#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CHD5	26038	broad.mit.edu	37	1	6186638	6186638	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:6186638C>A	ENST00000262450.3	-	26	4171	c.4072G>T	c.(4072-4074)Gac>Tac	p.D1358Y	CHD5_ENST00000378021.1_Missense_Mutation_p.D215Y	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GCACCCTGGTCCTCCTGGGAG	0.672																																							uc001amb.1		NA																	0				central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12						c.(4072-4074)GAC>TAC		chromodomain helicase DNA binding protein 5							63.0	45.0	51.0					1																	6186638		2203	4300	6503	SO:0001583	missense	26038				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	g.chr1:6186638C>A	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.4072G>T	1.37:g.6186638C>A	ENSP00000262450:p.Asp1358Tyr		Somatic				CHD5_uc001alz.1_Missense_Mutation_p.D215Y|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	p.D1358Y	NM_015557	NP_056372	WXS	Illumina HiSeq	Unspecified	Q8TDI0	CHD5_HUMAN		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	26	4172	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	1358					A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	c.4072G>T	CCDS57.1	.	.	.	.	.	.	.	.	.	.	C	34	5.303241	0.95601	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.92199	-2.99;2.0	4.5	4.5	0.54988	Domain of unknown function DUF1087 (1);	0.000000	0.85682	D	0.000000	D	0.95105	0.8414	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.961	D	0.95695	0.8744	10	0.72032	D	0.01	-37.2401	17.5905	0.87994	0.0:1.0:0.0:0.0	.	1358;215	Q8TDI0;Q5TG85	CHD5_HUMAN;.	Y	1358;874;215;766;766;215	ENSP00000262450:D1358Y;ENSP00000367260:D215Y	ENSP00000262450:D1358Y	D	-	1	0	CHD5	6109225	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.307000	0.78920	2.226000	0.72624	0.561000	0.74099	GAC		0.672	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		29	44	1	0	1.22384e-17	0.002836	1.48857e-17	29	44				
CLSTN1	22883	broad.mit.edu	37	1	9790694	9790694	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:9790694C>T	ENST00000377298.4	-	19	3610	c.2818G>A	c.(2818-2820)Gaa>Aaa	p.E940K	CLSTN1_ENST00000477264.1_5'UTR|CLSTN1_ENST00000377288.3_Missense_Mutation_p.E921K|CLSTN1_ENST00000361311.4_Missense_Mutation_p.E930K	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	940	Glu-rich (highly acidic).				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCCTCTTCTTCGCCGTCCTCG	0.622																																							uc001aqh.2		NA																	0				skin(1)	1						c.(2818-2820)GAA>AAA		calsyntenin 1 isoform 1							108.0	79.0	89.0					1																	9790694		2203	4300	6503	SO:0001583	missense	22883				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding	g.chr1:9790694C>T	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.2818G>A	1.37:g.9790694C>T	ENSP00000366513:p.Glu940Lys		Somatic				CLSTN1_uc001aqi.2_Missense_Mutation_p.E930K|CLSTN1_uc010oag.1_Missense_Mutation_p.E921K|CLSTN1_uc001aqf.2_Missense_Mutation_p.E204K	p.E940K	NM_001009566	NP_001009566	WXS	Illumina HiSeq	Unspecified	O94985	CSTN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)	19	3577	-	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	940			Glu-rich (highly acidic).|Cytoplasmic (Potential).		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	ENST00000377298.4	37	c.2818G>A	CCDS30580.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715652	0.48622	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.05717	3.4;3.4;3.4;3.4	5.18	5.18	0.71444	.	0.358364	0.28001	N	0.016999	T	0.07728	0.0194	L	0.46157	1.445	0.80722	D	1	P;P;P;B	0.43909	0.555;0.821;0.727;0.373	B;B;B;B	0.33339	0.038;0.162;0.078;0.052	T	0.13548	-1.0505	10	0.66056	D	0.02	-24.4153	18.2961	0.90146	0.0:1.0:0.0:0.0	.	921;930;940;295	B4E3Q1;O94985-2;O94985;B3KMD3	.;.;CSTN1_HUMAN;.	K	940;930;741;921;921	ENSP00000366513:E940K;ENSP00000354997:E930K;ENSP00000401934:E741K;ENSP00000366502:E921K	ENSP00000354997:E930K	E	-	1	0	CLSTN1	9713281	1.000000	0.71417	0.902000	0.35471	0.028000	0.11728	5.870000	0.69620	2.419000	0.82065	0.651000	0.88453	GAA		0.622	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1			16	40	0	0	0	0.008871	0	16	40				
TNFRSF1B	7133	broad.mit.edu	37	1	12252977	12252977	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:12252977G>T	ENST00000376259.3	+	6	698	c.609G>T	c.(607-609)acG>acT	p.T203T	MIR4632_ENST00000584158.1_RNA|TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	203					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GCACGTCCACGTCCCCCACCC	0.622																																							uc001att.2		NA																	0				liver(1)|central_nervous_system(1)|skin(1)	3						c.(607-609)ACG>ACT		tumor necrosis factor receptor 2 precursor	Etanercept(DB00005)|Infliximab(DB00065)						159.0	118.0	132.0					1																	12252977		2203	4300	6503	SO:0001819	synonymous_variant	7133				apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity	g.chr1:12252977G>T	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.609G>T	1.37:g.12252977G>T			Somatic				TNFRSF1B_uc001atu.2_Silent_p.T8T|TNFRSF1B_uc009vnk.2_RNA	p.T203T	NM_001066	NP_001057	WXS	Illumina HiSeq	Unspecified	P20333	TNR1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	6	698	+	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	203			Extracellular (Potential).		B1AJZ3|Q16042|Q6YI29|Q9UIH1	Silent	SNP	ENST00000376259.3	37	c.609G>T	CCDS145.1																																																																																				0.622	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066		16	44	1	0	6.44725e-10	0.002299	7.25052e-10	16	44				
SYF2	25949	broad.mit.edu	37	1	25549784	25549784	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:25549784C>G	ENST00000236273.4	-	7	730	c.705G>C	c.(703-705)caG>caC	p.Q235H	SYF2_ENST00000354361.3_Missense_Mutation_p.Q193H	NM_015484.4	NP_056299.1	O95926	SYF2_HUMAN	SYF2 pre-mRNA-splicing factor	235					embryonic organ development (GO:0048568)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|mitotic G2 DNA damage checkpoint (GO:0007095)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(4)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		TTTCCAAATTCTGTTTAATTT	0.338																																							uc001bjt.1		NA																	0					0						c.(703-705)CAG>CAC		SYF2 homolog, RNA splicing factor isoform 1							154.0	156.0	155.0					1																	25549784		2202	4300	6502	SO:0001583	missense	25949					catalytic step 2 spliceosome		g.chr1:25549784C>G	AF273089	CCDS258.1, CCDS259.1	1p36.11	2013-08-21	2013-08-21	2005-09-14	ENSG00000117614	ENSG00000117614			19824	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 29"""	607090	"""CCNDBP1 interactor"", ""SYF2 homolog, RNA splicing factor (S. cerevisiae)"""	CBPIN		11118353	Standard	NM_207170		Approved	p29, DKFZp564O2082, NTC31, fSAP29	uc001bjt.1	O95926	OTTHUMG00000043610	ENST00000236273.4:c.705G>C	1.37:g.25549784C>G	ENSP00000236273:p.Gln235His		Somatic				SYF2_uc001bju.1_Missense_Mutation_p.Q193H	p.Q235H	NM_015484	NP_056299	WXS	Illumina HiSeq	Unspecified	O95926	SYF2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)	7	760	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	235					Q5TH73	Missense_Mutation	SNP	ENST00000236273.4	37	c.705G>C	CCDS259.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442216	0.63067	.	.	ENSG00000117614	ENST00000236273;ENST00000354361	T;T	0.49720	0.77;0.83	5.32	2.12	0.27331	.	0.000000	0.85682	D	0.000000	T	0.69628	0.3132	M	0.90650	3.135	0.80722	D	1	D;D	0.67145	0.996;0.991	D;D	0.72338	0.977;0.94	T	0.72534	-0.4264	10	0.62326	D	0.03	-11.389	9.9408	0.41578	0.0:0.7661:0.0:0.2339	.	235;235	B2RBX8;O95926	.;SYF2_HUMAN	H	235;193	ENSP00000236273:Q235H;ENSP00000346330:Q193H	ENSP00000236273:Q235H	Q	-	3	2	SYF2	25422371	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.216000	0.32443	0.621000	0.30232	0.655000	0.94253	CAG		0.338	SYF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101962.1	NM_015484		28	77	0	0	0	0.008361	0	28	77				
KIAA1522	57648	broad.mit.edu	37	1	33237907	33237907	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:33237907C>G	ENST00000373480.1	+	6	3053	c.2950C>G	c.(2950-2952)Cga>Gga	p.R984G	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.R1043G|YARS_ENST00000469100.1_5'Flank|KIAA1522_ENST00000373481.3_Missense_Mutation_p.R995G	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	984	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CAGTTACCCTCGAGCTGAGCC	0.662																																							uc001bvv.2		NA																	0					0						c.(2950-2952)CGA>GGA		hypothetical protein LOC57648							34.0	39.0	37.0					1																	33237907		1897	4106	6003	SO:0001583	missense	57648							g.chr1:33237907C>G	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2950C>G	1.37:g.33237907C>G	ENSP00000362579:p.Arg984Gly		Somatic				KIAA1522_uc001bvu.1_Missense_Mutation_p.R1043G|KIAA1522_uc010ohm.1_Missense_Mutation_p.R995G|KIAA1522_uc010ohn.1_Intron	p.R984G	NM_020888	NP_065939	WXS	Illumina HiSeq	Unspecified	Q9P206	K1522_HUMAN			6	3086	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)	984			Pro-rich.		B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	c.2950C>G	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.281258	0.40394	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.12147	2.71;2.71;2.72	4.6	0.301	0.15781	.	0.389852	0.21645	N	0.071278	T	0.09905	0.0243	L	0.47716	1.5	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.003	T	0.22977	-1.0201	10	0.38643	T	0.18	-6.5059	3.9612	0.09412	0.4974:0.2883:0.1326:0.0817	.	995;984;1043	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	G	1043;995;984	ENSP00000383851:R1043G;ENSP00000362580:R995G;ENSP00000362579:R984G	ENSP00000362579:R984G	R	+	1	2	KIAA1522	33010494	0.000000	0.05858	0.271000	0.24616	0.495000	0.33615	-0.150000	0.10189	-0.030000	0.13804	-0.145000	0.13849	CGA		0.662	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1			20	77	0	0	0	0.00278	0	20	77				
CSMD2	114784	broad.mit.edu	37	1	34190196	34190197	+	Missense_Mutation	DNP	CG	CG	GA	rs373711523		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:34190196_34190197CG>GA	ENST00000373381.4	-	18	2980_2981	c.2804_2805CG>TC	c.(2803-2805)tCG>tTC	p.S935F		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	895	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATGTGTAGCCCGAGTCACAGCT	0.589																																							uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(2683-2685)TCG>TTC		CUB and Sushi multiple domains 2																																				SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34190196_34190197CG>GA	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2804_2805delinsGA	1.37:g.34190196_34190197delinsGA	ENSP00000362479:p.Ser935Phe		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.S935F	p.S895F	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			18	2713_2714	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	895			Sushi 5.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	DNP	ENST00000373381.4	37	c.2684_2685CG>TC																																																																																					0.589	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		24	64	0	0	0	0.004672	0	24	64				
CSF3R	1441	broad.mit.edu	37	1	36939405	36939405	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:36939405C>G	ENST00000373106.1	-	5	992	c.445G>C	c.(445-447)Gag>Cag	p.E149Q	CSF3R_ENST00000418048.2_Missense_Mutation_p.E149Q|CSF3R_ENST00000331941.5_Missense_Mutation_p.E149Q|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000440588.2_Missense_Mutation_p.E149Q|CSF3R_ENST00000338937.5_Missense_Mutation_p.E149Q|CSF3R_ENST00000361632.4_Missense_Mutation_p.E149Q|CSF3R_ENST00000373103.1_Missense_Mutation_p.E149Q|CSF3R_ENST00000373104.1_Missense_Mutation_p.E149Q	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	149	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	AGGTGGGTCTCAGGTCCTGGC	0.597																																							uc001caw.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(445-447)GAG>CAG		colony stimulating factor 3 receptor isoform a	Filgrastim(DB00099)|Pegfilgrastim(DB00019)						110.0	104.0	106.0					1																	36939405		2203	4300	6503	SO:0001583	missense	1441				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity	g.chr1:36939405C>G	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.445G>C	1.37:g.36939405C>G	ENSP00000362198:p.Glu149Gln		Somatic				CSF3R_uc009vvc.1_5'Flank|CSF3R_uc001cau.1_5'Flank|CSF3R_uc001cav.1_Missense_Mutation_p.E149Q|CSF3R_uc001cax.1_Missense_Mutation_p.E149Q|CSF3R_uc001cay.1_Missense_Mutation_p.E149Q	p.E149Q	NM_000760	NP_000751	WXS	Illumina HiSeq	Unspecified	Q99062	CSF3R_HUMAN			5	623	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	149			Fibronectin type-III 1.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000373106.1	37	c.445G>C	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797150	0.31777	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.52	-3.07	0.05363	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.023180	0.07740	N	0.946732	T	0.31358	0.0794	L	0.49571	1.57	0.09310	N	1	P;P;B;P	0.47604	0.747;0.468;0.215;0.898	B;B;B;B	0.43680	0.185;0.229;0.081;0.427	T	0.35674	-0.9779	10	0.30078	T	0.28	-0.3417	8.4077	0.32625	0.0:0.3876:0.1059:0.5065	.	149;149;149;149	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	Q	149	ENSP00000362198:E149Q;ENSP00000362196:E149Q;ENSP00000362195:E149Q;ENSP00000355406:E149Q;ENSP00000332180:E149Q;ENSP00000401588:E149Q;ENSP00000345013:E149Q;ENSP00000397568:E149Q	ENSP00000332180:E149Q	E	-	1	0	CSF3R	36711992	0.000000	0.05858	0.000000	0.03702	0.777000	0.43975	-0.836000	0.04382	-0.447000	0.07138	-0.192000	0.12808	GAG		0.597	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039		20	54	0	0	0	0.008871	0	20	54				
ZC3H12A	80149	broad.mit.edu	37	1	37947399	37947399	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:37947399G>A	ENST00000373087.6	+	4	897	c.781G>A	c.(781-783)Gag>Aag	p.E261K		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCGCTTCATCGAGGAGCGGCT	0.572																																							uc001cbb.3		NA																	0				ovary(2)	2						c.(781-783)GAG>AAG		zinc finger CCCH-type containing 12A							120.0	107.0	112.0					1																	37947399		2203	4300	6503	SO:0001583	missense	80149				angiogenesis|apoptosis|cell differentiation	cytoplasm|nucleus|plasma membrane	endonuclease activity|metal ion binding	g.chr1:37947399G>A		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.781G>A	1.37:g.37947399G>A	ENSP00000362179:p.Glu261Lys		Somatic				ZC3H12A_uc001cbc.1_5'UTR	p.E261K	NM_025079	NP_079355	WXS	Illumina HiSeq	Unspecified	Q5D1E8	ZC12A_HUMAN			4	931	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	261						Missense_Mutation	SNP	ENST00000373087.6	37	c.781G>A	CCDS417.1	.	.	.	.	.	.	.	.	.	.	G	37	6.120763	0.97300	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.42900	0.96	5.8	5.8	0.92144	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.63450	0.2512	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	D	0.68943	0.961	T	0.59894	-0.7368	10	0.45353	T	0.12	-43.0166	20.063	0.97692	0.0:0.0:1.0:0.0	.	261	Q5D1E8	ZC12A_HUMAN	K	261	ENSP00000362179:E261K	ENSP00000362174:E261K	E	+	1	0	ZC3H12A	37719986	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.735000	0.93741	0.655000	0.94253	GAG		0.572	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079		14	22	0	0	0	0.003163	0	14	22				
MACF1	23499	broad.mit.edu	37	1	39888568	39888568	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:39888568A>C	ENST00000372915.3	+	59	16247	c.16160A>C	c.(16159-16161)cAg>cCg	p.Q5387P	MACF1_ENST00000545844.1_Missense_Mutation_p.Q3320P|MACF1_ENST00000567887.1_Missense_Mutation_p.Q5419P|MACF1_ENST00000361689.2_Missense_Mutation_p.Q3320P|MACF1_ENST00000564288.1_Missense_Mutation_p.Q5382P|MACF1_ENST00000539005.1_Missense_Mutation_p.Q3299P|MACF1_ENST00000317713.7_Missense_Mutation_p.Q3320P|MACF1_ENST00000289893.4_Missense_Mutation_p.Q3822P			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5387					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATCCAAGAACAGAAGGTAAGT	0.448																																							uc010oiu.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(11464-11466)CAG>CCG		microfilament and actin filament cross-linker							57.0	58.0	58.0					1																	39888568		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39888568A>C	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16160A>C	1.37:g.39888568A>C	ENSP00000362006:p.Gln5387Pro		Somatic				MACF1_uc010ois.1_Missense_Mutation_p.Q3320P|MACF1_uc001cda.1_Missense_Mutation_p.Q3207P|MACF1_uc001cdc.1_Missense_Mutation_p.Q2386P	p.Q3822P	NM_033044	NP_149033	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		24	11596	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	5387			Spectrin 7.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.11465A>C		.	.	.	.	.	.	.	.	.	.	A	25.5	4.647787	0.87958	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000482035	T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000014	T	0.73931	0.3650	M	0.88310	2.945	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.994	T	0.77335	-0.2626	10	0.46703	T	0.11	.	16.4311	0.83844	1.0:0.0:0.0:0.0	.	5387;3320;3264	Q9UPN3;F8W8Q1;Q9UPN3-3	MACF1_HUMAN;.;.	P	3320;5387;3320;3320;3299;3822;136	ENSP00000439537:Q3320P;ENSP00000362006:Q5387P;ENSP00000354573:Q3320P;ENSP00000313438:Q3320P;ENSP00000444364:Q3299P;ENSP00000289893:Q3822P;ENSP00000433104:Q136P	ENSP00000289893:Q3822P	Q	+	2	0	MACF1	39661155	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.335000	0.96500	2.277000	0.76020	0.528000	0.53228	CAG		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		12	27	0	0	0	0.001855	0	12	27				
CCDC17	149483	broad.mit.edu	37	1	46085982	46085982	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:46085982G>A	ENST00000528266.1	-	13	1981	c.1834C>T	c.(1834-1836)Cac>Tac	p.H612Y	CCDC17_ENST00000421127.2_Missense_Mutation_p.H603Y|CCDC17_ENST00000343901.2_Missense_Mutation_p.H580Y|CCDC17_ENST00000445048.2_Missense_Mutation_p.H100Y|CCDC17_ENST00000464739.1_5'Flank			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	612										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					GAACTGTGGTGAGGGCCCAAA	0.552																																							uc010olt.1		NA																	0				ovary(1)	1						c.(1834-1836)CAC>TAC		coiled-coil domain containing 17							47.0	42.0	44.0					1																	46085982		2203	4300	6503	SO:0001583	missense	149483							g.chr1:46085982G>A		CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.1834C>T	1.37:g.46085982G>A	ENSP00000432172:p.His612Tyr		Somatic				CCDC17_uc009vxy.2_Missense_Mutation_p.H580Y|CCDC17_uc010ols.1_Missense_Mutation_p.H603Y|CCDC17_uc001com.3_Missense_Mutation_p.H433Y|CCDC17_uc001con.3_RNA|CCDC17_uc009vxz.2_Missense_Mutation_p.H100Y	p.H612Y	NM_001114938	NP_001108410	WXS	Illumina HiSeq	Unspecified	Q96LX7	CCD17_HUMAN			13	1982	-	Acute lymphoblastic leukemia(166;0.155)		612					A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Missense_Mutation	SNP	ENST00000528266.1	37	c.1834C>T	CCDS44131.2	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690212	0.29962	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266;ENST00000445048	T;T;T;T	0.44083	2.22;2.22;2.22;0.93	4.33	1.29	0.21616	.	.	.	.	.	T	0.30665	0.0772	N	0.24115	0.695	0.09310	N	1	P;P;P	0.49447	0.924;0.924;0.924	P;P;P	0.47981	0.563;0.563;0.563	T	0.13683	-1.0500	9	0.66056	D	0.02	.	2.9955	0.05997	0.099:0.1773:0.5408:0.183	.	612;603;100	Q96LX7;Q96LX7-5;Q96LX7-3	CCD17_HUMAN;.;.	Y	603;580;612;100	ENSP00000389415:H603Y;ENSP00000341451:H580Y;ENSP00000432172:H612Y;ENSP00000411335:H100Y	ENSP00000341451:H580Y	H	-	1	0	CCDC17	45858569	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.036000	0.12185	0.299000	0.22661	0.655000	0.94253	CAC		0.552	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386833.1	NM_152500		7	24	0	0	0	0.004482	0	7	24				
GLIS1	148979	broad.mit.edu	37	1	54060371	54060371	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:54060371C>A	ENST00000312233.2	-	3	771	c.205G>T	c.(205-207)Ggc>Tgc	p.G69C		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						GGGGGTAGGCCCAAGACGCAG	0.667																																							uc001cvr.1		NA																	0				skin(1)	1						c.(205-207)GGC>TGC		GLIS family zinc finger 1							17.0	18.0	18.0					1																	54060371		2199	4294	6493	SO:0001583	missense	148979				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr1:54060371C>A	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.205G>T	1.37:g.54060371C>A	ENSP00000309653:p.Gly69Cys		Somatic					p.G69C	NM_147193	NP_671726	WXS	Illumina HiSeq	Unspecified	Q8NBF1	GLIS1_HUMAN			3	772	-			69						Missense_Mutation	SNP	ENST00000312233.2	37	c.205G>T	CCDS582.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051237	0.36181	.	.	ENSG00000174332	ENST00000312233	T	0.10382	2.88	4.53	4.53	0.55603	.	0.117425	0.38272	N	0.001747	T	0.18593	0.0446	L	0.27053	0.805	0.31379	N	0.679269	D	0.89917	1.0	D	0.70716	0.97	T	0.01520	-1.1334	10	0.56958	D	0.05	.	11.5337	0.50624	0.0:0.8181:0.1819:0.0	.	69	Q8NBF1	GLIS1_HUMAN	C	69	ENSP00000309653:G69C	ENSP00000309653:G69C	G	-	1	0	GLIS1	53832959	0.636000	0.27207	1.000000	0.80357	0.273000	0.26683	0.567000	0.23608	2.456000	0.83038	0.563000	0.77884	GGC		0.667	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193		7	16	1	0	0.00198382	0.001984	0.00204955	7	16				
IL23R	149233	broad.mit.edu	37	1	67635043	67635043	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:67635043G>T	ENST00000347310.5	+	3	260	c.89G>T	c.(88-90)tGc>tTc	p.C30F	IL23R_ENST00000371002.1_Missense_Mutation_p.C30F|C1orf141_ENST00000371007.2_Intron	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	30					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						AATATAAACTGCTCTGGCCAC	0.313																																							uc001ddo.2		NA																	0					0						c.(88-90)TGC>TTC		interleukin 23 receptor precursor							47.0	53.0	51.0					1																	67635043		2189	4286	6475	SO:0001583	missense	149233				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity	g.chr1:67635043G>T	AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.89G>T	1.37:g.67635043G>T	ENSP00000321345:p.Cys30Phe		Somatic				IL23R_uc009waz.2_5'UTR|IL23R_uc001ddp.2_RNA|IL23R_uc010opi.1_RNA|IL23R_uc010opj.1_5'UTR|IL23R_uc010opk.1_5'UTR|IL23R_uc010opl.1_5'UTR|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_5'UTR|IL23R_uc010opn.1_5'UTR|IL23R_uc001ddr.2_RNA	p.C30F	NM_144701	NP_653302	WXS	Illumina HiSeq	Unspecified	Q5VWK5	IL23R_HUMAN			3	174	+			30			Extracellular (Potential).		C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	ENST00000347310.5	37	c.89G>T	CCDS637.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379663	0.61845	.	.	ENSG00000162594	ENST00000347310;ENST00000371002	D;D	0.84800	-1.9;-1.9	5.51	5.51	0.81932	.	0.166998	0.53938	D	0.000058	D	0.89269	0.6667	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89662	0.3877	10	0.66056	D	0.02	-25.6168	15.2763	0.73745	0.0:0.0:1.0:0.0	.	30	Q5VWK5	IL23R_HUMAN	F	30	ENSP00000321345:C30F;ENSP00000360041:C30F	ENSP00000321345:C30F	C	+	2	0	IL23R	67407631	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.951000	0.63610	2.746000	0.94184	0.655000	0.94253	TGC		0.313	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701		13	42	1	0	1.49906e-05	0.00245	1.58452e-05	13	42				
DIRAS3	9077	broad.mit.edu	37	1	68512795	68512795	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:68512795G>A	ENST00000370981.1	-	4	822	c.186C>T	c.(184-186)ttC>ttT	p.F62F	GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000413628.1_RNA|DIRAS3_ENST00000395201.1_Silent_p.F62F			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	62					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ACTCATGACGGAAGTTGCCGC	0.582																																							uc001ded.2		NA																	0				skin(1)	1						c.(184-186)TTC>TTT		DIRAS family, GTP-binding RAS-like 3							117.0	118.0	117.0					1																	68512795		2203	4300	6503	SO:0001819	synonymous_variant	9077				regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr1:68512795G>A	U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.186C>T	1.37:g.68512795G>A			Somatic				uc001deb.1_Intron|uc001dec.1_Intron	p.F62F	NM_004675	NP_004666	WXS	Illumina HiSeq	Unspecified	O95661	DIRA3_HUMAN			2	481	-			62					B3KMP3	Silent	SNP	ENST00000370981.1	37	c.186C>T	CCDS641.1																																																																																				0.582	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026354.2	NM_004675		44	103	0	0	0	0.00361	0	44	103				
ERICH3	127254	broad.mit.edu	37	1	75037590	75037590	+	Silent	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:75037590T>A	ENST00000326665.5	-	14	4022	c.3804A>T	c.(3802-3804)ctA>ctT	p.L1268L	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1268	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCTGGGTCCTTAGCACGACAT	0.572																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(3802-3804)CTA>CTT		hypothetical protein LOC127254							157.0	134.0	142.0					1																	75037590		2203	4300	6503	SO:0001819	synonymous_variant	127254							g.chr1:75037590T>A																												ENST00000326665.5:c.3804A>T	1.37:g.75037590T>A			Somatic					p.L1268L	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			14	4023	-			1268			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	c.3804A>T	CCDS30755.1																																																																																				0.572	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			49	98	0	0	0	0.00361	0	49	98				
