#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
UBE4B	10277	broad.mit.edu	37	1	10197176	10197176	+	Missense_Mutation	SNP	T	T	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:10197176T>G	ENST00000253251.8	+	16	2728	c.1889T>G	c.(1888-1890)tTt>tGt	p.F630C	UBE4B_ENST00000343090.6_Missense_Mutation_p.F759C|UBE4B_ENST00000377157.3_Missense_Mutation_p.F514C					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GAGTGCTTCTTTCTCACCCTG	0.468																																							uc001aqs.3		NA																	0				ovary(2)|skin(2)	4						c.(2275-2277)TTT>TGT		ubiquitination factor E4B isoform 1							161.0	141.0	148.0					1																	10197176		2203	4300	6503	SO:0001583	missense	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10197176T>G	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1889T>G	1.37:g.10197176T>G	ENSP00000253251:p.Phe630Cys		Somatic				UBE4B_uc001aqr.3_Missense_Mutation_p.F630C|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Missense_Mutation_p.F214C|UBE4B_uc001aqt.1_Missense_Mutation_p.F99C	p.F759C	NM_001105562	NP_001099032	WXS	Illumina HiSeq	Unspecified	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	17	2989	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	759						Missense_Mutation	SNP	ENST00000253251.8	37	c.2276T>G	CCDS110.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.627974	0.87560	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.56275	0.47;0.47;0.47	5.71	4.59	0.56863	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.76586	0.4008	M	0.91354	3.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.80686	-0.1272	10	0.87932	D	0	-16.2944	11.6625	0.51356	0.0:0.0693:0.0:0.9307	.	630;759;630	A8K8S9;O95155;O95155-2	.;UBE4B_HUMAN;.	C	630;514;759	ENSP00000253251:F630C;ENSP00000366362:F514C;ENSP00000343001:F759C	ENSP00000253251:F630C	F	+	2	0	UBE4B	10119763	1.000000	0.71417	0.899000	0.35326	0.976000	0.68499	7.991000	0.88244	1.007000	0.39238	0.533000	0.62120	TTT		0.468	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		9	94	0	0	0	0.004482	0	9	94				
KIAA0754	643314	broad.mit.edu	37	1	39877931	39877931	+	Nonsense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:39877931C>G	ENST00000530275.1	+	1	1781	c.1586C>G	c.(1585-1587)tCa>tGa	p.S529*	MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000289893.4_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	529										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATGTTACCTCAGGACCTGAA	0.393																																							uc009vvt.1		NA																	0					0						c.(1993-1995)TCA>TGA		hypothetical protein LOC643314							185.0	176.0	179.0					1																	39877931		1885	4119	6004	SO:0001587	stop_gained	643314							g.chr1:39877931C>G			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1586C>G	1.37:g.39877931C>G	ENSP00000431179:p.Ser529*		Somatic				MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	p.S665*	NM_015038	NP_055853	WXS	Illumina HiSeq	Unspecified	O94854	K0754_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		1	2756	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	529					E9PMC2|Q6ZSB2	Nonsense_Mutation	SNP	ENST00000530275.1	37	c.1994C>G		.	.	.	.	.	.	.	.	.	.	C	38	6.869734	0.97901	.	.	ENSG00000255103	ENST00000530275	.	.	.	5.41	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.9134	0.41419	0.0:0.8926:0.0:0.1074	.	.	.	.	X	529	.	ENSP00000431179:S529X	S	+	2	0	RP4-562N20.1	39650518	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.470000	0.45119	2.543000	0.85770	0.655000	0.94253	TCA		0.393	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038		7	143	0	0	0	0.004482	0	7	143				
COL11A1	1301	broad.mit.edu	37	1	103355112	103355112	+	Missense_Mutation	SNP	G	G	A	rs184965786		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:103355112G>A	ENST00000370096.3	-	59	4675	c.4363C>T	c.(4363-4365)Cct>Tct	p.P1455S	COL11A1_ENST00000358392.2_Missense_Mutation_p.P1467S|COL11A1_ENST00000512756.1_Missense_Mutation_p.P1339S|COL11A1_ENST00000353414.4_Missense_Mutation_p.P1416S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1455	Collagen-like 7.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATTAAACCAGGATGTCCCTTT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		13097	0.001		0.0	False		,,,				2504	0.0						uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(4363-4365)CCT>TCT		alpha 1 type XI collagen isoform A							55.0	51.0	52.0					1																	103355112		2203	4299	6502	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103355112G>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4363C>T	1.37:g.103355112G>A	ENSP00000359114:p.Pro1455Ser		Somatic				COL11A1_uc001duk.2_Missense_Mutation_p.P651S|COL11A1_uc001dum.2_Missense_Mutation_p.P1467S|COL11A1_uc001dun.2_Missense_Mutation_p.P1416S|COL11A1_uc009weh.2_Missense_Mutation_p.P1339S	p.P1455S	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	59	4681	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1455			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.4363C>T	CCDS778.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.38	3.611560	0.66558	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.97614	0.9218	M	0.68593	2.085	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.999;0.998	D	0.97317	0.9941	10	0.48119	T	0.1	.	19.3074	0.94169	0.0:0.0:1.0:0.0	.	1339;1416;1467;1455;675	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1455;1467;1416;675;1339	ENSP00000359114:P1455S;ENSP00000351163:P1467S;ENSP00000302551:P1416S;ENSP00000426533:P1339S	ENSP00000302551:P1416S	P	-	1	0	COL11A1	103127700	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.560000	0.86352	0.563000	0.77884	CCT		0.388	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		3	45	0	0	0	0.004672	0	3	45				
NTNG1	22854	broad.mit.edu	37	1	107937934	107937934	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:107937934G>A	ENST00000370068.1	+	4	1892	c.1046G>A	c.(1045-1047)gGc>gAc	p.G349D	NTNG1_ENST00000370061.3_Missense_Mutation_p.G349D|NTNG1_ENST00000370073.2_Missense_Mutation_p.G349D|NTNG1_ENST00000370072.3_Missense_Mutation_p.G349D|NTNG1_ENST00000370065.1_Missense_Mutation_p.G349D|NTNG1_ENST00000370067.1_Missense_Mutation_p.G349D|NTNG1_ENST00000370070.2_Missense_Mutation_p.G349D|NTNG1_ENST00000542803.1_Missense_Mutation_p.G349D|NTNG1_ENST00000370066.1_Missense_Mutation_p.G349D|NTNG1_ENST00000370074.4_Missense_Mutation_p.G349D|NTNG1_ENST00000370071.2_Missense_Mutation_p.G349D			Q9Y2I2	NTNG1_HUMAN	netrin G1	349	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		ATCCCCAAAGGCACTGCAAAT	0.448																																							uc001dvh.3		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(1045-1047)GGC>GAC		netrin G1 isoform 1							148.0	149.0	148.0					1																	107937934		2203	4300	6503	SO:0001583	missense	22854				axonogenesis	anchored to plasma membrane	protein binding	g.chr1:107937934G>A	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1046G>A	1.37:g.107937934G>A	ENSP00000359085:p.Gly349Asp		Somatic				NTNG1_uc001dvf.3_Missense_Mutation_p.G349D|NTNG1_uc010out.1_Missense_Mutation_p.G349D|NTNG1_uc001dvc.3_Missense_Mutation_p.G349D|NTNG1_uc001dvi.2_5'UTR|NTNG1_uc001dve.2_RNA|NTNG1_uc009wek.2_RNA|NTNG1_uc001dvg.2_RNA|NTNG1_uc009wem.2_Silent_p.R21R|NTNG1_uc001dvd.1_Missense_Mutation_p.G349D	p.G349D	NM_001113226	NP_001106697	WXS	Illumina HiSeq	Unspecified	Q9Y2I2	NTNG1_HUMAN		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)	4	1764	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	349			Laminin EGF-like 1.		Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	c.1046G>A	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673898	0.88445	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370064;ENST00000370062;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.74106	0.74;-0.36;0.64;0.1;0.01;-0.57;-0.81;0.74;-0.56;-0.36;0.12	5.8	5.8	0.92144	EGF-like, laminin (2);	0.000000	0.64402	D	0.000007	T	0.76263	0.3963	L	0.42744	1.35	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.984;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.99;1.0;1.0	T	0.68618	-0.5361	10	0.11485	T	0.65	.	20.0637	0.97700	0.0:0.0:1.0:0.0	.	349;349;349;349;349	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	D	349;349;349;349;349;349;349;349;110;110;349;349;349;349;349;349	ENSP00000359090:G349D;ENSP00000359088:G349D;ENSP00000440561:G349D;ENSP00000359078:G349D;ENSP00000359089:G349D;ENSP00000359087:G349D;ENSP00000359091:G349D;ENSP00000359085:G349D;ENSP00000359084:G349D;ENSP00000359083:G349D;ENSP00000359082:G349D	ENSP00000294649:G349D	G	+	2	0	NTNG1	107739457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.751000	0.94390	0.650000	0.86243	GGC		0.448	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917		21	84	0	0	0	0.008871	0	21	84				
ITGA10	8515	broad.mit.edu	37	1	145534172	145534172	+	Silent	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:145534172G>A	ENST00000369304.3	+	14	1852	c.1677G>A	c.(1675-1677)ctG>ctA	p.L559L	ITGA10_ENST00000538811.1_Silent_p.L428L|ITGA10_ENST00000539363.1_Silent_p.L416L	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	559					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTCCTGATCTGAACCAAGATG	0.582																																							uc001eoa.2		NA																	0				lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8						c.(1675-1677)CTG>CTA		integrin, alpha 10 precursor							121.0	129.0	126.0					1																	145534172		2203	4300	6503	SO:0001819	synonymous_variant	8515				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity	g.chr1:145534172G>A	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1677G>A	1.37:g.145534172G>A			Somatic				NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Silent_p.L428L|ITGA10_uc009wiw.2_Silent_p.L416L|ITGA10_uc010oyw.1_Silent_p.L504L	p.L559L	NM_003637	NP_003628	WXS	Illumina HiSeq	Unspecified	O75578	ITA10_HUMAN			14	1753	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		559			Potential.|Extracellular (Potential).|FG-GAP 6.		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Silent	SNP	ENST00000369304.3	37	c.1677G>A	CCDS918.1																																																																																				0.582	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		10	180	0	0	0	0.010729	0	10	180				
FLG	2312	broad.mit.edu	37	1	152282874	152282874	+	Missense_Mutation	SNP	G	G	C	rs374409476		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:152282874G>C	ENST00000368799.1	-	3	4523	c.4488C>G	c.(4486-4488)agC>agG	p.S1496R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1496	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTCCTCTGCTTGACCCCG	0.577									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(4486-4488)AGC>AGG		filaggrin		G	ARG/SER	0,4406		0,0,2203	384.0	371.0	375.0		4488	-1.7	0.0	1		375	1,8599		0,1,4299	no	missense	FLG	NM_002016.1	110	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging	1496/4062	152282874	1,13005	2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152282874G>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4488C>G	1.37:g.152282874G>C	ENSP00000357789:p.Ser1496Arg		Somatic					p.S1496R	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4524	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1496			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.4488C>G	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	7.109	0.575690	0.13623	0.0	1.16E-4	ENSG00000143631	ENST00000368799	T	0.03745	3.82	2.23	-1.74	0.08056	.	.	.	.	.	T	0.00815	0.0027	L	0.35341	1.055	0.09310	N	1	P	0.36647	0.563	B	0.34931	0.192	T	0.45920	-0.9228	9	0.33940	T	0.23	.	2.1579	0.03818	0.3322:0.0:0.343:0.3248	.	1496	P20930	FILA_HUMAN	R	1496	ENSP00000357789:S1496R	ENSP00000357789:S1496R	S	-	3	2	FLG	150549498	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-2.258000	0.01179	-0.397000	0.07691	0.485000	0.47835	AGC		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		220	475	0	0	0	0.01441	0	220	475				
SLC30A1	7779	broad.mit.edu	37	1	211749082	211749082	+	Missense_Mutation	SNP	T	T	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:211749082T>C	ENST00000367001.4	-	2	1301	c.1172A>G	c.(1171-1173)gAa>gGa	p.E391G		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	391					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TGTTGGATCTTCACATTTTAT	0.388																																							uc001hio.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1171-1173)GAA>GGA		solute carrier family 30 (zinc transporter),							91.0	86.0	87.0					1																	211749082		2203	4300	6503	SO:0001583	missense	7779				cadmium ion transmembrane transport|cellular calcium ion homeostasis|cellular zinc ion homeostasis|negative regulation of calcium ion import|negative regulation of neurotransmitter secretion|negative regulation of zinc ion import	integral to membrane|T-tubule	calcium channel inhibitor activity|zinc ion transmembrane transporter activity	g.chr1:211749082T>C	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1172A>G	1.37:g.211749082T>C	ENSP00000355968:p.Glu391Gly		Somatic					p.E391G	NM_021194	NP_067017	WXS	Illumina HiSeq	Unspecified	Q9Y6M5	ZNT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)	2	1317	-			391			Cytoplasmic (Potential).		Q0VAK9|Q9BZF6	Missense_Mutation	SNP	ENST00000367001.4	37	c.1172A>G	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.240148	0.39598	.	.	ENSG00000170385	ENST00000367001	T	0.55234	0.53	5.69	3.37	0.38596	.	0.352028	0.32459	N	0.006073	T	0.36468	0.0968	L	0.33245	0.995	0.36297	D	0.85675	B	0.12630	0.006	B	0.10450	0.005	T	0.29027	-1.0025	10	0.26408	T	0.33	-12.1967	7.0255	0.24938	0.0:0.14:0.1328:0.7272	.	391	Q9Y6M5	ZNT1_HUMAN	G	391	ENSP00000355968:E391G	ENSP00000355968:E391G	E	-	2	0	SLC30A1	209815705	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	3.372000	0.52387	1.000000	0.39049	0.460000	0.39030	GAA		0.388	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2			3	65	0	0	0	0.004672	0	3	65				
USH2A	7399	broad.mit.edu	37	1	216251437	216251437	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:216251437C>G	ENST00000307340.3	-	27	5952	c.5566G>C	c.(5566-5568)Gaa>Caa	p.E1856Q	RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.E1856Q|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1856	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTACCTTGTTCCAAACACAAA	0.458										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(5566-5568)GAA>CAA		usherin isoform B							72.0	77.0	76.0					1																	216251437		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216251437C>G	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5566G>C	1.37:g.216251437C>G	ENSP00000305941:p.Glu1856Gln	HNSCC(13;0.011)	Somatic					p.E1856Q	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	27	5953	-			1856			Laminin G-like 2.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.5566G>C	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.477168	0.84640	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77750	-1.12;-1.12	5.01	5.01	0.66863	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.44902	D	0.000405	T	0.69296	0.3095	N	0.24115	0.695	0.28344	N	0.921197	P	0.47034	0.889	P	0.46758	0.526	T	0.63171	-0.6697	10	0.21540	T	0.41	.	13.9863	0.64337	0.0:0.8483:0.1517:0.0	.	1856	O75445	USH2A_HUMAN	Q	1856	ENSP00000305941:E1856Q;ENSP00000355910:E1856Q	ENSP00000305941:E1856Q	E	-	1	0	USH2A	214318060	0.679000	0.27596	0.451000	0.26982	0.934000	0.57294	1.073000	0.30691	2.338000	0.79540	0.650000	0.86243	GAA		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		6	88	0	0	0	0.001984	0	6	88				
HHIPL2	79802	broad.mit.edu	37	1	222715378	222715378	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:222715378C>A	ENST00000343410.6	-	3	1152	c.1094G>T	c.(1093-1095)gGc>gTc	p.G365V		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	365					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		TCCAAACAGGCCAAAGGGATC	0.537																																							uc001hnh.1		NA																	0				ovary(1)	1						c.(1093-1095)GGC>GTC		HHIP-like 2 precursor							65.0	65.0	65.0					1																	222715378		2203	4300	6503	SO:0001583	missense	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222715378C>A	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1094G>T	1.37:g.222715378C>A	ENSP00000342118:p.Gly365Val		Somatic					p.G365V	NM_024746	NP_079022	WXS	Illumina HiSeq	Unspecified	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	3	1152	-			365					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	c.1094G>T	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321459	0.81580	.	.	ENSG00000143512	ENST00000343410	T	0.10763	2.84	5.63	5.63	0.86233	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.098032	0.64402	D	0.000002	T	0.39253	0.1071	M	0.83603	2.65	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.22103	-1.0226	10	0.62326	D	0.03	-16.2511	19.2507	0.93923	0.0:1.0:0.0:0.0	.	365	Q6UWX4	HIPL2_HUMAN	V	365	ENSP00000342118:G365V	ENSP00000342118:G365V	G	-	2	0	HHIPL2	220782001	1.000000	0.71417	0.997000	0.53966	0.641000	0.38312	7.363000	0.79516	2.623000	0.88846	0.591000	0.81541	GGC		0.537	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		20	51	1	0	4.54149e-19	0.014323	6.34094e-19	20	51				
CNST	163882	broad.mit.edu	37	1	246810486	246810486	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr1:246810486A>G	ENST00000366513.4	+	9	1252	c.983A>G	c.(982-984)cAt>cGt	p.H328R	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Missense_Mutation_p.H328R	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	328					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						GAAAGCCAACATACAGTGGAG	0.433											OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ibp.2		NA																	0					0						c.(982-984)CAT>CGT		hypothetical protein LOC163882 isoform 1							74.0	78.0	77.0					1																	246810486		2203	4300	6503	SO:0001583	missense	163882				positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding	g.chr1:246810486A>G	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.983A>G	1.37:g.246810486A>G	ENSP00000355470:p.His328Arg		Somatic	OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2468	CNST_uc001ibo.3_Missense_Mutation_p.H328R	p.H328R	NM_152609	NP_689822	WXS	Illumina HiSeq	Unspecified	Q6PJW8	CNST_HUMAN			9	1361	+			328					Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	37	c.983A>G	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	A	1.187	-0.636384	0.03557	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.19806	2.15;2.12	5.26	-2.22	0.06952	.	0.835710	0.10670	N	0.647679	T	0.11110	0.0271	N	0.20986	0.625	0.21950	N	0.999455	B;B	0.06786	0.001;0.001	B;B	0.09377	0.001;0.004	T	0.40664	-0.9551	10	0.13470	T	0.59	-6.3699	8.5186	0.33262	0.4777:0.3927:0.1296:0.0	.	328;328	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	R	328	ENSP00000355470:H328R;ENSP00000355469:H328R	ENSP00000355469:H328R	H	+	2	0	CNST	244877109	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.976000	0.03786	-0.508000	0.06540	-1.773000	0.00660	CAT		0.433	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609		19	90	0	0	0	0.014323	0	19	90				
FAM171A1	221061	broad.mit.edu	37	10	15256140	15256140	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr10:15256140C>G	ENST00000378116.4	-	8	1453	c.1447G>C	c.(1447-1449)Gat>Cat	p.D483H	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	483						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CTGTAGTCATCATTGCCCGAG	0.483																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1447-1449)GAT>CAT		hypothetical protein LOC221061 precursor							126.0	107.0	113.0					10																	15256140		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15256140C>G	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1447G>C	10.37:g.15256140C>G	ENSP00000367356:p.Asp483His		Somatic					p.D483H	NM_001010924	NP_001010924	WXS	Illumina HiSeq	Unspecified	Q5VUB5	F1711_HUMAN			8	1454	-			483			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.1447G>C	CCDS31154.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.874|3.874	-0.027237|-0.027237	0.07589|0.07589	.|.	.|.	ENSG00000148468|ENSG00000148468	ENST00000378116|ENST00000396781	T|.	0.34667|.	1.35|.	5.25|5.25	2.22|2.22	0.28083|0.28083	.|.	0.813268|.	0.11427|.	N|.	0.565243|.	T|T	0.38161|0.38161	0.1030|0.1030	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	B|.	0.33826|.	0.427|.	B|.	0.38842|.	0.283|.	T|T	0.26467|0.26467	-1.0102|-1.0102	10|6	0.66056|0.18276	D|T	0.02|0.48	-0.8277|-0.8277	7.3007|7.3007	0.26418|0.26418	0.0:0.692:0.0:0.308|0.0:0.692:0.0:0.308	.|.	483|.	Q5VUB5|.	F1711_HUMAN|.	H|I	483|482	ENSP00000367356:D483H|.	ENSP00000367356:D483H|ENSP00000380001:M482I	D|M	-|-	1|3	0|0	FAM171A1|FAM171A1	15296146|15296146	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.058000|0.058000	0.15608|0.15608	-0.109000|-0.109000	0.10840|0.10840	0.272000|0.272000	0.22027|0.22027	0.563000|0.563000	0.77884|0.77884	GAT|ATG		0.483	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		15	83	0	0	0	0.00245	0	15	83				
CCNY	219771	broad.mit.edu	37	10	35842027	35842027	+	Silent	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr10:35842027C>T	ENST00000374704.4	+	8	840	c.660C>T	c.(658-660)atC>atT	p.I220I	CCNY_ENST00000374706.1_Silent_p.I166I|CCNY_ENST00000265375.9_Silent_p.I166I|CCNY_ENST00000492478.1_3'UTR|CCNY_ENST00000339497.5_Silent_p.I195I	NM_145012.4	NP_659449.3	Q8ND76	CCNY_HUMAN	cyclin Y	220	Cyclin N-terminal.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	8						TAGGGGCGATCCTGCTGGCCT	0.512																																							uc001iyw.3		NA																	0					0						c.(658-660)ATC>ATT		cyclin Y isoform 1							128.0	129.0	129.0					10																	35842027		2203	4300	6503	SO:0001819	synonymous_variant	219771				cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding	g.chr10:35842027C>T	AF413522, AY504868	CCDS7189.1, CCDS7190.1, CCDS60513.1	10p11.22	2011-01-25	2007-02-09	2007-02-09	ENSG00000108100	ENSG00000108100			23354	protein-coding gene	gene with protein product		612786	"""chromosome 10 open reading frame 9"""	C10orf9		20441050	Standard	XM_005252388		Approved	CFP1, CBCP1	uc001iyw.4	Q8ND76	OTTHUMG00000017955	ENST00000374704.4:c.660C>T	10.37:g.35842027C>T			Somatic				CCNY_uc001iyu.3_Silent_p.I166I|CCNY_uc001iyv.3_Silent_p.I166I|CCNY_uc001iyx.3_Silent_p.I166I|CCNY_uc009xmb.2_Silent_p.I195I|CCNY_uc010qet.1_Silent_p.I87I	p.I220I	NM_145012	NP_659449	WXS	Illumina HiSeq	Unspecified	Q8ND76	CCNY_HUMAN			8	840	+			220			Cyclin N-terminal.		B7ZKX9|D3DRY9|Q2M3V4|Q2TU96|Q6NT86|Q7Z4U7|Q8TEX2|Q8TEX3|Q96M99|Q96P45	Silent	SNP	ENST00000374704.4	37	c.660C>T	CCDS7189.1																																																																																				0.512	CCNY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047568.2	NM_181698		8	83	0	0	0	0.00308	0	8	83				
NEURL1	9148	broad.mit.edu	37	10	105350046	105350046	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr10:105350046C>T	ENST00000369780.4	+	6	2051	c.1642C>T	c.(1642-1644)Cgc>Tgc	p.R548C	NEURL_ENST00000369777.2_Missense_Mutation_p.R531C|SH3PXD2A_ENST00000427662.2_Intron	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		548					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTGTGGCCTGCGCCTCAAGAA	0.622																																							uc001kxh.2		NA																	0					0						c.(1642-1644)CGC>TGC		neuralized-like							97.0	74.0	82.0					10																	105350046		2203	4300	6503	SO:0001583	missense	9148				nervous system development	perinuclear region of cytoplasm	zinc ion binding	g.chr10:105350046C>T																												ENST00000369780.4:c.1642C>T	10.37:g.105350046C>T	ENSP00000358795:p.Arg548Cys		Somatic				SH3PXD2A_uc010qqr.1_Intron	p.R548C	NM_004210	NP_004201	WXS	Illumina HiSeq	Unspecified	O76050	NEU1A_HUMAN		Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)	6	2052	+			548			RING-type.		Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	c.1642C>T	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581806	0.86748	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	T;T	0.80304	-1.36;-1.36	5.84	4.88	0.63580	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.122569	0.53938	D	0.000057	D	0.87665	0.6234	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	P	0.60609	0.877	D	0.88693	0.3210	10	0.87932	D	0	-29.6281	12.217	0.54412	0.3274:0.6726:0.0:0.0	.	548	O76050	NEU1A_HUMAN	C	548;531	ENSP00000358795:R548C;ENSP00000358792:R531C	ENSP00000358792:R531C	R	+	1	0	NEURL	105340036	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.979000	0.56888	2.768000	0.95171	0.561000	0.74099	CGC		0.622	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			7	40	0	0	0	0.001984	0	7	40				
CFAP58	159686	broad.mit.edu	37	10	106121912	106121912	+	Silent	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr10:106121912A>T	ENST00000369704.3	+	3	557	c.423A>T	c.(421-423)tcA>tcT	p.S141S	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		141						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CTGGACTGTCAATGGACCAGC	0.488																																							uc001kyh.2		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(421-423)TCA>TCT		coiled-coil domain containing 147							168.0	156.0	160.0					10																	106121912		2203	4300	6503	SO:0001819	synonymous_variant	159686							g.chr10:106121912A>T																												ENST00000369704.3:c.423A>T	10.37:g.106121912A>T			Somatic					p.S141S	NM_001008723	NP_001008723	WXS	Illumina HiSeq	Unspecified	Q5T655	CC147_HUMAN		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)	3	557	+		Colorectal(252;0.103)|Breast(234;0.122)	141			Potential.		D3DRA6|Q8NA27	Silent	SNP	ENST00000369704.3	37	c.423A>T	CCDS31282.1																																																																																				0.488	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1			3	8	0	0	0	0.004672	0	3	8				
ZNF511	118472	broad.mit.edu	37	10	135125252	135125252	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr10:135125252G>T	ENST00000359035.3	+	5	590	c.587G>T	c.(586-588)gGa>gTa	p.G196V	TUBGCP2_ENST00000368563.2_5'Flank|TUBGCP2_ENST00000417178.2_5'Flank|TUBGCP2_ENST00000470829.1_5'Flank|ZNF511_ENST00000361518.5_Missense_Mutation_p.G196V|ZNF511_ENST00000463816.2_3'UTR|ZNF511_ENST00000368554.4_Missense_Mutation_p.G131V			Q8NB15	ZN511_HUMAN	zinc finger protein 511	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		GGGGACAGTGGAGAGCGGTCA	0.627																																							uc001lml.1		NA																	0					0						c.(586-588)GGA>GTA		SubName: Full=cDNA FLJ78327; SubName: Full=Zinc finger protein 511, isoform CRA_d;							62.0	63.0	63.0					10																	135125252		2203	4300	6503	SO:0001583	missense	118472				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:135125252G>T	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.587G>T	10.37:g.135125252G>T	ENSP00000351929:p.Gly196Val		Somatic				TUBGCP2_uc001lmg.1_5'Flank|TUBGCP2_uc010qvc.1_5'Flank|TUBGCP2_uc009ybk.1_5'Flank|TUBGCP2_uc010qvd.1_5'Flank|TUBGCP2_uc001lmh.1_RNA|ZNF511_uc001lmj.1_Missense_Mutation_p.G196V|ZNF511_uc001lmk.1_Missense_Mutation_p.W176C|ZNF511_uc001lmm.1_RNA	p.G196V			WXS	Illumina HiSeq	Unspecified	Q8NB15	ZN511_HUMAN		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)	5	612	+		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	196					A8K8L5|Q8WUP1|Q96BV2	Missense_Mutation	SNP	ENST00000359035.3	37	c.587G>T		.	.	.	.	.	.	.	.	.	.	G	5.397	0.258491	0.10239	.	.	ENSG00000198546	ENST00000361518;ENST00000359035;ENST00000368554	D;D;D	0.88046	-2.33;-2.32;-2.32	4.09	3.17	0.36434	.	1.396020	0.04555	N	0.390647	D	0.83552	0.5279	M	0.62723	1.935	0.09310	N	1	P;B	0.42518	0.782;0.418	B;B	0.37304	0.246;0.122	T	0.70278	-0.4916	10	0.11182	T	0.66	-18.8145	8.761	0.34674	0.1109:0.0:0.8891:0.0	.	196;196	Q8NB15;Q8NB15-2	ZN511_HUMAN;.	V	196;196;131	ENSP00000355251:G196V;ENSP00000351929:G196V;ENSP00000357542:G131V	ENSP00000351929:G196V	G	+	2	0	ZNF511	134975242	0.027000	0.19231	0.004000	0.12327	0.008000	0.06430	0.180000	0.16860	2.213000	0.71641	0.655000	0.94253	GGA		0.627	ZNF511-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051143.1	NM_145806		10	62	1	0	0.000673444	0.008291	0.000743804	10	62				
