	13				
GUCY1A2	2977	broad.mit.edu	37	11	106856830	106856830	+	Missense_Mutation	SNP	T	T	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:106856830T>A	ENST00000526355.2	-	2	799	c.331A>T	c.(331-333)Agg>Tgg	p.R111W	GUCY1A2_ENST00000347596.2_Missense_Mutation_p.R111W|GUCY1A2_ENST00000282249.2_Missense_Mutation_p.R111W	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	111					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TGCAGTGTCCTCTTGAGAGTC	0.343																																							uc001pjg.1		NA																	0				large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8						c.(331-333)AGG>TGG		guanylate cyclase 1, soluble, alpha 2							104.0	99.0	101.0					11																	106856830		2201	4298	6499	SO:0001583	missense	2977				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding	g.chr11:106856830T>A	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.331A>T	11.37:g.106856830T>A	ENSP00000431245:p.Arg111Trp		Somatic				GUCY1A2_uc010rvo.1_Missense_Mutation_p.R111W|GUCY1A2_uc009yxn.1_Missense_Mutation_p.R111W	p.R111W	NM_000855	NP_000846	WXS	Illumina HiSeq	Unspecified	P33402	GCYA2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	2	721	-		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)	111					A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	c.331A>T	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.272441	0.80580	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.90324	-2.3;-2.65;-2.31	5.32	5.32	0.75619	.	0.000000	0.44285	U	0.000471	D	0.93762	0.8006	L	0.58810	1.83	0.50813	D	0.999897	D;D;P	0.76494	0.994;0.999;0.947	P;D;P	0.83275	0.841;0.996;0.721	D	0.94226	0.7472	10	0.87932	D	0	.	12.9618	0.58462	0.0:0.0:0.0:1.0	.	111;111;111	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	W	111	ENSP00000431245:R111W;ENSP00000282249:R111W;ENSP00000344874:R111W	ENSP00000282249:R111W	R	-	1	2	GUCY1A2	106362040	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.143000	0.64826	2.144000	0.66660	0.455000	0.32223	AGG		0.343	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			15	75	0	0	0	0.004007	0	15	75				
HTR3B	9177	broad.mit.edu	37	11	113803729	113803729	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:113803729G>A	ENST00000260191.2	+	6	867	c.610G>A	c.(610-612)Gac>Aac	p.D204N	HTR3B_ENST00000537778.1_Missense_Mutation_p.D193N	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	204					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	GTTTTTGAATGACAGTGAGTG	0.453																																							uc001pok.2		NA																	0					0						c.(610-612)GAC>AAC		5-hydroxytryptamine (serotonin) receptor 3B							150.0	135.0	140.0					11																	113803729		2201	4296	6497	SO:0001583	missense	9177				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity	g.chr11:113803729G>A	AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.610G>A	11.37:g.113803729G>A	ENSP00000260191:p.Asp204Asn		Somatic				HTR3B_uc001pol.2_Missense_Mutation_p.D193N	p.D204N	NM_006028	NP_006019	WXS	Illumina HiSeq	Unspecified	O95264	5HT3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	6	677	+		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	204			Extracellular (Potential).		B0YJ23|Q0VJC3	Missense_Mutation	SNP	ENST00000260191.2	37	c.610G>A	CCDS8364.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.96|12.96	2.093285|2.093285	0.36952|0.36952	.|.	.|.	ENSG00000149305|ENSG00000149305	ENST00000260191;ENST00000537778|ENST00000543092	T;T|.	0.76316|.	-1.01;-1.01|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.40423|0.40423	0.1116|0.1116	N|N	0.05554|0.05554	-0.025|-0.025	0.49582|0.49582	D|D	0.9998|0.9998	P;D|.	0.76494|.	0.498;0.999|.	B;D|.	0.68765|.	0.166;0.96|.	T|T	0.29427|0.29427	-1.0012|-1.0012	10|5	0.09084|.	T|.	0.74|.	-25.5489|-25.5489	15.7666|15.7666	0.78131|0.78131	0.0:0.1366:0.8634:0.0|0.0:0.1366:0.8634:0.0	.|.	193;204|.	O95264-2;O95264|.	.;5HT3B_HUMAN|.	N|I	204;193|132	ENSP00000260191:D204N;ENSP00000443118:D193N|.	ENSP00000260191:D204N|.	D|M	+|+	1|3	0|0	HTR3B|HTR3B	113308939|113308939	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	1.846000|1.846000	0.39289|0.39289	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAC|ATG		0.453	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398842.1	NM_006028		6	42	0	0	0	0.001168	0	6	42				
DCPS	28960	broad.mit.edu	37	11	126174154	126174154	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:126174154A>T	ENST00000263579.4	+	1	508	c.179A>T	c.(178-180)aAa>aTa	p.K60I	RP11-712L6.5_ENST00000524964.1_Missense_Mutation_p.L3M	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger	60					cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)			endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		GCGCGGGACAAAATCATTTTC	0.537																																							uc001qdp.2		NA																	0					0						c.(178-180)AAA>ATA		mRNA decapping enzyme							77.0	75.0	76.0					11																	126174154		2201	4298	6499	SO:0001583	missense	28960				deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding	g.chr11:126174154A>T	AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.179A>T	11.37:g.126174154A>T	ENSP00000263579:p.Lys60Ile		Somatic					p.K60I	NM_014026	NP_054745	WXS	Illumina HiSeq	Unspecified	Q96C86	DCPS_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)	1	508	+	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)	60					Q8NHL8|Q9Y2S5	Missense_Mutation	SNP	ENST00000263579.4	37	c.179A>T	CCDS8473.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	29.6|29.6	5.016898|5.016898	0.93404|0.93404	.|.	.|.	ENSG00000110063|ENSG00000255062	ENST00000263579|ENST00000524964	T|.	0.59638|.	0.25|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Scavenger mRNA decapping enzyme, N-terminal (1);|.	0.102964|.	0.64402|.	D|.	0.000005|.	T|T	0.79953|0.79953	0.4535|0.4535	M|M	0.89214|0.89214	3.015|3.015	0.52099|0.52099	D|D	0.999942|0.999942	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.84003|0.84003	0.0344|0.0344	10|6	0.87932|0.87932	D|D	0|0	-21.3525|-21.3525	13.1724|13.1724	0.59606|0.59606	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	60|.	Q96C86|.	DCPS_HUMAN|.	I|M	60|3	ENSP00000263579:K60I|.	ENSP00000263579:K60I|ENSP00000436320:L3M	K|L	+|-	2|1	0|2	DCPS|RP11-712L6.5	125679364|125679364	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.009000|5.009000	0.63998|0.63998	2.143000|2.143000	0.66587|0.66587	0.482000|0.482000	0.46254|0.46254	AAA|TTG		0.537	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	NM_014026		19	99	0	0	0	0.001882	0	19	99				
FLI1	2313	broad.mit.edu	37	11	128680399	128680399	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:128680399C>T	ENST00000527786.2	+	9	1364	c.875C>T	c.(874-876)tCc>tTc	p.S292F	FLI1_ENST00000344954.6_Missense_Mutation_p.S259F|FLI1_ENST00000525560.1_Missense_Mutation_p.S99F|FLI1_ENST00000534087.2_Missense_Mutation_p.S259F|FLI1_ENST00000281428.8_Missense_Mutation_p.S226F	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	292					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GAGCTGCTCTCCGACAGCGCC	0.627			T	EWSR1	Ewing sarcoma																																		uc010sbu.1		NA		Dom	yes		11	11q24	2313	T	Friend leukemia virus integration 1			M	EWSR1		Ewing sarcoma	EWSR1/FLI1(2266)	0				bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273						c.(874-876)TCC>TTC		Friend leukemia virus integration 1							17.0	19.0	18.0					11																	128680399		2176	4293	6469	SO:0001583	missense	2313				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:128680399C>T	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.875C>T	11.37:g.128680399C>T	ENSP00000433488:p.Ser292Phe		Somatic				FLI1_uc010sbt.1_Missense_Mutation_p.S99F|FLI1_uc010sbv.1_Missense_Mutation_p.S259F|FLI1_uc009zci.2_Missense_Mutation_p.S226F	p.S292F	NM_002017	NP_002008	WXS	Illumina HiSeq	Unspecified	Q01543	FLI1_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)	9	1216	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)	292			ETS.		B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	37	c.875C>T	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208798	0.79240	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.63	5.63	0.86233	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.106359	0.64402	D	0.000003	T	0.54775	0.1879	M	0.74389	2.26	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.995;0.996;0.998	T	0.56721	-0.7932	10	0.87932	D	0	.	19.6723	0.95915	0.0:1.0:0.0:0.0	.	292;99;226	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	F	99;259;292;259;226	ENSP00000437124:S99F;ENSP00000339627:S259F;ENSP00000399985:S292F;ENSP00000432950:S259F;ENSP00000281428:S226F	ENSP00000281428:S226F	S	+	2	0	FLI1	128185609	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.818000	0.86416	2.656000	0.90262	0.585000	0.79938	TCC		0.627	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017		5	11	0	0	0	0.000602	0	5	11				
BARX2	8538	broad.mit.edu	37	11	129246035	129246035	+	Silent	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr11:129246035C>A	ENST00000281437.4	+	1	201	c.105C>A	c.(103-105)acC>acA	p.T35T		NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	35					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CCAAGGAGACCTGCGATTACT	0.602											OREG0021508	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qfc.3		NA																	0					0						c.(103-105)ACC>ACA		BarH-like homeobox 2							144.0	155.0	152.0					11																	129246035		2201	4297	6498	SO:0001819	synonymous_variant	8538							g.chr11:129246035C>A	AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.105C>A	11.37:g.129246035C>A			Somatic	OREG0021508	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1571		p.T35T	NM_003658	NP_003649	WXS	Illumina HiSeq	Unspecified	Q9UMQ3	BARX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)	1	155	+	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	35					O43518|Q6NT51	Silent	SNP	ENST00000281437.4	37	c.105C>A	CCDS8481.1																																																																																				0.602	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386153.1	NM_003658		29	166	1	0	6.05902e-23	0.003755	9.92425e-23	29	166				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		3	33	1	0	0.000602214	0.000602	0.000697687	3	33				
KIAA1551	55196	broad.mit.edu	37	12	32134631	32134631	+	Nonsense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:32134631C>T	ENST00000312561.4	+	4	1156	c.742C>T	c.(742-744)Cag>Tag	p.Q248*	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	248																	TAAAAATAGTCAGCTTCTAAA	0.393																																							uc001rks.2		NA																	0				ovary(1)|skin(1)	2						c.(742-744)CAG>TAG		hypothetical protein LOC55196							64.0	66.0	65.0					12																	32134631		2203	4300	6503	SO:0001587	stop_gained	55196							g.chr12:32134631C>T	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.742C>T	12.37:g.32134631C>T	ENSP00000310338:p.Gln248*		Somatic					p.Q248*	NM_018169	NP_060639	WXS	Illumina HiSeq	Unspecified	Q9HCM1	CL035_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0114)		4	1156	+	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		248					B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Nonsense_Mutation	SNP	ENST00000312561.4	37	c.742C>T	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	C	37	6.253762	0.97417	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	.	.	.	5.27	4.35	0.52113	.	2.464180	0.01398	N	0.013492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6134	0.62092	0.0:0.8443:0.1557:0.0	.	.	.	.	X	248	.	.	Q	+	1	0	C12orf35	32025898	0.004000	0.15560	0.004000	0.12327	0.049000	0.14656	1.047000	0.30367	1.163000	0.42636	0.650000	0.86243	CAG		0.393	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169		6	60	0	0	0	0.001984	0	6	60				
BICD1	636	broad.mit.edu	37	12	32458919	32458919	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:32458919C>T	ENST00000281474.5	+	4	971	c.868C>T	c.(868-870)Cat>Tat	p.H290Y	BICD1_ENST00000548411.1_Missense_Mutation_p.H290Y	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	290					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CGGTCATATCCATGGGCCTCT	0.448																																							uc001rku.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(868-870)CAT>TAT		bicaudal D homolog 1 isoform 1							115.0	112.0	113.0					12																	32458919		2203	4300	6503	SO:0001583	missense	636				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton	g.chr12:32458919C>T	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.868C>T	12.37:g.32458919C>T	ENSP00000281474:p.His290Tyr		Somatic				BICD1_uc001rkv.2_Missense_Mutation_p.H290Y|BICD1_uc010skd.1_RNA	p.H290Y	NM_001714	NP_001705	WXS	Illumina HiSeq	Unspecified	Q96G01	BICD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0201)		4	949	+	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		290					A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	c.868C>T	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787515	0.49997	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.44881	0.91;0.91	4.58	4.58	0.56647	.	0.125962	0.53938	D	0.000058	T	0.43545	0.1252	L	0.60455	1.87	0.80722	D	1	B;B	0.32620	0.378;0.213	B;B	0.32393	0.145;0.09	T	0.51212	-0.8734	10	0.72032	D	0.01	.	18.0111	0.89224	0.0:1.0:0.0:0.0	.	290;290	F8W113;Q96G01	.;BICD1_HUMAN	Y	290	ENSP00000446793:H290Y;ENSP00000281474:H290Y	ENSP00000281474:H290Y	H	+	1	0	BICD1	32350186	1.000000	0.71417	0.493000	0.27502	0.945000	0.59286	5.102000	0.64572	2.559000	0.86315	0.644000	0.83932	CAT		0.448	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714		5	51	0	0	0	0.001168	0	5	51				
LRP1	4035	broad.mit.edu	37	12	57587439	57587439	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:57587439G>T	ENST00000243077.3	+	47	8241	c.7775G>T	c.(7774-7776)gGg>gTg	p.G2592V	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2592	LDL-receptor class A 12. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GACGACTGTGGGGATGGCTCT	0.602																																							uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(7774-7776)GGG>GTG		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						94.0	84.0	87.0					12																	57587439		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57587439G>T	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7775G>T	12.37:g.57587439G>T	ENSP00000243077:p.Gly2592Val		Somatic				MIR1228_hsa-mir-1228|MI0006318_5'Flank	p.G2592V	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	47	8241	+			2592			Extracellular (Potential).|LDL-receptor class A 12.		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.7775G>T	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710052	0.48517	.	.	ENSG00000123384	ENST00000243077	D	0.95482	-3.72	5.01	5.01	0.66863	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.97626	0.9222	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97737	1.0206	10	0.52906	T	0.07	.	17.2551	0.87053	0.0:0.0:1.0:0.0	.	2592	Q07954	LRP1_HUMAN	V	2592	ENSP00000243077:G2592V	ENSP00000243077:G2592V	G	+	2	0	LRP1	55873706	1.000000	0.71417	0.998000	0.56505	0.109000	0.19521	5.448000	0.66612	2.606000	0.88127	0.655000	0.94253	GGG		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		25	78	1	0	2.61193e-14	0.001786	3.97014e-14	25	78				
LRRIQ1	84125	broad.mit.edu	37	12	85638600	85638600	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:85638600G>C	ENST00000393217.2	+	27	5111	c.5050G>C	c.(5050-5052)Gac>Cac	p.D1684H	LRRIQ1_ENST00000528777.3_3'UTR	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1684										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CACGGATTTAGACCTTTTTTC	0.398																																							uc001tac.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(5050-5052)GAC>CAC		leucine-rich repeats and IQ motif containing 1							122.0	109.0	113.0					12																	85638600		1845	4111	5956	SO:0001583	missense	84125							g.chr12:85638600G>C	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.5050G>C	12.37:g.85638600G>C	ENSP00000376910:p.Asp1684His		Somatic					p.D1684H	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	27	5161	+			1684					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.5050G>C	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642896	0.67244	.	.	ENSG00000133640	ENST00000393217	T	0.61274	0.12	5.9	5.9	0.94986	.	.	.	.	.	T	0.65270	0.2675	N	0.19112	0.55	0.40022	D	0.975425	D	0.89917	1.0	D	0.76575	0.988	T	0.69465	-0.5138	9	0.72032	D	0.01	.	18.4528	0.90710	0.0:0.0:1.0:0.0	.	1684	Q96JM4	LRIQ1_HUMAN	H	1684	ENSP00000376910:D1684H	ENSP00000376910:D1684H	D	+	1	0	LRRIQ1	84162731	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.780000	0.75063	2.793000	0.96121	0.563000	0.77884	GAC		0.398	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		15	79	0	0	0	0.001523	0	15	79				
ANKS1B	56899	broad.mit.edu	37	12	100048885	100048885	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:100048885C>A	ENST00000547776.2	-	9	1231	c.1232G>T	c.(1231-1233)tGt>tTt	p.C411F	ANKS1B_ENST00000329257.7_Missense_Mutation_p.C411F|ANKS1B_ENST00000547010.1_5'UTR	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	411						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		ACATCCATTACACGGAGTTAA	0.403																																							uc001tge.1		NA																	0					0						c.(1231-1233)TGT>TTT		cajalin 2 isoform a							126.0	122.0	124.0					12																	100048885		1904	4116	6020	SO:0001583	missense	56899					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane		g.chr12:100048885C>A	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1232G>T	12.37:g.100048885C>A	ENSP00000449629:p.Cys411Phe		Somatic				ANKS1B_uc001tgf.1_5'UTR|ANKS1B_uc009ztt.1_Missense_Mutation_p.C377F	p.C411F	NM_152788	NP_690001	WXS	Illumina HiSeq	Unspecified	Q7Z6G8	ANS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)	9	1649	-		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)	411					A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	c.1232G>T	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347271	0.61183	.	.	ENSG00000185046	ENST00000547776;ENST00000329257;ENST00000549866	T;T;T	0.75260	0.57;0.57;-0.92	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.80874	0.4707	L	0.40543	1.245	0.80722	D	1	D;D	0.69078	0.997;0.98	D;D	0.78314	0.991;0.962	T	0.79035	-0.1968	9	.	.	.	-5.6295	16.2624	0.82553	0.0:1.0:0.0:0.0	.	377;411	F8VVQ4;Q7Z6G8	.;ANS1B_HUMAN	F	411;411;377	ENSP00000449629:C411F;ENSP00000331381:C411F;ENSP00000449894:C377F	.	C	-	2	0	ANKS1B	98573016	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	4.743000	0.62110	2.573000	0.86826	0.591000	0.81541	TGT		0.403	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140		9	45	1	0	7.03913e-09	0.001368	9.76229e-09	9	45				
SFSWAP	6433	broad.mit.edu	37	12	132281798	132281798	+	Silent	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr12:132281798A>G	ENST00000261674.4	+	16	2751	c.2610A>G	c.(2608-2610)tcA>tcG	p.S870S	SFSWAP_ENST00000539506.1_3'UTR|SFSWAP_ENST00000541286.1_Silent_p.S922S	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	870	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						AGTCGGTGTCACCCAGCAAGC	0.672																																							uc001uja.1		NA																	0					0						c.(2608-2610)TCA>TCG		splicing factor, arginine/serine-rich 8							49.0	61.0	57.0					12																	132281798		2200	4296	6496	SO:0001819	synonymous_variant	6433				mRNA splice site selection|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|RNA binding	g.chr12:132281798A>G	U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.2610A>G	12.37:g.132281798A>G			Somatic				SFRS8_uc010tbn.1_Silent_p.S922S	p.S870S	NM_004592	NP_004583	WXS	Illumina HiSeq	Unspecified	Q12872	SFSWA_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.44e-07)|Epithelial(86;2.94e-06)|all cancers(50;4.82e-05)	16	2750	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		870			Arg/Ser-rich (RS domain).		B2RN45|B7ZM97|F5H6B8|Q6PJF7	Silent	SNP	ENST00000261674.4	37	c.2610A>G	CCDS9273.1																																																																																				0.672	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592		16	77	0	0	0	0.004007	0	16	77				
NALCN	259232	broad.mit.edu	37	13	101712256	101712256	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr13:101712256G>A	ENST00000251127.6	-	42	4900	c.4819C>T	c.(4819-4821)Cgg>Tgg	p.R1607W	NALCN-AS1_ENST00000457843.1_RNA	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1607					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCAGAAACCGGCTCAGCTCT	0.532																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(4819-4821)CGG>TGG		voltage gated channel like 1							141.0	110.0	121.0					13																	101712256		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101712256G>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4819C>T	13.37:g.101712256G>A	ENSP00000251127:p.Arg1607Trp		Somatic					p.R1607W	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			42	5008	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1607			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.4819C>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262292	0.80358	.	.	ENSG00000102452	ENST00000251127	D	0.97870	-4.58	5.55	2.39	0.29439	.	0.054026	0.64402	D	0.000001	D	0.96944	0.9002	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	P	0.60886	0.88	D	0.96595	0.9440	10	0.66056	D	0.02	.	15.2228	0.73327	0.0:0.0:0.5315:0.4685	.	1607	Q8IZF0	NALCN_HUMAN	W	1607	ENSP00000251127:R1607W	ENSP00000251127:R1607W	R	-	1	2	NALCN	100510257	1.000000	0.71417	0.992000	0.48379	0.937000	0.57800	3.586000	0.53950	0.635000	0.30488	0.655000	0.94253	CGG		0.532	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		8	133	0	0	0	0.004482	0	8	133				
SUPT16H	11198	broad.mit.edu	37	14	21836475	21836475	+	Missense_Mutation	SNP	T	T	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr14:21836475T>G	ENST00000216297.2	-	7	1246	c.908A>C	c.(907-909)aAc>aCc	p.N303T		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	303					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		GAGCAAAAAGTTATAATTTTC	0.408																																							uc001wao.2		NA																	0					0						c.(907-909)AAC>ACC		chromatin-specific transcription elongation							84.0	83.0	83.0					14																	21836475		2203	4300	6503	SO:0001583	missense	11198				DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding	g.chr14:21836475T>G	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.908A>C	14.37:g.21836475T>G	ENSP00000216297:p.Asn303Thr		Somatic					p.N303T	NM_007192	NP_009123	WXS	Illumina HiSeq	Unspecified	Q9Y5B9	SP16H_HUMAN	Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)	7	1247	-	all_cancers(95;0.00115)		303					Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	ENST00000216297.2	37	c.908A>C	CCDS9569.1	.	.	.	.	.	.	.	.	.	.	T	4.082	0.013049	0.07912	.	.	ENSG00000092201	ENST00000216297;ENST00000538230	T	0.75938	-0.98	5.56	5.56	0.83823	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	T	0.57770	0.2076	N	0.21097	0.63	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.53436	-0.8439	10	0.11485	T	0.65	-20.5596	11.4787	0.50312	0.0:0.0:0.1502:0.8498	.	303	Q9Y5B9	SP16H_HUMAN	T	303	ENSP00000216297:N303T	ENSP00000216297:N303T	N	-	2	0	SUPT16H	20906315	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.442000	0.44873	2.241000	0.73720	0.533000	0.62120	AAC		0.408	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2			10	67	0	0	0	0.000978	0	10	67				
CHD8	57680	broad.mit.edu	37	14	21873479	21873479	+	Nonsense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr14:21873479C>A	ENST00000557364.1	-	16	3459	c.3196G>T	c.(3196-3198)Gag>Tag	p.E1066*	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Nonsense_Mutation_p.E787*|CHD8_ENST00000399982.2_Nonsense_Mutation_p.E1066*			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1066					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AAATTCTTCTCCAAAATAGCC	0.408																																							uc001was.1		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(2359-2361)GAG>TAG		chromodomain helicase DNA binding protein 8							82.0	75.0	77.0					14																	21873479		1840	4097	5937	SO:0001587	stop_gained	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21873479C>A	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3196G>T	14.37:g.21873479C>A	ENSP00000451601:p.Glu1066*		Somatic				CHD8_uc001war.1_Nonsense_Mutation_p.E683*|CHD8_uc001wav.1_Nonsense_Mutation_p.E229*	p.E787*	NM_020920	NP_065971	WXS	Illumina HiSeq	Unspecified	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	16	2453	-	all_cancers(95;0.00121)		1066					Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Nonsense_Mutation	SNP	ENST00000557364.1	37	c.2359G>T	CCDS53885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.483692|5.483692	0.96307|0.96307	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364|ENST00000555935	.|.	.|.	.|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.73690	.|0.3619	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72459	.|-0.4287	.|3	0.72032|.	D|.	0.01|.	-22.9101|-22.9101	17.6614|17.6614	0.88193|0.88193	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	787;1066;786;1066|291	.|.	ENSP00000262707:E786X|.	E|G	-|-	1|2	0|0	CHD8|CHD8	20943319|20943319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.651000|7.651000	0.83577|0.83577	2.706000|2.706000	0.92434|0.92434	0.561000|0.561000	0.74099|0.74099	GAG|GGA		0.408	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		5	14	1	0	8.12818e-05	0.001984	9.7744e-05	5	14				
SIX6	4990	broad.mit.edu	37	14	60976318	60976318	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr14:60976318C>A	ENST00000327720.5	+	1	650	c.202C>A	c.(202-204)Cgc>Agc	p.R68S		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	68					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.R68S(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		TGGCAACTACCGCGAGCTCTA	0.607																																							uc001xfa.3		NA																	1	Substitution - Missense(1)		NS(1)		0						c.(202-204)CGC>AGC		SIX homeobox 6							46.0	46.0	46.0					14																	60976318		2203	4300	6503	SO:0001583	missense	4990				organ morphogenesis|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:60976318C>A	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.202C>A	14.37:g.60976318C>A	ENSP00000328596:p.Arg68Ser		Somatic					p.R68S	NM_007374	NP_031400	WXS	Illumina HiSeq	Unspecified	O95475	SIX6_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.088)	1	381	+			68					Q6NT42|Q9P1X8	Missense_Mutation	SNP	ENST00000327720.5	37	c.202C>A	CCDS9747.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.002620	0.54254	.	.	ENSG00000184302	ENST00000327720	D	0.97114	-4.25	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	M	0.87547	2.89	0.80722	D	1	P	0.46784	0.884	B	0.40329	0.326	D	0.96708	0.9523	10	0.87932	D	0	.	13.1453	0.59459	0.2612:0.7388:0.0:0.0	.	68	O95475	SIX6_HUMAN	S	68	ENSP00000328596:R68S	ENSP00000328596:R68S	R	+	1	0	SIX6	60046071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.678000	0.54627	2.873000	0.98535	0.563000	0.77884	CGC		0.607	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2			6	22	1	0	3.59834e-05	0.001168	4.35467e-05	6	22				
SETD3	84193	broad.mit.edu	37	14	99871602	99871602	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr14:99871602C>A	ENST00000331768.5	-	10	1190	c.1031G>T	c.(1030-1032)aGt>aTt	p.S344I		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	344					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				GTCACTTTTACTCACTCCAAG	0.463																																							uc001ygc.2		NA																	0					0						c.(1030-1032)AGT>ATT		SET domain containing 3 isoform a							148.0	137.0	141.0					14																	99871602		2203	4300	6503	SO:0001583	missense	84193				peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity	g.chr14:99871602C>A	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.1031G>T	14.37:g.99871602C>A	ENSP00000327436:p.Ser344Ile		Somatic					p.S344I	NM_032233	NP_115609	WXS	Illumina HiSeq	Unspecified	Q86TU7	SETD3_HUMAN			10	1201	-		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)	344					A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	c.1031G>T	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207491	0.95033	.	.	ENSG00000183576	ENST00000331768	T	0.25579	1.79	5.63	5.63	0.86233	Rubisco LS methyltransferase, substrate-binding domain (3);	0.000000	0.85682	D	0.000000	T	0.58963	0.2159	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62840	-0.6769	10	0.72032	D	0.01	-4.0584	20.0572	0.97657	0.0:1.0:0.0:0.0	.	344	Q86TU7	SETD3_HUMAN	I	344	ENSP00000327436:S344I	ENSP00000327436:S344I	S	-	2	0	SETD3	98941355	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.744000	0.85034	2.826000	0.97356	0.655000	0.94253	AGT		0.463	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233		26	85	1	0	7.33532e-06	0.003954	9.2914e-06	26	85				