LPHN2	23266	broad.mit.edu	37	1	82450289	82450289	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:82450289G>C	ENST00000370728.1	+	22	3938	c.3293G>C	c.(3292-3294)tGc>tCc	p.C1098S	LPHN2_ENST00000370730.1_Missense_Mutation_p.C1098S|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370715.1_Missense_Mutation_p.C1085S|LPHN2_ENST00000370721.1_Missense_Mutation_p.C1023S|LPHN2_ENST00000359929.3_Missense_Mutation_p.C1085S|LPHN2_ENST00000271029.4_Missense_Mutation_p.C1113S|LPHN2_ENST00000319517.6_Missense_Mutation_p.C1085S|LPHN2_ENST00000394879.1_Missense_Mutation_p.C1100S|LPHN2_ENST00000370717.2_Missense_Mutation_p.C1113S|LPHN2_ENST00000335786.5_Missense_Mutation_p.C1098S|LPHN2_ENST00000370713.1_Missense_Mutation_p.C1085S|LPHN2_ENST00000370725.1_Missense_Mutation_p.C1113S|LPHN2_ENST00000370727.1_Missense_Mutation_p.C1113S|LPHN2_ENST00000370723.1_Missense_Mutation_p.C1100S			O95490	LPHN2_HUMAN	latrophilin 2	1098					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TATGGCAAGTGCTTCAGACAC	0.453																																							uc001dit.3		NA																	0				ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9						c.(3253-3255)TGC>TCC		latrophilin 2 precursor							155.0	149.0	151.0					1																	82450289		2203	4300	6503	SO:0001583	missense	23266				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding	g.chr1:82450289G>C	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.3293G>C	1.37:g.82450289G>C	ENSP00000359763:p.Cys1098Ser		Somatic				LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.C1085S|LPHN2_uc001div.2_Missense_Mutation_p.C1085S|LPHN2_uc009wcd.2_Missense_Mutation_p.C1085S|LPHN2_uc001diw.2_Missense_Mutation_p.C669S	p.C1085S	NM_012302	NP_036434	WXS	Illumina HiSeq	Unspecified	O95490	LPHN2_HUMAN		all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)	19	3435	+			1098			Cytoplasmic (Potential).		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37	c.3254G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.650003|4.650003	0.87958|0.87958	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.39787	.|1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.048424	.|0.85682	.|D	.|0.000000	T|T	0.63402|0.63402	0.2508|0.2508	M|M	0.76938|0.76938	2.355|2.355	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;1.0	.|D;D;D	.|0.91635	.|0.986;0.998;0.999	T|T	0.66304|0.66304	-0.5957|-0.5957	5|10	.|0.87932	.|D	.|0	.|.	19.9116|19.9116	0.97026|0.97026	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1085;1085;1085	.|O95490-3;O95490-4;O95490-2	.|.;.;.	P|S	990|1023;1098;1098;1113;1113;1100;1085;1085;1085;1085;1113;1100;1113;1098	.|ENSP00000359756:C1023S;ENSP00000359763:C1098S;ENSP00000359765:C1098S;ENSP00000359762:C1113S;ENSP00000359760:C1113S;ENSP00000359758:C1100S;ENSP00000353006:C1085S;ENSP00000359750:C1085S;ENSP00000359748:C1085S;ENSP00000322270:C1085S;ENSP00000359752:C1113S;ENSP00000378344:C1100S;ENSP00000271029:C1113S;ENSP00000337306:C1098S	.|ENSP00000271029:C1113S	A|C	+|+	1|2	0|0	LPHN2|LPHN2	82222877|82222877	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.805000|0.805000	0.45488|0.45488	9.869000|9.869000	0.99810|0.99810	2.716000|2.716000	0.92895|0.92895	0.484000|0.484000	0.47621|0.47621	GCT|TGC		0.453	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302		35	76	0	0	0	0.005524	0	35	76				
CLCA1	1179	broad.mit.edu	37	1	86959282	86959282	+	Splice_Site	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:86959282G>C	ENST00000234701.3	+	11	2031	c.1680G>C	c.(1678-1680)aaG>aaC	p.K560N	CLCA1_ENST00000394711.1_Splice_Site_p.K560N			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	560					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GCATTGCTAAGGTATGGAGTC	0.388																																							uc001dlt.2		NA																	0				ovary(1)	1						c.(1678-1680)AAG>AAC		chloride channel accessory 1 precursor							79.0	71.0	74.0					1																	86959282		2203	4300	6503	SO:0001630	splice_region_variant	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86959282G>C		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1680+1G>C	1.37:g.86959282G>C			Somatic				CLCA1_uc001dls.1_Missense_Mutation_p.K499N	p.K560N	NM_001285	NP_001276	WXS	Illumina HiSeq	Unspecified	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	10	1809	+		Lung NSC(277;0.239)	560					B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	c.1680G>C	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550099	0.65311	.	.	ENSG00000016490	ENST00000234701;ENST00000394711;ENST00000539889	T;T	0.34275	1.37;1.37	5.7	5.7	0.88788	Domain of unknown function DUF1973 (1);	0.197077	0.43260	D	0.000592	T	0.54111	0.1838	M	0.80422	2.495	0.80722	D	1	P;P	0.45827	0.867;0.867	P;P	0.57776	0.827;0.677	T	0.57087	-0.7871	10	0.72032	D	0.01	-5.3385	18.6064	0.91268	0.0:0.0:1.0:0.0	.	560;323	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	N	560;560;273	ENSP00000234701:K560N;ENSP00000378200:K560N	ENSP00000234701:K560N	K	+	3	2	CLCA1	86731870	1.000000	0.71417	1.000000	0.80357	0.296000	0.27459	6.581000	0.74045	2.691000	0.91804	0.557000	0.71058	AAG		0.388	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	Missense_Mutation	15	19	0	0	0	0.004007	0	15	19				
ZNF326	284695	broad.mit.edu	37	1	90478797	90478797	+	Splice_Site	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:90478797G>T	ENST00000340281.4	+	7	1069		c.e7+1		ZNF326_ENST00000370447.3_Splice_Site|ZNF326_ENST00000455342.2_Splice_Site	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326						mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		ATGGATACAGGTTTGTACTTA	0.348																																							uc001dnq.2		NA																	0				ovary(1)	1						c.e7+1		zinc finger protein 326 isoform 1							47.0	56.0	52.0					1																	90478797		2203	4300	6503	SO:0001630	splice_region_variant	284695				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	DNA binding	g.chr1:90478797G>T	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.926+1G>T	1.37:g.90478797G>T			Somatic				ZNF326_uc009wda.1_Splice_Site_p.R220_splice|ZNF326_uc001dnr.2_Splice_Site_p.R103_splice	p.R309_splice	NM_182976	NP_892021	WXS	Illumina HiSeq	Unspecified	Q5BKZ1	ZN326_HUMAN		all cancers(265;0.00728)|Epithelial(280;0.0265)	7	1065	+		all_lung(203;0.0116)|Lung NSC(277;0.0417)						A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Splice_Site	SNP	ENST00000340281.4	37	c.926_splice	CCDS727.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296135	0.81025	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9454	0.92620	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF326	90251385	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.909000	0.75735	2.466000	0.83321	0.591000	0.81541	.		0.348	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	Intron	10	10	1	0	0.000442599	0.006214	0.000460733	10	10				
SLC44A3	126969	broad.mit.edu	37	1	95290143	95290143	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:95290143C>A	ENST00000271227.6	+	3	332	c.230C>A	c.(229-231)tCc>tAc	p.S77Y	SLC44A3_ENST00000529450.1_Missense_Mutation_p.S77Y|SLC44A3_ENST00000467909.1_Missense_Mutation_p.S29Y|SLC44A3_ENST00000532427.1_Missense_Mutation_p.S29Y|SLC44A3_ENST00000446120.2_Missense_Mutation_p.S41Y|SLC44A3_ENST00000527077.1_Missense_Mutation_p.S41Y	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	77					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	AAGAAGAACTCCCCCGTGGAA	0.507																																							uc001dqv.3		NA																	0				kidney(1)	1						c.(229-231)TCC>TAC		solute carrier family 44, member 3 isoform 1	Choline(DB00122)						88.0	96.0	93.0					1																	95290143		2203	4300	6503	SO:0001583	missense	126969					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:95290143C>A	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.230C>A	1.37:g.95290143C>A	ENSP00000271227:p.Ser77Tyr		Somatic				SLC44A3_uc001dqx.3_Missense_Mutation_p.S77Y|SLC44A3_uc010otq.1_Missense_Mutation_p.S41Y|SLC44A3_uc010otr.1_Missense_Mutation_p.S41Y|SLC44A3_uc001dqw.3_Missense_Mutation_p.S29Y|SLC44A3_uc010ots.1_Missense_Mutation_p.S29Y|SLC44A3_uc009wds.2_5'UTR|SLC44A3_uc010ott.1_Missense_Mutation_p.S29Y|SLC44A3_uc010otu.1_5'Flank	p.S77Y	NM_001114106	NP_001107578	WXS	Illumina HiSeq	Unspecified	Q8N4M1	CTL3_HUMAN		all cancers(265;0.039)|Epithelial(280;0.124)	3	337	+		all_lung(203;0.000712)|Lung NSC(277;0.00316)	77					B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	37	c.230C>A	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.772942	0.69992	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000422520;ENST00000532427	D;D;T;D;T;D;T	0.81579	-1.51;-1.51;2.22;-1.51;2.68;-1.51;2.22	5.71	5.71	0.89125	.	0.308854	0.28453	N	0.015285	D	0.85771	0.5774	M	0.64997	1.995	0.36405	D	0.863389	D;D;D;D;D	0.67145	0.996;0.993;0.996;0.991;0.991	P;P;P;P;P	0.62649	0.887;0.905;0.887;0.77;0.77	D	0.87339	0.2330	10	0.87932	D	0	-16.86	18.624	0.91331	0.0:1.0:0.0:0.0	.	29;41;41;77;77	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	Y	41;77;41;77;29;29;29	ENSP00000389143:S41Y;ENSP00000271227:S77Y;ENSP00000433641:S41Y;ENSP00000431836:S77Y;ENSP00000432789:S29Y;ENSP00000410832:S29Y;ENSP00000436661:S29Y	ENSP00000271227:S77Y	S	+	2	0	SLC44A3	95062731	0.985000	0.35326	0.999000	0.59377	0.766000	0.43426	1.545000	0.36169	2.681000	0.91329	0.655000	0.94253	TCC		0.507	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369		34	89	1	0	3.38236e-24	0.006999	4.27311e-24	34	89				
VCAM1	7412	broad.mit.edu	37	1	101186295	101186295	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:101186295G>T	ENST00000294728.2	+	2	429	c.328G>T	c.(328-330)Gtg>Ttg	p.V110L	VCAM1_ENST00000370119.4_Intron|VCAM1_ENST00000370115.1_Missense_Mutation_p.V110L|VCAM1_ENST00000347652.2_Missense_Mutation_p.V110L	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	110	Ig-like C2-type 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AGGAATCCAGGTGGAGATCTA	0.318																																							uc001dti.2		NA																	0				central_nervous_system(1)	1						c.(328-330)GTG>TTG		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						84.0	83.0	83.0					1																	101186295		2203	4300	6503	SO:0001583	missense	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101186295G>T	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.328G>T	1.37:g.101186295G>T	ENSP00000294728:p.Val110Leu		Somatic				VCAM1_uc001dtj.2_Missense_Mutation_p.V110L|VCAM1_uc010ouj.1_Intron	p.V110L	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	2	448	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	110			Ig-like C2-type 2.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	c.328G>T	CCDS773.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477565	0.44044	.	.	ENSG00000162692	ENST00000347652;ENST00000294728;ENST00000370115	T;T;T	0.52057	0.68;0.68;0.68	5.82	5.82	0.92795	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.174761	0.51477	D	0.000081	T	0.58680	0.2139	M	0.71296	2.17	0.50813	D	0.999891	D;D	0.76494	0.994;0.999	P;D	0.79108	0.873;0.992	T	0.59669	-0.7411	9	.	.	.	-20.8397	12.2477	0.54581	0.0785:0.0:0.9215:0.0	.	110;110	P19320-2;P19320	.;VCAM1_HUMAN	L	110	ENSP00000304611:V110L;ENSP00000294728:V110L;ENSP00000359133:V110L	.	V	+	1	0	VCAM1	100958883	1.000000	0.71417	0.964000	0.40570	0.755000	0.42902	4.634000	0.61325	2.745000	0.94114	0.655000	0.94253	GTG		0.318	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		16	38	1	0	4.54149e-19	0.002299	5.63374e-19	16	38				
COL11A1	1301	broad.mit.edu	37	1	103404613	103404613	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:103404613C>T	ENST00000370096.3	-	44	3728	c.3416G>A	c.(3415-3417)aGc>aAc	p.S1139N	COL11A1_ENST00000512756.1_Missense_Mutation_p.S1023N|COL11A1_ENST00000353414.4_Missense_Mutation_p.S1100N|COL11A1_ENST00000358392.2_Missense_Mutation_p.S1151N	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1139	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GTCACCCTTGCTGCCTTTTTG	0.328																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(3415-3417)AGC>AAC		alpha 1 type XI collagen isoform A							156.0	156.0	156.0					1																	103404613		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103404613C>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3416G>A	1.37:g.103404613C>T	ENSP00000359114:p.Ser1139Asn		Somatic				COL11A1_uc001duk.2_Missense_Mutation_p.S335N|COL11A1_uc001dum.2_Missense_Mutation_p.S1151N|COL11A1_uc001dun.2_Missense_Mutation_p.S1100N|COL11A1_uc009weh.2_Missense_Mutation_p.S1023N	p.S1139N	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	44	3734	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1139			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.3416G>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995585	0.74703	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.92241	0.7539	L	0.33293	1	0.58432	D	0.999999	B;P;P;P;P	0.46142	0.319;0.81;0.873;0.682;0.763	B;P;B;B;P	0.54312	0.135;0.748;0.42;0.24;0.711	D	0.92147	0.5725	10	0.46703	T	0.11	.	19.2688	0.94000	0.0:1.0:0.0:0.0	.	1023;1100;1151;1139;359	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	N	1139;1151;1100;359;1023	ENSP00000359114:S1139N;ENSP00000351163:S1151N;ENSP00000302551:S1100N;ENSP00000426533:S1023N	ENSP00000302551:S1100N	S	-	2	0	COL11A1	103177201	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.750000	0.85110	2.639000	0.89480	0.591000	0.81541	AGC		0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		40	85	0	0	0	0.00361	0	40	85				
AMY2B	280	broad.mit.edu	37	1	104120463	104120463	+	Missense_Mutation	SNP	G	G	T	rs576493727		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:104120463G>T	ENST00000361355.4	+	11	1958	c.1342G>T	c.(1342-1344)Gac>Tac	p.D448Y	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	448					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		CAACAATGATGACTGGTAAGT	0.338																																							uc001duq.2		NA																	0					0						c.(1342-1344)GAC>TAC		amylase, pancreatic, alpha-2B precursor							115.0	151.0	138.0					1																	104120463		1410	2420	3830	SO:0001583	missense	280				carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding	g.chr1:104120463G>T	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1342G>T	1.37:g.104120463G>T	ENSP00000354610:p.Asp448Tyr		Somatic				AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.D448Y|AMY2B_uc001dus.1_RNA	p.D448Y	NM_020978	NP_066188	WXS	Illumina HiSeq	Unspecified	P19961	AMY2B_HUMAN		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)	11	1958	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	448					B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	ENST00000361355.4	37	c.1342G>T	CCDS782.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236464	0.58886	.	.	ENSG00000240038	ENST00000361355	T	0.77229	-1.08	4.57	4.57	0.56435	Alpha-amylase, C-terminal all beta (2);Glycosyl hydrolase, family 13, all-beta (1);	0.000000	0.85682	D	0.000000	D	0.85239	0.5651	M	0.78049	2.395	0.80722	D	1	D	0.64830	0.994	D	0.67548	0.952	D	0.87005	0.2119	10	0.56958	D	0.05	.	17.3366	0.87283	0.0:0.0:1.0:0.0	.	448	P19961	AMY2B_HUMAN	Y	448	ENSP00000354610:D448Y	ENSP00000354610:D448Y	D	+	1	0	AMY2B	103921986	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.928000	0.87587	2.063000	0.61619	0.467000	0.42956	GAC		0.338	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978		63	110	1	0	1.15062e-32	0.00361	1.50062e-32	63	110				
WDR77	79084	broad.mit.edu	37	1	111986713	111986713	+	Missense_Mutation	SNP	G	G	A	rs373098617		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:111986713G>A	ENST00000235090.5	-	5	733	c.527C>T	c.(526-528)tCt>tTt	p.S176F	RP11-552M11.4_ENST00000416099.1_RNA|WDR77_ENST00000411751.2_Missense_Mutation_p.S112F|Y_RNA_ENST00000363020.1_RNA|WDR77_ENST00000497278.1_5'UTR	NM_024102.2	NP_077007.1	Q9BQA1	MEP50_HUMAN	WD repeat domain 77	176					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA metabolic process (GO:0016070)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|methylosome (GO:0034709)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTTGTGAGGAGAGGCAGCAAC	0.468																																							uc001ebb.2		NA																	0					0						c.(526-528)TCT>TTT		WD repeat domain 77							118.0	115.0	116.0					1																	111986713		2203	4300	6503	SO:0001583	missense	79084				ncRNA metabolic process|spliceosomal snRNP assembly	cytosol|nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding	g.chr1:111986713G>A	BC016946	CCDS835.1	1p13.2	2013-01-09		2005-08-09	ENSG00000116455	ENSG00000116455		"""WD repeat domain containing"""	29652	protein-coding gene	gene with protein product		611734				11756452, 8619474	Standard	NM_024102		Approved	MEP50	uc001ebb.3	Q9BQA1	OTTHUMG00000011748	ENST00000235090.5:c.527C>T	1.37:g.111986713G>A	ENSP00000235090:p.Ser176Phe		Somatic				WDR77_uc010owd.1_RNA|WDR77_uc010owe.1_Missense_Mutation_p.S112F	p.S176F	NM_024102	NP_077007	WXS	Illumina HiSeq	Unspecified	Q9BQA1	MEP50_HUMAN		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)	5	566	-		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)	176			WD 3.		B3KMW6|B4DP38|Q3LID2|Q53FU2|Q6JZZ5|Q96GK4|Q9BWY3	Missense_Mutation	SNP	ENST00000235090.5	37	c.527C>T	CCDS835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.52|16.52	3.145040|3.145040	0.57044|0.57044	.|.	.|.	ENSG00000116455|ENSG00000116455	ENST00000449340|ENST00000235090;ENST00000411751	.|T;T	.|0.66460	.|-0.21;-0.21	6.06|6.06	5.12|5.12	0.69794|0.69794	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.140540	.|0.64402	.|D	.|0.000004	T|T	0.77343|0.77343	0.4116|0.4116	M|M	0.71296|0.71296	2.17|2.17	0.40030|0.40030	D|D	0.975521|0.975521	.|D;D	.|0.71674	.|0.995;0.998	.|D;D	.|0.73708	.|0.981;0.974	T|T	0.78996|0.78996	-0.1983|-0.1983	5|10	.|0.87932	.|D	.|0	-18.7323|-18.7323	16.1133|16.1133	0.81278|0.81278	0.0:0.291:0.709:0.0|0.0:0.291:0.709:0.0	.|.	.|112;176	.|B4DP38;Q9BQA1	.|.;MEP50_HUMAN	F|F	113|176;112	.|ENSP00000235090:S176F;ENSP00000400321:S112F	.|ENSP00000235090:S176F	L|S	-|-	1|2	0|0	WDR77|WDR77	111788236|111788236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.349000|0.349000	0.29174|0.29174	3.148000|3.148000	0.50647|0.50647	2.871000|2.871000	0.98454|0.98454	0.655000|0.655000	0.94253|0.94253	CTC|TCT		0.468	WDR77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032465.1	NM_024102		12	68	0	0	0	0.001855	0	12	68				
Unknown	0	broad.mit.edu	37	1	121310581	121310581	+	IGR	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:121310581T>C								RP11-344P13.6 (49954 upstream) : RP11-344P13.1 (5162 downstream)																							CAGGAGTCTCTGGGCCAGTGA	0.333																																							uc009wht.1		NA																	0					0						c.(355-357)CTG>CCG		Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.																																				SO:0001628	intergenic_variant	647121							g.chr1:121310581T>C																													1.37:g.121310581T>C			Somatic				LOC647121_uc001eiu.1_RNA	p.L119P			WXS	Illumina HiSeq	Unspecified					4	385	+									Missense_Mutation	SNP		37	c.356T>C																																																																																				0	0.333									9	22	0	0	0	0.001882	0	9	22				
SEC22B	9554	broad.mit.edu	37	1	145115793	145115793	+	RNA	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:145115793G>A	ENST00000453618.1	+	0	879							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											GCCAGGATGCGAAGTACTTGA	0.398																																							uc001eml.1		NA																	0					0						c.(550-552)GCG>GCA		SEC22 vesicle trafficking protein homolog B							214.0	211.0	212.0					1																	145115793		2014	4190	6204			9554				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding	g.chr1:145115793G>A	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145115793G>A			Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	p.A184A	NM_004892	NP_004883	WXS	Illumina HiSeq	Unspecified	O75396	SC22B_HUMAN			7	692	+			184			v-SNARE coiled-coil homology.|Cytoplasmic (Potential).		A8K1G0	Silent	SNP	ENST00000453618.1	37	c.552G>A																																																																																					0.398	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892		22	238	0	0	0	0.005443	0	22	238				
BCL9	607	broad.mit.edu	37	1	147084819	147084819	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:147084819G>T	ENST00000234739.3	+	5	931	c.191G>T	c.(190-192)tGt>tTt	p.C64F	BCL9_ENST00000473292.1_Intron	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	64					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCATCCCCCTGTGACTCCAAG	0.597			T	"""IGH@, IGL@"""	B-ALL																																		uc001epq.2		NA		Dom	yes		1	1q21	607	T	B-cell CLL/lymphoma 9			L	IGH@|IGL@		B-ALL		0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(190-192)TGT>TTT		B-cell CLL/lymphoma 9							31.0	33.0	32.0					1																	147084819		2203	4300	6503	SO:0001583	missense	607				Wnt receptor signaling pathway	nucleus	protein binding	g.chr1:147084819G>T	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.191G>T	1.37:g.147084819G>T	ENSP00000234739:p.Cys64Phe		Somatic				BCL9_uc010ozr.1_Intron	p.C64F	NM_004326	NP_004317	WXS	Illumina HiSeq	Unspecified	O00512	BCL9_HUMAN			5	931	+	all_hematologic(923;0.115)		64					Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	c.191G>T	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133509	0.77662	.	.	ENSG00000116128	ENST00000234739	T	0.63580	-0.05	5.4	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	L	0.50333	1.59	0.80722	D	1	P	0.40875	0.731	B	0.34418	0.182	T	0.54563	-0.8275	10	0.87932	D	0	-5.0686	14.2084	0.65748	0.0712:0.0:0.9288:0.0	.	64	O00512	BCL9_HUMAN	F	64	ENSP00000234739:C64F	ENSP00000234739:C64F	C	+	2	0	BCL9	145551443	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.338000	0.79269	1.511000	0.48818	0.655000	0.94253	TGT		0.597	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326		7	29	1	0	8.12818e-05	0.001984	8.53895e-05	7	29				
RFX5	5993	broad.mit.edu	37	1	151318730	151318730	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:151318730C>G	ENST00000290524.4	-	3	245	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	RFX5_ENST00000368870.2_Missense_Mutation_p.E23Q|RP11-126K1.6_ENST00000455503.1_RNA|RFX5_ENST00000452513.2_Missense_Mutation_p.E23Q|RFX5_ENST00000452671.2_Missense_Mutation_p.E23Q|RFX5_ENST00000478564.1_5'UTR	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	23					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCCCCAGCCTCAGCACCACCT	0.567																																							uc001exv.1		NA																	0				ovary(1)	1						c.(67-69)GAG>CAG		regulatory factor X, 5							105.0	108.0	107.0					1																	151318730		2203	4300	6503	SO:0001583	missense	5993					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:151318730C>G		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.67G>C	1.37:g.151318730C>G	ENSP00000290524:p.Glu23Gln		Somatic				RFX5_uc001exw.1_Missense_Mutation_p.E23Q|RFX5_uc009wmr.1_Missense_Mutation_p.E23Q|RFX5_uc010pcx.1_Missense_Mutation_p.E23Q	p.E23Q	NM_001025603	NP_001020774	WXS	Illumina HiSeq	Unspecified	P48382	RFX5_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		3	281	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		23					B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	ENST00000290524.4	37	c.67G>C	CCDS994.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549084	0.86127	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513;ENST00000392746;ENST00000422595;ENST00000450506;ENST00000458484;ENST00000430227;ENST00000412774;ENST00000437327;ENST00000436271	T;T;T;T;T;T;D;D	0.82803	0.24;0.24;0.24;0.33;0.25;-0.64;-1.65;-1.64	4.88	4.88	0.63580	.	0.253062	0.27986	N	0.017047	T	0.69904	0.3163	L	0.36672	1.1	0.30703	N	0.750053	P;P	0.50443	0.849;0.935	P;P	0.48368	0.478;0.575	T	0.65105	-0.6249	10	0.21014	T	0.42	-10.4522	13.3851	0.60791	0.0:1.0:0.0:0.0	.	23;23	B7Z848;P48382	.;RFX5_HUMAN	Q	23	ENSP00000290524:E23Q;ENSP00000357864:E23Q;ENSP00000389130:E23Q;ENSP00000398388:E23Q;ENSP00000376502:E23Q;ENSP00000399095:E23Q;ENSP00000398666:E23Q;ENSP00000409187:E23Q	ENSP00000290524:E23Q	E	-	1	0	RFX5	149585354	0.416000	0.25424	0.987000	0.45799	0.840000	0.47671	1.957000	0.40392	2.535000	0.85469	0.491000	0.48974	GAG		0.567	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449		90	100	0	0	0	0.00361	0	90	100				
TCHH	7062	broad.mit.edu	37	1	152082320	152082320	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:152082320T>C	ENST00000368804.1	-	2	3372	c.3373A>G	c.(3373-3375)Aga>Gga	p.R1125G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1125	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cgttcctctctcagcagctgc	0.612																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(3373-3375)AGA>GGA		trichohyalin							93.0	94.0	94.0					1																	152082320		1979	4139	6118	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152082320T>C	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3373A>G	1.37:g.152082320T>C	ENSP00000357794:p.Arg1125Gly		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.R1125G	p.R1125G	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	3373	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1125			4-8.|10 X 30 AA tandem repeats.		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.3373A>G	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	T	5.521	0.281051	0.10458	.	.	ENSG00000159450	ENST00000368804	T	0.06849	3.25	2.38	1.02	0.19986	.	.	.	.	.	T	0.04407	0.0121	L	0.29908	0.895	0.09310	N	1	D	0.58268	0.982	P	0.59171	0.853	T	0.40590	-0.9555	9	0.28530	T	0.3	.	5.1512	0.15011	0.0:0.0:0.3026:0.6974	.	1125	Q07283	TRHY_HUMAN	G	1125	ENSP00000357794:R1125G	ENSP00000357794:R1125G	R	-	1	2	TCHH	150348944	0.001000	0.12720	0.006000	0.13384	0.018000	0.09664	1.171000	0.31896	0.940000	0.37473	0.379000	0.24179	AGA		0.612	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		4	153	0	0	0	0.009096	0	4	153				
FLG2	388698	broad.mit.edu	37	1	152324674	152324674	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:152324674C>G	ENST00000388718.5	-	3	5660	c.5588G>C	c.(5587-5589)gGa>gCa	p.G1863A	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1863					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGGACTGTCCATGACCAGA	0.493																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(5587-5589)GGA>GCA		filaggrin family member 2							331.0	289.0	303.0					1																	152324674		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152324674C>G	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5588G>C	1.37:g.152324674C>G	ENSP00000373370:p.Gly1863Ala		Somatic				uc001ezv.2_Intron	p.G1863A	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5661	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1863					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.5588G>C	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	8.505	0.865088	0.17250	.	.	ENSG00000143520	ENST00000388718	T	0.12984	2.63	4.05	-0.151	0.13411	.	.	.	.	.	T	0.03608	0.0103	M	0.68317	2.08	0.09310	N	1	P	0.51057	0.941	B	0.41036	0.346	T	0.33266	-0.9875	9	0.09843	T	0.71	-1.1978	4.1324	0.10156	0.0:0.5228:0.1721:0.3051	.	1863	Q5D862	FILA2_HUMAN	A	1863	ENSP00000373370:G1863A	ENSP00000373370:G1863A	G	-	2	0	FLG2	150591298	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.291000	0.08343	-0.090000	0.12462	0.549000	0.68633	GGA		0.493	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		164	198	0	0	0	0.00361	0	164	198				