TH	7054	broad.mit.edu	37	11	2189733	2189733	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:2189733C>A	ENST00000381178.1	-	4	586	c.568G>T	c.(568-570)Gcg>Tcg	p.A190S	TH_ENST00000333684.5_Missense_Mutation_p.A163S|TH_ENST00000352909.3_Missense_Mutation_p.A159S|TH_ENST00000381175.1_Missense_Mutation_p.A186S	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	190					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	TTGGGCCCCGCGGGGCTGCGC	0.687																																							uc001lvq.2		NA																	0					0						c.(568-570)GCG>TCG		tyrosine hydroxylase isoform a	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)						14.0	16.0	15.0					11																	2189733		2148	4208	6356	SO:0001583	missense	7054				dopamine biosynthetic process from tyrosine|embryonic camera-type eye morphogenesis|epinephrine biosynthetic process|eye photoreceptor cell development|heart morphogenesis|hormone biosynthetic process|learning|locomotory behavior|memory|neurotransmitter biosynthetic process|neurotransmitter secretion|norepinephrine biosynthetic process|pigmentation|regulation of heart contraction|response to ethanol|response to hypoxia|synaptic transmission, dopaminergic|visual perception	cytosol|internal side of plasma membrane|melanosome membrane|nucleus|perikaryon|smooth endoplasmic reticulum	protein binding|tyrosine 3-monooxygenase activity	g.chr11:2189733C>A	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.568G>T	11.37:g.2189733C>A	ENSP00000370571:p.Ala190Ser		Somatic				TH_uc001lvp.2_Missense_Mutation_p.A186S|TH_uc001lvr.2_Missense_Mutation_p.A159S|TH_uc010qxj.1_Missense_Mutation_p.A163S|TH_uc001lvs.2_Missense_Mutation_p.A159S|TH_uc001lvt.2_Missense_Mutation_p.A163S|TH_uc009ydh.1_5'Flank	p.A190S	NM_199292	NP_954986	WXS	Illumina HiSeq	Unspecified	P07101	TY3H_HUMAN	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	4	587	-		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	190					B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	ENST00000381178.1	37	c.568G>T	CCDS7731.1	.	.	.	.	.	.	.	.	.	.	C	4.876	0.162805	0.09287	.	.	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.99436	-5.9;-5.9;-5.89;-5.56	3.67	-7.34	0.01427	Aromatic amino acid hydroxylase, C-terminal (1);	0.778438	0.11739	U	0.534257	D	0.95233	0.8454	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.22800	0.075;0.02;0.02;0.009;0.013;0.023	B;B;B;B;B;B	0.27076	0.061;0.02;0.02;0.048;0.035;0.076	D	0.93669	0.6988	10	0.17832	T	0.49	-15.4536	7.1681	0.25702	0.0:0.1945:0.294:0.5115	.	163;163;159;159;190;186	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;.;TY3H_HUMAN;.	S	190;186;159;163	ENSP00000370571:A190S;ENSP00000370567:A186S;ENSP00000325951:A159S;ENSP00000328814:A163S	ENSP00000328814:A163S	A	-	1	0	TH	2146309	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.171000	0.16685	-1.226000	0.02574	-0.339000	0.08088	GCG		0.687	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360		3	28	1	0	0.004672	0.004672	0.00490394	3	28				
OR56B1	387748	broad.mit.edu	37	11	5758467	5758467	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:5758467G>A	ENST00000317121.3	+	1	787	c.721G>A	c.(721-723)Gaa>Aaa	p.E241K	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		GAACTCAGCTGAAGCTGCAGC	0.423																																							uc001mbt.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(721-723)GAA>AAA		olfactory receptor, family 56, subfamily B,							135.0	129.0	131.0					11																	5758467		2201	4297	6498	SO:0001583	missense	387748				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5758467G>A	BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.721G>A	11.37:g.5758467G>A	ENSP00000322939:p.Glu241Lys		Somatic				TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.E241K	NM_001005180	NP_001005180	WXS	Illumina HiSeq	Unspecified	Q8NGI3	O56B1_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)	1	721	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)	241			Cytoplasmic (Potential).		B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	ENST00000317121.3	37	c.721G>A	CCDS31395.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250328	0.39797	.	.	ENSG00000181023	ENST00000317121	T	0.00174	8.62	5.87	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.335138	0.21041	N	0.081164	T	0.00210	0.0006	L	0.35854	1.095	0.23559	N	0.997416	B	0.27316	0.175	B	0.37508	0.252	T	0.27365	-1.0076	10	0.66056	D	0.02	.	8.1113	0.30916	0.2437:0.0:0.7563:0.0	.	241	Q8NGI3	O56B1_HUMAN	K	241	ENSP00000322939:E241K	ENSP00000322939:E241K	E	+	1	0	OR56B1	5715043	0.005000	0.15991	0.707000	0.30419	0.908000	0.53690	0.698000	0.25571	0.835000	0.34877	0.655000	0.94253	GAA		0.423	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143354.1	NM_001005180		21	83	0	0	0	0.008871	0	21	83				
NELL1	4745	broad.mit.edu	37	11	21592368	21592368	+	Missense_Mutation	SNP	T	T	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:21592368T>C	ENST00000357134.5	+	18	2191	c.2039T>C	c.(2038-2040)cTa>cCa	p.L680P	NELL1_ENST00000298925.5_Missense_Mutation_p.L708P|NELL1_ENST00000325319.5_Missense_Mutation_p.L623P|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000532434.1_Missense_Mutation_p.L633P	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	680					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						AGTGCTGACCTATTCTGTTGC	0.438																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(2038-2040)CTA>CCA		nel-like 1 isoform 1 precursor							166.0	149.0	155.0					11																	21592368		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21592368T>C	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2039T>C	11.37:g.21592368T>C	ENSP00000349654:p.Leu680Pro		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.L633P|NELL1_uc009yid.2_Missense_Mutation_p.L708P|NELL1_uc010rdo.1_Missense_Mutation_p.L623P|NELL1_uc010rdp.1_Missense_Mutation_p.L393P|NELL1_uc001mqh.2_Missense_Mutation_p.L225P	p.L680P	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			18	2192	+			680			VWFC 3.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.2039T>C	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.322839	0.81580	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.79940	-1.32;-1.29;-1.21;-0.08	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000001	D	0.89357	0.6692	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	0.978;0.979;1.0;0.999;0.963	P;P;D;D;P	0.72982	0.837;0.692;0.972;0.979;0.692	D	0.87276	0.2289	10	0.23302	T	0.38	-13.6202	16.8061	0.85666	0.0:0.0:0.0:1.0	.	623;708;225;633;680	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	P	708;680;623;633	ENSP00000298925:L708P;ENSP00000349654:L680P;ENSP00000317837:L623P;ENSP00000437170:L633P	ENSP00000298925:L708P	L	+	2	0	NELL1	21548944	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.676000	0.84012	2.367000	0.80283	0.528000	0.53228	CTA		0.438	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		16	82	0	0	0	0.004007	0	16	82				
RAG1	5896	broad.mit.edu	37	11	36596428	36596428	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:36596428C>A	ENST00000299440.5	+	2	1686	c.1574C>A	c.(1573-1575)cCt>cAt	p.P525H		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	525			P -> S (in dbSNP:rs4151032).		adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				TGGCAGCCACCTCTGAAGAAT	0.493									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	uc001mwu.3		NA																	0				ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5						c.(1573-1575)CCT>CAT		recombination activating gene 1							98.0	94.0	95.0					11																	36596428		2202	4298	6500	SO:0001583	missense	5896	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:36596428C>A	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1574C>A	11.37:g.36596428C>A	ENSP00000299440:p.Pro525His		Somatic				RAG1_uc001mwt.2_RNA	p.P525H	NM_000448	NP_000439	WXS	Illumina HiSeq	Unspecified	P15918	RAG1_HUMAN			2	1698	+	all_lung(20;0.226)	all_hematologic(20;0.107)	525					E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	c.1574C>A	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162131	0.57368	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.88354	-2.37;-2.37	5.58	4.67	0.58626	.	0.185258	0.47455	D	0.000239	D	0.95382	0.8501	M	0.91717	3.235	0.51767	D	0.999933	D	0.89917	1.0	D	0.91635	0.999	D	0.96174	0.9125	10	0.87932	D	0	.	14.3628	0.66785	0.0:0.9289:0.0:0.0711	.	525	P15918	RAG1_HUMAN	H	525	ENSP00000434610:P525H;ENSP00000299440:P525H	ENSP00000299440:P525H	P	+	2	0	RAG1	36553004	1.000000	0.71417	0.995000	0.50966	0.916000	0.54674	5.781000	0.68964	1.376000	0.46267	0.650000	0.86243	CCT		0.493	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448		20	77	1	0	2.4624e-09	0.008871	3.22509e-09	20	77				
ALX4	60529	broad.mit.edu	37	11	44289169	44289169	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:44289169A>G	ENST00000329255.3	-	3	884	c.781T>C	c.(781-783)Tgg>Cgg	p.W261R		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	261					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						TTCTGGAACCAGACCTACAAG	0.577																																							uc001myb.2		NA																	0					0						c.(781-783)TGG>CGG		aristaless-like homeobox 4							145.0	126.0	132.0					11																	44289169		2203	4299	6502	SO:0001583	missense	60529				hair follicle development			g.chr11:44289169A>G	AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.781T>C	11.37:g.44289169A>G	ENSP00000332744:p.Trp261Arg		Somatic					p.W261R	NM_021926	NP_068745	WXS	Illumina HiSeq	Unspecified	Q9H161	ALX4_HUMAN			3	885	-			261			Homeobox.		Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	ENST00000329255.3	37	c.781T>C	CCDS31468.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.947424	0.73672	.	.	ENSG00000052850	ENST00000329255	D	0.99822	-6.94	4.88	4.88	0.63580	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99914	0.9959	H	0.99752	4.75	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95932	0.8939	10	0.87932	D	0	.	14.9385	0.70975	1.0:0.0:0.0:0.0	.	261	Q9H161	ALX4_HUMAN	R	261	ENSP00000332744:W261R	ENSP00000332744:W261R	W	-	1	0	ALX4	44245745	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	8.999000	0.93557	2.180000	0.69256	0.379000	0.24179	TGG		0.577	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390399.1			20	69	0	0	0	0.010504	0	20	69				
AGBL2	79841	broad.mit.edu	37	11	47712126	47712126	+	Missense_Mutation	SNP	G	G	A	rs374430629		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:47712126G>A	ENST00000525123.1	-	10	1418	c.1133C>T	c.(1132-1134)aCg>aTg	p.T378M	AGBL2_ENST00000298861.4_Missense_Mutation_p.T378M|AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000528244.1_Missense_Mutation_p.T340M|AGBL2_ENST00000357610.3_Missense_Mutation_p.T378M	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	378						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						AATGGTCCACGTGAGACAGTA	0.468																																							uc001ngg.2		NA																	0				ovary(2)	2						c.(1132-1134)ACG>ATG		carboxypeptidase 2, cytosolic		G	MET/THR	0,4402		0,0,2201	178.0	152.0	161.0		1133	5.9	1.0	11		161	1,8595	1.2+/-3.3	0,1,4297	no	missense	AGBL2	NM_024783.3	81	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	378/903	47712126	1,12997	2201	4298	6499	SO:0001583	missense	79841				proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding	g.chr11:47712126G>A		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1133C>T	11.37:g.47712126G>A	ENSP00000435582:p.Thr378Met		Somatic				AGBL2_uc001ngf.2_RNA|AGBL2_uc010rhq.1_Missense_Mutation_p.T340M|AGBL2_uc001ngh.1_Missense_Mutation_p.T322M	p.T378M	NM_024783	NP_079059	WXS	Illumina HiSeq	Unspecified	Q5U5Z8	CBPC2_HUMAN			9	1233	-			378					A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	c.1133C>T	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179592	0.78564	0.0	1.16E-4	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244;ENST00000532595	T;T;T;T;T	0.18810	2.67;2.66;2.67;2.68;2.19	5.87	5.87	0.94306	.	0.045949	0.85682	D	0.000000	T	0.56615	0.1997	M	0.90870	3.155	0.49915	D	0.999834	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.943;0.962	T	0.64956	-0.6285	10	0.87932	D	0	-17.4993	17.1281	0.86719	0.0:0.1261:0.8739:0.0	.	340;340;378	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	M	378;378;378;340;322	ENSP00000435582:T378M;ENSP00000350228:T378M;ENSP00000298861:T378M;ENSP00000436630:T340M;ENSP00000436063:T322M	ENSP00000298861:T378M	T	-	2	0	AGBL2	47668702	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	6.162000	0.71874	2.785000	0.95823	0.655000	0.94253	ACG		0.468	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783		22	98	0	0	0	0.00333	0	22	98				
OR4A5	81318	broad.mit.edu	37	11	51412273	51412273	+	Silent	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:51412273C>A	ENST00000319760.6	-	1	175	c.123G>T	c.(121-123)ctG>ctT	p.L41L		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CCACAATGAGCAGGTTCCCCA	0.448																																							uc001nhi.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(121-123)CTG>CTT		olfactory receptor, family 4, subfamily A,							58.0	54.0	55.0					11																	51412273		2201	4296	6497	SO:0001819	synonymous_variant	81318				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51412273C>A	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.123G>T	11.37:g.51412273C>A			Somatic					p.L41L	NM_001005272	NP_001005272	WXS	Illumina HiSeq	Unspecified	Q8NH83	OR4A5_HUMAN			1	123	-		all_lung(304;0.236)	41			Helical; Name=1; (Potential).		Q6IF84	Silent	SNP	ENST00000319760.6	37	c.123G>T	CCDS31497.1																																																																																				0.448	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272		12	32	1	0	2.27111e-07	0.013537	2.77789e-07	12	32				
OR5T2	219464	broad.mit.edu	37	11	55999948	55999948	+	Silent	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:55999948G>T	ENST00000313264.4	-	1	789	c.714C>A	c.(712-714)ctC>ctA	p.L238L		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	238			L -> V (in dbSNP:rs12221615).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					CAAAGTAGAAGAGTAGAAGCT	0.428																																							uc010rjc.1		NA																	0				ovary(2)	2						c.(712-714)CTC>CTA		olfactory receptor, family 5, subfamily T,							123.0	115.0	118.0					11																	55999948		2201	4296	6497	SO:0001819	synonymous_variant	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55999948G>T	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.714C>A	11.37:g.55999948G>T			Somatic					p.L238L	NM_001004746	NP_001004746	WXS	Illumina HiSeq	Unspecified	Q8NGG2	OR5T2_HUMAN			1	714	-	Esophageal squamous(21;0.00448)		238			Helical; Name=5; (Potential).		B9EGX5|Q6IFC8	Silent	SNP	ENST00000313264.4	37	c.714C>A	CCDS31523.1																																																																																				0.428	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		14	87	1	0	4.93089e-13	0.00245	6.63429e-13	14	87				
TMEM179B	374395	broad.mit.edu	37	11	62554927	62554927	+	Silent	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:62554927C>T	ENST00000333449.4	+	1	29	c.24C>T	c.(22-24)cgC>cgT	p.R8R	TMEM223_ENST00000527073.1_Intron|TMEM179B_ENST00000533861.1_Silent_p.R8R|RP11-727F15.12_ENST00000601484.1_RNA	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	8						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						GGCTGCAGCGCGTCGAGCTTG	0.726											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001nvd.3		NA																	0					0						c.(22-24)CGC>CGT		transmembrane protein 179B							6.0	7.0	7.0					11																	62554927		2146	4202	6348	SO:0001819	synonymous_variant	374395					integral to membrane		g.chr11:62554927C>T	BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.24C>T	11.37:g.62554927C>T			Somatic	OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1062		p.R8R	NM_199337	NP_955369	WXS	Illumina HiSeq	Unspecified	Q7Z7N9	T179B_HUMAN			1	54	+			8						Silent	SNP	ENST00000333449.4	37	c.24C>T	CCDS8036.1																																																																																				0.726	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395362.2	NM_199337		3	18	0	0	0	0.004672	0	3	18				
FERMT3	83706	broad.mit.edu	37	11	63990560	63990560	+	Missense_Mutation	SNP	A	A	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:63990560A>C	ENST00000279227.5	+	14	1818	c.1723A>C	c.(1723-1725)Aac>Cac	p.N575H	FERMT3_ENST00000345728.5_Missense_Mutation_p.N571H|TRPT1_ENST00000540472.1_5'Flank	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	575					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GGGCATCGCCAACAACCGACT	0.627																																							uc001nyl.2		NA																	0				ovary(1)	1						c.(1723-1725)AAC>CAC		fermitin family homolog 3 long form							109.0	83.0	91.0					11																	63990560		2201	4297	6498	SO:0001583	missense	83706				integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding	g.chr11:63990560A>C	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1723A>C	11.37:g.63990560A>C	ENSP00000279227:p.Asn575His		Somatic				FERMT3_uc001nym.2_Missense_Mutation_p.N571H	p.N575H	NM_178443	NP_848537	WXS	Illumina HiSeq	Unspecified	Q86UX7	URP2_HUMAN			14	1872	+			575					Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	c.1723A>C	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843484	0.51057	.	.	ENSG00000149781	ENST00000345728;ENST00000279227;ENST00000545896	T;T;T	0.76968	-1.06;-1.06;-1.06	5.19	5.19	0.71726	Pleckstrin homology-type (1);	0.199509	0.41500	D	0.000873	T	0.74921	0.3780	L	0.34521	1.04	0.42061	D	0.991163	D;P	0.53745	0.962;0.937	P;P	0.52386	0.697;0.501	T	0.71262	-0.4645	10	0.16420	T	0.52	-50.2343	14.3257	0.66518	1.0:0.0:0.0:0.0	.	571;575	Q86UX7-2;Q86UX7	.;URP2_HUMAN	H	571;575;92	ENSP00000339950:N571H;ENSP00000279227:N575H;ENSP00000440209:N92H	ENSP00000279227:N575H	N	+	1	0	FERMT3	63747136	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.256000	0.43231	2.094000	0.63399	0.459000	0.35465	AAC		0.627	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471		13	53	0	0	0	0.001855	0	13	53				
SIPA1	6494	broad.mit.edu	37	11	65408900	65408900	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:65408900G>A	ENST00000394224.3	+	2	804	c.508G>A	c.(508-510)Ggg>Agg	p.G170R	SIPA1_ENST00000527525.1_Missense_Mutation_p.G170R|SIPA1_ENST00000394227.3_Missense_Mutation_p.G170R|SIPA1_ENST00000534313.1_Missense_Mutation_p.G170R	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	170					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						GTGTGAGCTCGGGGGTGAGGG	0.677																																							uc001ofb.2		NA																	0					0						c.(508-510)GGG>AGG		signal-induced proliferation-associated protein							56.0	61.0	60.0					11																	65408900		2201	4297	6498	SO:0001583	missense	6494				cell proliferation|cytoskeleton organization|intracellular signal transduction|negative regulation of cell adhesion|negative regulation of cell cycle|negative regulation of cell growth	cytosol|endomembrane system|membrane|perinuclear region of cytoplasm	Rap GTPase activator activity	g.chr11:65408900G>A	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.508G>A	11.37:g.65408900G>A	ENSP00000377771:p.Gly170Arg		Somatic				SIPA1_uc010rom.1_Missense_Mutation_p.G170R|SIPA1_uc001ofd.2_Missense_Mutation_p.G170R	p.G170R	NM_006747	NP_006738	WXS	Illumina HiSeq	Unspecified	Q96FS4	SIPA1_HUMAN			2	675	+			170					O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	c.508G>A	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859999	0.71834	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.90504	-2.68;-2.61;-2.68;-2.61	5.04	4.1	0.47936	.	0.218504	0.26911	U	0.021865	D	0.94742	0.8303	M	0.79805	2.47	0.41277	D	0.986889	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.95	D	0.95111	0.8238	10	0.87932	D	0	-28.6011	12.6523	0.56768	0.0:0.0:0.8331:0.1669	.	170;170	F6RY50;Q96FS4	.;SIPA1_HUMAN	R	170	ENSP00000436269:G170R;ENSP00000433686:G170R;ENSP00000377771:G170R;ENSP00000377774:G170R	ENSP00000377771:G170R	G	+	1	0	SIPA1	65165476	1.000000	0.71417	0.971000	0.41717	0.957000	0.61999	8.461000	0.90372	1.219000	0.43474	0.555000	0.69702	GGG		0.677	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747		6	77	0	0	0	0.001984	0	6	77				
USP35	57558	broad.mit.edu	37	11	77918630	77918630	+	Silent	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:77918630C>T	ENST00000529308.1	+	8	1707	c.1446C>T	c.(1444-1446)acC>acT	p.T482T	USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_Silent_p.T213T|USP35_ENST00000441408.2_Silent_p.T68T|USP35_ENST00000530267.1_Silent_p.T50T	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	482	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CCCTGATGACCAAGCTGCAGT	0.582																																							uc009yva.1		NA																	0				lung(2)|ovary(1)	3						c.(1444-1446)ACC>ACT		ubiquitin specific protease 35							110.0	106.0	107.0					11																	77918630		2012	4175	6187	SO:0001819	synonymous_variant	57558				ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr11:77918630C>T	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1446C>T	11.37:g.77918630C>T			Somatic				USP35_uc001oze.2_Silent_p.T238T|USP35_uc001ozc.2_Silent_p.T50T|USP35_uc010rsp.1_Intron|USP35_uc001ozd.2_Silent_p.T93T|USP35_uc001ozf.2_Silent_p.T213T	p.T482T	NM_020798	NP_065849	WXS	Illumina HiSeq	Unspecified	Q9P2H5	UBP35_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)		8	1692	+	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		482						Silent	SNP	ENST00000529308.1	37	c.1446C>T	CCDS41693.1																																																																																				0.582	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527		17	104	0	0	0	0.006122	0	17	104				
FAT3	120114	broad.mit.edu	37	11	92615964	92615964	+	Silent	SNP	G	G	A	rs376313413		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:92615964G>A	ENST00000298047.6	+	23	12359	c.12342G>A	c.(12340-12342)gtG>gtA	p.V4114V	FAT3_ENST00000409404.2_Silent_p.V4114V|FAT3_ENST00000525166.1_Silent_p.V3964V|FAT3_ENST00000533797.1_Silent_p.V449V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4114	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCTCCTGCGTGAACGTGTTCG	0.637										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(12340-12342)GTG>GTA		FAT tumor suppressor homolog 3							68.0	91.0	83.0					11																	92615964		2157	4241	6398	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92615964G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12342G>A	11.37:g.92615964G>A		TCGA Ovarian(4;0.039)	Somatic				FAT3_uc001pdi.3_Silent_p.V554V	p.V4114V	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			23	12359	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	4114			Extracellular (Potential).|EGF-like 4; calcium-binding (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.12342G>A																																																																																					0.637	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		5	12	0	0	0	0.001168	0	5	12				
OR6M1	390261	broad.mit.edu	37	11	123676438	123676438	+	Missense_Mutation	SNP	G	G	A	rs146786799		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr11:123676438G>A	ENST00000309154.2	-	1	657	c.620C>T	c.(619-621)tCc>tTc	p.S207F		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S207F(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GAATGCCAGGGAGCTCAGGAT	0.483																																							uc010rzz.1		NA																	1	Substitution - Missense(1)	p.S207F(1)	skin(1)	skin(2)	2						c.(619-621)TCC>TTC		olfactory receptor, family 6, subfamily M,							65.0	60.0	61.0					11																	123676438		2202	4299	6501	SO:0001583	missense	390261				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123676438G>A	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.620C>T	11.37:g.123676438G>A	ENSP00000311038:p.Ser207Phe		Somatic					p.S207F	NM_001005325	NP_001005325	WXS	Illumina HiSeq	Unspecified	Q8NGM8	OR6M1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)	1	620	-		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	207			Helical; Name=5; (Potential).		B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	c.620C>T	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999507	0.35320	.	.	ENSG00000196099	ENST00000309154	T	0.37584	1.19	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32952	U	0.005458	T	0.68016	0.2955	H	0.94306	3.52	0.32240	N	0.572811	D	0.89917	1.0	D	0.85130	0.997	T	0.80113	-0.1518	10	0.87932	D	0	.	12.4955	0.55925	0.0:0.0:1.0:0.0	.	207	Q8NGM8	OR6M1_HUMAN	F	207	ENSP00000311038:S207F	ENSP00000311038:S207F	S	-	2	0	OR6M1	123181648	0.006000	0.16342	0.353000	0.25747	0.005000	0.04900	1.521000	0.35910	1.754000	0.51921	0.655000	0.94253	TCC		0.483	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325		3	43	0	0	0	0.004672	0	3	43				
ITPR2	3709	broad.mit.edu	37	12	26810659	26810659	+	Nonsense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr12:26810659C>A	ENST00000381340.3	-	18	2589	c.2173G>T	c.(2173-2175)Gaa>Taa	p.E725*		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	725					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GTAAGAACTTCTAAGTCAGCT	0.398																																							uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(2173-2175)GAA>TAA		inositol 1,4,5-triphosphate receptor, type 2							130.0	130.0	130.0					12																	26810659		1904	4105	6009	SO:0001587	stop_gained	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26810659C>A	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2173G>T	12.37:g.26810659C>A	ENSP00000370744:p.Glu725*		Somatic					p.E725*	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			18	2590	-	Colorectal(261;0.0847)		725			Cytoplasmic (Potential).		O94773	Nonsense_Mutation	SNP	ENST00000381340.3	37	c.2173G>T	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	45	11.378346	0.99554	.	.	ENSG00000123104	ENST00000381340	.	.	.	4.72	4.72	0.59763	.	0.097820	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	17.9024	0.88909	0.0:1.0:0.0:0.0	.	.	.	.	X	725	.	ENSP00000370744:E725X	E	-	1	0	ITPR2	26701926	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	7.307000	0.78920	2.448000	0.82819	0.655000	0.94253	GAA		0.398	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		13	75	1	0	1.5842e-08	0.001855	2.00395e-08	13	75				
YARS2	51067	broad.mit.edu	37	12	32908428	32908428	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr12:32908428C>G	ENST00000324868.8	-	1	408	c.381G>C	c.(379-381)aaG>aaC	p.K127N		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	127					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	CCTCGCGTTCCTTGGTACGGC	0.682											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001rli.2		NA																	0					0						c.(379-381)AAG>AAC		tyrosyl-tRNA synthetase 2, mitochondrial	L-Tyrosine(DB00135)						12.0	14.0	13.0					12																	32908428		2193	4283	6476	SO:0001583	missense	51067				tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity	g.chr12:32908428C>G	AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.381G>C	12.37:g.32908428C>G	ENSP00000320658:p.Lys127Asn		Somatic	OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	836		p.K127N	NM_001040436	NP_001035526	WXS	Illumina HiSeq	Unspecified	Q9Y2Z4	SYYM_HUMAN			1	447	-	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		127					D3DUW8|Q9H817	Missense_Mutation	SNP	ENST00000324868.8	37	c.381G>C	CCDS31770.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339619	0.41398	.	.	ENSG00000139131	ENST00000324868	T	0.52057	0.68	4.92	1.99	0.26369	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.403128	0.26895	N	0.021945	T	0.33904	0.0879	L	0.43554	1.36	0.32157	N	0.583501	B	0.33120	0.398	B	0.28305	0.088	T	0.42172	-0.9467	10	0.49607	T	0.09	-11.7895	7.7659	0.28980	0.0:0.6059:0.2473:0.1468	.	127	Q9Y2Z4	SYYM_HUMAN	N	127	ENSP00000320658:K127N	ENSP00000320658:K127N	K	-	3	2	YARS2	32799695	1.000000	0.71417	0.867000	0.34043	0.992000	0.81027	1.547000	0.36190	0.660000	0.30964	0.650000	0.86243	AAG		0.682	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404153.1	NM_015936		5	40	0	0	0	0.000602	0	5	40				