TRPM1	4308	broad.mit.edu	37	15	31294305	31294305	+	Missense_Mutation	SNP	A	A	T	rs556799723		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr15:31294305A>T	ENST00000256552.6	-	28	4745	c.4598T>A	c.(4597-4599)gTc>gAc	p.V1533D	TRPM1_ENST00000397795.2_Missense_Mutation_p.V1511D|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000542188.1_Missense_Mutation_p.V1550D	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TGCTTCAGCGACATGGTGTTC	0.458																																							uc001zfm.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(4531-4533)GTC>GAC		transient receptor potential cation channel,							265.0	246.0	252.0					15																	31294305		2036	4178	6214	SO:0001583	missense	4308				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity	g.chr15:31294305A>T	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.4598T>A	15.37:g.31294305A>T	ENSP00000256552:p.Val1533Asp		Somatic				TRPM1_uc010azy.2_Missense_Mutation_p.V1418D|TRPM1_uc001zfl.2_RNA	p.V1511D	NM_002420	NP_002411	WXS	Illumina HiSeq	Unspecified	Q7Z4N2	TRPM1_HUMAN		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)	27	4660	-		all_lung(180;1.92e-11)	1511			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000256552.6	37	c.4532T>A	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	A	0.030	-1.339230	0.01287	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.55413	0.54;0.52;0.55	5.17	0.0305	0.14167	.	1.024190	0.07760	N	0.949991	T	0.39627	0.1085	L	0.27053	0.805	0.09310	N	0.999999	B;B	0.22746	0.074;0.073	B;B	0.28553	0.091;0.042	T	0.34625	-0.9821	10	0.22109	T	0.4	-1.1276	10.038	0.42139	0.6369:0.0:0.3631:0.0	.	1505;1511	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	D	1511;1550;1533;1511	ENSP00000380897:V1511D;ENSP00000437849:V1550D;ENSP00000256552:V1533D	ENSP00000256552:V1533D	V	-	2	0	TRPM1	29081597	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.132000	0.15891	0.003000	0.14656	0.460000	0.39030	GTC		0.458	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		12	311	0	0	0	0.001855	0	12	311				
SIN3A	25942	broad.mit.edu	37	15	75694265	75694265	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr15:75694265C>A	ENST00000394947.3	-	10	1768	c.1454G>T	c.(1453-1455)cGc>cTc	p.R485L	SIN3A_ENST00000394949.4_Missense_Mutation_p.R485L|SIN3A_ENST00000360439.4_Missense_Mutation_p.R485L	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						AACAAGACAGCGTAGGAAATT	0.463																																							uc002bai.2		NA																	0				skin(3)|ovary(1)|lung(1)	5						c.(1453-1455)CGC>CTC		transcriptional co-repressor Sin3A							96.0	92.0	93.0					15																	75694265		2197	4294	6491	SO:0001583	missense	25942				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding	g.chr15:75694265C>A	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1454G>T	15.37:g.75694265C>A	ENSP00000378402:p.Arg485Leu		Somatic				SIN3A_uc002baj.2_Missense_Mutation_p.R485L|SIN3A_uc010uml.1_Missense_Mutation_p.R485L	p.R485L	NM_015477	NP_056292	WXS	Illumina HiSeq	Unspecified	Q96ST3	SIN3A_HUMAN			10	1713	-			485			PAH 3.|Interaction with SAP30 (By similarity).			Missense_Mutation	SNP	ENST00000394947.3	37	c.1454G>T	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929465	0.92389	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.53640	0.61;0.61;0.61	5.72	5.72	0.89469	.	0.046152	0.85682	D	0.000000	T	0.76321	0.3971	M	0.91300	3.195	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.81387	-0.0956	10	0.87932	D	0	-13.5579	18.8673	0.92298	0.0:1.0:0.0:0.0	.	485	Q96ST3	SIN3A_HUMAN	L	485	ENSP00000378402:R485L;ENSP00000378403:R485L;ENSP00000353622:R485L	ENSP00000353622:R485L	R	-	2	0	SIN3A	73481318	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.996000	0.70639	2.706000	0.92434	0.467000	0.42956	CGC		0.463	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477		3	67	1	0	0.004672	0.004672	0.00531545	3	67				
IL16	3603	broad.mit.edu	37	15	81593853	81593853	+	Splice_Site	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr15:81593853G>T	ENST00000302987.4	+	14	3318	c.3318G>T	c.(3316-3318)aaG>aaT	p.K1106N	IL16_ENST00000394652.2_Splice_Site_p.K405N|IL16_ENST00000394660.2_Splice_Site_p.K1106N|RP11-761I4.4_ENST00000607019.1_RNA			Q14005	IL16_HUMAN	interleukin 16	1106	Interaction with HTLV-1 tax.|Interaction with PPP1R12A, PPP1R12B and PPP1R12C.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CAACATTAAAGGTAGGTTTCC	0.473																																							uc002bgh.3		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(3316-3318)AAG>AAT		interleukin 16 isoform 2							90.0	88.0	89.0					15																	81593853		2203	4300	6503	SO:0001630	splice_region_variant	3603				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity	g.chr15:81593853G>T	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.3318+1G>T	15.37:g.81593853G>T			Somatic				IL16_uc010blq.1_Missense_Mutation_p.K1060N|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.K1148N|IL16_uc002bgg.2_Missense_Mutation_p.K1106N|IL16_uc002bgi.1_Missense_Mutation_p.K496N|IL16_uc002bgj.2_Missense_Mutation_p.K600N|IL16_uc002bgk.2_Missense_Mutation_p.K405N|IL16_uc002bgl.1_Missense_Mutation_p.K405N|IL16_uc010unq.1_Missense_Mutation_p.K405N	p.K1106N	NM_172217	NP_757366	WXS	Illumina HiSeq	Unspecified	Q14005	IL16_HUMAN			15	3694	+			1106			Interaction with HTLV-1 tax.|Interaction with PPP1R12A, PPP1R12B and PPP1R12C.		A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	c.3318G>T	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195536	0.58126	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653;ENST00000394652;ENST00000394656	T;T;T	0.28255	1.62;1.62;1.62	4.87	4.87	0.63330	PDZ/DHR/GLGF (1);	0.150449	0.30830	N	0.008798	T	0.46852	0.1414	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.986;0.998;0.999;0.992	D;D;P;D;D;D	0.91635	0.999;0.996;0.796;0.994;0.992;0.986	T	0.49995	-0.8879	10	0.72032	D	0.01	.	18.0043	0.89205	0.0:0.0:1.0:0.0	.	938;599;643;496;1106;1106	F8W7Z5;Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;.;IL16_HUMAN;.	N	1106;938;1106;643;496;405;405	ENSP00000378155:K1106N;ENSP00000302935:K1106N;ENSP00000378147:K405N	ENSP00000302935:K1106N	K	+	3	2	IL16	79380908	1.000000	0.71417	0.991000	0.47740	0.151000	0.21798	6.120000	0.71596	2.258000	0.74832	0.561000	0.74099	AAG		0.473	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	Missense_Mutation	9	52	1	0	3.07112e-06	0.000978	3.94265e-06	9	52				
FANCI	55215	broad.mit.edu	37	15	89857858	89857858	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr15:89857858G>A	ENST00000310775.7	+	36	3822	c.3736G>A	c.(3736-3738)Gaa>Aaa	p.E1246K	FANCI_ENST00000300027.8_Missense_Mutation_p.E1186K|FANCI_ENST00000566615.1_3'UTR	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	1246					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					AGTTCTTCGGGAAACCAAGCC	0.373								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc010bnp.1		NA																	0				ovary(2)	2						c.(3736-3738)GAA>AAA	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group I isoform							106.0	95.0	99.0					15																	89857858		2200	4299	6499	SO:0001583	missense	55215	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle|DNA repair	nucleoplasm	protein binding	g.chr15:89857858G>A	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3736G>A	15.37:g.89857858G>A	ENSP00000310842:p.Glu1246Lys		Somatic				FANCI_uc002bnm.1_Missense_Mutation_p.E1186K|FANCI_uc002bnn.1_RNA|FANCI_uc002bnp.1_Missense_Mutation_p.E1006K|FANCI_uc002bnq.1_Missense_Mutation_p.E659K	p.E1246K	NM_001113378	NP_001106849	WXS	Illumina HiSeq	Unspecified	Q9NVI1	FANCI_HUMAN			36	3826	+	Lung NSC(78;0.0472)|all_lung(78;0.089)		1246					A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	c.3736G>A	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618812	0.87460	.	.	ENSG00000140525	ENST00000300027;ENST00000310775	D;D	0.88277	-2.36;-2.36	6.17	5.26	0.73747	.	0.151373	0.64402	D	0.000018	D	0.88757	0.6523	L	0.57536	1.79	0.80722	D	1	P;P;P	0.43024	0.798;0.791;0.791	B;P;P	0.44673	0.409;0.457;0.457	D	0.88755	0.3253	10	0.52906	T	0.07	-21.4962	15.01	0.71542	0.0673:0.0:0.9327:0.0	.	1246;1185;1186	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	K	1186;1246	ENSP00000300027:E1186K;ENSP00000310842:E1246K	ENSP00000300027:E1186K	E	+	1	0	FANCI	87658862	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.307000	0.72815	2.941000	0.99782	0.655000	0.94253	GAA		0.373	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193		3	75	0	0	0	0.000248	0	3	75				
PKD1	5310	broad.mit.edu	37	16	2160351	2160351	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:2160351G>A	ENST00000262304.4	-	15	5025	c.4817C>T	c.(4816-4818)aCc>aTc	p.T1606I	PKD1_ENST00000423118.1_Missense_Mutation_p.T1606I|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1606	PKD 11. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GATATTGAAGGTGCCCACGGA	0.617																																							uc002cos.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(4816-4818)ACC>ATC		polycystin 1 isoform 1 precursor							55.0	56.0	56.0					16																	2160351		2197	4297	6494	SO:0001583	missense	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2160351G>A	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.4817C>T	16.37:g.2160351G>A	ENSP00000262304:p.Thr1606Ile		Somatic				PKD1_uc002cot.1_Missense_Mutation_p.T1606I	p.T1606I	NM_001009944	NP_001009944	WXS	Illumina HiSeq	Unspecified	P98161	PKD1_HUMAN			15	5026	-			1606			PKD 11.|Extracellular (Potential).		Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	c.4817C>T	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	g	22.1	4.243640	0.79912	.	.	ENSG00000008710	ENST00000262304;ENST00000423118	T;T	0.63913	-0.07;-0.07	5.12	5.12	0.69794	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (4);	0.054782	0.64402	D	0.000001	T	0.72036	0.3411	L	0.34521	1.04	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74896	-0.3508	10	0.62326	D	0.03	.	18.5786	0.91163	0.0:0.0:1.0:0.0	.	1606;1606	P98161-3;P98161	.;PKD1_HUMAN	I	1606	ENSP00000262304:T1606I;ENSP00000399501:T1606I	ENSP00000262304:T1606I	T	-	2	0	PKD1	2100352	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.413000	0.80104	2.403000	0.81681	0.550000	0.68814	ACC		0.617	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			3	74	0	0	0	0.000248	0	3	74				
NAA60	79903	broad.mit.edu	37	16	3533551	3533551	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:3533551A>G	ENST00000407558.4	+	6	829	c.526A>G	c.(526-528)Acc>Gcc	p.T176A	NAA60_ENST00000421765.3_Intron|NAA60_ENST00000608993.1_Missense_Mutation_p.T111A|NAA60_ENST00000608722.1_Missense_Mutation_p.T176A|NAA60_ENST00000572584.1_Missense_Mutation_p.T176A|NAA60_ENST00000360862.5_Missense_Mutation_p.T111A|LA16c-306E5.3_ENST00000574423.2_RNA|NAA60_ENST00000424546.2_Missense_Mutation_p.T183A|NAA60_ENST00000572942.1_Intron|NAA60_ENST00000573580.1_Missense_Mutation_p.T111A|NAA60_ENST00000577013.1_Intron|NAA60_ENST00000570551.1_3'UTR|NAA60_ENST00000414063.2_Missense_Mutation_p.T176A|NAA60_ENST00000576916.1_Intron|NAA60_ENST00000610180.1_Missense_Mutation_p.T176A|NAA60_ENST00000570819.1_Intron|NAA60_ENST00000575076.1_Missense_Mutation_p.T176A			Q9H7X0	NAA60_HUMAN	N(alpha)-acetyltransferase 60, NatF catalytic subunit	176	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|histone H4 acetylation (GO:0043967)|N-terminal peptidyl-methionine acetylation (GO:0017196)|nucleosome assembly (GO:0006334)	Golgi membrane (GO:0000139)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)	7						AGATGGCTTCACCTATGTCCT	0.488																																							uc002cvh.3		NA																	0					0						c.(526-528)ACC>GCC		N-acetyltransferase 15							130.0	130.0	130.0					16																	3533551		1969	4157	6126	SO:0001583	missense	79903						N-acetyltransferase activity	g.chr16:3533551A>G		CCDS45396.1	16p13.3	2012-07-13	2011-08-02	2011-08-02	ENSG00000122390	ENSG00000122390	2.3.1.48, 2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	25875	protein-coding gene	gene with protein product		614246	"""N-acetyltransferase 15 (GCN5-related, putative)"""	NAT15		12975309, 21750686	Standard	NM_001083600		Approved	FLJ14154	uc010btm.3	Q9H7X0	OTTHUMG00000150268	ENST00000407558.4:c.526A>G	16.37:g.3533551A>G	ENSP00000385903:p.Thr176Ala		Somatic				NAT15_uc010uxb.1_Missense_Mutation_p.T183A|NAT15_uc010btk.1_Missense_Mutation_p.T111A|NAT15_uc010btl.2_Intron|NAT15_uc010btm.2_Missense_Mutation_p.T176A|NAT15_uc010uxc.1_Missense_Mutation_p.T176A|NAT15_uc010uxd.1_Intron|NAT15_uc010uxe.1_Intron|NAT15_uc002cvg.1_Missense_Mutation_p.T176A	p.T176A	NM_001083601	NP_001077070	WXS	Illumina HiSeq	Unspecified	Q9H7X0	NAT15_HUMAN			6	772	+			176			N-acetyltransferase.		B3KRQ0|B4DLZ0|B4DPZ8|B4DYC4|D3DUC2|E7EQ65|Q6IA31|Q6UX26	Missense_Mutation	SNP	ENST00000407558.4	37	c.526A>G	CCDS45396.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399236	0.62177	.	.	ENSG00000122390	ENST00000424546;ENST00000407558;ENST00000414063;ENST00000360862	T;T;T;T	0.48201	0.82;0.87;0.87;1.0	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.45816	0.1361	M	0.69523	2.12	0.80722	D	1	P;P	0.38048	0.604;0.616	B;B	0.32533	0.135;0.147	T	0.45629	-0.9248	10	0.29301	T	0.29	-38.3804	15.0151	0.71578	1.0:0.0:0.0:0.0	.	183;176	B4DLZ0;Q9H7X0	.;NAA60_HUMAN	A	183;176;176;111	ENSP00000401237:T183A;ENSP00000385903:T176A;ENSP00000393224:T176A;ENSP00000354108:T111A	ENSP00000354108:T111A	T	+	1	0	NAA60	3473552	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	8.860000	0.92272	2.206000	0.71126	0.459000	0.35465	ACC		0.488	NAA60-001	KNOWN	NMD_exception|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317235.2	NM_024845		6	65	0	0	0	0.004482	0	6	65				
TXNDC11	51061	broad.mit.edu	37	16	11785454	11785454	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:11785454G>A	ENST00000356957.3	-	9	1780	c.1673C>T	c.(1672-1674)aCt>aTt	p.T558I	TXNDC11_ENST00000283033.5_Missense_Mutation_p.T531I|TXNDC11_ENST00000570917.1_5'Flank			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	558					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						AAATGCAACAGTAGGGGCTTC	0.488																																							uc010buu.1		NA																	0					0						c.(1672-1674)ACT>ATT		thioredoxin domain containing 11							113.0	108.0	110.0					16																	11785454		2197	4300	6497	SO:0001583	missense	51061				cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane		g.chr16:11785454G>A	BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1673C>T	16.37:g.11785454G>A	ENSP00000349439:p.Thr558Ile		Somatic				TXNDC11_uc002dbg.1_Missense_Mutation_p.T531I	p.T558I	NM_015914	NP_056998	WXS	Illumina HiSeq	Unspecified	Q6PKC3	TXD11_HUMAN			9	1735	-			558					O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	ENST00000356957.3	37	c.1673C>T		.	.	.	.	.	.	.	.	.	.	G	2.963	-0.214117	0.06101	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.23348	1.91;1.91	5.81	1.37	0.22104	.	1.498250	0.03574	N	0.229024	T	0.22360	0.0539	L	0.36672	1.1	0.09310	N	1	B;B	0.28178	0.054;0.202	B;B	0.24155	0.009;0.051	T	0.25779	-1.0122	10	0.38643	T	0.18	-7.6739	8.4459	0.32841	0.0:0.2265:0.3261:0.4474	.	558;531	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	I	558;531	ENSP00000349439:T558I;ENSP00000283033:T531I	ENSP00000283033:T531I	T	-	2	0	TXNDC11	11692955	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.592000	0.23984	0.346000	0.23899	0.655000	0.94253	ACT		0.488	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000437057.1	NM_015914		4	133	0	0	0	0.000602	0	4	133				
HS3ST2	9956	broad.mit.edu	37	16	22926638	22926638	+	Silent	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:22926638C>A	ENST00000261374.3	+	2	1293	c.859C>A	c.(859-861)Cga>Aga	p.R287R		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	287					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		CGAGATGGGGCGAGTCCAGGA	0.532																																							uc002dli.2		NA																	0				ovary(1)|pancreas(1)	2						c.(859-861)CGA>AGA		heparan sulfate D-glucosaminyl							103.0	107.0	106.0					16																	22926638		2197	4300	6497	SO:0001819	synonymous_variant	9956					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity	g.chr16:22926638C>A	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.859C>A	16.37:g.22926638C>A			Somatic				HS3ST2_uc002dlj.2_RNA	p.R287R	NM_006043	NP_006034	WXS	Illumina HiSeq	Unspecified	Q9Y278	HS3S2_HUMAN		GBM - Glioblastoma multiforme(48;0.0299)	2	931	+			287			Lumenal (Potential).		Q52LZ1	Silent	SNP	ENST00000261374.3	37	c.859C>A	CCDS10606.1																																																																																				0.532	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043		28	218	1	0	1.08312e-15	0.001786	1.67311e-15	28	218				
PLK1	5347	broad.mit.edu	37	16	23702633	23702633	+	IGR	SNP	C	C	T	rs375099369		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:23702633C>T	ENST00000300093.4	+	0	2227				CTD-2196E14.5_ENST00000566143.1_RNA|ERN2_ENST00000457008.2_Silent_p.P778P|ERN2_ENST00000256797.4_Silent_p.P878P	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		CTGTCTGCAGCGGCATGGAGA	0.672																																					Colon(12;240 564 27038 33155)		uc002dma.3		NA																	0				large_intestine(2)|lung(2)|ovary(2)	6						c.(2632-2634)CCG>CCA		endoplasmic reticulum to nucleus signalling 2		C		0,4394		0,0,2197	52.0	53.0	53.0		2634	-11.6	0.0	16		53	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ERN2	NM_033266.3		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		878/975	23702633	1,12993	2197	4300	6497	SO:0001628	intergenic_variant	10595				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity	g.chr16:23702633C>T		CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23702633C>T			Somatic				ERN2_uc010bxp.2_Silent_p.P826P	p.P878P	NM_033266	NP_150296	WXS	Illumina HiSeq	Unspecified	Q76MJ5	ERN2_HUMAN		GBM - Glioblastoma multiforme(48;0.0156)	20	2803	-			830			KEN.|Cytoplasmic (Potential).		Q15153|Q99746	Silent	SNP	ENST00000300093.4	37	c.2634G>A	CCDS10616.1																																																																																				0.672	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030		3	51	0	0	0	0.000248	0	3	51				
EIF3C	8663	broad.mit.edu	37	16	28734627	28734627	+	Nonsense_Mutation	SNP	G	G	T	rs374480438		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:28734627G>T	ENST00000331666.6	+	9	1105	c.919G>T	c.(919-921)Gga>Tga	p.G307*	EIF3C_ENST00000566866.1_Nonsense_Mutation_p.G307*|EIF3C_ENST00000564243.1_Nonsense_Mutation_p.G297*|EIF3C_ENST00000395587.1_Nonsense_Mutation_p.G307*|EIF3C_ENST00000566501.1_Nonsense_Mutation_p.G307*					eukaryotic translation initiation factor 3, subunit C									p.G307*(2)		lung(5)|skin(1)	6						GGTCCGGGGCGGAGTGCCGTT	0.542																																							uc010byj.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(922-924)GGA>TGA		eukaryotic translation initiation factor 3,							248.0	291.0	276.0					16																	28734627		2197	4298	6495	SO:0001587	stop_gained	728689					eukaryotic translation initiation factor 3 complex	translation initiation factor activity	g.chr16:28734627G>T	U46025	CCDS10638.1, CCDS66993.1	16p11.2	2008-02-05	2007-07-27	2007-07-27		ENSG00000184110			3279	protein-coding gene	gene with protein product		603916	"""eukaryotic translation initiation factor 3, subunit 8, 110kDa"""	EIF3S8		8995409	Standard	NM_001199142		Approved	eIF3-p110, eIF3c	uc002dph.4	Q99613		ENST00000331666.6:c.919G>T	16.37:g.28734627G>T	ENSP00000332604:p.Gly307*		Somatic				uc010vct.1_Intron|EIF3CL_uc010byi.2_Nonsense_Mutation_p.G307*|EIF3CL_uc002dqs.3_Nonsense_Mutation_p.G307*|EIF3C_uc002dqt.3_Nonsense_Mutation_p.G307*|EIF3CL_uc010vcy.1_Nonsense_Mutation_p.G297*|EIF3C_uc002dqu.3_Nonsense_Mutation_p.G307*|EIF3CL_uc002dqv.3_Nonsense_Mutation_p.G53*	p.G308*	NM_001099661	NP_001093131	WXS	Illumina HiSeq	Unspecified	B5ME19	B5ME19_HUMAN			10	1011	+			308						Nonsense_Mutation	SNP	ENST00000331666.6	37	c.922G>T	CCDS10638.1	.	.	.	.	.	.	.	.	.	.	.	32	5.179028	0.94846	.	.	ENSG00000184110	ENST00000395587;ENST00000331666;ENST00000537985;ENST00000395583;ENST00000454461	.	.	.	3.95	3.95	0.45737	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.4423	0.61121	0.0:0.0:1.0:0.0	.	.	.	.	X	307;307;292;155;129	.	ENSP00000332604:G307X	G	+	1	0	EIF3C	28642128	1.000000	0.71417	0.591000	0.28745	0.243000	0.25628	4.898000	0.63238	2.220000	0.72140	0.447000	0.29281	GGA		0.542	EIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216908.3	NM_003752		37	492	1	0	1.38909e-20	0.00361	2.2558e-20	37	492				
ORAI3	93129	broad.mit.edu	37	16	30964750	30964750	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:30964750G>C	ENST00000318663.4	+	2	697	c.473G>C	c.(472-474)gGc>gCc	p.G158A	ORAI3_ENST00000562699.1_Intron|ORAI3_ENST00000566237.1_Missense_Mutation_p.G158A|AC135048.13_ENST00000566056.1_RNA	NM_152288.2	NP_689501.1	Q9BRQ5	ORAI3_HUMAN	ORAI calcium release-activated calcium modulator 3	158					store-operated calcium entry (GO:0002115)	integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6						ACTGCCCTGGGCACCTTTCTC	0.597											OREG0023742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002eac.2		NA																	0					0						c.(472-474)GGC>GCC		ORAI calcium release-activated calcium modulator							129.0	141.0	137.0					16																	30964750		2197	4300	6497	SO:0001583	missense	93129					integral to membrane	protein binding	g.chr16:30964750G>C	BC006126	CCDS10697.1	16p11.2	2007-08-14	2007-08-14	2007-08-14	ENSG00000175938	ENSG00000175938		"""ORAI calcium release-activated calcium modulators"""	28185	protein-coding gene	gene with protein product		610930	"""transmembrane protein 142C"""	TMEM142C		16582901	Standard	NM_152288		Approved	MGC13024	uc002eac.3	Q9BRQ5	OTTHUMG00000132409	ENST00000318663.4:c.473G>C	16.37:g.30964750G>C	ENSP00000322249:p.Gly158Ala		Somatic	OREG0023742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	821		p.G158A	NM_152288	NP_689501	WXS	Illumina HiSeq	Unspecified	Q9BRQ5	ORAI3_HUMAN			2	679	+			158			Helical; (Potential).		Q96BI8	Missense_Mutation	SNP	ENST00000318663.4	37	c.473G>C	CCDS10697.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884474	0.91814	.	.	ENSG00000175938	ENST00000318663;ENST00000420438	T	0.74842	-0.88	5.56	5.56	0.83823	.	0.100414	0.44285	D	0.000471	D	0.84347	0.5452	M	0.73430	2.235	0.80722	D	1	D	0.62365	0.991	P	0.58721	0.844	D	0.86084	0.1546	10	0.87932	D	0	-12.9047	18.2904	0.90127	0.0:0.0:1.0:0.0	.	158	Q9BRQ5	ORAI3_HUMAN	A	158	ENSP00000322249:G158A	ENSP00000322249:G158A	G	+	2	0	ORAI3	30872251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.619000	0.88677	0.650000	0.86243	GGC		0.597	ORAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255545.20	NM_152288		24	140	0	0	0	0.008361	0	24	140				
ZNF668	79759	broad.mit.edu	37	16	31073432	31073432	+	Missense_Mutation	SNP	T	T	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:31073432T>A	ENST00000538906.1	-	3	1601	c.817A>T	c.(817-819)Acg>Tcg	p.T273S	ZNF668_ENST00000539836.3_Missense_Mutation_p.T296S|ZNF668_ENST00000426488.2_Missense_Mutation_p.T296S|ZNF668_ENST00000417110.2_Missense_Mutation_p.V207E|ZNF668_ENST00000394983.2_Missense_Mutation_p.T273S|ZNF668_ENST00000300849.4_Missense_Mutation_p.T273S|ZNF668_ENST00000535577.1_Missense_Mutation_p.T273S|ZNF668_ENST00000564456.1_5'Flank	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	273					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						CCCGAGTGCGTGCGCTCGTGG	0.692																																					Colon(181;1111 1980 5060 10512 25785)	Colon(181;1111 1980 5060 10512 25785)	uc010caf.2		NA																	0				breast(4)	4						c.(817-819)ACG>TCG		zinc finger protein 668							40.0	43.0	42.0					16																	31073432		2197	4297	6494	SO:0001583	missense	79759				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:31073432T>A		CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.817A>T	16.37:g.31073432T>A	ENSP00000440149:p.Thr273Ser		Somatic				ZNF668_uc002eao.2_Missense_Mutation_p.T273S	p.T273S	NM_024706	NP_078982	WXS	Illumina HiSeq	Unspecified	Q96K58	ZN668_HUMAN			3	1174	-			273			C2H2-type 8.		C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Missense_Mutation	SNP	ENST00000538906.1	37	c.817A>T	CCDS10701.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.4|21.4	4.145823|4.145823	0.77888|0.77888	.|.	.|.	ENSG00000167394|ENSG00000232748	ENST00000539836;ENST00000535577;ENST00000538906;ENST00000394983;ENST00000300849|ENST00000417110	T;T;T;T;T|.	0.19394|.	2.15;2.15;2.15;2.15;2.15|.	5.02|5.02	5.02|5.02	0.67125|0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63462|0.63462	0.2513|0.2513	L|L	0.46741|0.46741	1.465|1.465	0.47476|0.47476	D|D	0.999432|0.999432	P|.	0.41131|.	0.739|.	B|.	0.42827|.	0.399|.	T|T	0.67233|0.67233	-0.5722|-0.5722	10|6	0.87932|0.87932	D|D	0|0	-19.0447|-19.0447	13.8549|13.8549	0.63519|0.63519	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	273|.	Q96K58|.	ZN668_HUMAN|.	S|E	296;273;273;273;273|207	ENSP00000442573:T296S;ENSP00000441349:T273S;ENSP00000440149:T273S;ENSP00000378434:T273S;ENSP00000300849:T273S|.	ENSP00000300849:T273S|ENSP00000391989:V207E	T|V	-|+	1|2	0|0	ZNF668|AC135050.1	30980933|30980933	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.603000|0.603000	0.37013|0.37013	2.235000|2.235000	0.43044|0.43044	2.089000|2.089000	0.63090|0.63090	0.533000|0.533000	0.62120|0.62120	ACG|GTG		0.692	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108516.2	NM_024706		5	59	0	0	0	0.001168	0	5	59				
SHCBP1	79801	broad.mit.edu	37	16	46649880	46649880	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:46649880C>A	ENST00000303383.3	-	4	840	c.574G>T	c.(574-576)Gcc>Tcc	p.A192S		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	192					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				ATTGCAAGGGCTGTCTGGTCA	0.463																																							uc002eec.3		NA																	0				ovary(1)|breast(1)	2						c.(574-576)GCC>TCC		SHC SH2-domain binding protein 1							140.0	144.0	143.0					16																	46649880		2203	4300	6503	SO:0001583	missense	79801							g.chr16:46649880C>A	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.574G>T	16.37:g.46649880C>A	ENSP00000306473:p.Ala192Ser		Somatic					p.A192S	NM_024745	NP_079021	WXS	Illumina HiSeq	Unspecified	Q8NEM2	SHCBP_HUMAN			4	614	-		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)	192					Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	ENST00000303383.3	37	c.574G>T	CCDS10720.1	.	.	.	.	.	.	.	.	.	.	.	20.2	3.946701	0.73672	.	.	ENSG00000171241	ENST00000303383	T	0.49139	0.79	3.91	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.75309	-0.3363	10	0.72032	D	0.01	-12.3336	16.0651	0.80865	0.0:1.0:0.0:0.0	.	192	Q8NEM2	SHCBP_HUMAN	S	192	ENSP00000306473:A192S	ENSP00000306473:A192S	A	-	1	0	SHCBP1	45207381	1.000000	0.71417	0.994000	0.49952	0.645000	0.38454	6.347000	0.73004	1.997000	0.58415	0.484000	0.47621	GCC		0.463	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745		26	181	1	0	9.65021e-13	0.002096	1.42135e-12	26	181				
CDH8	1006	broad.mit.edu	37	16	61689518	61689518	+	Missense_Mutation	SNP	T	T	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:61689518T>A	ENST00000577390.1	-	11	2716	c.1762A>T	c.(1762-1764)Agc>Tgc	p.S588C	CDH8_ENST00000299345.6_Missense_Mutation_p.S588C|CDH8_ENST00000577730.1_Missense_Mutation_p.S588C	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	588	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GTGCTAGTGCTGCTCAGTGGA	0.453																																							uc002eog.1		NA																	0				ovary(6)|skin(2)|breast(1)	9						c.(1762-1764)AGC>TGC		cadherin 8, type 2 preproprotein							153.0	133.0	139.0					16																	61689518		2203	4300	6503	SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61689518T>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1762A>T	16.37:g.61689518T>A	ENSP00000462701:p.Ser588Cys		Somatic					p.S588C	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	11	2014	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	588			Extracellular (Potential).|Cadherin 5.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	c.1762A>T	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689222	0.88735	.	.	ENSG00000150394	ENST00000299345	T	0.55052	0.54	5.52	5.52	0.82312	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.83101	0.5181	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89694	0.3900	10	0.87932	D	0	.	14.82	0.70065	0.0:0.0:0.0:1.0	.	588	P55286	CADH8_HUMAN	C	588	ENSP00000299345:S588C	ENSP00000299345:S588C	S	-	1	0	CDH8	60247019	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	7.649000	0.83500	2.101000	0.63845	0.459000	0.35465	AGC		0.453	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		14	77	0	0	0	0.006122	0	14	77				