GATAD2B	57459	broad.mit.edu	37	1	153789011	153789011	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:153789011C>T	ENST00000368655.4	-	7	1197	c.954G>A	c.(952-954)atG>atA	p.M318I		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	318					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGCAAGGTTCATATAGATGG	0.507																																							uc001fdb.3		NA																	0					0						c.(952-954)ATG>ATA		GATA zinc finger domain containing 2B							102.0	82.0	89.0					1																	153789011		2203	4300	6503	SO:0001583	missense	57459					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:153789011C>T	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.954G>A	1.37:g.153789011C>T	ENSP00000357644:p.Met318Ile		Somatic					p.M318I	NM_020699	NP_065750	WXS	Illumina HiSeq	Unspecified	Q8WXI9	P66B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		7	1198	-	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		318					D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	c.954G>A	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.994790	0.74703	.	.	ENSG00000143614	ENST00000368655	T	0.30714	1.52	5.06	5.06	0.68205	.	0.152997	0.64402	D	0.000001	T	0.30947	0.0781	L	0.40543	1.245	0.58432	D	0.999999	P	0.45126	0.851	P	0.55391	0.775	T	0.00915	-1.1516	10	0.29301	T	0.29	-8.6999	17.3544	0.87331	0.0:1.0:0.0:0.0	.	318	Q8WXI9	P66B_HUMAN	I	318	ENSP00000357644:M318I	ENSP00000357644:M318I	M	-	3	0	GATAD2B	152055635	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.853000	0.75435	2.621000	0.88768	0.557000	0.71058	ATG		0.507	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699		37	41	0	0	0	0.009718	0	37	41				
FCRL4	83417	broad.mit.edu	37	1	157555986	157555986	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:157555986C>A	ENST00000271532.1	-	6	1242	c.1107G>T	c.(1105-1107)caG>caT	p.Q369H	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	369	Ig-like C2-type 4.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				GCACCATGCTCTGGACAGGGC	0.498											OREG0007229	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=FCRL4|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																											uc001fqw.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(1105-1107)CAG>CAT		Fc receptor-like 4 precursor							106.0	94.0	98.0					1																	157555986		2203	4300	6503	SO:0001583	missense	83417					integral to membrane|plasma membrane	receptor activity	g.chr1:157555986C>A	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.1107G>T	1.37:g.157555986C>A	ENSP00000271532:p.Gln369His		Somatic	OREG0007229	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=FCRL4|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	1787	FCRL4_uc010phy.1_RNA	p.Q369H	NM_031282	NP_112572	WXS	Illumina HiSeq	Unspecified	Q96PJ5	FCRL4_HUMAN			6	1243	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)	369			Ig-like C2-type 4.|Extracellular (Potential).		Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	c.1107G>T	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	C	7.531	0.658763	0.14645	.	.	ENSG00000163518	ENST00000271532	T	0.14022	2.54	4.01	1.9	0.25705	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.097970	0.07189	N	0.855330	T	0.04452	0.0122	L	0.35487	1.065	0.09310	N	1	P	0.47677	0.899	B	0.42882	0.401	T	0.34775	-0.9815	10	0.42905	T	0.14	.	6.2263	0.20710	0.2155:0.5755:0.209:0.0	.	369	Q96PJ5	FCRL4_HUMAN	H	369	ENSP00000271532:Q369H	ENSP00000271532:Q369H	Q	-	3	2	FCRL4	155822610	0.011000	0.17503	0.190000	0.23270	0.007000	0.05969	-0.101000	0.10973	0.975000	0.38392	0.467000	0.42956	CAG		0.498	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		32	114	1	0	6.03168e-27	0.004878	7.69096e-27	32	114				
CD5L	922	broad.mit.edu	37	1	157803231	157803231	+	Missense_Mutation	SNP	C	C	G	rs146902396	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:157803231C>G	ENST00000368174.4	-	5	886	c.790G>C	c.(790-792)Gta>Cta	p.V264L	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	264	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GAGCCCCATACGCCCTTGTGC	0.567																																							uc001frk.3		NA																	0				ovary(1)	1						c.(790-792)GTA>CTA		CD5 molecule-like precursor							132.0	135.0	134.0					1																	157803231		2203	4300	6503	SO:0001583	missense	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157803231C>G	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.790G>C	1.37:g.157803231C>G	ENSP00000357156:p.Val264Leu		Somatic					p.V264L	NM_005894	NP_005885	WXS	Illumina HiSeq	Unspecified	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		5	933	-	all_hematologic(112;0.0378)		264			SRCR 3.		A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	c.790G>C	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	4.371	0.068490	0.08436	.	.	ENSG00000073754	ENST00000368174	T	0.35236	1.32	4.88	-9.76	0.00503	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	2.147750	0.02020	N	0.047717	T	0.07503	0.0189	L	0.28504	0.86	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.08911	-1.0699	10	0.39692	T	0.17	.	5.5771	0.17228	0.0918:0.1198:0.1753:0.6131	.	264	O43866	CD5L_HUMAN	L	264	ENSP00000357156:V264L	ENSP00000357156:V264L	V	-	1	0	CD5L	156069855	0.000000	0.05858	0.000000	0.03702	0.313000	0.28021	-7.190000	0.00042	-2.009000	0.00954	0.655000	0.94253	GTA		0.567	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		40	180	0	0	0	0.00361	0	40	180				
OR10T2	128360	broad.mit.edu	37	1	158368962	158368962	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:158368962C>T	ENST00000334438.1	-	1	294	c.295G>A	c.(295-297)Gcc>Acc	p.A99T		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					AGCTGGGTGGCACAGGCCATG	0.498																																							uc010pih.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(295-297)GCC>ACC		olfactory receptor, family 10, subfamily T,							105.0	106.0	105.0					1																	158368962		2203	4300	6503	SO:0001583	missense	128360				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158368962C>T	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.295G>A	1.37:g.158368962C>T	ENSP00000334115:p.Ala99Thr		Somatic					p.A99T	NM_001004475	NP_001004475	WXS	Illumina HiSeq	Unspecified	Q8NGX3	O10T2_HUMAN			1	295	-	all_hematologic(112;0.0378)		99			Extracellular (Potential).		Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	c.295G>A	CCDS30895.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.185649	0.38609	.	.	ENSG00000186306	ENST00000334438	T	0.19806	2.12	4.56	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.192904	0.25253	N	0.032004	T	0.25306	0.0615	M	0.71581	2.175	0.22656	N	0.998886	D	0.69078	0.997	D	0.64687	0.928	T	0.05241	-1.0897	10	0.72032	D	0.01	.	8.1153	0.30940	0.0:0.8116:0.0:0.1884	.	99	Q8NGX3	O10T2_HUMAN	T	99	ENSP00000334115:A99T	ENSP00000334115:A99T	A	-	1	0	OR10T2	156635586	0.000000	0.05858	0.991000	0.47740	0.306000	0.27790	-1.175000	0.03102	1.119000	0.41883	0.650000	0.86243	GCC		0.498	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475		19	27	0	0	0	0.008871	0	19	27				
OR6Y1	391112	broad.mit.edu	37	1	158517795	158517795	+	Missense_Mutation	SNP	G	G	A	rs372365884		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:158517795G>A	ENST00000302617.3	-	1	100	c.101C>T	c.(100-102)tCc>tTc	p.S34F		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CAGGAAAATGGAGAAAAAGAG	0.443																																							uc010pil.1		NA																	0				ovary(1)	1						c.(100-102)TCC>TTC		olfactory receptor, family 6, subfamily Y,							47.0	47.0	47.0					1																	158517795		2202	4300	6502	SO:0001583	missense	391112				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158517795G>A	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.101C>T	1.37:g.158517795G>A	ENSP00000304807:p.Ser34Phe		Somatic					p.S34F	NM_001005189	NP_001005189	WXS	Illumina HiSeq	Unspecified	Q8NGX8	OR6Y1_HUMAN			1	101	-	all_hematologic(112;0.0378)		34			Helical; Name=1; (Potential).		Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	37	c.101C>T	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.547826	0.00926	.	.	ENSG00000197532	ENST00000302617	T	0.00424	7.45	4.91	-3.33	0.04958	.	0.545947	0.15309	N	0.269172	T	0.00039	0.0001	N	0.04669	-0.19	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21449	-1.0245	10	0.12103	T	0.63	.	1.4736	0.02421	0.4145:0.2419:0.2199:0.1237	.	34	Q8NGX8	OR6Y1_HUMAN	F	34	ENSP00000304807:S34F	ENSP00000304807:S34F	S	-	2	0	OR6Y1	156784419	0.000000	0.05858	0.001000	0.08648	0.131000	0.20780	-0.160000	0.10041	-0.475000	0.06852	-0.344000	0.07964	TCC		0.443	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189		23	18	0	0	0	0.00333	0	23	18				
CADM3	57863	broad.mit.edu	37	1	159170669	159170669	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:159170669G>A	ENST00000368125.4	+	9	1311	c.1154G>A	c.(1153-1155)gGc>gAc	p.G385D	CADM3_ENST00000368124.4_Missense_Mutation_p.G419D|CADM3_ENST00000497636.1_3'UTR|DARC_ENST00000537147.1_5'Flank|CTA-134P22.2_ENST00000609696.1_RNA|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	385					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					AATGCAGAAGGCGGGCAGTCA	0.607																																							uc001ftl.2		NA																	0				ovary(2)	2						c.(1153-1155)GGC>GAC		cell adhesion molecule 3 isoform 2							93.0	88.0	90.0					1																	159170669		2203	4300	6503	SO:0001583	missense	57863				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity	g.chr1:159170669G>A	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.1154G>A	1.37:g.159170669G>A	ENSP00000357107:p.Gly385Asp		Somatic				CADM3_uc001ftk.2_Missense_Mutation_p.G419D|uc001ftm.1_RNA	p.G385D	NM_001127173	NP_001120645	WXS	Illumina HiSeq	Unspecified	Q8N126	CADM3_HUMAN			9	1296	+	all_hematologic(112;0.0429)		385			Cytoplasmic (Potential).		Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	c.1154G>A	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102985	0.76983	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	T;T	0.53857	0.6;0.61	3.81	3.81	0.43845	.	0.000000	0.64402	D	0.000001	T	0.65238	0.2672	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.67921	-0.5545	10	0.44086	T	0.13	.	13.2211	0.59887	0.0:0.0:1.0:0.0	.	385;419	Q8N126;Q8N126-2	CADM3_HUMAN;.	D	419;385	ENSP00000357106:G419D;ENSP00000357107:G385D	ENSP00000357106:G419D	G	+	2	0	CADM3	157437293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.966000	0.93397	1.965000	0.57142	0.591000	0.81541	GGC		0.607	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189		55	80	0	0	0	0.00361	0	55	80				
SLAMF8	56833	broad.mit.edu	37	1	159803054	159803054	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:159803054C>A	ENST00000289707.5	+	4	825	c.676C>A	c.(676-678)Cca>Aca	p.P226T	SLAMF8_ENST00000471286.1_3'UTR|SLAMF8_ENST00000368104.4_Missense_Mutation_p.P117T|C1orf204_ENST00000491974.1_5'Flank	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	226					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					ATGTTCAGCACCAGGGAAGGC	0.572																																							uc001fue.3		NA																	0					0						c.(676-678)CCA>ACA		SLAM family member 8 precursor							249.0	214.0	226.0					1																	159803054		2203	4300	6503	SO:0001583	missense	56833					integral to membrane		g.chr1:159803054C>A	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.676C>A	1.37:g.159803054C>A	ENSP00000289707:p.Pro226Thr		Somatic					p.P226T	NM_020125	NP_064510	WXS	Illumina HiSeq	Unspecified	Q9P0V8	SLAF8_HUMAN			4	886	+	all_hematologic(112;0.0597)		226			Extracellular (Potential).		Q32MC6|Q5VU15	Missense_Mutation	SNP	ENST00000289707.5	37	c.676C>A	CCDS1188.1	.	.	.	.	.	.	.	.	.	.	C	6.448	0.450721	0.12223	.	.	ENSG00000158714	ENST00000289707;ENST00000368104	T;T	0.37058	1.22;1.22	4.77	3.84	0.44239	.	1.305210	0.04919	N	0.454613	T	0.09730	0.0239	L	0.27053	0.805	0.25244	N	0.98973	B	0.24186	0.099	B	0.21917	0.037	T	0.27571	-1.0070	10	0.13470	T	0.59	-6.5364	7.9486	0.30001	0.0:0.8875:0.0:0.1125	.	226	Q9P0V8	SLAF8_HUMAN	T	226;117	ENSP00000289707:P226T;ENSP00000357084:P117T	ENSP00000289707:P226T	P	+	1	0	SLAMF8	158069678	0.803000	0.28956	0.640000	0.29408	0.480000	0.33159	1.163000	0.31798	1.206000	0.43276	0.561000	0.74099	CCA		0.572	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085983.1	NM_020125		175	206	1	0	4.17301e-93	0.00361	5.58029e-93	175	206				
CFAP45	25790	broad.mit.edu	37	1	159850455	159850455	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:159850455C>A	ENST00000368099.4	-	8	997	c.933G>T	c.(931-933)atG>atT	p.M311I	CCDC19_ENST00000426543.2_Missense_Mutation_p.M226I|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			TCTCAGCTTGCATCTTCAGTT	0.473																																							uc001fui.2		NA																	0				ovary(1)	1						c.(931-933)ATG>ATT		nasopharyngeal epithelium specific protein 1							138.0	116.0	123.0					1																	159850455		2203	4300	6503	SO:0001583	missense	25790					mitochondrion|soluble fraction		g.chr1:159850455C>A																												ENST00000368099.4:c.933G>T	1.37:g.159850455C>A	ENSP00000357079:p.Met311Ile		Somatic				CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Missense_Mutation_p.M226I|CCDC19_uc001ful.2_Missense_Mutation_p.M226I|CCDC19_uc009wtc.1_Missense_Mutation_p.M297I	p.M311I	NM_012337	NP_036469	WXS	Illumina HiSeq	Unspecified	Q9UL16	CCD19_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.151)		8	951	-	all_hematologic(112;0.0597)		311			Potential.			Missense_Mutation	SNP	ENST00000368099.4	37	c.933G>T	CCDS30914.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540321	0.27563	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.08984	3.03;3.03	5.07	1.79	0.24919	.	0.274240	0.41294	N	0.000903	T	0.01558	0.0050	N	0.17723	0.515	0.33461	D	0.584903	B;B	0.21905	0.062;0.062	B;B	0.18871	0.023;0.023	T	0.47995	-0.9073	9	.	.	.	-12.9211	8.776	0.34762	0.1576:0.39:0.4523:0.0	.	311;311	A8K884;Q9UL16	.;CCD19_HUMAN	I	311;226	ENSP00000357079:M311I;ENSP00000403044:M226I	.	M	-	3	0	CCDC19	158117079	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	1.191000	0.32138	0.458000	0.26988	0.462000	0.41574	ATG		0.473	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1			13	57	1	0	1.05317e-09	0.00245	1.18245e-09	13	57				
IGSF8	93185	broad.mit.edu	37	1	160064708	160064708	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:160064708G>A	ENST00000368086.1	-	2	609	c.393C>T	c.(391-393)tcC>tcT	p.S131S	IGSF8_ENST00000314485.7_Silent_p.S131S|IGSF8_ENST00000460351.1_5'UTR			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	131	Ig-like C2-type 1.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GGGTATCAGTGGAGGGGGTGT	0.632																																							uc001fva.2		NA																	0					0						c.(391-393)TCC>TCT		immunoglobulin superfamily, member 8							39.0	42.0	41.0					1																	160064708		2203	4300	6503	SO:0001819	synonymous_variant	93185				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding	g.chr1:160064708G>A	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.393C>T	1.37:g.160064708G>A			Somatic				IGSF8_uc001fuz.2_Silent_p.S131S|IGSF8_uc009wtf.2_Silent_p.S131S	p.S131S	NM_052868	NP_443100	WXS	Illumina HiSeq	Unspecified	Q969P0	IGSF8_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		2	438	-	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		131			Ig-like C2-type 1.|Extracellular (Potential).		Q8NG09|Q96DP4|Q9BTG9	Silent	SNP	ENST00000368086.1	37	c.393C>T	CCDS1195.1																																																																																				0.632	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868		20	73	0	0	0	0.00278	0	20	73				
ARHGAP30	257106	broad.mit.edu	37	1	161024435	161024435	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:161024435C>T	ENST00000368013.3	-	4	726	c.406G>A	c.(406-408)Gaa>Aaa	p.E136K	ARHGAP30_ENST00000368015.1_Intron|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.E136K	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	136	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			ACAGGGAGTTCCCGAAGCACC	0.522																																							uc001fxl.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(406-408)GAA>AAA		Rho GTPase activating protein 30 isoform 1							162.0	163.0	163.0					1																	161024435		2203	4300	6503	SO:0001583	missense	257106				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr1:161024435C>T	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.406G>A	1.37:g.161024435C>T	ENSP00000356992:p.Glu136Lys		Somatic				ARHGAP30_uc001fxk.2_Missense_Mutation_p.E136K|ARHGAP30_uc001fxm.2_5'UTR|ARHGAP30_uc009wtx.2_5'UTR|ARHGAP30_uc001fxn.1_5'UTR	p.E136K	NM_001025598	NP_001020769	WXS	Illumina HiSeq	Unspecified	Q7Z6I6	RHG30_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00122)		4	752	-	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		136			Rho-GAP.		Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	c.406G>A	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596421	0.86953	.	.	ENSG00000186517	ENST00000368016;ENST00000368013	T;T	0.16897	2.31;2.31	5.86	5.86	0.93980	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.058601	0.64402	D	0.000003	T	0.15435	0.0372	N	0.05383	-0.06	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.80764	0.994;0.98	T	0.30179	-0.9987	10	0.38643	T	0.18	.	17.7531	0.88440	0.0:1.0:0.0:0.0	.	136;136	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	K	136	ENSP00000356995:E136K;ENSP00000356992:E136K	ENSP00000356992:E136K	E	-	1	0	ARHGAP30	159291059	0.559000	0.26562	1.000000	0.80357	0.949000	0.60115	1.065000	0.30592	2.784000	0.95788	0.644000	0.83932	GAA		0.522	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		33	127	0	0	0	0.009718	0	33	127				
NUF2	83540	broad.mit.edu	37	1	163298026	163298026	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:163298026G>C	ENST00000271452.3	+	4	486	c.207G>C	c.(205-207)gtG>gtC	p.V69V	NUF2_ENST00000367900.3_Silent_p.V69V|NUF2_ENST00000524800.1_Silent_p.V69V|NUF2_ENST00000490881.1_3'UTR	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	69	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AGATGCCAGTGAACTCTGAAG	0.323																																							uc001gcq.1		NA																	0				ovary(3)|skin(1)	4						c.(205-207)GTG>GTC		NUF2, NDC80 kinetochore complex component							147.0	133.0	138.0					1																	163298026		2203	4299	6502	SO:0001819	synonymous_variant	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163298026G>C	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.207G>C	1.37:g.163298026G>C			Somatic				NUF2_uc001gcp.2_Silent_p.V69V|NUF2_uc001gcr.1_Silent_p.V69V|NUF2_uc009wvc.1_Silent_p.V69V	p.V69V	NM_145697	NP_663735	WXS	Illumina HiSeq	Unspecified	Q9BZD4	NUF2_HUMAN			4	507	+	all_hematologic(923;0.101)		69			Interaction with the N-terminus of NDC80.		Q8WU69|Q96HJ4|Q96Q78	Silent	SNP	ENST00000271452.3	37	c.207G>C	CCDS1245.1																																																																																				0.323	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		50	49	0	0	0	0.00361	0	50	49				
MROH9	80133	broad.mit.edu	37	1	170967360	170967360	+	Missense_Mutation	SNP	T	T	A	rs370759194		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:170967360T>A	ENST00000367758.3	+	15	1640	c.1541T>A	c.(1540-1542)gTa>gAa	p.V514E	MROH9_ENST00000367759.4_Missense_Mutation_p.V514E	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	514																	AAGCTCTCAGTAGAAGGTCCT	0.398																																							uc001ghg.2		NA																	0				pancreas(1)	1						c.(1540-1542)GTA>GAA		hypothetical protein LOC80133 isoform 2							134.0	120.0	124.0					1																	170967360		1828	4077	5905	SO:0001583	missense	80133						binding	g.chr1:170967360T>A	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1541T>A	1.37:g.170967360T>A	ENSP00000356732:p.Val514Glu		Somatic				C1orf129_uc009wvy.2_Missense_Mutation_p.V321E|C1orf129_uc010plz.1_Missense_Mutation_p.V514E	p.V514E	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			15	1671	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		514					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	c.1541T>A	CCDS41436.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.16|16.16	3.045966|3.045966	0.55110|0.55110	.|.	.|.	ENSG00000117501|ENSG00000117501	ENST00000426136|ENST00000367759;ENST00000367758	T|T;T	0.66815|0.64438	-0.23|-0.1;2.36	4.65|4.65	4.65|4.65	0.58169|0.58169	.|.	.|0.000000	.|0.50627	.|D	.|0.000115	T|T	0.66752|0.66752	0.2821|0.2821	M|M	0.62723|0.62723	1.935|1.935	0.40007|0.40007	D|D	0.97523|0.97523	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.74674	.|0.984;0.984	T|T	0.69602|0.69602	-0.5101|-0.5101	7|10	0.51188|0.48119	T|T	0.08|0.1	-23.402|-23.402	10.8105|10.8105	0.46545|0.46545	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|514;514	.|F5GWX6;Q5TGP6	.|.;CA129_HUMAN	R|E	120|514	ENSP00000403697:S120R|ENSP00000356733:V514E;ENSP00000356732:V514E	ENSP00000403697:S120R|ENSP00000356732:V514E	S|V	+|+	3|2	2|0	C1orf129|C1orf129	169233984|169233984	0.892000|0.892000	0.30473|0.30473	0.843000|0.843000	0.33291|0.33291	0.496000|0.496000	0.33645|0.33645	2.055000|2.055000	0.41345|0.41345	1.867000|1.867000	0.54127|0.54127	0.367000|0.367000	0.22151|0.22151	AGT|GTA		0.398	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		23	85	0	0	0	0.001882	0	23	85				
SUCO	51430	broad.mit.edu	37	1	172579007	172579007	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:172579007G>C	ENST00000263688.3	+	24	3592	c.3373G>C	c.(3373-3375)Gaa>Caa	p.E1125Q	SUCO_ENST00000610051.1_Missense_Mutation_p.E754Q|SUCO_ENST00000367723.4_Missense_Mutation_p.E1276Q|SUCO_ENST00000608151.1_Missense_Mutation_p.E1277Q	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1125					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											AAAGCCTGAAGAACCATTGCA	0.368																																						Colon(43;174 953 11768 38880 47057)	uc001giq.3		NA																	0				ovary(2)	2						c.(3373-3375)GAA>CAA		chromosome 1 open reading frame 9 protein							77.0	80.0	79.0					1																	172579007		2203	4300	6503	SO:0001583	missense	51430				multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane		g.chr1:172579007G>C	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3373G>C	1.37:g.172579007G>C	ENSP00000263688:p.Glu1125Gln		Somatic				C1orf9_uc009wwd.2_Missense_Mutation_p.E1081Q|C1orf9_uc010pmn.1_Missense_Mutation_p.E754Q|C1orf9_uc010pmo.1_RNA	p.E1125Q	NM_014283	NP_055098	WXS	Illumina HiSeq	Unspecified	Q9UBS9	OSPT_HUMAN		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)	24	3689	+		Breast(1374;0.212)	1125					B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	c.3373G>C	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788843	0.31685	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.26	4.34	0.51931	.	0.401656	0.29300	N	0.012545	T	0.10937	0.0267	N	0.22421	0.69	0.29096	N	0.881787	P;P;B	0.49447	0.924;0.536;0.112	B;B;B	0.37091	0.241;0.099;0.063	T	0.03413	-1.1039	9	0.32370	T	0.25	-3.949	15.1119	0.72365	0.0:0.1421:0.8579:0.0	.	754;1277;1125	B4DYM4;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	Q	1277;1125	.	ENSP00000263688:E1125Q	E	+	1	0	C1orf9	170845630	1.000000	0.71417	0.999000	0.59377	0.882000	0.50991	5.787000	0.69013	1.341000	0.45600	0.650000	0.86243	GAA		0.368	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227		40	37	0	0	0	0.00361	0	40	37				
TNR	7143	broad.mit.edu	37	1	175332847	175332847	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:175332847G>T	ENST00000367674.2	-	13	3412	c.2704C>A	c.(2704-2706)Caa>Aaa	p.Q902K	TNR_ENST00000263525.2_Missense_Mutation_p.Q902K			Q92752	TENR_HUMAN	tenascin R	902	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TTGTTACCTTGGGTGGGTCGA	0.453																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(2704-2706)CAA>AAA		tenascin R precursor							139.0	130.0	133.0					1																	175332847		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175332847G>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2704C>A	1.37:g.175332847G>T	ENSP00000356646:p.Gln902Lys		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.Q902K	p.Q902K	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			11	2785	-	Renal(580;0.146)		902			Fibronectin type-III 7.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.2704C>A	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	6.041	0.375952	0.11409	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.56941	0.43;0.43	5.5	4.58	0.56647	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.245603	0.42172	N	0.000756	T	0.29588	0.0738	N	0.13098	0.295	0.34105	D	0.662262	B	0.02656	0.0	B	0.06405	0.002	T	0.30031	-0.9992	10	0.06494	T	0.89	.	9.8801	0.41227	0.0:0.1964:0.6643:0.1392	.	902	Q92752	TENR_HUMAN	K	902;902;812	ENSP00000356646:Q902K;ENSP00000263525:Q902K	ENSP00000263525:Q902K	Q	-	1	0	TNR	173599470	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.368000	0.44222	1.442000	0.47568	0.655000	0.94253	CAA		0.453	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		52	125	1	0	4.60343e-24	0.00361	5.79441e-24	52	125				
PAPPA2	60676	broad.mit.edu	37	1	176659359	176659359	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:176659359T>C	ENST00000367662.3	+	5	3388	c.2224T>C	c.(2224-2226)Tac>Cac	p.Y742H	PAPPA2_ENST00000367661.3_Missense_Mutation_p.Y742H	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	742	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TCTGGGACTCTACCATGTCTT	0.522																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(2224-2226)TAC>CAC		pappalysin 2 isoform 1							123.0	121.0	121.0					1																	176659359		2084	4250	6334	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176659359T>C	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2224T>C	1.37:g.176659359T>C	ENSP00000356634:p.Tyr742His		Somatic				PAPPA2_uc001gky.1_Missense_Mutation_p.Y742H|PAPPA2_uc009www.2_RNA	p.Y742H	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			5	3388	+			742			Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.2224T>C	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.263750	0.59431	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.80480	-1.38;0.28	5.33	5.33	0.75918	Peptidase M43, pregnancy-associated plasma-A (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90356	0.6982	M	0.84948	2.725	0.51233	D	0.999913	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91878	0.5513	10	0.72032	D	0.01	-24.2929	14.9711	0.71235	0.0:0.0:0.0:1.0	.	742;742	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	H	742	ENSP00000356634:Y742H;ENSP00000356633:Y742H	ENSP00000356633:Y742H	Y	+	1	0	PAPPA2	174925982	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	7.927000	0.87577	2.009000	0.58944	0.460000	0.39030	TAC		0.522	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			53	142	0	0	0	0.00361	0	53	142				