KRT6B	3854	broad.mit.edu	37	12	52845437	52845437	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr12:52845437C>A	ENST00000252252.3	-	1	473	c.426G>T	c.(424-426)caG>caT	p.Q142H		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	142	Head.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.Q142H(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCAGGAGACTCTGGTTGACAG	0.622																																							uc001sak.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(424-426)CAG>CAT		keratin 6B							138.0	181.0	166.0					12																	52845437		2200	4300	6500	SO:0001583	missense	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52845437C>A	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.426G>T	12.37:g.52845437C>A	ENSP00000252252:p.Gln142His		Somatic					p.Q142H	NM_005555	NP_005546	WXS	Illumina HiSeq	Unspecified	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	1	474	-			142			Head.		P48669	Missense_Mutation	SNP	ENST00000252252.3	37	c.426G>T	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380440	0.61845	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.93659	-3.26	3.28	3.28	0.37604	.	0.000000	0.56097	D	0.000026	D	0.95092	0.8410	M	0.91510	3.215	0.40793	D	0.983276	P	0.40553	0.721	P	0.46479	0.518	D	0.95846	0.8870	10	0.72032	D	0.01	.	10.7121	0.45990	0.0:0.9027:0.0:0.0973	.	142	P04259	K2C6B_HUMAN	H	142	ENSP00000252252:Q142H	ENSP00000252252:Q142H	Q	-	3	2	KRT6B	51131704	.	.	0.971000	0.41717	0.919000	0.55068	.	.	2.160000	0.67779	0.298000	0.19748	CAG		0.622	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		12	160	1	0	0.00136819	0.013537	0.00146734	12	160				
ITGA5	3678	broad.mit.edu	37	12	54801969	54801969	+	Nonsense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr12:54801969C>A	ENST00000293379.4	-	7	1003	c.742G>T	c.(742-744)Gag>Tag	p.E248*	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	248					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						ATCAGGTACTCGGGGTAATAA	0.547																																							uc001sga.2		NA																	0				ovary(2)	2						c.(742-744)GAG>TAG		integrin alpha 5 precursor							84.0	79.0	81.0					12																	54801969		2203	4300	6503	SO:0001587	stop_gained	3678				angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding	g.chr12:54801969C>A		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.742G>T	12.37:g.54801969C>A	ENSP00000293379:p.Glu248*		Somatic				ITGA5_uc010sow.1_RNA|ITGA5_uc009znp.1_RNA	p.E248*	NM_002205	NP_002196	WXS	Illumina HiSeq	Unspecified	P08648	ITA5_HUMAN			7	810	-			248			Extracellular (Potential).		Q96HA5	Nonsense_Mutation	SNP	ENST00000293379.4	37	c.742G>T	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	C	38	6.746984	0.97809	.	.	ENSG00000161638	ENST00000293379	.	.	.	5.03	4.13	0.48395	.	0.784362	0.11700	N	0.538093	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7202	0.62723	0.0:0.8445:0.1555:0.0	.	.	.	.	X	248	.	ENSP00000293379:E248X	E	-	1	0	ITGA5	53088236	0.976000	0.34144	0.994000	0.49952	0.785000	0.44390	3.134000	0.50538	1.232000	0.43678	0.478000	0.44815	GAG		0.547	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1			13	45	1	0	1.49906e-05	0.00245	1.77489e-05	13	45				
ATP2A2	488	broad.mit.edu	37	12	110783811	110783811	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr12:110783811C>T	ENST00000539276.2	+	19	2856	c.2747C>T	c.(2746-2748)tCc>tTc	p.S916F	ATP2A2_ENST00000395494.2_Missense_Mutation_p.S889F|ATP2A2_ENST00000308664.6_Missense_Mutation_p.S916F			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	916					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TGCAGCTTGTCCGAAAACCAG	0.572																																							uc001tqk.3		NA																	0				ovary(3)|skin(1)	4	GRCh37	CM011281	ATP2A2	M		c.(2746-2748)TCC>TTC		ATPase, Ca++ transporting, slow twitch 2 isoform							182.0	137.0	152.0					12																	110783811		2203	4300	6503	SO:0001583	missense	488				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding	g.chr12:110783811C>T		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2747C>T	12.37:g.110783811C>T	ENSP00000440045:p.Ser916Phe		Somatic				ATP2A2_uc001tql.3_Missense_Mutation_p.S916F|ATP2A2_uc010sxy.1_Missense_Mutation_p.S889F|ATP2A2_uc001tqn.3_5'UTR|ATP2A2_uc009zvn.2_5'Flank	p.S916F	NM_170665	NP_733765	WXS	Illumina HiSeq	Unspecified	P16615	AT2A2_HUMAN			19	3310	+			916			Helical; Name=8; (By similarity).		A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	c.2747C>T	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309316	0.81247	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	D;D;D	0.96885	-4.16;-4.16;-4.16	6.17	6.17	0.99709	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.128057	0.64402	D	0.000008	D	0.98874	0.9619	H	0.95679	3.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.986;0.992	D	0.98911	1.0780	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	889;916;916	P16615-4;P16615-2;P16615	.;.;AT2A2_HUMAN	F	916;889;916	ENSP00000311186:S916F;ENSP00000378872:S889F;ENSP00000440045:S916F	ENSP00000311186:S916F	S	+	2	0	ATP2A2	109268194	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	TCC		0.572	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681		13	73	0	0	0	0.013537	0	13	73				
IFT88	8100	broad.mit.edu	37	13	21205212	21205212	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr13:21205212G>T	ENST00000319980.6	+	18	1711	c.1384G>T	c.(1384-1386)Gca>Tca	p.A462S	IFT88_ENST00000351808.5_Missense_Mutation_p.A453S|IFT88_ENST00000537103.1_Missense_Mutation_p.A434S|IFT88_ENST00000382778.4_Missense_Mutation_p.A462S|IFT88_ENST00000461115.1_3'UTR	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	462					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		AAGTGCAGCTGCAACCAATCT	0.343																																							uc001unh.2		NA																	0				ovary(1)	1						c.(1384-1386)GCA>TCA		intraflagellar transport 88 homolog isoform 1							114.0	117.0	116.0					13																	21205212		2203	4300	6503	SO:0001583	missense	8100				cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding	g.chr13:21205212G>T	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1384G>T	13.37:g.21205212G>T	ENSP00000323580:p.Ala462Ser		Somatic				IFT88_uc001uni.2_Missense_Mutation_p.A453S|IFT88_uc001unj.2_Missense_Mutation_p.A452S|IFT88_uc010tcq.1_Missense_Mutation_p.A433S|IFT88_uc001unk.2_Missense_Mutation_p.A208S|IFT88_uc001unl.1_Missense_Mutation_p.A80S	p.A462S	NM_175605	NP_783195	WXS	Illumina HiSeq	Unspecified	Q13099	IFT88_HUMAN		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)	18	1780	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	462			TPR 6.		A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	c.1384G>T	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962947	0.92791	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.76448	-1.02;0.64;0.64;0.64	5.42	5.42	0.78866	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.055638	0.64402	D	0.000001	D	0.88930	0.6571	M	0.87617	2.895	0.80722	D	1	D;D;P;D	0.69078	0.997;0.973;0.917;0.996	P;P;P;P	0.61874	0.895;0.685;0.601;0.824	D	0.89571	0.3813	10	0.49607	T	0.09	-17.722	19.2054	0.93728	0.0:0.0:1.0:0.0	.	434;462;260;462	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	S	462;325;453;462;434	ENSP00000372228:A462S;ENSP00000261632:A453S;ENSP00000323580:A462S;ENSP00000437719:A434S	ENSP00000323580:A462S	A	+	1	0	IFT88	20103212	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.365000	0.97139	2.531000	0.85337	0.655000	0.94253	GCA		0.343	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		11	69	1	0	2.80697e-09	0.010729	3.61245e-09	11	69				
MTUS2	23281	broad.mit.edu	37	13	29600083	29600083	+	Silent	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr13:29600083A>T	ENST00000431530.3	+	1	1336	c.1278A>T	c.(1276-1278)ccA>ccT	p.P426P		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	416						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AAATTTCACCATGTGCAGGTG	0.512																																							uc001usl.3		NA																	0					0						c.(1276-1278)CCA>CCT		hypothetical protein LOC23281 isoform a							37.0	38.0	38.0					13																	29600083		1915	4139	6054	SO:0001819	synonymous_variant	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29600083A>T	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1278A>T	13.37:g.29600083A>T			Somatic					p.P426P	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			1	1336	+			416					A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000431530.3	37	c.1278A>T	CCDS45022.1																																																																																				0.512	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		9	41	0	0	0	0.004482	0	9	41				
CPB2	1361	broad.mit.edu	37	13	46632454	46632454	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr13:46632454G>T	ENST00000181383.4	-	9	875	c.859C>A	c.(859-861)Cca>Aca	p.P287T	CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000606351.1_RNA|CPB2_ENST00000439329.3_Missense_Mutation_p.P250T	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	287					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		TTCACTTCTGGTTCTGACTCA	0.418																																							uc001vaw.2		NA																	0				ovary(1)|skin(1)	2						c.(859-861)CCA>ACA		plasma carboxypeptidase B2 isoform a							173.0	156.0	162.0					13																	46632454		2203	4300	6503	SO:0001583	missense	1361				blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding	g.chr13:46632454G>T	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.859C>A	13.37:g.46632454G>T	ENSP00000181383:p.Pro287Thr		Somatic				uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Missense_Mutation_p.P250T	p.P287T	NM_001872	NP_001863	WXS	Illumina HiSeq	Unspecified	Q96IY4	CBPB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)	9	926	-		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	287					A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	37	c.859C>A	CCDS9401.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577169	0.86645	.	.	ENSG00000080618	ENST00000181383;ENST00000439329	T;T	0.18810	2.19;2.19	5.86	5.86	0.93980	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.53449	0.1797	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.53136	-0.8481	10	0.46703	T	0.11	.	19.1654	0.93555	0.0:0.0:1.0:0.0	.	250;287	Q96IY4-2;Q96IY4	.;CBPB2_HUMAN	T	287;250	ENSP00000181383:P287T;ENSP00000400714:P250T	ENSP00000181383:P287T	P	-	1	0	CPB2	45530455	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	6.160000	0.71862	2.778000	0.95560	0.655000	0.94253	CCA		0.418	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872		6	87	1	0	0.00116845	0.001168	0.00126226	6	87				
DNAJC3	5611	broad.mit.edu	37	13	96416145	96416145	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr13:96416145A>G	ENST00000602402.1	+	9	1130	c.1013A>G	c.(1012-1014)gAc>gGc	p.D338G	DNAJC3_ENST00000376795.6_Missense_Mutation_p.D287G	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	338					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)			NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			ATGGAACCTGACAATGTGAAT	0.393																																							uc001vmq.2		NA																	0					0						c.(1012-1014)GAC>GGC		DnaJ (Hsp40) homolog, subfamily C, member 3							166.0	163.0	164.0					13																	96416145		2203	4300	6503	SO:0001583	missense	5611				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding	g.chr13:96416145A>G	U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.1013A>G	13.37:g.96416145A>G	ENSP00000473631:p.Asp338Gly		Somatic				DNAJC3_uc001vmr.2_Missense_Mutation_p.D287G	p.D338G	NM_006260	NP_006251	WXS	Illumina HiSeq	Unspecified	Q13217	DNJC3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.126)		9	1121	+	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		338			TPR 8.		Q86WT9|Q8N4N2	Missense_Mutation	SNP	ENST00000602402.1	37	c.1013A>G	CCDS9479.1	.	.	.	.	.	.	.	.	.	.	A	14.14	2.445843	0.43429	.	.	ENSG00000102580	ENST00000376795	.	.	.	5.9	3.6	0.41247	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.327523	0.37761	N	0.001951	T	0.32585	0.0834	N	0.14661	0.345	0.35064	D	0.761801	B;B	0.11235	0.004;0.002	B;B	0.18871	0.023;0.006	T	0.30966	-0.9960	9	0.25751	T	0.34	-17.3518	9.6192	0.39710	0.7574:0.1659:0.0768:0.0	.	338;338	A8KA82;Q13217	.;DNJC3_HUMAN	G	338	.	ENSP00000365991:D338G	D	+	2	0	DNAJC3	95214146	0.990000	0.36364	1.000000	0.80357	0.991000	0.79684	1.793000	0.38764	1.053000	0.40415	0.528000	0.53228	GAC		0.393	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045504.3			10	74	0	0	0	0.006214	0	10	74				
CLYBL	171425	broad.mit.edu	37	13	100511246	100511246	+	Silent	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr13:100511246G>T	ENST00000376360.1	+	3	408	c.381G>T	c.(379-381)cgG>cgT	p.R127R	CLYBL_ENST00000444838.2_Silent_p.R127R|CLYBL_ENST00000339105.4_Silent_p.R127R|CLYBL_ENST00000376355.3_Silent_p.R127R|CLYBL_ENST00000376354.1_Silent_p.R127R			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	127						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)			NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGCAATCCCGGGTCCTTCCTT	0.488																																							uc001vok.2		NA																	0					0						c.(379-381)CGG>CGT		citrate lyase beta like precursor							73.0	69.0	70.0					13																	100511246		2203	4300	6503	SO:0001819	synonymous_variant	171425				cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding	g.chr13:100511246G>T	AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.381G>T	13.37:g.100511246G>T			Somatic				CLYBL_uc010tix.1_Silent_p.R127R|CLYBL_uc010tiy.1_Silent_p.R127R	p.R127R	NM_206808	NP_996531	WXS	Illumina HiSeq	Unspecified	Q8N0X4	CLYBL_HUMAN			3	395	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		127					Q5W0F7|Q8TDH8	Silent	SNP	ENST00000376360.1	37	c.381G>T	CCDS32002.1																																																																																				0.488	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045611.1			9	28	1	0	2.74318e-10	0.006214	3.65757e-10	9	28				
ZFYVE26	23503	broad.mit.edu	37	14	68264919	68264919	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr14:68264919G>A	ENST00000347230.4	-	11	2198	c.2060C>T	c.(2059-2061)gCc>gTc	p.A687V	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.A687V	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	687					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CCTGAGGAAGGCCCCTATTGC	0.483																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.(2059-2061)GCC>GTC		zinc finger, FYVE domain containing 26							68.0	72.0	70.0					14																	68264919		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68264919G>A	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2060C>T	14.37:g.68264919G>A	ENSP00000251119:p.Ala687Val		Somatic				ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.A687V|ZFYVE26_uc010tta.1_Missense_Mutation_p.A687V	p.A687V	NM_015346	NP_056161	WXS	Illumina HiSeq	Unspecified	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	11	2199	-			687					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.2060C>T	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041722	0.75732	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.29917	1.69;1.55	5.71	5.71	0.89125	.	0.186702	0.47093	D	0.000245	T	0.43656	0.1257	M	0.65975	2.015	0.34846	D	0.741199	D;D;P	0.61697	0.99;0.973;0.92	P;P;B	0.56088	0.791;0.615;0.166	T	0.56535	-0.7963	10	0.41790	T	0.15	-15.231	9.0452	0.36343	0.0733:0.0:0.7789:0.1477	.	687;687;687	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	V	687;666;687	ENSP00000251119:A687V;ENSP00000450603:A687V	ENSP00000251119:A687V	A	-	2	0	ZFYVE26	67334672	0.988000	0.35896	1.000000	0.80357	0.994000	0.84299	2.383000	0.44354	2.710000	0.92621	0.655000	0.94253	GCC		0.483	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		9	54	0	0	0	0.004482	0	9	54				
SPATA7	55812	broad.mit.edu	37	14	88857734	88857734	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr14:88857734C>T	ENST00000393545.4	+	2	318	c.29C>T	c.(28-30)aCc>aTc	p.T10I	SPATA7_ENST00000554102.1_3'UTR|SPATA7_ENST00000356583.5_Missense_Mutation_p.T10I|SPATA7_ENST00000556553.1_Missense_Mutation_p.T10I|SPATA7_ENST00000045347.7_Missense_Mutation_p.T10I	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	10					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						GTCAGAGCAACCTCTGTCCTT	0.318																																							uc001xwq.2		NA																	0				ovary(1)	1						c.(28-30)ACC>ATC		spermatogenesis-associated protein 7 isoform a							74.0	70.0	71.0					14																	88857734		2203	4300	6503	SO:0001583	missense	55812				response to stimulus|visual perception			g.chr14:88857734C>T	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.29C>T	14.37:g.88857734C>T	ENSP00000377176:p.Thr10Ile		Somatic				SPATA7_uc001xwr.2_Missense_Mutation_p.T10I	p.T10I	NM_018418	NP_060888	WXS	Illumina HiSeq	Unspecified	Q9P0W8	SPAT7_HUMAN			2	180	+			10					Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	37	c.29C>T	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070297	0.36566	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000553885;ENST00000045347	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	3.91	0.608	0.17569	.	0.308852	0.24022	N	0.042269	T	0.22003	0.0530	M	0.68317	2.08	0.28363	N	0.920362	P;D	0.53151	0.95;0.958	P;P	0.49276	0.605;0.563	T	0.08534	-1.0717	10	0.87932	D	0	-0.0732	6.5761	0.22567	0.1963:0.4204:0.3832:0.0	.	10;10	Q9P0W8-2;Q9P0W8	.;SPAT7_HUMAN	I	10	ENSP00000451128:T10I;ENSP00000377176:T10I;ENSP00000348991:T10I;ENSP00000450606:T10I;ENSP00000045347:T10I	ENSP00000045347:T10I	T	+	2	0	SPATA7	87927487	0.618000	0.27051	0.997000	0.53966	0.979000	0.70002	0.684000	0.25364	0.388000	0.25054	0.585000	0.79938	ACC		0.318	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1			3	14	0	0	0	0.004672	0	3	14				
PIGB	9488	broad.mit.edu	37	15	55613537	55613537	+	Silent	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr15:55613537A>T	ENST00000164305.5	+	3	657	c.366A>T	c.(364-366)gcA>gcT	p.A122A	RP11-139H15.1_ENST00000567948.1_RNA|RP11-139H15.1_ENST00000565225.1_RNA|PIGB_ENST00000539642.1_Intron|RP11-139H15.1_ENST00000436697.2_RNA|RAB27A_ENST00000561545.1_5'Flank	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	122					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		TAATCTTTGCAAGCATTTACA	0.328																																							uc002act.2		NA																	0					0						c.(364-366)GCA>GCT		phosphatidylinositol glycan, class B							103.0	98.0	99.0					15																	55613537		1825	4082	5907	SO:0001819	synonymous_variant	9488				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	integral to membrane|intrinsic to endoplasmic reticulum membrane	glycolipid mannosyltransferase activity	g.chr15:55613537A>T	D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.366A>T	15.37:g.55613537A>T			Somatic				uc002acs.2_5'Flank|PIGB_uc010ugg.1_Intron	p.A122A	NM_004855	NP_004846	WXS	Illumina HiSeq	Unspecified	Q92521	PIGB_HUMAN		all cancers(107;0.0255)	3	682	+			122					Q53FF9|Q8WVN7	Silent	SNP	ENST00000164305.5	37	c.366A>T																																																																																					0.328	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855		5	10	0	0	0	0.00308	0	5	10				
VPS33B	26276	broad.mit.edu	37	15	91548985	91548985	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr15:91548985C>T	ENST00000333371.3	-	13	1322	c.969G>A	c.(967-969)atG>atA	p.M323I	VPS33B_ENST00000535843.1_Missense_Mutation_p.M232I|VPS33B_ENST00000535906.1_Missense_Mutation_p.M296I	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	323					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CGAAATTCTTCATCTGCTTAA	0.567																																							uc002bqp.1		NA																	0				ovary(2)	2						c.(967-969)ATG>ATA		vacuolar protein sorting 33B (yeast homolog))							98.0	86.0	90.0					15																	91548985		2198	4298	6496	SO:0001583	missense	26276				cellular membrane fusion|lysosome localization|melanosome localization|platelet alpha granule organization|protein transport|vesicle docking involved in exocytosis	late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm|platelet alpha granule	protein binding	g.chr15:91548985C>T	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.969G>A	15.37:g.91548985C>T	ENSP00000327650:p.Met323Ile		Somatic				VPS33B_uc002bqq.1_Missense_Mutation_p.M232I|VPS33B_uc010uqu.1_Missense_Mutation_p.M296I	p.M323I	NM_018668	NP_061138	WXS	Illumina HiSeq	Unspecified	Q9H267	VP33B_HUMAN			13	1323	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		323					B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	ENST00000333371.3	37	c.969G>A	CCDS10369.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375144	0.61735	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.78003	-1.14;-1.14;-1.14	5.65	4.72	0.59763	.	0.075135	0.85682	D	0.000000	T	0.64091	0.2567	N	0.20986	0.625	0.80722	D	1	P;P	0.42296	0.775;0.669	B;B	0.41374	0.306;0.355	T	0.64326	-0.6434	10	0.05721	T	0.95	-15.3517	15.768	0.78143	0.1374:0.8626:0.0:0.0	.	296;323	F5H008;Q9H267	.;VP33B_HUMAN	I	323;296;232;278	ENSP00000327650:M323I;ENSP00000444053:M296I;ENSP00000446267:M232I	ENSP00000327650:M323I	M	-	3	0	VPS33B	89349989	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	5.186000	0.65082	1.606000	0.50161	-0.182000	0.12963	ATG		0.567	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668		9	85	0	0	0	0.006214	0	9	85				
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																							uc002cdi.2		NA																	10	Substitution - Missense(10)		kidney(7)|prostate(2)|endometrium(1)		0						c.(523-525)GGC>AGC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515299G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A			Somatic				WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.G175S	NR_003659		WXS	Illumina HiSeq	Unspecified					9	1943	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.523G>A		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		9	15	0	0	0	0.008291	0	9	15				
GDE1	51573	broad.mit.edu	37	16	19514835	19514835	+	Missense_Mutation	SNP	T	T	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr16:19514835T>C	ENST00000353258.3	-	6	1133	c.953A>G	c.(952-954)tAt>tGt	p.Y318C	CTA-363E6.7_ENST00000569345.1_RNA	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	318	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						GTCAGTGATATAGCTGGAACC	0.458											OREG0023659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002dgh.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(952-954)TAT>TGT		glycerophosphodiester phosphodiesterase 1							157.0	137.0	144.0					16																	19514835		2197	4300	6497	SO:0001583	missense	51573				glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding	g.chr16:19514835T>C		CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.953A>G	16.37:g.19514835T>C	ENSP00000261386:p.Tyr318Cys		Somatic	OREG0023659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	733	GDE1_uc002dgi.2_Missense_Mutation_p.Y208C	p.Y318C	NM_016641	NP_057725	WXS	Illumina HiSeq	Unspecified	Q9NZC3	GDE1_HUMAN			6	1117	-			318			Cytoplasmic (Potential).|GDPD.		O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	ENST00000353258.3	37	c.953A>G	CCDS10578.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.255808	0.80135	.	.	ENSG00000006007	ENST00000353258	T	0.31510	1.49	6.08	4.99	0.66335	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.054255	0.85682	D	0.000000	T	0.55433	0.1920	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.59397	-0.7462	10	0.72032	D	0.01	-21.2694	12.2998	0.54868	0.0:0.066:0.0:0.934	.	318	Q9NZC3	GDE1_HUMAN	C	318	ENSP00000261386:Y318C	ENSP00000261386:Y318C	Y	-	2	0	GDE1	19422336	1.000000	0.71417	0.980000	0.43619	0.927000	0.56198	7.860000	0.86993	1.111000	0.41721	0.533000	0.62120	TAT		0.458	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641		11	77	0	0	0	0.013537	0	11	77				
ACSM5	54988	broad.mit.edu	37	16	20430747	20430747	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr16:20430747G>A	ENST00000331849.4	+	4	760	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	ACSM5_ENST00000575584.1_Missense_Mutation_p.E205K	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	205					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GAACTTCAGGGAACTCCTCCG	0.517																																							uc002dhe.2		NA																	0				ovary(2)	2						c.(613-615)GAA>AAA		acyl-CoA synthetase medium-chain family member 5							42.0	41.0	41.0					16																	20430747		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20430747G>A		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.613G>A	16.37:g.20430747G>A	ENSP00000327916:p.Glu205Lys		Somatic				ACSM5_uc002dhd.1_Missense_Mutation_p.E205K	p.E205K	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			4	760	+			205					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.613G>A	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964764	0.53507	.	.	ENSG00000183549	ENST00000331849	T	0.53423	0.62	4.65	3.7	0.42460	AMP-dependent synthetase/ligase (1);	0.093236	0.46442	D	0.000293	T	0.55386	0.1917	L	0.50847	1.595	0.47245	D	0.999364	P	0.44478	0.836	P	0.56216	0.794	T	0.51795	-0.8660	10	0.32370	T	0.25	-12.9043	12.796	0.57560	0.0806:0.0:0.9194:0.0	.	205	Q6NUN0	ACSM5_HUMAN	K	205	ENSP00000327916:E205K	ENSP00000327916:E205K	E	+	1	0	ACSM5	20338248	0.935000	0.31712	0.999000	0.59377	0.989000	0.77384	2.204000	0.42761	1.312000	0.45043	-0.142000	0.14014	GAA		0.517	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		12	37	0	0	0	0.001855	0	12	37				
MYH3	4621	broad.mit.edu	37	17	10537453	10537453	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr17:10537453A>G	ENST00000583535.1	-	32	4490	c.4403T>C	c.(4402-4404)cTg>cCg	p.L1468P	MYH3_ENST00000226209.7_Missense_Mutation_p.L1468P	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1468					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GGATGCCTCCAGCTCTGCTTG	0.507																																							uc002gmq.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(4402-4404)CTG>CCG		myosin, heavy chain 3, skeletal muscle,							109.0	108.0	108.0					17																	10537453		2203	4300	6503	SO:0001583	missense	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10537453A>G		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4403T>C	17.37:g.10537453A>G	ENSP00000464317:p.Leu1468Pro		Somatic					p.L1468P	NM_002470	NP_002461	WXS	Illumina HiSeq	Unspecified	P11055	MYH3_HUMAN			31	4480	-			1468			Potential.		Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	c.4403T>C	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589539	0.86851	.	.	ENSG00000109063	ENST00000226209	T	0.81163	-1.46	5.31	5.31	0.75309	Myosin tail (1);	.	.	.	.	D	0.93536	0.7937	H	0.97829	4.085	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.95867	0.8888	9	0.87932	D	0	.	15.5461	0.76101	1.0:0.0:0.0:0.0	.	1468	P11055	MYH3_HUMAN	P	1468	ENSP00000226209:L1468P	ENSP00000226209:L1468P	L	-	2	0	MYH3	10478178	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.233000	0.65337	2.120000	0.65058	0.533000	0.62120	CTG		0.507	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		5	103	0	0	0	0.001168	0	5	103				