FAM65A	79567	broad.mit.edu	37	16	67579635	67579635	+	Missense_Mutation	SNP	G	G	A	rs139937481		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:67579635G>A	ENST00000379312.3	+	19	3392	c.3271G>A	c.(3271-3273)Gag>Aag	p.E1091K	FAM65A_ENST00000428437.2_Missense_Mutation_p.E1101K|FAM65A_ENST00000422602.2_Missense_Mutation_p.E1107K|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.E1087K|FAM65A_ENST00000540839.3_Missense_Mutation_p.E1106K	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	1091						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		ATTGGCGCCCGAGGGGCGTCT	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15255	0.0		0.0	False		,,,				2504	0.0						uc010vjp.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3319-3321)GAG>AAG		hypothetical protein LOC79567		G	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	1,4395	2.1+/-5.4	0,1,2197	69.0	75.0	73.0		3271,3319,3301,3259	4.7	0.9	16	dbSNP_134	73	0,8600		0,0,4300	no	missense,missense,missense,missense	FAM65A	NM_001193522.1,NM_001193523.1,NM_001193524.1,NM_024519.3	56,56,56,56	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	1091/1224,1107/1240,1101/1234,1087/1220	67579635	1,12995	2198	4300	6498	SO:0001583	missense	79567					cytoplasm	binding	g.chr16:67579635G>A	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.3271G>A	16.37:g.67579635G>A	ENSP00000368614:p.Glu1091Lys		Somatic				FAM65A_uc002eth.2_Missense_Mutation_p.E1087K|FAM65A_uc010cej.2_Missense_Mutation_p.E1090K|FAM65A_uc010vjq.1_Missense_Mutation_p.E1101K|FAM65A_uc002etk.2_Missense_Mutation_p.E1085K	p.E1107K	NM_024519	NP_078795	WXS	Illumina HiSeq	Unspecified	Q6ZS17	FA65A_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)	19	3415	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	1091					B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	c.3319G>A	CCDS54028.1	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	22.1|22.1	4.248246|4.248246	0.80024|0.80024	2.27E-4|2.27E-4	0.0|0.0	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.76448|.	-1.02;-1.02;-1.02|.	5.69|5.69	4.71|4.71	0.59529|0.59529	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.049177|.	0.85682|.	D|.	0.000000|.	T|T	0.62490|0.62490	0.2432|0.2432	L|L	0.48362|0.48362	1.52|1.52	0.40264|0.40264	D|D	0.978218|0.978218	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.87578|.	0.998;0.998;0.998|.	T|T	0.61451|0.61451	-0.7060|-0.7060	10|5	0.07325|.	T|.	0.83|.	-19.3414|-19.3414	15.8907|15.8907	0.79296|0.79296	0.0:0.0:0.8636:0.1364|0.0:0.0:0.8636:0.1364	.|.	1101;1107;1091|.	B4DIM2;E9PBS3;Q6ZS17|.	.;.;FA65A_HUMAN|.	K|Q	1091;1087;1107;1101|1080	ENSP00000368614:E1091K;ENSP00000042381:E1087K;ENSP00000400099:E1107K|.	ENSP00000042381:E1087K|.	E|R	+|+	1|2	0|0	FAM65A|FAM65A	66137136|66137136	1.000000|1.000000	0.71417|0.71417	0.884000|0.884000	0.34674|0.34674	0.984000|0.984000	0.73092|0.73092	6.279000|6.279000	0.72620|0.72620	1.368000|1.368000	0.46115|0.46115	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.622	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519		8	95	0	0	0	0.00308	0	8	95				
HYDIN	54768	broad.mit.edu	37	16	70889125	70889125	+	Missense_Mutation	SNP	C	C	G	rs368579966		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:70889125C>G	ENST00000393567.2	-	73	12499	c.12349G>C	c.(12349-12351)Gat>Cat	p.D4117H	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4117					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AAGGAAAAATCGAACCCCTGC	0.547																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(12346-12348)GAT>CAT		hydrocephalus inducing isoform a							48.0	73.0	65.0					16																	70889125		1689	4090	5779	SO:0001583	missense	54768							g.chr16:70889125C>G	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12349G>C	16.37:g.70889125C>G	ENSP00000377197:p.Asp4117His		Somatic				HYDIN_uc010cfy.2_RNA	p.D4116H	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			73	12474	-		Ovarian(137;0.0654)	4117					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.12346G>C	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	4.480	0.088938	0.08583	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00856	5.61	5.57	0.561	0.17285	.	1.955800	0.03903	N	0.280617	T	0.00496	0.0016	N	0.01219	-0.95	0.28565	N	0.910903	B	0.18968	0.032	B	0.28232	0.087	T	0.45556	-0.9253	10	0.13470	T	0.59	.	0.7289	0.00953	0.2241:0.1391:0.2648:0.372	.	4116	F8WD23	.	H	4117;4116	ENSP00000377197:D4117H	ENSP00000313052:D4116H	D	-	1	0	HYDIN	69446626	0.000000	0.05858	0.037000	0.18230	0.521000	0.34408	-0.837000	0.04377	-0.105000	0.12132	-0.424000	0.05967	GAT		0.547	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			3	110	0	0	0	0.000602	0	3	110				
MPRIP	23164	broad.mit.edu	37	17	17057722	17057722	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr17:17057722G>T	ENST00000341712.4	+	13	1468	c.1468G>T	c.(1468-1470)Gtg>Ttg	p.V490L	MPRIP_ENST00000395804.3_Missense_Mutation_p.V490L|MPRIP_ENST00000444976.1_Missense_Mutation_p.V452L|MPRIP_ENST00000395811.5_Missense_Mutation_p.V490L			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	490						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TGCCCCGGATGTGACCAGGTA	0.592																																							uc002gqu.1		NA																	0					0						c.(1468-1470)GTG>TTG		myosin phosphatase-Rho interacting protein							97.0	81.0	87.0					17																	17057722		2203	4300	6503	SO:0001583	missense	23164					cytoplasm|cytoskeleton	actin binding	g.chr17:17057722G>T	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.1468G>T	17.37:g.17057722G>T	ENSP00000342379:p.Val490Leu		Somatic				MPRIP_uc002gqv.1_Missense_Mutation_p.V490L|MPRIP_uc002gqw.1_Missense_Mutation_p.V245L	p.V490L	NM_201274	NP_958431	WXS	Illumina HiSeq	Unspecified	Q6WCQ1	MPRIP_HUMAN			13	1524	+			490					Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	37	c.1468G>T	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921595	0.52653	.	.	ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	T;T;T;T	0.27890	1.64;1.92;1.92;1.92	5.32	5.32	0.75619	Pleckstrin homology-type (1);	.	.	.	.	T	0.38612	0.1047	M	0.80616	2.505	0.80722	D	1	B;B	0.34290	0.447;0.366	B;B	0.26770	0.068;0.073	T	0.43245	-0.9403	9	0.54805	T	0.06	.	19.3659	0.94461	0.0:0.0:1.0:0.0	.	490;490	Q6WCQ1-2;Q6WCQ1	.;MPRIP_HUMAN	L	452;490;490;490	ENSP00000400189:V452L;ENSP00000379156:V490L;ENSP00000379149:V490L;ENSP00000342379:V490L	ENSP00000342379:V490L	V	+	1	0	MPRIP	16998447	1.000000	0.71417	0.988000	0.46212	0.150000	0.21749	9.682000	0.98655	2.646000	0.89796	0.655000	0.94253	GTG		0.592	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134		12	60	1	0	6.31663e-08	0.003163	8.63424e-08	12	60				
MYO15A	51168	broad.mit.edu	37	17	18023545	18023545	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr17:18023545C>A	ENST00000205890.5	+	2	1769	c.1431C>A	c.(1429-1431)ttC>ttA	p.F477L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	477					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TCCGCAAGTTCCGCCTCTTCC	0.647																																							uc010vxh.1		NA																	0				skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(1429-1431)TTC>TTA		myosin XV							40.0	49.0	46.0					17																	18023545		2101	4203	6304	SO:0001583	missense	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18023545C>A	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1431C>A	17.37:g.18023545C>A	ENSP00000205890:p.Phe477Leu		Somatic					p.F477L	NM_016239	NP_057323	WXS	Illumina HiSeq	Unspecified	Q9UKN7	MYO15_HUMAN			2	1769	+	all_neural(463;0.228)		477			Myosin head-like.		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	c.1431C>A	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.934200	0.52866	.	.	ENSG00000091536	ENST00000205890	T	0.47869	0.83	5.2	4.23	0.50019	.	.	.	.	.	T	0.34048	0.0884	L	0.29908	0.895	0.80722	D	1	B	0.17852	0.024	B	0.10450	0.005	T	0.11131	-1.0600	9	0.40728	T	0.16	.	9.052	0.36383	0.0:0.7722:0.1495:0.0783	.	477	Q9UKN7	MYO15_HUMAN	L	477	ENSP00000205890:F477L	ENSP00000205890:F477L	F	+	3	2	MYO15A	17964270	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.563000	0.53784	1.182000	0.42928	0.561000	0.74099	TTC		0.647	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		19	35	1	0	1.55795e-14	0.001882	2.38718e-14	19	35				
SLC13A2	9058	broad.mit.edu	37	17	26822805	26822805	+	Missense_Mutation	SNP	A	A	G	rs200119933		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr17:26822805A>G	ENST00000314669.5	+	10	1861	c.1441A>G	c.(1441-1443)Acg>Gcg	p.T481A	SLC13A2_ENST00000537681.1_Missense_Mutation_p.T410A|SLC13A2_ENST00000444914.3_Missense_Mutation_p.T530A|SLC13A2_ENST00000545060.1_Missense_Mutation_p.T438A	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	481					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	GGCCACCACTACGATCTTCCT	0.637																																							uc002hbh.2		NA																	0					0						c.(1441-1443)ACG>GCG		solute carrier family 13, member 2 isoform b	Succinic acid(DB00139)						141.0	125.0	130.0					17																	26822805		2203	4300	6503	SO:0001583	missense	9058					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity	g.chr17:26822805A>G	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.1441A>G	17.37:g.26822805A>G	ENSP00000316202:p.Thr481Ala		Somatic				SLC13A2_uc010wam.1_Missense_Mutation_p.T437A|SLC13A2_uc010wan.1_Missense_Mutation_p.T530A|SLC13A2_uc010wao.1_Missense_Mutation_p.T438A|SLC13A2_uc002hbi.2_Missense_Mutation_p.T410A	p.T481A	NM_003984	NP_003975	WXS	Illumina HiSeq	Unspecified	Q13183	S13A2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	10	1508	+	all_lung(13;0.000871)|Lung NSC(42;0.0027)		481					B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	c.1441A>G	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.604631	0.87157	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000537681	T;T;T;T	0.02498	4.27;4.27;4.27;4.27	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.09247	0.0228	L	0.37750	1.13	0.80722	D	1	D;P;D;P	0.89917	1.0;0.513;1.0;0.944	D;P;D;D	0.97110	0.999;0.679;1.0;0.923	T	0.40850	-0.9541	10	0.32370	T	0.25	-6.4408	15.2815	0.73787	1.0:0.0:0.0:0.0	.	438;530;410;481	F5GWV6;E7ETH5;G3V1L2;Q13183	.;.;.;S13A2_HUMAN	A	481;530;438;410	ENSP00000316202:T481A;ENSP00000392411:T530A;ENSP00000441935:T438A;ENSP00000440802:T410A	ENSP00000316202:T481A	T	+	1	0	SLC13A2	23846932	1.000000	0.71417	0.997000	0.53966	0.861000	0.49209	7.256000	0.78350	2.022000	0.59522	0.460000	0.39030	ACG		0.637	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984		29	185	0	0	0	0.004878	0	29	185				
ANKRD13B	124930	broad.mit.edu	37	17	27939023	27939023	+	Splice_Site	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr17:27939023A>G	ENST00000394859.3	+	10	1253	c.1099A>G	c.(1099-1101)Aag>Gag	p.K367E	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	367						endosome (GO:0005768)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						CAAGACACAGAAGTGAGGCCC	0.612																																							uc002hei.2		NA																	0					0						c.(1099-1101)AAG>GAG		ankyrin repeat domain 13B							45.0	47.0	46.0					17																	27939023		2203	4300	6503	SO:0001630	splice_region_variant	124930							g.chr17:27939023A>G	AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.1100+1A>G	17.37:g.27939023A>G			Somatic				ANKRD13B_uc002heh.2_Missense_Mutation_p.K235E|ANKRD13B_uc002hej.2_RNA|ANKRD13B_uc002hek.2_5'Flank	p.K367E	NM_152345	NP_689558	WXS	Illumina HiSeq	Unspecified	Q86YJ7	AN13B_HUMAN			10	1212	+			367					Q8N7S9	Missense_Mutation	SNP	ENST00000394859.3	37	c.1099A>G	CCDS11251.1	.	.	.	.	.	.	.	.	.	.	A	34	5.360041	0.95877	.	.	ENSG00000198720	ENST00000394859	T	0.46063	0.88	5.97	5.97	0.96955	.	0.084318	0.85682	D	0.000000	T	0.65964	0.2742	M	0.86953	2.85	0.58432	D	0.999997	P	0.37731	0.607	P	0.51974	0.686	T	0.69953	-0.5005	10	0.72032	D	0.01	-40.7446	16.1238	0.81380	1.0:0.0:0.0:0.0	.	367	Q86YJ7	AN13B_HUMAN	E	367	ENSP00000378328:K367E	ENSP00000378328:K367E	K	+	1	0	ANKRD13B	24963149	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.186000	0.94906	2.288000	0.76882	0.533000	0.62120	AAG		0.612	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256077.1	NM_152345	Missense_Mutation	7	45	0	0	0	0.004482	0	7	45				
PTPRM	5797	broad.mit.edu	37	18	8384599	8384599	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr18:8384599A>T	ENST00000332175.8	+	28	4957	c.3920A>T	c.(3919-3921)cAc>cTc	p.H1307L	PTPRM_ENST00000400053.4_Missense_Mutation_p.H1245L|PTPRM_ENST00000444013.1_Missense_Mutation_p.H1094L|PTPRM_ENST00000400060.4_Missense_Mutation_p.H1321L|PTPRM_ENST00000580170.1_Missense_Mutation_p.H1320L	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1307	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GTACACAGACACGGCCCCATC	0.453																																							uc002knn.3		NA																	0				lung(3)|ovary(2)|central_nervous_system(1)	6						c.(3919-3921)CAC>CTC		protein tyrosine phosphatase, receptor type, M							137.0	118.0	124.0					18																	8384599		2203	4300	6503	SO:0001583	missense	5797				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr18:8384599A>T	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3920A>T	18.37:g.8384599A>T	ENSP00000331418:p.His1307Leu		Somatic				PTPRM_uc010dkv.2_Missense_Mutation_p.H1320L|PTPRM_uc010wzl.1_Missense_Mutation_p.H1094L	p.H1307L	NM_002845	NP_002836	WXS	Illumina HiSeq	Unspecified	P28827	PTPRM_HUMAN			28	4423	+		Colorectal(10;0.234)	1307			Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).		A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	c.3920A>T	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	16.73	3.205153	0.58234	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	5.33	5.33	0.75918	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.123185	0.56097	D	0.000037	T	0.09247	0.0228	N	0.11673	0.155	0.80722	D	1	B;B;B	0.25007	0.001;0.0;0.116	B;B;B	0.19666	0.01;0.001;0.026	T	0.15636	-1.0430	10	0.66056	D	0.02	.	15.3385	0.74277	1.0:0.0:0.0:0.0	.	1094;1320;1307	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	L	1307;1321;1245;1094	ENSP00000331418:H1307L;ENSP00000382933:H1321L;ENSP00000382927:H1245L;ENSP00000387608:H1094L	ENSP00000331418:H1307L	H	+	2	0	PTPRM	8374599	1.000000	0.71417	0.943000	0.38184	0.933000	0.57130	7.317000	0.79018	2.025000	0.59659	0.472000	0.43445	CAC		0.453	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1			19	87	0	0	0	0.002299	0	19	87				
EPG5	57724	broad.mit.edu	37	18	43437840	43437840	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr18:43437840G>A	ENST00000282041.5	-	42	7454	c.7420C>T	c.(7420-7422)Cgg>Tgg	p.R2474W	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2474					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GGCGACTTCCGGCCAAACCCA	0.488																																							uc002lbm.2		NA																	0					0						c.(7420-7422)CGG>TGG		hypothetical protein LOC57724							80.0	81.0	81.0					18																	43437840		1881	4111	5992	SO:0001583	missense	57724				autophagy			g.chr18:43437840G>A	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7420C>T	18.37:g.43437840G>A	ENSP00000282041:p.Arg2474Trp		Somatic				KIAA1632_uc010xcq.1_Missense_Mutation_p.R1028W|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Missense_Mutation_p.R1349W	p.R2474W	NM_020964	NP_066015	WXS	Illumina HiSeq	Unspecified	Q9HCE0	EPG5_HUMAN			42	7520	-			2474					A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	c.7420C>T	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765576	0.69878	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	T	0.12147	2.71	5.73	4.79	0.61399	.	0.115658	0.34700	U	0.003745	T	0.32496	0.0831	L	0.56769	1.78	0.49389	D	0.999784	D	0.89917	1.0	D	0.76071	0.987	T	0.01235	-1.1410	10	0.87932	D	0	-15.3754	13.462	0.61233	0.0:0.0:0.7338:0.2662	.	2474	Q9HCE0	EPG5_HUMAN	W	2474;402;1349	ENSP00000282041:R2474W	ENSP00000282041:R2474W	R	-	1	2	EPG5	41691838	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	4.426000	0.59882	2.710000	0.92621	0.561000	0.74099	CGG		0.488	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964		13	63	0	0	0	0.004007	0	13	63				
NEDD4L	23327	broad.mit.edu	37	18	55996235	55996235	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr18:55996235C>T	ENST00000400345.3	+	10	972	c.689C>T	c.(688-690)tCc>tTc	p.S230F	NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000256830.9_Missense_Mutation_p.S230F|NEDD4L_ENST00000356462.6_Missense_Mutation_p.S230F|NEDD4L_ENST00000435432.2_Missense_Mutation_p.S109F|NEDD4L_ENST00000586263.1_Missense_Mutation_p.S222F|NEDD4L_ENST00000256832.7_Missense_Mutation_p.S109F|NEDD4L_ENST00000357895.5_Missense_Mutation_p.S222F|NEDD4L_ENST00000431212.2_Missense_Mutation_p.S109F|NEDD4L_ENST00000382850.4_Missense_Mutation_p.S230F|NEDD4L_ENST00000456173.2_Missense_Mutation_p.S109F|NEDD4L_ENST00000456986.1_Missense_Mutation_p.S109F	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	230					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						AGGGACGTGTCCTCGGAGTCG	0.587																																							uc002lgy.2		NA																	0				lung(4)	4						c.(688-690)TCC>TTC		neural precursor cell expressed, developmentally							43.0	48.0	46.0					18																	55996235		2076	4210	6286	SO:0001583	missense	23327				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity	g.chr18:55996235C>T	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.689C>T	18.37:g.55996235C>T	ENSP00000383199:p.Ser230Phe		Somatic				NEDD4L_uc002lgz.2_Missense_Mutation_p.S230F|NEDD4L_uc002lgx.2_Missense_Mutation_p.S230F|NEDD4L_uc010xee.1_Missense_Mutation_p.S109F|NEDD4L_uc002lhc.2_Missense_Mutation_p.S222F|NEDD4L_uc002lhd.2_Missense_Mutation_p.S109F|NEDD4L_uc002lhb.2_Missense_Mutation_p.S109F|NEDD4L_uc002lhe.2_Missense_Mutation_p.S222F|NEDD4L_uc002lhf.2_Missense_Mutation_p.S109F|NEDD4L_uc002lhg.2_Missense_Mutation_p.S109F|NEDD4L_uc002lhh.2_Missense_Mutation_p.S109F|NEDD4L_uc010dpm.1_Missense_Mutation_p.S81F	p.S230F	NM_001144967	NP_001138439	WXS	Illumina HiSeq	Unspecified	Q96PU5	NED4L_HUMAN			10	963	+			230					O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	c.689C>T	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.293568	0.40594	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.34859	1.34;1.34;1.35;1.36;1.84;1.83;1.74;1.83;1.83;1.83	6.16	6.16	0.99307	.	0.329562	0.37261	N	0.002161	T	0.30293	0.0760	N	0.22421	0.69	0.35505	D	0.8001	B;B;B;B;B;B;B	0.31351	0.32;0.042;0.069;0.016;0.045;0.017;0.137	B;B;B;B;B;B;B	0.32533	0.147;0.078;0.078;0.013;0.04;0.024;0.078	T	0.34601	-0.9822	10	0.56958	D	0.05	.	17.2446	0.87023	0.0:0.8667:0.1333:0.0	.	230;222;222;109;230;230;230	Q96PU5-3;Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;.;NED4L_HUMAN;.	F	230;230;230;230;109;109;222;109;109;109	ENSP00000383199:S230F;ENSP00000372301:S230F;ENSP00000348847:S230F;ENSP00000256830:S230F;ENSP00000256832:S109F;ENSP00000411947:S109F;ENSP00000350569:S222F;ENSP00000393395:S109F;ENSP00000405440:S109F;ENSP00000389406:S109F	ENSP00000256830:S230F	S	+	2	0	NEDD4L	54147215	1.000000	0.71417	0.788000	0.31933	0.436000	0.31835	4.335000	0.59298	2.937000	0.99478	0.650000	0.86243	TCC		0.587	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1			5	65	0	0	0	0.000602	0	5	65				
MUC16	94025	broad.mit.edu	37	19	9087070	9087070	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:9087070G>T	ENST00000397910.4	-	1	4948	c.4745C>A	c.(4744-4746)tCc>tAc	p.S1582Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1582	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGGGAAGGGGATGCTGAGGC	0.498																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(4744-4746)TCC>TAC		mucin 16							347.0	332.0	337.0					19																	9087070		2041	4195	6236	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9087070G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4745C>A	19.37:g.9087070G>T	ENSP00000381008:p.Ser1582Tyr		Somatic					p.S1582Y	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	4949	-			1582			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.4745C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343125	0.05243	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.522	0.522	0.17053	.	.	.	.	.	T	0.04137	0.0115	N	0.08118	0	.	.	.	D	0.58970	0.984	D	0.63877	0.919	T	0.45659	-0.9246	7	0.87932	D	0	.	.	.	.	.	1582	B5ME49	.	Y	1582	ENSP00000381008:S1582Y	ENSP00000381008:S1582Y	S	-	2	0	MUC16	8948070	0.002000	0.14202	0.101000	0.21167	0.220000	0.24768	1.490000	0.35573	0.508000	0.28173	0.313000	0.20887	TCC		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		23	209	1	0	2.27525e-19	0.003954	3.63276e-19	23	209				
BEST2	54831	broad.mit.edu	37	19	12867072	12867072	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:12867072C>T	ENST00000549706.1	+	9	1390	c.1066C>T	c.(1066-1068)Cgg>Tgg	p.R356W	BEST2_ENST00000042931.1_Missense_Mutation_p.R356W|BEST2_ENST00000553030.1_Missense_Mutation_p.R356W			Q8NFU1	BEST2_HUMAN	bestrophin 2	356					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						CTTCCAGCTGCGGCAGCCTTC	0.627																																							uc002mux.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1066-1068)CGG>TGG		vitelliform macular dystrophy 2-like 1							108.0	112.0	110.0					19																	12867072		2066	4198	6264	SO:0001583	missense	54831				membrane depolarization|sensory perception of smell	chloride channel complex|cilium|plasma membrane	chloride channel activity	g.chr19:12867072C>T	AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	ENST00000549706.1:c.1066C>T	19.37:g.12867072C>T	ENSP00000448310:p.Arg356Trp		Somatic					p.R356W	NM_017682	NP_060152	WXS	Illumina HiSeq	Unspecified	Q8NFU1	BEST2_HUMAN			8	1066	+			356			Cytoplasmic (Potential).		Q53YQ8|Q9NXP0	Missense_Mutation	SNP	ENST00000549706.1	37	c.1066C>T	CCDS42506.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977925	0.53720	.	.	ENSG00000039987	ENST00000549706;ENST00000553030;ENST00000042931	D;D;D	0.97976	-4.64;-4.64;-4.64	4.03	4.03	0.46877	.	0.339336	0.27240	N	0.020261	D	0.96790	0.8952	L	0.43923	1.385	0.44129	D	0.996918	D	0.59767	0.986	P	0.51701	0.677	D	0.97061	0.9771	10	0.62326	D	0.03	-4.2851	15.0879	0.72170	0.0:1.0:0.0:0.0	.	356	Q8NFU1	BEST2_HUMAN	W	356	ENSP00000448310:R356W;ENSP00000447203:R356W;ENSP00000042931:R356W	ENSP00000042931:R356W	R	+	1	2	BEST2	12728072	0.073000	0.21202	0.024000	0.17045	0.005000	0.04900	2.372000	0.44257	2.086000	0.62901	0.491000	0.48974	CGG		0.627	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403343.1	NM_017682		10	199	0	0	0	0.000978	0	10	199				
CYP4F3	4051	broad.mit.edu	37	19	15769110	15769110	+	Silent	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:15769110C>T	ENST00000221307.8	+	10	1199	c.1152C>T	c.(1150-1152)tgC>tgT	p.C384C	CYP4F3_ENST00000585846.1_Silent_p.C384C|CYP4F3_ENST00000591058.1_Silent_p.C384C|CYP4F3_ENST00000586182.2_Silent_p.C384C	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	384					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.C384*(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						TGACCATGTGCATTAAGGAGA	0.592																																							uc002nbj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(1150-1152)TGC>TGT		cytochrome P450, family 4, subfamily F,							86.0	87.0	87.0					19																	15769110		2203	4300	6503	SO:0001819	synonymous_variant	4051				leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding	g.chr19:15769110C>T	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.1152C>T	19.37:g.15769110C>T			Somatic				CYP4F3_uc010xok.1_Silent_p.C384C|CYP4F3_uc010xol.1_Silent_p.C384C|CYP4F3_uc010xom.1_Silent_p.C235C|CYP4F3_uc002nbk.2_Silent_p.C384C|CYP4F3_uc010xon.1_Silent_p.C94C	p.C384C	NM_000896	NP_000887	WXS	Illumina HiSeq	Unspecified	Q08477	CP4F3_HUMAN			10	1202	+			384					B7Z8Z3|O60634|Q5U740	Silent	SNP	ENST00000221307.8	37	c.1152C>T	CCDS12332.1																																																																																				0.592	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896		17	122	0	0	0	0.006122	0	17	122				
C19orf44	84167	broad.mit.edu	37	19	16612013	16612013	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:16612013G>T	ENST00000221671.3	+	2	566	c.410G>T	c.(409-411)gGg>gTg	p.G137V	C19orf44_ENST00000594035.1_Missense_Mutation_p.G137V|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	137										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						ATCCTCTCTGGGGGTGCACTC	0.507																																							uc002neh.1		NA																	0					0						c.(409-411)GGG>GTG		hypothetical protein LOC84167							57.0	62.0	60.0					19																	16612013		2203	4300	6503	SO:0001583	missense	84167							g.chr19:16612013G>T	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.410G>T	19.37:g.16612013G>T	ENSP00000221671:p.Gly137Val		Somatic				MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.G137V|C19orf44_uc002neg.2_Missense_Mutation_p.G137V|C19orf44_uc010eai.1_RNA	p.G137V	NM_032207	NP_115583	WXS	Illumina HiSeq	Unspecified	Q9H6X5	CS044_HUMAN			2	483	+			137					Q8N6Y7	Missense_Mutation	SNP	ENST00000221671.3	37	c.410G>T	CCDS12345.1	.	.	.	.	.	.	.	.	.	.	G	7.510	0.654564	0.14580	.	.	ENSG00000105072	ENST00000221671	.	.	.	2.93	0.782	0.18567	.	1.763520	0.03668	N	0.243540	T	0.25680	0.0625	L	0.36672	1.1	0.09310	N	1	P;P	0.42584	0.642;0.784	B;B	0.36885	0.141;0.235	T	0.20338	-1.0278	9	0.26408	T	0.33	-1.505	4.5458	0.12079	0.3136:0.0:0.6864:0.0	.	137;137	Q9H6X5;Q9H6X5-2	CS044_HUMAN;.	V	137	.	ENSP00000221671:G137V	G	+	2	0	C19orf44	16473013	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.112000	0.31172	0.582000	0.29556	-0.140000	0.14226	GGG		0.507	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207		12	60	1	0	1.05317e-09	0.00245	1.48224e-09	12	60				
PBX4	80714	broad.mit.edu	37	19	19681537	19681537	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:19681537C>A	ENST00000251203.9	-	3	585	c.299G>T	c.(298-300)gGa>gTa	p.G100V		NM_025245.2	NP_079521.1	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4	100					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|XY body (GO:0001741)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(4)|ovary(1)|prostate(3)	9						TCCTCCTCTTCCTCTCTTCTC	0.602																																							uc002nmy.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(298-300)GGA>GTA		pre-B-cell leukemia homeobox 4							77.0	69.0	72.0					19																	19681537		2203	4300	6503	SO:0001583	missense	80714						sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:19681537C>A	AJ300182	CCDS12406.1	19p13.11	2014-09-11	2007-01-30		ENSG00000105717			"""Homeoboxes / TALE class"""	13403	protein-coding gene	gene with protein product		608127	"""pre-B-cell leukemia transcription factor 4"""				Standard	NM_025245		Approved		uc002nmy.3	Q9BYU1	OTTHUMG00000172310	ENST00000251203.9:c.299G>T	19.37:g.19681537C>A	ENSP00000251203:p.Gly100Val		Somatic				PBX4_uc010xqz.1_RNA|PBX4_uc010xra.1_5'UTR	p.G100V	NM_025245	NP_079521	WXS	Illumina HiSeq	Unspecified	Q9BYU1	PBX4_HUMAN			3	300	-			100					A5D8Y0|B3KUK9	Missense_Mutation	SNP	ENST00000251203.9	37	c.299G>T	CCDS12406.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821136	0.32237	.	.	ENSG00000105717	ENST00000251203	T	0.34667	1.35	3.13	0.95	0.19572	PBX (1);	0.137737	0.49916	D	0.000121	T	0.48677	0.1513	M	0.73962	2.25	0.80722	D	1	D	0.58970	0.984	P	0.57679	0.825	T	0.44112	-0.9349	10	0.54805	T	0.06	-14.0231	8.5728	0.33581	0.0:0.8282:0.0:0.1718	.	100	Q9BYU1	PBX4_HUMAN	V	100	ENSP00000251203:G100V	ENSP00000251203:G100V	G	-	2	0	PBX4	19542537	1.000000	0.71417	0.032000	0.17829	0.225000	0.24961	3.077000	0.50089	0.050000	0.15949	-0.703000	0.03666	GGA		0.602	PBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417784.6			9	53	1	0	1.12685e-05	0.004482	1.39936e-05	9	53				