BRINP2	57795	broad.mit.edu	37	1	177199193	177199193	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:177199193G>T	ENST00000361539.4	+	2	493	c.181G>T	c.(181-183)Gac>Tac	p.D61Y		NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	61					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GCTGCTCACAGACCGGGGCCC	0.642																																							uc001glf.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(181-183)GAC>TAC		family with sequence similarity 5, member B							39.0	43.0	42.0					1																	177199193		2201	4295	6496	SO:0001583	missense	57795					extracellular region		g.chr1:177199193G>T		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.181G>T	1.37:g.177199193G>T	ENSP00000354481:p.Asp61Tyr		Somatic					p.D61Y	NM_021165	NP_066988	WXS	Illumina HiSeq	Unspecified	Q9C0B6	FAM5B_HUMAN			2	493	+			61					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	c.181G>T	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718669	0.89205	.	.	ENSG00000198797	ENST00000361539	T	0.22539	1.95	5.63	5.63	0.86233	.	0.064540	0.64402	D	0.000012	T	0.33411	0.0862	L	0.59436	1.845	0.58432	D	0.999999	D	0.55385	0.971	P	0.52710	0.707	T	0.03231	-1.1058	10	0.87932	D	0	-35.7273	12.6262	0.56630	0.0757:0.0:0.9243:0.0	.	61	Q9C0B6	FAM5B_HUMAN	Y	61	ENSP00000354481:D61Y	ENSP00000354481:D61Y	D	+	1	0	FAM5B	175465816	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	7.742000	0.85008	2.652000	0.90054	0.655000	0.94253	GAC		0.642	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		31	82	1	0	4.11147e-13	0.003755	4.78046e-13	31	82				
SEC16B	89866	broad.mit.edu	37	1	177902413	177902413	+	Missense_Mutation	SNP	G	G	A	rs77169763		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:177902413G>A	ENST00000308284.6	-	22	2848	c.2759C>T	c.(2758-2760)tCg>tTg	p.S920L	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000495165.1_5'UTR	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	920					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GGTGGGCTTCGATCGAAACCA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		17429	0.001		0.0	False		,,,				2504	0.0						uc001gli.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(2758-2760)TCG>TTG		leucine zipper transcription regulator 2		G	LEU/SER	1,3951		0,1,1975	30.0	38.0	35.0		2759	4.7	0.0	1	dbSNP_131	35	0,8338		0,0,4169	no	missense	SEC16B	NM_033127.2	145	0,1,6144	AA,AG,GG		0.0,0.0253,0.0081	probably-damaging	920/1061	177902413	1,12289	1976	4169	6145	SO:0001583	missense	89866				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane		g.chr1:177902413G>A	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2759C>T	1.37:g.177902413G>A	ENSP00000308339:p.Ser920Leu		Somatic				SEC16B_uc001glk.1_Missense_Mutation_p.S597L|SEC16B_uc009wwy.1_Missense_Mutation_p.S475L|SEC16B_uc001glh.1_Missense_Mutation_p.S579L|SEC16B_uc009wwz.1_Missense_Mutation_p.S579L|SEC16B_uc001glj.1_Missense_Mutation_p.S921L	p.S920L	NM_033127	NP_149118	WXS	Illumina HiSeq	Unspecified	Q96JE7	SC16B_HUMAN			22	2849	-			920					A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	c.2759C>T	CCDS44281.1	4	0.0018315018315018315	0	0.0	0	0.0	1	0.0017482517482517483	3	0.00395778364116095	G	15.04	2.716285	0.48622	2.53E-4	0.0	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.17854	2.25	5.65	4.72	0.59763	.	0.000000	0.64402	D	0.000012	T	0.38746	0.1052	M	0.70275	2.135	0.30835	N	0.736321	D;B;B;B	0.89917	1.0;0.263;0.167;0.263	D;B;B;B	0.79108	0.992;0.02;0.011;0.02	T	0.41716	-0.9493	10	0.38643	T	0.18	-0.9901	12.4682	0.55771	0.0:0.1682:0.8318:0.0	.	475;921;920;617	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	L	920;604;635	ENSP00000308339:S920L	ENSP00000239472:S635L	S	-	2	0	AL359075.1	176169036	0.852000	0.29690	0.017000	0.16124	0.268000	0.26511	2.411000	0.44600	1.346000	0.45694	0.655000	0.94253	TCG		0.577	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		11	7	0	0	0	0.001368	0	11	7				
SWT1	54823	broad.mit.edu	37	1	185143850	185143850	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:185143850A>T	ENST00000367500.4	+	5	736	c.571A>T	c.(571-573)Aac>Tac	p.N191Y	SWT1_ENST00000367501.3_Missense_Mutation_p.N191Y	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	191										breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						GAAAGGAAGAAACAGTAAATT	0.348																																							uc001grg.3		NA																	0					0						c.(571-573)AAC>TAC		hypothetical protein LOC54823							39.0	43.0	42.0					1																	185143850		2199	4300	6499	SO:0001583	missense	54823							g.chr1:185143850A>T	AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.571A>T	1.37:g.185143850A>T	ENSP00000356470:p.Asn191Tyr		Somatic				C1orf26_uc001grh.3_Missense_Mutation_p.N191Y	p.N191Y	NM_001105518	NP_001098988	WXS	Illumina HiSeq	Unspecified	Q5T5J6	SWT1_HUMAN			5	685	+			191					Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	ENST00000367500.4	37	c.571A>T	CCDS1367.1	.	.	.	.	.	.	.	.	.	.	A	1.809	-0.475240	0.04414	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.18338	2.22;2.22	5.51	-10.2	0.00374	.	1.129070	0.06534	N	0.742097	T	0.04227	0.0117	N	0.03154	-0.405	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37150	-0.9718	10	0.02654	T	1	.	7.0388	0.25008	0.2539:0.5458:0.081:0.1193	.	191	Q5T5J6	SWT1_HUMAN	Y	191	ENSP00000356471:N191Y;ENSP00000356470:N191Y	ENSP00000356470:N191Y	N	+	1	0	SWT1	183410473	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.977000	0.03782	-1.301000	0.02338	-0.624000	0.04008	AAC		0.348	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673		20	18	0	0	0	0.001882	0	20	18				
TRAF5	7188	broad.mit.edu	37	1	211529722	211529722	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:211529722A>G	ENST00000261464.5	+	4	344	c.290A>G	c.(289-291)aAt>aGt	p.N97S	TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000367004.3_Missense_Mutation_p.N97S|TRAF5_ENST00000427925.2_Missense_Mutation_p.N97S|TRAF5_ENST00000336184.2_Missense_Mutation_p.N97S	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	97					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TTTAAAGACAATTGTTGCAAA	0.358																																							uc001hih.2		NA																	0				lung(2)|breast(2)|ovary(1)	5						c.(289-291)AAT>AGT		TNF receptor-associated factor 5							160.0	159.0	160.0					1																	211529722		2203	4300	6503	SO:0001583	missense	7188				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:211529722A>G	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.290A>G	1.37:g.211529722A>G	ENSP00000261464:p.Asn97Ser		Somatic				TRAF5_uc001hii.2_Missense_Mutation_p.N97S|TRAF5_uc010psx.1_Missense_Mutation_p.N97S|TRAF5_uc010psy.1_Missense_Mutation_p.N97S|TRAF5_uc001hij.2_Missense_Mutation_p.N97S	p.N97S	NM_004619	NP_004610	WXS	Illumina HiSeq	Unspecified	O00463	TRAF5_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)	4	350	+			97					B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	ENST00000261464.5	37	c.290A>G	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	A	18.25	3.582297	0.65992	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;T;T;T	0.39229	2.02;1.09;2.02;2.02	4.79	4.79	0.61399	Zinc finger, RING/FYVE/PHD-type (1);	0.096640	0.64402	N	0.000002	T	0.65026	0.2652	M	0.78285	2.405	0.40969	D	0.984685	D;D;D	0.89917	0.996;1.0;0.997	D;D;D	0.83275	0.99;0.996;0.985	T	0.70139	-0.4954	10	0.54805	T	0.06	-38.1948	14.6335	0.68673	1.0:0.0:0.0:0.0	.	97;97;97	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	S	97	ENSP00000336825:N97S;ENSP00000389891:N97S;ENSP00000261464:N97S;ENSP00000355971:N97S	ENSP00000261464:N97S	N	+	2	0	TRAF5	209596345	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.485000	0.60279	1.913000	0.55393	0.533000	0.62120	AAT		0.358	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619		34	50	0	0	0	0.003755	0	34	50				
USH2A	7399	broad.mit.edu	37	1	215848206	215848206	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:215848206G>T	ENST00000307340.3	-	63	13433	c.13047C>A	c.(13045-13047)atC>atA	p.I4349I	USH2A_ENST00000366943.2_Silent_p.I4349I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4349	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCAGAGTTGTGATGCTGGTGG	0.512										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(13045-13047)ATC>ATA		usherin isoform B							63.0	63.0	63.0					1																	215848206		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215848206G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13047C>A	1.37:g.215848206G>T		HNSCC(13;0.011)	Somatic					p.I4349I	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	63	13434	-			4349			Fibronectin type-III 28.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.13047C>A	CCDS31025.1																																																																																				0.512	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		34	32	1	0	3.33393e-15	0.004878	3.95005e-15	34	32				
USH2A	7399	broad.mit.edu	37	1	216062108	216062108	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:216062108G>T	ENST00000307340.3	-	41	8269	c.7883C>A	c.(7882-7884)cCa>cAa	p.P2628Q	USH2A_ENST00000366943.2_Missense_Mutation_p.P2628Q|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2628	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCTGGACTTGGGATCCCTTC	0.498										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(7882-7884)CCA>CAA		usherin isoform B							77.0	81.0	80.0					1																	216062108		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216062108G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7883C>A	1.37:g.216062108G>T	ENSP00000305941:p.Pro2628Gln	HNSCC(13;0.011)	Somatic					p.P2628Q	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	41	8270	-			2628			Extracellular (Potential).|Fibronectin type-III 13.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.7883C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762364	0.31228	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53206	0.63;0.63	5.84	3.99	0.46301	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.344301	0.20803	N	0.085387	T	0.58206	0.2106	L	0.53249	1.67	0.46096	D	0.998863	P	0.51147	0.942	P	0.60012	0.867	T	0.52668	-0.8545	10	0.33141	T	0.24	.	12.3789	0.55295	0.1352:0.0:0.8648:0.0	.	2628	O75445	USH2A_HUMAN	Q	2628	ENSP00000305941:P2628Q;ENSP00000355910:P2628Q	ENSP00000305941:P2628Q	P	-	2	0	USH2A	214128731	1.000000	0.71417	0.073000	0.20177	0.187000	0.23431	3.044000	0.49830	0.824000	0.34613	0.655000	0.94253	CCA		0.498	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		35	28	1	0	6.00712e-18	0.002445	7.31951e-18	35	28				
USH2A	7399	broad.mit.edu	37	1	216246500	216246500	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:216246500G>A	ENST00000307340.3	-	28	6101	c.5715C>T	c.(5713-5715)tcC>tcT	p.S1905S	RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Silent_p.S1905S|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1905	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAACCAGGATGGAGTCATTTC	0.473										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(5713-5715)TCC>TCT		usherin isoform B							88.0	76.0	80.0					1																	216246500		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216246500G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5715C>T	1.37:g.216246500G>A		HNSCC(13;0.011)	Somatic					p.S1905S	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	28	6102	-			1905			Fibronectin type-III 5.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.5715C>T	CCDS31025.1																																																																																				0.473	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		20	23	0	0	0	0.008871	0	20	23				
RAB3GAP2	25782	broad.mit.edu	37	1	220327347	220327347	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:220327347C>T	ENST00000358951.2	-	32	3724	c.3608G>A	c.(3607-3609)gGg>gAg	p.G1203E		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	1203					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		ATCCATTTCCCCACTAGGTAA	0.308																																							uc010puk.1		NA																	0				central_nervous_system(1)	1						c.(3607-3609)GGG>GAG		rab3 GTPase-activating protein, non-catalytic							112.0	121.0	118.0					1																	220327347		2201	4299	6500	SO:0001583	missense	25782				intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity	g.chr1:220327347C>T	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.3608G>A	1.37:g.220327347C>T	ENSP00000351832:p.Gly1203Glu		Somatic				RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.G783E|RAB3GAP2_uc001hmh.2_Missense_Mutation_p.G147E	p.G1203E	NM_012414	NP_036546	WXS	Illumina HiSeq	Unspecified	Q9H2M9	RBGPR_HUMAN		GBM - Glioblastoma multiforme(131;0.0443)	32	3772	-			1203					A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	c.3608G>A	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753023	0.89753	.	.	ENSG00000118873	ENST00000358951	T	0.28069	1.63	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.14559	-1.0468	10	0.31617	T	0.26	.	20.2602	0.98440	0.0:1.0:0.0:0.0	.	1203;1203	Q9H2M9;A6H8V0	RBGPR_HUMAN;.	E	1203	ENSP00000351832:G1203E	ENSP00000351832:G1203E	G	-	2	0	RAB3GAP2	218393970	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.892000	0.75644	2.861000	0.98227	0.655000	0.94253	GGG		0.308	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414		5	195	0	0	0	0.001168	0	5	195				
SRP9	6726	broad.mit.edu	37	1	225976981	225976981	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:225976981A>G	ENST00000304786.7	+	3	293	c.181A>G	c.(181-183)Aag>Gag	p.K61E	SRP9_ENST00000366839.4_3'UTR|SRP9_ENST00000366838.1_3'UTR	NM_003133.5	NP_003124.1	P49458	SRP09_HUMAN	signal recognition particle 9kDa	61					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|negative regulation of translational elongation (GO:0045900)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|signal recognition particle receptor complex (GO:0005785)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|RNA binding (GO:0003723)|signal recognition particle binding (GO:0005047)			endometrium(1)|kidney(1)|skin(1)	3						AGATGTAAAGAAGATTGAGAA	0.348																																							uc001hpg.2		NA																	0					0						c.(181-183)AAG>GAG		signal recognition particle 9kDa isoform 2							39.0	39.0	39.0					1																	225976981		2203	4299	6502	SO:0001583	missense	6726				negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding	g.chr1:225976981A>G	BC015094	CCDS1546.1, CCDS44323.1	1q42.12	2010-06-03	2002-08-29		ENSG00000143742	ENSG00000143742			11304	protein-coding gene	gene with protein product		600707	"""signal recognition particle 9kD"""			7730321	Standard	NM_001130440		Approved		uc001hpg.3	P49458	OTTHUMG00000037738	ENST00000304786.7:c.181A>G	1.37:g.225976981A>G	ENSP00000305230:p.Lys61Glu		Somatic				SRP9_uc001hpf.3_RNA|SRP9_uc001hph.2_3'UTR|SRP9_uc001hpi.3_RNA	p.K61E	NM_003133	NP_003124	WXS	Illumina HiSeq	Unspecified	P49458	SRP09_HUMAN			3	309	+			61					A8K0N0|Q6NVX0|Q8WTW0	Missense_Mutation	SNP	ENST00000304786.7	37	c.181A>G	CCDS1546.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.794496	0.90453	.	.	ENSG00000143742	ENST00000304786	.	.	.	5.79	5.79	0.91817	Signal recognition particle, SRP9/SRP14 subunit (2);	0.000000	0.85682	U	0.000000	T	0.78489	0.4291	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	T	0.81502	-0.0904	8	0.87932	D	0	-3.1804	14.6941	0.69107	1.0:0.0:0.0:0.0	.	61	P49458	SRP09_HUMAN	E	61	.	ENSP00000305230:K61E	K	+	1	0	SRP9	224043604	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.600000	0.90860	2.202000	0.70862	0.533000	0.62120	AAG		0.348	SRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092054.1	NM_003133		17	12	0	0	0	0.008361	0	17	12				
LEFTY1	10637	broad.mit.edu	37	1	226076613	226076613	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:226076613C>A	ENST00000272134.5	-	1	233	c.154G>T	c.(154-156)Gtc>Ttc	p.V52F	RP4-559A3.7_ENST00000432920.2_Intron|LEFTY1_ENST00000492457.1_Intron	NM_020997.3	NP_066277.1	O75610	LFTY1_HUMAN	left-right determination factor 1	52					cell growth (GO:0016049)|determination of left/right symmetry (GO:0007368)|heart morphogenesis (GO:0003007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)				cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	10	Breast(184;0.197)					GTGGGGATGACCAGCTCCTCC	0.701																																							uc001hpo.2		NA																	0					0						c.(154-156)GTC>TTC		left-right determination, factor B							29.0	31.0	30.0					1																	226076613		2203	4299	6502	SO:0001583	missense	10637				cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226076613C>A	AF081507	CCDS1548.1	1q42.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000243709	ENSG00000243709			6552	protein-coding gene	gene with protein product		603037	"""left-right determination, factor B"""	LEFTB		10053005, 10886363	Standard	NM_020997		Approved	LEFTYB	uc001hpo.3	O75610	OTTHUMG00000037443	ENST00000272134.5:c.154G>T	1.37:g.226076613C>A	ENSP00000272134:p.Val52Phe		Somatic				LEFTY1_uc010pvj.1_Intron|LEFTY1_uc009xej.1_Missense_Mutation_p.V52F	p.V52F	NM_020997	NP_066277	WXS	Illumina HiSeq	Unspecified	O75610	LFTY1_HUMAN			1	224	-	Breast(184;0.197)		52					B2R7U0|Q53H67|Q5TE94	Missense_Mutation	SNP	ENST00000272134.5	37	c.154G>T	CCDS1548.1	.	.	.	.	.	.	.	.	.	.	c	13.68	2.308884	0.40895	.	.	ENSG00000243709	ENST00000272134	T	0.67345	-0.26	4.18	3.27	0.37495	Transforming growth factor-beta, N-terminal (1);	0.240387	0.41938	D	0.000788	T	0.75213	0.3819	M	0.75777	2.31	0.42502	D	0.992931	P;P	0.51240	0.943;0.943	P;P	0.57371	0.819;0.819	T	0.76386	-0.2978	10	0.87932	D	0	.	9.1291	0.36835	0.0:0.8926:0.0:0.1074	.	52;52	B2R7U0;O75610	.;LFTY1_HUMAN	F	52	ENSP00000272134:V52F	ENSP00000272134:V52F	V	-	1	0	LEFTY1	224143236	0.998000	0.40836	0.052000	0.19188	0.045000	0.14185	0.560000	0.23500	0.761000	0.33130	0.313000	0.20887	GTC		0.701	LEFTY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091155.1	NM_020997		4	33	1	0	1.23904e-05	0.000602	1.3117e-05	4	33				
SIPA1L2	57568	broad.mit.edu	37	1	232577108	232577108	+	Silent	SNP	G	G	A	rs181504085		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:232577108G>A	ENST00000366630.1	-	13	3929	c.3571C>T	c.(3571-3573)Ctg>Ttg	p.L1191L	SIPA1L2_ENST00000308942.4_Silent_p.L265L|SIPA1L2_ENST00000262861.4_Silent_p.L1191L			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1191					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TAGGAACCCAGGACTTTGGAA	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		19162	0.0		0.001	False		,,,				2504	0.0						uc001hvg.2		NA																	0				ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(3571-3573)CTG>TTG		signal-induced proliferation-associated 1 like							225.0	233.0	230.0					1																	232577108		1828	4087	5915	SO:0001819	synonymous_variant	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232577108G>A	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3571C>T	1.37:g.232577108G>A			Somatic				SIPA1L2_uc001hvf.2_Silent_p.L265L	p.L1191L	NM_020808	NP_065859	WXS	Illumina HiSeq	Unspecified	Q9P2F8	SI1L2_HUMAN			12	3729	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	1191					Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	ENST00000366630.1	37	c.3571C>T	CCDS41474.1																																																																																				0.408	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		88	280	0	0	0	0.00361	0	88	280				
TARBP1	6894	broad.mit.edu	37	1	234546274	234546274	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:234546274C>T	ENST00000040877.1	-	23	3708	c.3709G>A	c.(3709-3711)Gaa>Aaa	p.E1237K	TARBP1_ENST00000483404.1_5'Flank	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1237					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGATTTTCTTCACCCTGAAAA	0.348																																							uc001hwd.2		NA																	0				ovary(2)|skin(1)	3						c.(3709-3711)GAA>AAA		TAR RNA binding protein 1							43.0	47.0	45.0					1																	234546274		2197	4294	6491	SO:0001583	missense	6894				regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity	g.chr1:234546274C>T		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3709G>A	1.37:g.234546274C>T	ENSP00000040877:p.Glu1237Lys		Somatic					p.E1237K	NM_005646	NP_005637	WXS	Illumina HiSeq	Unspecified	Q13395	TARB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000263)		23	3709	-	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	1237					Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	c.3709G>A	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960313	0.74016	.	.	ENSG00000059588	ENST00000040877	T	0.06849	3.25	4.73	4.73	0.59995	Armadillo-type fold (1);	0.124322	0.56097	D	0.000033	T	0.15305	0.0369	L	0.60455	1.87	0.58432	D	0.999995	D	0.57257	0.979	P	0.49999	0.628	T	0.06006	-1.0851	10	0.20046	T	0.44	-12.8249	16.4216	0.83760	0.0:1.0:0.0:0.0	.	1237	Q13395	TARB1_HUMAN	K	1237	ENSP00000040877:E1237K	ENSP00000040877:E1237K	E	-	1	0	TARBP1	232612897	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.717000	0.61923	2.609000	0.88269	0.467000	0.42956	GAA		0.348	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646		9	44	0	0	0	0.004482	0	9	44				
RBM34	23029	broad.mit.edu	37	1	235324524	235324524	+	Missense_Mutation	SNP	C	C	T	rs370358826		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:235324524C>T	ENST00000408888.3	-	1	248	c.18G>A	c.(16-18)atG>atA	p.M6I	RBM34_ENST00000366606.3_Start_Codon_SNP_p.M1I			P42696	RBM34_HUMAN	RNA binding motif protein 34	6						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M6I(1)		central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			TCCGTTTGCTCATCCCTTCCA	0.622																																							uc001hwn.2		NA																	1	Substitution - Missense(1)		breast(1)	central_nervous_system(1)	1						c.(16-18)ATG>ATA		RNA binding motif protein 34 isoform 1		C	ILE/MET,ILE/MET	0,4156		0,0,2078	138.0	155.0	149.0		18,18	1.6	0.0	1		149	1,8381		0,1,4190	no	missense,missense	RBM34	NM_015014.2,NM_001161533.1	10,10	0,1,6268	TT,TC,CC		0.0119,0.0,0.0080	benign,benign	6/431,6/226	235324524	1,12537	2078	4191	6269	SO:0001583	missense	23029					nucleolus	nucleotide binding|RNA binding	g.chr1:235324524C>T		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.18G>A	1.37:g.235324524C>T	ENSP00000386226:p.Met6Ile		Somatic				RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA|RBM34_uc010pxp.1_Missense_Mutation_p.M6I	p.M6I	NM_015014	NP_055829	WXS	Illumina HiSeq	Unspecified	P42696	RBM34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)		1	48	-	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	6					A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	c.18G>A	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	C	11.73	1.725117	0.30593	0.0	1.19E-4	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000400947;ENST00000447801;ENST00000429912	T;T;T	0.13420	2.59;2.63;2.7	4.63	1.57	0.23409	.	0.695426	0.14072	N	0.343295	T	0.06188	0.0160	N	0.08118	0	0.20307	N	0.999911	B;B	0.21309	0.008;0.054	B;B	0.20577	0.03;0.027	T	0.33137	-0.9880	10	0.87932	D	0	-0.977	3.3013	0.06984	0.1769:0.5558:0.1713:0.0961	.	6;6	P42696-2;P42696	.;RBM34_HUMAN	I	6;1;6;4;6	ENSP00000386226:M6I;ENSP00000355565:M1I;ENSP00000400000:M4I	ENSP00000355565:M1I	M	-	3	0	RBM34	233391147	0.000000	0.05858	0.008000	0.14137	0.018000	0.09664	0.208000	0.17415	0.220000	0.20860	-0.137000	0.14449	ATG		0.622	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014		77	120	0	0	0	0.00361	0	77	120				
RYR2	6262	broad.mit.edu	37	1	237780642	237780642	+	Silent	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:237780642C>A	ENST00000366574.2	+	38	6089	c.5772C>A	c.(5770-5772)gcC>gcA	p.A1924A	RYR2_ENST00000360064.6_Silent_p.A1922A|RYR2_ENST00000542537.1_Silent_p.A1908A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1924	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGATAGAAGCCATTGTAGCCT	0.433																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(5770-5772)GCC>GCA		cardiac muscle ryanodine receptor							65.0	60.0	61.0					1																	237780642		1929	4139	6068	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237780642C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5772C>A	1.37:g.237780642C>A			Somatic					p.A1924A	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		38	5892	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1924			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.5772C>A	CCDS55691.1																																																																																				0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		8	30	1	0	3.09899e-07	0.004482	3.35846e-07	8	30				
CNST	163882	broad.mit.edu	37	1	246784876	246784876	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:246784876A>G	ENST00000366513.4	+	3	794	c.525A>G	c.(523-525)tcA>tcG	p.S175S	CNST_ENST00000366512.3_Silent_p.S175S|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	175					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						CTCTGTTTTCACTTATACGAG	0.453																																							uc001ibp.2		NA																	0					0						c.(523-525)TCA>TCG		hypothetical protein LOC163882 isoform 1							201.0	197.0	198.0					1																	246784876		2203	4300	6503	SO:0001819	synonymous_variant	163882				positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding	g.chr1:246784876A>G	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.525A>G	1.37:g.246784876A>G			Somatic				CNST_uc001ibo.3_Silent_p.S175S	p.S175S	NM_152609	NP_689822	WXS	Illumina HiSeq	Unspecified	Q6PJW8	CNST_HUMAN			3	903	+			175					Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Silent	SNP	ENST00000366513.4	37	c.525A>G	CCDS1628.1																																																																																				0.453	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609		52	170	0	0	0	0.00361	0	52	170				
OR2G2	81470	broad.mit.edu	37	1	247752236	247752236	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:247752236G>T	ENST00000320065.1	+	1	575	c.575G>T	c.(574-576)tGt>tTt	p.C192F	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AAGCTGGCTTGTGTGGGCACC	0.537																																							uc010pyy.1		NA																	0					0						c.(574-576)TGT>TTT		olfactory receptor, family 2, subfamily G,							173.0	173.0	173.0					1																	247752236		2203	4300	6503	SO:0001583	missense	81470				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247752236G>T	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.575G>T	1.37:g.247752236G>T	ENSP00000326349:p.Cys192Phe		Somatic					p.C192F	NM_001001915	NP_001001915	WXS	Illumina HiSeq	Unspecified	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	575	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		192			Extracellular (Potential).		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	c.575G>T	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522561	0.64747	.	.	ENSG00000177489	ENST00000320065	T	0.00460	7.27	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	U	0.000980	T	0.02688	0.0081	H	0.97051	3.93	0.44908	D	0.997923	D	0.89917	1.0	D	0.97110	1.0	T	0.05162	-1.0902	10	0.87932	D	0	.	14.3294	0.66545	0.0:0.0:1.0:0.0	.	192	Q8NGZ5	OR2G2_HUMAN	F	192	ENSP00000326349:C192F	ENSP00000326349:C192F	C	+	2	0	OR2G2	245818859	0.956000	0.32656	0.998000	0.56505	0.793000	0.44817	3.469000	0.53093	2.206000	0.71126	0.591000	0.81541	TGT		0.537	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1			54	78	1	0	1.0442e-30	0.00361	1.35924e-30	54	78				