HOXB1	3211	broad.mit.edu	37	17	46607756	46607756	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr17:46607756C>G	ENST00000239174.6	-	1	603	c.511G>C	c.(511-513)Gaa>Caa	p.E171Q	HOXB1_ENST00000577092.1_Missense_Mutation_p.E171Q	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	171					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GTGTTAGGTTCTGAAGGGCAG	0.602																																							uc002ink.1		NA																	0				ovary(1)	1						c.(511-513)GAA>CAA		homeobox B1							65.0	63.0	64.0					17																	46607756		2203	4300	6503	SO:0001583	missense	3211					nucleus	protein domain specific binding|sequence-specific DNA binding transcription factor activity	g.chr17:46607756C>G		CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.511G>C	17.37:g.46607756C>G	ENSP00000355140:p.Glu171Gln		Somatic					p.E171Q	NM_002144	NP_002135	WXS	Illumina HiSeq	Unspecified	P14653	HXB1_HUMAN			1	517	-			171					Q4VB03	Missense_Mutation	SNP	ENST00000239174.6	37	c.511G>C	CCDS32675.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.271651	0.23221	.	.	ENSG00000120094	ENST00000239174	D	0.89196	-2.48	4.34	4.34	0.51931	.	0.000000	0.46758	D	0.000264	T	0.80701	0.4673	L	0.29908	0.895	0.37631	D	0.921686	B	0.20780	0.048	B	0.18561	0.022	T	0.77043	-0.2734	10	0.28530	T	0.3	.	9.3886	0.38359	0.158:0.6883:0.1536:0.0	.	171	P14653	HXB1_HUMAN	Q	171	ENSP00000355140:E171Q	ENSP00000355140:E171Q	E	-	1	0	HOXB1	43962755	0.949000	0.32298	0.947000	0.38551	0.334000	0.28698	2.221000	0.42917	2.255000	0.74692	0.655000	0.94253	GAA		0.602	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358383.3			7	40	0	0	0	0.001984	0	7	40				
DLX4	1748	broad.mit.edu	37	17	48051138	48051138	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr17:48051138G>A	ENST00000240306.3	+	3	849	c.554G>A	c.(553-555)gGg>gAg	p.G185E	DLX4_ENST00000411890.2_Missense_Mutation_p.G113E	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	185					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						GGGCAGGAAGGGGACTTCCCT	0.557																																							uc002ipv.2		NA																	0					0						c.(553-555)GGG>GAG		distal-less homeobox 4 isoform a							90.0	101.0	97.0					17																	48051138		2203	4300	6503	SO:0001583	missense	1748				multicellular organismal development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:48051138G>A		CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.554G>A	17.37:g.48051138G>A	ENSP00000240306:p.Gly185Glu		Somatic				DLX4_uc002ipw.2_Missense_Mutation_p.G113E	p.G185E	NM_138281	NP_612138	WXS	Illumina HiSeq	Unspecified	Q92988	DLX4_HUMAN			3	825	+			185					D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Missense_Mutation	SNP	ENST00000240306.3	37	c.554G>A	CCDS11555.1	.	.	.	.	.	.	.	.	.	.	G	9.781	1.175234	0.21704	.	.	ENSG00000108813	ENST00000240306;ENST00000411890	D;D	0.92595	-2.92;-3.07	5.41	3.36	0.38483	Homeodomain-like (1);	.	.	.	.	D	0.82995	0.5158	N	0.25245	0.725	0.26463	N	0.975407	B;B	0.20368	0.044;0.006	B;B	0.26969	0.075;0.004	T	0.67476	-0.5661	9	0.09843	T	0.71	-13.1074	4.9572	0.14048	0.1855:0.1762:0.6382:0.0	.	113;185	Q92988-2;Q92988	.;DLX4_HUMAN	E	185;113	ENSP00000240306:G185E;ENSP00000410622:G113E	ENSP00000240306:G185E	G	+	2	0	DLX4	45406137	0.992000	0.36948	0.261000	0.24466	0.611000	0.37282	1.734000	0.38166	0.790000	0.33803	0.561000	0.74099	GGG		0.557	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366214.1			37	127	0	0	0	0.003755	0	37	127				
NOL4	8715	broad.mit.edu	37	18	31803075	31803075	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr18:31803075G>T	ENST00000261592.5	-	1	440	c.143C>A	c.(142-144)aCg>aAg	p.T48K	NOL4_ENST00000535475.1_5'Flank|NOL4_ENST00000589544.1_Missense_Mutation_p.T48K|RP11-379L18.1_ENST00000587528.1_RNA|NOL4_ENST00000538587.1_5'Flank|NOL4_ENST00000590846.1_5'Flank|NOL4_ENST00000269185.4_5'UTR	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	48						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GGCGTTGTCCGTGGAGCTCGA	0.597																																							uc010dmi.2		NA																	0				ovary(3)	3						c.(142-144)ACG>AAG		nucleolar protein 4							98.0	101.0	100.0					18																	31803075		2018	4167	6185	SO:0001583	missense	8715					nucleolus	RNA binding	g.chr18:31803075G>T	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.143C>A	18.37:g.31803075G>T	ENSP00000261592:p.Thr48Lys		Somatic				NOL4_uc002kxr.3_5'Flank|NOL4_uc010xbt.1_5'Flank|NOL4_uc010dmh.2_5'Flank|NOL4_uc010xbu.1_Missense_Mutation_p.T48K|NOL4_uc002kxt.3_Missense_Mutation_p.T48K	p.T48K	NM_003787	NP_003778	WXS	Illumina HiSeq	Unspecified	O94818	NOL4_HUMAN			1	372	-			48					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	c.143C>A	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949952	0.53186	.	.	ENSG00000101746	ENST00000261592	D	0.84223	-1.82	5.72	5.72	0.89469	.	.	.	.	.	T	0.82254	0.4997	L	0.34521	1.04	0.80722	D	1	P;P	0.51240	0.943;0.943	B;P	0.45998	0.42;0.5	D	0.83497	0.0073	9	0.51188	T	0.08	-6.7952	16.5937	0.84789	0.0:0.0:1.0:0.0	.	48;48	O94818;O94818-2	NOL4_HUMAN;.	K	48	ENSP00000261592:T48K	ENSP00000261592:T48K	T	-	2	0	NOL4	30057073	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.237000	0.95368	2.701000	0.92244	0.561000	0.74099	ACG		0.597	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		9	71	1	0	3.86212e-05	0.008291	4.43096e-05	9	71				
ADNP2	22850	broad.mit.edu	37	18	77895840	77895840	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr18:77895840C>G	ENST00000262198.4	+	4	2999	c.2544C>G	c.(2542-2544)caC>caG	p.H848Q		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	848					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTGGGATACACTCCAAGTCAC	0.567																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(2542-2544)CAC>CAG		ADNP homeobox 2							59.0	60.0	60.0					18																	77895840		2203	4300	6503	SO:0001583	missense	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77895840C>G	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2544C>G	18.37:g.77895840C>G	ENSP00000262198:p.His848Gln		Somatic					p.H848Q	NM_014913	NP_055728	WXS	Illumina HiSeq	Unspecified	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	2999	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	848					A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	c.2544C>G	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	C	4.373	0.068819	0.08436	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.18	3.37	0.38596	.	0.160793	0.41938	D	0.000788	T	0.39682	0.1087	L	0.44542	1.39	0.32514	N	0.537131	D	0.53151	0.958	P	0.51229	0.663	T	0.50118	-0.8865	8	.	.	.	-27.4124	6.1814	0.20474	0.0:0.619:0.0:0.381	.	848	Q6IQ32	ADNP2_HUMAN	Q	848	.	.	H	+	3	2	ADNP2	75996831	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.621000	0.24418	1.416000	0.47057	0.655000	0.94253	CAC		0.567	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		13	83	0	0	0	0.003163	0	13	83				
TJP3	27134	broad.mit.edu	37	19	3736270	3736270	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:3736270G>A	ENST00000541714.2	+	11	1697	c.1235G>A	c.(1234-1236)gGc>gAc	p.G412D	TJP3_ENST00000587686.1_Missense_Mutation_p.G431D|TJP3_ENST00000262968.9_Missense_Mutation_p.G445D|TJP3_ENST00000539908.2_Missense_Mutation_p.G376D|TJP3_ENST00000382008.3_Missense_Mutation_p.G426D|TJP3_ENST00000589378.1_Missense_Mutation_p.G421D	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	412	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGCAGGCGGGCAGCCCGGCC	0.697																																							uc010xhv.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1333-1335)GGC>GAC		tight junction protein 3							17.0	19.0	18.0					19																	3736270		2202	4296	6498	SO:0001583	missense	27134					tight junction	protein binding	g.chr19:3736270G>A	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1235G>A	19.37:g.3736270G>A	ENSP00000439278:p.Gly412Asp		Somatic				TJP3_uc010xhs.1_Missense_Mutation_p.G412D|TJP3_uc010xht.1_Missense_Mutation_p.G376D|TJP3_uc010xhu.1_Missense_Mutation_p.G421D|TJP3_uc010xhw.1_Missense_Mutation_p.G431D	p.G445D	NM_014428	NP_055243	WXS	Illumina HiSeq	Unspecified	O95049	ZO3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)	10	1334	+			426			PDZ 3.		A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	37	c.1334G>A	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	G	2.174	-0.389158	0.04932	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	4.5	2.36	0.29203	PDZ/DHR/GLGF (4);	0.262940	0.39341	N	0.001390	T	0.21427	0.0516	N	0.10760	0.04	0.43555	D	0.99586	B;B;B;B	0.22800	0.06;0.075;0.074;0.06	B;B;B;B	0.31614	0.032;0.133;0.055;0.032	T	0.04017	-1.0984	10	0.16896	T	0.51	.	7.933	0.29914	0.0837:0.3067:0.6096:0.0	.	431;445;426;412	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	D	412;376;426;445	ENSP00000439278:G412D;ENSP00000439991:G376D;ENSP00000371438:G426D;ENSP00000262968:G445D	ENSP00000262968:G445D	G	+	2	0	TJP3	3687270	1.000000	0.71417	0.998000	0.56505	0.080000	0.17528	2.819000	0.48049	0.537000	0.28751	-0.458000	0.05436	GGC		0.697	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1			3	30	0	0	0	0.009096	0	3	30				
RYR1	6261	broad.mit.edu	37	19	38983277	38983277	+	Splice_Site	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:38983277G>A	ENST00000359596.3	+	38	6274		c.e38+1		RYR1_ENST00000360985.3_Splice_Site|RYR1_ENST00000355481.4_Splice_Site			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)						calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGCAAACCCCGTGAGGACTGG	0.627																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.e38+1		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						31.0	27.0	28.0					19																	38983277		2202	4299	6501	SO:0001630	splice_region_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38983277G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.6274+1G>A	19.37:g.38983277G>A			Somatic				RYR1_uc002oiu.2_Splice_Site_p.R2092_splice	p.R2092_splice	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		38	6404	+	all_cancers(60;7.91e-06)							Q16314|Q16368|Q9NPK1|Q9P1U4	Splice_Site	SNP	ENST00000359596.3	37	c.6274_splice	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	g	19.12	3.765651	0.69878	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9455	0.79789	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR1	43675117	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	8.040000	0.89188	2.349000	0.79799	0.539000	0.68188	.		0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		Intron	3	11	0	0	0	0.004672	0	3	11				
SAMD4B	55095	broad.mit.edu	37	19	39871697	39871697	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:39871697G>A	ENST00000314471.6	+	14	2951	c.1916G>A	c.(1915-1917)cGc>cAc	p.R639H	SAMD4B_ENST00000596368.1_Intron|SAMD4B_ENST00000598913.1_Missense_Mutation_p.R639H	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	639					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			TCTGTGCAGCGCACCCACTCG	0.607																																							uc002olb.2		NA																	0					0						c.(1915-1917)CGC>CAC		sterile alpha motif domain containing 4B							96.0	82.0	87.0					19																	39871697		2203	4300	6503	SO:0001583	missense	55095						protein binding	g.chr19:39871697G>A		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1916G>A	19.37:g.39871697G>A	ENSP00000317224:p.Arg639His		Somatic				SAMD4B_uc002ola.2_Missense_Mutation_p.R639H	p.R639H	NM_018028	NP_060498	WXS	Illumina HiSeq	Unspecified	Q5PRF9	SMAG2_HUMAN	Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)		14	2951	+	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		639					A5Z0M6|Q6P194	Missense_Mutation	SNP	ENST00000314471.6	37	c.1916G>A	CCDS33020.1	.	.	.	.	.	.	.	.	.	.	G	33	5.233384	0.95207	.	.	ENSG00000179134	ENST00000314471	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	L	0.46157	1.445	0.52501	D	0.999956	D;D	0.76494	0.999;0.999	D;D	0.73380	0.98;0.98	T	0.72497	-0.4275	9	0.87932	D	0	.	15.2588	0.73606	0.0:0.0:1.0:0.0	.	639;639	Q5PRF9;A5Z0M6	SMAG2_HUMAN;.	H	639	.	ENSP00000317224:R639H	R	+	2	0	SAMD4B	44563537	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.990000	0.93510	2.463000	0.83235	0.455000	0.32223	CGC		0.607	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028		5	72	0	0	0	0.000602	0	5	72				
PSG11	5680	broad.mit.edu	37	19	43523108	43523108	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:43523108C>G	ENST00000401740.1	-	3	626	c.523G>C	c.(523-525)Gac>Cac	p.D175H	PSG11_ENST00000320078.7_Missense_Mutation_p.D175H|PSG11_ENST00000403486.1_Missense_Mutation_p.D53H|PSG11_ENST00000306322.7_Missense_Mutation_p.D53H|PSG11_ENST00000595312.1_5'UTR			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	175	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				TAGCTTGCGTCCGGAGTCTCA	0.527																																							uc002ovm.1		NA																	0					0						c.(523-525)GAC>CAC		pregnancy specific beta-1-glycoprotein 11							254.0	258.0	257.0					19																	43523108		2200	4297	6497	SO:0001583	missense	5680				female pregnancy	extracellular region		g.chr19:43523108C>G	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.523G>C	19.37:g.43523108C>G	ENSP00000384995:p.Asp175His		Somatic				PSG11_uc002ouw.2_Missense_Mutation_p.D181H|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.D181H|PSG11_uc002ovn.1_Missense_Mutation_p.D181H|PSG11_uc002ovo.1_Missense_Mutation_p.D53H|PSG11_uc002ovp.1_Missense_Mutation_p.D53H	p.D175H	NM_002785	NP_002776	WXS	Illumina HiSeq	Unspecified	Q9UQ72	PSG11_HUMAN			3	630	-		Prostate(69;0.00682)	175			Ig-like C2-type 1.		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	c.523G>C	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	t	7.749	0.703001	0.15172	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	0.569	-0.866	0.10659	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.26484	0.0647	L	0.59436	1.845	0.09310	N	1	P;P	0.50156	0.932;0.808	D;P	0.67103	0.949;0.862	T	0.12372	-1.0550	8	0.72032	D	0.01	.	.	.	.	.	53;175	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	H	175;53;53;175	ENSP00000319140:D175H;ENSP00000385427:D53H;ENSP00000304913:D53H;ENSP00000384995:D175H	ENSP00000304913:D53H	D	-	1	0	PSG11	48214948	0.000000	0.05858	0.009000	0.14445	0.012000	0.07955	-2.612000	0.00884	-0.311000	0.08754	0.184000	0.17185	GAC		0.527	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785		26	336	0	0	0	0.00333	0	26	336				
CLEC11A	6320	broad.mit.edu	37	19	51228604	51228604	+	Silent	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:51228604C>T	ENST00000250340.4	+	4	1049	c.852C>T	c.(850-852)agC>agT	p.S284S	CLEC11A_ENST00000599973.1_Missense_Mutation_p.P301S	NM_002975.2	NP_002966.1	Q9Y240	CLC11_HUMAN	C-type lectin domain family 11, member A	284	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	7		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		ATCCGCTCAGCCCGGACCAGC	0.701																																							uc002psy.2		NA																	0				ovary(1)	1						c.(850-852)AGC>AGT		stem cell growth factor precursor							13.0	15.0	15.0					19																	51228604		2179	4262	6441	SO:0001819	synonymous_variant	6320				positive regulation of cell proliferation	cytoplasm|extracellular region	growth factor activity|sugar binding	g.chr19:51228604C>T	AF087658	CCDS12800.1	19q13.3	2010-04-27	2005-02-09	2005-02-11		ENSG00000105472		"""C-type lectin domain containing"""	10576	protein-coding gene	gene with protein product		604713	"""stem cell growth factor; lymphocyte secreted C-type lectin"""	SCGF		9207134, 9442024	Standard	NM_002975		Approved	P47, LSLCL, CLECSF3	uc002psy.3	Q9Y240		ENST00000250340.4:c.852C>T	19.37:g.51228604C>T			Somatic					p.S284S	NM_002975	NP_002966	WXS	Illumina HiSeq	Unspecified	Q9Y240	CLC11_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)	4	1030	+		all_neural(266;0.057)	284			C-type lectin.		B2RAD4	Silent	SNP	ENST00000250340.4	37	c.852C>T	CCDS12800.1																																																																																				0.701	CLEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464062.1	NM_002975		6	15	0	0	0	0.001984	0	6	15				
ZNF845	91664	broad.mit.edu	37	19	53854728	53854728	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:53854728G>T	ENST00000595091.1	+	5	1019	c.800G>T	c.(799-801)gGc>gTc	p.G267V	ZNF845_ENST00000458035.1_Missense_Mutation_p.G267V			Q96IR2	ZN845_HUMAN	zinc finger protein 845	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TGTCACACTGGCAAGAAACCT	0.393																																							uc010ydv.1		NA																	0					0						c.(799-801)GGC>GTC		zinc finger protein 845							97.0	81.0	86.0					19																	53854728		692	1591	2283	SO:0001583	missense	91664				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53854728G>T	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.800G>T	19.37:g.53854728G>T	ENSP00000470005:p.Gly267Val		Somatic				ZNF845_uc010ydw.1_Missense_Mutation_p.G267V	p.G267V	NM_138374	NP_612383	WXS	Illumina HiSeq	Unspecified	Q96IR2	ZN845_HUMAN			4	917	+			267						Missense_Mutation	SNP	ENST00000595091.1	37	c.800G>T	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445592	0.43429	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.23552	1.9	1.91	0.834	0.18880	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46698	0.1406	M	0.86268	2.805	0.41564	D	0.988648	D	0.59357	0.985	D	0.63597	0.916	T	0.51934	-0.8642	9	0.62326	D	0.03	.	7.6788	0.28500	0.1612:0.0:0.8388:0.0	.	267	Q96IR2	ZN845_HUMAN	V	267	ENSP00000388311:G267V	ENSP00000412086:G267V	G	+	2	0	ZNF845	58546540	0.000000	0.05858	0.011000	0.14972	0.145000	0.21501	0.153000	0.16323	1.045000	0.40225	0.205000	0.17691	GGC		0.393	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908		7	61	1	0	2.7689e-08	0.001984	3.47285e-08	7	61				
ZNF813	126017	broad.mit.edu	37	19	53989968	53989968	+	Missense_Mutation	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr19:53989968A>G	ENST00000396403.4	+	3	226	c.98A>G	c.(97-99)tAc>tGc	p.Y33C	ZNF813_ENST00000396421.4_Missense_Mutation_p.Y33C	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	33	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		AGGACTCTATACAGGGACGTG	0.473																																							uc002qbu.2		NA																	0				large_intestine(1)	1						c.(97-99)TAC>TGC		zinc finger protein 813							57.0	64.0	61.0					19																	53989968		2191	4252	6443	SO:0001583	missense	126017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53989968A>G	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.98A>G	19.37:g.53989968A>G	ENSP00000379684:p.Tyr33Cys		Somatic				ZNF813_uc010eqq.1_RNA	p.Y33C	NM_001004301	NP_001004301	WXS	Illumina HiSeq	Unspecified	Q6ZN06	ZN813_HUMAN		GBM - Glioblastoma multiforme(134;0.00619)	3	226	+			33			KRAB.			Missense_Mutation	SNP	ENST00000396403.4	37	c.98A>G	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	A	6.984	0.551623	0.13374	.	.	ENSG00000198346	ENST00000396403;ENST00000490956;ENST00000396421	T;T;T	0.07021	3.23;3.23;3.23	1.05	1.05	0.20165	Krueppel-associated box (4);	.	.	.	.	T	0.38453	0.1041	H	0.97611	4.04	0.21897	N	0.999482	D	0.89917	1.0	D	0.87578	0.998	T	0.13124	-1.0521	9	0.87932	D	0	.	7.1679	0.25702	1.0:0.0:0.0:0.0	.	33	Q6ZN06	ZN813_HUMAN	C	33	ENSP00000379684:Y33C;ENSP00000418289:Y33C;ENSP00000379699:Y33C	ENSP00000379684:Y33C	Y	+	2	0	ZNF813	58681780	0.049000	0.20398	0.278000	0.24718	0.074000	0.17049	1.733000	0.38156	0.462000	0.27095	0.318000	0.21364	TAC		0.473	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301		22	131	0	0	0	0.003954	0	22	131				
RAD51AP2	729475	broad.mit.edu	37	2	17699682	17699682	+	Start_Codon_SNP	SNP	T	T	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:17699682T>A	ENST00000399080.2	-	1	24	c.1A>T	c.(1-3)Atg>Ttg	p.M1L		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GGGAGAGACATGACAGCGAAT	0.622																																							uc002rcl.1		NA																	0				ovary(1)	1						c.(1-3)ATG>TTG		RAD51 associated protein 2							59.0	64.0	63.0					2																	17699682		1963	4148	6111	SO:0001582	initiator_codon_variant	729475							g.chr2:17699682T>A	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.1A>T	2.37:g.17699682T>A	ENSP00000382030:p.Met1Leu		Somatic				RAD51AP2_uc010exn.1_Intron	p.M1L	NM_001099218	NP_001092688	WXS	Illumina HiSeq	Unspecified	Q09MP3	R51A2_HUMAN			1	25	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		1						Missense_Mutation	SNP	ENST00000399080.2	37	c.1A>T	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.496009	0.26774	.	.	ENSG00000214842	ENST00000399080	T	0.32988	1.43	3.58	2.41	0.29592	.	.	.	.	.	T	0.24431	0.0592	.	.	.	0.09310	N	0.999991	B	0.24533	0.105	B	0.24848	0.056	T	0.24333	-1.0163	8	0.87932	D	0	-6.4323	7.9588	0.30060	0.0:0.1098:0.0:0.8902	.	1	Q09MP3	R51A2_HUMAN	L	1	ENSP00000382030:M1L	ENSP00000382030:M1L	M	-	1	0	RAD51AP2	17563163	0.835000	0.29415	0.518000	0.27811	0.004000	0.04260	1.443000	0.35057	0.244000	0.21351	-1.431000	0.01090	ATG		0.622	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	Missense_Mutation	14	95	0	0	0	0.004007	0	14	95				
QPCT	25797	broad.mit.edu	37	2	37594376	37594376	+	Splice_Site	SNP	C	C	G	rs151306583		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:37594376C>G	ENST00000338415.3	+	4	706	c.548C>G	c.(547-549)aCt>aGt	p.T183S	QPCT_ENST00000537448.1_Splice_Site_p.T134S	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase	183					cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				TTTTACCAGACTGTTTCAGAC	0.363																																							uc002rqg.2		NA																	0				central_nervous_system(1)	1						c.(547-549)ACT>AGT		glutaminyl-peptide cyclotransferase precursor		C	SER/THR	1,4405	2.1+/-5.4	0,1,2202	129.0	125.0	127.0		548	3.2	0.3	2	dbSNP_134	127	0,8600		0,0,4300	no	missense-near-splice	QPCT	NM_012413.3	58	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign	183/362	37594376	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	25797				peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	extracellular region	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|zinc ion binding	g.chr2:37594376C>G	X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.547-1C>G	2.37:g.37594376C>G			Somatic				QPCT_uc002rqh.2_Missense_Mutation_p.T134S	p.T183S	NM_012413	NP_036545	WXS	Illumina HiSeq	Unspecified	Q16769	QPCT_HUMAN			4	670	+		Ovarian(717;0.051)|all_hematologic(82;0.21)	183					Q16770|Q3KRG6|Q53TR4	Missense_Mutation	SNP	ENST00000338415.3	37	c.548C>G	CCDS1790.1	.	.	.	.	.	.	.	.	.	.	C	4.426	0.078844	0.08533	2.27E-4	0.0	ENSG00000115828	ENST00000338415;ENST00000404976;ENST00000537448	T;T;T	0.47869	0.83;0.83;0.83	5.61	3.22	0.36961	Peptidase M28 (1);	0.756536	0.13562	N	0.378719	T	0.22513	0.0543	N	0.02916	-0.46	0.27638	N	0.947821	B;B	0.20887	0.049;0.035	B;B	0.25140	0.031;0.058	T	0.26677	-1.0096	10	0.19590	T	0.45	-20.1712	8.3339	0.32202	0.6081:0.3196:0.0722:0.0	.	134;183	Q16769-2;Q16769	.;QPCT_HUMAN	S	183;134;134	ENSP00000344829:T183S;ENSP00000385391:T134S;ENSP00000441606:T134S	ENSP00000344829:T183S	T	+	2	0	QPCT	37447880	0.049000	0.20398	0.276000	0.24689	0.852000	0.48524	0.412000	0.21131	0.416000	0.25844	-0.410000	0.06199	ACT		0.363	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218572.2		Missense_Mutation	11	76	0	0	0	0.001855	0	11	76				
CCDC88A	55704	broad.mit.edu	37	2	55646180	55646180	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:55646180C>G	ENST00000436346.1	-	1	877	c.36G>C	c.(34-36)caG>caC	p.Q12H	CCDC88A_ENST00000413716.2_Missense_Mutation_p.Q12H|CCDC88A_ENST00000336838.6_Missense_Mutation_p.Q12H|CCDC88A_ENST00000471947.1_5'UTR|CCDC88A_ENST00000263630.8_Missense_Mutation_p.Q12H	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	12					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TGGTCATGAACTGCTCCAGAA	0.423																																							uc002ryv.2		NA																	0				ovary(2)|skin(2)	4						c.(34-36)CAG>CAC		coiled-coil domain containing 88A isoform 1							110.0	112.0	111.0					2																	55646180		2203	4300	6503	SO:0001583	missense	55704				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding	g.chr2:55646180C>G	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.36G>C	2.37:g.55646180C>G	ENSP00000410608:p.Gln12His		Somatic				CCDC88A_uc010yoz.1_Missense_Mutation_p.Q12H|CCDC88A_uc010ypa.1_Missense_Mutation_p.Q12H|CCDC88A_uc010fbz.2_RNA	p.Q12H	NM_001135597	NP_001129069	WXS	Illumina HiSeq	Unspecified	Q3V6T2	GRDN_HUMAN			1	878	-			12					A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37	c.36G>C		.	.	.	.	.	.	.	.	.	.	C	9.285	1.049212	0.19827	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.56	2.63	0.31362	.	0.168625	0.27604	U	0.018635	T	0.30070	0.0753	L	0.43152	1.355	0.80722	D	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.10450	0.005;0.003;0.004	T	0.16453	-1.0402	10	0.45353	T	0.12	-3.1197	4.8857	0.13701	0.3769:0.4311:0.1225:0.0695	.	12;12;12	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	H	12	ENSP00000338728:Q12H;ENSP00000263630:Q12H;ENSP00000410608:Q12H;ENSP00000404431:Q12H	ENSP00000263630:Q12H	Q	-	3	2	CCDC88A	55499684	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.631000	0.37092	1.336000	0.45506	0.563000	0.77884	CAG		0.423	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571		11	36	0	0	0	0.001855	0	11	36				
M1AP	130951	broad.mit.edu	37	2	74834325	74834325	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:74834325C>T	ENST00000290536.5	-	4	568	c.452G>A	c.(451-453)gGa>gAa	p.G151E	M1AP_ENST00000536235.1_Missense_Mutation_p.G151E|M1AP_ENST00000358434.2_5'UTR|M1AP_ENST00000409585.1_Missense_Mutation_p.G151E	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	151					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CACCTCTTTTCCAGGCTGAGA	0.443																																							uc002smy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(451-453)GGA>GAA		hypothetical protein LOC130951							132.0	126.0	128.0					2																	74834325		2203	4300	6503	SO:0001583	missense	130951				chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane		g.chr2:74834325C>T		CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.452G>A	2.37:g.74834325C>T	ENSP00000290536:p.Gly151Glu		Somatic				C2orf65_uc010ysa.1_Missense_Mutation_p.G151E|C2orf65_uc002smz.2_Missense_Mutation_p.G151E	p.G151E	NM_138804	NP_620159	WXS	Illumina HiSeq	Unspecified	Q8TC57	CB065_HUMAN			4	569	-			151					B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	ENST00000290536.5	37	c.452G>A	CCDS33229.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619901	0.87460	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235	T;T;T	0.54279	0.58;0.58;0.58	5.98	5.98	0.97165	.	0.055511	0.64402	D	0.000001	T	0.69033	0.3066	M	0.66939	2.045	0.80722	D	1	D;D;D	0.71674	0.998;0.992;0.996	D;P;D	0.63192	0.912;0.856;0.912	T	0.70077	-0.4971	10	0.66056	D	0.02	-15.8593	15.9562	0.79889	0.0:1.0:0.0:0.0	.	151;151;151	E9PGG8;Q8TC57-2;Q8TC57	.;.;CB065_HUMAN	E	151	ENSP00000290536:G151E;ENSP00000386793:G151E;ENSP00000445662:G151E	ENSP00000290536:G151E	G	-	2	0	C2orf65	74687833	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.671000	0.61590	2.847000	0.97988	0.591000	0.81541	GGA		0.443	M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804		6	70	0	0	0	0.001168	0	6	70				
REV1	51455	broad.mit.edu	37	2	100019435	100019435	+	Missense_Mutation	SNP	T	T	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:100019435T>G	ENST00000258428.3	-	20	3529	c.3301A>C	c.(3301-3303)Act>Cct	p.T1101P	REV1_ENST00000465835.1_5'Flank|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000393445.3_Missense_Mutation_p.T1100P	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1101					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTGGCAGAGTTTTTGCAGGA	0.413								Direct reversal of damage																															uc002tad.2		NA																	0				ovary(2)	2						c.(3301-3303)ACT>CCT	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	REV1-like isoform 1							92.0	93.0	93.0					2																	100019435		2203	4300	6503	SO:0001583	missense	51455				DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding	g.chr2:100019435T>G	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3301A>C	2.37:g.100019435T>G	ENSP00000258428:p.Thr1101Pro		Somatic				REV1_uc002tac.2_Missense_Mutation_p.T1100P	p.T1101P	NM_016316	NP_057400	WXS	Illumina HiSeq	Unspecified	Q9UBZ9	REV1_HUMAN			20	3513	-			1101					O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	c.3301A>C	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.269183	0.40095	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.29917	1.55;1.55	5.95	-4.34	0.03666	.	0.948671	0.08921	N	0.874479	T	0.20088	0.0483	L	0.48362	1.52	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.34204	-0.9838	10	0.44086	T	0.13	.	2.5508	0.04748	0.3562:0.0615:0.1954:0.3869	.	1101;1100	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	P	1100;1101	ENSP00000377091:T1100P;ENSP00000258428:T1101P	ENSP00000258428:T1101P	T	-	1	0	REV1	99385867	0.001000	0.12720	0.001000	0.08648	0.870000	0.49936	-0.845000	0.04340	-0.437000	0.07243	0.533000	0.62120	ACT		0.413	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316		8	66	0	0	0	0.00308	0	8	66				