ZNF98	148198	broad.mit.edu	37	19	22585642	22585642	+	Nonsense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:22585642C>A	ENST00000357774.5	-	3	323	c.202G>T	c.(202-204)Gga>Tga	p.G68*	ZNF98_ENST00000601553.1_Nonsense_Mutation_p.G68*	NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	68	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GGTTCTTTTCCTTGCTCCAGA	0.423																																							uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(202-204)GGA>TGA		zinc finger protein 98							105.0	113.0	111.0					19																	22585642		2198	4300	6498	SO:0001587	stop_gained	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22585642C>A		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.202G>T	19.37:g.22585642C>A	ENSP00000350418:p.Gly68*		Somatic					p.G68*	NM_001098626	NP_001092096	WXS	Illumina HiSeq	Unspecified	A6NK75	ZNF98_HUMAN			3	324	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	68			KRAB.			Nonsense_Mutation	SNP	ENST00000357774.5	37	c.202G>T	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	22.9	4.353609	0.82243	.	.	ENSG00000197360	ENST00000357774	.	.	.	0.476	-0.698	0.11280	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	.	.	.	.	.	.	.	X	68	.	ENSP00000350418:G68X	G	-	1	0	ZNF98	22377482	0.028000	0.19301	0.063000	0.19743	0.932000	0.56968	-0.178000	0.09782	-0.295000	0.08960	0.298000	0.19748	GGA		0.423	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		18	99	1	0	3.32936e-07	0.006122	4.3929e-07	18	99				
UPK1A	11045	broad.mit.edu	37	19	36159410	36159410	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:36159410C>T	ENST00000222275.2	+	2	139	c.139C>T	c.(139-141)Cgt>Tgt	p.R47C	UPK1A-AS1_ENST00000443196.1_RNA|UPK1A_ENST00000379013.2_Missense_Mutation_p.R47C	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	47					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)	p.R47S(1)		breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGACCAGTACCGTGTATACCC	0.577																																							uc002oaw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)CGT>TGT		uroplakin 1A							142.0	106.0	118.0					19																	36159410		2203	4300	6503	SO:0001583	missense	11045				epithelial cell differentiation|protein oligomerization	endoplasmic reticulum|integral to membrane	monosaccharide binding|protein homodimerization activity	g.chr19:36159410C>T	AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.139C>T	19.37:g.36159410C>T	ENSP00000222275:p.Arg47Cys		Somatic				UPK1A_uc010eeh.2_Missense_Mutation_p.R47C|uc002oax.1_Missense_Mutation_p.R46Q	p.R47C	NM_007000	NP_008931	WXS	Illumina HiSeq	Unspecified	O00322	UPK1A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		2	139	+	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		47			Extracellular (Potential).		Q3KNU5|Q3KNU6	Missense_Mutation	SNP	ENST00000222275.2	37	c.139C>T	CCDS12470.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027209	0.54683	.	.	ENSG00000105668	ENST00000222275;ENST00000379013	T;T	0.79454	-1.27;-1.27	5.33	5.33	0.75918	.	0.187708	0.34580	N	0.003849	T	0.74275	0.3695	N	0.22421	0.69	0.38719	D	0.953408	D;D	0.69078	0.997;0.974	P;P	0.53861	0.736;0.664	T	0.78489	-0.2184	10	0.66056	D	0.02	-4.7915	11.9087	0.52727	0.174:0.826:0.0:0.0	.	47;47	O00322-2;O00322	.;UPK1A_HUMAN	C	47	ENSP00000222275:R47C;ENSP00000368298:R47C	ENSP00000222275:R47C	R	+	1	0	UPK1A	40851250	1.000000	0.71417	0.974000	0.42286	0.243000	0.25628	4.228000	0.58619	2.659000	0.90383	0.561000	0.74099	CGT		0.577	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3			8	96	0	0	0	0.006214	0	8	96				
PSENEN	55851	broad.mit.edu	37	19	36237385	36237385	+	Missense_Mutation	SNP	C	C	G	rs201796315		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:36237385C>G	ENST00000587708.2	+	3	810	c.127C>G	c.(127-129)Ctt>Gtt	p.L43V	U2AF1L4_ENST00000378975.3_5'Flank|U2AF1L4_ENST00000412391.2_5'Flank|PSENEN_ENST00000222266.2_Missense_Mutation_p.L43V|U2AF1L4_ENST00000588100.1_5'Flank|AC002398.11_ENST00000585365.1_RNA|U2AF1L4_ENST00000292879.5_5'Flank|PSENEN_ENST00000591949.1_Missense_Mutation_p.L43V|AD000671.6_ENST00000589807.1_5'Flank|AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_5'Flank|AC002398.9_ENST00000591613.2_Missense_Mutation_p.L43V			Q9NZ42	PEN2_HUMAN	presenilin enhancer gamma secretase subunit	43					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGAGGCCTTCCTTGTCCCAGC	0.527																																							uc002obi.1		NA																	0				ovary(2)	2						c.(127-129)CTT>GTT		presenilin enhancer 2							136.0	133.0	134.0					19																	36237385		2203	4300	6503	SO:0001583	missense	55851				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	aspartic-type endopeptidase activity|protein binding	g.chr19:36237385C>G	AF220053	CCDS12474.1	19q13.12	2014-09-17	2013-09-12			ENSG00000205155			30100	protein-coding gene	gene with protein product		607632	"""presenilin enhancer 2 homolog (C. elegans)"""			12110170, 12660785	Standard	NM_172341		Approved	PEN2	uc002obi.1	Q9NZ42		ENST00000587708.2:c.127C>G	19.37:g.36237385C>G	ENSP00000468411:p.Leu43Val		Somatic				TMEM149_uc010eej.2_5'Flank|U2AF1L4_uc002obh.1_5'Flank|U2AF1L4_uc002obe.2_5'Flank|U2AF1L4_uc002obf.2_5'Flank|U2AF1L4_uc002obg.2_5'Flank|PSENEN_uc002obj.1_Missense_Mutation_p.L43V|PSENEN_uc002obk.1_RNA|LIN37_uc002obm.2_5'Flank	p.L43V	NM_172341	NP_758844	WXS	Illumina HiSeq	Unspecified	Q9NZ42	PEN2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		3	331	+	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		43			Cytoplasmic (Potential).		B2R5L9	Missense_Mutation	SNP	ENST00000587708.2	37	c.127C>G	CCDS12474.1	.	.	.	.	.	.	.	.	.	.	C	8.728	0.915941	0.17907	.	.	ENSG00000205155	ENST00000222266	T	0.76316	-1.01	5.44	0.695	0.18070	.	0.631764	0.16746	N	0.201237	T	0.56529	0.1991	N	0.21097	0.63	0.35891	D	0.829701	B	0.12013	0.005	B	0.12156	0.007	T	0.41752	-0.9491	10	0.15499	T	0.54	-1.3753	4.4326	0.11535	0.2701:0.5111:0.0:0.2188	.	43	Q9NZ42	PEN2_HUMAN	V	43	ENSP00000222266:L43V	ENSP00000222266:L43V	L	+	1	0	PSENEN	40929225	0.607000	0.26958	0.997000	0.53966	0.998000	0.95712	-0.277000	0.08502	0.084000	0.17077	0.655000	0.94253	CTT		0.527	PSENEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459101.2	NM_172341		15	128	0	0	0	0.008871	0	15	128				
RYR1	6261	broad.mit.edu	37	19	39034259	39034259	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:39034259G>T	ENST00000359596.3	+	86	11866	c.11866G>T	c.(11866-11868)Gtg>Ttg	p.V3956L	RYR1_ENST00000355481.4_Missense_Mutation_p.V3951L|RYR1_ENST00000360985.3_Missense_Mutation_p.V3951L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3956					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGCCATGTCGGTGGCTAAGCA	0.597																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(11866-11868)GTG>TTG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						94.0	90.0	91.0					19																	39034259		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39034259G>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11866G>T	19.37:g.39034259G>T	ENSP00000352608:p.Val3956Leu		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.V3951L|RYR1_uc002oiv.1_Missense_Mutation_p.V865L	p.V3956L	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		86	11996	+	all_cancers(60;7.91e-06)		3956					Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.11866G>T	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090876	0.55968	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95205	-3.64;-3.64;-3.64	4.2	4.2	0.49525	RyR/IP3R Homology associated domain (1);	0.000000	0.56097	U	0.000026	D	0.95227	0.8452	L	0.35542	1.07	0.58432	D	0.999997	D;D;D	0.69078	0.99;0.996;0.997	D;D;D	0.79108	0.98;0.987;0.992	D	0.96115	0.9080	10	0.87932	D	0	.	16.3078	0.82855	0.0:0.0:1.0:0.0	.	3951;3951;3956	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	L	3956;3951;3951	ENSP00000352608:V3956L;ENSP00000347667:V3951L;ENSP00000354254:V3951L	ENSP00000347667:V3951L	V	+	1	0	RYR1	43726099	1.000000	0.71417	0.973000	0.42090	0.976000	0.68499	9.259000	0.95561	2.182000	0.69389	0.486000	0.48141	GTG		0.597	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			17	105	1	0	5.3912e-06	0.006122	6.87469e-06	17	105				
ZNF534	147658	broad.mit.edu	37	19	52941209	52941209	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:52941209G>T	ENST00000332323.6	+	4	596	c.535G>T	c.(535-537)Gat>Tat	p.D179Y	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.D166Y	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CTACAGAAATGATTTTCTTTT	0.333																																							uc002pzk.2		NA																	0					0						c.(535-537)GAT>TAT		zinc finger protein 534 isoform 2							85.0	77.0	79.0					19																	52941209		1568	3582	5150	SO:0001583	missense	147658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52941209G>T	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.535G>T	19.37:g.52941209G>T	ENSP00000327538:p.Asp179Tyr		Somatic				ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.D166Y	p.D179Y	NM_001143939	NP_001137411	WXS	Illumina HiSeq	Unspecified	Q76KX8	ZN534_HUMAN			4	596	+			179					Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	c.535G>T	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	G	9.217	1.032329	0.19590	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.07688	3.17;3.21	1.03	1.03	0.20045	.	.	.	.	.	T	0.21347	0.0514	M	0.70595	2.14	0.09310	N	0.999994	D;D	0.89917	0.982;1.0	P;D	0.64042	0.557;0.921	T	0.04229	-1.0967	9	0.72032	D	0.01	.	7.5575	0.27833	0.0:0.0:1.0:0.0	.	166;179	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	Y	179;166;178	ENSP00000327538:D179Y;ENSP00000391358:D166Y	ENSP00000327538:D179Y	D	+	1	0	ZNF534	57633021	0.000000	0.05858	0.007000	0.13788	0.056000	0.15407	0.105000	0.15333	0.856000	0.35383	0.195000	0.17529	GAT		0.333	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512		7	52	1	0	1.12685e-05	0.004482	1.39936e-05	7	52				
CACNG8	59283	broad.mit.edu	37	19	54483188	54483188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:54483188C>A	ENST00000270458.2	+	3	538	c.435C>A	c.(433-435)tgC>tgA	p.C145*	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	145					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GGGGTGTGTGCGTGGCGGCCT	0.642																																							uc002qcs.1		NA																	0					0						c.(430-432)TGC>TGA		voltage-dependent calcium channel gamma-8							35.0	36.0	35.0					19																	54483188		2203	4300	6503	SO:0001587	stop_gained	59283				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr19:54483188C>A	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.435C>A	19.37:g.54483188C>A	ENSP00000270458:p.Cys145*		Somatic				MIR935_hsa-mir-935|MI0005757_5'Flank	p.C144*	NM_031895	NP_114101	WXS	Illumina HiSeq	Unspecified	Q8WXS5	CCG8_HUMAN		GBM - Glioblastoma multiforme(134;0.162)	3	538	+	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)		145			Helical; (Potential).		Q9BXT0|Q9BY23	Nonsense_Mutation	SNP	ENST00000270458.2	37	c.432C>A	CCDS33104.1	.	.	.	.	.	.	.	.	.	.	.	37	6.215331	0.97385	.	.	ENSG00000142408	ENST00000270458	.	.	.	4.53	2.37	0.29283	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.8854	8.2186	0.31528	0.0:0.8005:0.0:0.1995	.	.	.	.	X	145	.	ENSP00000270458:C145X	C	+	3	2	CACNG8	59175000	0.519000	0.26242	1.000000	0.80357	0.985000	0.73830	-0.282000	0.08445	1.072000	0.40860	0.531000	0.56144	TGC		0.642	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139361.3			11	28	1	0	0.00010058	0.001368	0.000119439	11	28				
LILRB5	10990	broad.mit.edu	37	19	54760503	54760503	+	Silent	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:54760503G>T	ENST00000316219.5	-	3	311	c.204C>A	c.(202-204)gcC>gcA	p.A68A	LILRB5_ENST00000345866.6_Silent_p.A68A|LILRB5_ENST00000449561.2_Silent_p.A68A|LILRB5_ENST00000450632.1_Silent_p.A68A	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	68	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTCTCTTCCGGGCCCATGGGA	0.602																																							uc002qex.2		NA																	0				ovary(1)|pancreas(1)	2						c.(202-204)GCC>GCA		leukocyte immunoglobulin-like receptor,							179.0	170.0	174.0					19																	54760503		2203	4300	6503	SO:0001819	synonymous_variant	10990				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity	g.chr19:54760503G>T	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.204C>A	19.37:g.54760503G>T			Somatic				LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.A68A|LILRB5_uc002qey.2_Silent_p.A68A|LILRB5_uc002qez.2_Silent_p.A68A|LILRB5_uc002qfa.1_Silent_p.A58A|LILRB5_uc010yes.1_RNA	p.A68A	NM_006840	NP_006831	WXS	Illumina HiSeq	Unspecified	O75023	LIRB5_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	3	315	-	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)		68			Ig-like C2-type 1.|Extracellular (Potential).		Q8N760	Silent	SNP	ENST00000316219.5	37	c.204C>A	CCDS12885.1																																																																																				0.602	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2			33	189	1	0	1.30998e-17	0.005524	2.057e-17	33	189				
SH3YL1	26751	broad.mit.edu	37	2	233146	233146	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:233146G>C	ENST00000405430.1	-	8	864	c.488C>G	c.(487-489)tCt>tGt	p.S163C	SH3YL1_ENST00000403712.2_Missense_Mutation_p.S163C|SH3YL1_ENST00000415006.2_Missense_Mutation_p.S67C|SH3YL1_ENST00000403657.1_Missense_Mutation_p.S67C|SH3YL1_ENST00000403658.1_Missense_Mutation_p.S67C|SH3YL1_ENST00000356150.5_Missense_Mutation_p.S163C|SH3YL1_ENST00000468321.1_5'UTR			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	163					phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		CCCTTCTAAAGACACGCCTGC	0.423																																							uc002qvx.2		NA																	0				ovary(1)	1						c.(487-489)TCT>TGT		SH3 domain containing, Ysc84-like 1 isoform 1							64.0	60.0	61.0					2																	233146		1851	4099	5950	SO:0001583	missense	26751							g.chr2:233146G>C		CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.488C>G	2.37:g.233146G>C	ENSP00000384269:p.Ser163Cys		Somatic				SH3YL1_uc002qvy.2_Missense_Mutation_p.S163C|SH3YL1_uc002qvz.2_RNA|SH3YL1_uc002qwa.2_RNA|SH3YL1_uc010ewe.2_Missense_Mutation_p.S67C|SH3YL1_uc002qvu.2_RNA|SH3YL1_uc002qvv.2_Missense_Mutation_p.S67C|SH3YL1_uc002qvw.2_RNA	p.S163C	NM_015677	NP_056492	WXS	Illumina HiSeq	Unspecified	Q96HL8	SH3Y1_HUMAN		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)	6	572	-	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)	163					A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Missense_Mutation	SNP	ENST00000405430.1	37	c.488C>G		.	.	.	.	.	.	.	.	.	.	G	14.55	2.570266	0.45798	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658	T;T;T;T;T;T	0.29142	1.75;1.75;1.77;1.58;1.58;1.77	5.72	4.83	0.62350	Ysc84 actin-binding domain (1);	0.521381	0.19768	N	0.106501	T	0.66597	0.2805	H	0.94503	3.545	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.974;0.919;0.999;0.999	T	0.76520	-0.2929	10	0.87932	D	0	-40.0217	14.284	0.66232	0.0:0.1671:0.8329:0.0	.	67;163;163;67	Q96HL8-4;Q96HL8-2;Q96HL8;Q96HL8-3	.;.;SH3Y1_HUMAN;.	C	67;163;67;163;163;67	ENSP00000404143:S67C;ENSP00000384276:S163C;ENSP00000385668:S67C;ENSP00000384269:S163C;ENSP00000348471:S163C;ENSP00000383928:S67C	ENSP00000348471:S163C	S	-	2	0	SH3YL1	223146	1.000000	0.71417	0.018000	0.16275	0.056000	0.15407	6.646000	0.74348	1.380000	0.46344	0.563000	0.77884	TCT		0.423	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677		6	38	0	0	0	0.006214	0	6	38				
PLB1	151056	broad.mit.edu	37	2	28840597	28840597	+	Missense_Mutation	SNP	T	T	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:28840597T>G	ENST00000327757.5	+	45	3243	c.3199T>G	c.(3199-3201)Tgg>Ggg	p.W1067G	PLB1_ENST00000422425.2_Missense_Mutation_p.W1056G|PLB1_ENST00000541605.1_Missense_Mutation_p.W32G	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1067	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GATTTAGAACTGGGGCAGTGA	0.463																																							uc002rmb.1		NA																	0				ovary(4)|large_intestine(2)|skin(2)|breast(1)	9						c.(3199-3201)TGG>GGG		phospholipase B1 precursor							196.0	174.0	181.0					2																	28840597		2203	4300	6503	SO:0001583	missense	151056				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	g.chr2:28840597T>G		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.3199T>G	2.37:g.28840597T>G	ENSP00000330442:p.Trp1067Gly		Somatic				PLB1_uc010ezj.1_Missense_Mutation_p.W1056G|PLB1_uc002rme.1_Missense_Mutation_p.W32G|PLB1_uc002rmf.1_RNA	p.W1067G	NM_153021	NP_694566	WXS	Illumina HiSeq	Unspecified	Q6P1J6	PLB1_HUMAN			45	3199	+	Acute lymphoblastic leukemia(172;0.155)		1067			4 X 308-326 AA approximate repeats.|Extracellular (Potential).|4.		A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	c.3199T>G	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	T	17.22	3.334686	0.60853	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000541605	T;T;T	0.18502	2.21;2.57;2.74	5.22	5.22	0.72569	.	0.547416	0.20176	N	0.097636	T	0.38348	0.1037	M	0.78223	2.4	0.34944	D	0.750625	D;D	0.65815	0.995;0.991	D;P	0.66716	0.946;0.884	T	0.48801	-0.9003	10	0.21540	T	0.41	-4.9508	11.8028	0.52137	0.0:0.0:0.0:1.0	.	1056;1067	Q6P1J6-3;Q6P1J6	.;PLB1_HUMAN	G	1067;1056;32	ENSP00000330442:W1067G;ENSP00000416440:W1056G;ENSP00000437426:W32G	ENSP00000330442:W1067G	W	+	1	0	PLB1	28694101	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	4.622000	0.61240	2.110000	0.64415	0.397000	0.26171	TGG		0.463	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			25	99	0	0	0	0.002445	0	25	99				
ATOH8	84913	broad.mit.edu	37	2	85981354	85981354	+	Silent	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:85981354C>T	ENST00000306279.3	+	1	338	c.42C>T	c.(40-42)acC>acT	p.T14T		NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	14					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGTGGAAGACCGTGTGCGTGA	0.692																																							uc002sqn.2		NA																	0					0						c.(40-42)ACC>ACT		atonal homolog 8							15.0	17.0	16.0					2																	85981354		2189	4276	6465	SO:0001819	synonymous_variant	84913				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr2:85981354C>T	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.42C>T	2.37:g.85981354C>T			Somatic				ATOH8_uc002sqm.3_Silent_p.T14T	p.T14T	NM_032827	NP_116216	WXS	Illumina HiSeq	Unspecified	Q96SQ7	ATOH8_HUMAN			1	446	+			14					Q504S2|Q659B0	Silent	SNP	ENST00000306279.3	37	c.42C>T	CCDS1985.1																																																																																				0.692	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827		4	16	0	0	0	0.001168	0	4	16				
TBC1D8	11138	broad.mit.edu	37	2	101706815	101706815	+	Missense_Mutation	SNP	C	C	G	rs376513686		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:101706815C>G	ENST00000376840.4	-	2	138	c.139G>C	c.(139-141)Ggc>Cgc	p.G47R	TBC1D8_ENST00000409318.1_Missense_Mutation_p.G47R			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	47					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TCCAGAGCGCCGACCAGGCGA	0.547																																							uc010fiv.2		NA																	0				ovary(3)	3						c.(139-141)GGC>CGC		TBC1 domain family, member 8							54.0	54.0	54.0					2																	101706815		1961	4153	6114	SO:0001583	missense	11138				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity	g.chr2:101706815C>G	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.139G>C	2.37:g.101706815C>G	ENSP00000366036:p.Gly47Arg		Somatic				TBC1D8_uc010yvw.1_Missense_Mutation_p.G47R	p.G47R	NM_001102426	NP_001095896	WXS	Illumina HiSeq	Unspecified	O95759	TBCD8_HUMAN			2	270	-			47					A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	37	c.139G>C	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006903	0.93287	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.24350	1.86;3.35	5.7	5.7	0.88788	.	.	.	.	.	T	0.57725	0.2073	M	0.83223	2.63	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	T	0.60286	-0.7293	9	0.59425	D	0.04	-7.0608	19.8389	0.96675	0.0:1.0:0.0:0.0	.	47;47	B7Z6L4;O95759	.;TBCD8_HUMAN	R	47	ENSP00000366036:G47R;ENSP00000386856:G47R	ENSP00000366036:G47R	G	-	1	0	TBC1D8	101073247	1.000000	0.71417	0.866000	0.34008	0.962000	0.63368	6.832000	0.75329	2.703000	0.92315	0.655000	0.94253	GGC		0.547	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063		7	45	0	0	0	0.00308	0	7	45				
LRP1B	53353	broad.mit.edu	37	2	141299476	141299476	+	Nonsense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:141299476C>T	ENST00000389484.3	-	44	8230	c.7259G>A	c.(7258-7260)tGg>tAg	p.W2420*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2420					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCAGTCCGACCAGAATATATA	0.388										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(7258-7260)TGG>TAG		low density lipoprotein-related protein 1B							96.0	91.0	93.0					2																	141299476		2203	4299	6502	SO:0001587	stop_gained	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141299476C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7259G>A	2.37:g.141299476C>T	ENSP00000374135:p.Trp2420*	TSP Lung(27;0.18)	Somatic					p.W2420*	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	44	8231	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2420			Extracellular (Potential).|LDL-receptor class B 27.		Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	c.7259G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	54	22.302295	0.99947	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.46	5.46	0.80206	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2959	0.94122	0.0:1.0:0.0:0.0	.	.	.	.	X	2420;2358	.	ENSP00000374135:W2420X	W	-	2	0	LRP1B	141015946	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.771000	0.85420	2.552000	0.86080	0.491000	0.48974	TGG		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		13	62	0	0	0	0.00245	0	13	62				
SCN7A	6332	broad.mit.edu	37	2	167262236	167262236	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:167262236C>A	ENST00000409855.1	-	25	5029	c.4903G>T	c.(4903-4905)Gct>Tct	p.A1635S		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1635					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTTTTATAAGCACGTTGAATG	0.378																																							uc002udu.1		NA																	0				large_intestine(1)	1						c.(4903-4905)GCT>TCT		sodium channel, voltage-gated, type VII, alpha							175.0	164.0	167.0					2																	167262236		1862	4101	5963	SO:0001583	missense	6332				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167262236C>A	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4903G>T	2.37:g.167262236C>A	ENSP00000386796:p.Ala1635Ser		Somatic					p.A1635S	NM_002976	NP_002967	WXS	Illumina HiSeq	Unspecified	Q01118	SCN7A_HUMAN			25	5030	-			1635						Missense_Mutation	SNP	ENST00000409855.1	37	c.4903G>T	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673154	0.67928	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.97256	-4.31	4.51	4.51	0.55191	.	0.000000	0.56097	D	0.000040	D	0.98077	0.9366	M	0.75447	2.3	0.34855	D	0.741992	D	0.76494	0.999	D	0.78314	0.991	D	0.99967	1.1882	10	0.66056	D	0.02	.	15.1081	0.72336	0.0:1.0:0.0:0.0	.	1635	Q01118	SCN7A_HUMAN	S	1635	ENSP00000386796:A1635S	ENSP00000259060:A1635S	A	-	1	0	SCN7A	166970482	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	3.612000	0.54142	2.514000	0.84764	0.655000	0.94253	GCT		0.378	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			15	109	1	0	1.3612e-06	0.003163	1.77143e-06	15	109				
MDH1B	130752	broad.mit.edu	37	2	207621963	207621963	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:207621963G>C	ENST00000374412.3	-	3	543	c.268C>G	c.(268-270)Cag>Gag	p.Q90E	MDH1B_ENST00000454776.2_Missense_Mutation_p.Q90E|MDH1B_ENST00000449792.1_5'UTR|MDH1B_ENST00000392214.2_Missense_Mutation_p.Q90E	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	90					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		TTATATACCTGAGCATGCTCC	0.368																																					Pancreas(76;29 1355 28675 37177 51207)	Pancreas(76;29 1355 28675 37177 51207)	uc002vbs.2		NA																	0				ovary(3)|kidney(1)	4						c.(268-270)CAG>GAG		malate dehydrogenase 1B, NAD (soluble)							99.0	96.0	97.0					2																	207621963		2203	4300	6503	SO:0001583	missense	130752				carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity	g.chr2:207621963G>C		CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.268C>G	2.37:g.207621963G>C	ENSP00000363533:p.Gln90Glu		Somatic				MDH1B_uc010ziw.1_RNA|MDH1B_uc010fui.2_Missense_Mutation_p.Q90E|MDH1B_uc010fuj.2_5'UTR|MDH1B_uc002vbt.2_RNA	p.Q90E	NM_001039845	NP_001034934	WXS	Illumina HiSeq	Unspecified	Q5I0G3	MDH1B_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)	3	323	-			90					A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	ENST00000374412.3	37	c.268C>G	CCDS33365.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671023	0.47781	.	.	ENSG00000138400	ENST00000374412;ENST00000454776;ENST00000392214	T;T;T	0.58940	0.3;0.3;0.3	5.84	4.93	0.64822	.	0.056003	0.64402	D	0.000001	T	0.54431	0.1858	L	0.48986	1.54	0.44129	D	0.996917	B;B	0.22346	0.068;0.041	B;B	0.26517	0.07;0.032	T	0.50039	-0.8874	10	0.33940	T	0.23	-27.0199	16.9986	0.86375	0.0:0.1269:0.8731:0.0	.	90;90	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	E	90	ENSP00000363533:Q90E;ENSP00000389916:Q90E;ENSP00000376049:Q90E	ENSP00000363533:Q90E	Q	-	1	0	MDH1B	207330208	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.835000	0.69368	2.779000	0.95612	0.655000	0.94253	CAG		0.368	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845		20	87	0	0	0	0.00278	0	20	87				
DES	1674	broad.mit.edu	37	2	220286087	220286087	+	Missense_Mutation	SNP	G	G	T	rs57965306		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:220286087G>T	ENST00000373960.3	+	6	1135	c.1049G>T	c.(1048-1050)cGg>cTg	p.R350L		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	350	Coil 2B.|Rod.		R -> P (in Kaeser syndrome and MFM1; incapable of de novo formation of a desmin intermediate filaments network; exerts a dominant negative effect on the ordered lateral arrangement of desmin subunits; dbSNP:rs57965306). {ECO:0000269|PubMed:15800015, ECO:0000269|PubMed:17439987}.		cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGGCAGATGCGGGAATTGGAG	0.587																																							uc002vll.2		NA																	0				central_nervous_system(2)	2	GRCh37	CM051448	DES	M	rs57965306	c.(1048-1050)CGG>CTG		desmin							58.0	59.0	59.0					2																	220286087		2203	4300	6503	SO:0001583	missense	1674				cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton	g.chr2:220286087G>T	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.1049G>T	2.37:g.220286087G>T	ENSP00000363071:p.Arg350Leu		Somatic					p.R350L	NM_001927	NP_001918	WXS	Illumina HiSeq	Unspecified	P17661	DESM_HUMAN		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)	6	1135	+		Renal(207;0.0183)	350			Rod.|Coil 2B.		Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Missense_Mutation	SNP	ENST00000373960.3	37	c.1049G>T	CCDS33383.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988663	0.93106	.	.	ENSG00000175084	ENST00000373960	D	0.95918	-3.85	5.24	5.24	0.73138	Filament (1);	0.000000	0.45867	D	0.000333	D	0.97433	0.9160	M	0.75615	2.305	0.52099	D	0.99994	D	0.69078	0.997	D	0.68483	0.958	D	0.97659	1.0159	10	0.62326	D	0.03	.	18.6284	0.91350	0.0:0.0:1.0:0.0	.	350	P17661	DESM_HUMAN	L	350	ENSP00000363071:R350L	ENSP00000363071:R350L	R	+	2	0	DES	219994331	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.519000	0.98025	2.706000	0.92434	0.655000	0.94253	CGG		0.587	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130240.1	NM_001927		7	64	1	0	3.09899e-07	0.004482	4.11753e-07	7	64				
STK11IP	114790	broad.mit.edu	37	2	220473352	220473352	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:220473352G>C	ENST00000456909.1	+	15	1741	c.1651G>C	c.(1651-1653)Ggc>Cgc	p.G551R	STK11IP_ENST00000295641.10_Missense_Mutation_p.G562R			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	562	Glu-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGCCTGAGGGCGTACGGGG	0.602																																							uc002vml.2		NA																	0				ovary(1)	1						c.(1684-1686)GGC>CGC		LKB1 interacting protein							51.0	56.0	54.0					2																	220473352		1989	4143	6132	SO:0001583	missense	114790				protein localization	cytoplasm	protein kinase binding	g.chr2:220473352G>C	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1651G>C	2.37:g.220473352G>C	ENSP00000389383:p.Gly551Arg		Somatic				STK11IP_uc010zll.1_Missense_Mutation_p.G519R|STK11IP_uc002vmm.1_Missense_Mutation_p.G551R	p.G562R	NM_052902	NP_443134	WXS	Illumina HiSeq	Unspecified	Q8N1F8	S11IP_HUMAN		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	15	1727	+		Renal(207;0.0183)	562			Glu-rich.		Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37	c.1684G>C		.	.	.	.	.	.	.	.	.	.	G	9.958	1.221987	0.22457	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.05925	3.37;3.37	4.5	2.65	0.31530	.	0.643302	0.15054	N	0.283110	T	0.19446	0.0467	M	0.65975	2.015	0.09310	N	1	B;D;B	0.89917	0.073;1.0;0.043	B;D;B	0.79108	0.044;0.992;0.043	T	0.01940	-1.1243	10	0.66056	D	0.02	-9.4031	8.5884	0.33672	0.1907:0.0:0.8093:0.0	.	530;562;562	B4DUE4;Q8N1F8-2;Q8N1F8	.;.;S11IP_HUMAN	R	551;530;562	ENSP00000389383:G551R;ENSP00000295641:G562R	ENSP00000295641:G562R	G	+	1	0	STK11IP	220181596	0.999000	0.42202	0.006000	0.13384	0.068000	0.16541	3.318000	0.51975	1.109000	0.41680	-0.258000	0.10820	GGC		0.602	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		6	56	0	0	0	0.001984	0	6	56				