OR14C36	127066	broad.mit.edu	37	1	248512673	248512673	+	Silent	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:248512673C>A	ENST00000317861.1	+	1	597	c.597C>A	c.(595-597)gtC>gtA	p.V199V		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						TGATTGTTGTCTCTGCTCTGG	0.483																																							uc010pzl.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(595-597)GTC>GTA		olfactory receptor, family 14, subfamily C,							160.0	147.0	151.0					1																	248512673		2203	4300	6503	SO:0001819	synonymous_variant	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512673C>A	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.597C>A	1.37:g.248512673C>A			Somatic					p.V199V	NM_001001918	NP_001001918	WXS	Illumina HiSeq	Unspecified	Q8NHC7	O14CZ_HUMAN			1	597	+			199			Helical; Name=5; (Potential).		Q6IEZ6	Silent	SNP	ENST00000317861.1	37	c.597C>A	CCDS31112.1																																																																																				0.483	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		26	86	1	0	3.73988e-18	0.00632	4.57319e-18	26	86				
LARP4B	23185	broad.mit.edu	37	10	871104	871104	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:871104G>A	ENST00000316157.3	-	12	1425	c.1385C>T	c.(1384-1386)aCa>aTa	p.T462I		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	462					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TTGAATCCGTGTTCTAGTTTG	0.493																																							uc001ifs.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1384-1386)ACA>ATA		La ribonucleoprotein domain family, member 4B							161.0	169.0	166.0					10																	871104		2203	4300	6503	SO:0001583	missense	23185						nucleotide binding|RNA binding	g.chr10:871104G>A	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1385C>T	10.37:g.871104G>A	ENSP00000326128:p.Thr462Ile		Somatic					p.T462I	NM_015155	NP_055970	WXS	Illumina HiSeq	Unspecified	Q92615	LAR4B_HUMAN			12	1426	-			462					A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	37	c.1385C>T	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289449	0.59976	.	.	ENSG00000107929	ENST00000316157	T	0.41065	1.01	5.81	5.81	0.92471	.	0.135636	0.64402	D	0.000002	T	0.50343	0.1610	L	0.43923	1.385	0.58432	D	0.999999	D	0.56035	0.974	P	0.53224	0.721	T	0.22034	-1.0228	10	0.25751	T	0.34	-6.9935	20.0833	0.97789	0.0:0.0:1.0:0.0	.	462	Q92615	LAR4B_HUMAN	I	462	ENSP00000326128:T462I	ENSP00000326128:T462I	T	-	2	0	LARP4B	861104	1.000000	0.71417	0.996000	0.52242	0.519000	0.34347	7.993000	0.88291	2.756000	0.94617	0.655000	0.94253	ACA		0.493	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155		54	86	0	0	0	0.00361	0	54	86				
FBXO18	84893	broad.mit.edu	37	10	5965635	5965635	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:5965635C>T	ENST00000362091.4	+	16	2489	c.2374C>T	c.(2374-2376)Cag>Tag	p.Q792*	FBXO18_ENST00000379999.5_Nonsense_Mutation_p.Q843*|FBXO18_ENST00000397269.3_Nonsense_Mutation_p.Q279*	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	792					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GATCCTTCTTCAGCCAGAGGA	0.438																																							uc001iis.2		NA																	0				ovary(2)|skin(1)	3						c.(2374-2376)CAG>TAG		F-box only protein, helicase, 18 isoform 2							92.0	92.0	92.0					10																	5965635		2203	4300	6503	SO:0001587	stop_gained	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5965635C>T	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2374C>T	10.37:g.5965635C>T	ENSP00000355415:p.Gln792*		Somatic				FBXO18_uc001iir.2_Nonsense_Mutation_p.Q718*|FBXO18_uc009xig.2_Nonsense_Mutation_p.Q718*|FBXO18_uc001iit.2_Nonsense_Mutation_p.Q843*	p.Q792*	NM_178150	NP_835363	WXS	Illumina HiSeq	Unspecified	Q8NFZ0	FBX18_HUMAN			16	2469	+			792					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Nonsense_Mutation	SNP	ENST00000362091.4	37	c.2374C>T	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	C	42	9.257012	0.99117	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	.	.	.	5.9	5.0	0.66597	.	0.053963	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-21.4611	14.3757	0.66874	0.1489:0.8511:0.0:0.0	.	.	.	.	X	279;792;843	.	ENSP00000355415:Q792X	Q	+	1	0	FBXO18	6005641	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.210000	0.65214	1.503000	0.48686	0.558000	0.71614	CAG		0.438	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		17	52	0	0	0	0.008871	0	17	52				
PHYH	5264	broad.mit.edu	37	10	13337539	13337539	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:13337539C>G	ENST00000263038.4	-	3	260	c.202G>C	c.(202-204)Gta>Cta	p.V68L	PHYH_ENST00000396913.2_5'UTR|PHYH_ENST00000396920.3_Missense_Mutation_p.V49L	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	68					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)			NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	TTTTTGATTACTAGAAACCCA	0.323																																							uc001imf.2		NA																	0					0						c.(202-204)GTA>CTA		phytanoyl-CoA 2-hydroxylase isoform a precursor	Antihemophilic Factor(DB00025)|Vitamin C(DB00126)						88.0	90.0	89.0					10																	13337539		2201	4300	6501	SO:0001583	missense	5264				fatty acid alpha-oxidation|nervous system development	peroxisomal matrix	electron carrier activity|L-ascorbic acid binding|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|phytanoyl-CoA dioxygenase activity|protein binding	g.chr10:13337539C>G		CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.202G>C	10.37:g.13337539C>G	ENSP00000263038:p.Val68Leu		Somatic				PHYH_uc001ime.2_5'UTR|PHYH_uc001img.2_Missense_Mutation_p.V49L	p.V68L	NM_006214	NP_006205	WXS	Illumina HiSeq	Unspecified	O14832	PAHX_HUMAN			3	290	-		Ovarian(717;0.0448)	68					A8MTS8|B1ALH5	Missense_Mutation	SNP	ENST00000263038.4	37	c.202G>C	CCDS7097.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456713	0.26161	.	.	ENSG00000107537	ENST00000263038;ENST00000396920;ENST00000479604	D;D;D	0.91843	-2.92;-2.92;-2.92	5.67	1.65	0.23941	.	0.254747	0.39687	N	0.001289	D	0.86711	0.5998	L	0.27944	0.81	0.35990	D	0.836614	B;B	0.27316	0.175;0.175	B;B	0.39876	0.209;0.312	T	0.78909	-0.2018	10	0.33141	T	0.24	-10.4905	6.5569	0.22466	0.0:0.5504:0.2365:0.2131	.	49;68	B1ALH6;O14832	.;PAHX_HUMAN	L	68;49;68	ENSP00000263038:V68L;ENSP00000380126:V49L;ENSP00000420117:V68L	ENSP00000263038:V68L	V	-	1	0	PHYH	13377545	0.902000	0.30710	0.929000	0.37066	0.135000	0.20990	1.235000	0.32671	0.036000	0.15547	-0.310000	0.09108	GTA		0.323	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046845.2			13	64	0	0	0	0.001855	0	13	64				
KIF5B	3799	broad.mit.edu	37	10	32329346	32329346	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:32329346C>T	ENST00000302418.4	-	3	711	c.254G>A	c.(253-255)gGa>gAa	p.G85E		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	85	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				GGATGTTTGTCCATATGCAAA	0.323			T	"""RET, ALK"""	NSCLC																																		uc001iwe.3		NA		Dom	yes		10	10p11.22	3799		kinesin family member 5B			E				KIF5B/ALK(4)	0				lung(4)|ovary(1)	5						c.(253-255)GGA>GAA		kinesin family member 5B							224.0	201.0	209.0					10																	32329346		2202	4297	6499	SO:0001583	missense	3799				stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity	g.chr10:32329346C>T	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.254G>A	10.37:g.32329346C>T	ENSP00000307078:p.Gly85Glu		Somatic					p.G85E	NM_004521	NP_004512	WXS	Illumina HiSeq	Unspecified	P33176	KINH_HUMAN			3	724	-		Prostate(175;0.0137)	85			Kinesin-motor.|ATP.		A0AVB2|Q5VZ85	Missense_Mutation	SNP	ENST00000302418.4	37	c.254G>A	CCDS7171.1	.	.	.	.	.	.	.	.	.	.	C	33	5.235105	0.95207	.	.	ENSG00000170759	ENST00000302418	D	0.96802	-4.13	5.8	5.8	0.92144	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	H	0.99946	5.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98098	1.0413	10	0.87932	D	0	.	20.1011	0.97876	0.0:1.0:0.0:0.0	.	85	P33176	KINH_HUMAN	E	85	ENSP00000307078:G85E	ENSP00000307078:G85E	G	-	2	0	KIF5B	32369352	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.713000	0.84693	2.754000	0.94517	0.650000	0.86243	GGA		0.323	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521		10	54	0	0	0	0.008291	0	10	54				
CCDC7	79741	broad.mit.edu	37	10	33137593	33137593	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:33137593C>T	ENST00000375030.2	+	20	2066	c.1448C>T	c.(1447-1449)aCa>aTa	p.T483I	C10orf68_ENST00000375025.4_Missense_Mutation_p.T588I|C10orf68_ENST00000375028.3_Missense_Mutation_p.T528I			Q9H943	CJ068_HUMAN		524										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AGGAGCATTACACCAAGTAAA	0.279																																							uc001iwn.3		NA																	0				skin(2)|ovary(1)	3						c.(1570-1572)ACA>ATA		chromosome 10 open reading frame 68							79.0	79.0	79.0					10																	33137593		2201	4293	6494	SO:0001583	missense	79741							g.chr10:33137593C>T																												ENST00000375030.2:c.1448C>T	10.37:g.33137593C>T	ENSP00000364170:p.Thr483Ile		Somatic				C10orf68_uc001iwl.1_Missense_Mutation_p.T483I|C10orf68_uc001iwm.1_Missense_Mutation_p.T528I|C10orf68_uc010qei.1_Missense_Mutation_p.T500I|C10orf68_uc001iwo.3_RNA	p.T524I	NM_024688	NP_078964	WXS	Illumina HiSeq	Unspecified	Q9H943	CJ068_HUMAN			19	2044	+			524					B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	ENST00000375030.2	37	c.1571C>T		.	.	.	.	.	.	.	.	.	.	.	11.47	1.648180	0.29336	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.28895	1.61;1.6;1.59;1.59	3.18	0.108	0.14548	.	.	.	.	.	T	0.21921	0.0528	L	0.47716	1.5	0.09310	N	1	P;B;P;B	0.37101	0.582;0.395;0.582;0.395	B;B;B;B	0.35655	0.207;0.158;0.207;0.158	T	0.18745	-1.0327	9	0.54805	T	0.06	.	2.5903	0.04840	0.23:0.5078:0.0:0.2622	.	505;524;528;483	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	I	524;483;528;588;500	ENSP00000303710:T524I;ENSP00000364170:T483I;ENSP00000364168:T528I;ENSP00000364165:T588I	ENSP00000303710:T524I	T	+	2	0	C10orf68	33177599	0.000000	0.05858	0.000000	0.03702	0.140000	0.21249	-0.498000	0.06420	0.031000	0.15407	-0.339000	0.08088	ACA		0.279	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2			11	50	0	0	0	0.000978	0	11	50				
ARHGAP22	58504	broad.mit.edu	37	10	49662178	49662178	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:49662178C>T	ENST00000249601.4	-	7	1115	c.819G>A	c.(817-819)gtG>gtA	p.V273V	ARHGAP22_ENST00000417247.2_Silent_p.V183V|ARHGAP22_ENST00000374172.1_Silent_p.V164V|ARHGAP22_ENST00000435790.2_Silent_p.V279V|ARHGAP22_ENST00000417912.2_Silent_p.V289V|ARHGAP22_ENST00000477708.2_5'Flank|ARHGAP22_ENST00000374170.1_Intron	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	273	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GAAGGTTGCTCACTTGTTTAG	0.527																																							uc001jgt.2		NA																	0				ovary(1)	1						c.(817-819)GTG>GTA		Rho GTPase activating protein 2							168.0	148.0	155.0					10																	49662178		2203	4300	6503	SO:0001819	synonymous_variant	58504				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity	g.chr10:49662178C>T	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.819G>A	10.37:g.49662178C>T			Somatic				ARHGAP22_uc001jgs.2_Silent_p.V183V|ARHGAP22_uc001jgu.2_Silent_p.V289V|ARHGAP22_uc010qgl.1_Silent_p.V230V|ARHGAP22_uc010qgm.1_Silent_p.V279V|ARHGAP22_uc001jgv.2_5'UTR|ARHGAP22_uc001jgr.2_5'Flank	p.V273V	NM_021226	NP_067049	WXS	Illumina HiSeq	Unspecified	Q7Z5H3	RHG22_HUMAN			7	1116	-			273			Rho-GAP.		A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Silent	SNP	ENST00000249601.4	37	c.819G>A	CCDS7227.1																																																																																				0.527	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226		41	80	0	0	0	0.00361	0	41	80				
OGDHL	55753	broad.mit.edu	37	10	50957830	50957830	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:50957830C>A	ENST00000374103.4	-	8	1014	c.929G>T	c.(928-930)cGc>cTc	p.R310L	OGDHL_ENST00000432695.1_Missense_Mutation_p.R101L|OGDHL_ENST00000419399.1_Missense_Mutation_p.R253L	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	310					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CAGGTCCTTGCGGATCACGTT	0.672																																							uc001jie.2		NA																	0				pancreas(1)	1						c.(928-930)CGC>CTC		oxoglutarate dehydrogenase-like isoform a							58.0	51.0	53.0					10																	50957830		2202	4300	6502	SO:0001583	missense	55753				glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr10:50957830C>A	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.929G>T	10.37:g.50957830C>A	ENSP00000363216:p.Arg310Leu		Somatic				OGDHL_uc009xog.2_Missense_Mutation_p.R337L|OGDHL_uc010qgt.1_Missense_Mutation_p.R253L|OGDHL_uc010qgu.1_Missense_Mutation_p.R101L|OGDHL_uc009xoh.2_Missense_Mutation_p.R101L	p.R310L	NM_018245	NP_060715	WXS	Illumina HiSeq	Unspecified	Q9ULD0	OGDHL_HUMAN			8	1071	-			310					A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	c.929G>T	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311828	0.81358	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;D	0.95885	2.54;2.54;-3.84	5.3	4.39	0.52855	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.96315	0.8798	M	0.88906	2.99	0.80722	D	1	B;B;P	0.42161	0.308;0.308;0.772	B;B;P	0.44732	0.262;0.262;0.459	D	0.96146	0.9104	10	0.66056	D	0.02	.	13.9256	0.63961	0.0:0.9266:0.0:0.0734	.	253;101;310	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	L	310;253;101	ENSP00000363216:R310L;ENSP00000401356:R253L;ENSP00000390240:R101L	ENSP00000363216:R310L	R	-	2	0	OGDHL	50627836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.707000	0.68370	1.242000	0.43836	0.655000	0.94253	CGC		0.672	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245		11	14	1	0	1.08611e-07	0.000978	1.18831e-07	11	14				
A1CF	29974	broad.mit.edu	37	10	52575818	52575818	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:52575818G>C	ENST00000373993.1	-	7	1133	c.1089C>G	c.(1087-1089)gcC>gcG	p.A363A	A1CF_ENST00000374001.2_Silent_p.A363A|A1CF_ENST00000395495.1_Silent_p.A308A|A1CF_ENST00000373995.3_Silent_p.A371A|A1CF_ENST00000373997.3_Silent_p.A363A|ASAH2B_ENST00000483649.1_3'UTR|A1CF_ENST00000395489.2_Silent_p.A356A|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000282641.2_Silent_p.A363A			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	363	Required for nuclear localization. {ECO:0000269|PubMed:12896982}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						GTCCTTTGGTGGCTGGGAAAT	0.483																																							uc001jjj.2		NA																	0				central_nervous_system(1)	1						c.(1087-1089)GCC>GCG		apobec-1 complementation factor isoform 2							162.0	157.0	158.0					10																	52575818		2203	4300	6503	SO:0001819	synonymous_variant	29974				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding	g.chr10:52575818G>C	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1089C>G	10.37:g.52575818G>C			Somatic				A1CF_uc010qhn.1_Silent_p.A371A|A1CF_uc001jji.2_Silent_p.A363A|A1CF_uc001jjh.2_Silent_p.A371A|A1CF_uc010qho.1_Silent_p.A371A|A1CF_uc009xov.2_Silent_p.A363A	p.A363A	NM_138932	NP_620310	WXS	Illumina HiSeq	Unspecified	Q9NQ94	A1CF_HUMAN			9	1277	-			363			Required for nuclear localization.		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Silent	SNP	ENST00000373993.1	37	c.1089C>G	CCDS7242.1																																																																																				0.483	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576		17	51	0	0	0	0.008871	0	17	51				
PCDH15	65217	broad.mit.edu	37	10	55591228	55591228	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:55591228C>T	ENST00000320301.6	-	30	4443	c.4049G>A	c.(4048-4050)cGc>cAc	p.R1350H	PCDH15_ENST00000395445.1_Missense_Mutation_p.R1357H|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000414778.1_Missense_Mutation_p.R1355H|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000409834.1_Missense_Mutation_p.R961H|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.R1313H|PCDH15_ENST00000373965.2_Missense_Mutation_p.R1357H|PCDH15_ENST00000361849.3_Missense_Mutation_p.R1350H|PCDH15_ENST00000395433.1_Missense_Mutation_p.R1328H|PCDH15_ENST00000395438.1_Missense_Mutation_p.R1350H|PCDH15_ENST00000395430.1_Missense_Mutation_p.R1350H|PCDH15_ENST00000437009.1_Missense_Mutation_p.R1279H	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1350					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.R1350H(2)|p.R1355H(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTCCAGAATGCGTCCTCCTTC	0.418										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - Missense(4)		endometrium(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(4048-4050)CGC>CAC		protocadherin 15 isoform CD1-4 precursor							174.0	155.0	162.0					10																	55591228		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55591228C>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4049G>A	10.37:g.55591228C>T	ENSP00000322604:p.Arg1350His	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.R1355H|PCDH15_uc010qhr.1_Missense_Mutation_p.R1350H|PCDH15_uc010qhs.1_Missense_Mutation_p.R1362H|PCDH15_uc010qht.1_Missense_Mutation_p.R1357H|PCDH15_uc010qhu.1_Missense_Mutation_p.R1350H|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.R1350H|PCDH15_uc010qhw.1_Missense_Mutation_p.R1313H|PCDH15_uc010qhx.1_Missense_Mutation_p.R1279H|PCDH15_uc010qhy.1_Missense_Mutation_p.R1355H|PCDH15_uc010qhz.1_Missense_Mutation_p.R1350H|PCDH15_uc010qia.1_Missense_Mutation_p.R1328H|PCDH15_uc010qib.1_Missense_Mutation_p.R1328H	p.R1350H	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			30	4444	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1350			Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.4049G>A	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.032480	0.93575	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.60171	0.37;0.43;0.35;0.36;0.32;0.26;0.21;0.29;0.22;0.23;0.22	5.75	5.75	0.90469	.	.	.	.	.	T	0.70090	0.3184	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.997;0.999;0.999;0.998;0.999;0.999;0.997;0.999;0.999;0.999;0.999;0.999;0.999	T	0.71189	-0.4666	9	0.66056	D	0.02	.	19.539	0.95267	0.0:1.0:0.0:0.0	.	1328;1350;1350;1355;1279;1313;1350;1350;1357;1357;1350;1355;1350	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	H	1357;1355;1350;1350;961;1357;1313;1350;1328;1350;1350;1355;1279	ENSP00000363076:R1357H;ENSP00000410304:R1355H;ENSP00000378826:R1350H;ENSP00000386693:R961H;ENSP00000378832:R1357H;ENSP00000378820:R1313H;ENSP00000354950:R1350H;ENSP00000378821:R1328H;ENSP00000322604:R1350H;ENSP00000378818:R1350H;ENSP00000412628:R1279H	ENSP00000322604:R1350H	R	-	2	0	PCDH15	55261234	1.000000	0.71417	0.999000	0.59377	0.785000	0.44390	7.814000	0.86154	2.709000	0.92574	0.585000	0.79938	CGC		0.418	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		11	49	0	0	0	0.001855	0	11	49				
IPMK	253430	broad.mit.edu	37	10	60027344	60027344	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:60027344G>A	ENST00000373935.3	-	1	350	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	CISD1_ENST00000333926.5_5'Flank	NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	10					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						GCCTCGACCCGGAGGGGGGAT	0.677																																							uc001jkb.2		NA																	0				ovary(1)	1						c.(28-30)CGG>TGG		inositol polyphosphate multikinase							5.0	7.0	6.0					10																	60027344		2076	4115	6191	SO:0001583	missense	253430					nucleus	ATP binding|inositol trisphosphate 6-kinase activity	g.chr10:60027344G>A	AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.28C>T	10.37:g.60027344G>A	ENSP00000363046:p.Arg10Trp		Somatic				CISD1_uc001jkc.3_5'Flank	p.R10W	NM_152230	NP_689416	WXS	Illumina HiSeq	Unspecified	Q8NFU5	IPMK_HUMAN			1	351	-			10						Missense_Mutation	SNP	ENST00000373935.3	37	c.28C>T	CCDS7250.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979514	0.34942	.	.	ENSG00000151151	ENST00000373935	T	0.22336	1.96	2.93	2.01	0.26516	.	0.380203	0.18642	U	0.135271	T	0.11324	0.0276	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28713	-1.0035	9	.	.	.	-2.6725	5.8398	0.18627	0.1554:0.0:0.8446:0.0	.	10	Q8NFU5	IPMK_HUMAN	W	10	ENSP00000363046:R10W	.	R	-	1	2	IPMK	59697350	0.998000	0.40836	0.302000	0.25058	0.125000	0.20455	3.460000	0.53028	0.551000	0.29008	0.305000	0.20034	CGG		0.677	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048142.1	NM_152230		5	5	0	0	0	0.00308	0	5	5				
ANK3	288	broad.mit.edu	37	10	61932732	61932732	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:61932732C>T	ENST00000280772.2	-	20	2499	c.2308G>A	c.(2308-2310)Gca>Aca	p.A770T	ANK3_ENST00000373827.2_Missense_Mutation_p.A764T|ANK3_ENST00000503366.1_Missense_Mutation_p.A753T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	770					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGCTGTGCTGCTTGATGTAAT	0.428																																							uc001jky.2		NA																	0				skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.(2308-2310)GCA>ACA		ankyrin 3 isoform 1							153.0	138.0	143.0					10																	61932732		2203	4300	6503	SO:0001583	missense	288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:61932732C>T	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2308G>A	10.37:g.61932732C>T	ENSP00000280772:p.Ala770Thr		Somatic				ANK3_uc001jkx.2_5'Flank|ANK3_uc010qih.1_Missense_Mutation_p.A753T|ANK3_uc001jkz.3_Missense_Mutation_p.A764T|ANK3_uc001jlb.1_Missense_Mutation_p.A299T|ANK3_uc001jlc.1_Missense_Mutation_p.A431T	p.A770T	NM_020987	NP_066267	WXS	Illumina HiSeq	Unspecified	Q12955	ANK3_HUMAN			20	2500	-			770			ANK 22.		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	c.2308G>A	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	35	5.462567	0.96240	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304;ENST00000536348	D;D;D	0.86956	-2.19;-2.19;-2.19	6.06	6.06	0.98353	Ankyrin repeat-containing domain (3);	0.000000	0.41938	D	0.000798	D	0.95519	0.8544	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.988;0.939;0.998;0.994;0.999	D	0.95393	0.8483	10	0.66056	D	0.02	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	753;431;314;764;770	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	T	770;764;753;732;431;426;314	ENSP00000280772:A770T;ENSP00000362933:A764T;ENSP00000425236:A753T	ENSP00000280772:A770T	A	-	1	0	ANK3	61602738	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.764000	0.85297	2.882000	0.98803	0.655000	0.94253	GCA		0.428	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		16	80	0	0	0	0.008871	0	16	80				
MYPN	84665	broad.mit.edu	37	10	69926080	69926080	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:69926080C>A	ENST00000358913.5	+	10	2118	c.1630C>A	c.(1630-1632)Ctt>Att	p.L544I	MYPN_ENST00000540630.1_Missense_Mutation_p.L544I|MYPN_ENST00000354393.2_Missense_Mutation_p.L269I	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	544					sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CAACGGGTCTCTTCACTCAGC	0.552																																							uc001jnm.3		NA																	0				ovary(3)|skin(2)	5						c.(1630-1632)CTT>ATT		myopalladin							86.0	70.0	76.0					10																	69926080		2203	4300	6503	SO:0001583	missense	84665					nucleus|sarcomere	actin binding	g.chr10:69926080C>A	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1630C>A	10.37:g.69926080C>A	ENSP00000351790:p.Leu544Ile		Somatic				MYPN_uc001jnl.1_Missense_Mutation_p.L544I|MYPN_uc001jnn.3_Missense_Mutation_p.L269I|MYPN_uc001jno.3_Missense_Mutation_p.L544I|MYPN_uc009xps.2_Missense_Mutation_p.L544I|MYPN_uc009xpt.2_Missense_Mutation_p.L544I|MYPN_uc010qit.1_Missense_Mutation_p.L250I|MYPN_uc010qiu.1_RNA	p.L544I	NM_032578	NP_115967	WXS	Illumina HiSeq	Unspecified	Q86TC9	MYPN_HUMAN			11	1815	+			544					Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	c.1630C>A	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.374953	0.24857	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.58060	0.36;0.43;0.4	5.29	5.29	0.74685	.	0.405610	0.23891	N	0.043554	T	0.44561	0.1299	N	0.24115	0.695	0.43007	D	0.994539	P;P;P	0.46656	0.882;0.61;0.671	B;B;B	0.44278	0.445;0.215;0.154	T	0.34030	-0.9845	9	.	.	.	.	17.1274	0.86718	0.0:1.0:0.0:0.0	.	544;269;544	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	I	269;269;544;544	ENSP00000346369:L269I;ENSP00000351790:L544I;ENSP00000441668:L544I	.	L	+	1	0	MYPN	69596086	1.000000	0.71417	1.000000	0.80357	0.275000	0.26752	5.390000	0.66261	2.455000	0.83008	0.655000	0.94253	CTT		0.552	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		39	37	1	0	8.94452e-30	0.00361	1.15773e-29	39	37				
DDX50	79009	broad.mit.edu	37	10	70706177	70706177	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:70706177G>C	ENST00000373585.3	+	15	2112	c.2005G>C	c.(2005-2007)Gat>Cat	p.D669H	DDX50_ENST00000466265.1_3'UTR	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	669						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						AGAATATTATGATGGAAACAC	0.488																																							uc001jou.2		NA																	0				ovary(1)	1						c.(2005-2007)GAT>CAT		nucleolar protein GU2							54.0	53.0	53.0					10																	70706177		2203	4300	6503	SO:0001583	missense	79009					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr10:70706177G>C	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.2005G>C	10.37:g.70706177G>C	ENSP00000362687:p.Asp669His		Somatic				DDX50_uc010qjc.1_Intron	p.D669H	NM_024045	NP_076950	WXS	Illumina HiSeq	Unspecified	Q9BQ39	DDX50_HUMAN			15	2112	+			669					Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	c.2005G>C	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230314	0.79688	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.20738	2.05	5.46	5.46	0.80206	.	0.494171	0.24044	N	0.042076	T	0.27967	0.0689	N	0.19112	0.55	0.41784	D	0.989834	D	0.69078	0.997	P	0.59012	0.85	T	0.02431	-1.1160	10	0.59425	D	0.04	-15.8102	15.1702	0.72865	0.0:0.0:1.0:0.0	.	669	Q9BQ39	DDX50_HUMAN	H	669	ENSP00000362687:D669H	ENSP00000362687:D669H	D	+	1	0	DDX50	70376183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.360000	0.52299	2.733000	0.93635	0.467000	0.42956	GAT		0.488	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045		14	49	0	0	0	0.003163	0	14	49				