LIMS1	3987	broad.mit.edu	37	2	109292448	109292448	+	Silent	SNP	C	C	T	rs111779374		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:109292448C>T	ENST00000393310.1	+	6	776	c.609C>T	c.(607-609)cgC>cgT	p.R203R	LIMS1_ENST00000332345.6_Silent_p.R203R|LIMS1_ENST00000409441.1_Silent_p.R240R|LIMS1_ENST00000542845.1_Silent_p.R265R|LIMS1_ENST00000410093.1_Silent_p.R207R|LIMS1_ENST00000544547.1_Silent_p.R215R|LIMS1_ENST00000338045.3_Silent_p.R203R|AC010095.5_ENST00000411710.1_RNA	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	203	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						TCGAAGGGCGCGTGGTGAACG	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19736	0.0		0.0	False		,,,				2504	0.0						uc002teg.2		NA																	0					0						c.(607-609)CGC>CGT		LIM and senescent cell antigen-like domains 1							43.0	38.0	40.0					2																	109292448		2203	4300	6503	SO:0001819	synonymous_variant	3987				cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding	g.chr2:109292448C>T		CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.609C>T	2.37:g.109292448C>T			Somatic				LIMS1_uc002tef.2_Silent_p.R215R|LIMS1_uc002teh.2_Silent_p.R203R|LIMS1_uc002tei.2_Silent_p.R203R|LIMS1_uc002tej.2_Silent_p.R240R|LIMS1_uc002tek.3_Silent_p.R265R	p.R203R	NM_004987	NP_004978	WXS	Illumina HiSeq	Unspecified	P48059	LIMS1_HUMAN			6	728	+			203			LIM zinc-binding 4.		B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Silent	SNP	ENST00000393310.1	37	c.609C>T	CCDS2078.1																																																																																				0.537	LIMS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253596.1	NM_004987		8	35	0	0	0	0.00308	0	8	35				
POTEF	728378	broad.mit.edu	37	2	130832520	130832520	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:130832520A>T	ENST00000409914.2	-	17	2924	c.2525T>A	c.(2524-2526)cTg>cAg	p.L842Q	POTEF_ENST00000357462.5_Missense_Mutation_p.L842Q	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	842	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						AGAGGTGTACAGGGACAGCAC	0.587																																							uc010fmh.2		NA																	0				skin(3)|ovary(2)	5						c.(2524-2526)CTG>CAG		prostate, ovary, testis expressed protein on							102.0	122.0	115.0					2																	130832520		2199	4289	6488	SO:0001583	missense	728378					cell cortex	ATP binding	g.chr2:130832520A>T	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2525T>A	2.37:g.130832520A>T	ENSP00000386786:p.Leu842Gln		Somatic					p.L842Q	NM_001099771	NP_001093241	WXS	Illumina HiSeq	Unspecified	A5A3E0	POTEF_HUMAN			17	2925	-			842			Actin-like.		A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	c.2525T>A	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	13.83	2.355325	0.41700	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.97906	-4.6;-4.6	.	.	.	.	.	.	.	.	D	0.99214	0.9727	H	0.99946	5.015	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95957	0.8959	8	0.87932	D	0	.	4.5487	0.12098	0.9994:0.0:6.0E-4:0.0	.	842	A5A3E0	POTEF_HUMAN	Q	842	ENSP00000350052:L842Q;ENSP00000386786:L842Q	ENSP00000350052:L842Q	L	-	2	0	POTEF	130548990	1.000000	0.71417	0.117000	0.21633	0.119000	0.20118	6.182000	0.71995	0.103000	0.17682	0.102000	0.15555	CTG		0.587	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		41	428	0	0	0	0.009718	0	41	428				
NYAP2	57624	broad.mit.edu	37	2	226446708	226446708	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:226446708C>A	ENST00000272907.6	+	4	988	c.575C>A	c.(574-576)cCt>cAt	p.P192H	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	192					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												AAGATTCCTCCTCCCAAACCG	0.473																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(574-576)CCT>CAT		hypothetical protein LOC57624							109.0	113.0	112.0					2																	226446708		1916	4117	6033	SO:0001583	missense	57624							g.chr2:226446708C>A	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.575C>A	2.37:g.226446708C>A	ENSP00000272907:p.Pro192His		Somatic				KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_5'UTR	p.P192H	NM_020864	NP_065915	WXS	Illumina HiSeq	Unspecified	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	750	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	192					A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	c.575C>A	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693422	0.88735	.	.	ENSG00000144460	ENST00000272907	T	0.79845	-1.31	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.90820	0.7117	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90958	0.4810	10	0.87932	D	0	-22.0801	20.3541	0.98825	0.0:1.0:0.0:0.0	.	192	Q9P242	K1486_HUMAN	H	192	ENSP00000272907:P192H	ENSP00000272907:P192H	P	+	2	0	KIAA1486	226154952	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.484000	0.81180	2.816000	0.96949	0.644000	0.83932	CCT		0.473	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		32	161	1	0	3.99451e-17	0.009535	5.52511e-17	32	161				
UGT1A1	54658	broad.mit.edu	37	2	234669637	234669637	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:234669637C>T	ENST00000608383.1	+	1	704	c.704C>T	c.(703-705)tCa>tTa	p.S235L	UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000360418.3_Missense_Mutation_p.S235L|UGT1A1_ENST00000609767.1_Intron|UGT1A8_ENST00000305208.5_Missense_Mutation_p.S235L|UGT1A5_ENST00000373414.3_Intron			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	235					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	ACCCTTGCCTCAGAATTCCTT	0.493																																							uc002vvb.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(703-705)TCA>TTA		UDP glycosyltransferase 1 family, polypeptide A1	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)						162.0	161.0	162.0					2																	234669637		2203	4300	6503	SO:0001583	missense	54658				bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding	g.chr2:234669637C>T	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000608383.1:c.704C>T	2.37:g.234669637C>T	ENSP00000476741:p.Ser235Leu		Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Missense_Mutation_p.S235L	p.S235L	NM_000463	NP_000454	WXS	Illumina HiSeq	Unspecified	P22309	UD11_HUMAN		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	1	719	+		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)	235					A6NJC3|B8K286	Missense_Mutation	SNP	ENST00000608383.1	37	c.704C>T	CCDS2510.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196818	0.38806	.	.	ENSG00000241635	ENST00000305208;ENST00000360418	T;T	0.66099	-0.19;-0.19	5.76	4.83	0.62350	.	.	.	.	.	T	0.81706	0.4879	M	0.88906	2.99	0.09310	N	1	D;D	0.61080	0.989;0.959	D;P	0.67900	0.954;0.833	T	0.74325	-0.3702	9	0.87932	D	0	.	15.4345	0.75133	0.2179:0.7821:0.0:0.0	.	235;235	A6NJC3;P22309	.;UD11_HUMAN	L	235	ENSP00000304845:S235L;ENSP00000353593:S235L	ENSP00000304845:S235L	S	+	2	0	UGT1A1	234334376	0.000000	0.05858	0.703000	0.30354	0.045000	0.14185	-0.215000	0.09279	2.713000	0.92767	0.655000	0.94253	TCA		0.493	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	protein_coding				9	157	0	0	0	0.004482	0	9	157				
TRPM8	79054	broad.mit.edu	37	2	234871956	234871956	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr2:234871956C>G	ENST00000324695.4	+	13	1724	c.1684C>G	c.(1684-1686)Caa>Gaa	p.Q562E	TRPM8_ENST00000433712.2_Missense_Mutation_p.Q250E	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	562					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GCACCCCCTGCAAGCTCTCTT	0.502																																							uc002vvh.2		NA																	0				skin(4)	4						c.(1684-1686)CAA>GAA		transient receptor potential cation channel,	Menthol(DB00825)						92.0	81.0	85.0					2																	234871956		2203	4300	6503	SO:0001583	missense	79054					integral to membrane		g.chr2:234871956C>G	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.1684C>G	2.37:g.234871956C>G	ENSP00000323926:p.Gln562Glu		Somatic				TRPM8_uc010fyj.2_Missense_Mutation_p.Q250E	p.Q562E	NM_024080	NP_076985	WXS	Illumina HiSeq	Unspecified	Q7Z2W7	TRPM8_HUMAN		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	13	1724	+		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)	562			Cytoplasmic (Potential).		A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	c.1684C>G	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469021	0.63625	.	.	ENSG00000144481	ENST00000324695;ENST00000433712	D;D	0.98044	-4.68;-4.68	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000004	D	0.96386	0.8821	M	0.67953	2.075	0.45295	D	0.998295	P;P	0.44006	0.824;0.688	B;B	0.37047	0.24;0.13	D	0.96858	0.9630	10	0.56958	D	0.05	-13.2819	17.8245	0.88660	0.0:1.0:0.0:0.0	.	250;562	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	E	562;250	ENSP00000323926:Q562E;ENSP00000404423:Q250E	ENSP00000323926:Q562E	Q	+	1	0	TRPM8	234536695	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.224000	0.58593	2.614000	0.88457	0.655000	0.94253	CAA		0.502	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080		3	43	0	0	0	0.009096	0	3	43				
TGM3	7053	broad.mit.edu	37	20	2293605	2293605	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:2293605G>T	ENST00000381458.5	+	5	665	c.602G>T	c.(601-603)cGt>cTt	p.R201L		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	201					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)	p.R201H(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	AATTTCCGCCGTGACGCTGCT	0.463																																							uc002wfx.3		NA																	1	Substitution - Missense(1)	p.R201C(1)|p.R201H(1)	large_intestine(1)	large_intestine(4)|ovary(3)|breast(1)|skin(1)	9						c.(601-603)CGT>CTT		transglutaminase 3 precursor	L-Glutamine(DB00130)						174.0	151.0	159.0					20																	2293605		2203	4300	6503	SO:0001583	missense	7053				cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr20:2293605G>T	L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.602G>T	20.37:g.2293605G>T	ENSP00000370867:p.Arg201Leu		Somatic					p.R201L	NM_003245	NP_003236	WXS	Illumina HiSeq	Unspecified	Q08188	TGM3_HUMAN			5	699	+			201					A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	ENST00000381458.5	37	c.602G>T	CCDS33435.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560014	0.45590	.	.	ENSG00000125780	ENST00000381458;ENST00000420960	D	0.88664	-2.41	5.79	5.79	0.91817	.	0.228496	0.45126	D	0.000382	D	0.89448	0.6718	M	0.65975	2.015	0.39674	D	0.970799	D	0.58970	0.984	P	0.49853	0.624	D	0.88718	0.3227	10	0.38643	T	0.18	.	10.9401	0.47268	0.0843:0.0:0.9157:0.0	.	201	Q08188	TGM3_HUMAN	L	201	ENSP00000370867:R201L	ENSP00000370867:R201L	R	+	2	0	TGM3	2241605	0.007000	0.16637	0.997000	0.53966	0.795000	0.44927	0.606000	0.24194	2.759000	0.94783	0.556000	0.70494	CGT		0.463	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245		11	78	1	0	0.000978159	0.010729	0.00107235	11	78				
PAK7	57144	broad.mit.edu	37	20	9546635	9546635	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:9546635C>T	ENST00000378429.3	-	6	1933	c.1387G>A	c.(1387-1389)Gta>Ata	p.V463I	PAK7_ENST00000378423.1_Missense_Mutation_p.V463I|PAK7_ENST00000353224.5_Missense_Mutation_p.V463I	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	463	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.V463L(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GCGATGCATACGATGCCGGTT	0.522																																							uc002wnl.2		NA																	1	Substitution - Missense(1)	p.V463L(1)	lung(1)	lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1387-1389)GTA>ATA		p21-activated kinase 7							256.0	235.0	242.0					20																	9546635		2203	4300	6503	SO:0001583	missense	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9546635C>T	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1387G>A	20.37:g.9546635C>T	ENSP00000367686:p.Val463Ile		Somatic				PAK7_uc002wnk.2_Missense_Mutation_p.V463I|PAK7_uc002wnj.2_Missense_Mutation_p.V463I|PAK7_uc010gby.1_Missense_Mutation_p.V463I	p.V463I	NM_020341	NP_065074	WXS	Illumina HiSeq	Unspecified	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		6	1932	-			463			Protein kinase.|ATP (By similarity).		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	c.1387G>A	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	31	5.102081	0.94245	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.80824	-1.42;-1.42;-1.42	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92136	0.7507	M	0.91354	3.2	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	D	0.93185	0.6578	9	.	.	.	.	19.4019	0.94634	0.0:1.0:0.0:0.0	.	463;463	B0AZM9;Q9P286	.;PAK7_HUMAN	I	463;463;463;411	ENSP00000367686:V463I;ENSP00000322957:V463I;ENSP00000367679:V463I	.	V	-	1	0	PAK7	9494635	1.000000	0.71417	0.990000	0.47175	0.977000	0.68977	7.818000	0.86416	2.568000	0.86640	0.460000	0.39030	GTA		0.522	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			6	143	0	0	0	0.001984	0	6	143				
HNF4A	3172	broad.mit.edu	37	20	43034755	43034755	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:43034755C>T	ENST00000316099.4	+	2	262	c.173C>T	c.(172-174)gCc>gTc	p.A58V	HNF4A_ENST00000457232.1_Missense_Mutation_p.A36V|HNF4A_ENST00000316673.4_Missense_Mutation_p.A36V|MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000609795.1_Missense_Mutation_p.A36V|HNF4A_ENST00000443598.2_Missense_Mutation_p.A58V|HNF4A_ENST00000415691.2_Missense_Mutation_p.A58V	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	58					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGTGTCAGCGCCCTGTGTGCC	0.632																																					Colon(79;2 1269 8820 14841 52347)	Colon(79;2 1269 8820 14841 52347)	uc002xma.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(172-174)GCC>GTC		hepatocyte nuclear factor 4 alpha isoform b							108.0	108.0	108.0					20																	43034755		2203	4300	6503	SO:0001583	missense	3172				blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:43034755C>T	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.173C>T	20.37:g.43034755C>T	ENSP00000312987:p.Ala58Val		Somatic				HNF4A_uc010zwo.1_Missense_Mutation_p.P49S|HNF4A_uc002xlt.2_Missense_Mutation_p.A36V|HNF4A_uc002xlu.2_Missense_Mutation_p.A36V|HNF4A_uc002xlv.2_Missense_Mutation_p.A36V|HNF4A_uc002xly.2_Missense_Mutation_p.A58V|HNF4A_uc002xlz.2_Missense_Mutation_p.A58V|HNF4A_uc010ggq.2_Missense_Mutation_p.A51V	p.A58V	NM_000457	NP_000448	WXS	Illumina HiSeq	Unspecified	P41235	HNF4A_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		2	262	+		Myeloproliferative disorder(115;0.0122)	58			Nuclear receptor.		A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	37	c.173C>T	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	c	14.67	2.603616	0.46423	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94	5.17	5.17	0.71159	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (2);	0.284775	0.39210	N	0.001423	D	0.89364	0.6694	N	0.19112	0.55	0.34868	D	0.743271	B;B;B;B;B;B;B	0.10296	0.003;0.001;0.0;0.002;0.001;0.001;0.002	B;B;B;B;B;B;B	0.18561	0.022;0.003;0.003;0.005;0.014;0.008;0.007	D	0.86718	0.1940	10	0.25106	T	0.35	.	8.8756	0.35343	0.0:0.7706:0.1508:0.0785	.	51;58;58;58;36;36;36	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	V	36;36;58;58;88;58	ENSP00000315180:A36V;ENSP00000396216:A36V;ENSP00000312987:A58V;ENSP00000410911:A58V;ENSP00000412111:A58V	ENSP00000312987:A58V	A	+	2	0	HNF4A	42468169	0.997000	0.39634	1.000000	0.80357	0.983000	0.72400	3.030000	0.49720	2.414000	0.81942	0.645000	0.84053	GCC		0.632	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3			37	133	0	0	0	0.004878	0	37	133				
SALL4	57167	broad.mit.edu	37	20	50407055	50407055	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:50407055G>A	ENST00000217086.4	-	2	2078	c.1967C>T	c.(1966-1968)aCg>aTg	p.T656M	SALL4_ENST00000395997.3_Intron|SALL4_ENST00000371539.3_Intron|SALL4_ENST00000483130.1_5'Flank	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	656					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGGCAGGGGCGTGTTGGGAAT	0.547																																							uc002xwh.3		NA																	0				ovary(2)	2						c.(1966-1968)ACG>ATG		sal-like 4							65.0	56.0	59.0					20																	50407055		2203	4300	6503	SO:0001583	missense	57167				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50407055G>A	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1967C>T	20.37:g.50407055G>A	ENSP00000217086:p.Thr656Met		Somatic				SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	p.T656M	NM_020436	NP_065169	WXS	Illumina HiSeq	Unspecified	Q9UJQ4	SALL4_HUMAN			2	2068	-			656					A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	c.1967C>T	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280939	0.80692	.	.	ENSG00000101115	ENST00000217086	T	0.11604	2.76	5.56	5.56	0.83823	.	0.143577	0.32655	N	0.005801	T	0.32406	0.0828	L	0.59912	1.85	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.00998	-1.1486	10	0.72032	D	0.01	-13.8517	19.5251	0.95201	0.0:0.0:1.0:0.0	.	656	Q9UJQ4	SALL4_HUMAN	M	656	ENSP00000217086:T656M	ENSP00000217086:T656M	T	-	2	0	SALL4	49840462	1.000000	0.71417	0.967000	0.41034	0.959000	0.62525	9.863000	0.99569	2.613000	0.88420	0.561000	0.74099	ACG		0.547	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			5	64	0	0	0	0.001168	0	5	64				
ZNF831	128611	broad.mit.edu	37	20	57766574	57766574	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:57766574C>T	ENST00000371030.2	+	1	500	c.500C>T	c.(499-501)aCg>aTg	p.T167M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	167							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CGGTCCCACACGGGTGAGAGG	0.612																																							uc002yan.2		NA																	0				skin(13)|ovary(1)	14						c.(499-501)ACG>ATG		zinc finger protein 831							80.0	86.0	84.0					20																	57766574		2094	4224	6318	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57766574C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.500C>T	20.37:g.57766574C>T	ENSP00000360069:p.Thr167Met		Somatic					p.T167M	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			1	500	+	all_lung(29;0.0085)		167					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.500C>T	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044792	0.55110	.	.	ENSG00000124203	ENST00000371030	T	0.26373	1.74	5.41	5.41	0.78517	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54727	0.1876	M	0.78801	2.425	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.58901	-0.7554	9	0.87932	D	0	-10.7884	18.1834	0.89786	0.0:1.0:0.0:0.0	.	167	Q5JPB2	ZN831_HUMAN	M	167	ENSP00000360069:T167M	ENSP00000360069:T167M	T	+	2	0	ZNF831	57199969	1.000000	0.71417	0.744000	0.31058	0.064000	0.16182	7.755000	0.85180	2.538000	0.85594	0.561000	0.74099	ACG		0.612	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		8	158	0	0	0	0.00308	0	8	158				
PHACTR3	116154	broad.mit.edu	37	20	58349347	58349347	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:58349347C>T	ENST00000371015.1	+	7	1443	c.976C>T	c.(976-978)Cgt>Tgt	p.R326C	PHACTR3_ENST00000541461.1_Missense_Mutation_p.R285C|PHACTR3_ENST00000355648.4_Missense_Mutation_p.R285C|PHACTR3_ENST00000395639.4_Missense_Mutation_p.R215C|PHACTR3_ENST00000361300.4_Missense_Mutation_p.R215C|PHACTR3_ENST00000359926.3_Missense_Mutation_p.R323C|PHACTR3_ENST00000395636.2_Missense_Mutation_p.R285C	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	326						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GCTGGATGTCCGTCTGTCGAG	0.532																																							uc002yau.2		NA																	0				ovary(2)|pancreas(1)	3						c.(976-978)CGT>TGT		phosphatase and actin regulator 3 isoform 1							63.0	64.0	64.0					20																	58349347		2203	4300	6503	SO:0001583	missense	116154					nuclear matrix	actin binding|protein phosphatase inhibitor activity	g.chr20:58349347C>T	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.976C>T	20.37:g.58349347C>T	ENSP00000360054:p.Arg326Cys		Somatic				PHACTR3_uc002yat.2_Missense_Mutation_p.R323C|PHACTR3_uc010zzw.1_Missense_Mutation_p.R285C|PHACTR3_uc002yav.2_Missense_Mutation_p.R285C|PHACTR3_uc002yaw.2_Missense_Mutation_p.R285C|PHACTR3_uc002yax.2_Missense_Mutation_p.R215C	p.R326C	NM_080672	NP_542403	WXS	Illumina HiSeq	Unspecified	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)		7	1443	+	all_lung(29;0.00344)		326					B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	c.976C>T	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375952	0.61735	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.33438	1.8;1.81;1.41;1.81;1.81;1.81;1.41	5.06	4.12	0.48240	.	0.108809	0.64402	N	0.000004	T	0.49423	0.1556	M	0.74258	2.255	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	P;P;P	0.58873	0.845;0.708;0.847	T	0.53258	-0.8464	10	0.59425	D	0.04	-3.8447	12.4242	0.55538	0.0:0.9191:0.0:0.0808	.	215;326;323	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	C	323;326;215;285;285;285;215	ENSP00000353002:R323C;ENSP00000360054:R326C;ENSP00000379001:R215C;ENSP00000442483:R285C;ENSP00000347866:R285C;ENSP00000378998:R285C;ENSP00000354555:R215C	ENSP00000347866:R285C	R	+	1	0	PHACTR3	57782742	1.000000	0.71417	0.338000	0.25549	0.356000	0.29392	5.111000	0.64628	1.120000	0.41904	0.655000	0.94253	CGT		0.532	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		3	60	0	0	0	0.004672	0	3	60				
DIDO1	11083	broad.mit.edu	37	20	61513083	61513083	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr20:61513083C>T	ENST00000266070.4	-	16	4550	c.4225G>A	c.(4225-4227)Gag>Aag	p.E1409K	DIDO1_ENST00000395343.1_Missense_Mutation_p.E1409K	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1409					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E1409*(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTTTCCACCTCGTGGCGCCGC	0.602																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(3)	6						c.(4225-4227)GAG>AAG		death inducer-obliterator 1 isoform c							75.0	81.0	79.0					20																	61513083		2203	4300	6503	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61513083C>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4225G>A	20.37:g.61513083C>T	ENSP00000266070:p.Glu1409Lys		Somatic				DIDO1_uc002yds.1_Missense_Mutation_p.E1409K	p.E1409K	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			16	4489	-	Breast(26;5.68e-08)		1409					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.4225G>A	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049421	0.55218	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09723	2.95;2.95	5.67	5.67	0.87782	.	0.309842	0.22708	N	0.056604	T	0.09818	0.0241	L	0.50333	1.59	0.40496	D	0.980595	P	0.35226	0.491	B	0.20184	0.028	T	0.05131	-1.0904	10	0.52906	T	0.07	-29.0191	10.8151	0.46571	0.0:0.8859:0.0:0.1141	.	1409	Q9BTC0	DIDO1_HUMAN	K	1409	ENSP00000266070:E1409K;ENSP00000378752:E1409K	ENSP00000266070:E1409K	E	-	1	0	DIDO1	60983528	0.029000	0.19370	0.011000	0.14972	0.001000	0.01503	2.321000	0.43805	2.667000	0.90743	0.563000	0.77884	GAG		0.602	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		13	108	0	0	0	0.00245	0	13	108				
PARVG	64098	broad.mit.edu	37	22	44585089	44585089	+	Silent	SNP	C	C	A	rs149519388		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr22:44585089C>A	ENST00000444313.3	+	6	827	c.343C>A	c.(343-345)Cgg>Agg	p.R115R	PARVG_ENST00000422871.1_Silent_p.R115R|PARVG_ENST00000415224.1_Silent_p.R115R	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	115	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				GGCCGTGAACCGGAGTCTGCA	0.647																																							uc011aqe.1		NA																	0					0						c.(343-345)CGG>AGG		parvin, gamma							107.0	97.0	101.0					22																	44585089		2203	4300	6503	SO:0001819	synonymous_variant	64098				cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr22:44585089C>A	AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.343C>A	22.37:g.44585089C>A			Somatic				PARVG_uc003bep.2_Silent_p.R115R|PARVG_uc011aqf.1_Silent_p.R115R|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	p.R115R	NM_001137605	NP_001131077	WXS	Illumina HiSeq	Unspecified	Q9HBI0	PARVG_HUMAN			6	767	+		Ovarian(80;0.024)|all_neural(38;0.0299)	115			CH 1.		B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Silent	SNP	ENST00000444313.3	37	c.343C>A	CCDS14057.1																																																																																				0.647	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318238.4	NM_022141		11	42	1	0	3.86212e-05	0.008291	4.43096e-05	11	42				
KCNH8	131096	broad.mit.edu	37	3	19575248	19575248	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr3:19575248C>T	ENST00000328405.2	+	16	3247	c.2981C>T	c.(2980-2982)tCa>tTa	p.S994L		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	994	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTTGATTATTCACCTTCCCAC	0.478																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	0				lung(4)|ovary(1)	5						c.(2980-2982)TCA>TTA		potassium voltage-gated channel, subfamily H,							196.0	194.0	195.0					3																	19575248		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19575248C>T	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2981C>T	3.37:g.19575248C>T	ENSP00000328813:p.Ser994Leu		Somatic				KCNH8_uc010hex.1_Missense_Mutation_p.S455L	p.S994L	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			16	3176	+			994			Ser-rich.|Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.2981C>T	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267921	0.59540	.	.	ENSG00000183960	ENST00000328405	D	0.98958	-5.27	5.58	5.58	0.84498	.	0.000000	0.30920	U	0.008620	D	0.96999	0.9020	L	0.42245	1.32	0.80722	D	1	P	0.39282	0.666	B	0.37508	0.252	D	0.96675	0.9499	9	.	.	.	.	19.5672	0.95398	0.0:1.0:0.0:0.0	.	994	Q96L42	KCNH8_HUMAN	L	994	ENSP00000328813:S994L	.	S	+	2	0	KCNH8	19550252	0.997000	0.39634	0.415000	0.26534	0.954000	0.61252	4.029000	0.57253	2.616000	0.88540	0.655000	0.94253	TCA		0.478	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		20	112	0	0	0	0.007413	0	20	112				
MYLK	4638	broad.mit.edu	37	3	123337498	123337498	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr3:123337498A>T	ENST00000475616.1	-	30	5487	c.5488T>A	c.(5488-5490)Tgc>Agc	p.C1830S	MYLK_ENST00000583087.1_Missense_Mutation_p.C70S|MYLK_ENST00000360772.3_Missense_Mutation_p.C1779S|MYLK_ENST00000360304.3_Missense_Mutation_p.C1830S|MYLK_ENST00000346322.5_Missense_Mutation_p.C1761S|MYLK_ENST00000418370.2_Missense_Mutation_p.C70S|MYLK-AS1_ENST00000470449.1_RNA|MYLK_ENST00000359169.1_Missense_Mutation_p.C1779S|MYLK-AS1_ENST00000485162.1_RNA|MYLK_ENST00000354792.5_Missense_Mutation_p.C630S|MYLK-AS1_ENST00000463408.1_RNA|MYLK_ENST00000578202.1_Missense_Mutation_p.C69S			Q15746	MYLK_HUMAN	myosin light chain kinase	1830	Ig-like C2-type 9.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TCAATCTTGCAGTCAAATCTA	0.473																																							uc003ego.2		NA																	0				ovary(6)|skin(2)|stomach(1)	9						c.(5488-5490)TGC>AGC		myosin light chain kinase isoform 1							171.0	162.0	165.0					3																	123337498		2203	4300	6503	SO:0001583	missense	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123337498A>T	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.5488T>A	3.37:g.123337498A>T	ENSP00000418335:p.Cys1830Ser		Somatic				uc003egk.2_Intron|MYLK_uc003egl.2_Missense_Mutation_p.C70S|MYLK_uc003egm.2_Missense_Mutation_p.C69S|MYLK_uc010hrr.2_Missense_Mutation_p.C265S|MYLK_uc011bjv.1_Missense_Mutation_p.C630S|MYLK_uc011bjw.1_Missense_Mutation_p.C1829S|MYLK_uc003egp.2_Missense_Mutation_p.C1761S|MYLK_uc003egq.2_Missense_Mutation_p.C1779S|MYLK_uc003egr.2_Missense_Mutation_p.C1710S|MYLK_uc003egs.2_Missense_Mutation_p.C1654S	p.C1830S	NM_053025	NP_444253	WXS	Illumina HiSeq	Unspecified	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	33	5770	-		Lung NSC(201;0.0496)	1830			Ig-like C2-type 9.		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	c.5488T>A	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.732484	0.89482	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000418370;ENST00000346322;ENST00000354792;ENST00000475616	T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.37	5.37	0.77165	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.86045	0.5839	H	0.97659	4.05	0.80722	D	1	D;P;D;P;D;D	0.89917	1.0;0.945;1.0;0.703;1.0;0.993	D;D;D;P;D;D	0.97110	0.999;0.992;1.0;0.888;0.999;0.996	D	0.90687	0.4610	9	0.87932	D	0	.	14.1107	0.65120	1.0:0.0:0.0:0.0	.	1829;1710;1779;1761;1830;142	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746;Q05D81	.;.;.;.;MYLK_HUMAN;.	S	1779;1830;1779;70;1761;630;1830	ENSP00000354004:C1779S;ENSP00000353452:C1830S;ENSP00000352088:C1779S;ENSP00000428967:C70S;ENSP00000320622:C1761S;ENSP00000346846:C630S;ENSP00000418335:C1830S	ENSP00000320622:C1761S	C	-	1	0	MYLK	124820188	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.404000	0.90210	2.251000	0.74343	0.528000	0.53228	TGC		0.473	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		9	88	0	0	0	0.010729	0	9	88				