INPP5D	3635	broad.mit.edu	37	2	233995347	233995347	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:233995347G>A	ENST00000359570.5	+	5	654	c.654G>A	c.(652-654)aaG>aaA	p.K218K	INPP5D_ENST00000538935.1_Silent_p.K218K|INPP5D_ENST00000474278.1_3'UTR			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	218					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TGCTCTGCAAGGAGCTCTATG	0.577																																					NSCLC(82;1215 1426 16163 20348 41018)	NSCLC(82;1215 1426 16163 20348 41018)	uc010zmo.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(652-654)AAG>AAA		SH2 containing inositol phosphatase isoform a							39.0	39.0	39.0					2																	233995347		1893	4106	5999	SO:0001819	synonymous_variant	3635				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding	g.chr2:233995347G>A	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.654G>A	2.37:g.233995347G>A			Somatic				INPP5D_uc010zmp.1_Silent_p.K217K	p.K218K	NM_001017915	NP_001017915	WXS	Illumina HiSeq	Unspecified	Q92835	SHIP1_HUMAN		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)	5	807	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)	218					O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Silent	SNP	ENST00000359570.5	37	c.654G>A																																																																																					0.577	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915		4	38	0	0	0	0.001168	0	4	38				
ANKMY1	51281	broad.mit.edu	37	2	241465684	241465685	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr2:241465684_241465685CC>AA	ENST00000272972.3	-	5	1078_1079	c.864_865GG>TT	c.(862-867)gtGGcg>gtTTcg	p.A289S	ANKMY1_ENST00000536462.1_Intron|ANKMY1_ENST00000373320.4_Intron|ANKMY1_ENST00000361678.4_Intron|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000405002.1_Intron|ANKMY1_ENST00000405523.3_Intron|ANKMY1_ENST00000373318.2_Intron|ANKMY1_ENST00000462004.1_5'UTR|ANKMY1_ENST00000391987.1_Missense_Mutation_p.A289S|ANKMY1_ENST00000401804.1_Missense_Mutation_p.A378S|ANKMY1_ENST00000403283.1_Intron	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	289							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		TTTGCGTCCGCCACGTCAGCAC	0.554																																							uc002vyz.1		NA																	0				central_nervous_system(1)	1						c.(862-867)GTGGCG>GTTTCG		ankyrin repeat and MYND domain containing 1																																				SO:0001583	missense	51281						zinc ion binding	g.chr2:241465684_241465685CC>AA	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.864_865delinsAA	2.37:g.241465684_241465685delinsAA	ENSP00000272972:p.Ala289Ser		Somatic				ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Missense_Mutation_p.A378S|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	p.A289S	NM_016552	NP_057636	WXS	Illumina HiSeq	Unspecified	Q9P2S6	ANKY1_HUMAN		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)	5	1093_1094	-		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	289					B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	DNP	ENST00000272972.3	37	c.864_865GG>TT	CCDS2536.1																																																																																				0.554	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844		7	90	0	0	0	0.004672	0	7	90				
PLCB1	23236	broad.mit.edu	37	20	8703032	8703032	+	Silent	SNP	T	T	C	rs201832361		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr20:8703032T>C	ENST00000338037.6	+	15	1572	c.1545T>C	c.(1543-1545)gaT>gaC	p.D515D	PLCB1_ENST00000378641.3_Silent_p.D515D|PLCB1_ENST00000378637.2_Silent_p.D515D|PLCB1_ENST00000494924.1_3'UTR	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	515					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						ACGACGACGATGATGATGATG	0.423													t|||	1	0.000199681	0.0	0.0	5008	,	,		16928	0.001		0.0	False		,,,				2504	0.0						uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(1543-1545)GAT>GAC		phosphoinositide-specific phospholipase C beta 1							218.0	177.0	191.0					20																	8703032		2203	4300	6503	SO:0001819	synonymous_variant	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8703032T>C	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1545T>C	20.37:g.8703032T>C			Somatic				PLCB1_uc010zrb.1_Silent_p.D414D|PLCB1_uc002wna.2_Silent_p.D515D|PLCB1_uc002wnc.1_Silent_p.D414D|PLCB1_uc002wnd.1_Silent_p.D92D	p.D515D	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			15	1548	+			515					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	c.1545T>C	CCDS13102.1																																																																																				0.423	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			3	87	0	0	0	0.004672	0	3	87				
TTC3	7267	broad.mit.edu	37	21	38459593	38459593	+	Silent	SNP	G	G	T	rs73201925		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr21:38459593G>T	ENST00000399017.2	+	2	2783	c.36G>T	c.(34-36)gcG>gcT	p.A12A	TTC3_ENST00000399010.1_Silent_p.A12A|TTC3_ENST00000355666.1_Silent_p.A12A|TTC3_ENST00000354749.2_Silent_p.A12A|TTC3_ENST00000540756.1_Intron|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	12					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TCACTGTGGCGGATTATGCCT	0.403																																					Ovarian(38;194 1649 35661)	Ovarian(38;194 1649 35661)	uc002yvz.2		NA																	0				skin(3)|ovary(2)|lung(2)|breast(2)	9						c.(34-36)GCG>GCT		tetratricopeptide repeat domain 3							343.0	291.0	309.0					21																	38459593		2203	4300	6503	SO:0001819	synonymous_variant	7267				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr21:38459593G>T	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.36G>T	21.37:g.38459593G>T			Somatic				TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Silent_p.A12A|TTC3_uc002ywb.2_Silent_p.A12A|TTC3_uc010gnf.2_5'UTR|TTC3_uc011aed.1_Intron|TTC3_uc010gne.1_Silent_p.A12A	p.A12A	NM_001001894	NP_001001894	WXS	Illumina HiSeq	Unspecified	P53804	TTC3_HUMAN			2	141	+		Myeloproliferative disorder(46;0.0412)	12					A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	ENST00000399017.2	37	c.36G>T	CCDS13651.1																																																																																				0.403	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1			39	233	1	0	2.42038e-35	0.007835	3.9989e-35	39	233				
AP1B1	162	broad.mit.edu	37	22	29754807	29754807	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr22:29754807C>A	ENST00000405198.1	-	4	464	c.433G>T	c.(433-435)Gtg>Ttg	p.V145L	AP1B1_ENST00000317368.7_Missense_Mutation_p.V145L|AP1B1_ENST00000432560.2_Missense_Mutation_p.V145L|AP1B1_ENST00000356015.2_Missense_Mutation_p.V145L|AP1B1_ENST00000415447.1_Missense_Mutation_p.V145L|AP1B1_ENST00000357586.2_Missense_Mutation_p.V145L|AP1B1_ENST00000402502.1_Missense_Mutation_p.V145L			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	145					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AGCTTGGCCACGCACACAGCT	0.577																																							uc003afj.2		NA																	0				ovary(1)|skin(1)	2						c.(433-435)GTG>TTG		adaptor-related protein complex 1 beta 1 subunit							143.0	104.0	117.0					22																	29754807		2203	4300	6503	SO:0001583	missense	162				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity	g.chr22:29754807C>A	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.433G>T	22.37:g.29754807C>A	ENSP00000384194:p.Val145Leu		Somatic				AP1B1_uc003afi.2_Missense_Mutation_p.V145L|AP1B1_uc003afk.2_Missense_Mutation_p.V145L|AP1B1_uc003afl.2_Missense_Mutation_p.V145L	p.V145L	NM_001127	NP_001118	WXS	Illumina HiSeq	Unspecified	Q10567	AP1B1_HUMAN			5	617	-			145					C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	c.433G>T	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621782	0.87460	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447;ENST00000421126	T;T;T;T;T;T;T;T	0.05513	3.43;3.43;3.43;3.43;3.43;3.43;3.43;3.43	5.62	5.62	0.85841	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25644	0.0624	M	0.70842	2.15	0.80722	D	1	P;P;D;D	0.67145	0.621;0.621;0.996;0.967	B;B;D;P	0.67103	0.149;0.149;0.949;0.803	T	0.00174	-1.1956	10	0.87932	D	0	-20.5281	19.2522	0.93929	0.0:1.0:0.0:0.0	.	145;145;145;145	F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;AP1B1_HUMAN;.	L	145	ENSP00000350199:V145L;ENSP00000348297:V145L;ENSP00000400065:V145L;ENSP00000384194:V145L;ENSP00000319361:V145L;ENSP00000386071:V145L;ENSP00000387612:V145L;ENSP00000400022:V145L	ENSP00000319361:V145L	V	-	1	0	AP1B1	28084807	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.738000	0.84966	2.651000	0.90000	0.563000	0.77884	GTG		0.577	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127		7	48	1	0	2.17888e-05	0.006214	2.68823e-05	7	48				
CELSR1	9620	broad.mit.edu	37	22	46780486	46780486	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr22:46780486G>A	ENST00000262738.3	-	20	6836	c.6837C>T	c.(6835-6837)tcC>tcT	p.S2279S		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2279					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGGAGACGGAGGACTCCAGCT	0.552																																							uc003bhw.1		NA																	0				lung(4)|breast(4)|pancreas(2)|skin(1)	11						c.(6835-6837)TCC>TCT		cadherin EGF LAG seven-pass G-type receptor 1							50.0	55.0	53.0					22																	46780486		2203	4300	6503	SO:0001819	synonymous_variant	9620				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity	g.chr22:46780486G>A	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6837C>T	22.37:g.46780486G>A			Somatic				CELSR1_uc011arc.1_Silent_p.S600S	p.S2279S	NM_014246	NP_055061	WXS	Illumina HiSeq	Unspecified	Q9NYQ6	CELR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	20	6837	-		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)	2279			Extracellular (Potential).		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	c.6837C>T	CCDS14076.1																																																																																				0.552	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246		8	24	0	0	0	0.00308	0	8	24				
ITPR1	3708	broad.mit.edu	37	3	4558210	4558210	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr3:4558210G>T	ENST00000443694.2	+	1	35	c.35G>T	c.(34-36)gGa>gTa	p.G12V	ITPR1_ENST00000354582.6_Missense_Mutation_p.G12V|ITPR1_ENST00000456211.2_Missense_Mutation_p.G12V|ITPR1_ENST00000357086.4_Missense_Mutation_p.G12V|ITPR1_ENST00000423119.2_Missense_Mutation_p.G12V|ITPR1_ENST00000302640.8_Missense_Mutation_p.G12V|ITPR1_ENST00000544951.1_Missense_Mutation_p.G12V			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	12					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CTACATATTGGAGACATTTGT	0.383																																							uc003bqa.2		NA																	0				lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21						c.(34-36)GGA>GTA		inositol 1,4,5-triphosphate receptor, type 1							195.0	183.0	186.0					3																	4558210		1888	4106	5994	SO:0001583	missense	3708				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding	g.chr3:4558210G>T	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.35G>T	3.37:g.4558210G>T	ENSP00000401671:p.Gly12Val		Somatic				ITPR1_uc010hbz.2_Missense_Mutation_p.G12V|ITPR1_uc010hca.1_Missense_Mutation_p.G12V|ITPR1_uc011asu.1_Missense_Mutation_p.G12V|ITPR1_uc010hcb.1_Missense_Mutation_p.G12V	p.G12V	NM_001099952	NP_001093422	WXS	Illumina HiSeq	Unspecified	Q14643	ITPR1_HUMAN		Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	3	383	+			12			Cytoplasmic (Potential).		E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	c.35G>T	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624798	0.87560	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.99252	-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63	5.57	5.57	0.84162	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	M	0.92833	3.35	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98216	1.0475	10	0.87932	D	0	.	18.3298	0.90264	0.0:0.0:1.0:0.0	.	12;12;12;12;12	B7ZMI3;E7EPX7;Q14643;E7EVP7;G5E9P1	.;.;ITPR1_HUMAN;.;.	V	12	ENSP00000306253:G12V;ENSP00000346595:G12V;ENSP00000405934:G12V;ENSP00000349597:G12V;ENSP00000397885:G12V;ENSP00000440564:G12V;ENSP00000401671:G12V	ENSP00000306253:G12V	G	+	2	0	ITPR1	4533210	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.929000	0.92859	2.602000	0.87976	0.591000	0.81541	GGA		0.383	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222		10	117	1	0	2.80697e-09	0.000978	3.92151e-09	10	117				
SLC25A38	54977	broad.mit.edu	37	3	39432934	39432934	+	Silent	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr3:39432934C>T	ENST00000273158.4	+	4	656	c.279C>T	c.(277-279)tcC>tcT	p.S93S		NM_017875.2	NP_060345.2			solute carrier family 25, member 38											breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CTCTGCAGTCCATTGTGAGAT	0.468																																							uc003cjo.2		NA																	0					0						c.(277-279)TCC>TCT		solute carrier family 25, member 38							337.0	366.0	356.0					3																	39432934		2203	4300	6503	SO:0001819	synonymous_variant	54977				erythrocyte differentiation|heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane		g.chr3:39432934C>T	BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.279C>T	3.37:g.39432934C>T			Somatic					p.S93S	NM_017875	NP_060345	WXS	Illumina HiSeq	Unspecified	Q96DW6	S2538_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)	4	680	+			93			Solcar 1.|Helical; Name=2; (Potential).			Silent	SNP	ENST00000273158.4	37	c.279C>T	CCDS2685.1																																																																																				0.468	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254057.3	NM_017875		78	544	0	0	0	0.00361	0	78	544				
GPR27	2850	broad.mit.edu	37	3	71804119	71804119	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr3:71804119C>T	ENST00000304411.2	+	1	919	c.919C>T	c.(919-921)Cgg>Tgg	p.R307W	EIF4E3_ENST00000448225.1_5'Flank|EIF4E3_ENST00000421769.2_5'Flank|EIF4E3_ENST00000295612.3_5'Flank	NM_018971.1	NP_061844.1	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	307					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|lung(2)|ovary(1)|prostate(1)	5		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		CAGCTACCTGCGGGTCCTGGT	0.662																																							uc011bge.1		NA																	0				ovary(1)	1						c.(919-921)CGG>TGG		G protein-coupled receptor 27							27.0	34.0	32.0					3																	71804119		2200	4300	6500	SO:0001583	missense	2850					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:71804119C>T	AB040799	CCDS2915.1	3p21-p14	2012-08-21			ENSG00000170837	ENSG00000170837		"""GPCR / Class A : Orphans"""	4482	protein-coding gene	gene with protein product		605187				10833454	Standard	NM_018971		Approved	SREB1	uc011bge.2	Q9NS67	OTTHUMG00000158810	ENST00000304411.2:c.919C>T	3.37:g.71804119C>T	ENSP00000303149:p.Arg307Trp		Somatic				EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_5'Flank|EIF4E3_uc010hoc.2_5'Flank	p.R307W	NM_018971	NP_061844	WXS	Illumina HiSeq	Unspecified	Q9NS67	GPR27_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)	1	919	+		Prostate(10;0.00899)	307			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000304411.2	37	c.919C>T	CCDS2915.1	.	.	.	.	.	.	.	.	.	.	c	13.75	2.330719	0.41297	.	.	ENSG00000170837	ENST00000304411	T	0.72942	-0.7	4.44	1.01	0.19927	GPCR, rhodopsin-like superfamily (1);	0.080418	0.49305	U	0.000160	T	0.81138	0.4760	M	0.78223	2.4	0.54753	D	0.99998	D	0.89917	1.0	D	0.87578	0.998	T	0.80360	-0.1415	10	0.66056	D	0.02	-3.3098	10.1004	0.42502	0.3744:0.5127:0.1129:0.0	.	307	Q9NS67	GPR27_HUMAN	W	307	ENSP00000303149:R307W	ENSP00000303149:R307W	R	+	1	2	GPR27	71886809	1.000000	0.71417	0.988000	0.46212	0.182000	0.23217	1.177000	0.31969	0.309000	0.22966	-0.377000	0.06932	CGG		0.662	GPR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352303.1	NM_018971		5	44	0	0	0	0.000602	0	5	44				
GOLGB1	2804	broad.mit.edu	37	3	121383793	121383793	+	Missense_Mutation	SNP	T	T	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr3:121383793T>G	ENST00000340645.5	-	21	9750	c.9625A>C	c.(9625-9627)Aca>Cca	p.T3209P	GOLGB1_ENST00000393667.3_Missense_Mutation_p.T3219P	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	3209					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CTGTTGCTTGTAAGATCTATT	0.478																																							uc003eei.3		NA																	0				ovary(6)|breast(2)|skin(2)	10						c.(9625-9627)ACA>CCA		golgi autoantigen, golgin subfamily b,							135.0	126.0	129.0					3																	121383793		2203	4300	6503	SO:0001583	missense	2804				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding	g.chr3:121383793T>G	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.9625A>C	3.37:g.121383793T>G	ENSP00000341848:p.Thr3209Pro		Somatic				GOLGB1_uc010hrc.2_Missense_Mutation_p.T3219P|GOLGB1_uc003eej.3_Missense_Mutation_p.T3175P	p.T3209P	NM_004487	NP_004478	WXS	Illumina HiSeq	Unspecified	Q14789	GOGB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0989)	21	9751	-			3209			Cytoplasmic (Potential).		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	c.9625A>C	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	8.958	0.969971	0.18659	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.14766	2.48;2.48	5.42	1.63	0.23807	.	0.315273	0.28125	N	0.016518	T	0.05502	0.0145	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.001	T	0.35151	-0.9800	10	0.28530	T	0.3	.	4.9862	0.14190	0.0:0.1024:0.3984:0.4992	.	3219;3219;3209	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	P	3209;3219	ENSP00000341848:T3209P;ENSP00000377275:T3219P	ENSP00000341848:T3209P	T	-	1	0	GOLGB1	122866483	0.000000	0.05858	0.037000	0.18230	0.893000	0.52053	0.259000	0.18405	0.458000	0.26988	0.533000	0.62120	ACA		0.478	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		8	66	0	0	0	0.006214	0	8	66				
IL12A	3592	broad.mit.edu	37	3	159713204	159713204	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr3:159713204A>G	ENST00000305579.2	+	7	927	c.620A>G	c.(619-621)aAc>aGc	p.N207S	IL12A-AS1_ENST00000462431.1_RNA|IL12A_ENST00000480787.1_Missense_Mutation_p.N169S|IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Missense_Mutation_p.N193S	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	173					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTGAATTTCAACAGTGAGACT	0.373																																							uc003fcx.2		NA																	0					0						c.(619-621)AAC>AGC		interleukin 12A precursor							95.0	94.0	94.0					3																	159713204		2203	4300	6503	SO:0001583	missense	3592				cell cycle arrest|cell migration|defense response to Gram-positive bacterium|immune response|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of cell adhesion|positive regulation of interferon-gamma production|positive regulation of natural killer cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of NK T cell activation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of tyrosine phosphorylation of Stat4 protein|response to lipopolysaccharide|response to UV-B|response to virus	interleukin-12 complex	cytokine activity|growth factor activity|interleukin-12 receptor binding|interleukin-27 binding|protein heterodimerization activity	g.chr3:159713204A>G	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.620A>G	3.37:g.159713204A>G	ENSP00000303231:p.Asn207Ser		Somatic				uc003fcw.1_Intron	p.N207S	NM_000882	NP_000873	WXS	Illumina HiSeq	Unspecified	P29459	IL12A_HUMAN	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		7	835	+			173					Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	37	c.620A>G	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	A	10.45	1.352736	0.24512	.	.	ENSG00000168811	ENST00000305579;ENST00000480787;ENST00000466512	.	.	.	5.48	-3.65	0.04502	.	1.159590	0.05828	N	0.617028	T	0.24661	0.0598	N	0.25144	0.715	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.20538	-1.0272	9	0.27082	T	0.32	-2.9226	5.4022	0.16303	0.3587:0.2899:0.3514:0.0	.	207	O60595	.	S	207;169;193	.	ENSP00000303231:N207S	N	+	2	0	IL12A	161195898	0.000000	0.05858	0.000000	0.03702	0.347000	0.29111	-0.784000	0.04633	-0.511000	0.06514	-0.316000	0.08728	AAC		0.373	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882		8	74	0	0	0	0.004482	0	8	74				
LPHN3	23284	broad.mit.edu	37	4	62800699	62800699	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr4:62800699C>G	ENST00000514591.1	+	13	2379	c.2050C>G	c.(2050-2052)Ctt>Gtt	p.L684V	LPHN3_ENST00000507164.1_Missense_Mutation_p.L752V|LPHN3_ENST00000504896.1_Missense_Mutation_p.L684V|LPHN3_ENST00000508693.1_Missense_Mutation_p.L752V|LPHN3_ENST00000506720.1_Missense_Mutation_p.L752V|LPHN3_ENST00000507625.1_Missense_Mutation_p.L752V|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000545650.1_Missense_Mutation_p.L684V|LPHN3_ENST00000514996.1_Missense_Mutation_p.L684V|LPHN3_ENST00000511324.1_Missense_Mutation_p.L752V|LPHN3_ENST00000514157.1_Missense_Mutation_p.L684V|LPHN3_ENST00000509896.1_Missense_Mutation_p.L752V|LPHN3_ENST00000508946.1_Missense_Mutation_p.L684V|LPHN3_ENST00000506746.1_Missense_Mutation_p.L752V|LPHN3_ENST00000506700.1_Missense_Mutation_p.L684V|LPHN3_ENST00000512091.2_Missense_Mutation_p.L684V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	671					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GGCTGATAACCTTTTGAAGAC	0.443																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(2050-2052)CTT>GTT		latrophilin 3 precursor							112.0	113.0	113.0					4																	62800699		2021	4184	6205	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62800699C>G	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2050C>G	4.37:g.62800699C>G	ENSP00000422533:p.Leu684Val		Somatic				LPHN3_uc003hcq.3_Missense_Mutation_p.L684V|LPHN3_uc003hct.2_Missense_Mutation_p.L77V|LPHN3_uc003hcs.1_Missense_Mutation_p.L500V	p.L684V	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			11	2223	+			671			Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.2050C>G	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.03|18.03	3.533005|3.533005	0.64972|0.64972	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.10573|.	2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Domain of unknown function DUF3497 (1);|.	0.139146|.	0.50627|.	D|.	0.000116|.	T|T	0.67664|0.67664	0.2917|0.2917	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	D;D;D|.	0.54964|.	0.969;0.969;0.961|.	P;P;P|.	0.56163|.	0.793;0.793;0.689|.	T|T	0.60717|0.60717	-0.7208|-0.7208	10|5	0.20519|.	T|.	0.43|.	.|.	19.8946|19.8946	0.96949|0.96949	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	684;671;684|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	V|R	684;684;752;752;684;684;671;684;752;752;752;684;684;684;752;752;684|141	ENSP00000423388:L684V;ENSP00000422533:L684V;ENSP00000423787:L752V;ENSP00000425033:L752V;ENSP00000424120:L684V;ENSP00000439831:L684V;ENSP00000421476:L752V;ENSP00000424030:L752V;ENSP00000421372:L752V;ENSP00000425201:L684V;ENSP00000423434:L684V;ENSP00000421627:L684V;ENSP00000420931:L752V;ENSP00000425884:L752V;ENSP00000424258:L684V|.	ENSP00000280009:L684V|.	L|P	+|+	1|2	0|0	LPHN3|LPHN3	62483294|62483294	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.651000|7.651000	0.83577|0.83577	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CTT|CCT		0.443	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			5	60	0	0	0	0.001168	0	5	60				
PDLIM5	10611	broad.mit.edu	37	4	95585159	95585159	+	Missense_Mutation	SNP	T	T	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr4:95585159T>C	ENST00000317968.4	+	13	1868	c.1732T>C	c.(1732-1734)Ttt>Ctt	p.F578L	PDLIM5_ENST00000514743.1_Missense_Mutation_p.F607L|PDLIM5_ENST00000542407.1_Missense_Mutation_p.F456L|PDLIM5_ENST00000437932.1_Missense_Mutation_p.F469L|PDLIM5_ENST00000380176.3_3'UTR	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	578	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		AGGTCAGACCTTTTTCTCCAA	0.373																																							uc003hti.2		NA																	0				ovary(1)|skin(1)	2						c.(1732-1734)TTT>CTT		PDZ and LIM domain 5 isoform a							88.0	89.0	89.0					4																	95585159		2203	4300	6503	SO:0001583	missense	10611				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding	g.chr4:95585159T>C	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.1732T>C	4.37:g.95585159T>C	ENSP00000321746:p.Phe578Leu		Somatic				PDLIM5_uc011cdx.1_Missense_Mutation_p.F475L|PDLIM5_uc003hth.2_Missense_Mutation_p.F469L|PDLIM5_uc003htj.2_Missense_Mutation_p.F253L|PDLIM5_uc003htk.2_Missense_Mutation_p.F607L|PDLIM5_uc011cdy.1_Missense_Mutation_p.F456L|PDLIM5_uc003htl.2_Missense_Mutation_p.F253L	p.F578L	NM_006457	NP_006448	WXS	Illumina HiSeq	Unspecified	Q96HC4	PDLI5_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)	13	1883	+		Hepatocellular(203;0.114)	578			LIM zinc-binding 3.		A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	37	c.1732T>C	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	T	33	5.283947	0.95489	.	.	ENSG00000163110	ENST00000437932;ENST00000317968;ENST00000503974;ENST00000542407;ENST00000514743	D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25	5.78	5.78	0.91487	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.93393	0.7893	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.998;1.0	D;D;D;D	0.91635	0.999;0.997;0.997;0.999	D	0.94118	0.7377	10	0.87932	D	0	.	16.1027	0.81194	0.0:0.0:0.0:1.0	.	475;607;578;469	E9PBF5;D6RB78;Q96HC4;Q96HC4-4	.;.;PDLI5_HUMAN;.	L	469;578;475;456;607	ENSP00000398469:F469L;ENSP00000321746:F578L;ENSP00000424297:F475L;ENSP00000442187:F456L;ENSP00000424360:F607L	ENSP00000321746:F578L	F	+	1	0	PDLIM5	95804182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.198000	0.70561	0.455000	0.32223	TTT		0.373	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1			3	100	0	0	0	0.000248	0	3	100				
FAT4	79633	broad.mit.edu	37	4	126372962	126372962	+	Silent	SNP	A	A	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr4:126372962A>T	ENST00000394329.3	+	9	10804	c.10791A>T	c.(10789-10791)acA>acT	p.T3597T	FAT4_ENST00000335110.5_Silent_p.T1895T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3597	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGTCTTCCACAGGAACTGTGC	0.428																																							uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(10789-10791)ACA>ACT		FAT tumor suppressor homolog 4 precursor							87.0	86.0	86.0					4																	126372962		2203	4300	6503	SO:0001819	synonymous_variant	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126372962A>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10791A>T	4.37:g.126372962A>T			Somatic				FAT4_uc011cgp.1_Silent_p.T1895T|FAT4_uc003ifi.1_Silent_p.T1075T	p.T3597T	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			9	10791	+			3597			Cadherin 34.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	c.10791A>T	CCDS3732.3																																																																																				0.428	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		20	106	0	0	0	0.003954	0	20	106				
SLC9A3	6550	broad.mit.edu	37	5	491958	491958	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:491958G>A	ENST00000264938.3	-	2	449	c.440C>T	c.(439-441)gCc>gTc	p.A147V	SLC9A3_ENST00000514375.1_Missense_Mutation_p.A147V	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	147					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			ACCCACGACGGCGTACAACAG	0.642																																							uc003jbe.2		NA																	0					0						c.(439-441)GCC>GTC		solute carrier family 9 (sodium/hydrogen							52.0	36.0	42.0					5																	491958		2194	4295	6489	SO:0001583	missense	6550					cell surface|integral to membrane	sodium:hydrogen antiporter activity	g.chr5:491958G>A		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.440C>T	5.37:g.491958G>A	ENSP00000264938:p.Ala147Val		Somatic				SLC9A3_uc011clx.1_Missense_Mutation_p.A147V	p.A147V	NM_004174	NP_004165	WXS	Illumina HiSeq	Unspecified	P48764	SL9A3_HUMAN	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)		2	552	-			147			Helical; Name=E/M5; (Potential).		B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	c.440C>T	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890588	0.72524	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.21734	1.99;1.99	4.52	4.52	0.55395	Cation/H+ exchanger (1);	0.113883	0.64402	D	0.000013	T	0.54191	0.1843	M	0.89534	3.04	0.53688	D	0.999973	D;D	0.89917	1.0;0.989	D;P	0.71184	0.972;0.809	T	0.66913	-0.5803	10	0.87932	D	0	.	17.2619	0.87072	0.0:0.0:1.0:0.0	.	147;147	E9PF67;P48764	.;SL9A3_HUMAN	V	147	ENSP00000264938:A147V;ENSP00000422983:A147V	ENSP00000264938:A147V	A	-	2	0	SLC9A3	544958	1.000000	0.71417	0.018000	0.16275	0.018000	0.09664	9.531000	0.98054	2.237000	0.73441	0.505000	0.49811	GCC		0.642	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174		6	15	0	0	0	0.001168	0	6	15				