TBATA	219793	broad.mit.edu	37	10	72539364	72539364	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:72539364G>A	ENST00000299290.1	-	5	801	c.412C>T	c.(412-414)Ccc>Tcc	p.P138S	TBATA_ENST00000456372.2_Missense_Mutation_p.P138S|TBATA_ENST00000545575.1_Missense_Mutation_p.P128S	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	138					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											GAAAGCTGGGGGTTCCGATTA	0.582																																							uc001jrj.1		NA																	0				skin(1)	1						c.(412-414)CCC>TCC		stromal protein associated with thymii and lymph							54.0	52.0	53.0					10																	72539364		2203	4300	6503	SO:0001583	missense	219793				cell differentiation|multicellular organismal development|spermatogenesis	cytosol		g.chr10:72539364G>A	AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.412C>T	10.37:g.72539364G>A	ENSP00000299290:p.Pro138Ser		Somatic				C10orf27_uc010qjm.1_Missense_Mutation_p.P138S|C10orf27_uc009xqh.1_RNA|C10orf27_uc010qjn.1_Missense_Mutation_p.P138S|C10orf27_uc009xqi.1_Intron|C10orf27_uc010qjo.1_Missense_Mutation_p.P127S|C10orf27_uc009xqj.1_Silent_p.T132T|C10orf27_uc010qjp.1_Missense_Mutation_p.P127S	p.P138S	NM_152710	NP_689923	WXS	Illumina HiSeq	Unspecified	Q96M53	SPATL_HUMAN			5	802	-			138					A4QPA8|B2RPQ2|Q5T4G2	Missense_Mutation	SNP	ENST00000299290.1	37	c.412C>T	CCDS7308.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727699	0.48833	.	.	ENSG00000166220	ENST00000299290;ENST00000536955;ENST00000456372;ENST00000545575	T;T;T	0.25250	1.81;1.81;1.81	5.21	5.21	0.72293	.	0.084839	0.49916	D	0.000136	T	0.53222	0.1783	M	0.81497	2.545	0.33264	D	0.560077	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.998;0.998	T	0.67783	-0.5581	10	0.72032	D	0.01	-28.9944	14.6214	0.68588	0.0:0.0:1.0:0.0	.	127;127;138;138;138	B7Z8D7;B7Z8G0;B7ZMN4;B7ZMN5;Q96M53	.;.;.;.;SPATL_HUMAN	S	138;125;138;128	ENSP00000299290:P138S;ENSP00000400224:P138S;ENSP00000444940:P128S	ENSP00000299290:P138S	P	-	1	0	C10orf27	72209370	0.996000	0.38824	0.719000	0.30619	0.507000	0.33981	4.602000	0.61098	2.568000	0.86640	0.655000	0.94253	CCC		0.582	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1	NM_152710		20	30	0	0	0	0.001882	0	20	30				
GRID1	2894	broad.mit.edu	37	10	87615890	87615890	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:87615890T>C	ENST00000327946.7	-	7	1094	c.1009A>G	c.(1009-1011)Aag>Gag	p.K337E		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	337					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCCTCCAGCTTCCTGTGAAAG	0.512										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(1009-1011)AAG>GAG		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						115.0	98.0	103.0					10																	87615890		2203	4300	6503	SO:0001583	missense	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87615890T>C	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1009A>G	10.37:g.87615890T>C	ENSP00000330148:p.Lys337Glu	Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_RNA	p.K337E	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			7	1110	-			337			Extracellular (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	c.1009A>G	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.475977	0.84640	.	.	ENSG00000182771	ENST00000327946	D	0.82619	-1.63	5.43	5.43	0.79202	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88782	0.6530	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.86851	0.2023	10	0.26408	T	0.33	.	14.662	0.68879	0.0:0.0:0.0:1.0	.	337	Q9ULK0	GRID1_HUMAN	E	337	ENSP00000330148:K337E	ENSP00000330148:K337E	K	-	1	0	GRID1	87605870	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.033000	0.88852	2.065000	0.61736	0.528000	0.53228	AAG		0.512	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		27	47	0	0	0	0.009535	0	27	47				
BMPR1A	657	broad.mit.edu	37	10	88659610	88659610	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:88659610C>G	ENST00000372037.3	+	6	930	c.393C>G	c.(391-393)aaC>aaG	p.N131K		NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	131					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						ATTTATGTAACCAGTATTTGC	0.413			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)	Ovarian(190;603 2086 22044 30335 47971)	uc001kdy.2		NA	yes	Rec		Juvenile polyposis	10	10q22.3	657	Mis|N|F	"""bone morphogenetic protein receptor, type IA"""			E		gastrointestinal polyps			0				lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						c.(391-393)AAC>AAG		bone morphogenetic protein receptor, type IA							98.0	94.0	96.0					10																	88659610		2203	4300	6503	SO:0001583	missense	657	Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity	g.chr10:88659610C>G	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.393C>G	10.37:g.88659610C>G	ENSP00000361107:p.Asn131Lys		Somatic					p.N131K	NM_004329	NP_004320	WXS	Illumina HiSeq	Unspecified	P36894	BMR1A_HUMAN			6	941	+			131			Extracellular (Potential).		A8K6U9|Q8NEN8	Missense_Mutation	SNP	ENST00000372037.3	37	c.393C>G	CCDS7378.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494378	0.64186	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	D	0.99941	-8.45	5.15	4.24	0.50183	TGF-beta receptor/activin receptor, type I/II (1);	0.046599	0.85682	D	0.000000	D	0.99924	0.9965	M	0.93638	3.44	0.80722	D	1	P	0.49559	0.925	P	0.59012	0.85	D	0.95890	0.8906	10	0.87932	D	0	.	8.7526	0.34626	0.0:0.7789:0.0:0.2211	.	131	P36894	BMR1A_HUMAN	K	131	ENSP00000361107:N131K	ENSP00000224764:N131K	N	+	3	2	BMPR1A	88649590	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.469000	0.35343	1.291000	0.44653	0.563000	0.77884	AAC		0.413	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329		3	104	0	0	0	0.000602	0	3	104				
PIK3AP1	118788	broad.mit.edu	37	10	98380131	98380131	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:98380131G>A	ENST00000339364.5	-	12	2038	c.1919C>T	c.(1918-1920)tCg>tTg	p.S640L	RNA5SP324_ENST00000365177.1_RNA|PIK3AP1_ENST00000371110.2_Missense_Mutation_p.S462L|PIK3AP1_ENST00000371109.3_Missense_Mutation_p.S239L	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	640					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		AAAGGACTCCGATCGTTTCTT	0.512																																							uc001kmq.2		NA																	0				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5						c.(1918-1920)TCG>TTG		phosphoinositide-3-kinase adaptor protein 1							149.0	144.0	146.0					10																	98380131		2203	4300	6503	SO:0001583	missense	118788					cytoplasm|plasma membrane		g.chr10:98380131G>A	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1919C>T	10.37:g.98380131G>A	ENSP00000339826:p.Ser640Leu		Somatic				PIK3AP1_uc001kmo.2_Missense_Mutation_p.S239L|PIK3AP1_uc001kmp.2_Missense_Mutation_p.S462L	p.S640L	NM_152309	NP_689522	WXS	Illumina HiSeq	Unspecified	Q6ZUJ8	BCAP_HUMAN		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)	12	2047	-		Colorectal(252;0.0442)	640					Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	37	c.1919C>T	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972804	0.74246	.	.	ENSG00000155629	ENST00000339364;ENST00000371110;ENST00000371109	T;T;T	0.45276	0.9;0.9;0.9	5.88	4.96	0.65561	.	0.116099	0.64402	D	0.000011	T	0.36744	0.0978	M	0.61703	1.905	0.23624	N	0.997261	P;P	0.52692	0.789;0.955	B;B	0.31337	0.128;0.128	T	0.44952	-0.9294	10	0.66056	D	0.02	-18.5423	15.9348	0.79694	0.0:0.1352:0.8648:0.0	.	640;239	Q6ZUJ8;Q6ZUJ8-3	BCAP_HUMAN;.	L	640;462;239	ENSP00000339826:S640L;ENSP00000360151:S462L;ENSP00000360150:S239L	ENSP00000339826:S640L	S	-	2	0	PIK3AP1	98370121	1.000000	0.71417	0.193000	0.23327	0.985000	0.73830	6.620000	0.74224	1.454000	0.47793	0.555000	0.69702	TCG		0.512	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309		72	127	0	0	0	0.00361	0	72	127				
SORCS1	114815	broad.mit.edu	37	10	108412183	108412183	+	Missense_Mutation	SNP	G	G	T	rs150967356	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:108412183G>T	ENST00000263054.6	-	18	2439	c.2432C>A	c.(2431-2433)gCg>gAg	p.A811E	SORCS1_ENST00000369698.1_Missense_Mutation_p.A346E|SORCS1_ENST00000344440.6_Missense_Mutation_p.A811E	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	811	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.A811V(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TCCTTGTTCCGCTGTCAGCTT	0.522																																							uc001kym.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	breast(1)|central_nervous_system(1)	2						c.(2431-2433)GCG>GAG		SORCS receptor 1 isoform a							127.0	113.0	118.0					10																	108412183		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108412183G>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2432C>A	10.37:g.108412183G>T	ENSP00000263054:p.Ala811Glu		Somatic				SORCS1_uc001kyl.2_Missense_Mutation_p.A811E|SORCS1_uc009xxs.2_Missense_Mutation_p.A811E|SORCS1_uc001kyn.1_Missense_Mutation_p.A811E|SORCS1_uc001kyo.2_Missense_Mutation_p.A811E	p.A811E	NM_052918	NP_443150	WXS	Illumina HiSeq	Unspecified	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	18	2440	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	811			Lumenal (Potential).|PKD.		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.2432C>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057554	0.76074	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.62232	0.04;0.04;0.04	5.74	5.74	0.90152	PKD/Chitinase domain (1);PKD domain (2);	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	L	0.54323	1.7	0.54753	D	0.999985	D;D;D;D;D	0.76494	0.997;0.996;0.996;0.999;0.996	D;D;D;D;D	0.74348	0.983;0.972;0.972;0.983;0.972	T	0.73193	-0.4060	9	.	.	.	-17.331	19.9145	0.97053	0.0:0.0:1.0:0.0	.	811;811;811;811;811	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	E	346;811;811	ENSP00000358712:A346E;ENSP00000263054:A811E;ENSP00000345964:A811E	.	A	-	2	0	SORCS1	108402173	1.000000	0.71417	0.629000	0.29254	0.272000	0.26649	9.277000	0.95755	2.709000	0.92574	0.655000	0.94253	GCG		0.522	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		3	89	1	0	0.00909568	0.009096	0.00929901	3	89				
SMC3	9126	broad.mit.edu	37	10	112337194	112337194	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:112337194C>T	ENST00000361804.4	+	5	340	c.214C>T	c.(214-216)Cgt>Tgt	p.R72C	snoU13_ENST00000458966.1_RNA|SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	72					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TACTGGTCCTCGTGTTATTTC	0.299																																							uc001kze.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(214-216)CGT>TGT		structural maintenance of chromosomes 3							172.0	167.0	169.0					10																	112337194		2203	4300	6503	SO:0001583	missense	9126				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity	g.chr10:112337194C>T	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.214C>T	10.37:g.112337194C>T	ENSP00000354720:p.Arg72Cys		Somatic					p.R72C	NM_005445	NP_005436	WXS	Illumina HiSeq	Unspecified	Q9UQE7	SMC3_HUMAN		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)	5	340	+		Breast(234;0.0848)|Lung NSC(174;0.238)	72					A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	c.214C>T	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747591	0.89663	.	.	ENSG00000108055	ENST00000361804	T	0.68331	-0.32	5.26	5.26	0.73747	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.82756	0.5106	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.85036	0.0920	10	0.87932	D	0	.	18.8764	0.92338	0.0:1.0:0.0:0.0	.	72	Q9UQE7	SMC3_HUMAN	C	72	ENSP00000354720:R72C	ENSP00000354720:R72C	R	+	1	0	SMC3	112327184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.378000	0.79679	2.452000	0.82932	0.460000	0.39030	CGT		0.299	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445		10	18	0	0	0	0.001855	0	10	18				
TDRD1	56165	broad.mit.edu	37	10	115986915	115986915	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:115986915C>T	ENST00000251864.2	+	23	3413	c.3260C>T	c.(3259-3261)tCt>tTt	p.S1087F	TDRD1_ENST00000422662.1_Intron|TDRD1_ENST00000369280.1_Intron|TDRD1_ENST00000369282.1_Intron|TDRD1_ENST00000369281.2_Missense_Mutation_p.S973F	NM_198795.1	NP_942090.1	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1087					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GTAATGCTTTCTGTGAAAGGA	0.328																																							uc001lbg.1		NA																	0					0						c.(3259-3261)TCT>TTT		tudor domain containing 1							75.0	68.0	70.0					10																	115986915		2203	4300	6503	SO:0001583	missense	56165				DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding	g.chr10:115986915C>T	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000251864.2:c.3260C>T	10.37:g.115986915C>T	ENSP00000251864:p.Ser1087Phe		Somatic				TDRD1_uc001lbf.2_Missense_Mutation_p.S964F|TDRD1_uc001lbh.1_Missense_Mutation_p.S1074F|TDRD1_uc001lbi.1_Missense_Mutation_p.S1078F|TDRD1_uc010qsc.1_Intron|TDRD1_uc001lbj.2_Missense_Mutation_p.S796F	p.S1087F	NM_198795	NP_942090	WXS	Illumina HiSeq	Unspecified	Q9BXT4	TDRD1_HUMAN		Epithelial(162;0.0343)|all cancers(201;0.0754)	23	3413	+		Colorectal(252;0.172)|Breast(234;0.188)	1087					A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000251864.2	37	c.3260C>T	CCDS7588.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553979	0.45487	.	.	ENSG00000095627	ENST00000251864;ENST00000369281	T;T	0.18657	3.02;2.2	6.07	5.16	0.70880	.	0.105381	0.41500	D	0.000867	T	0.24160	0.0585	M	0.62723	1.935	0.80722	D	1	B;B;B;B	0.20671	0.028;0.028;0.047;0.047	B;B;B;B	0.20955	0.01;0.014;0.032;0.032	T	0.02477	-1.1153	10	0.36615	T	0.2	-12.5968	13.0749	0.59081	0.0:0.9255:0.0:0.0745	.	1087;973;1087;973	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	F	1087;973	ENSP00000251864:S1087F;ENSP00000358287:S973F	ENSP00000251864:S1087F	S	+	2	0	TDRD1	115976905	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.508000	0.35769	1.558000	0.49541	0.650000	0.86243	TCT		0.328	TDRD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				13	24	0	0	0	0.001855	0	13	24				
ATRNL1	26033	broad.mit.edu	37	10	117607396	117607396	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:117607396C>T	ENST00000355044.3	+	28	4038	c.3912C>T	c.(3910-3912)ccC>ccT	p.P1304P	ATRNL1_ENST00000423111.2_Silent_p.P355P|ATRNL1_ENST00000303745.7_Silent_p.P97P	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1304					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AGGGGGCACCCAAGCCAATTG	0.458																																							uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(3910-3912)CCC>CCT		attractin-like 1 precursor							103.0	94.0	97.0					10																	117607396		2203	4300	6503	SO:0001819	synonymous_variant	26033					integral to membrane	sugar binding	g.chr10:117607396C>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3912C>T	10.37:g.117607396C>T			Somatic				ATRNL1_uc010qsm.1_Silent_p.P433P|ATRNL1_uc010qsn.1_RNA	p.P1304P	NM_207303	NP_997186	WXS	Illumina HiSeq	Unspecified	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	28	4298	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	1304			Cytoplasmic (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	c.3912C>T	CCDS7592.1																																																																																				0.458	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		12	18	0	0	0	0.001368	0	12	18				
PNLIPRP2	5408	broad.mit.edu	37	10	118386379	118386379	+	RNA	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:118386379T>A	ENST00000298771.7	+	0	360				PNLIPRP2_ENST00000537242.1_RNA|PNLIPRP2_ENST00000433618.4_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		CCCCAGAAAATGTTTGAAGTG	0.522																																							uc001lcq.2		NA																	0				large_intestine(1)	1						c.(337-339)ATG>AAG		pancreatic lipase-related protein 2							72.0	66.0	68.0					10																	118386379		1920	4192	6112			5408				galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity	g.chr10:118386379T>A	M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118386379T>A			Somatic				PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	p.M113K	NM_005396	NP_005387	WXS	Illumina HiSeq	Unspecified	P54317	LIPR2_HUMAN		all cancers(201;0.015)	7	361	+			112					A8K627|Q6IB55	Missense_Mutation	SNP	ENST00000298771.7	37	c.338T>A		.	.	.	.	.	.	.	.	.	.	T	13.15	2.149804	0.37923	.	.	ENSG00000165862	ENST00000537242	D	0.91011	-2.77	5.56	5.56	0.83823	Lipase, N-terminal (1);	0.162243	0.41194	U	0.000940	D	0.88358	0.6415	.	.	.	0.29810	N	0.831704	P	0.44281	0.831	B	0.40602	0.334	D	0.87693	0.2555	9	0.87932	D	0	.	14.6905	0.69083	0.0:0.0:0.0:1.0	.	112	P54317	LIPR2_HUMAN	K	112	ENSP00000446346:M112K	ENSP00000446346:M112K	M	+	2	0	PNLIPRP2	118376369	1.000000	0.71417	0.995000	0.50966	0.950000	0.60333	6.122000	0.71608	2.108000	0.64289	0.459000	0.35465	ATG		0.522	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000050546.6	NM_005396		10	12	0	0	0	0.001855	0	10	12				
ATE1	11101	broad.mit.edu	37	10	123662043	123662043	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:123662043C>A	ENST00000224652.6	-	6	761	c.676G>T	c.(676-678)Gct>Tct	p.A226S	ATE1_ENST00000540606.1_Missense_Mutation_p.A219S|ATE1_ENST00000481784.1_5'UTR|ATE1_ENST00000369043.3_Missense_Mutation_p.A226S|ATE1_ENST00000543447.1_Missense_Mutation_p.A111S|ATE1_ENST00000369040.3_Missense_Mutation_p.A130S|ATE1_ENST00000535655.1_Intron	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1	226					protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				AGTTCTCCAGCTGGGTTCTGC	0.433																																							uc001lfp.2		NA																	0					0						c.(676-678)GCT>TCT		arginyltransferase 1 isoform 2							157.0	137.0	144.0					10																	123662043		2203	4300	6503	SO:0001583	missense	11101				protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity	g.chr10:123662043C>A	AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.676G>T	10.37:g.123662043C>A	ENSP00000224652:p.Ala226Ser		Somatic				ATE1_uc001lfq.2_Missense_Mutation_p.A226S|ATE1_uc010qtr.1_Missense_Mutation_p.A111S|ATE1_uc010qts.1_Missense_Mutation_p.A130S|ATE1_uc010qtt.1_Missense_Mutation_p.A219S|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	p.A226S	NM_007041	NP_008972	WXS	Illumina HiSeq	Unspecified	O95260	ATE1_HUMAN			6	758	-		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)	226					O95261|Q5SQQ3|Q8WW04	Missense_Mutation	SNP	ENST00000224652.6	37	c.676G>T	CCDS31300.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.767|8.767	0.925104|0.925104	0.18056|0.18056	.|.	.|.	ENSG00000107669|ENSG00000107669	ENST00000369043;ENST00000224652;ENST00000369040;ENST00000540606;ENST00000543447;ENST00000455628|ENST00000423243	.|.	.|.	.|.	5.2|5.2	0.978|0.978	0.19740|0.19740	.|.	1.014970|.	0.07877|.	N|.	0.968965|.	T|T	0.37183|0.37183	0.0994|0.0994	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.15473|.	0.006;0.006;0.013;0.004|.	B;B;B;B|.	0.18871|.	0.023;0.013;0.013;0.007|.	T|T	0.31503|0.31503	-0.9941|-0.9941	9|5	0.08179|.	T|.	0.78|.	-31.879|-31.879	2.7124|2.7124	0.05179|0.05179	0.2066:0.363:0.0:0.4304|0.2066:0.363:0.0:0.4304	.|.	219;130;226;226|.	F5GXE4;B4E107;O95260;O95260-2|.	.;.;ATE1_HUMAN;.|.	S|I	226;226;130;219;111;219|222	.|.	ENSP00000224652:A226S|.	A|S	-|-	1|2	0|0	ATE1|ATE1	123652033|123652033	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.674000|0.674000	0.39518|0.39518	0.289000|0.289000	0.18957|0.18957	0.340000|0.340000	0.23745|0.23745	-0.259000|-0.259000	0.10710|0.10710	GCT|AGC		0.433	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001001976		16	37	1	0	0.000308642	0.003163	0.000321776	16	37				
TACC2	10579	broad.mit.edu	37	10	123970110	123970110	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:123970110C>T	ENST00000369005.1	+	9	6510	c.6170C>T	c.(6169-6171)tCa>tTa	p.S2057L	TACC2_ENST00000360561.3_Missense_Mutation_p.S135L|TACC2_ENST00000368999.1_Missense_Mutation_p.S135L|TACC2_ENST00000453444.2_Missense_Mutation_p.S2061L|TACC2_ENST00000515603.1_Missense_Mutation_p.S2012L|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000369004.3_Missense_Mutation_p.S135L|TACC2_ENST00000260733.3_Missense_Mutation_p.S135L|TACC2_ENST00000334433.3_Missense_Mutation_p.S2057L|TACC2_ENST00000513429.1_Missense_Mutation_p.S203L|TACC2_ENST00000515273.1_Missense_Mutation_p.S2061L|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000358010.1_Missense_Mutation_p.S203L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2057					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCTCGTGCCTCAGACGCTAAG	0.522																																							uc001lfv.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(6169-6171)TCA>TTA		transforming, acidic coiled-coil containing							138.0	120.0	126.0					10																	123970110		2203	4300	6503	SO:0001583	missense	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123970110C>T	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6170C>T	10.37:g.123970110C>T	ENSP00000358001:p.Ser2057Leu		Somatic				TACC2_uc001lfw.2_Missense_Mutation_p.S203L|TACC2_uc009xzx.2_Missense_Mutation_p.S2012L|TACC2_uc010qtv.1_Missense_Mutation_p.S2061L|TACC2_uc001lfx.2_5'UTR|TACC2_uc001lfy.2_5'UTR|TACC2_uc001lfz.2_Missense_Mutation_p.S135L|TACC2_uc001lga.2_Missense_Mutation_p.S135L|TACC2_uc009xzy.2_Missense_Mutation_p.S135L|TACC2_uc001lgb.2_Missense_Mutation_p.S92L|TACC2_uc010qtw.1_Missense_Mutation_p.S152L	p.S2057L	NM_206862	NP_996744	WXS	Illumina HiSeq	Unspecified	O95359	TACC2_HUMAN			9	6530	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	2057					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	c.6170C>T	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	C	3.443	-0.113583	0.06881	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.09445	3.95;3.47;4.07;4.04;3.95;3.47;4.07;3.37;3.38;3.38;3.37;2.98	5.64	3.76	0.43208	.	1.231060	0.06288	N	0.698695	T	0.08492	0.0211	N	0.16478	0.41	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.24721	0.002;0.11;0.0;0.11;0.11;0.001;0.0;0.001;0.11	B;B;B;B;B;B;B;B;B	0.27796	0.003;0.083;0.001;0.057;0.083;0.002;0.002;0.003;0.057	T	0.37384	-0.9708	10	0.23891	T	0.37	-0.148	9.0463	0.36349	0.0:0.7468:0.1229:0.1302	.	152;2061;135;2012;2061;135;135;203;2057	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	L	2057;203;2061;2012;2057;203;2061;2047;135;135;135;135;152	ENSP00000358001:S2057L;ENSP00000425062:S203L;ENSP00000424467:S2061L;ENSP00000427618:S2012L;ENSP00000334280:S2057L;ENSP00000350701:S203L;ENSP00000395048:S2061L;ENSP00000353763:S135L;ENSP00000357995:S135L;ENSP00000422815:S135L;ENSP00000260733:S135L;ENSP00000420967:S152L	ENSP00000260733:S135L	S	+	2	0	TACC2	123960100	0.024000	0.19004	0.010000	0.14722	0.002000	0.02628	1.547000	0.36190	1.380000	0.46344	-0.165000	0.13383	TCA		0.522	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			27	58	0	0	0	0.008361	0	27	58				
EDRF1	26098	broad.mit.edu	37	10	127414318	127414318	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:127414318G>C	ENST00000356792.4	+	6	935	c.703G>C	c.(703-705)Gat>Cat	p.D235H	C10orf137_ENST00000337623.3_Missense_Mutation_p.D235H	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GTCCAGTTCAGATCAGACAAA	0.483																																							uc001liq.1		NA																	0				ovary(5)|large_intestine(3)|lung(2)	10						c.(703-705)GAT>CAT		erythroid differentiation-related factor 1							92.0	85.0	88.0					10																	127414318		2203	4300	6503	SO:0001583	missense	26098				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding	g.chr10:127414318G>C																												ENST00000356792.4:c.703G>C	10.37:g.127414318G>C	ENSP00000349244:p.Asp235His		Somatic				C10orf137_uc001lin.2_Missense_Mutation_p.D235H|C10orf137_uc001lio.1_Missense_Mutation_p.D235H|C10orf137_uc001lip.1_5'UTR	p.D235H	NM_015608	NP_056423	WXS	Illumina HiSeq	Unspecified	Q3B7T1	EDRF1_HUMAN			6	996	+		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)	235					B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	c.703G>C	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358192	0.41801	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623	.	.	.	4.85	0.791	0.18619	.	0.626909	0.17410	N	0.175224	T	0.24967	0.0606	L	0.31926	0.97	0.09310	N	1	P;B;B	0.41569	0.755;0.0;0.0	B;B;B	0.41036	0.346;0.001;0.001	T	0.09037	-1.0693	9	0.41790	T	0.15	.	6.3929	0.21597	0.068:0.3658:0.4404:0.1258	.	235;235;235	Q3B7T1;Q3B7T1-5;Q3B7T1-3	EDRF1_HUMAN;.;.	H	235	.	ENSP00000336727:D235H	D	+	1	0	C10orf137	127404308	0.279000	0.24239	0.001000	0.08648	0.403000	0.30841	2.547000	0.45786	0.058000	0.16222	-0.172000	0.13284	GAT		0.483	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			13	31	0	0	0	0.001368	0	13	31				
MMP21	118856	broad.mit.edu	37	10	127460821	127460821	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:127460821G>C	ENST00000368808.3	-	4	944	c.945C>G	c.(943-945)gaC>gaG	p.D315E		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	315					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	TGTCTGACCAGTCCAACTCAA	0.517																																							uc001liu.2		NA																	0				ovary(2)	2						c.(943-945)GAC>GAG		matrix metalloproteinase 21 preproprotein							135.0	114.0	121.0					10																	127460821		2203	4300	6503	SO:0001583	missense	118856				proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:127460821G>C	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.945C>G	10.37:g.127460821G>C	ENSP00000357798:p.Asp315Glu		Somatic					p.D315E	NM_147191	NP_671724	WXS	Illumina HiSeq	Unspecified	Q8N119	MMP21_HUMAN			4	945	-		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)	315					Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	37	c.945C>G	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225267	0.58668	.	.	ENSG00000154485	ENST00000368808	T	0.17213	2.29	5.05	5.05	0.67936	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.110751	0.64402	D	0.000020	T	0.30198	0.0757	L	0.59912	1.85	0.38740	D	0.953873	D	0.55800	0.973	P	0.52672	0.706	T	0.06338	-1.0832	10	0.48119	T	0.1	-16.0664	15.9032	0.79400	0.0:0.0:1.0:0.0	.	315	Q8N119	MMP21_HUMAN	E	315	ENSP00000357798:D315E	ENSP00000357798:D315E	D	-	3	2	MMP21	127450811	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	4.214000	0.58527	2.338000	0.79540	0.561000	0.74099	GAC		0.517	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1			22	74	0	0	0	0.00278	0	22	74				