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		555	Substitution - Missense(555)	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1624-1626)GAA>AAA		phosphoinositide-3-kinase, catalytic, alpha							56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936082G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E542K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1781	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		542		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1624G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			9	27	0	0	0	0.010729	0	9	27				
MUC4	4585	broad.mit.edu	37	3	195515885	195515885	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr3:195515885C>T	ENST00000463781.3	-	2	3025	c.2566G>A	c.(2566-2568)Gcc>Acc	p.A856T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A856T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	861	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGGGATGGCACCATGACTG	0.577																																							uc011bto.1		NA																	0					0						c.(2566-2568)GCC>ACC		mucin 4 isoform a							67.0	73.0	71.0					3																	195515885		2116	4217	6333	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195515885C>T	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2566G>A	3.37:g.195515885C>T	ENSP00000417498:p.Ala856Thr		Somatic				MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.A738T	p.A856T	NM_018406	NP_060876	WXS	Illumina HiSeq	Unspecified	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	2	3026	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	861			Ser-rich.		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	c.2566G>A	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.253	0.414865	0.11870	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.49139	0.79;0.8	2.78	-3.15	0.05233	.	1.862570	0.03103	N	0.161441	T	0.20495	0.0493	N	0.08118	0	0.09310	N	1	B;B	0.14438	0.01;0.002	B;B	0.13407	0.009;0.001	T	0.20505	-1.0273	10	0.02654	T	1	.	3.2788	0.06908	0.1963:0.3841:0.0:0.4196	.	856;861	E7ESK3;Q99102	.;MUC4_HUMAN	T	856;856;830	ENSP00000417498:A856T;ENSP00000420243:A856T	ENSP00000376209:A830T	A	-	1	0	MUC4	197000280	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.073000	0.14640	-0.657000	0.05373	-1.512000	0.00943	GCC		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		6	45	0	0	0	0.001984	0	6	45				
BTC	685	broad.mit.edu	37	4	75673268	75673268	+	Missense_Mutation	SNP	C	C	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr4:75673268C>G	ENST00000395743.3	-	5	880	c.520G>C	c.(520-522)Gag>Cag	p.E174Q		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	174					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			ATATTTGTCTCTTCAATATCT	0.338																																							uc003hig.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(520-522)GAG>CAG		betacellulin precursor							146.0	146.0	146.0					4																	75673268		2201	4299	6500	SO:0001583	missense	685				positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity	g.chr4:75673268C>G	S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.520G>C	4.37:g.75673268C>G	ENSP00000379092:p.Glu174Gln		Somatic					p.E174Q	NM_001729	NP_001720	WXS	Illumina HiSeq	Unspecified	P35070	BTC_HUMAN	Lung(101;0.219)		5	867	-			174			Cytoplasmic (Potential).		Q96F48	Missense_Mutation	SNP	ENST00000395743.3	37	c.520G>C	CCDS3566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.57|13.57	2.275904|2.275904	0.40294|0.40294	.|.	.|.	ENSG00000174808|ENSG00000174808	ENST00000395743|ENST00000512743	T|.	0.12147|.	2.71|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	0.276731|.	0.30949|.	N|.	0.008556|.	T|T	0.41743|0.41743	0.1172|0.1172	N|N	0.24115|0.24115	0.695|0.695	0.32255|0.32255	N|N	0.570888|0.570888	D|.	0.76494|.	0.999|.	D|.	0.83275|.	0.996|.	T|T	0.47315|0.47315	-0.9127|-0.9127	10|5	0.87932|.	D|.	0|.	-18.5521|-18.5521	14.169|14.169	0.65497|0.65497	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	174|.	P35070|.	BTC_HUMAN|.	Q|N	174|103	ENSP00000379092:E174Q|.	ENSP00000379092:E174Q|.	E|K	-|-	1|3	0|2	BTC|BTC	75892292|75892292	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.047000|0.047000	0.14425|0.14425	2.573000|2.573000	0.46007|0.46007	2.601000|2.601000	0.87937|0.87937	0.655000|0.655000	0.94253|0.94253	GAG|AAG		0.338	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252413.1			3	52	0	0	0	0.004672	0	3	52				
CCSER1	401145	broad.mit.edu	37	4	91230499	91230499	+	Missense_Mutation	SNP	T	T	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr4:91230499T>A	ENST00000509176.1	+	2	1352	c.1064T>A	c.(1063-1065)cTa>cAa	p.L355Q	CCSER1_ENST00000432775.2_Missense_Mutation_p.L355Q|CCSER1_ENST00000333691.8_Missense_Mutation_p.L355Q	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	355																	ATTGCTGAACTACCTGCTACA	0.408																																							uc003hsv.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(1063-1065)CTA>CAA		KIAA1680 protein isoform 1							102.0	96.0	98.0					4																	91230499		1861	4104	5965	SO:0001583	missense	401145							g.chr4:91230499T>A		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1064T>A	4.37:g.91230499T>A	ENSP00000425040:p.Leu355Gln		Somatic				FAM190A_uc003hsu.3_Missense_Mutation_p.L355Q|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.L355Q	p.L355Q	NM_001145065	NP_001138537	WXS	Illumina HiSeq	Unspecified	Q9C0I3	F190A_HUMAN			2	1404	+			355					Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	c.1064T>A	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	T	0.444	-0.897077	0.02472	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.45276	1.44;0.9;1.44	4.45	-2.61	0.06171	.	1.051330	0.07543	N	0.914267	T	0.29288	0.0729	L	0.40543	1.245	0.09310	N	1	P;P;P	0.46220	0.874;0.571;0.571	B;B;B	0.42030	0.277;0.206;0.373	T	0.25882	-1.0119	10	0.52906	T	0.07	0.1451	2.368	0.04324	0.1131:0.2428:0.1155:0.5286	.	355;355;355	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	Q	355	ENSP00000425040:L355Q;ENSP00000389283:L355Q;ENSP00000329482:L355Q	ENSP00000329482:L355Q	L	+	2	0	FAM190A	91449522	0.004000	0.15560	0.000000	0.03702	0.030000	0.12068	0.393000	0.20817	-0.160000	0.11002	0.477000	0.44152	CTA		0.408	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		15	53	0	0	0	0.00499	0	15	53				
PAPSS1	9061	broad.mit.edu	37	4	108578069	108578069	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr4:108578069A>T	ENST00000265174.4	-	7	1150	c.878T>A	c.(877-879)tTt>tAt	p.F293Y	PAPSS1_ENST00000511304.1_5'UTR	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	293					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		AAGACAATCAAAATGAAGGCA	0.393																																							uc003hyk.2		NA																	0				ovary(1)	1						c.(877-879)TTT>TAT		3'-phosphoadenosine 5'-phosphosulfate synthase							106.0	101.0	103.0					4																	108578069		2203	4300	6503	SO:0001583	missense	9061				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity	g.chr4:108578069A>T	Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.878T>A	4.37:g.108578069A>T	ENSP00000265174:p.Phe293Tyr		Somatic				PAPSS1_uc011cfh.1_RNA	p.F293Y	NM_005443	NP_005434	WXS	Illumina HiSeq	Unspecified	O43252	PAPS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)	7	962	-		Hepatocellular(203;0.217)	293			Adenylyl-sulfate kinase.		O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Missense_Mutation	SNP	ENST00000265174.4	37	c.878T>A	CCDS3676.1	.	.	.	.	.	.	.	.	.	.	A	33	5.283288	0.95489	.	.	ENSG00000138801	ENST00000265174	T	0.22945	1.93	6.16	6.16	0.99307	Sulphate adenylyltransferase (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.61085	0.2319	M	0.91818	3.245	0.80722	D	1	D	0.59357	0.985	D	0.74348	0.983	T	0.69555	-0.5114	10	0.72032	D	0.01	-25.8879	16.8061	0.85666	1.0:0.0:0.0:0.0	.	293	O43252	PAPS1_HUMAN	Y	293	ENSP00000265174:F293Y	ENSP00000265174:F293Y	F	-	2	0	PAPSS1	108797518	1.000000	0.71417	0.962000	0.40283	0.988000	0.76386	8.726000	0.91474	2.367000	0.80283	0.528000	0.53228	TTT		0.393	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253946.2			16	48	0	0	0	0.00499	0	16	48				
SLC45A2	51151	broad.mit.edu	37	5	33964049	33964049	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr5:33964049C>A	ENST00000296589.4	-	3	781	c.635G>T	c.(634-636)gGt>gTt	p.G212V	SLC45A2_ENST00000342059.3_Missense_Mutation_p.G153V|SLC45A2_ENST00000382102.3_Missense_Mutation_p.G212V|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000509381.1_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	212					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						GAATTCTGTACCCAACAGTCT	0.473																																					Ovarian(31;380 859 8490 22203 49048)	Ovarian(31;380 859 8490 22203 49048)	uc003jid.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(634-636)GGT>GTT		membrane-associated transporter protein isoform							96.0	93.0	94.0					5																	33964049		2203	4300	6503	SO:0001583	missense	51151				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		g.chr5:33964049C>A	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.635G>T	5.37:g.33964049C>A	ENSP00000296589:p.Gly212Val		Somatic				SLC45A2_uc003jie.2_Missense_Mutation_p.G212V|SLC45A2_uc003jif.3_Intron|SLC45A2_uc011coe.1_Intron	p.G212V	NM_016180	NP_057264	WXS	Illumina HiSeq	Unspecified	Q9UMX9	S45A2_HUMAN			3	727	-			212			Extracellular (Potential).		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	c.635G>T	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241097	0.79912	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;D;D;D	0.92348	-3.02;-2.25;-3.02;-3.02	5.93	5.01	0.66863	Major facilitator superfamily domain, general substrate transporter (1);	0.095529	0.64402	D	0.000001	D	0.95620	0.8576	M	0.85710	2.77	0.80722	D	1	D;D	0.57257	0.963;0.979	P;D	0.63957	0.864;0.92	D	0.94399	0.7621	10	0.34782	T	0.22	-17.5115	14.8588	0.70362	0.1444:0.8556:0.0:0.0	.	212;212	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	V	212;153;212;37	ENSP00000296589:G212V;ENSP00000341014:G153V;ENSP00000371534:G212V;ENSP00000424010:G37V	ENSP00000296589:G212V	G	-	2	0	SLC45A2	33999806	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.141000	0.50593	2.814000	0.96858	0.563000	0.77884	GGT		0.473	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		14	47	1	0	3.27435e-08	0.00245	4.03837e-08	14	47				
TRAPPC13	80006	broad.mit.edu	37	5	64960080	64960080	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr5:64960080C>A	ENST00000399438.3	+	12	1360	c.1015C>A	c.(1015-1017)Ctg>Atg	p.L339M	TRAPPC13_ENST00000231526.4_Missense_Mutation_p.L333M|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.L334M|TRAPPC13_ENST00000438419.2_Missense_Mutation_p.L340M|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.L341M	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	339																	GACTATGGATCTGGTTTTGGA	0.413																																							uc003jtz.3		NA																	0				ovary(1)	1						c.(1015-1017)CTG>ATG		hypothetical protein LOC80006 isoform 2							159.0	156.0	157.0					5																	64960080		1878	4107	5985	SO:0001583	missense	80006							g.chr5:64960080C>A		CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.1015C>A	5.37:g.64960080C>A	ENSP00000382367:p.Leu339Met		Somatic				C5orf44_uc003jua.3_Missense_Mutation_p.L340M|C5orf44_uc003juc.3_Missense_Mutation_p.L333M|C5orf44_uc010iwv.2_Missense_Mutation_p.L334M	p.L339M	NM_024941	NP_079217	WXS	Illumina HiSeq	Unspecified	A5PLN9	CE044_HUMAN			12	1345	+			339					Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	ENST00000399438.3	37	c.1015C>A	CCDS47222.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314024	0.81358	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.93	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.79227	0.4410	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.81252	-0.1017	9	0.87932	D	0	-4.6641	15.4007	0.74838	0.0:0.9326:0.0:0.0674	.	334;333;340;339	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	M	339;340;333;334;341	.	ENSP00000231526:L333M	L	+	1	2	C5orf44	64995836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.004000	0.49513	2.805000	0.96524	0.655000	0.94253	CTG		0.413	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370113.1	NM_024941		24	115	1	0	8.24728e-16	0.004656	1.13018e-15	24	115				
PCDHA11	56138	broad.mit.edu	37	5	140249937	140249937	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr5:140249937G>A	ENST00000398640.2	+	1	1249	c.1249G>A	c.(1249-1251)Gtg>Atg	p.V417M	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	417	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGAGAACGTGTGGGCCTA	0.622																																							uc003lia.2		NA																	0				breast(1)	1						c.(1249-1251)GTG>ATG		protocadherin alpha 11 isoform 1 precursor							160.0	159.0	159.0					5																	140249937		2203	4300	6503	SO:0001583	missense	56138				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140249937G>A	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1249G>A	5.37:g.140249937G>A	ENSP00000381636:p.Val417Met		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.V417M	p.V417M	NM_018902	NP_061725	WXS	Illumina HiSeq	Unspecified	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2107	+			417			Cadherin 4.|Extracellular (Potential).		B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	c.1249G>A	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	G	8.306	0.821032	0.16678	.	.	ENSG00000249158	ENST00000398640	T	0.51574	0.7	5.7	2.99	0.34606	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.48804	0.1520	M	0.71036	2.16	0.09310	N	1	P;P	0.48911	0.877;0.917	B;B	0.44224	0.444;0.223	T	0.38714	-0.9648	9	0.56958	D	0.05	.	8.8792	0.35365	0.2873:0.0:0.7127:0.0	.	417;417	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	M	417	ENSP00000381636:V417M	ENSP00000381636:V417M	V	+	1	0	PCDHA11	140230121	0.000000	0.05858	0.002000	0.10522	0.021000	0.10359	-0.212000	0.09319	0.352000	0.24053	0.563000	0.77884	GTG		0.622	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		12	176	0	0	0	0.013537	0	12	176				
UNC5A	90249	broad.mit.edu	37	5	176301080	176301080	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr5:176301080G>T	ENST00000329542.4	+	7	1272	c.998G>T	c.(997-999)gGg>gTg	p.G333V	UNC5A_ENST00000261961.3_Missense_Mutation_p.G293V	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	333					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGAAGGAGGGGCTGGACTCA	0.632																																							uc003mey.2		NA																	0				skin(1)	1						c.(997-999)GGG>GTG		netrin receptor Unc5h1 precursor							115.0	101.0	106.0					5																	176301080		2203	4300	6503	SO:0001583	missense	90249				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane		g.chr5:176301080G>T	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.998G>T	5.37:g.176301080G>T	ENSP00000332737:p.Gly333Val		Somatic				UNC5A_uc010jkg.1_Missense_Mutation_p.G293V	p.G333V	NM_133369	NP_588610	WXS	Illumina HiSeq	Unspecified	Q6ZN44	UNC5A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		7	1190	+	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	333			Cytoplasmic (Potential).		B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	c.998G>T	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455416	0.84209	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.50277	0.75;1.1	5.29	5.29	0.74685	.	0.110760	0.64402	D	0.000009	T	0.58892	0.2154	L	0.39898	1.24	0.80722	D	1	D;D	0.58970	0.957;0.984	P;P	0.59889	0.865;0.737	T	0.61252	-0.7100	10	0.66056	D	0.02	-30.6587	18.9122	0.92490	0.0:0.0:1.0:0.0	.	293;333	Q6ZN44-3;Q6ZN44	.;UNC5A_HUMAN	V	333;293	ENSP00000332737:G333V;ENSP00000261961:G293V	ENSP00000261961:G293V	G	+	2	0	UNC5A	176233686	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.825000	0.55730	2.481000	0.83766	0.484000	0.47621	GGG		0.632	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300		8	39	1	0	5.4927e-09	0.004482	7.00793e-09	8	39				
UNC5A	90249	broad.mit.edu	37	5	176304986	176304986	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr5:176304986G>A	ENST00000329542.4	+	11	2001	c.1727G>A	c.(1726-1728)gGc>gAc	p.G576D	UNC5A_ENST00000261961.3_Missense_Mutation_p.G536D	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	576					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGCAGCTGGGCCGCTTTGCC	0.667																																							uc003mey.2		NA																	0				skin(1)	1						c.(1726-1728)GGC>GAC		netrin receptor Unc5h1 precursor							31.0	31.0	31.0					5																	176304986		2202	4297	6499	SO:0001583	missense	90249				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane		g.chr5:176304986G>A	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.1727G>A	5.37:g.176304986G>A	ENSP00000332737:p.Gly576Asp		Somatic					p.G576D	NM_133369	NP_588610	WXS	Illumina HiSeq	Unspecified	Q6ZN44	UNC5A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		11	1919	+	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	576			Cytoplasmic (Potential).		B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	c.1727G>A	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551588	0.86127	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.52526	0.66;0.99	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.71417	0.3337	M	0.82823	2.61	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.75722	-0.3218	10	0.87932	D	0	-39.3777	15.7105	0.77623	0.0:0.0:0.8629:0.1371	.	576	Q6ZN44	UNC5A_HUMAN	D	576;536	ENSP00000332737:G576D;ENSP00000261961:G536D	ENSP00000261961:G536D	G	+	2	0	UNC5A	176237592	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.867000	0.99620	2.580000	0.87095	0.555000	0.69702	GGC		0.667	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300		15	36	0	0	0	0.00245	0	15	36				
RMND5B	64777	broad.mit.edu	37	5	177571094	177571094	+	Missense_Mutation	SNP	C	C	G	rs373548331		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr5:177571094C>G	ENST00000515098.1	+	8	1030	c.679C>G	c.(679-681)Cgg>Ggg	p.R227G	RMND5B_ENST00000542098.1_Missense_Mutation_p.R214G|RMND5B_ENST00000313386.4_Missense_Mutation_p.R227G			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	227								p.R227W(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCTTTGCTCGGCTGCACCA	0.637																																							uc003mim.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(679-681)CGG>GGG		required for meiotic nuclear division 5 homolog							35.0	35.0	35.0					5																	177571094		2203	4300	6503	SO:0001583	missense	64777							g.chr5:177571094C>G	BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.679C>G	5.37:g.177571094C>G	ENSP00000420875:p.Arg227Gly		Somatic				RMND5B_uc003min.2_Missense_Mutation_p.R227G|RMND5B_uc003mio.2_Missense_Mutation_p.R214G|RMND5B_uc003mip.2_Missense_Mutation_p.R227G|RMND5B_uc011dgf.1_Missense_Mutation_p.R268G|RMND5B_uc003miq.2_Missense_Mutation_p.R167G	p.R227G	NM_022762	NP_073599	WXS	Illumina HiSeq	Unspecified	Q96G75	RMD5B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		7	859	+	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	227					Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	ENST00000515098.1	37	c.679C>G	CCDS4431.1	.	.	.	.	.	.	.	.	.	.	C	0.315	-0.965542	0.02249	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098	.	.	.	4.41	2.6	0.31112	Ran binding protein-like, CRA domain (1);	0.401733	0.26453	N	0.024289	T	0.15219	0.0367	N	0.11201	0.11	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.12837	0.008;0.004;0.007	T	0.16247	-1.0409	9	0.21014	T	0.42	-10.6598	3.2772	0.06902	0.1766:0.5557:0.1714:0.0963	.	214;214;227	B3KSG5;F5H6G4;Q96G75	.;.;RMD5B_HUMAN	G	227;227;214	.	ENSP00000320623:R227G	R	+	1	2	RMND5B	177503700	0.002000	0.14202	0.386000	0.26170	0.101000	0.19017	1.323000	0.33701	0.473000	0.27368	0.313000	0.20887	CGG		0.637	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1	NM_022762		5	67	0	0	0	0.000602	0	5	67				
GRM4	2914	broad.mit.edu	37	6	34029800	34029800	+	Missense_Mutation	SNP	C	C	T	rs144674222		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr6:34029800C>T	ENST00000538487.2	-	4	1185	c.742G>A	c.(742-744)Gtg>Atg	p.V248M	GRM4_ENST00000374177.3_Missense_Mutation_p.V179M|GRM4_ENST00000544773.2_Missense_Mutation_p.V79M|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000609222.1_Missense_Mutation_p.V115M|GRM4_ENST00000535756.1_Missense_Mutation_p.V115M|GRM4_ENST00000455714.2_Missense_Mutation_p.V108M|GRM4_ENST00000374181.4_Missense_Mutation_p.V248M	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	248					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GCGATGCACACGCCCCCTGCA	0.642																																							uc003oir.3		NA																	0				lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6						c.(742-744)GTG>ATG		glutamate receptor, metabotropic 4 precursor	L-Glutamic Acid(DB00142)	C	MET/VAL	0,4406		0,0,2203	77.0	70.0	72.0		742	4.0	1.0	6	dbSNP_134	72	2,8598	2.2+/-6.3	0,2,4298	no	missense	GRM4	NM_000841.1	21	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	248/913	34029800	2,13004	2203	4300	6503	SO:0001583	missense	2914				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:34029800C>T	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.742G>A	6.37:g.34029800C>T	ENSP00000440556:p.Val248Met		Somatic				GRM4_uc011dsn.1_Missense_Mutation_p.V248M|GRM4_uc010jvh.2_Missense_Mutation_p.V248M|GRM4_uc010jvi.2_Translation_Start_Site|GRM4_uc003oio.2_Translation_Start_Site|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.V108M|GRM4_uc003oiq.2_Missense_Mutation_p.V115M|GRM4_uc011dsm.1_Missense_Mutation_p.V79M	p.V248M	NM_000841	NP_000832	WXS	Illumina HiSeq	Unspecified	Q14833	GRM4_HUMAN			3	912	-			248			Extracellular (Potential).		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	c.742G>A	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415686	0.62511	0.0	2.33E-4	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24;-2.24	4.01	4.01	0.46588	Extracellular ligand-binding receptor (1);	0.344837	0.20953	U	0.082701	D	0.92951	0.7757	M	0.89715	3.055	0.80722	D	1	D;D;D;D;D	0.60575	0.984;0.985;0.985;0.988;0.984	P;P;P;P;P	0.61275	0.722;0.776;0.541;0.475;0.886	D	0.94305	0.7540	10	0.72032	D	0.01	.	16.2241	0.82283	0.0:1.0:0.0:0.0	.	248;79;108;248;115	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	M	248;179;115;79;248;108	ENSP00000363296:V248M;ENSP00000363292:V179M;ENSP00000437925:V115M;ENSP00000437730:V79M;ENSP00000440556:V248M;ENSP00000398456:V108M	ENSP00000363292:V179M	V	-	1	0	GRM4	34137778	0.589000	0.26807	1.000000	0.80357	0.957000	0.61999	1.105000	0.31086	2.219000	0.72066	0.530000	0.56133	GTG		0.642	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			6	51	0	0	0	0.00308	0	6	51				
GFRAL	389400	broad.mit.edu	37	6	55196548	55196548	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr6:55196548C>A	ENST00000340465.2	+	2	144	c.58C>A	c.(58-60)Caa>Aaa	p.Q20K		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	20					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATACACTTCCCAAACCAATAA	0.348																																							uc003pcm.1		NA																	0				ovary(1)|breast(1)	2						c.(58-60)CAA>AAA		GDNF family receptor alpha like precursor							102.0	96.0	98.0					6																	55196548		2203	4300	6503	SO:0001583	missense	389400					integral to membrane	receptor activity	g.chr6:55196548C>A	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.58C>A	6.37:g.55196548C>A	ENSP00000343636:p.Gln20Lys		Somatic					p.Q20K	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		2	144	+	Lung NSC(77;0.0875)|Renal(3;0.122)		20			Extracellular (Potential).		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	c.58C>A	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	7.374	0.627378	0.14257	.	.	ENSG00000187871	ENST00000340465	T	0.30981	1.51	4.92	4.04	0.47022	.	0.557459	0.16766	N	0.200382	T	0.11410	0.0278	M	0.63843	1.955	0.09310	N	1	B	0.32939	0.391	B	0.27380	0.079	T	0.09596	-1.0667	10	0.17369	T	0.5	-7.4202	8.2051	0.31449	0.0:0.8933:0.0:0.1067	.	20	Q6UXV0	GFRAL_HUMAN	K	20	ENSP00000343636:Q20K	ENSP00000343636:Q20K	Q	+	1	0	GFRAL	55304507	0.158000	0.22850	0.335000	0.25508	0.032000	0.12392	1.238000	0.32707	2.283000	0.76528	0.467000	0.42956	CAA		0.348	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		3	31	1	0	6.4e-05	0.004672	7.28615e-05	3	31				
EYS	346007	broad.mit.edu	37	6	66204723	66204723	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr6:66204723C>A	ENST00000370621.3	-	4	1107	c.581G>T	c.(580-582)tGg>tTg	p.W194L	EYS_ENST00000370618.3_Missense_Mutation_p.W194L|EYS_ENST00000342421.5_Missense_Mutation_p.W194L|EYS_ENST00000503581.1_Missense_Mutation_p.W194L|EYS_ENST00000370616.2_Missense_Mutation_p.W194L|EYS_ENST00000393380.2_Missense_Mutation_p.W194L			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	194	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGTCTTGCTCCAAGCTTCACT	0.418																																							uc011dxu.1		NA																	0				lung(4)|ovary(1)|skin(1)	6						c.(580-582)TGG>TTG		eyes shut homolog isoform 1							52.0	49.0	50.0					6																	66204723		2203	4300	6503	SO:0001583	missense	346007				response to stimulus|visual perception	extracellular region	calcium ion binding	g.chr6:66204723C>A		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.581G>T	6.37:g.66204723C>A	ENSP00000359655:p.Trp194Leu		Somatic				EYS_uc003peq.2_Missense_Mutation_p.W194L|EYS_uc003per.1_Missense_Mutation_p.W194L|EYS_uc010kaj.1_RNA	p.W194L	NM_001142800	NP_001136272	WXS	Illumina HiSeq	Unspecified	Q5T1H1	EYS_HUMAN			4	1119	-			194			EGF-like 1.		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37	c.581G>T		.	.	.	.	.	.	.	.	.	.	C	3.743	-0.053081	0.07362	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	4.69	1.7	0.24286	.	.	.	.	.	T	0.60560	0.2278	N	0.19112	0.55	0.09310	N	1	B;P;P	0.38551	0.395;0.582;0.636	B;B;P	0.46049	0.256;0.188;0.502	T	0.58719	-0.7587	9	0.08837	T	0.75	.	3.6159	0.08077	0.1783:0.5675:0.1605:0.0937	.	194;194;194	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	L	194	ENSP00000424243:W194L;ENSP00000359655:W194L;ENSP00000359650:W194L;ENSP00000377042:W194L;ENSP00000341818:W194L;ENSP00000359652:W194L	ENSP00000341818:W194L	W	-	2	0	EYS	66261444	0.679000	0.27596	0.004000	0.12327	0.616000	0.37450	1.210000	0.32370	0.087000	0.17167	0.591000	0.81541	TGG		0.418	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050		5	20	1	0	3.59834e-05	0.001168	4.19334e-05	5	20				