PRDM9	56979	broad.mit.edu	37	5	23527167	23527167	+	Missense_Mutation	SNP	G	G	C	rs112679149	byFrequency	TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:23527167G>C	ENST00000296682.3	+	11	2152	c.1970G>C	c.(1969-1971)aGa>aCa	p.R657T		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	657					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CACCAGAGGAGACACACAGGG	0.607										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1969-1971)AGA>ACA		PR domain containing 9							15.0	15.0	15.0					5																	23527167		1363	3077	4440	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527167G>C	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1970G>C	5.37:g.23527167G>C	ENSP00000296682:p.Arg657Thr	HNSCC(3;0.000094)	Somatic					p.R657T	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	2152	+			657			C2H2-type 6.		B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.1970G>C	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.137268	0.00335	.	.	ENSG00000164256	ENST00000296682	T	0.15603	2.41	2.25	2.25	0.28309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37623	N	0.002013	T	0.04907	0.0132	N	0.04063	-0.285	0.18873	N	0.999986	B	0.02656	0.0	B	0.06405	0.002	T	0.40757	-0.9546	10	0.02654	T	1	-0.7289	3.6224	0.08100	0.0:0.5769:0.2673:0.1558	.	657	Q9NQV7	PRDM9_HUMAN	T	657	ENSP00000296682:R657T	ENSP00000296682:R657T	R	+	2	0	PRDM9	23562924	0.000000	0.05858	1.000000	0.80357	0.511000	0.34104	-2.003000	0.01463	0.507000	0.28148	-0.371000	0.07208	AGA		0.607	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		5	96	0	0	0	0.000602	0	5	96				
PLK2	10769	broad.mit.edu	37	5	57750850	57750850	+	Splice_Site	SNP	T	T	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:57750850T>C	ENST00000274289.3	-	13	2056		c.e13-2		PLK2_ENST00000502671.1_Intron	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2						G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		ATCTCCACCCTGGAAGAGATT	0.403																																							uc003jrn.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.e13-1		polo-like kinase 2							117.0	119.0	118.0					5																	57750850		2203	4300	6503	SO:0001630	splice_region_variant	10769				positive regulation of I-kappaB kinase/NF-kappaB cascade		ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity	g.chr5:57750850T>C		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.1756-2A>G	5.37:g.57750850T>C			Somatic					p.G586_splice	NM_006622	NP_006613	WXS	Illumina HiSeq	Unspecified	Q9NYY3	PLK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)	13	1883	-		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)						O60679|Q96CV7|Q9UE61	Splice_Site	SNP	ENST00000274289.3	37	c.1756_splice	CCDS3974.1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.233820	0.58886	.	.	ENSG00000145632	ENST00000274289	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1303	0.81428	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLK2	57786607	1.000000	0.71417	0.939000	0.37840	0.966000	0.64601	7.651000	0.83577	2.217000	0.71921	0.533000	0.62120	.		0.403	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	Intron	16	103	0	0	0	0.00499	0	16	103				
TGFBI	7045	broad.mit.edu	37	5	135382099	135382099	+	Missense_Mutation	SNP	C	C	T	rs372436914		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:135382099C>T	ENST00000442011.2	+	4	535	c.374C>T	c.(373-375)aCg>aTg	p.T125M	TGFBI_ENST00000504185.1_3'UTR|TGFBI_ENST00000305126.8_Missense_Mutation_p.T125M	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	125	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082}.		Missing (associated with Leu-124 in atypical granular dystrophy; French granular variant). {ECO:0000269|PubMed:10865320, ECO:0000269|PubMed:11297504}.		angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ACGGACCGCACGGAGAAGCTG	0.612																																							uc003lbf.3		NA																	0				breast(3)|ovary(1)	4						c.(373-375)ACG>ATG		transforming growth factor, beta-induced, 68kDa							51.0	52.0	52.0					5																	135382099		2004	4162	6166	SO:0001583	missense	7045				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding	g.chr5:135382099C>T	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.374C>T	5.37:g.135382099C>T	ENSP00000416330:p.Thr125Met		Somatic				TGFBI_uc003lbg.3_Translation_Start_Site|TGFBI_uc003lbh.3_Translation_Start_Site|TGFBI_uc011cyb.1_Translation_Start_Site	p.T125M	NM_000358	NP_000349	WXS	Illumina HiSeq	Unspecified	Q15582	BGH3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		4	535	+			125		Missing (associated with Leu-124 in atypical granular dystrophy; French granular variant).	FAS1 1.		D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	ENST00000442011.2	37	c.374C>T	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	C	30	5.049996	0.93740	.	.	ENSG00000120708	ENST00000442011;ENST00000305126	D;D	0.91521	-2.86;-2.86	5.83	5.83	0.93111	FAS1 domain (3);	0.092925	0.85682	D	0.000000	D	0.93044	0.7786	L	0.50333	1.59	0.58432	D	0.999992	D	0.67145	0.996	P	0.58620	0.842	D	0.91872	0.5508	10	0.41790	T	0.15	-3.3572	20.1218	0.97964	0.0:1.0:0.0:0.0	.	125	Q15582	BGH3_HUMAN	M	125	ENSP00000416330:T125M;ENSP00000306306:T125M	ENSP00000306306:T125M	T	+	2	0	TGFBI	135409998	1.000000	0.71417	0.992000	0.48379	0.951000	0.60555	7.818000	0.86416	2.763000	0.94921	0.561000	0.74099	ACG		0.612	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1			3	60	0	0	0	0.004672	0	3	60				
CDC25C	995	broad.mit.edu	37	5	137622942	137622942	+	Silent	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:137622942C>A	ENST00000323760.6	-	11	1220	c.942G>T	c.(940-942)ctG>ctT	p.L314L	CDC25C_ENST00000356505.3_Silent_p.L284L|CDC25C_ENST00000514555.1_Silent_p.L284L|CDC25C_ENST00000357274.3_Silent_p.L271L|CDC25C_ENST00000348983.3_Silent_p.L241L|CDC25C_ENST00000415130.2_Silent_p.L241L|CDC25C_ENST00000513970.1_Silent_p.L314L	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	314					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ACTTCCCCGACAGTAAGGCAG	0.468																																							uc003lcp.1		NA																	0				lung(3)	3						c.(940-942)CTG>CTT		cell division cycle 25C isoform a							89.0	81.0	84.0					5																	137622942		2203	4300	6503	SO:0001819	synonymous_variant	995				cell cycle checkpoint|cell division|cell proliferation|DNA replication|G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm	protein tyrosine phosphatase activity|WW domain binding	g.chr5:137622942C>A	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.942G>T	5.37:g.137622942C>A			Somatic				CDC25C_uc003lcq.1_Silent_p.L241L|CDC25C_uc003lcr.1_Silent_p.L314L|CDC25C_uc011cyp.1_Silent_p.L331L|CDC25C_uc003lcs.1_Silent_p.L392L	p.L314L	NM_001790	NP_001781	WXS	Illumina HiSeq	Unspecified	P30307	MPIP3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)		11	1213	-			314					D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Silent	SNP	ENST00000323760.6	37	c.942G>T	CCDS4202.1	.	.	.	.	.	.	.	.	.	.	C	3.733	-0.055100	0.07362	.	.	ENSG00000158402	ENST00000514017	.	.	.	4.98	-2.87	0.05700	.	.	.	.	.	T	0.17959	0.0431	.	.	.	0.27706	N	0.945617	.	.	.	.	.	.	T	0.27157	-1.0082	4	.	.	.	-2.9311	0.8334	0.01135	0.3336:0.169:0.291:0.2063	.	.	.	.	F	116	.	.	V	-	1	0	CDC25C	137650841	0.000000	0.05858	0.066000	0.19879	0.972000	0.66771	-0.501000	0.06398	-0.438000	0.07232	-0.929000	0.02709	GTC		0.468	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1			7	78	1	0	5.68852e-11	0.004482	8.25053e-11	7	78				
FAM71B	153745	broad.mit.edu	37	5	156589684	156589684	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:156589684G>T	ENST00000302938.4	-	2	1687	c.1592C>A	c.(1591-1593)gCc>gAc	p.A531D		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	531						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GATCTTACTGGCTTTCTTTTG	0.473																																							uc003lwn.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(1591-1593)GCC>GAC		family with sequence similarity 71, member B							116.0	119.0	118.0					5																	156589684		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156589684G>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1592C>A	5.37:g.156589684G>T	ENSP00000305596:p.Ala531Asp		Somatic					p.A531D	NM_130899	NP_570969	WXS	Illumina HiSeq	Unspecified	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1692	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	531					Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.1592C>A	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011140	0.35511	.	.	ENSG00000170613	ENST00000302938	T	0.19532	2.14	3.87	2.05	0.26809	.	0.581163	0.14481	N	0.316966	T	0.11793	0.0287	N	0.19112	0.55	0.09310	N	1	B	0.24092	0.097	B	0.18871	0.023	T	0.21008	-1.0258	10	0.54805	T	0.06	-1.7985	5.5078	0.16864	0.1111:0.2024:0.6865:0.0	.	531	Q8TC56	FA71B_HUMAN	D	531	ENSP00000305596:A531D	ENSP00000305596:A531D	A	-	2	0	FAM71B	156522262	0.999000	0.42202	0.078000	0.20375	0.464000	0.32679	2.414000	0.44627	0.578000	0.29487	0.655000	0.94253	GCC		0.473	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		13	44	1	0	1.5842e-08	0.001855	2.18115e-08	13	44				
STK10	6793	broad.mit.edu	37	5	171520788	171520788	+	Silent	SNP	T	T	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:171520788T>G	ENST00000176763.5	-	9	1525	c.1182A>C	c.(1180-1182)ccA>ccC	p.P394P	STK10_ENST00000517775.1_5'Flank	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	394					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGCCACGACTGGGGGACTGG	0.632																																							uc003mbo.1		NA																	0				ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8						c.(1180-1182)CCA>CCC		serine/threonine kinase 10							45.0	47.0	46.0					5																	171520788		2203	4300	6503	SO:0001819	synonymous_variant	6793						ATP binding|protein serine/threonine kinase activity	g.chr5:171520788T>G	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1182A>C	5.37:g.171520788T>G			Somatic					p.P394P	NM_005990	NP_005981	WXS	Illumina HiSeq	Unspecified	O94804	STK10_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		9	1482	-	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	394					A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	37	c.1182A>C	CCDS34290.1																																																																																				0.632	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990		10	75	0	0	0	0.000978	0	10	75				
SERPINB6	5269	broad.mit.edu	37	6	2948601	2948601	+	Silent	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:2948601G>A	ENST00000380520.1	-	6	3056	c.1062C>T	c.(1060-1062)ccC>ccT	p.P354P	SERPINB6_ENST00000335686.5_Silent_p.P354P|SERPINB6_ENST00000380529.1_Silent_p.P354P|SERPINB6_ENST00000380539.1_Silent_p.P354P|SERPINB6_ENST00000380524.1_Silent_p.P354P|SERPINB6_ENST00000380546.3_Silent_p.P354P			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	354					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	AGAAAAGGAAGGGGTGGTCGG	0.602																																							uc003muk.2		NA																	0					0						c.(1060-1062)CCC>CCT		serine (or cysteine) proteinase inhibitor, clade	Drotrecogin alfa(DB00055)						54.0	56.0	55.0					6																	2948601		2203	4300	6503	SO:0001819	synonymous_variant	5269				regulation of proteolysis	centrosome|cytosol|protein complex	protease binding|serine-type endopeptidase inhibitor activity	g.chr6:2948601G>A	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.1062C>T	6.37:g.2948601G>A			Somatic				SERPINB6_uc003mui.2_Silent_p.P237P|SERPINB6_uc003muj.2_RNA|SERPINB6_uc003mul.2_Silent_p.P354P|SERPINB6_uc003mum.2_Silent_p.P354P|SERPINB6_uc003mun.2_Silent_p.P354P|SERPINB6_uc003muo.2_Silent_p.P354P	p.P354P	NM_004568	NP_004559	WXS	Illumina HiSeq	Unspecified	P35237	SPB6_HUMAN			6	3057	-	Ovarian(93;0.0412)	all_hematologic(90;0.0895)	354					B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Silent	SNP	ENST00000380520.1	37	c.1062C>T	CCDS4479.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447772	0.26074	.	.	ENSG00000124570	ENST00000380500	.	.	.	5.01	1.26	0.21427	.	0.000000	0.85682	D	0.000000	T	0.49541	0.1563	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53913	-0.8371	6	0.87932	D	0	.	7.0021	0.24815	0.4688:0.0:0.5312:0.0	.	.	.	.	L	159	.	ENSP00000369869:P159L	P	-	2	0	SERPINB6	2893600	0.998000	0.40836	0.998000	0.56505	0.982000	0.71751	0.551000	0.23361	0.374000	0.24650	0.551000	0.68910	CCT		0.602	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1			3	38	0	0	0	0.004672	0	3	38				
PPT2	9374	broad.mit.edu	37	6	32122466	32122466	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:32122466A>G	ENST00000324816.6	+	2	663	c.95A>G	c.(94-96)cAc>cGc	p.H32R	PPT2-EGFL8_ENST00000422437.1_Missense_Mutation_p.H32R|PPT2_ENST00000375143.2_Missense_Mutation_p.H32R|PPT2_ENST00000395523.1_Missense_Mutation_p.H32R|PPT2_ENST00000445576.2_Missense_Mutation_p.H32R|PRRT1_ENST00000375150.2_5'Flank|PPT2_ENST00000493548.1_3'UTR|PRRT1_ENST00000375152.2_5'Flank|PPT2_ENST00000437001.2_5'UTR|PPT2-EGFL8_ENST00000453656.2_3'UTR|PRRT1_ENST00000211413.5_5'Flank|PPT2_ENST00000375137.2_Missense_Mutation_p.H32R|PPT2_ENST00000361568.2_Missense_Mutation_p.H38R			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	32					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						CCCGCGCCCCACCGCGCGTCC	0.672																																							uc003nzx.2		NA																	0					0						c.(94-96)CAC>CGC		palmitoyl-protein thioesterase 2 isoform a							53.0	60.0	57.0					6																	32122466		1507	2707	4214	SO:0001583	missense	9374				protein modification process	lysosome	palmitoyl-(protein) hydrolase activity	g.chr6:32122466A>G	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.95A>G	6.37:g.32122466A>G	ENSP00000320528:p.His32Arg		Somatic				PRRT1_uc003nzs.2_5'Flank|PRRT1_uc003nzt.2_5'Flank|PRRT1_uc003nzu.2_5'Flank|uc003nzv.3_5'Flank|PPT2_uc003nzw.2_Missense_Mutation_p.H38R|PPT2_uc011dpi.1_RNA|PPT2_uc003nzy.1_RNA|PPT2_uc003nzz.2_Missense_Mutation_p.H32R|PPT2_uc003oaa.2_Missense_Mutation_p.H32R|PPT2_uc010jtu.1_Missense_Mutation_p.H32R	p.H32R	NM_005155	NP_005146	WXS	Illumina HiSeq	Unspecified	Q9UMR5	PPT2_HUMAN			2	663	+			32					A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Missense_Mutation	SNP	ENST00000324816.6	37	c.95A>G	CCDS4742.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350357	0.41599	.	.	ENSG00000221988	ENST00000414204;ENST00000361568;ENST00000395523;ENST00000445576;ENST00000324816;ENST00000375137;ENST00000375143;ENST00000424499;ENST00000436118;ENST00000453656	T;D;D;D;D;D;D;T;T	0.91407	1.59;-2.81;-2.81;-2.84;-2.81;-2.81;-2.81;-1.49;1.52	4.63	-0.805	0.10879	.	0.638780	0.15557	N	0.256115	T	0.56543	0.1992	N	0.03608	-0.345	0.53005	D	0.999969	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.33929	-0.9849	10	0.23302	T	0.38	-2.5716	5.2087	0.15304	0.512:0.305:0.1831:0.0	.	32;32;38	Q9UMR5-2;Q9UMR5;B0S872	.;PPT2_HUMAN;.	R	32;38;32;32;32;32;32;32;32;32	ENSP00000398847:H32R;ENSP00000354608:H38R;ENSP00000378894:H32R;ENSP00000412381:H32R;ENSP00000320528:H32R;ENSP00000364279:H32R;ENSP00000364285:H32R;ENSP00000409877:H32R;ENSP00000395456:H32R	ENSP00000320528:H32R	H	+	2	0	PPT2	32230444	0.035000	0.19736	0.117000	0.21633	0.616000	0.37450	0.131000	0.15870	-0.002000	0.14469	0.397000	0.26171	CAC		0.672	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076552.4	NM_138717		7	66	0	0	0	0.001984	0	7	66				
PACSIN1	29993	broad.mit.edu	37	6	34499392	34499392	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:34499392C>G	ENST00000538621.1	+	9	1298	c.1053C>G	c.(1051-1053)gaC>gaG	p.D351E	PACSIN1_ENST00000244458.2_Missense_Mutation_p.D351E|PACSIN1_ENST00000374043.2_Missense_Mutation_p.D309E	NM_001199583.2	NP_001186512.1	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in neurons 1	351					actin filament organization (GO:0007015)|establishment of protein localization to plasma membrane (GO:0090002)|membrane tubulation (GO:0097320)|neuron projection morphogenesis (GO:0048812)|positive regulation of dendrite development (GO:1900006)|protein localization to membrane (GO:0072657)|synaptic vesicle endocytosis (GO:0048488)	axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	13						GCAGCTACGACAGAGGCCAGC	0.622																																							uc003ojo.2		NA																	0					0						c.(1051-1053)GAC>GAG		protein kinase C and casein kinase substrate in							82.0	83.0	83.0					6																	34499392		2202	4299	6501	SO:0001583	missense	29993				endocytosis		protein kinase activity	g.chr6:34499392C>G	AB037800	CCDS4793.1	6p21.3	2008-02-05			ENSG00000124507	ENSG00000124507			8570	protein-coding gene	gene with protein product	"""syndapin I"""	606512				11179684	Standard	NM_020804		Approved	SDPI	uc003ojp.4	Q9BY11	OTTHUMG00000014547	ENST00000538621.1:c.1053C>G	6.37:g.34499392C>G	ENSP00000439639:p.Asp351Glu		Somatic				PACSIN1_uc003ojp.2_Missense_Mutation_p.D351E	p.D351E	NM_020804	NP_065855	WXS	Illumina HiSeq	Unspecified	Q9BY11	PACN1_HUMAN			9	1259	+			351					Q9P2G8	Missense_Mutation	SNP	ENST00000538621.1	37	c.1053C>G	CCDS4793.1	.	.	.	.	.	.	.	.	.	.	C	6.916	0.538645	0.13250	.	.	ENSG00000124507	ENST00000244458;ENST00000374043;ENST00000436831;ENST00000538621	T;T;T	0.25250	1.81;1.81;1.81	4.94	4.07	0.47477	.	1.406090	0.04733	N	0.421485	T	0.04543	0.0124	N	0.10760	0.04	0.50313	D	0.999862	B	0.09022	0.002	B	0.09377	0.004	T	0.38672	-0.9650	10	0.08381	T	0.77	-40.6307	8.7589	0.34663	0.0:0.7674:0.1529:0.0797	.	351	Q9BY11	PACN1_HUMAN	E	351;309;351;351	ENSP00000244458:D351E;ENSP00000363155:D309E;ENSP00000439639:D351E	ENSP00000244458:D351E	D	+	3	2	PACSIN1	34607370	0.965000	0.33210	0.998000	0.56505	0.976000	0.68499	0.114000	0.15520	1.306000	0.44926	0.561000	0.74099	GAC		0.622	PACSIN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040236.1			11	138	0	0	0	0.001855	0	11	138				
ASCC3	10973	broad.mit.edu	37	6	100965873	100965873	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:100965873A>G	ENST00000369162.2	-	38	6265	c.5921T>C	c.(5920-5922)cTt>cCt	p.L1974P		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1974	SEC63 2.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTACTTGAAAAGGTGAAGATG	0.308																																							uc003pqk.2		NA																	0				ovary(5)|skin(1)	6						c.(5920-5922)CTT>CCT		activating signal cointegrator 1 complex subunit							71.0	73.0	72.0					6																	100965873		2203	4300	6503	SO:0001583	missense	10973				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr6:100965873A>G	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.5921T>C	6.37:g.100965873A>G	ENSP00000358159:p.Leu1974Pro		Somatic					p.L1974P	NM_006828	NP_006819	WXS	Illumina HiSeq	Unspecified	Q8N3C0	HELC1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)	38	6250	-		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)	1974					E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	c.5921T>C	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.633843	0.67130	.	.	ENSG00000112249	ENST00000369162	T	0.60171	0.21	4.83	4.83	0.62350	Sec63 domain (3);	0.076856	0.53938	D	0.000056	T	0.57681	0.2070	M	0.66297	2.02	0.80722	D	1	P	0.37441	0.595	P	0.50378	0.639	T	0.58177	-0.7682	10	0.30854	T	0.27	.	14.6995	0.69147	1.0:0.0:0.0:0.0	.	1974	Q8N3C0	HELC1_HUMAN	P	1974	ENSP00000358159:L1974P	ENSP00000358159:L1974P	L	-	2	0	ASCC3	101072594	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.176000	0.94839	1.947000	0.56498	0.377000	0.23210	CTT		0.308	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828		3	79	0	0	0	0.004672	0	3	79				
AIM1	202	broad.mit.edu	37	6	106967686	106967686	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:106967686C>T	ENST00000369066.3	+	2	1866	c.1379C>T	c.(1378-1380)tCa>tTa	p.S460L		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CCTGCTGAGTCATCTCCTGGG	0.512																																							uc003prh.2		NA																	0				breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9						c.(1378-1380)TCA>TTA		absent in melanoma 1							107.0	104.0	105.0					6																	106967686		2203	4300	6503	SO:0001583	missense	202						sugar binding	g.chr6:106967686C>T	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1379C>T	6.37:g.106967686C>T	ENSP00000358062:p.Ser460Leu		Somatic					p.S460L	NM_001624	NP_001615	WXS	Illumina HiSeq	Unspecified	Q9Y4K1	AIM1_HUMAN	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)	2	1866	+	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	460					Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	c.1379C>T	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.128005	0.37533	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.72505	-0.66	6.17	1.96	0.26148	.	1.334140	0.05480	N	0.554734	T	0.43411	0.1246	L	0.59436	1.845	0.19300	N	0.999975	B	0.10296	0.003	B	0.08055	0.003	T	0.21552	-1.0242	10	0.30854	T	0.27	.	3.9144	0.09216	0.3352:0.4863:0.0:0.1785	.	460	Q9Y4K1	AIM1_HUMAN	L	868;460	ENSP00000358062:S460L	ENSP00000285105:S868L	S	+	2	0	AIM1	107074379	0.056000	0.20664	0.422000	0.26621	0.000000	0.00434	0.591000	0.23969	0.920000	0.36970	-0.140000	0.14226	TCA		0.512	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			9	108	0	0	0	0.000978	0	9	108				
PTPRK	5796	broad.mit.edu	37	6	128643394	128643394	+	Silent	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:128643394C>A	ENST00000368215.3	-	3	284	c.285G>T	c.(283-285)ctG>ctT	p.L95L	PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000525459.1_Silent_p.L95L|PTPRK_ENST00000368213.5_Silent_p.L95L|PTPRK_ENST00000368207.3_Silent_p.L95L|PTPRK_ENST00000368210.3_Silent_p.L95L|PTPRK_ENST00000368226.4_Silent_p.L95L|PTPRK_ENST00000368227.3_Silent_p.L95L|PTPRK_ENST00000532331.1_Silent_p.L95L			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	95	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TCATTGTAGGCAGCTGAAGTC	0.388																																							uc003qbk.2		NA																	0				ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8						c.(283-285)CTG>CTT		protein tyrosine phosphatase, receptor type, K							146.0	140.0	142.0					6																	128643394		2203	4300	6503	SO:0001819	synonymous_variant	5796				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr6:128643394C>A	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.285G>T	6.37:g.128643394C>A			Somatic				PTPRK_uc003qbj.2_Silent_p.L95L|PTPRK_uc010kfc.2_Silent_p.L95L|PTPRK_uc011ebu.1_Silent_p.L95L|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Silent_p.L95L|PTPRK_uc003qbm.3_Silent_p.L24L	p.L95L	NM_002844	NP_002835	WXS	Illumina HiSeq	Unspecified	Q15262	PTPRK_HUMAN		all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)	3	652	-			95			Extracellular (Potential).|MAM.		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	37	c.285G>T																																																																																					0.388	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1			11	128	1	0	4.3838e-07	0.001855	5.74429e-07	11	128				
VNN2	8875	broad.mit.edu	37	6	133078815	133078815	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr6:133078815C>T	ENST00000326499.6	-	1	332	c.208G>A	c.(208-210)Gag>Aag	p.E70K	VNN2_ENST00000526192.1_5'UTR|VNN2_ENST00000525289.1_Missense_Mutation_p.E70K|VNN2_ENST00000525270.1_Missense_Mutation_p.E17K	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	70	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		AATACCTGCTCAGCTGCCTGC	0.433																																							uc003qdt.2		NA																	0					0						c.(208-210)GAG>AAG		vanin 2 isoform 1 precursor							112.0	108.0	110.0					6																	133078815		2203	4300	6503	SO:0001583	missense	8875				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity	g.chr6:133078815C>T	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.208G>A	6.37:g.133078815C>T	ENSP00000322276:p.Glu70Lys		Somatic				VNN2_uc003qds.2_5'UTR|VNN2_uc010kgb.2_Missense_Mutation_p.E70K|VNN2_uc003qdv.2_Missense_Mutation_p.E17K	p.E70K	NM_004665	NP_004656	WXS	Illumina HiSeq	Unspecified	O95498	VNN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)	1	219	-			70			CN hydrolase.		A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	ENST00000326499.6	37	c.208G>A	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	c	4.574	0.106696	0.08780	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289;ENST00000524919;ENST00000530536;ENST00000532012	D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	5.59	-6.42	0.01932	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	1.303910	0.04898	N	0.450734	T	0.41328	0.1154	N	0.03253	-0.375	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.50162	-0.8860	10	0.02654	T	1	-0.0649	5.0048	0.14282	0.0784:0.1759:0.2302:0.5154	.	70;70	O95498-2;O95498	.;VNN2_HUMAN	K	70;17;70;70;17;70	ENSP00000322276:E70K;ENSP00000436822:E17K;ENSP00000436935:E70K;ENSP00000431451:E70K;ENSP00000434210:E17K;ENSP00000431680:E70K	ENSP00000322276:E70K	E	-	1	0	VNN2	133120508	0.000000	0.05858	0.000000	0.03702	0.266000	0.26442	-5.003000	0.00161	-1.247000	0.02507	0.604000	0.83254	GAG		0.433	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2			4	78	0	0	0	0.000248	0	4	78				
GLCCI1	113263	broad.mit.edu	37	7	8126004	8126004	+	Missense_Mutation	SNP	G	G	A	rs374066040		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:8126004G>A	ENST00000223145.5	+	8	2037	c.1480G>A	c.(1480-1482)Gtt>Att	p.V494I		NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	494						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		AACTCTGACCGTTGAGCAGCT	0.552																																							uc003srk.2		NA																	0					0						c.(1480-1482)GTT>ATT		glucocorticoid induced transcript 1		G	ILE/VAL	0,4406		0,0,2203	191.0	208.0	203.0		1480	3.5	0.6	7		203	1,8599	1.2+/-3.3	0,1,4299	no	missense	GLCCI1	NM_138426.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	494/548	8126004	1,13005	2203	4300	6503	SO:0001583	missense	113263							g.chr7:8126004G>A	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.1480G>A	7.37:g.8126004G>A	ENSP00000223145:p.Val494Ile		Somatic					p.V494I	NM_138426	NP_612435	WXS	Illumina HiSeq	Unspecified	Q86VQ1	GLCI1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)	8	2039	+		Ovarian(82;0.0608)	494					A4D103|Q96FD0	Missense_Mutation	SNP	ENST00000223145.5	37	c.1480G>A	CCDS34601.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155287	0.38021	0.0	1.16E-4	ENSG00000106415	ENST00000223145	.	.	.	5.32	3.52	0.40303	.	0.448294	0.24215	N	0.040481	T	0.39886	0.1095	N	0.22421	0.69	0.42198	D	0.991752	B	0.27971	0.196	B	0.14578	0.011	T	0.22730	-1.0208	9	0.35671	T	0.21	-30.1131	11.7827	0.52023	0.1412:0.0:0.8588:0.0	.	494	Q86VQ1	GLCI1_HUMAN	I	494	.	ENSP00000223145:V494I	V	+	1	0	GLCCI1	8092529	1.000000	0.71417	0.644000	0.29465	0.179000	0.23085	2.871000	0.48459	0.941000	0.37499	0.655000	0.94253	GTT		0.552	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426		5	274	0	0	0	0.000602	0	5	274				
ISPD	729920	broad.mit.edu	37	7	16348241	16348241	+	Silent	SNP	A	A	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:16348241A>G	ENST00000407010.2	-	4	695	c.696T>C	c.(694-696)taT>taC	p.Y232Y	ISPD_ENST00000399310.3_Silent_p.Y182Y	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	232					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						ATTCCAAGTCATAGTCACTAC	0.373										Multiple Myeloma(15;0.18)																													uc010ktx.2		NA																	0				ovary(1)	1						c.(694-696)TAT>TAC		notch1-induced protein isoform a							103.0	98.0	100.0					7																	16348241		1904	4137	6041	SO:0001819	synonymous_variant	729920				isoprenoid biosynthetic process		nucleotidyltransferase activity	g.chr7:16348241A>G	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.696T>C	7.37:g.16348241A>G		Multiple Myeloma(15;0.18)	Somatic				ISPD_uc010kty.2_Silent_p.Y182Y	p.Y232Y	NM_001101426	NP_001094896	WXS	Illumina HiSeq	Unspecified	A4D126	ISPD_HUMAN			4	696	-			232					A8MU35|H9KVB2	Silent	SNP	ENST00000407010.2	37	c.696T>C																																																																																					0.373	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426		4	15	0	0	0	0.000248	0	4	15				