EBF3	253738	broad.mit.edu	37	10	131761712	131761712	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:131761712G>T	ENST00000355311.5	-	2	282	c.210C>A	c.(208-210)ttC>ttA	p.F70L	EBF3_ENST00000368648.3_Missense_Mutation_p.F70L			Q9H4W6	COE3_HUMAN	early B-cell factor 3	70					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GCGCCAGCACGAAGTGGAAGA	0.582																																							uc001lki.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(208-210)TTC>TTA		early B-cell factor 3							60.0	66.0	64.0					10																	131761712		2203	4300	6503	SO:0001583	missense	253738				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding	g.chr10:131761712G>T		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.210C>A	10.37:g.131761712G>T	ENSP00000347463:p.Phe70Leu		Somatic				EBF3_uc010qur.1_Missense_Mutation_p.F56L	p.F70L	NM_001005463	NP_001005463	WXS	Illumina HiSeq	Unspecified	Q9H4W6	COE3_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00513)	2	269	-		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)	70					A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37	c.210C>A		.	.	.	.	.	.	.	.	.	.	G	22.8	4.334587	0.81801	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.65916	-0.18;-0.12	3.27	3.27	0.37495	.	0.000000	0.85682	U	0.000000	T	0.78168	0.4241	M	0.81682	2.555	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72982	0.973;0.979	T	0.81106	-0.1083	10	0.52906	T	0.07	-6.8433	14.1154	0.65149	0.0:0.0:1.0:0.0	.	70;70	Q9H4W6;Q9H4W6-2	COE3_HUMAN;.	L	70	ENSP00000347463:F70L;ENSP00000357637:F70L	ENSP00000347463:F70L	F	-	3	2	EBF3	131651702	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.820000	0.62671	1.343000	0.45638	0.205000	0.17691	TTC		0.582	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463		15	65	1	0	6.31663e-08	0.003163	6.93313e-08	15	65				
C10orf91	170393	broad.mit.edu	37	10	134261355	134261355	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:134261355G>A	ENST00000392630.3	+	3	289	c.228G>A	c.(226-228)acG>acA	p.T76T	C10orf91_ENST00000321248.2_Silent_p.T76T|C10orf91_ENST00000490765.1_3'UTR	NM_173541.2	NP_775812.1	Q5T1B1	CJ091_HUMAN	chromosome 10 open reading frame 91	76										endometrium(1)|kidney(1)|lung(1)|ovary(2)	5		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)		CCCAGACCACGAGAGCGCTTT	0.627																																							uc001llm.2		NA																	0				ovary(1)	1						c.(226-228)ACG>ACA		hypothetical protein LOC170393							146.0	147.0	147.0					10																	134261355		2203	4300	6503	SO:0001819	synonymous_variant	170393							g.chr10:134261355G>A	BC030794	CCDS7668.1	10q26.3	2004-03-16			ENSG00000180066	ENSG00000180066			27275	protein-coding gene	gene with protein product						12477932	Standard	NM_173541		Approved	bA432J24.4	uc001llm.3	Q5T1B1	OTTHUMG00000019289	ENST00000392630.3:c.228G>A	10.37:g.134261355G>A			Somatic					p.T76T	NM_173541	NP_775812	WXS	Illumina HiSeq	Unspecified	Q5T1B1	CJ091_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)	3	268	+		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)	76					Q8N0T7	Silent	SNP	ENST00000392630.3	37	c.228G>A	CCDS7668.1																																																																																				0.627	C10orf91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051078.2	NM_173541		51	167	0	0	0	0.00361	0	51	167				
OR51F1	256892	broad.mit.edu	37	11	4790238	4790238	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:4790238C>A	ENST00000380383.1	-	1	930	c.931G>T	c.(931-933)Gct>Tct	p.A311S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron|OR51F1_ENST00000343430.3_Missense_Mutation_p.A304S			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTGAGCATAGCCTTGCGGATT	0.428																																							uc010qyl.1		NA																	0				ovary(1)|skin(1)	2						c.(910-912)GCT>TCT		olfactory receptor, family 51, subfamily F,							99.0	95.0	96.0					11																	4790238		2201	4298	6499	SO:0001583	missense	256892					integral to membrane	olfactory receptor activity	g.chr11:4790238C>A	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.931G>T	11.37:g.4790238C>A	ENSP00000369744:p.Ala311Ser		Somatic					p.A304S	NM_001004752	NP_001004752	WXS	Illumina HiSeq	Unspecified	A6NLW9	A6NLW9_HUMAN		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)	1	910	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	304						Missense_Mutation	SNP	ENST00000380383.1	37	c.910G>T		.	.	.	.	.	.	.	.	.	.	C	3.134	-0.177782	0.06380	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.44482	0.92;0.92	5.43	3.59	0.41128	.	0.372322	0.23130	N	0.051584	T	0.34571	0.0902	M	0.64260	1.97	0.09310	N	1	B	0.29552	0.248	B	0.25884	0.064	T	0.19321	-1.0309	10	0.28530	T	0.3	.	6.687	0.23150	0.3151:0.604:0.0:0.0809	.	311	A6NGY5	O51F1_HUMAN	S	304;311	ENSP00000345163:A304S;ENSP00000369744:A311S	ENSP00000345163:A304S	A	-	1	0	OR51F1	4746814	0.000000	0.05858	0.030000	0.17652	0.001000	0.01503	-0.392000	0.07314	0.875000	0.35847	-0.127000	0.14921	GCT		0.428	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752		26	76	1	0	5.45727e-16	0.008361	6.54491e-16	26	76				
OR51B2	79345	broad.mit.edu	37	11	5345279	5345279	+	Silent	SNP	T	T	C	rs189784581		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:5345279T>C	ENST00000328813.2	-	1	303	c.249A>G	c.(247-249)ctA>ctG	p.L83L	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATTCACCCATAGGATGCCCA	0.507																																							uc001mao.1		NA																	0				ovary(2)|skin(1)	3						c.(247-249)CTA>CTG		olfactory receptor, family 51, subfamily B,							105.0	90.0	95.0					11																	5345279		2201	4297	6498	SO:0001819	synonymous_variant	79345				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5345279T>C	AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.249A>G	11.37:g.5345279T>C			Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	p.L83L	NM_033180	NP_149420	WXS	Illumina HiSeq	Unspecified	Q9Y5P1	O51B2_HUMAN		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	304	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	83			Extracellular (Potential).		Q96RD4	Silent	SNP	ENST00000328813.2	37	c.249A>G	CCDS31377.1																																																																																				0.507	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180		18	68	0	0	0	0.007413	0	18	68				
OR10A2	341276	broad.mit.edu	37	11	6891617	6891617	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:6891617C>A	ENST00000307322.4	+	1	694	c.632C>A	c.(631-633)gCc>gAc	p.A211D		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ATTGCTGCTGCCATCCTCAAG	0.453																																							uc001meu.1		NA																	0				breast(1)	1						c.(631-633)GCC>GAC		olfactory receptor, family 10, subfamily A,							275.0	219.0	238.0					11																	6891617		2201	4296	6497	SO:0001583	missense	341276				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6891617C>A	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.632C>A	11.37:g.6891617C>A	ENSP00000303862:p.Ala211Asp		Somatic					p.A211D	NM_001004460	NP_001004460	WXS	Illumina HiSeq	Unspecified	Q9H208	O10A2_HUMAN		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)	1	632	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	211			Cytoplasmic (Potential).		B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	37	c.632C>A	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	c	15.92	2.975982	0.53720	.	.	ENSG00000170790	ENST00000307322	T	0.00258	8.41	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.222761	0.31809	N	0.007038	T	0.00496	0.0016	M	0.93594	3.435	0.25996	N	0.982183	P	0.45126	0.851	P	0.47603	0.551	T	0.10636	-1.0621	10	0.87932	D	0	.	14.4597	0.67440	0.0:1.0:0.0:0.0	.	211	Q9H208	O10A2_HUMAN	D	211	ENSP00000303862:A211D	ENSP00000303862:A211D	A	+	2	0	OR10A2	6848193	0.002000	0.14202	1.000000	0.80357	0.986000	0.74619	1.242000	0.32755	2.356000	0.79943	0.650000	0.86243	GCC		0.453	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460		46	82	1	0	4.88482e-21	0.00361	6.09271e-21	46	82				
NLRP14	338323	broad.mit.edu	37	11	7064056	7064056	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:7064056G>T	ENST00000299481.4	+	4	1145	c.799G>T	c.(799-801)Gcc>Tcc	p.A267S		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	267	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ACTGAACTTTGCCTTTGAAGA	0.468																																							uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(799-801)GCC>TCC		NLR family, pyrin domain containing 14							111.0	109.0	109.0					11																	7064056		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7064056G>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.799G>T	11.37:g.7064056G>T	ENSP00000299481:p.Ala267Ser		Somatic					p.A267S	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	4	1122	+			267			NACHT.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.799G>T	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	2.343	-0.350763	0.05173	.	.	ENSG00000158077	ENST00000299481	T	0.78246	-1.16	4.57	2.48	0.30137	NACHT nucleoside triphosphatase (1);	0.150785	0.31335	N	0.007821	T	0.58032	0.2094	N	0.13272	0.32	0.25168	N	0.990302	P	0.52316	0.952	P	0.47470	0.548	T	0.57516	-0.7798	10	0.05525	T	0.97	.	6.7675	0.23575	0.0:0.1886:0.5989:0.2124	.	267	Q86W24	NAL14_HUMAN	S	267	ENSP00000299481:A267S	ENSP00000299481:A267S	A	+	1	0	NLRP14	7020632	0.000000	0.05858	0.970000	0.41538	0.934000	0.57294	0.156000	0.16382	1.234000	0.43709	0.655000	0.94253	GCC		0.468	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		30	65	1	0	4.02929e-09	0.002096	4.50178e-09	30	65				
PPFIBP2	8495	broad.mit.edu	37	11	7662787	7662787	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:7662787C>A	ENST00000299492.4	+	16	1841	c.1453C>A	c.(1453-1455)Cct>Act	p.P485T	PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.P373T|PPFIBP2_ENST00000533792.1_Missense_Mutation_p.P327T|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.P342T	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	485					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGAATCAGGTCCTCAGTCTCC	0.473																																							uc001mfj.3		NA																	0				ovary(2)|breast(2)	4						c.(1453-1455)CCT>ACT		PTPRF interacting protein, binding protein 2							158.0	135.0	143.0					11																	7662787		2201	4296	6497	SO:0001583	missense	8495				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding	g.chr11:7662787C>A	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1453C>A	11.37:g.7662787C>A	ENSP00000299492:p.Pro485Thr		Somatic				PPFIBP2_uc010rbb.1_Missense_Mutation_p.P408T|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Missense_Mutation_p.P419T|PPFIBP2_uc010rbd.1_Missense_Mutation_p.P327T|PPFIBP2_uc010rbe.1_Missense_Mutation_p.P373T|PPFIBP2_uc001mfl.3_Missense_Mutation_p.P342T|PPFIBP2_uc009yfj.1_Missense_Mutation_p.P129T	p.P485T	NM_003621	NP_003612	WXS	Illumina HiSeq	Unspecified	Q8ND30	LIPB2_HUMAN		Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)	16	1841	+			485					B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	37	c.1453C>A	CCDS31419.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.45|17.45	3.391526|3.391526	0.62066|0.62066	.|.	.|.	ENSG00000166387|ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000537467;ENST00000541115;ENST00000528883;ENST00000530181;ENST00000530081|ENST00000534409	T;T;T;T|.	0.29917|.	1.98;1.56;1.97;1.55|.	6.03|6.03	4.14|4.14	0.48551|0.48551	.|.	0.147570|.	0.47852|.	D|.	0.000209|.	T|T	0.58278|0.58278	0.2111|0.2111	L|L	0.50333|0.50333	1.59|1.59	0.40480|0.40480	D|D	0.980434|0.980434	P;B;P;D;D;P|.	0.54964|.	0.745;0.047;0.835;0.969;0.969;0.745|.	B;B;B;P;P;P|.	0.49752|.	0.218;0.037;0.39;0.621;0.621;0.448|.	T|T	0.55224|0.55224	-0.8174|-0.8174	10|5	0.15499|.	T|.	0.54|.	-9.9961|-9.9961	9.8987|9.8987	0.41334|0.41334	0.0:0.7842:0.1401:0.0756|0.0:0.7842:0.1401:0.0756	.|.	373;373;408;327;342;485|.	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30|.	.;.;.;.;.;LIPB2_HUMAN|.	T|Y	485;327;327;408;373;342;146|175	ENSP00000299492:P485T;ENSP00000436498:P327T;ENSP00000435469:P373T;ENSP00000437321:P342T|.	ENSP00000299492:P485T|.	P|S	+|+	1|2	0|0	PPFIBP2|PPFIBP2	7619363|7619363	0.941000|0.941000	0.31946|0.31946	0.829000|0.829000	0.32907|0.32907	0.991000|0.991000	0.79684|0.79684	2.082000|2.082000	0.41605|0.41605	0.854000|0.854000	0.35336|0.35336	0.655000|0.655000	0.94253|0.94253	CCT|TCC		0.473	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621		28	69	1	0	1.12875e-08	0.00632	1.25295e-08	28	69				
OVCH2	341277	broad.mit.edu	37	11	7718041	7718041	+	RNA	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:7718041G>A	ENST00000533663.1	-	0	0				OVCH2_ENST00000534193.2_RNA|OVCH2_ENST00000454689.1_RNA			Q7RTZ1	OVCH2_HUMAN	ovochymase 2 (gene/pseudogene)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(2)	15				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		AGAATACATTGACAGGTAACT	0.453																																							uc010rbf.1		NA																	0					0						c.(1111-1113)TCA>TTA		ovochymase 2 precursor							94.0	90.0	92.0					11																	7718041		1933	4124	6057			341277							g.chr11:7718041G>A	BN000120	CCDS73251.1	11p15.4	2012-10-02	2010-06-08		ENSG00000183378	ENSG00000183378			29970	protein-coding gene	gene with protein product			"""ovochymase 2"""			12838346	Standard	XM_006718221		Approved	OVTN	uc031pyw.1	Q7RTZ1	OTTHUMG00000165418		11.37:g.7718041G>A			Somatic					p.S371L	NM_198185	NP_937828	WXS	Illumina HiSeq	Unspecified				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)	10	1112	-									Missense_Mutation	SNP	ENST00000533663.1	37	c.1112C>T		.	.	.	.	.	.	.	.	.	.	G	19.57	3.852994	0.71719	.	.	ENSG00000183378	ENST00000454689	T	0.18338	2.22	5.69	4.65	0.58169	CUB (5);	0.437004	0.17071	N	0.188172	T	0.22704	0.0548	L	0.58428	1.81	0.22401	N	0.999136	P	0.43578	0.811	P	0.45660	0.489	T	0.11155	-1.0599	10	0.66056	D	0.02	-0.9673	8.5078	0.33197	0.1336:0.0:0.8664:0.0	.	371	Q7RTZ1	OVCH2_HUMAN	L	371	ENSP00000407158:S371L	ENSP00000407158:S371L	S	-	2	0	OVCH2	7674617	0.997000	0.39634	0.998000	0.56505	0.887000	0.51463	2.679000	0.46909	1.148000	0.42385	0.655000	0.94253	TCA		0.453	OVCH2-002	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000383928.1	NM_198185		20	39	0	0	0	0.001882	0	20	39				
SERGEF	26297	broad.mit.edu	37	11	17981053	17981053	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:17981053C>T	ENST00000265965.5	-	9	1126	c.975G>A	c.(973-975)atG>atA	p.M325I	SERGEF_ENST00000532265.1_Intron|SERGEF_ENST00000528200.1_Intron	NM_012139.2	NP_036271.1	Q9UGK8	SRGEF_HUMAN	secretion regulating guanine nucleotide exchange factor	325					negative regulation of protein secretion (GO:0050709)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(5)|lung(5)	12						GAGACGAAGGCATGCTGTTCG	0.448																																							uc001mnm.2		NA																	0				central_nervous_system(1)	1						c.(973-975)ATG>ATA		deafness locus associated putative guanine							108.0	103.0	104.0					11																	17981053		2200	4293	6493	SO:0001583	missense	26297				negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity	g.chr11:17981053C>T	AJ243950	CCDS7828.1	11p14.3	2006-03-09			ENSG00000129158	ENSG00000129158			17499	protein-coding gene	gene with protein product		606051				10571079, 12459492	Standard	NM_012139		Approved	DelGEF, Gnefr	uc001mnm.3	Q9UGK8	OTTHUMG00000166420	ENST00000265965.5:c.975G>A	11.37:g.17981053C>T	ENSP00000265965:p.Met325Ile		Somatic				SERGEF_uc009yhd.2_RNA|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron|SERGEF_uc001mno.1_Missense_Mutation_p.M211I	p.M325I	NM_012139	NP_036271	WXS	Illumina HiSeq	Unspecified	Q9UGK8	SRGEF_HUMAN			9	1055	-			325			RCC1 6.		Q9UGK9	Missense_Mutation	SNP	ENST00000265965.5	37	c.975G>A	CCDS7828.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.08|13.08|13.08	2.130457|2.130457|2.130457	0.37630|0.37630|0.37630	.|.|.	.|.|.	ENSG00000129158|ENSG00000129158|ENSG00000129158	ENST00000533241|ENST00000529151|ENST00000265965;ENST00000529728	.|.|D;T	.|.|0.84223	.|.|-1.82;1.49	6.17|6.17|6.17	-5.04|-5.04|-5.04	0.02964|0.02964|0.02964	.|.|Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	.|.|2.293570	.|.|0.01151	.|.|N	.|.|0.006409	T|T|T	0.63319|0.63319|0.63319	0.2501|0.2501|0.2501	N|N|N	0.01529|0.01529|0.01529	-0.815|-0.815|-0.815	0.20563|0.20563|0.20563	N|N|N	0.999887|0.999887|0.999887	.|.|B;B	.|.|0.02656	.|.|0.0;0.0	.|.|B;B	.|.|0.01281	.|.|0.0;0.0	T|T|T	0.57631|0.57631|0.57631	-0.7778|-0.7778|-0.7778	5|5|10	.|.|0.33940	.|.|T	.|.|0.23	14.393|14.393|14.393	7.9472|7.9472|7.9472	0.29993|0.29993|0.29993	0.1118:0.2902:0.0:0.598|0.1118:0.2902:0.0:0.598|0.1118:0.2902:0.0:0.598	.|.|.	.|.|211;325	.|.|E9PMV6;Q9UGK8	.|.|.;SRGEF_HUMAN	T|Y|I	98|189|325;211	.|.|ENSP00000265965:M325I;ENSP00000437297:M211I	.|.|ENSP00000265965:M325I	A|C|M	-|-|-	1|2|3	0|0|0	SERGEF|SERGEF|SERGEF	17937629|17937629|17937629	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.003000|0.003000|0.003000	0.11579|0.11579|0.11579	0.819000|0.819000|0.819000	0.46315|0.46315|0.46315	-1.192000|-1.192000|-1.192000	0.03052|0.03052|0.03052	-0.611000|-0.611000|-0.611000	0.05709|0.05709|0.05709	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCC|TGC|ATG		0.448	SERGEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389538.1	NM_012139		20	53	0	0	0	0.00278	0	20	53				
NAV2	89797	broad.mit.edu	37	11	20129313	20129313	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:20129313C>T	ENST00000396087.3	+	39	7221	c.7122C>T	c.(7120-7122)gtC>gtT	p.V2374V	NAV2_ENST00000540292.1_Silent_p.V2305V|NAV2_ENST00000396085.1_Silent_p.V2318V|NAV2_ENST00000527559.2_Silent_p.V2303V|NAV2_ENST00000349880.4_Silent_p.V2315V|NAV2_ENST00000311043.8_Silent_p.V1379V|NAV2_ENST00000360655.4_Silent_p.V2251V|NAV2_ENST00000533917.1_Silent_p.V1379V	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	2374			V -> I (in dbSNP:rs35891966). {ECO:0000269|PubMed:14702039}.		glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TGGAAGCCGTCAGAGAAGGAC	0.552																																							uc001mpr.3		NA																	0				skin(4)|ovary(1)|pancreas(1)	6						c.(6952-6954)GTC>GTT		neuron navigator 2 isoform 1							164.0	153.0	157.0					11																	20129313		2203	4300	6503	SO:0001819	synonymous_variant	89797					nucleus	ATP binding|helicase activity	g.chr11:20129313C>T	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.7122C>T	11.37:g.20129313C>T			Somatic				NAV2_uc001mpp.2_Silent_p.V2251V|NAV2_uc009yhx.2_Silent_p.V1379V|NAV2_uc009yhz.2_Silent_p.V960V|NAV2_uc001mpu.2_Silent_p.V753V|NAV2_uc001mpv.2_Silent_p.V77V	p.V2318V	NM_182964	NP_892009	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			36	7315	+			2374					A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	c.6954C>T	CCDS58126.1																																																																																				0.552	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		63	117	0	0	0	0.00361	0	63	117				
PRMT3	10196	broad.mit.edu	37	11	20483592	20483592	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:20483592T>C	ENST00000331079.6	+	12	1356	c.1139T>C	c.(1138-1140)aTt>aCt	p.I380T	PRMT3_ENST00000437750.2_Missense_Mutation_p.I318T	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	380	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						GCTGATAGAATTGCTTTTTGG	0.388																																							uc001mqb.2		NA																	0					0						c.(1138-1140)ATT>ACT		protein arginine methyltransferase 3 isoform 1							199.0	189.0	192.0					11																	20483592		2203	4300	6503	SO:0001583	missense	10196						zinc ion binding	g.chr11:20483592T>C	AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.1139T>C	11.37:g.20483592T>C	ENSP00000331879:p.Ile380Thr		Somatic				PRMT3_uc001mqc.2_Missense_Mutation_p.I303T|PRMT3_uc010rdn.1_Missense_Mutation_p.I318T	p.I380T	NM_005788	NP_005779	WXS	Illumina HiSeq	Unspecified	O60678	ANM3_HUMAN			12	1356	+			380					B4DUC7	Missense_Mutation	SNP	ENST00000331079.6	37	c.1139T>C	CCDS7853.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.348568	0.82132	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.79352	-1.26;-1.26	5.78	5.78	0.91487	.	0.095228	0.64402	D	0.000001	D	0.89339	0.6687	M	0.86740	2.835	0.58432	D	0.999996	D;D	0.69078	0.997;0.995	D;D	0.72982	0.979;0.94	D	0.91156	0.4957	10	0.87932	D	0	-25.1187	15.7652	0.78120	0.0:0.0:0.0:1.0	.	318;380	O60678-2;O60678	.;ANM3_HUMAN	T	380;380;318	ENSP00000331879:I380T;ENSP00000397766:I318T	ENSP00000331879:I380T	I	+	2	0	PRMT3	20440168	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.698000	0.84413	2.191000	0.70037	0.528000	0.53228	ATT		0.388	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1	NM_005788		36	77	0	0	0	0.004878	0	36	77				
C11orf74	119710	broad.mit.edu	37	11	36657643	36657643	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:36657643G>T	ENST00000334307.5	+	4	449	c.334G>T	c.(334-336)Gag>Tag	p.E112*	C11orf74_ENST00000446510.2_Nonsense_Mutation_p.E112*|C11orf74_ENST00000534635.1_Intron|C11orf74_ENST00000347206.4_Intron	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	112										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				CATGGATGAAGAGATTAAACC	0.328																																							uc001mwy.1		NA																	0					0						c.(334-336)GAG>TAG		hypothetical protein LOC119710							120.0	123.0	122.0					11																	36657643		2202	4298	6500	SO:0001587	stop_gained	119710							g.chr11:36657643G>T	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.334G>T	11.37:g.36657643G>T	ENSP00000334848:p.Glu112*		Somatic				C11orf74_uc010rfd.1_Intron|C11orf74_uc001mww.1_Intron|C11orf74_uc001mwx.1_Intron|C11orf74_uc001mwz.1_Intron|C11orf74_uc010rfe.1_RNA	p.E112*	NM_138787	NP_620142	WXS	Illumina HiSeq	Unspecified	Q86VG3	CK074_HUMAN			4	407	+	all_lung(20;0.226)	all_hematologic(20;0.0118)	112					D3DR18|Q96DD6	Nonsense_Mutation	SNP	ENST00000334307.5	37	c.334G>T	CCDS7904.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641293	0.67244	.	.	ENSG00000166352	ENST00000334307;ENST00000531554;ENST00000446510;ENST00000532470	.	.	.	5.43	5.43	0.79202	.	0.101533	0.43260	D	0.000596	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1147	15.9686	0.79995	0.0:0.0:1.0:0.0	.	.	.	.	X	112	.	.	E	+	1	0	C11orf74	36614219	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	5.214000	0.65236	2.545000	0.85829	0.655000	0.94253	GAG		0.328	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787		15	20	1	0	3.99206e-14	0.007413	4.6733e-14	15	20				
OR4A5	81318	broad.mit.edu	37	11	51412202	51412202	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:51412202G>T	ENST00000319760.6	-	1	246	c.194C>A	c.(193-195)tCa>tAa	p.S65*		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				ATCTATAAATGACAGGCAGGC	0.443																																							uc001nhi.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(193-195)TCA>TAA		olfactory receptor, family 4, subfamily A,							59.0	58.0	59.0					11																	51412202		2201	4296	6497	SO:0001587	stop_gained	81318				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51412202G>T	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.194C>A	11.37:g.51412202G>T	ENSP00000367664:p.Ser65*		Somatic					p.S65*	NM_001005272	NP_001005272	WXS	Illumina HiSeq	Unspecified	Q8NH83	OR4A5_HUMAN			1	194	-		all_lung(304;0.236)	65			Helical; Name=2; (Potential).		Q6IF84	Nonsense_Mutation	SNP	ENST00000319760.6	37	c.194C>A	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	3.358	-0.131022	0.06753	.	.	ENSG00000221840	ENST00000319760	.	.	.	1.93	1.93	0.25924	.	0.000000	0.41097	D	0.000948	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9079	0.41388	0.0:0.0:1.0:0.0	.	.	.	.	X	65	.	ENSP00000367664:S65X	S	-	2	0	OR4A5	51268778	0.017000	0.18338	0.189000	0.23252	0.035000	0.12851	1.944000	0.40263	1.394000	0.46624	0.162000	0.16502	TCA		0.443	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272		17	52	1	0	4.63292e-17	0.008871	5.61517e-17	17	52				
OR4A16	81327	broad.mit.edu	37	11	55111087	55111088	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:55111087_55111088GG>CT	ENST00000314721.2	+	1	461_462	c.411_412GG>CT	c.(409-414)ctGGtt>ctCTtt	p.V138F		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TGAATCGACTGGTTTGCATCCT	0.47																																							uc010rie.1		NA																	0				large_intestine(2)|pancreas(1)	3						c.(409-414)CTGGTT>CTCTTT		olfactory receptor, family 4, subfamily A,																																				SO:0001583	missense	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55111087_55111088GG>CT	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	Exception_encountered	11.37:g.55111087_55111088delinsCT	ENSP00000325128:p.Val138Phe		Somatic					p.V138F	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	411_412	+			138			Helical; Name=4; (Potential).		Q6IFL3	Missense_Mutation	DNP	ENST00000314721.2	37	c.411_412GG>CT	CCDS31499.1																																																																																				0.470	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		29	60	0	0	0	0.004672	0	29	60				
OR5D13	390142	broad.mit.edu	37	11	55541372	55541372	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:55541372G>T	ENST00000361760.1	+	1	459	c.459G>T	c.(457-459)tgG>tgT	p.W153C		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				CCTATACATGGGGGATAGTGT	0.408																																							uc010ril.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(457-459)TGG>TGT		olfactory receptor, family 5, subfamily D,							187.0	186.0	187.0					11																	55541372		2200	4296	6496	SO:0001583	missense	390142				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55541372G>T	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.459G>T	11.37:g.55541372G>T	ENSP00000354800:p.Trp153Cys		Somatic					p.W153C	NM_001001967	NP_001001967	WXS	Illumina HiSeq	Unspecified	Q8NGL4	OR5DD_HUMAN			1	459	+		all_epithelial(135;0.196)	153			Helical; Name=4; (Potential).		Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	c.459G>T	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	G	3.732	-0.055357	0.07362	.	.	ENSG00000198877	ENST00000361760	T	0.36878	1.23	3.3	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32204	U	0.006428	T	0.27454	0.0674	L	0.28608	0.87	0.46749	D	0.999186	P	0.36944	0.574	P	0.44921	0.464	T	0.03374	-1.1043	10	0.11182	T	0.66	-5.7388	7.8701	0.29561	0.1237:0.0:0.8763:0.0	.	153	Q8NGL4	OR5DD_HUMAN	C	153	ENSP00000354800:W153C	ENSP00000354800:W153C	W	+	3	0	OR5D13	55297948	0.000000	0.05858	0.203000	0.23512	0.010000	0.07245	-0.633000	0.05483	0.747000	0.32809	0.486000	0.48141	TGG		0.408	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967		40	122	1	0	1.61572e-30	0.002522	2.09922e-30	40	122				