STXBP5	134957	broad.mit.edu	37	6	147581750	147581750	+	Splice_Site	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr6:147581750G>T	ENST00000321680.6	+	5	431		c.e5-1		STXBP5_ENST00000179882.6_Splice_Site|STXBP5_ENST00000546097.1_Splice_Site|STXBP5_ENST00000367481.3_Splice_Site|STXBP5_ENST00000367480.3_Splice_Site	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)						exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TTCTCTTGCAGGGTTACATTT	0.353																																							uc003qlz.2		NA																	0					0						c.e5-1		syntaxin binding protein 5 (tomosyn) isoform b							72.0	72.0	72.0					6																	147581750		2203	4300	6503	SO:0001630	splice_region_variant	134957				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding	g.chr6:147581750G>T	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.432-1G>T	6.37:g.147581750G>T			Somatic				STXBP5_uc010khz.1_Splice_Site_p.R144_splice|STXBP5_uc003qlx.2_Splice_Site|STXBP5_uc003qly.2_Splice_Site	p.R144_splice	NM_001127715	NP_001121187	WXS	Illumina HiSeq	Unspecified	Q5T5C0	STXB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)	5	593	+		Ovarian(120;0.0164)						Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Splice_Site	SNP	ENST00000321680.6	37	c.432_splice	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617972	0.87359	.	.	ENSG00000164506	ENST00000367481;ENST00000546097;ENST00000321680;ENST00000367480	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7112	0.96096	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STXBP5	147623443	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.722000	0.93159	0.655000	0.94253	.		0.353	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		Intron	7	32	1	0	0.00198382	0.001984	0.00211227	7	32				
PDE1C	5137	broad.mit.edu	37	7	31862712	31862712	+	Silent	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:31862712C>T	ENST00000396191.1	-	14	2012	c.1557G>A	c.(1555-1557)gaG>gaA	p.E519E	PDE1C_ENST00000396184.3_Silent_p.E519E|PDE1C_ENST00000396193.1_Silent_p.E579E|PDE1C_ENST00000321453.7_Silent_p.E519E|PDE1C_ENST00000396182.2_Silent_p.E519E|PDE1C_ENST00000479980.1_5'Flank	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	519	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CCCTCCATCTCTCCCGATTGA	0.468																																							uc003tcm.1		NA																	0				skin(3)|central_nervous_system(1)	4						c.(1555-1557)GAG>GAA		phosphodiesterase 1C							199.0	174.0	183.0					7																	31862712		2203	4300	6503	SO:0001819	synonymous_variant	5137				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr7:31862712C>T	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1557G>A	7.37:g.31862712C>T			Somatic				PDE1C_uc003tcn.1_Silent_p.E519E|PDE1C_uc003tco.1_Silent_p.E579E|PDE1C_uc003tcr.2_Silent_p.E519E|PDE1C_uc003tcs.2_Silent_p.E519E	p.E519E	NM_005020	NP_005011	WXS	Illumina HiSeq	Unspecified	Q14123	PDE1C_HUMAN	GBM - Glioblastoma multiforme(11;0.216)		14	2026	-			519			Catalytic (By similarity).		B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	ENST00000396191.1	37	c.1557G>A	CCDS55099.1																																																																																				0.468	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1			12	136	0	0	0	0.003163	0	12	136				
BMPER	168667	broad.mit.edu	37	7	34125511	34125511	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:34125511G>T	ENST00000297161.2	+	14	1926	c.1552G>T	c.(1552-1554)Gat>Tat	p.D518Y	BMPER_ENST00000426693.1_Missense_Mutation_p.D518Y	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	518	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.D518H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTTCAAGTTTGATGTGGATGA	0.483																																							uc011kap.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1552-1554)GAT>TAT		BMP-binding endothelial regulator precursor							186.0	161.0	169.0					7																	34125511		2203	4300	6503	SO:0001583	missense	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34125511G>T		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1552G>T	7.37:g.34125511G>T	ENSP00000297161:p.Asp518Tyr		Somatic					p.D518Y	NM_133468	NP_597725	WXS	Illumina HiSeq	Unspecified	Q8N8U9	BMPER_HUMAN			13	1666	+			518			VWFD.		A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	c.1552G>T	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693553	0.88735	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.21932	1.98;1.98	6.08	6.08	0.98989	von Willebrand factor, type D domain (1);	0.000000	0.85682	D	0.000000	T	0.49898	0.1584	M	0.87038	2.855	0.80722	D	1	D	0.60160	0.987	P	0.56216	0.794	T	0.54364	-0.8305	10	0.72032	D	0.01	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	518	Q8N8U9	BMPER_HUMAN	Y	518	ENSP00000297161:D518Y;ENSP00000393950:D518Y	ENSP00000297161:D518Y	D	+	1	0	BMPER	34092036	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	7.397000	0.79903	2.894000	0.99253	0.655000	0.94253	GAT		0.483	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		17	72	1	0	3.32936e-07	0.006122	4.03889e-07	17	72				
CAMK2B	816	broad.mit.edu	37	7	44298523	44298523	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:44298523G>A	ENST00000395749.2	-	4	299	c.223C>T	c.(223-225)Cgt>Tgt	p.R75C	CAMK2B_ENST00000350811.3_Missense_Mutation_p.R75C|CAMK2B_ENST00000457475.1_Missense_Mutation_p.R75C|CAMK2B_ENST00000358707.3_Missense_Mutation_p.R75C|CAMK2B_ENST00000346990.4_Missense_Mutation_p.R75C|CAMK2B_ENST00000502837.2_Intron|CAMK2B_ENST00000347193.4_Missense_Mutation_p.R75C|CAMK2B_ENST00000353625.4_Missense_Mutation_p.R75C|CAMK2B_ENST00000440254.2_Missense_Mutation_p.R75C|CAMK2B_ENST00000258682.6_Missense_Mutation_p.R75C|CAMK2B_ENST00000395747.2_Missense_Mutation_p.R75C	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	75	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						TCGTGGAGACGCACTGTGGGG	0.612																																							uc003tkq.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(223-225)CGT>TGT		calcium/calmodulin-dependent protein kinase II							93.0	71.0	79.0					7																	44298523		2203	4300	6503	SO:0001583	missense	816				interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr7:44298523G>A	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.223C>T	7.37:g.44298523G>A	ENSP00000379098:p.Arg75Cys		Somatic				CAMK2B_uc003tkp.2_Missense_Mutation_p.R75C|CAMK2B_uc003tkx.2_Missense_Mutation_p.R75C|CAMK2B_uc010kyd.2_RNA|CAMK2B_uc003tkr.2_Missense_Mutation_p.R75C|CAMK2B_uc003tks.2_Missense_Mutation_p.R75C|CAMK2B_uc003tku.2_Missense_Mutation_p.R75C|CAMK2B_uc003tkv.2_Missense_Mutation_p.R75C|CAMK2B_uc003tkt.2_Missense_Mutation_p.R75C|CAMK2B_uc003tkw.2_Missense_Mutation_p.R75C|CAMK2B_uc010kyc.2_Missense_Mutation_p.R75C	p.R75C	NM_001220	NP_001211	WXS	Illumina HiSeq	Unspecified	Q13554	KCC2B_HUMAN			4	433	-			75			Protein kinase.		A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	37	c.223C>T	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040299	0.75732	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747;ENST00000415369;ENST00000424197;ENST00000421607	T;T;T;T;T;T;T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65	4.28	4.28	0.50868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.57932	0.2087	M	0.81682	2.555	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.87578	0.991;0.911;0.967;0.99;0.946;0.995;0.993;0.998;0.993	T	0.65573	-0.6135	9	0.87932	D	0	.	15.6608	0.77186	0.0:0.0:1.0:0.0	.	75;75;75;75;75;75;75;75;75	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2	.;.;.;.;.;.;.;KCC2B_HUMAN;.	C	75;75;75;75;75;75;75;75;75;75;91;75;75	ENSP00000326375:R75C;ENSP00000390292:R75C;ENSP00000379098:R75C;ENSP00000397937:R75C;ENSP00000351542:R75C;ENSP00000326427:R75C;ENSP00000326544:R75C;ENSP00000326518:R75C;ENSP00000258682:R75C;ENSP00000379096:R75C;ENSP00000390419:R91C;ENSP00000400387:R75C;ENSP00000388445:R75C	ENSP00000258682:R75C	R	-	1	0	CAMK2B	44265048	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.665000	0.61547	2.219000	0.72066	0.555000	0.69702	CGT		0.612	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084		8	13	0	0	0	0.004482	0	8	13				
GTF2IRD2P1	401375	broad.mit.edu	37	7	72658037	72658037	+	RNA	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:72658037A>G	ENST00000425256.1	-	0	1874									GTF2I repeat domain containing 2 pseudogene 1																		gtagtacaggaggctaccata	0.517																																							uc003txs.1		NA																	0					0						c.(946-948)CTC>CCC		RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;																																						401375							g.chr7:72658037A>G	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72658037A>G			Somatic				FKBP6_uc003twz.2_Intron	p.L316P	NR_002164		WXS	Illumina HiSeq	Unspecified					13	1875	-									Missense_Mutation	SNP	ENST00000425256.1	37	c.947T>C																																																																																					0.517	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164		8	70	0	0	0	0.006214	0	8	70				
MET	4233	broad.mit.edu	37	7	116412044	116412044	+	Splice_Site	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:116412044G>A	ENST00000318493.6	+	14	3269		c.e14+1		MET_ENST00000397752.3_Splice_Site			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase						apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.982_1028del47(4)|p.?(3)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTCCAGAAGGTATATTTCAG	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		7	Unknown(5)|Deletion - In frame(2)	p.982_1028del47(4)|p.?(2)	lung(5)|stomach(2)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.e14+1		met proto-oncogene isoform b precursor							62.0	57.0	59.0					7																	116412044		1829	4071	5900	SO:0001630	splice_region_variant	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116412044G>A	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3082+1G>A	7.37:g.116412044G>A			Somatic				MET_uc010lkh.2_Splice_Site_p.D1028_splice|MET_uc011knj.1_Splice_Site_p.D580_splice	p.D1010_splice	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		14	3215	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)						A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Splice_Site	SNP	ENST00000318493.6	37	c.3028_splice	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942804	0.73672	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1169	0.97940	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MET	116199280	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	9.238000	0.95380	2.835000	0.97688	0.591000	0.81541	.		0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		Intron	8	22	0	0	0	0.004482	0	8	22				
TAS2R38	5726	broad.mit.edu	37	7	141672764	141672764	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:141672764G>T	ENST00000547270.1	-	1	809	c.726C>A	c.(724-726)caC>caA	p.H242Q		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	242					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GGGCTTTAATGTGGGCCTCCA	0.507																																							uc003vwx.1		NA																	0				kidney(1)|skin(1)	2						c.(724-726)CAC>CAA		taste receptor, type 2, member 38							59.0	61.0	60.0					7																	141672764		2203	4300	6503	SO:0001583	missense	5726				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr7:141672764G>T	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.726C>A	7.37:g.141672764G>T	ENSP00000448219:p.His242Gln		Somatic					p.H242Q	NM_176817	NP_789787	WXS	Illumina HiSeq	Unspecified	P59533	T2R38_HUMAN			1	810	-	Melanoma(164;0.0171)		242			Cytoplasmic (Potential).		A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	37	c.726C>A	CCDS34765.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016823	0.35606	.	.	ENSG00000257138	ENST00000547270	T	0.00976	5.48	5.21	-0.849	0.10723	.	0.069234	0.56097	D	0.000022	T	0.02418	0.0074	M	0.64080	1.96	0.19300	N	0.999971	D	0.58620	0.983	P	0.62382	0.901	T	0.36696	-0.9737	10	0.62326	D	0.03	.	5.1817	0.15163	0.4068:0.1403:0.4529:0.0	.	242	P59533	T2R38_HUMAN	Q	242	ENSP00000448219:H242Q	ENSP00000331291:H242Q	H	-	3	2	TAS2R38	141319233	0.005000	0.15991	0.039000	0.18376	0.556000	0.35491	-0.203000	0.09438	-0.364000	0.08088	-0.140000	0.14226	CAC		0.507	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817		16	50	1	0	2.31682e-05	0.003163	2.72135e-05	16	50				
OR2F1	26211	broad.mit.edu	37	7	143657663	143657663	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr7:143657663G>T	ENST00000392899.1	+	1	637	c.600G>T	c.(598-600)atG>atT	p.M200I	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	200					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TCACCATCATGGTGTCTAGCA	0.473																																							uc003wds.1		NA																	0				skin(2)|ovary(1)	3						c.(598-600)ATG>ATT		olfactory receptor, family 2, subfamily F,							225.0	198.0	207.0					7																	143657663		2203	4300	6503	SO:0001583	missense	26211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143657663G>T	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.600G>T	7.37:g.143657663G>T	ENSP00000376633:p.Met200Ile		Somatic					p.M200I	NM_012369	NP_036501	WXS	Illumina HiSeq	Unspecified	Q13607	OR2F1_HUMAN			1	644	+	Melanoma(164;0.0903)		200			Extracellular (Potential).		A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	37	c.600G>T	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	G	7.076	0.569207	0.13560	.	.	ENSG00000213215	ENST00000392899	T	0.00032	8.88	5.53	3.73	0.42828	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.00109	0.0003	N	0.04148	-0.265	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.40924	-0.9537	10	0.72032	D	0.01	-20.9038	13.8942	0.63761	0.0:0.4455:0.5545:0.0	.	200	Q13607	OR2F1_HUMAN	I	200	ENSP00000376633:M200I	ENSP00000376633:M200I	M	+	3	0	OR2F1	143288596	0.000000	0.05858	0.160000	0.22671	0.477000	0.33069	-0.486000	0.06513	0.880000	0.35969	0.655000	0.94253	ATG		0.473	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1			19	74	1	0	8.34094e-07	0.008871	9.95531e-07	19	74				
DEFA4	1669	broad.mit.edu	37	8	6793542	6793542	+	Nonstop_Mutation	SNP	T	T	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr8:6793542T>A	ENST00000297435.2	-	3	418	c.294A>T	c.(292-294)taA>taT	p.*98Y		NM_001925.1	NP_001916.1	P12838	DEF4_HUMAN	defensin, alpha 4, corticostatin	0					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	10				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CAGCAGAACGTTAATCGACAC	0.488																																							uc003wqu.1		NA																	0				large_intestine(1)	1						c.(292-294)TAA>TAT		defensin, alpha 4 preproprotein							153.0	136.0	142.0					8																	6793542		2203	4300	6503	SO:0001578	stop_lost	1669				defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space		g.chr8:6793542T>A	X65977	CCDS5961.1	8p23.1	2007-02-20			ENSG00000164821	ENSG00000164821		"""Defensins, alpha"""	2763	protein-coding gene	gene with protein product		601157		DEF4		8469233	Standard	NM_001925		Approved	HP-4	uc003wqu.1	P12838	OTTHUMG00000090382	ENST00000297435.2:c.294A>T	8.37:g.6793542T>A			Somatic					p.*98Y	NM_001925	NP_001916	WXS	Illumina HiSeq	Unspecified	P12838	DEF4_HUMAN		COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)	3	345	-			98					Q6EZF8	Nonstop_Mutation	SNP	ENST00000297435.2	37	c.294A>T	CCDS5961.1	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.510533	0.00984	.	.	ENSG00000164821	ENST00000297435	.	.	.	0.387	-0.774	0.10991	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Y	98	.	.	X	-	3	2	DEFA4	6780952	0.116000	0.22171	0.001000	0.08648	0.001000	0.01503	0.000000	0.12993	-0.467000	0.06932	-0.467000	0.05162	TAA		0.488	DEFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206754.1	NM_001925		13	93	0	0	0	0.003163	0	13	93				
WRN	7486	broad.mit.edu	37	8	30938527	30938527	+	Silent	SNP	A	A	T	rs201979783		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr8:30938527A>T	ENST00000298139.5	+	9	1233	c.984A>T	c.(982-984)gtA>gtT	p.V328V		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	328					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CTGGGGGAGTACAACAGAAAC	0.368			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	Ovarian(18;161 598 2706 14834 27543)	uc003xio.3		NA	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Mis|N|F|S	Werner syndrome (RECQL2)			"""L, E, M, O"""		osteosarcoma|meningioma|others			0				ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(982-984)GTA>GTT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner syndrome protein							86.0	86.0	86.0					8																	30938527		2203	4300	6503	SO:0001819	synonymous_variant	7486	Werner_syndrome	Familial Cancer Database	WS, Adult Progeria	base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding	g.chr8:30938527A>T		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.984A>T	8.37:g.30938527A>T			Somatic				WRN_uc011lbd.1_Silent_p.V31V|WRN_uc011lbe.1_5'Flank	p.V328V	NM_000553	NP_000544	WXS	Illumina HiSeq	Unspecified	Q14191	WRN_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	9	1772	+		Breast(100;0.195)	328					A1KYY9	Silent	SNP	ENST00000298139.5	37	c.984A>T	CCDS6082.1																																																																																				0.368	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			6	37	0	0	0	0.001984	0	6	37				
PREX2	80243	broad.mit.edu	37	8	69021837	69021837	+	Missense_Mutation	SNP	T	T	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr8:69021837T>C	ENST00000288368.4	+	25	3402	c.3125T>C	c.(3124-3126)aTg>aCg	p.M1042T		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1042					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GAGGTGGAGATGTGTGTTTGT	0.363																																							uc003xxv.1		NA																	0				skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(3124-3126)ATG>ACG		DEP domain containing 2 isoform a							121.0	119.0	119.0					8																	69021837		2203	4300	6503	SO:0001583	missense	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:69021837T>C	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3125T>C	8.37:g.69021837T>C	ENSP00000288368:p.Met1042Thr		Somatic				PREX2_uc011lez.1_Missense_Mutation_p.M977T	p.M1042T	NM_024870	NP_079146	WXS	Illumina HiSeq	Unspecified	Q70Z35	PREX2_HUMAN			25	3152	+			1042					B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	c.3125T>C	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	T	9.089	1.001355	0.19121	.	.	ENSG00000046889	ENST00000288368	T	0.57436	0.4	5.72	5.72	0.89469	.	.	.	.	.	T	0.19765	0.0475	N	0.00707	-1.245	0.25610	N	0.986509	B	0.02656	0.0	B	0.01281	0.0	T	0.03231	-1.1058	9	0.42905	T	0.14	.	3.7752	0.08657	0.1667:0.1517:0.0:0.6816	.	1042	Q70Z35	PREX2_HUMAN	T	1042	ENSP00000288368:M1042T	ENSP00000288368:M1042T	M	+	2	0	PREX2	69184391	0.833000	0.29383	1.000000	0.80357	0.992000	0.81027	0.833000	0.27504	2.184000	0.69523	0.533000	0.62120	ATG		0.363	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		12	37	0	0	0	0.013537	0	12	37				
C8orf34	116328	broad.mit.edu	37	8	69351791	69351791	+	Missense_Mutation	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr8:69351791G>A	ENST00000539993.1	+	2	676	c.127G>A	c.(127-129)Gac>Aac	p.D43N	C8orf34_ENST00000348340.2_Missense_Mutation_p.D43N|C8orf34_ENST00000337103.4_Missense_Mutation_p.D18N|C8orf34_ENST00000518698.1_Missense_Mutation_p.D129N|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000523686.1_Missense_Mutation_p.D43N			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	43										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			ATTTCTCATTGACCATCTTCA	0.388																																							uc010lyz.2		NA																	0				large_intestine(1)	1						c.(127-129)GAC>AAC		hypothetical protein LOC116328							87.0	84.0	85.0					8																	69351791		2203	4300	6503	SO:0001583	missense	116328				signal transduction		cAMP-dependent protein kinase regulator activity	g.chr8:69351791G>A	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.127G>A	8.37:g.69351791G>A	ENSP00000438159:p.Asp43Asn		Somatic				C8orf34_uc010lyx.1_Missense_Mutation_p.D43N|C8orf34_uc010lyy.1_Missense_Mutation_p.D43N|C8orf34_uc003xyb.2_Missense_Mutation_p.D18N	p.D43N	NM_052958	NP_443190	WXS	Illumina HiSeq	Unspecified	Q49A92	CH034_HUMAN	Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)		2	176	+			43					A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	37	c.127G>A		.	.	.	.	.	.	.	.	.	.	G	20.6	4.012112	0.75046	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000523686;ENST00000348340;ENST00000337103	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;0.68	5.74	4.87	0.63330	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (1);	0.049175	0.85682	D	0.000000	T	0.64940	0.2644	L	0.31294	0.92	0.32198	N	0.57824	B;B;B	0.10296	0.003;0.001;0.003	B;B;B	0.12156	0.007;0.002;0.007	T	0.63786	-0.6558	9	.	.	.	-11.8649	10.6823	0.45821	0.1447:0.0:0.8553:0.0	.	43;43;43	Q49A92;Q49A92-3;Q49A92-5	CH034_HUMAN;.;.	N	129;43;43;43;18	ENSP00000427820:D129N;ENSP00000438159:D43N;ENSP00000429102:D43N;ENSP00000345255:D43N;ENSP00000337174:D18N	.	D	+	1	0	C8orf34	69514345	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.758000	0.62220	1.434000	0.47414	0.557000	0.71058	GAC		0.388	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958		4	29	0	0	0	0.000602	0	4	29				
ZFPM2	23414	broad.mit.edu	37	8	106814552	106814552	+	Nonsense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr8:106814552G>T	ENST00000407775.2	+	8	2492	c.2242G>T	c.(2242-2244)Gag>Tag	p.E748*	RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000378472.4_Nonsense_Mutation_p.E479*|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000520492.1_Nonsense_Mutation_p.E616*|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000517361.1_Nonsense_Mutation_p.E616*|RP11-152P17.2_ENST00000518932.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	748					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GTGCCTACCTGAGCAGGAACA	0.522																																							uc003ymd.2		NA																	0				ovary(4)|large_intestine(1)	5						c.(2242-2244)GAG>TAG		zinc finger protein, multitype 2							49.0	49.0	49.0					8																	106814552		2064	4207	6271	SO:0001587	stop_gained	23414				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding	g.chr8:106814552G>T	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2242G>T	8.37:g.106814552G>T	ENSP00000384179:p.Glu748*		Somatic				ZFPM2_uc011lhs.1_Nonsense_Mutation_p.E479*	p.E748*	NM_012082	NP_036214	WXS	Illumina HiSeq	Unspecified	Q8WW38	FOG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)		8	2265	+			748					Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Nonsense_Mutation	SNP	ENST00000407775.2	37	c.2242G>T	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	37	6.302351	0.97458	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	.	.	.	5.72	5.72	0.89469	.	0.043828	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	.	.	.	X	748;616;616;479	.	ENSP00000367733:E479X	E	+	1	0	ZFPM2	106883728	1.000000	0.71417	0.228000	0.23943	0.680000	0.39746	7.876000	0.87215	2.708000	0.92522	0.561000	0.74099	GAG		0.522	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			4	23	1	0	0.00024832	0.009096	0.000276326	4	23				
TRIB1	10221	broad.mit.edu	37	8	126445584	126445584	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr8:126445584A>T	ENST00000311922.3	+	2	968	c.386A>T	c.(385-387)gAc>gTc	p.D129V	TRIB1_ENST00000519576.1_5'Flank|TRIB1_ENST00000520847.1_5'UTR|TRIB1_ENST00000521778.1_3'UTR	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CACTACCAGGACAAAATCAGG	0.512																																							uc003yrx.2		NA																	0				lung(1)	1						c.(385-387)GAC>GTC		G-protein-coupled receptor induced protein							194.0	202.0	199.0					8																	126445584		2203	4300	6503	SO:0001583	missense	10221				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr8:126445584A>T	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.386A>T	8.37:g.126445584A>T	ENSP00000312150:p.Asp129Val		Somatic				TRIB1_uc011lis.1_5'UTR|TRIB1_uc010mdn.2_5'Flank	p.D129V	NM_025195	NP_079471	WXS	Illumina HiSeq	Unspecified	Q96RU8	TRIB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)		2	968	+	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		129			Protein kinase.			Missense_Mutation	SNP	ENST00000311922.3	37	c.386A>T	CCDS6357.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.464838	0.84425	.	.	ENSG00000173334	ENST00000311922	T	0.73469	-0.75	5.03	5.03	0.67393	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35151	U	0.003419	T	0.73729	0.3624	L	0.31420	0.93	0.80722	D	1	P	0.51147	0.942	P	0.52710	0.707	T	0.77843	-0.2437	10	0.87932	D	0	-23.1384	14.7646	0.69629	1.0:0.0:0.0:0.0	.	129	Q96RU8	TRIB1_HUMAN	V	129	ENSP00000312150:D129V	ENSP00000312150:D129V	D	+	2	0	TRIB1	126514766	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	1.901000	0.55032	0.418000	0.28097	GAC		0.512	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195		30	245	0	0	0	0.003271	0	30	245				
DOCK8	81704	broad.mit.edu	37	9	371489	371489	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr9:371489C>T	ENST00000453981.1	+	17	2042	c.1930C>T	c.(1930-1932)Cac>Tac	p.H644Y	DOCK8_ENST00000469391.1_Missense_Mutation_p.H576Y|DOCK8_ENST00000382331.1_Intron|DOCK8_ENST00000432829.2_Missense_Mutation_p.H576Y|DOCK8_ENST00000382329.1_Missense_Mutation_p.H111Y			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	644	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGTAAATCACCACCTCCTGTT	0.438																																							uc003zgf.2		NA																	0				ovary(3)|central_nervous_system(3)	6						c.(1930-1932)CAC>TAC		dedicator of cytokinesis 8							116.0	105.0	109.0					9																	371489		2203	4300	6503	SO:0001583	missense	81704				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr9:371489C>T	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1930C>T	9.37:g.371489C>T	ENSP00000408464:p.His644Tyr		Somatic				DOCK8_uc010mgu.2_5'UTR|DOCK8_uc010mgv.2_Missense_Mutation_p.H576Y|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Missense_Mutation_p.H102Y|DOCK8_uc003zgh.2_RNA	p.H644Y	NM_203447	NP_982272	WXS	Illumina HiSeq	Unspecified	Q8NF50	DOCK8_HUMAN		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)	17	2042	+		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)	644					A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	c.1930C>T	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976095	0.92982	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.57007	0.2024	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	T	0.60105	-0.7328	10	0.87932	D	0	.	19.8831	0.96905	0.0:1.0:0.0:0.0	.	576;111;644	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	Y	644;644;576;576;111	ENSP00000408464:H644Y;ENSP00000394888:H576Y;ENSP00000419438:H576Y;ENSP00000371766:H111Y	ENSP00000287364:H644Y	H	+	1	0	DOCK8	361489	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.731000	0.84895	2.705000	0.92388	0.655000	0.94253	CAC		0.438	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307		5	65	0	0	0	0.001168	0	5	65				
Unknown	0	broad.mit.edu	37	9	66499891	66499891	+	IGR	SNP	T	T	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr9:66499891T>C								RP11-262H14.1 (30581 upstream) : RP11-262H14.7 (17314 downstream)																							ACCATCGCCATGTACATGAAG	0.572																																							uc004aee.1		NA																	0					0						c.(700-702)ATG>ACG		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499891T>C																													9.37:g.66499891T>C			Somatic				LOC442421_uc004aed.1_RNA	p.M234T			WXS	Illumina HiSeq	Unspecified					1	701	+									Missense_Mutation	SNP		37	c.701T>C																																																																																				0	0.572									4	23	0	0	0	0.013537	0	4	23				
Unknown	0	broad.mit.edu	37	9	66499904	66499904	+	IGR	SNP	C	C	T	rs372946348		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr9:66499904C>T								RP11-262H14.1 (30594 upstream) : RP11-262H14.7 (17301 downstream)																							ACATGAAGGGCGGGTAACCTG	0.542																																							uc004aee.1		NA																	0					0						c.(712-714)GGC>GGT		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499904C>T																													9.37:g.66499904C>T			Somatic				LOC442421_uc004aed.1_RNA	p.G238G			WXS	Illumina HiSeq	Unspecified					1	714	+									Silent	SNP		37	c.714C>T																																																																																				0	0.542									6	19	0	0	0	0.001855	0	6	19				