SP4	6671	broad.mit.edu	37	7	21469643	21469643	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:21469643C>T	ENST00000222584.3	+	3	1078	c.860C>T	c.(859-861)gCt>gTt	p.A287V		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	287					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GGCCAGCCTGCTGCTACTGCT	0.517																																							uc003sva.2		NA																	0				ovary(3)|skin(2)	5						c.(859-861)GCT>GTT		Sp4 transcription factor							101.0	84.0	90.0					7																	21469643		2203	4300	6503	SO:0001583	missense	6671				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr7:21469643C>T		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.860C>T	7.37:g.21469643C>T	ENSP00000222584:p.Ala287Val		Somatic				SP4_uc003svb.2_5'UTR	p.A287V	NM_003112	NP_003103	WXS	Illumina HiSeq	Unspecified	Q02446	SP4_HUMAN			3	1041	+			287					O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	c.860C>T	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299313	0.40694	.	.	ENSG00000105866	ENST00000222584	T	0.09073	3.02	4.94	4.94	0.65067	.	0.436743	0.27113	N	0.020869	T	0.08403	0.0209	L	0.40543	1.245	0.28567	N	0.910845	B	0.09022	0.002	B	0.12156	0.007	T	0.12528	-1.0544	10	0.22109	T	0.4	.	13.529	0.61611	0.0:1.0:0.0:0.0	.	287	Q02446	SP4_HUMAN	V	287	ENSP00000222584:A287V	ENSP00000222584:A287V	A	+	2	0	SP4	21436168	0.489000	0.26004	1.000000	0.80357	0.988000	0.76386	1.223000	0.32527	2.559000	0.86315	0.655000	0.94253	GCT		0.517	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112		6	87	0	0	0	0.001984	0	6	87				
URGCP	55665	broad.mit.edu	37	7	43917298	43917298	+	Silent	SNP	C	C	A	rs201056662		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:43917298C>A	ENST00000453200.1	-	6	2257	c.1764G>T	c.(1762-1764)acG>acT	p.T588T	URGCP_ENST00000336086.6_Silent_p.T545T|URGCP_ENST00000223341.7_Silent_p.T545T|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000447717.3_Silent_p.T545T|URGCP_ENST00000402306.3_Silent_p.T579T|URGCP_ENST00000443736.1_Silent_p.T545T|URGCP-MRPS24_ENST00000603700.1_Intron			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	588					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGGTGAGAAGCGTCTCCGGAG	0.647																																							uc003tiw.2		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(1762-1764)ACG>ACT		up-regulated gene 4 isoform 3							41.0	49.0	46.0					7																	43917298		2005	4145	6150	SO:0001819	synonymous_variant	55665				cell cycle	centrosome|nucleus	GTP binding	g.chr7:43917298C>A		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1764G>T	7.37:g.43917298C>A			Somatic				URGCP_uc003tiu.2_Silent_p.T545T|URGCP_uc003tiv.2_Silent_p.T513T|URGCP_uc003tix.2_Silent_p.T579T|URGCP_uc003tiy.2_Silent_p.T545T|URGCP_uc003tiz.2_Silent_p.T545T|URGCP_uc011kbj.1_Silent_p.T545T	p.T588T	NM_001077663	NP_001071131	WXS	Illumina HiSeq	Unspecified	Q8TCY9	URGCP_HUMAN			6	1821	-			588					E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	ENST00000453200.1	37	c.1764G>T	CCDS47578.1																																																																																				0.647	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664		12	67	1	0	0.00185496	0.001855	0.00213601	12	67				
CALCR	799	broad.mit.edu	37	7	93055880	93055880	+	Nonsense_Mutation	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:93055880G>A	ENST00000394441.1	-	13	1528	c.1213C>T	c.(1213-1215)Caa>Taa	p.Q405*	CALCR_ENST00000359558.2_Nonsense_Mutation_p.Q439*|CALCR_ENST00000360249.4_Nonsense_Mutation_p.Q421*|CALCR_ENST00000426151.1_Nonsense_Mutation_p.Q405*|CALCR_ENST00000421592.1_Nonsense_Mutation_p.Q421*	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	439					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TGGGCCCATTGGCGCTTCACG	0.532																																							uc003umv.1		NA																	0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(1315-1317)CAA>TAA		calcitonin receptor isoform 2 precursor	Salmon Calcitonin(DB00017)						35.0	40.0	39.0					7																	93055880		2203	4300	6503	SO:0001587	stop_gained	799				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding	g.chr7:93055880G>A	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1213C>T	7.37:g.93055880G>A	ENSP00000377959:p.Gln405*		Somatic				CALCR_uc011kia.1_Nonsense_Mutation_p.Q219*|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Nonsense_Mutation_p.Q405*|CALCR_uc003umw.2_Nonsense_Mutation_p.Q405*	p.Q439*	NM_001742	NP_001733	WXS	Illumina HiSeq	Unspecified	P30988	CALCR_HUMAN	STAD - Stomach adenocarcinoma(171;0.000244)		15	1576	-	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		421			Cytoplasmic (Potential).		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Nonsense_Mutation	SNP	ENST00000394441.1	37	c.1315C>T	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	G	33	5.286164	0.95517	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	13.8286	0.63366	0.0:0.0:1.0:0.0	.	.	.	.	X	439;421;421;405;405	.	ENSP00000352561:Q439X	Q	-	1	0	CALCR	92893816	1.000000	0.71417	0.954000	0.39281	0.304000	0.27724	7.279000	0.78599	2.728000	0.93425	0.585000	0.79938	CAA		0.532	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742		11	32	0	0	0	0.008291	0	11	32				
RELN	5649	broad.mit.edu	37	7	103202036	103202036	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:103202036C>G	ENST00000428762.1	-	36	5631	c.5472G>C	c.(5470-5472)gaG>gaC	p.E1824D	RELN_ENST00000343529.5_Missense_Mutation_p.E1824D|RELN_ENST00000424685.2_Missense_Mutation_p.E1824D	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1824					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GATTCCCCCTCTCTGCACCAT	0.418																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(5470-5472)GAG>GAC		reelin isoform a							121.0	121.0	121.0					7																	103202036		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103202036C>G		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5472G>C	7.37:g.103202036C>G	ENSP00000392423:p.Glu1824Asp		Somatic				RELN_uc010liz.2_Missense_Mutation_p.E1824D	p.E1824D	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	36	5632	-			1824					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.5472G>C	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.332935	0.60853	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.26518	1.73;1.73;1.73	5.86	4.98	0.66077	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.46425	0.1392	M	0.68952	2.095	0.45318	D	0.998317	D;D	0.69078	0.997;0.994	D;D	0.75020	0.985;0.958	T	0.43147	-0.9409	10	0.54805	T	0.06	.	10.8455	0.46741	0.0:0.8567:0.0:0.1433	.	1824;1824	P78509-2;P78509	.;RELN_HUMAN	D	1824	ENSP00000392423:E1824D;ENSP00000345694:E1824D;ENSP00000388446:E1824D	ENSP00000345694:E1824D	E	-	3	2	RELN	102989272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.443000	0.35057	1.480000	0.48289	0.563000	0.77884	GAG		0.418	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		21	152	0	0	0	0.00632	0	21	152				
HIPK2	28996	broad.mit.edu	37	7	139416071	139416071	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr7:139416071C>A	ENST00000406875.3	-	2	857	c.763G>T	c.(763-765)Gcc>Tcc	p.A255S	HIPK2_ENST00000342645.6_Missense_Mutation_p.A255S|HIPK2_ENST00000428878.2_Missense_Mutation_p.A255S	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	255	Interaction with DAXX.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TAGTCATCGGCACTCTCCGTG	0.517																																							uc003vvf.3		NA																	0				ovary(3)|central_nervous_system(3)|skin(1)	7						c.(763-765)GCC>TCC		homeodomain interacting protein kinase 2 isoform							82.0	73.0	76.0					7																	139416071		1568	3582	5150	SO:0001583	missense	28996				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding	g.chr7:139416071C>A	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.763G>T	7.37:g.139416071C>A	ENSP00000385571:p.Ala255Ser		Somatic				HIPK2_uc003vvd.3_Missense_Mutation_p.A255S	p.A255S	NM_022740	NP_073577	WXS	Illumina HiSeq	Unspecified	Q9H2X6	HIPK2_HUMAN			2	937	-	Melanoma(164;0.205)		255			Protein kinase.|Interaction with DAXX.		Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37	c.763G>T		.	.	.	.	.	.	.	.	.	.	C	20.4	3.986975	0.74589	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.20069	2.1;2.1;2.1	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.48857	0.1523	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.83275	0.996;0.99	T	0.46857	-0.9161	8	0.46703	T	0.11	.	18.6737	0.91521	0.0:1.0:0.0:0.0	.	255;255	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	S	255	ENSP00000385571:A255S;ENSP00000413724:A255S;ENSP00000343108:A255S	ENSP00000343108:A255S	A	-	1	0	HIPK2	139062557	1.000000	0.71417	0.912000	0.35992	0.524000	0.34500	7.818000	0.86416	2.394000	0.81467	0.591000	0.81541	GCC		0.517	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740		9	38	1	0	1.12685e-05	0.004482	1.39936e-05	9	38				
LZTS1	11178	broad.mit.edu	37	8	20107693	20107693	+	Missense_Mutation	SNP	C	C	A	rs148039718	byFrequency	TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr8:20107693C>A	ENST00000381569.1	-	4	1688	c.1331G>T	c.(1330-1332)gGc>gTc	p.G444V	LZTS1_ENST00000265801.6_Missense_Mutation_p.G444V|LZTS1_ENST00000522290.1_Missense_Mutation_p.G444V			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	444					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CAGCTCCAGGCCCTTGGTGCG	0.652																																							uc003wzr.2		NA																	0				ovary(1)	1						c.(1330-1332)GGC>GTC		leucine zipper, putative tumor suppressor 1							86.0	91.0	89.0					8																	20107693		2203	4300	6503	SO:0001583	missense	11178				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:20107693C>A	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1331G>T	8.37:g.20107693C>A	ENSP00000370981:p.Gly444Val		Somatic				LZTS1_uc010ltg.1_Missense_Mutation_p.G444V	p.G444V	NM_021020	NP_066300	WXS	Illumina HiSeq	Unspecified	Q9Y250	LZTS1_HUMAN		Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)	3	1442	-			444					D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	37	c.1331G>T	CCDS6015.1	.	.	.	.	.	.	.	.	.	.	c	10.44	1.349505	0.24426	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.42131	0.98;0.98;0.98	4.83	2.05	0.26809	.	0.445862	0.25211	N	0.032315	T	0.20700	0.0498	N	0.12182	0.205	0.46749	D	0.999189	B;B	0.28470	0.015;0.213	B;B	0.28916	0.024;0.096	T	0.03969	-1.0988	10	0.33141	T	0.24	-33.0933	4.8404	0.13487	0.0:0.4641:0.346:0.1899	.	444;444	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	V	444	ENSP00000370981:G444V;ENSP00000265801:G444V;ENSP00000429263:G444V	ENSP00000265801:G444V	G	-	2	0	LZTS1	20151973	0.983000	0.35010	0.997000	0.53966	0.929000	0.56500	1.577000	0.36515	0.469000	0.27268	-0.225000	0.12378	GGC		0.652	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		21	112	1	0	4.59853e-10	0.005443	6.56933e-10	21	112				
KCNB2	9312	broad.mit.edu	37	8	73848226	73848226	+	Silent	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr8:73848226C>A	ENST00000523207.1	+	3	1224	c.636C>A	c.(634-636)ctC>ctA	p.L212L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	212					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CTTTGTCTCTCAATACGCTGC	0.473																																							uc003xzb.2		NA																	0				skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(634-636)CTC>CTA		potassium voltage-gated channel, Shab-related							213.0	203.0	207.0					8																	73848226		2203	4300	6503	SO:0001819	synonymous_variant	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73848226C>A	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.636C>A	8.37:g.73848226C>A			Somatic					p.L212L	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	1224	+	Breast(64;0.137)		212			Helical; Name=Segment S1; (Potential).		Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	c.636C>A	CCDS6209.1																																																																																				0.473	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		62	178	1	0	6.5469e-37	0.00361	1.09115e-36	62	178				
PLEC	5339	broad.mit.edu	37	8	144993590	144993590	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr8:144993590C>A	ENST00000322810.4	-	32	10979	c.10810G>T	c.(10810-10812)Gcc>Tcc	p.A3604S	PLEC_ENST00000354958.2_Missense_Mutation_p.A3445S|PLEC_ENST00000354589.3_Missense_Mutation_p.A3467S|PLEC_ENST00000356346.3_Missense_Mutation_p.A3453S|PLEC_ENST00000398774.2_Missense_Mutation_p.A3435S|PLEC_ENST00000527096.1_Missense_Mutation_p.A3490S|PLEC_ENST00000357649.2_Missense_Mutation_p.A3471S|PLEC_ENST00000436759.2_Missense_Mutation_p.A3494S|PLEC_ENST00000345136.3_Missense_Mutation_p.A3467S	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3604	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCGATCTGGGCCTCCAGCAGG	0.667																																							uc003zaf.1		NA																	0				large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(10810-10812)GCC>TCC		plectin isoform 1							42.0	47.0	46.0					8																	144993590		2038	4183	6221	SO:0001583	missense	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144993590C>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10810G>T	8.37:g.144993590C>A	ENSP00000323856:p.Ala3604Ser		Somatic				PLEC_uc003zab.1_Missense_Mutation_p.A3467S|PLEC_uc003zac.1_Missense_Mutation_p.A3471S|PLEC_uc003zad.2_Missense_Mutation_p.A3467S|PLEC_uc003zae.1_Missense_Mutation_p.A3435S|PLEC_uc003zag.1_Missense_Mutation_p.A3445S|PLEC_uc003zah.2_Missense_Mutation_p.A3453S|PLEC_uc003zaj.2_Missense_Mutation_p.A3494S	p.A3604S	NM_201380	NP_958782	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			32	10980	-			3604			Globular 2.|Plectin 15.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	c.10810G>T	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975829	0.53720	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4	5.03	5.03	0.67393	.	0.000000	0.64402	U	0.000008	D	0.91778	0.7399	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.91635	0.997;0.997;0.997;0.999;0.997;0.997;0.997;0.997	D	0.91167	0.4965	10	0.30078	T	0.28	.	18.1723	0.89749	0.0:1.0:0.0:0.0	.	3494;3453;3445;3604;3435;3467;3471;3467	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	S	3467;3471;3467;3435;3604;3445;3453;3494;3490	ENSP00000344848:A3467S;ENSP00000350277:A3471S;ENSP00000346602:A3467S;ENSP00000381756:A3435S;ENSP00000323856:A3604S;ENSP00000347044:A3445S;ENSP00000348702:A3453S;ENSP00000388180:A3494S;ENSP00000434583:A3490S	ENSP00000323856:A3604S	A	-	1	0	PLEC	145065578	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.604000	0.82830	2.613000	0.88420	0.448000	0.29417	GCC		0.667	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		9	60	1	0	3.09899e-07	0.004482	4.11753e-07	9	60				
LRRC24	441381	broad.mit.edu	37	8	145749504	145749504	+	Silent	SNP	C	C	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr8:145749504C>T	ENST00000529415.2	-	4	714	c.597G>A	c.(595-597)ctG>ctA	p.L199L	LRRC14_ENST00000292524.1_3'UTR|LRRC14_ENST00000528528.1_Intron|LRRC24_ENST00000533758.1_Silent_p.L196L			Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24	199						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(1)|lung(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTGTGAGGCGCAGGACTTGCA	0.637																																							uc003zdm.2		NA																	0					0						c.(595-597)CTG>CTA		leucine rich repeat containing 24 precursor							102.0	109.0	107.0					8																	145749504		2203	4298	6501	SO:0001819	synonymous_variant	441381					integral to membrane		g.chr8:145749504C>T	AB178281	CCDS34969.1	8q24.3	2013-01-11			ENSG00000254402	ENSG00000254402		"""Immunoglobulin superfamily / I-set domain containing"""	28947	protein-coding gene	gene with protein product						7584026	Standard	NM_001024678		Approved	LRRC14OS	uc003zdm.3	Q50LG9	OTTHUMG00000165180	ENST00000529415.2:c.597G>A	8.37:g.145749504C>T			Somatic				LRRC24_uc003zdn.2_Silent_p.L196L|LRRC14_uc003zdk.1_3'UTR|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_Intron	p.L199L	NM_001024678	NP_001019849	WXS	Illumina HiSeq	Unspecified	Q50LG9	LRC24_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		4	729	-	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		199						Silent	SNP	ENST00000529415.2	37	c.597G>A	CCDS34969.1																																																																																				0.637	LRRC24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382501.2	NM_001024678		65	190	0	0	0	0.00361	0	65	190				
ZNF250	58500	broad.mit.edu	37	8	146112249	146112249	+	Missense_Mutation	SNP	G	G	C	rs138214845	byFrequency	TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr8:146112249G>C	ENST00000292579.7	-	5	453	c.337C>G	c.(337-339)Caa>Gaa	p.Q113E	ZNF250_ENST00000417550.2_Missense_Mutation_p.Q108E|ZNF250_ENST00000543949.1_Missense_Mutation_p.Q113E|ZNF250_ENST00000342660.6_Missense_Mutation_p.Q108E	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	113					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		AAACTGTCTTGTTGTGTACAG	0.373																																					NSCLC(16;520 556 24096 40084 43446)	NSCLC(16;520 556 24096 40084 43446)	uc003zeq.3		NA																	0					0						c.(337-339)CAA>GAA		zinc finger protein 250 isoform a							185.0	175.0	178.0					8																	146112249		2203	4300	6503	SO:0001583	missense	58500				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:146112249G>C	AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.337C>G	8.37:g.146112249G>C	ENSP00000292579:p.Gln113Glu		Somatic				COMMD5_uc010mgf.2_5'UTR|ZNF250_uc003zer.3_Missense_Mutation_p.Q108E|ZNF250_uc010mgg.2_Missense_Mutation_p.Q108E	p.Q113E	NM_021061	NP_066405	WXS	Illumina HiSeq	Unspecified	P15622	ZN250_HUMAN	Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)	5	454	-	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		113					D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	ENST00000292579.7	37	c.337C>G	CCDS34972.1	.	.	.	.	.	.	.	.	.	.	G	7.593	0.671214	0.14776	.	.	ENSG00000196150	ENST00000543949;ENST00000342660;ENST00000292579;ENST00000417550;ENST00000394912;ENST00000533622;ENST00000525694	T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45	3.33	3.33	0.38152	.	.	.	.	.	T	0.19087	0.0458	L	0.43152	1.355	0.25766	N	0.9849	P;P	0.42409	0.779;0.779	B;B	0.34873	0.191;0.191	T	0.08911	-1.0699	9	0.02654	T	1	-9.2502	10.6006	0.45365	0.0:0.0:1.0:0.0	.	108;113	D3DWP1;P15622	.;ZN250_HUMAN	E	113;108;113;108;108;108;108	ENSP00000445840:Q113E;ENSP00000344136:Q108E;ENSP00000292579:Q113E;ENSP00000393442:Q108E;ENSP00000433387:Q108E;ENSP00000432450:Q108E	ENSP00000292579:Q113E	Q	-	1	0	ZNF250	146083053	0.795000	0.28851	0.703000	0.30354	0.856000	0.48823	2.945000	0.49043	2.191000	0.70037	0.644000	0.83932	CAA		0.373	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061		16	138	0	0	0	0.001523	0	16	138				
SPATA31D1	389763	broad.mit.edu	37	9	84608545	84608545	+	Missense_Mutation	SNP	T	T	C	rs550323965		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr9:84608545T>C	ENST00000344803.2	+	4	3207	c.3160T>C	c.(3160-3162)Tca>Cca	p.S1054P		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1054					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCTTGTCACTTCACCTGTCAA	0.448													T|||	1	0.000199681	0.0	0.0	5008	,	,		19629	0.001		0.0	False		,,,				2504	0.0						uc004amn.2		NA																	0					0						c.(3160-3162)TCA>CCA		hypothetical protein LOC389763							123.0	127.0	126.0					9																	84608545		1858	4099	5957	SO:0001583	missense	389763					integral to membrane		g.chr9:84608545T>C		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3160T>C	9.37:g.84608545T>C	ENSP00000341988:p.Ser1054Pro		Somatic					p.S1054P	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	3207	+			1054						Missense_Mutation	SNP	ENST00000344803.2	37	c.3160T>C	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	T	8.697	0.908710	0.17833	.	.	ENSG00000214929	ENST00000344803	T	0.13420	2.59	1.11	1.11	0.20524	.	.	.	.	.	T	0.18257	0.0438	L	0.29908	0.895	0.09310	N	1	D	0.69078	0.997	D	0.71184	0.972	T	0.17258	-1.0375	9	0.30854	T	0.27	-4.0189	4.4491	0.11612	0.0:0.0:0.0:1.0	.	1054	Q6ZQQ2	F75D1_HUMAN	P	1054	ENSP00000341988:S1054P	ENSP00000341988:S1054P	S	+	1	0	FAM75D1	83798365	0.018000	0.18449	0.004000	0.12327	0.003000	0.03518	1.001000	0.29783	0.753000	0.32945	0.477000	0.44152	TCA		0.448	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		4	232	0	0	0	0.000602	0	4	232				
CTSL	1514	broad.mit.edu	37	9	90343602	90343602	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr9:90343602G>C	ENST00000343150.5	+	5	1389	c.499G>C	c.(499-501)Gta>Cta	p.V167L	CTSL_ENST00000340342.6_Missense_Mutation_p.V167L|CTSL_ENST00000342020.5_Missense_Mutation_p.V167L|CTSL_ENST00000495822.1_Intron			P07711	CATL1_HUMAN	cathepsin L	167					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										GCAGAATCTGGTAGACTGCTC	0.493																																							uc004aph.2		NA																	0				ovary(3)	3						c.(499-501)GTA>CTA		cathepsin L1 preproprotein	Glucagon recombinant(DB00040)						137.0	134.0	135.0					9																	90343602		2203	4300	6503	SO:0001583	missense	1514				macrophage apoptosis|proteolysis	extracellular region|lysosome|nucleus	cysteine-type endopeptidase activity|histone binding	g.chr9:90343602G>C	X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.499G>C	9.37:g.90343602G>C	ENSP00000345344:p.Val167Leu		Somatic				CTSL1_uc004api.2_Missense_Mutation_p.V167L|CTSL1_uc004apj.2_Missense_Mutation_p.V112L|CTSL1_uc010mqh.2_Intron|CTSL1_uc004apk.2_Missense_Mutation_p.V167L|CTSL1_uc004apl.2_Missense_Mutation_p.V167L	p.V167L	NM_001912	NP_001903	WXS	Illumina HiSeq	Unspecified	P07711	CATL1_HUMAN			5	849	+			167					Q6IAV1|Q96QJ0	Missense_Mutation	SNP	ENST00000343150.5	37	c.499G>C	CCDS6675.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819378	0.71028	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020	D;D;D	0.88277	-2.36;-2.36;-2.36	4.41	2.02	0.26589	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.87406	0.6169	L	0.50993	1.605	0.80722	D	1	B	0.25105	0.118	B	0.38616	0.277	T	0.82552	-0.0400	10	0.62326	D	0.03	.	10.5112	0.44864	0.1373:0.0:0.8627:0.0	.	167	P07711	CATL1_HUMAN	L	167	ENSP00000345344:V167L;ENSP00000365061:V167L;ENSP00000340470:V167L	ENSP00000365061:V167L	V	+	1	0	CTSL1	89533422	1.000000	0.71417	0.961000	0.40146	0.994000	0.84299	4.124000	0.57924	0.194000	0.20326	0.655000	0.94253	GTA		0.493	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912		5	116	0	0	0	0.000602	0	5	116				
ASTN2	23245	broad.mit.edu	37	9	119567928	119567928	+	Silent	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr9:119567928G>T	ENST00000313400.4	-	13	2479	c.2379C>A	c.(2377-2379)gtC>gtA	p.V793V	ASTN2_ENST00000373996.3_Silent_p.V789V|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000361209.2_Silent_p.V742V			O75129	ASTN2_HUMAN	astrotactin 2	793					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TCATCTGGAAGACTTGGCCTT	0.488																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(2377-2379)GTC>GTA		astrotactin 2 isoform c							187.0	167.0	174.0					9																	119567928		2203	4300	6503	SO:0001819	synonymous_variant	23245					integral to membrane		g.chr9:119567928G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.2379C>A	9.37:g.119567928G>T			Somatic				ASTN2_uc004bjr.1_Silent_p.V789V|ASTN2_uc004bjt.1_Silent_p.V742V	p.V793V	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			13	2480	-			793			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37	c.2379C>A																																																																																					0.488	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		20	114	1	0	3.73988e-18	0.00632	5.92148e-18	20	114				
SETX	23064	broad.mit.edu	37	9	135210025	135210025	+	Missense_Mutation	SNP	T	T	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr9:135210025T>A	ENST00000224140.5	-	7	990	c.808A>T	c.(808-810)Ata>Tta	p.I270L	SETX_ENST00000393220.1_Missense_Mutation_p.I270L|SETX_ENST00000372169.2_Missense_Mutation_p.I270L	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	270					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GTGTGAAGTATCGATTGCATA	0.373																																							uc004cbk.2		NA																	0				ovary(2)|skin(1)	3						c.(808-810)ATA>TTA		senataxin							178.0	145.0	156.0					9																	135210025		2203	4300	6503	SO:0001583	missense	23064				cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	g.chr9:135210025T>A	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.808A>T	9.37:g.135210025T>A	ENSP00000224140:p.Ile270Leu		Somatic					p.I270L	NM_015046	NP_055861	WXS	Illumina HiSeq	Unspecified	Q7Z333	SETX_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	7	991	-		Myeloproliferative disorder(178;0.204)	270					A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	c.808A>T	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499876	0.85176	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	T;T;T	0.63913	-0.07;-0.07;-0.07	5.91	5.91	0.95273	.	0.055743	0.64402	D	0.000002	T	0.70937	0.3281	L	0.34521	1.04	0.35518	D	0.80117	D	0.64830	0.994	D	0.76071	0.987	T	0.78814	-0.2056	10	0.66056	D	0.02	.	15.5243	0.75890	0.0:0.0:0.0:1.0	.	270	Q7Z333	SETX_HUMAN	L	270	ENSP00000224140:I270L;ENSP00000361242:I270L;ENSP00000376913:I270L	ENSP00000224140:I270L	I	-	1	0	SETX	134199846	1.000000	0.71417	0.901000	0.35422	0.730000	0.41778	5.833000	0.69349	2.263000	0.75096	0.377000	0.23210	ATA		0.373	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046		11	68	0	0	0	0.001855	0	11	68				
DCAF8L1	139425	broad.mit.edu	37	X	27999372	27999372	+	Missense_Mutation	SNP	G	G	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:27999372G>C	ENST00000441525.1	-	1	194	c.80C>G	c.(79-81)tCt>tGt	p.S27C		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	27										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TGCTACTCCAGACTGCTCCTC	0.567																																							uc004dbx.1		NA																	0				ovary(3)|skin(1)	4						c.(79-81)TCT>TGT		DDB1 and CUL4 associated factor 8-like 1							56.0	45.0	49.0					X																	27999372		2202	4300	6502	SO:0001583	missense	139425							g.chrX:27999372G>C		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.80C>G	X.37:g.27999372G>C	ENSP00000405222:p.Ser27Cys		Somatic					p.S27C	NM_001017930	NP_001017930	WXS	Illumina HiSeq	Unspecified	A6NGE4	DC8L1_HUMAN			1	195	-			27					B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	c.80C>G	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048324	0.36181	.	.	ENSG00000226372	ENST00000441525	T	0.72725	-0.68	0.842	0.842	0.18927	.	0.164825	0.40064	N	0.001194	T	0.77308	0.4111	M	0.63843	1.955	0.24352	N	0.994914	D	0.89917	1.0	D	0.87578	0.998	T	0.64711	-0.6343	10	0.59425	D	0.04	-9.0743	7.2758	0.26283	1.0E-4:0.0:0.9999:0.0	.	27	A6NGE4	DC8L1_HUMAN	C	27	ENSP00000405222:S27C	ENSP00000405222:S27C	S	-	2	0	DCAF8L1	27909293	0.990000	0.36364	0.025000	0.17156	0.108000	0.19459	2.306000	0.43673	0.691000	0.31592	0.284000	0.19432	TCT		0.567	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		10	45	0	0	0	0.001368	0	10	45				
FAM47A	158724	broad.mit.edu	37	X	34148985	34148985	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:34148985G>T	ENST00000346193.3	-	1	1462	c.1411C>A	c.(1411-1413)Ccc>Acc	p.P471T		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	471										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TGAGTCTCGGGAGGCTGCAGG	0.602																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1411-1413)CCC>ACC		hypothetical protein LOC158724							46.0	52.0	50.0					X																	34148985		2136	4237	6373	SO:0001583	missense	158724							g.chrX:34148985G>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1411C>A	X.37:g.34148985G>T	ENSP00000345029:p.Pro471Thr		Somatic					p.P471T	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	1444	-			471					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.1411C>A	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	10.34	1.323281	0.24080	.	.	ENSG00000185448	ENST00000346193	T	0.22539	1.95	0.8	0.8	0.18672	.	.	.	.	.	T	0.24431	0.0592	L	0.42245	1.32	0.09310	N	1	P	0.51933	0.949	P	0.53861	0.736	T	0.17961	-1.0352	8	0.19147	T	0.46	.	.	.	.	.	471	Q5JRC9	FA47A_HUMAN	T	471	ENSP00000345029:P471T	ENSP00000345029:P471T	P	-	1	0	FAM47A	34058906	0.981000	0.34729	0.030000	0.17652	0.088000	0.18126	2.090000	0.41682	0.666000	0.31087	0.183000	0.17082	CCC		0.602	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		11	68	1	0	2.27111e-07	0.001368	3.06036e-07	11	68				
FAM47B	170062	broad.mit.edu	37	X	34961812	34961812	+	Silent	SNP	C	C	G	rs142684131		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:34961812C>G	ENST00000329357.5	+	1	900	c.864C>G	c.(862-864)ccC>ccG	p.P288P		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	288	Pro-rich.									breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						CGGAGCCTCCCGAGACTCGCG	0.627																																							uc004ddi.1		NA																	0				ovary(3)|breast(1)	4						c.(862-864)CCC>CCG		hypothetical protein LOC170062		C		0,3833		0,0,1631,571	55.0	54.0	54.0		864	-0.5	0.0	X	dbSNP_134	54	1,6727		0,1,2427,1872	no	coding-synonymous	FAM47B	NM_152631.2		0,1,4058,2443	GG,GC,CC,C		0.0149,0.0,0.0095		288/646	34961812	1,10560	2202	4300	6502	SO:0001819	synonymous_variant	170062							g.chrX:34961812C>G	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.864C>G	X.37:g.34961812C>G			Somatic					p.P288P	NM_152631	NP_689844	WXS	Illumina HiSeq	Unspecified	Q8NA70	FA47B_HUMAN			1	882	+			288			Pro-rich.		Q5JQN5|Q6PIG3	Silent	SNP	ENST00000329357.5	37	c.864C>G	CCDS14236.1																																																																																				0.627	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		10	71	0	0	0	0.000978	0	10	71				
RGN	9104	broad.mit.edu	37	X	46951083	46951083	+	Missense_Mutation	SNP	G	G	A	rs147490967	byFrequency	TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:46951083G>A	ENST00000352078.4	+	5	914	c.569G>A	c.(568-570)cGc>cAc	p.R190H	RGN_ENST00000397180.1_Missense_Mutation_p.R190H|RGN_ENST00000457380.1_Missense_Mutation_p.R118H|RGN_ENST00000336169.3_Missense_Mutation_p.R190H	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin	190					cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						ATAGCCAACCGCAGAAGTGTT	0.428																																							uc004dgz.1		NA																	0					0						c.(568-570)CGC>CAC		regucalcin			HIS/ARG,HIS/ARG	4,3831		0,4,1628,571	108.0	102.0	104.0		569,569	6.0	1.0	X	dbSNP_134	104	0,6728		0,0,2428,1872	yes	missense,missense	RGN	NM_004683.4,NM_152869.2	29,29	0,4,4056,2443	AA,AG,GG,G		0.0,0.1043,0.0379	probably-damaging,probably-damaging	190/300,190/300	46951083	4,10559	2203	4300	6503	SO:0001583	missense	9104				cellular calcium ion homeostasis|positive regulation of ATPase activity|regulation of calcium-mediated signaling	cytoplasm|nucleus	calcium ion binding|enzyme regulator activity|gluconolactonase activity|zinc ion binding	g.chrX:46951083G>A	D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.569G>A	X.37:g.46951083G>A	ENSP00000253303:p.Arg190His		Somatic				RGN_uc004dha.1_Missense_Mutation_p.R190H|RGN_uc010nho.1_Missense_Mutation_p.R137H|RGN_uc010nhp.1_Missense_Mutation_p.R118H	p.R190H	NM_152869	NP_690608	WXS	Illumina HiSeq	Unspecified	Q15493	RGN_HUMAN			6	1538	+			190					A4FTW1|A8K271|Q53FC9|Q5JRR5	Missense_Mutation	SNP	ENST00000352078.4	37	c.569G>A	CCDS14272.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182856	0.78677	0.001043	0.0	ENSG00000130988	ENST00000397180;ENST00000457380;ENST00000352078;ENST00000336169	T;T;T;T	0.33654	1.4;1.57;1.4;1.4	6.02	6.02	0.97574	SMP-30/Gluconolaconase/LRE-like region (1);Six-bladed beta-propeller, TolB-like (1);	0.048497	0.85682	D	0.000000	T	0.66277	0.2773	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.65874	0.736;0.939	T	0.73199	-0.4058	10	0.72032	D	0.01	-25.4877	15.8082	0.78531	0.0:0.1414:0.8586:0.0	.	118;190	Q15493-2;Q15493	.;RGN_HUMAN	H	190;118;190;190	ENSP00000380365:R190H;ENSP00000406568:R118H;ENSP00000253303:R190H;ENSP00000338400:R190H	ENSP00000338400:R190H	R	+	2	0	RGN	46836027	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	2.641000	0.46587	2.555000	0.86185	0.591000	0.81541	CGC		0.428	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056385.1	NM_004683		11	64	0	0	0	0.004007	0	11	64				
GPKOW	27238	broad.mit.edu	37	X	48978831	48978831	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:48978831C>A	ENST00000156109.5	-	3	451	c.373G>T	c.(373-375)Gac>Tac	p.D125Y		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	125						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						AGCGTGGGGTCGACACCCGCA	0.567																																							uc004dmr.2		NA																	0				ovary(2)	2						c.(373-375)GAC>TAC		G patch domain and KOW motifs							54.0	46.0	48.0					X																	48978831		2203	4300	6503	SO:0001583	missense	27238					nucleus	nucleic acid binding	g.chrX:48978831C>A	U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.373G>T	X.37:g.48978831C>A	ENSP00000156109:p.Asp125Tyr		Somatic					p.D125Y	NM_015698	NP_056513	WXS	Illumina HiSeq	Unspecified	Q92917	GPKOW_HUMAN			3	380	-			125					Q59EK5|Q9BQA8	Missense_Mutation	SNP	ENST00000156109.5	37	c.373G>T	CCDS35251.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.055750	0.55325	.	.	ENSG00000068394	ENST00000156109	.	.	.	4.17	2.32	0.28847	.	0.399251	0.27366	N	0.019685	T	0.64000	0.2559	M	0.64997	1.995	0.44214	D	0.997041	D	0.64830	0.994	P	0.58266	0.836	T	0.62383	-0.6866	9	0.72032	D	0.01	-2.2016	6.7938	0.23715	0.0:0.7193:0.1746:0.1061	.	125	Q92917	GPKOW_HUMAN	Y	125	.	ENSP00000156109:D125Y	D	-	1	0	GPKOW	48865775	0.966000	0.33281	0.458000	0.27068	0.889000	0.51656	0.600000	0.24104	0.316000	0.23135	-0.312000	0.09012	GAC		0.567	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698		5	31	1	0	3.59834e-05	0.001168	4.35467e-05	5	31				
RPL36A	6173	broad.mit.edu	37	X	100646034	100646034	+	Splice_Site	SNP	G	G	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:100646034G>A	ENST00000553110.3	+	1	87	c.3G>A	c.(1-3)atG>atA	p.M1I	RPL36A-HNRNPH2_ENST00000409170.3_Splice_Site_p.W12*|RPL36A_ENST00000471855.1_5'Flank|RPL36A_ENST00000427805.2_Splice_Site_p.M37I			P83881	RL36A_HUMAN	ribosomal protein L36a	1					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			liver(4)|lung(1)|prostate(1)	6						ACGCAAGCATGGTAGGACTTG	0.582											OREG0019892	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004ehk.2		NA																	0					0						c.(1-3)ATG>ATA		ribosomal protein L36a							127.0	110.0	115.0					X																	100646034		2203	4300	6503	SO:0001630	splice_region_variant	6173				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome	g.chrX:100646034G>A	BC001781	CCDS14483.1, CCDS14483.2	Xq22.1	2011-04-06	2002-01-15	2002-01-18	ENSG00000241343	ENSG00000241343		"""L ribosomal proteins"""	10359	protein-coding gene	gene with protein product		300902	"""ribosomal protein L44"""	RPL44		3461443	Standard	NM_021029		Approved	L36A		P83881	OTTHUMG00000022027	ENST00000553110.3:c.3+1G>A	X.37:g.100646034G>A			Somatic	OREG0019892	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1352	BTK_uc010nno.2_5'Flank|RPL36A_uc004ehj.1_Missense_Mutation_p.M1I	p.M1I	NM_021029	NP_066357	WXS	Illumina HiSeq	Unspecified	P83881	RL36A_HUMAN			1	87	+			1					P09896|P10661|Q08ES5|Q5J9I6	Missense_Mutation	SNP	ENST00000553110.3	37	c.3G>A		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	13.54|13.54|13.54	2.266804|2.266804|2.266804	0.40095|0.40095|0.40095	.|.|.	.|.|.	ENSG00000241343|ENSG00000241343;ENSG00000241343;ENSG00000257529|ENSG00000257529	ENST00000392994|ENST00000427805;ENST00000553110;ENST00000409338|ENST00000409170	.|T;T;T|.	.|0.53423|.	.|0.74;0.62;0.74|.	5.1|5.1|5.1	5.1|5.1|5.1	0.69264|0.69264|0.69264	.|.|.	.|0.694155|.	.|0.11921|.	.|U|.	.|0.516681|.	T|T|.	0.64394|0.64394|.	0.2594|0.2594|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B;B|.	.|0.10296|.	.|0.002;0.003|.	.|B;B|.	.|0.11329|.	.|0.005;0.006|.	T|T|.	0.62421|0.62421|.	-0.6858|-0.6858|.	4|9|.	.|0.59425|.	.|D|.	.|0.04|.	-24.6815|-24.6815|-24.6815	12.7666|12.7666|12.7666	0.57394|0.57394|0.57394	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|1;1|.	.|P83881;B2REA7|.	.|RL36A_HUMAN;.|.	S|I|X	20|37;1;12|12	.|ENSP00000404375:M37I;ENSP00000446503:M1I;ENSP00000386974:M12I|.	.|ENSP00000386974:M12I|.	G|M|W	+|+|+	1|3|2	0|0|0	RPL36A|RPL36A;RP1-164F3.9|RP1-164F3.9	100532690|100532690|100532690	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.127000|0.127000|0.127000	0.20565|0.20565|0.20565	4.617000|4.617000|4.617000	0.61204|0.61204|0.61204	2.510000|2.510000|2.510000	0.84645|0.84645|0.84645	0.600000|0.600000|0.600000	0.82982|0.82982|0.82982	GGT|ATG|TGG		0.582	RPL36A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021029	Missense_Mutation	10	112	0	0	0	0.001368	0	10	112				
KIAA1210	57481	broad.mit.edu	37	X	118238956	118238956	+	Splice_Site	SNP	T	T	G			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:118238956T>G	ENST00000402510.2	-	7	1066	c.1067A>C	c.(1066-1068)cAg>cCg	p.Q356P		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	356										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TATACTCACCTGAGTCGCTGT	0.428																																							uc004era.3		NA																	0				ovary(4)|skin(1)	5						c.(1066-1068)CAG>CCG		hypothetical protein LOC57481							139.0	134.0	136.0					X																	118238956		1885	4110	5995	SO:0001630	splice_region_variant	57481							g.chrX:118238956T>G	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1068+1A>C	X.37:g.118238956T>G			Somatic					p.Q356P	NM_020721	NP_065772	WXS	Illumina HiSeq	Unspecified	Q9ULL0	K1210_HUMAN			7	1067	-			356					B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	c.1067A>C	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	T	10.56	1.384868	0.25031	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.11385	2.78	3.86	-0.144	0.13440	.	.	.	.	.	T	0.03783	0.0107	N	0.08118	0	0.09310	N	0.999999	P	0.44195	0.828	B	0.37304	0.246	T	0.32798	-0.9893	9	0.23891	T	0.37	.	2.6767	0.05083	0.1998:0.2465:0.0:0.5537	.	356	Q9ULL0	K1210_HUMAN	P	356;192	ENSP00000384670:Q356P	ENSP00000396164:Q192P	Q	-	2	0	RP13-347D8.5;RP13-347D8.6	118122984	0.257000	0.24022	0.032000	0.17829	0.007000	0.05969	0.022000	0.13511	-0.233000	0.09797	0.412000	0.27726	CAG		0.428	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	Missense_Mutation	29	184	0	0	0	0.00623	0	29	184				
AFF2	2334	broad.mit.edu	37	X	148037640	148037640	+	Missense_Mutation	SNP	C	C	A	rs140525796	byFrequency	TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:148037640C>A	ENST00000370460.2	+	11	2544	c.2065C>A	c.(2065-2067)Cct>Act	p.P689T	AFF2_ENST00000370457.5_Missense_Mutation_p.P656T|AFF2_ENST00000286437.5_Missense_Mutation_p.P330T|AFF2_ENST00000342251.3_Missense_Mutation_p.P656T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	689					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					ACCTAACATCCCTTTGGCTCC	0.488																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(2065-2067)CCT>ACT		fragile X mental retardation 2							91.0	95.0	93.0					X																	148037640		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148037640C>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2065C>A	X.37:g.148037640C>A	ENSP00000359489:p.Pro689Thr		Somatic				AFF2_uc004fcq.2_Missense_Mutation_p.P679T|AFF2_uc004fcr.2_Missense_Mutation_p.P650T|AFF2_uc011mxb.1_Missense_Mutation_p.P654T|AFF2_uc004fcs.2_Missense_Mutation_p.P656T|AFF2_uc011mxc.1_Missense_Mutation_p.P330T	p.P689T	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			11	2544	+	Acute lymphoblastic leukemia(192;6.56e-05)		689					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.2065C>A	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.716340	0.00706	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.67	0.558	0.17266	.	0.630590	0.16102	N	0.229520	T	0.44603	0.1301	L	0.48642	1.525	0.09310	N	1	B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.001;0.001	B;B;B;B;B;B	0.09377	0.004;0.001;0.001;0.001;0.003;0.004	T	0.21280	-1.0250	10	0.24483	T	0.36	.	1.1714	0.01826	0.2056:0.2639:0.3413:0.1891	.	330;654;656;650;679;689	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	T	689;656;656;330	ENSP00000359489:P689T;ENSP00000359486:P656T;ENSP00000345459:P656T;ENSP00000286437:P330T	ENSP00000286437:P330T	P	+	1	0	AFF2	147845340	0.013000	0.17824	0.005000	0.12908	0.095000	0.18619	0.284000	0.18864	-0.053000	0.13289	-0.237000	0.12165	CCT		0.488	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		15	100	1	0	8.60227e-14	0.004007	1.28695e-13	15	100				
SLC6A8	6535	broad.mit.edu	37	X	152960251	152960251	+	Missense_Mutation	SNP	G	G	T	rs188180929		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:152960251G>T	ENST00000253122.5	+	12	2150	c.1674G>T	c.(1672-1674)gaG>gaT	p.E558D	SLC6A8_ENST00000430077.2_Missense_Mutation_p.E443D|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	558					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GGTGGGGTGAGGCCATGGGCT	0.617																																							uc004fib.3		NA																	0				pancreas(1)	1						c.(1672-1674)GAG>GAT		solute carrier family 6 member 8 isoform 1	Creatine(DB00148)						54.0	44.0	48.0					X																	152960251		2202	4300	6502	SO:0001583	missense	6535				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chrX:152960251G>T		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1674G>T	X.37:g.152960251G>T	ENSP00000253122:p.Glu558Asp		Somatic				SLC6A8_uc004fic.3_Missense_Mutation_p.E548D|SLC6A8_uc011myx.1_Missense_Mutation_p.E443D|SLC6A8_uc010nuj.2_RNA	p.E558D	NM_005629	NP_005620	WXS	Illumina HiSeq	Unspecified	P48029	SC6A8_HUMAN			12	1952	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		558			Extracellular (Potential).		B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	37	c.1674G>T	CCDS14726.1	.	.	.	.	.	.	.	.	.	.	g	9.630	1.136169	0.21123	.	.	ENSG00000130821	ENST00000253122;ENST00000430077;ENST00000328897	T;T	0.74315	-0.83;-0.83	4.9	1.58	0.23477	.	0.000000	0.85682	U	0.000000	T	0.59445	0.2194	L	0.33792	1.035	0.44168	D	0.996974	B;B	0.21452	0.017;0.056	B;B	0.24848	0.021;0.056	T	0.47736	-0.9094	10	0.33940	T	0.23	.	7.2315	0.26045	0.5247:0.0:0.4753:0.0	.	567;558	Q59EV7;P48029	.;SC6A8_HUMAN	D	558;443;652	ENSP00000253122:E558D;ENSP00000403041:E443D	ENSP00000253122:E558D	E	+	3	2	SLC6A8	152613445	0.011000	0.17503	1.000000	0.80357	0.964000	0.63967	-1.184000	0.03076	0.316000	0.23135	-0.344000	0.07964	GAG		0.617	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1			11	62	1	0	1.61879e-10	0.001368	2.33008e-10	11	62				
SSR4	6748	broad.mit.edu	37	X	153062934	153062934	+	Missense_Mutation	SNP	G	G	T	rs149873632		TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chrX:153062934G>T	ENST00000320857.3	+	4	1292	c.208G>T	c.(208-210)Gtc>Ttc	p.V70F	SSR4_ENST00000370086.3_Missense_Mutation_p.V70F|SSR4_ENST00000370085.3_Intron|SSR4_ENST00000370087.1_Missense_Mutation_p.V70F|SSR4_ENST00000460616.1_3'UTR|IDH3G_ENST00000370092.3_5'Flank|IDH3G_ENST00000217901.5_5'Flank	NM_001204526.1	NP_001191455.1	P51571	SSRD_HUMAN	signal sequence receptor, delta	70					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|Sec61 translocon complex (GO:0005784)				central_nervous_system(1)|endometrium(1)|lung(2)	4	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CTATGCTGACGTCGGTGGAAA	0.617																																							uc004fiw.2		NA																	0					0						c.(208-210)GTC>TTC		signal sequence receptor, delta precursor							104.0	76.0	86.0					X																	153062934		2203	4300	6503	SO:0001583	missense	6748				intracellular protein transport	integral to membrane|Sec61 translocon complex	calcium ion binding|protein binding	g.chrX:153062934G>T	BC032351	CCDS14731.1	Xq28	2011-08-31	2011-08-31		ENSG00000180879	ENSG00000180879			11326	protein-coding gene	gene with protein product	"""translocon-associated protein delta"""	300090				9286695	Standard	NM_001204526		Approved	TRAPD	uc022chw.1	P51571	OTTHUMG00000024212	ENST00000320857.3:c.208G>T	X.37:g.153062934G>T	ENSP00000317331:p.Val70Phe		Somatic				IDH3G_uc004fip.2_5'Flank|IDH3G_uc004fiq.2_5'Flank|IDH3G_uc010num.2_5'Flank|IDH3G_uc004fir.2_5'Flank|IDH3G_uc004fit.1_5'Flank|IDH3G_uc004fis.2_5'Flank|SSR4_uc004fiv.2_Missense_Mutation_p.V81F	p.V70F	NM_006280	NP_006271	WXS	Illumina HiSeq	Unspecified	P51571	SSRD_HUMAN			3	257	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		70			Lumenal (Potential).		A8K378|Q53XY1	Missense_Mutation	SNP	ENST00000320857.3	37	c.208G>T	CCDS14731.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559088	0.86335	.	.	ENSG00000180879	ENST00000320857;ENST00000370087;ENST00000370086	T;T;T	0.57107	0.42;0.42;0.42	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.71846	0.3388	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.74241	-0.3729	10	0.87932	D	0	-4.9874	17.6815	0.88245	0.0:0.0:1.0:0.0	.	70	P51571	SSRD_HUMAN	F	70	ENSP00000317331:V70F;ENSP00000359104:V70F;ENSP00000359103:V70F	ENSP00000317331:V70F	V	+	1	0	SSR4	152716128	1.000000	0.71417	0.912000	0.35992	0.840000	0.47671	6.701000	0.74624	2.535000	0.85469	0.529000	0.55759	GTC		0.617	SSR4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061029.1	NM_006280		12	96	1	0	2.5808e-16	0.006122	4.01927e-16	12	96				
SLAMF6	114836	broad.mit.edu	37	1	160458940	160458940	+	Frame_Shift_Del	DEL	C	C	-			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr1:160458940delC	ENST00000368057.3	-	6	877	c.817delG	c.(817-819)gagfs	p.E273fs	SLAMF6_ENST00000368059.3_Frame_Shift_Del_p.E272fs|SLAMF6_ENST00000368055.1_Frame_Shift_Del_p.E162fs			Q96DU3	SLAF6_HUMAN	SLAM family member 6	273						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			GAAACATACTCTAGGTTCCTT	0.473																																							uc001fwe.1		NA																	0				ovary(1)|skin(1)	2						c.(817-819)GAGfs		activating NK receptor precursor							236.0	189.0	205.0					1																	160458940		2203	4300	6503	SO:0001589	frameshift_variant	114836					integral to membrane|plasma membrane	receptor activity	g.chr1:160458940delC	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.817delG	1.37:g.160458940delC	ENSP00000357036:p.Glu273fs		Somatic				SLAMF6_uc001fwd.1_Frame_Shift_Del_p.E272fs|SLAMF6_uc010pjh.1_Frame_Shift_Del_p.E223fs|SLAMF6_uc010pji.1_Frame_Shift_Del_p.E162fs|SLAMF6_uc010pjj.1_3'UTR	p.E273fs	NM_052931	NP_443163	WXS	Illumina HiSeq	Unspecified	Q96DU3	SLAF6_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0923)		6	877	-	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		273			Cytoplasmic (Potential).		A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Frame_Shift_Del	DEL	ENST00000368057.3	37	c.817delG	CCDS53394.1																																																																																				0.473	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931		19	167	NA	NA	NA	NA	NA	19	167	---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127548457	127548461	+	Frame_Shift_Del	DEL	ATGAA	ATGAA	-			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	ATGAA	ATGAA	-	-	ATGAA	ATGAA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr10:127548457_127548461delATGAA	ENST00000284690.3	-	3	1050_1054	c.560_564delTTCAT	c.(559-564)attcatfs	p.IH187fs	DHX32_ENST00000284688.6_Frame_Shift_Del_p.IH187fs	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	187	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGCTTCTTTCATGAATATCATCTAA	0.366																																							uc001ljf.1		NA																	0				breast(2)|ovary(1)|lung(1)	4						c.(559-564)ATTCATfs		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32																																				SO:0001589	frameshift_variant	55760					mitochondrion|nucleus	ATP binding|helicase activity	g.chr10:127548457_127548461delATGAA		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.560_564delTTCAT	10.37:g.127548457_127548461delATGAA	ENSP00000284690:p.Ile187fs		Somatic				DHX32_uc001ljg.1_Frame_Shift_Del_p.I187fs|DHX32_uc009yam.1_Frame_Shift_Del_p.I23fs	p.I187fs	NM_018180	NP_060650	WXS	Illumina HiSeq	Unspecified	Q7L7V1	DHX32_HUMAN			3	1051_1055	-		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)	187_188			DEAH box.|Helicase ATP-binding.		A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Frame_Shift_Del	DEL	ENST00000284690.3	37	c.560_564delTTCAT	CCDS7652.1																																																																																				0.366	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	NM_018180		9	65	NA	NA	NA	NA	NA	9	65	---	---	---	---
HSF4	3299	broad.mit.edu	37	16	67201666	67201666	+	Frame_Shift_Del	DEL	G	G	-			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr16:67201666delG	ENST00000521374.1	+	9	898	c.898delG	c.(898-900)gggfs	p.G301fs	NOL3_ENST00000432069.2_5'Flank|HSF4_ENST00000421453.1_Intron|NOL3_ENST00000564053.1_5'Flank|HSF4_ENST00000584272.1_Intron|HSF4_ENST00000264009.8_Frame_Shift_Del_p.G301fs			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	301	Interactions with DUSP26, MAPK1 and MAPK2.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.D302fs*14(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GGCCAGTCCAGGGGGGGATGG	0.647																																							uc002erl.1		NA																	1	Insertion - Frameshift(1)		large_intestine(1)		0						c.(898-900)GGGfs		heat shock transcription factor 4 isoform b			,	24,3552		3,18,1767	12.0	18.0	16.0		,	3.6	1.0	16		16	40,7768		2,36,3866	no	intron,frameshift	HSF4	NM_001538.3,NM_001040667.2	,	5,54,5633	A1A1,A1R,RR		0.5123,0.6711,0.5622	,	,	67201666	64,11320	1879	4088	5967	SO:0001589	frameshift_variant	3299				response to stress	nucleus	sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr16:67201666delG	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.898delG	16.37:g.67201666delG	ENSP00000430947:p.Gly301fs		Somatic				HSF4_uc002erm.1_Intron|HSF4_uc002ern.1_Intron|HSF4_uc010cec.1_Intron|NOL3_uc010vjc.1_5'Flank	p.G300fs	NM_001040667	NP_001035757	WXS	Illumina HiSeq	Unspecified	Q9ULV5	HSF4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)	11	1863	+		Ovarian(137;0.0563)	300			Interactions with DUSP26, MAPK1 and MAPK2.		Q99472|Q9ULV6	Frame_Shift_Del	DEL	ENST00000521374.1	37	c.898delG	CCDS42175.1																																																																																				0.647	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
MSL1	339287	broad.mit.edu	37	17	38290535	38290535	+	Frame_Shift_Del	DEL	T	T	-			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr17:38290535delT	ENST00000398532.4	+	9	2073	c.1758delT	c.(1756-1758)aatfs	p.N586fs	MSL1_ENST00000579565.1_Frame_Shift_Del_p.N323fs|MSL1_ENST00000578648.1_Frame_Shift_Del_p.N570fs	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	586	Sufficient for interaction with MSL3 MRG domain.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						TTGCCAGGAATTTTGAGCTAC	0.463																																							uc002hub.2		NA																	0					0						c.(1153-1155)AATfs		hampin							50.0	52.0	51.0					17																	38290535		1913	4115	6028	SO:0001589	frameshift_variant	339287				histone H4-K16 acetylation	MSL complex		g.chr17:38290535delT		CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.1758delT	17.37:g.38290535delT	ENSP00000381543:p.Asn586fs		Somatic				MSL1_uc002hua.3_Frame_Shift_Del_p.N323fs|MSL1_uc002hud.2_Frame_Shift_Del_p.N125fs	p.N385fs	NM_001012241	NP_001012241	WXS	Illumina HiSeq	Unspecified	Q68DK7	MSL1_HUMAN			9	1174	+			586					Q0VF46|Q69Z03	Frame_Shift_Del	DEL	ENST00000398532.4	37	c.1155delT																																																																																					0.463	MSL1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000447409.2	NM_001012241		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
PRR12	57479	broad.mit.edu	37	19	50098807	50098808	+	Frame_Shift_Ins	INS	-	-	C			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr19:50098807_50098808insC	ENST00000418929.2	+	4	1227_1228	c.1215_1216insC	c.(1216-1218)cccfs	p.P406fs		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GTGCCACCAGGCCCCCCCCACC	0.688																																							uc002poo.3		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1213-1218)AGGCCCfs		proline rich 12																																				SO:0001589	frameshift_variant	57479						DNA binding	g.chr19:50098807_50098808insC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.1223dupC	19.37:g.50098815_50098815dupC	ENSP00000394510:p.Pro406fs		Somatic					p.R405fs	NM_020719	NP_065770	WXS	Illumina HiSeq	Unspecified	Q9ULL5	PRR12_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)	4	1215_1216	+		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment_146					E9PB06|Q8N4J6	Frame_Shift_Ins	INS	ENST00000418929.2	37	c.1215_1216insC	CCDS46143.1																																																																																				0.688	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
RICTOR	253260	broad.mit.edu	37	5	38942422	38942423	+	Frame_Shift_Ins	INS	-	-	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:38942422_38942423insT	ENST00000357387.3	-	38	5140_5141	c.5110_5111insA	c.(5110-5112)acafs	p.T1704fs	RICTOR_ENST00000296782.5_Frame_Shift_Ins_p.T1728fs	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TTCAGCAGATGTATCAACTATA	0.347																																							uc003jlp.2		NA																	0				ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10						c.(5110-5112)ACAfs		rapamycin-insensitive companion of mTOR																																				SO:0001589	frameshift_variant	253260				actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding	g.chr5:38942422_38942423insT		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.5111dupA	5.37:g.38942423_38942423dupT	ENSP00000349959:p.Thr1704fs		Somatic				RICTOR_uc003jlo.2_Frame_Shift_Ins_p.T1728fs|RICTOR_uc010ivf.2_Frame_Shift_Ins_p.T1381fs	p.T1704fs	NM_152756	NP_689969	WXS	Illumina HiSeq	Unspecified	Q6R327	RICTR_HUMAN			38	5134_5135	-	all_lung(31;0.000396)		1704						Frame_Shift_Ins	INS	ENST00000357387.3	37	c.5110_5111insA	CCDS34148.1																																																																																				0.347	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		14	209	NA	NA	NA	NA	NA	14	209	---	---	---	---
C6	729	broad.mit.edu	37	5	41201800	41201801	+	Frame_Shift_Ins	INS	-	-	A			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr5:41201800_41201801insA	ENST00000263413.3	-	3	423_424	c.159_160insT	c.(157-162)gataagfs	p.K54fs	C6_ENST00000337836.5_Frame_Shift_Ins_p.K54fs	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	54	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TGGTAGTACTTATCTACTACTA	0.391																																							uc003jmk.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(157-162)GATAAGfs		complement component 6 precursor																																				SO:0001589	frameshift_variant	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41201800_41201801insA	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.160dupT	5.37:g.41201801_41201801dupA	ENSP00000263413:p.Lys54fs		Somatic				C6_uc003jml.1_Frame_Shift_Ins_p.D53fs	p.D53fs	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			3	369_370	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	53_54			TSP type-1 1.			Frame_Shift_Ins	INS	ENST00000263413.3	37	c.159_160insT	CCDS3936.1																																																																																				0.391	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			41	94	NA	NA	NA	NA	NA	41	94	---	---	---	---
MTAP	4507	broad.mit.edu	37	9	21816764	21816765	+	Frame_Shift_Ins	INS	-	-	T			TCGA-93-7347-01A-11D-2184-08	TCGA-93-7347-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	98ed5f8c-bc0b-47ac-aee7-456fda144cb2	4b1d71f3-ddc2-47c7-9b49-4c92b6cfb713	g.chr9:21816764_21816765insT	ENST00000460874.2	+	3	448_449	c.223_224insT	c.(223-225)cttfs	p.L75fs	RP11-145E5.5_ENST00000404796.2_Frame_Shift_Ins_p.L58fs|MTAP_ENST00000427788.2_3'UTR|MTAP_ENST00000580900.1_Frame_Shift_Ins_p.L58fs|MTAP_ENST00000380172.4_Frame_Shift_Ins_p.L58fs					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		TTGCGTCCTCCTTGCAAGGTAT	0.322																																							uc003zph.2		NA																	2	Whole gene deletion(2)		lung(2)	central_nervous_system(1)	1						c.(172-174)CTTfs		5'-methylthioadenosine phosphorylase	Adenine(DB00173)																																			SO:0001589	frameshift_variant	4507				nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity	g.chr9:21816764_21816765insT	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.225dupT	9.37:g.21816766_21816766dupT	ENSP00000461932:p.Leu75fs		Somatic				MTAP_uc003zpi.1_Frame_Shift_Ins_p.L58fs|MTAP_uc010mit.2_RNA|MTAP_uc011lnk.1_Frame_Shift_Ins_p.L75fs|MTAP_uc011lnl.1_5'Flank	p.L58fs	NM_002451	NP_002442	WXS	Illumina HiSeq	Unspecified	Q13126	MTAP_HUMAN		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	3	285_286	+		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)	58						Frame_Shift_Ins	INS	ENST00000460874.2	37	c.172_173insT																																																																																					0.322	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000051929.2	NM_002451		57	218	NA	NA	NA	NA	NA	57	218	---	---	---	---