COL15A1	1306	broad.mit.edu	37	9	101787221	101787221	+	Silent	SNP	T	T	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr9:101787221T>A	ENST00000375001.3	+	15	2343	c.1920T>A	c.(1918-1920)gtT>gtA	p.V640V		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	640	Collagen-like 1.|Triple-helical region 2 (COL2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GAACTGATGTTTTCATGGGAC	0.567																																							uc004azb.1		NA																	0				ovary(6)	6						c.(1918-1920)GTT>GTA		alpha 1 type XV collagen precursor							62.0	64.0	63.0					9																	101787221		2203	4300	6503	SO:0001819	synonymous_variant	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101787221T>A	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1920T>A	9.37:g.101787221T>A			Somatic					p.V640V	NM_001855	NP_001846	WXS	Illumina HiSeq	Unspecified	P39059	COFA1_HUMAN			15	2126	+		Acute lymphoblastic leukemia(62;0.0562)	640			Triple-helical region 2 (COL2).		Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	c.1920T>A	CCDS35081.1																																																																																				0.567	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		11	45	0	0	0	0.008291	0	11	45				
OR1K1	392392	broad.mit.edu	37	9	125562995	125562995	+	Silent	SNP	G	G	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr9:125562995G>A	ENST00000277309.2	+	1	626	c.594G>A	c.(592-594)ctG>ctA	p.L198L		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						ACATCCAGCTGCTCATCTTCA	0.617																																							uc011lze.1		NA																	0				ovary(1)	1						c.(592-594)CTG>CTA		olfactory receptor, family 1, subfamily K,							94.0	80.0	84.0					9																	125562995		2203	4300	6503	SO:0001819	synonymous_variant	392392				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125562995G>A	AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.594G>A	9.37:g.125562995G>A			Somatic					p.L198L	NM_080859	NP_543135	WXS	Illumina HiSeq	Unspecified	Q8NGR3	OR1K1_HUMAN			1	594	+			198			Helical; Name=5; (Potential).		B9EH41|Q4VXB7|Q96R23	Silent	SNP	ENST00000277309.2	37	c.594G>A	CCDS35132.1																																																																																				0.617	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1			13	78	0	0	0	0.001855	0	13	78				
C9orf116	138162	broad.mit.edu	37	9	138391685	138391685	+	Missense_Mutation	SNP	A	A	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr9:138391685A>C	ENST00000429260.2	-	1	33	c.13T>G	c.(13-15)Tgc>Ggc	p.C5G	MRPS2_ENST00000241600.5_5'Flank|MRPS2_ENST00000371785.1_5'Flank|C9orf116_ENST00000371789.3_Missense_Mutation_p.C5G|C9orf116_ENST00000371791.1_Missense_Mutation_p.C5G	NM_001048265.1|NM_144654.2	NP_001041730.1|NP_653255.1	Q5BN46	CI116_HUMAN	chromosome 9 open reading frame 116	5															OV - Ovarian serous cystadenocarcinoma(145;7.39e-08)|Epithelial(140;5.19e-07)|all cancers(34;1.04e-05)		GCTCTGGGGCATTCCTCAGCC	0.706																																							uc004cft.1		NA																	0					0						c.(13-15)TGC>GGC		hypothetical protein LOC138162 isoform 1							9.0	11.0	10.0					9																	138391685		2176	4275	6451	SO:0001583	missense	138162							g.chr9:138391685A>C	BC021261	CCDS6989.1, CCDS43899.1	9q34.3	2012-04-02			ENSG00000160345	ENSG00000160345			28435	protein-coding gene	gene with protein product	"""p53-induced expression 1 in Rb&#8722;/&#8722; cells"""	614502				12477932	Standard	NM_144654		Approved	MGC29761, RbEST47, PIERCE1	uc004cft.1	Q5BN46	OTTHUMG00000020902	ENST00000429260.2:c.13T>G	9.37:g.138391685A>C	ENSP00000395281:p.Cys5Gly		Somatic				C9orf116_uc004cfs.1_Missense_Mutation_p.C5G|C9orf116_uc004cfu.1_RNA|MRPS2_uc004cfv.3_5'Flank|MRPS2_uc004cfw.3_5'Flank|MRPS2_uc004cfx.3_5'Flank|MRPS2_uc010nat.2_5'Flank	p.C5G	NM_001048265	NP_001041730	WXS	Illumina HiSeq	Unspecified	Q5BN46	CI116_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;7.39e-08)|Epithelial(140;5.19e-07)|all cancers(34;1.04e-05)	1	77	-			5					Q5T897|Q8WU44	Missense_Mutation	SNP	ENST00000429260.2	37	c.13T>G	CCDS43899.1	.	.	.	.	.	.	.	.	.	.	A	4.801	0.148911	0.09185	.	.	ENSG00000160345	ENST00000429260;ENST00000371789;ENST00000371791	.	.	.	3.79	-5.8	0.02347	.	3.886250	0.00447	N	0.000086	T	0.14700	0.0355	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08086	-1.0739	9	0.22109	T	0.4	-0.684	1.205	0.01893	0.1286:0.2281:0.2567:0.3866	.	5;5	Q5BN46;Q5BN46-2	CI116_HUMAN;.	G	5	.	ENSP00000360854:C5G	C	-	1	0	C9orf116	137531506	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.145000	0.03194	-0.802000	0.04421	-0.384000	0.06662	TGC		0.706	C9orf116-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054985.2	NM_144654		2	12	0	0	0	0.004672	0	2	12				
ASMT	438	broad.mit.edu	37	X	1746614	1746614	+	Silent	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:1746614C>T	ENST00000381229.4	+	4	429	c.393C>T	c.(391-393)taC>taT	p.Y131Y	ASMT_ENST00000381233.3_Silent_p.Y131Y|ASMT_ENST00000381241.3_Silent_p.Y131Y			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	131					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	GGAACCAGTACCTGGAGACGT	0.378																																							uc004cqd.2		NA																	0				skin(1)	1						c.(391-393)TAC>TAT		acetylserotonin O-methyltransferase							235.0	222.0	226.0					X																	1746614		2203	4296	6499	SO:0001819	synonymous_variant	438				melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity	g.chrX:1746614C>T	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.393C>T	X.37:g.1746614C>T			Somatic				ASMT_uc010ncy.2_Silent_p.Y131Y|ASMT_uc004cqe.2_Silent_p.Y131Y	p.Y131Y	NM_004043	NP_004034	WXS	Illumina HiSeq	Unspecified	P46597	HIOM_HUMAN			5	538	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	131					B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	ENST00000381229.4	37	c.393C>T																																																																																					0.378	ASMT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055612.1	NM_004043		15	157	0	0	0	0.00245	0	15	157				
FAM9A	171482	broad.mit.edu	37	X	8759376	8759376	+	Missense_Mutation	SNP	A	A	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:8759376A>T	ENST00000543214.1	-	9	1110	c.975T>A	c.(973-975)agT>agA	p.S325R	FAM9A_ENST00000381003.3_Missense_Mutation_p.S325R	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	325						nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				CACTTTCTTCACTGGAAGAAA	0.343																																							uc004csg.2		NA																	0					0						c.(973-975)AGT>AGA		family with sequence similarity 9, member A							108.0	90.0	96.0					X																	8759376		2202	4300	6502	SO:0001583	missense	171482					nucleolus		g.chrX:8759376A>T		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.975T>A	X.37:g.8759376A>T	ENSP00000440163:p.Ser325Arg		Somatic					p.S325R	NM_174951	NP_777611	WXS	Illumina HiSeq	Unspecified	Q8IZU1	FAM9A_HUMAN			9	1086	-		Hepatocellular(5;0.219)	325					B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	c.975T>A	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	A	6.436	0.448525	0.12223	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.696	-1.11	0.09840	.	.	.	.	.	T	0.16257	0.0391	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.01281	0.0	T	0.18398	-1.0338	7	0.66056	D	0.02	.	.	.	.	.	325	Q8IZU1	FAM9A_HUMAN	R	325	.	ENSP00000370391:S325R	S	-	3	2	FAM9A	8719376	0.714000	0.27936	0.001000	0.08648	0.012000	0.07955	1.384000	0.34396	-0.409000	0.07553	0.376000	0.23039	AGT		0.343	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	NM_174951		4	24	0	0	0	0.009096	0	4	24				
SRPX	8406	broad.mit.edu	37	X	38020261	38020261	+	Missense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:38020261C>A	ENST00000378533.3	-	6	806	c.700G>T	c.(700-702)Gac>Tac	p.D234Y	SRPX_ENST00000343800.6_Missense_Mutation_p.D221Y|SRPX_ENST00000538295.1_Missense_Mutation_p.D234Y|SRPX_ENST00000479015.1_5'Flank|SRPX_ENST00000432886.2_Missense_Mutation_p.D175Y|TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000544439.1_Missense_Mutation_p.D214Y	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	234	HYR. {ECO:0000255|PROSITE- ProRule:PRU00113}.				autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						ATCTTGTGGTCTCCTTCTGGA	0.418																																							uc004ddy.1		NA																	0					0						c.(700-702)GAC>TAC		sushi-repeat-containing protein, X-linked							108.0	96.0	100.0					X																	38020261		2202	4299	6501	SO:0001583	missense	8406				cell adhesion	cell surface|membrane		g.chrX:38020261C>A	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.700G>T	X.37:g.38020261C>A	ENSP00000367794:p.Asp234Tyr		Somatic				SRPX_uc004ddz.1_Missense_Mutation_p.D214Y|SRPX_uc011mkh.1_Missense_Mutation_p.D175Y|SRPX_uc011mki.1_Missense_Mutation_p.D234Y	p.D234Y	NM_006307	NP_006298	WXS	Illumina HiSeq	Unspecified	P78539	SRPX_HUMAN			6	786	-			234			HYR.		A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Missense_Mutation	SNP	ENST00000378533.3	37	c.700G>T	CCDS14245.1	.	.	.	.	.	.	.	.	.	.	c	13.43	2.234578	0.39498	.	.	ENSG00000101955	ENST00000544439;ENST00000432886;ENST00000538295;ENST00000378533;ENST00000343800	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.86	4.01	0.46588	Hyalin (2);	0.184916	0.56097	D	0.000032	T	0.18635	0.0447	N	0.22421	0.69	0.40250	D	0.978051	B;B;B;B	0.20368	0.009;0.044;0.002;0.015	B;B;B;B	0.22152	0.012;0.038;0.004;0.018	T	0.06127	-1.0844	10	0.48119	T	0.1	-29.703	13.0759	0.59087	0.1244:0.7571:0.1185:0.0	.	234;175;214;234	F5H4D7;B4DQH5;G3V1L0;P78539	.;.;.;SRPX_HUMAN	Y	214;175;234;234;221	ENSP00000440758:D214Y;ENSP00000411165:D175Y;ENSP00000445034:D234Y;ENSP00000367794:D234Y;ENSP00000339211:D221Y	ENSP00000339211:D221Y	D	-	1	0	SRPX	37905205	0.909000	0.30893	1.000000	0.80357	0.987000	0.75469	1.641000	0.37197	2.465000	0.83290	0.597000	0.82753	GAC		0.418	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307		8	52	1	0	0.000157383	0.00308	0.00017646	8	52				
DGKK	139189	broad.mit.edu	37	X	50213490	50213491	+	RNA	DNP	GG	GG	TT			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:50213490_50213491GG>TT	ENST00000376025.2	-	0	246_247							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					ACAGGGACCTGGAGCAAGCTCT	0.668																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(187-189)CCA>AAA		diacylglycerol kinase kappa																																						139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50213490_50213491GG>TT	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6		Exception_encountered	X.37:g.50213490_50213491delinsTT			Somatic					p.P63K	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			1	247_248	-	Ovarian(276;0.236)		63			4.|33 X 4 AA approximate tandem repeats of E-P-A-P.		B2RP91	Missense_Mutation	DNP	ENST00000376025.2	37	c.187_188CC>AA																																																																																					0.668	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		12	137	0	0	0	0.004672	0	12	137				
ERCC6L	54821	broad.mit.edu	37	X	71424945	71424945	+	Silent	SNP	A	A	G			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:71424945A>G	ENST00000334463.3	-	2	3807	c.3672T>C	c.(3670-3672)gtT>gtC	p.V1224V	ERCC6L_ENST00000373657.1_Silent_p.V1101V|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	1224					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					CAAGCGCTTTAACTAAGCAGT	0.373																																							uc004eaq.1		NA																	0				ovary(3)	3						c.(3670-3672)GTT>GTC		excision repair protein ERCC6-like							82.0	72.0	75.0					X																	71424945		2203	4300	6503	SO:0001819	synonymous_variant	54821				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding	g.chrX:71424945A>G	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.3672T>C	X.37:g.71424945A>G			Somatic				PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.V1101V	p.V1224V	NM_017669	NP_060139	WXS	Illumina HiSeq	Unspecified	Q2NKX8	ERC6L_HUMAN			2	3769	-	Renal(35;0.156)		1224			TPR 2.		Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	37	c.3672T>C	CCDS35329.1																																																																																				0.373	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		4	45	0	0	0	0.009096	0	4	45				
TGIF2LX	90316	broad.mit.edu	37	X	89177188	89177188	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:89177188G>T	ENST00000561129.2	+	1	234	c.104G>T	c.(103-105)aGa>aTa	p.R35I	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.R35I			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	35					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						ATCATGTCGAGAAATAACGCA	0.582																																							uc004efe.2		NA																	0				ovary(1)|skin(1)	2						c.(103-105)AGA>ATA		TGFB-induced factor homeobox 2-like, X-linked							22.0	26.0	25.0					X																	89177188		2201	4270	6471	SO:0001583	missense	90316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:89177188G>T	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.104G>T	X.37:g.89177188G>T	ENSP00000453704:p.Arg35Ile		Somatic					p.R35I	NM_138960	NP_620410	WXS	Illumina HiSeq	Unspecified	Q8IUE1	TF2LX_HUMAN			2	153	+			35					Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	c.104G>T	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801714	0.31869	.	.	ENSG00000153779	ENST00000283891	T	0.66099	-0.19	1.76	-0.857	0.10693	.	.	.	.	.	T	0.51669	0.1688	L	0.46157	1.445	0.09310	N	1	P	0.43169	0.8	P	0.45037	0.467	T	0.41734	-0.9492	8	.	.	.	-0.2653	2.1495	0.03796	0.3935:0.3253:0.2812:0.0	.	35	Q8IUE1	TF2LX_HUMAN	I	35	ENSP00000355119:R35I	.	R	+	2	0	TGIF2LX	89063844	0.010000	0.17322	0.000000	0.03702	0.002000	0.02628	1.365000	0.34182	-0.302000	0.08869	0.513000	0.50165	AGA		0.582	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960		10	42	1	0	2.80697e-09	0.010729	3.61245e-09	10	42				
TRPC5	7224	broad.mit.edu	37	X	111195485	111195485	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:111195485G>T	ENST00000262839.2	-	2	1082	c.164C>A	c.(163-165)gCt>gAt	p.A55D		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	55					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GTAGATCTCAGCCTCCTGAAG	0.532																																							uc004epl.1		NA																	0				urinary_tract(1)	1						c.(163-165)GCT>GAT		transient receptor potential cation channel,							121.0	95.0	104.0					X																	111195485		2203	4300	6503	SO:0001583	missense	7224				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chrX:111195485G>T	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.164C>A	X.37:g.111195485G>T	ENSP00000262839:p.Ala55Asp		Somatic				TRPC5_uc004epm.1_Missense_Mutation_p.A55D	p.A55D	NM_012471	NP_036603	WXS	Illumina HiSeq	Unspecified	Q9UL62	TRPC5_HUMAN			2	1083	-			55			Cytoplasmic (Potential).|ANK 1.		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	c.164C>A	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322991	0.81580	.	.	ENSG00000072315	ENST00000262839	T	0.66460	-0.21	5.63	4.76	0.60689	Ankyrin repeat-containing domain (3);	0.102039	0.64402	D	0.000003	T	0.67739	0.2925	L	0.31371	0.925	0.80722	D	1	P;P	0.44478	0.741;0.836	P;P	0.53185	0.72;0.697	T	0.68093	-0.5500	10	0.45353	T	0.12	-6.8541	15.637	0.76963	0.0:0.1342:0.8658:0.0	.	56;55	Q59G51;Q9UL62	.;TRPC5_HUMAN	D	55	ENSP00000262839:A55D	ENSP00000262839:A55D	A	-	2	0	TRPC5	111082141	1.000000	0.71417	0.856000	0.33681	0.992000	0.81027	8.022000	0.88759	1.123000	0.41961	0.600000	0.82982	GCT		0.532	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471		7	91	1	0	8.12818e-05	0.001984	9.18299e-05	7	91				
MAGEC2	51438	broad.mit.edu	37	X	141290803	141290803	+	Missense_Mutation	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:141290803G>T	ENST00000247452.3	-	3	1318	c.971C>A	c.(970-972)aCt>aAt	p.T324N		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	324	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					ACTAGGAACAGTGTTGTTCAG	0.453										HNSCC(46;0.14)																													uc004fbu.1		NA																	0				breast(2)	2						c.(970-972)ACT>AAT		melanoma antigen family C, 2							140.0	126.0	131.0					X																	141290803		2203	4300	6503	SO:0001583	missense	51438					cytoplasm|nucleus		g.chrX:141290803G>T	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.971C>A	X.37:g.141290803G>T	ENSP00000354660:p.Thr324Asn	HNSCC(46;0.14)	Somatic					p.T324N	NM_016249	NP_057333	WXS	Illumina HiSeq	Unspecified	Q9UBF1	MAGC2_HUMAN			3	1319	-	Acute lymphoblastic leukemia(192;6.56e-05)		324			MAGE.		Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	c.971C>A	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	3.835	-0.034899	0.07543	.	.	ENSG00000046774	ENST00000247452	T	0.02525	4.26	0.798	-0.506	0.11989	.	0.432451	0.19567	U	0.111183	T	0.03959	0.0111	M	0.80508	2.5	0.09310	N	1	B	0.29508	0.246	B	0.19946	0.027	T	0.26744	-1.0094	9	0.52906	T	0.07	.	.	.	.	.	324	Q9UBF1	MAGC2_HUMAN	N	324	ENSP00000354660:T324N	ENSP00000354660:T324N	T	-	2	0	MAGEC2	141118469	0.000000	0.05858	0.001000	0.08648	0.107000	0.19398	-0.965000	0.03829	-0.237000	0.09739	0.284000	0.19432	ACT		0.453	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249		27	103	1	0	2.79863e-10	0.004656	3.69819e-10	27	103				
MAMLD1	10046	broad.mit.edu	37	X	149638205	149638205	+	Silent	SNP	G	G	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:149638205G>T	ENST00000370401.2	+	4	670	c.360G>T	c.(358-360)gcG>gcT	p.A120A	MAMLD1_ENST00000426613.2_Silent_p.A95A|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000468306.1_3'UTR|MAMLD1_ENST00000262858.5_Silent_p.A120A|MAMLD1_ENST00000432680.2_Silent_p.A95A			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	120					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CTAGCCCTGCGGCTATGGGAG	0.512																																							uc004fee.1		NA																	0					0						c.(358-360)GCG>GCT		mastermind-like domain containing 1							94.0	88.0	90.0					X																	149638205		2203	4300	6503	SO:0001819	synonymous_variant	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638205G>T	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.360G>T	X.37:g.149638205G>T			Somatic				MAMLD1_uc011mxt.1_Silent_p.A82A|MAMLD1_uc011mxu.1_Silent_p.A95A|MAMLD1_uc011mxv.1_Silent_p.A95A|MAMLD1_uc011mxw.1_Silent_p.A47A	p.A120A	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	436	+	Acute lymphoblastic leukemia(192;6.56e-05)		120					B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	c.360G>T	CCDS14693.2																																																																																				0.512	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		14	104	1	0	2.62699e-14	0.003163	3.56692e-14	14	104				
MAGEA10	4109	broad.mit.edu	37	X	151303721	151303721	+	Silent	SNP	T	T	C			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:151303721T>C	ENST00000370323.4	-	4	688	c.372A>G	c.(370-372)ccA>ccG	p.P124P	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Silent_p.P124P	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	124						nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					ACTCACTGTCTGGCAGGACCT	0.502																																							uc004ffk.2		NA																	0					0						c.(370-372)CCA>CCG		melanoma antigen family A, 10							146.0	141.0	143.0					X																	151303721		2203	4300	6503	SO:0001819	synonymous_variant	4109							g.chrX:151303721T>C		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.372A>G	X.37:g.151303721T>C			Somatic				MAGEA10_uc004ffl.2_Silent_p.P124P	p.P124P	NM_001011543	NP_001011543	WXS	Illumina HiSeq	Unspecified	P43363	MAGAA_HUMAN			5	780	-	Acute lymphoblastic leukemia(192;6.56e-05)		124						Silent	SNP	ENST00000370323.4	37	c.372A>G	CCDS14705.1																																																																																				0.502	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		18	149	0	0	0	0.006122	0	18	149				
GABRQ	55879	broad.mit.edu	37	X	151815621	151815621	+	Nonsense_Mutation	SNP	C	C	A			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:151815621C>A	ENST00000370306.2	+	4	539	c.519C>A	c.(517-519)taC>taA	p.Y173*		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	173					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.Y173Y(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGGTGCGGTACGGCATCCGGT	0.517																																							uc004ffp.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(2)|pancreas(1)	3						c.(517-519)TAC>TAA		gamma-aminobutyric acid (GABA) receptor, theta							145.0	106.0	119.0					X																	151815621		2203	4300	6503	SO:0001587	stop_gained	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151815621C>A	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.519C>A	X.37:g.151815621C>A	ENSP00000359329:p.Tyr173*		Somatic					p.Y173*	NM_018558	NP_061028	WXS	Illumina HiSeq	Unspecified	Q9UN88	GBRT_HUMAN			4	539	+	Acute lymphoblastic leukemia(192;6.56e-05)		173			Extracellular (Potential).		A6NFN1|Q32MB4|Q9NZK8	Nonsense_Mutation	SNP	ENST00000370306.2	37	c.519C>A	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.736414	0.49045	.	.	ENSG00000147402	ENST00000370306	.	.	.	5.19	2.78	0.32641	.	0.000000	0.38837	N	0.001556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4664	0.27324	0.0:0.1861:0.0:0.8139	.	.	.	.	X	173	.	ENSP00000359329:Y173X	Y	+	3	2	GABRQ	151566277	0.989000	0.36119	0.966000	0.40874	0.024000	0.10985	0.220000	0.17660	0.173000	0.19788	-0.460000	0.05396	TAC		0.517	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		5	49	1	0	5.9392e-07	0.001168	7.14635e-07	5	49				
MAGEA12	4111	broad.mit.edu	37	X	151900386	151900386	+	Missense_Mutation	SNP	C	C	T			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chrX:151900386C>T	ENST00000357916.4	-	2	570	c.415G>A	c.(415-417)Gtc>Atc	p.V139I	CSAG1_ENST00000370287.3_5'Flank|MAGEA12_ENST00000393900.3_Missense_Mutation_p.V139I|CSAG1_ENST00000370291.2_5'Flank|MAGEA12_ENST00000393869.3_Missense_Mutation_p.V139I|CSAG4_ENST00000361201.4_RNA|CSAG1_ENST00000452779.2_5'Flank	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	139	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					TTTCTGATGACACTCCCCAGC	0.502																																							uc010ntp.2		NA																	0				skin(1)	1						c.(415-417)GTC>ATC		melanoma antigen family A, 12							150.0	140.0	143.0					X																	151900386		2203	4300	6503	SO:0001583	missense	4111							g.chrX:151900386C>T		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.415G>A	X.37:g.151900386C>T	ENSP00000350592:p.Val139Ile		Somatic				MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.V139I|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	p.V139I	NM_005367	NP_005358	WXS	Illumina HiSeq	Unspecified	P43365	MAGAC_HUMAN			3	769	-	Acute lymphoblastic leukemia(192;6.56e-05)		139			MAGE.		Q9NSD3	Missense_Mutation	SNP	ENST00000357916.4	37	c.415G>A	CCDS14710.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435778	0.25813	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.05513	3.43;3.43;3.43	0.8	0.8	0.18672	.	0.119519	0.56097	N	0.000033	T	0.12817	0.0311	L	0.52266	1.64	0.09310	N	1	P	0.52842	0.956	D	0.65874	0.939	T	0.14144	-1.0483	9	0.19147	T	0.46	.	.	.	.	.	139	P43365	MAGAC_HUMAN	I	139	ENSP00000350592:V139I;ENSP00000377447:V139I;ENSP00000377478:V139I	ENSP00000350592:V139I	V	-	1	0	MAGEA12	151651042	0.000000	0.05858	0.004000	0.12327	0.028000	0.11728	-1.060000	0.03475	0.669000	0.31146	0.171000	0.16805	GTC		0.502	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367		16	181	0	0	0	0.00499	0	16	181				
CEP290	80184	broad.mit.edu	37	12	88512304	88512305	+	Frame_Shift_Ins	INS	-	-	T	rs77980773		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr12:88512304_88512305insT	ENST00000552810.1	-	17	2009_2010	c.1666_1667insA	c.(1666-1668)attfs	p.I556fs	CEP290_ENST00000309041.7_Frame_Shift_Ins_p.I558fs|CEP290_ENST00000397838.3_5'UTR	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	556					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.I558fs*20(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CATTTGACGAATTTTTTTTTTC	0.312																																							uc001tar.2		NA																	1	Insertion - Frameshift(1)		central_nervous_system(1)	ovary(5)|breast(1)|pancreas(1)	7	GRCh37	CD073590	CEP290	D	rs77980773	c.(1666-1668)ATTfs		centrosomal protein 290kDa																																				SO:0001589	frameshift_variant	80184				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding	g.chr12:88512304_88512305insT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1667dupA	12.37:g.88512314_88512314dupT	ENSP00000448012:p.Ile556fs		Somatic				CEP290_uc001tat.2_Frame_Shift_Ins_p.I318fs|CEP290_uc009zsl.1_RNA	p.I556fs	NM_025114	NP_079390	WXS	Illumina HiSeq	Unspecified	O15078	CE290_HUMAN			17	2010_2011	-			556			Potential.		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Ins	INS	ENST00000552810.1	37	c.1666_1667insA	CCDS55858.1																																																																																				0.312	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
SPRY2	10253	broad.mit.edu	37	13	80911047	80911048	+	In_Frame_Ins	INS	-	-	TTT			TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr13:80911047_80911048insTTT	ENST00000377102.1	-	2	1770_1771	c.793_794insAAA	c.(793-795)tgt>tAAAgt	p.265_265C>*S	SPRY2_ENST00000540649.1_In_Frame_Ins_p.265_265C>*S|SPRY2_ENST00000377104.3_In_Frame_Ins_p.265_265C>*S			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	265	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		ACACCATAAACAAGGCAAAAAG	0.49																																							uc001vli.2		NA																	0				ovary(1)|lung(1)	2						c.(793-795)TGT>TAAAGT		sprouty 2																																				SO:0001652	inframe_insertion	10253				epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene expression|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein kinase B signaling cascade	cytosol|microtubule|ruffle membrane	protein serine/threonine kinase activator activity	g.chr13:80911047_80911048insTTT	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.793_794insAAA	13.37:g.80911047_80911048insTTT	ENSP00000366306:p.Cys265delins*Ser		Somatic				SPRY2_uc001vlj.2_In_Frame_Ins_p.265_265C>*S	p.265_265C>*S	NM_005842	NP_005833	WXS	Illumina HiSeq	Unspecified	O43597	SPY2_HUMAN		GBM - Glioblastoma multiforme(99;0.0318)	2	1771_1772	-	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)	265			SPR.|Cys-rich.		B2R9J9|Q5T6Z7	In_Frame_Ins	INS	ENST00000377102.1	37	c.793_794insAAA	CCDS9463.1																																																																																				0.490	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1			10	62	NA	NA	NA	NA	NA	10	62	---	---	---	---
IRX3	79191	broad.mit.edu	37	16	54319061	54319062	+	Frame_Shift_Ins	INS	-	-	C	rs140590187		TCGA-93-7348-01A-21D-2036-08	TCGA-93-7348-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	36be8d78-9b00-4ca6-8cf6-ad665d32ccfe	c63facd4-bde2-440b-b37a-a5a67576d597	g.chr16:54319061_54319062insC	ENST00000329734.3	-	2	1443_1444	c.731_732insG	c.(730-732)ggcfs	p.G244fs		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	244	Asp/Glu-rich (acidic).				mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						cgtcagccaggccctcgccccc	0.678																																					GBM(143;1830 1866 4487 4646 37383)	GBM(143;1830 1866 4487 4646 37383)	uc002eht.1		NA																	0					0						c.(730-732)GGCfs		iroquois homeobox 3																																				SO:0001589	frameshift_variant	79191				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:54319061_54319062insC	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.732dupG	16.37:g.54319064_54319064dupC	ENSP00000331608:p.Gly244fs		Somatic					p.G244fs	NM_024336	NP_077312	WXS	Illumina HiSeq	Unspecified	P78415	IRX3_HUMAN			2	1147_1148	-			244			Asp/Glu-rich (acidic).		Q7Z4A4|Q7Z4A5|Q8IVC6	Frame_Shift_Ins	INS	ENST00000329734.3	37	c.731_732insG	CCDS10750.1																																																																																				0.678	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2			4	9	NA	NA	NA	NA	NA	4	9	---	---	---	---