OR5AS1	219447	broad.mit.edu	37	11	55798703	55798703	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:55798703C>A	ENST00000313555.1	+	1	809	c.809C>A	c.(808-810)aCt>aAt	p.T270N		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TCCCTAGACACTGATAAGGTG	0.398																																							uc010riw.1		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(808-810)ACT>AAT		olfactory receptor, family 5, subfamily AS,							92.0	80.0	84.0					11																	55798703		2201	4296	6497	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798703C>A	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.809C>A	11.37:g.55798703C>A	ENSP00000324111:p.Thr270Asn		Somatic					p.T270N	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	809	+	Esophageal squamous(21;0.00693)		270			Extracellular (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.809C>A	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	C	1.585	-0.530625	0.04112	.	.	ENSG00000181785	ENST00000313555	T	0.00115	8.71	5.14	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34362	U	0.004021	T	0.00144	0.0004	L	0.43923	1.385	0.09310	N	1	B	0.32010	0.351	B	0.33254	0.16	T	0.16689	-1.0394	10	0.42905	T	0.14	.	5.4701	0.16666	0.1614:0.6711:0.0:0.1675	.	270	Q8N127	O5AS1_HUMAN	N	270	ENSP00000324111:T270N	ENSP00000324111:T270N	T	+	2	0	OR5AS1	55555279	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	-0.238000	0.08977	0.550000	0.28991	0.579000	0.79373	ACT		0.398	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		15	45	1	0	7.93312e-07	0.00245	8.52997e-07	15	45				
OR5J2	282775	broad.mit.edu	37	11	55944812	55944812	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:55944812C>A	ENST00000312298.1	+	1	719	c.719C>A	c.(718-720)aCc>aAc	p.T240N		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					GCCTTCTCCACCTGTGCCTCT	0.468																																							uc010rjb.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(718-720)ACC>AAC		olfactory receptor, family 5, subfamily J,							141.0	123.0	129.0					11																	55944812		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944812C>A	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.719C>A	11.37:g.55944812C>A	ENSP00000310788:p.Thr240Asn		Somatic					p.T240N	NM_001005492	NP_001005492	WXS	Illumina HiSeq	Unspecified	Q8NH18	OR5J2_HUMAN			1	719	+	Esophageal squamous(21;0.00693)		240			Helical; Name=6; (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.719C>A	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119142	0.56505	.	.	ENSG00000174957	ENST00000312298	T	0.40476	1.03	4.26	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000022	T	0.72382	0.3453	H	0.95745	3.715	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	T	0.79718	-0.1686	10	0.87932	D	0	.	12.0379	0.53435	0.0:0.9128:0.0:0.0872	.	240	Q8NH18	OR5J2_HUMAN	N	240	ENSP00000310788:T240N	ENSP00000310788:T240N	T	+	2	0	OR5J2	55701388	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	3.613000	0.54152	0.949000	0.37715	0.591000	0.81541	ACC		0.468	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		32	68	1	0	2.52637e-11	0.005524	2.89331e-11	32	68				
OR5T2	219464	broad.mit.edu	37	11	55999647	55999647	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:55999647A>T	ENST00000313264.4	-	1	1090	c.1015T>A	c.(1015-1017)Tca>Aca	p.S339T		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	339						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TTTTTCATTGAGTCTTTTACA	0.333																																							uc010rjc.1		NA																	0				ovary(2)	2						c.(1015-1017)TCA>ACA		olfactory receptor, family 5, subfamily T,							66.0	62.0	63.0					11																	55999647		2201	4296	6497	SO:0001583	missense	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55999647A>T	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.1015T>A	11.37:g.55999647A>T	ENSP00000323688:p.Ser339Thr		Somatic					p.S339T	NM_001004746	NP_001004746	WXS	Illumina HiSeq	Unspecified	Q8NGG2	OR5T2_HUMAN			1	1015	-	Esophageal squamous(21;0.00448)		339			Cytoplasmic (Potential).		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	c.1015T>A	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.291285	0.23564	.	.	ENSG00000181718	ENST00000313264	T	0.35789	1.29	4.87	3.96	0.45880	.	0.172418	0.27189	U	0.020513	T	0.19967	0.0480	N	0.11756	0.17	0.09310	N	1	B	0.18741	0.03	B	0.23150	0.044	T	0.14783	-1.0460	10	0.66056	D	0.02	.	6.351	0.21375	0.3303:0.5836:0.0:0.0861	.	339	Q8NGG2	OR5T2_HUMAN	T	339	ENSP00000323688:S339T	ENSP00000323688:S339T	S	-	1	0	OR5T2	55756223	0.017000	0.18338	0.005000	0.12908	0.020000	0.10135	0.286000	0.18902	1.200000	0.43188	-0.833000	0.03075	TCA		0.333	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		25	45	0	0	0	0.004656	0	25	45				
LRRC55	219527	broad.mit.edu	37	11	56949704	56949704	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:56949704C>A	ENST00000497933.1	+	1	484	c.337C>A	c.(337-339)Ctc>Atc	p.L113I		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	83					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						CACCCGAAACCTCAGCCTGGC	0.587																																							uc001njl.1		NA																	0					0						c.(337-339)CTC>ATC		leucine rich repeat containing 55							64.0	66.0	65.0					11																	56949704		2201	4296	6497	SO:0001583	missense	219527					integral to membrane		g.chr11:56949704C>A		CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.337C>A	11.37:g.56949704C>A	ENSP00000419542:p.Leu113Ile		Somatic					p.L113I	NM_001005210	NP_001005210	WXS	Illumina HiSeq	Unspecified	Q6ZSA7	LRC55_HUMAN			1	484	+			83			LRR 1.		A7E2U7|B2RN81	Missense_Mutation	SNP	ENST00000497933.1	37	c.337C>A	CCDS31539.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397822	0.83120	.	.	ENSG00000183908	ENST00000497933	T	0.12039	2.72	5.8	5.8	0.92144	.	0.000000	0.53938	D	0.000054	T	0.39332	0.1074	M	0.79805	2.47	0.49915	D	0.999832	D	0.89917	1.0	D	0.91635	0.999	T	0.18116	-1.0347	10	0.87932	D	0	.	12.8727	0.57975	0.0:0.9222:0.0:0.0778	.	83	Q6ZSA7	LRC55_HUMAN	I	113	ENSP00000419542:L113I	ENSP00000419542:L113I	L	+	1	0	LRRC55	56706280	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.437000	0.66544	2.735000	0.93741	0.655000	0.94253	CTC		0.587	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	NM_001005210		23	41	1	0	1.80694e-10	0.009535	2.04886e-10	23	41				
CLP1	10978	broad.mit.edu	37	11	57428873	57428873	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:57428873C>T	ENST00000302731.4	+	3	1171	c.1051C>T	c.(1051-1053)Ctc>Ttc	p.L351F	CLP1_ENST00000525602.1_Missense_Mutation_p.L415F|CLP1_ENST00000533682.1_Missense_Mutation_p.L415F|CLP1_ENST00000529430.1_Missense_Mutation_p.L426F	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						GAACTTCCTTCTCATCATGGA	0.527																																							uc001nkw.2		NA																	0				ovary(1)	1						c.(1243-1245)CTC>TTC		ATP/GTP-binding protein isoform 1							121.0	107.0	112.0					11																	57428873		2201	4296	6497	SO:0001583	missense	10978				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity	g.chr11:57428873C>T	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.1051C>T	11.37:g.57428873C>T	ENSP00000304704:p.Leu351Phe		Somatic				CLP1_uc010rjw.1_Missense_Mutation_p.L351F|CLP1_uc009yml.2_Missense_Mutation_p.L415F	p.L415F	NM_006831	NP_006822	WXS	Illumina HiSeq	Unspecified	Q92989	CLP1_HUMAN			3	1382	+			415					Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000302731.4	37	c.1243C>T	CCDS44600.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.618902	0.87460	.	.	ENSG00000172409	ENST00000529430;ENST00000533682;ENST00000525602;ENST00000302731	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.91	4.99	0.66335	Pre-mRNA cleavage complex II Clp1 (1);	0.000000	0.85682	D	0.000000	T	0.75525	0.3861	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.77004	0.989;0.967	T	0.80815	-0.1214	10	0.87932	D	0	-3.988	16.0288	0.80560	0.1357:0.8643:0.0:0.0	.	351;415	Q92989-2;Q92989	.;CLP1_HUMAN	F	426;415;415;351	ENSP00000433406:L426F;ENSP00000434995:L415F;ENSP00000436066:L415F;ENSP00000304704:L351F	ENSP00000304704:L351F	L	+	1	0	CLP1	57185449	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.677000	0.84024	1.490000	0.48466	0.650000	0.86243	CTC		0.527	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1	NM_006831		4	138	0	0	0	0.009096	0	4	138				
OR9Q2	219957	broad.mit.edu	37	11	57958095	57958095	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:57958095A>G	ENST00000311591.3	+	1	190	c.133A>G	c.(133-135)Atg>Gtg	p.M45V		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				GAACACAGGCATGATCCTCCT	0.498																																							uc010rka.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(133-135)ATG>GTG		olfactory receptor, family 9, subfamily Q,							120.0	94.0	103.0					11																	57958095		2201	4296	6497	SO:0001583	missense	219957				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57958095A>G	AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.133A>G	11.37:g.57958095A>G	ENSP00000308714:p.Met45Val		Somatic					p.M45V	NM_001005283	NP_001005283	WXS	Illumina HiSeq	Unspecified	Q8NGE9	OR9Q2_HUMAN			1	133	+		Breast(21;0.0589)	45			Helical; Name=1; (Potential).			Missense_Mutation	SNP	ENST00000311591.3	37	c.133A>G	CCDS31544.1	.	.	.	.	.	.	.	.	.	.	A	4.225	0.040605	0.08196	.	.	ENSG00000186513	ENST00000311591	T	0.00408	7.54	5.43	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000017	T	0.00271	0.0008	L	0.41961	1.31	0.09310	N	1	P	0.35612	0.512	B	0.32677	0.15	T	0.47995	-0.9073	10	0.66056	D	0.02	-25.5706	2.9701	0.05920	0.5153:0.2765:0.0749:0.1333	.	45	Q8NGE9	OR9Q2_HUMAN	V	45	ENSP00000308714:M45V	ENSP00000308714:M45V	M	+	1	0	OR9Q2	57714671	0.001000	0.12720	0.354000	0.25760	0.037000	0.13140	0.000000	0.12993	0.978000	0.38470	0.533000	0.62120	ATG		0.498	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	NM_001005283		11	19	0	0	0	0.000978	0	11	19				
OR10Q1	219960	broad.mit.edu	37	11	57995839	57995839	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:57995839A>G	ENST00000316770.2	-	1	551	c.509T>C	c.(508-510)cTg>cCg	p.L170P		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GCAAAAGGGCAGGGTGAAGAT	0.652																																							uc010rkd.1		NA																	0				ovary(2)	2						c.(508-510)CTG>CCG		olfactory receptor, family 10, subfamily Q,							57.0	49.0	52.0					11																	57995839		2201	4295	6496	SO:0001583	missense	219960				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57995839A>G	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.509T>C	11.37:g.57995839A>G	ENSP00000314324:p.Leu170Pro		Somatic					p.L170P	NM_001004471	NP_001004471	WXS	Illumina HiSeq	Unspecified	Q8NGQ4	O10Q1_HUMAN			1	509	-		Breast(21;0.0589)	170			Extracellular (Potential).		Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	37	c.509T>C	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.655589	0.47467	.	.	ENSG00000180475	ENST00000316770	T	0.00301	8.21	4.67	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33438	N	0.004912	T	0.01061	0.0035	H	0.98738	4.315	0.46336	D	0.998996	D	0.76494	0.999	D	0.77004	0.989	T	0.35325	-0.9793	10	0.87932	D	0	.	6.4038	0.21652	0.7568:0.1585:0.0847:0.0	.	170	Q8NGQ4	O10Q1_HUMAN	P	170	ENSP00000314324:L170P	ENSP00000314324:L170P	L	-	2	0	OR10Q1	57752415	0.841000	0.29509	0.999000	0.59377	0.681000	0.39784	4.080000	0.57620	0.287000	0.22375	-0.256000	0.11100	CTG		0.652	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471		13	24	0	0	0	0.00245	0	13	24				
OSBP	5007	broad.mit.edu	37	11	59367987	59367987	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:59367987G>C	ENST00000263847.1	-	7	1772	c.1293C>G	c.(1291-1293)ctC>ctG	p.L431L		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	431	Sterol binding. {ECO:0000250}.				lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GGATCTTAGAGAGTTCTTTTC	0.478																																							uc001noc.1		NA																	0				large_intestine(1)	1						c.(1291-1293)CTC>CTG		oxysterol binding protein							203.0	188.0	193.0					11																	59367987		2201	4295	6496	SO:0001819	synonymous_variant	5007				lipid transport	Golgi membrane	oxysterol binding	g.chr11:59367987G>C	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1293C>G	11.37:g.59367987G>C			Somatic				OSBP_uc009ymr.1_RNA	p.L431L	NM_002556	NP_002547	WXS	Illumina HiSeq	Unspecified	P22059	OSBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)	7	1773	-		all_epithelial(135;0.000236)	431			Sterol binding (By similarity).		Q6P524	Silent	SNP	ENST00000263847.1	37	c.1293C>G	CCDS7974.1																																																																																				0.478	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1			7	158	0	0	0	0.008291	0	7	158				
CCDC86	79080	broad.mit.edu	37	11	60610191	60610191	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:60610191A>G	ENST00000227520.5	+	1	648	c.594A>G	c.(592-594)ccA>ccG	p.P198P	RP11-804A23.2_ENST00000539897.1_RNA|RP11-804A23.4_ENST00000538705.1_RNA	NM_024098.3	NP_077003.1	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	198	Pro-rich.				viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|liver(2)|lung(2)|urinary_tract(3)	10						CGAGCAAGCCACCTCCAGCTG	0.637																																							uc001nqa.2		NA																	0					0						c.(592-594)CCA>CCG		coiled-coil domain containing 86							19.0	21.0	21.0					11																	60610191		2202	4299	6501	SO:0001819	synonymous_variant	79080				interspecies interaction between organisms	nucleus		g.chr11:60610191A>G	AK025974	CCDS7993.1	11q12.2	2006-03-16			ENSG00000110104	ENSG00000110104			28359	protein-coding gene	gene with protein product		611293					Standard	NM_024098		Approved	MGC2574	uc001nqa.2	Q9H6F5	OTTHUMG00000167706	ENST00000227520.5:c.594A>G	11.37:g.60610191A>G			Somatic				CCDC86_uc001nqb.2_5'UTR	p.P198P	NM_024098	NP_077003	WXS	Illumina HiSeq	Unspecified	Q9H6F5	CCD86_HUMAN			1	763	+			198			Pro-rich.		B4DY99	Silent	SNP	ENST00000227520.5	37	c.594A>G	CCDS7993.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.434050	0.25813	.	.	ENSG00000110104	ENST00000339492	.	.	.	3.97	-5.12	0.02893	.	.	.	.	.	T	0.32615	0.0835	.	.	.	0.18873	N	0.999985	.	.	.	.	.	.	T	0.41502	-0.9505	5	0.35671	T	0.21	-1.3668	8.9628	0.35858	0.2514:0.1472:0.6013:0.0	.	.	.	.	A	134	.	ENSP00000343680:T134A	T	+	1	0	CCDC86	60366767	0.009000	0.17119	0.000000	0.03702	0.228000	0.25075	0.575000	0.23729	-0.893000	0.03930	0.379000	0.24179	ACC		0.637	CCDC86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395743.1	NM_024098		3	15	0	0	0	0.000602	0	3	15				
SYT7	9066	broad.mit.edu	37	11	61295611	61295611	+	Missense_Mutation	SNP	C	C	G	rs374646904		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:61295611C>G	ENST00000263846.4	-	5	725	c.398G>C	c.(397-399)cGa>cCa	p.R133P	SYT7_ENST00000539008.1_Missense_Mutation_p.R416P|SYT7_ENST00000542670.1_Missense_Mutation_p.R341P|SYT7_ENST00000540831.1_5'UTR|SYT7_ENST00000535826.1_Missense_Mutation_p.R252P|SYT7_ENST00000540677.1_Missense_Mutation_p.R208P|SYT7_ENST00000542836.1_Missense_Mutation_p.R177P	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	133					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CAGGTTCTCTCGGCTGCAACC	0.647																																							uc001nrv.2		NA																	0				ovary(3)|pancreas(1)	4						c.(397-399)CGA>CCA		synaptotagmin VII							51.0	58.0	56.0					11																	61295611		2202	4299	6501	SO:0001583	missense	9066					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr11:61295611C>G	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.398G>C	11.37:g.61295611C>G	ENSP00000263846:p.Arg133Pro		Somatic				SYT7_uc009ynr.2_Missense_Mutation_p.R208P	p.R133P	NM_004200	NP_004191	WXS	Illumina HiSeq	Unspecified	O43581	SYT7_HUMAN			5	404	-			133			Cytoplasmic (Potential).		F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	c.398G>C	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658112	0.88154	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826;ENST00000545053	T;T;T;T;T;T;T	0.23754	3.22;3.22;3.22;3.22;3.22;3.22;1.89	4.44	4.44	0.53790	.	0.156244	0.56097	D	0.000035	T	0.20007	0.0481	N	0.11427	0.14	0.80722	D	1	P;P	0.50943	0.94;0.761	P;B	0.46275	0.51;0.221	T	0.08452	-1.0721	10	0.44086	T	0.13	.	17.5426	0.87852	0.0:1.0:0.0:0.0	.	208;133	F5GZU9;O43581	.;SYT7_HUMAN	P	133;208;416;177;341;252;133	ENSP00000263846:R133P;ENSP00000444201:R208P;ENSP00000439694:R416P;ENSP00000444568:R177P;ENSP00000444019:R341P;ENSP00000437720:R252P;ENSP00000443576:R133P	ENSP00000263846:R133P	R	-	2	0	SYT7	61052187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.823000	0.69272	2.420000	0.82092	0.561000	0.74099	CGA		0.647	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200		40	71	0	0	0	0.00361	0	40	71				
AHNAK	79026	broad.mit.edu	37	11	62287401	62287401	+	Missense_Mutation	SNP	C	C	T	rs543343312		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:62287401C>T	ENST00000378024.4	-	5	14762	c.14488G>A	c.(14488-14490)Gca>Aca	p.A4830T	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4830				A -> P (in Ref. 4; AAA69898). {ECO:0000305}.	protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTCAGTTTTGCGTCTGGACCT	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20622	0.0		0.0	False		,,,				2504	0.0						uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(14488-14490)GCA>ACA		AHNAK nucleoprotein isoform 1							130.0	129.0	129.0					11																	62287401		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62287401C>T	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14488G>A	11.37:g.62287401C>T	ENSP00000367263:p.Ala4830Thr		Somatic				AHNAK_uc001ntk.1_Intron	p.A4830T	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	14788	-		Melanoma(852;0.155)	4830	A -> P (in Ref. 2; AAA69898).				A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.14488G>A	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400686	0.62177	.	.	ENSG00000124942	ENST00000378024	T	0.00686	5.85	4.58	3.65	0.41850	.	0.737081	0.11707	N	0.537338	T	0.02304	0.0071	L	0.48642	1.525	0.25443	N	0.988077	D	0.76494	0.999	D	0.69307	0.963	T	0.54050	-0.8351	10	0.21014	T	0.42	-5.3575	10.4167	0.44327	0.0:0.9011:0.0:0.0989	.	4830	Q09666	AHNK_HUMAN	T	4830	ENSP00000367263:A4830T	ENSP00000367263:A4830T	A	-	1	0	AHNAK	62043977	0.003000	0.15002	0.580000	0.28601	0.808000	0.45660	2.089000	0.41672	0.908000	0.36671	0.478000	0.44815	GCA		0.488	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		46	99	0	0	0	0.00361	0	46	99				
LGALS12	85329	broad.mit.edu	37	11	63283785	63283785	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:63283785A>T	ENST00000394618.3	+	9	1222	c.931A>T	c.(931-933)Agc>Tgc	p.S311C	LGALS12_ENST00000340246.5_Missense_Mutation_p.S312C|LGALS12_ENST00000425950.2_Missense_Mutation_p.S241C|LGALS12_ENST00000415491.2_Missense_Mutation_p.S250C|LGALS12_ENST00000255684.5_Missense_Mutation_p.S302C	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	311	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						GGGGGCCACCAGCATGAACCA	0.622																																							uc001nxa.2		NA																	0				ovary(2)	2						c.(931-933)AGC>TGC		lectin, galactoside-binding, soluble, 12 isoform							49.0	49.0	49.0					11																	63283785		2201	4298	6499	SO:0001583	missense	85329				apoptosis|induction of apoptosis by intracellular signals	nucleus	lactose binding	g.chr11:63283785A>T	AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.931A>T	11.37:g.63283785A>T	ENSP00000378116:p.Ser311Cys		Somatic				LGALS12_uc001nxb.2_Missense_Mutation_p.S302C|LGALS12_uc001nxc.2_Missense_Mutation_p.S312C|LGALS12_uc001nxd.2_Missense_Mutation_p.S250C|LGALS12_uc001nxe.2_Missense_Mutation_p.S241C|LGALS12_uc009yot.2_Missense_Mutation_p.S271C	p.S311C	NM_033101	NP_149092	WXS	Illumina HiSeq	Unspecified	Q96DT0	LEG12_HUMAN			9	1272	+			311			Galectin 2.		B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000394618.3	37	c.931A>T	CCDS8045.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.604278	0.46423	.	.	ENSG00000133317	ENST00000255684;ENST00000394618;ENST00000340246;ENST00000415491;ENST00000425950	T;T;T;T;T	0.05855	3.38;3.38;3.38;3.38;3.38	5.67	3.3	0.37823	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (3);Concanavalin A-like lectin/glucanase, subgroup (1);	0.244316	0.36519	N	0.002548	T	0.15609	0.0376	L	0.54323	1.7	0.32727	N	0.509531	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.76071	0.987;0.964;0.947;0.987	T	0.10428	-1.0630	10	0.62326	D	0.03	-15.5159	5.2962	0.15754	0.7607:0.0:0.0839:0.1554	.	271;312;302;311	Q9NZ03;G5E970;Q96DT0-3;Q96DT0	.;.;.;LEG12_HUMAN	C	302;311;312;250;241	ENSP00000255684:S302C;ENSP00000378116:S311C;ENSP00000339374:S312C;ENSP00000394659:S250C;ENSP00000399093:S241C	ENSP00000255684:S302C	S	+	1	0	LGALS12	63040361	0.562000	0.26586	0.989000	0.46669	0.129000	0.20672	1.053000	0.30442	0.479000	0.27511	0.533000	0.62120	AGC		0.622	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101		28	44	0	0	0	0.009535	0	28	44				
PLCB3	5331	broad.mit.edu	37	11	64023072	64023072	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:64023072G>T	ENST00000540288.1	+	7	684	c.581G>T	c.(580-582)gGc>gTc	p.G194V	PLCB3_ENST00000279230.6_Missense_Mutation_p.G194V|PLCB3_ENST00000325234.5_Missense_Mutation_p.G127V	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	194					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						GAATCCTGTGGCCTCAAATTC	0.637																																							uc001nzb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(580-582)GGC>GTC		phospholipase C beta 3							67.0	69.0	68.0					11																	64023072		2201	4297	6498	SO:0001583	missense	5331				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr11:64023072G>T	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.581G>T	11.37:g.64023072G>T	ENSP00000443631:p.Gly194Val		Somatic				PLCB3_uc009ypg.1_Missense_Mutation_p.G194V|PLCB3_uc009yph.1_Missense_Mutation_p.G127V|PLCB3_uc009ypi.2_Missense_Mutation_p.G194V	p.G194V	NM_000932	NP_000923	WXS	Illumina HiSeq	Unspecified	Q01970	PLCB3_HUMAN			7	581	+			194					A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	c.581G>T	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	g	11.52	1.664356	0.29604	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.47528	0.84;0.84;0.84	5.1	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	M	0.80508	2.5	0.80722	D	1	D;P	0.89917	1.0;0.907	D;B	0.97110	1.0;0.436	T	0.73222	-0.4051	10	0.59425	D	0.04	.	13.8268	0.63354	0.0:0.0:0.8454:0.1546	.	127;194	G5E960;Q01970	.;PLCB3_HUMAN	V	194;194;127	ENSP00000279230:G194V;ENSP00000443631:G194V;ENSP00000324660:G127V	ENSP00000279230:G194V	G	+	2	0	PLCB3	63779648	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	3.709000	0.54853	1.134000	0.42165	-0.322000	0.08575	GGC		0.637	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1			50	83	1	0	2.48254e-18	0.00361	3.04655e-18	50	83				
PLCB3	5331	broad.mit.edu	37	11	64033811	64033811	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:64033811C>G	ENST00000540288.1	+	28	3394	c.3291C>G	c.(3289-3291)atC>atG	p.I1097M	PLCB3_ENST00000279230.6_Missense_Mutation_p.I1097M|PLCB3_ENST00000325234.5_Missense_Mutation_p.I1030M	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1097				REKKELQKILDRKRHNSISEAKMRDKHKKEA -> SWPSWP RSVRSSGRGSPRRSAGACWARCRRG (in Ref. 2; CAA85776). {ECO:0000305}.	inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						TGCAGAAGATCCTGGACAGAA	0.587																																							uc001nzb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(3289-3291)ATC>ATG		phospholipase C beta 3																																				SO:0001583	missense	5331				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr11:64033811C>G	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3291C>G	11.37:g.64033811C>G	ENSP00000443631:p.Ile1097Met		Somatic				PLCB3_uc009ypg.1_Missense_Mutation_p.I1097M|PLCB3_uc009yph.1_Missense_Mutation_p.I1030M|PLCB3_uc009ypi.2_Missense_Mutation_p.I1097M	p.I1097M	NM_000932	NP_000923	WXS	Illumina HiSeq	Unspecified	Q01970	PLCB3_HUMAN			28	3291	+			1097	REKKELQKILDRKRHNSISEAKMRDKHKKEA -> SWPSWP RSVRSSGRGSPRRSAGACWARCRRG (in Ref. 2; CAA85776).				A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	c.3291C>G	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.537841	0.45176	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.44083	0.93;0.93;0.93	5.17	-1.45	0.08828	PLC-beta, C-terminal (1);	0.635049	0.16112	N	0.229053	T	0.28101	0.0693	L	0.27053	0.805	0.38972	D	0.958763	P;B	0.43885	0.82;0.425	B;B	0.44315	0.446;0.324	T	0.13150	-1.0520	10	0.51188	T	0.08	.	5.8104	0.18463	0.1215:0.503:0.0:0.3755	.	1030;1097	G5E960;Q01970	.;PLCB3_HUMAN	M	1097;1097;1030	ENSP00000279230:I1097M;ENSP00000443631:I1097M;ENSP00000324660:I1030M	ENSP00000279230:I1097M	I	+	3	3	PLCB3	63790387	0.950000	0.32346	0.997000	0.53966	0.995000	0.86356	0.092000	0.15066	-0.057000	0.13199	0.555000	0.69702	ATC		0.587	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1			10	56	0	0	0	0.00245	0	10	56				
CATSPER1	117144	broad.mit.edu	37	11	65788969	65788969	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:65788969G>C	ENST00000312106.5	-	4	1826	c.1689C>G	c.(1687-1689)ctC>ctG	p.L563L		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	563					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						CCACTGACCTGAGCCTCCGCA	0.617																																							uc001ogt.2		NA																	0				ovary(2)	2						c.(1687-1689)CTC>CTG		sperm-associated cation channel 1							43.0	47.0	45.0					11																	65788969		2201	4296	6497	SO:0001819	synonymous_variant	117144				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding	g.chr11:65788969G>C	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1689C>G	11.37:g.65788969G>C			Somatic					p.L563L	NM_053054	NP_444282	WXS	Illumina HiSeq	Unspecified	Q8NEC5	CTSR1_HUMAN			4	1827	-			563			Cytoplasmic (Potential).		Q96P76	Silent	SNP	ENST00000312106.5	37	c.1689C>G	CCDS8127.1																																																																																				0.617	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		14	34	0	0	0	0.00499	0	14	34				
RBM14	10432	broad.mit.edu	37	11	66392840	66392840	+	Missense_Mutation	SNP	A	A	G	rs144272368		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:66392840A>G	ENST00000310137.4	+	2	1632	c.1493A>G	c.(1492-1494)tAt>tGt	p.Y498C	RBM14-RBM4_ENST00000500635.2_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM4_ENST00000514361.3_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron|RBM14_ENST00000409738.4_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	498	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						ACTGGCTCCTATGGTGCCGCA	0.622																																							uc001oit.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1492-1494)TAT>TGT		RNA binding motif protein 14		A	CYS/TYR,,,,	1,4397		0,1,2198	33.0	38.0	36.0		1493,,,,	4.6	1.0	11	dbSNP_134	36	0,8588		0,0,4294	no	missense,intron,intron,intron,intron	RBM14,RBM14-RBM4	NM_006328.3,NM_001198836.1,NM_001198837.1,NM_001198845.1,NM_001198846.1	194,,,,	0,1,6492	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging,,,,	498/670,,,,	66392840	1,12985	2199	4294	6493	SO:0001583	missense	10432				DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription cofactor activity	g.chr11:66392840A>G	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1493A>G	11.37:g.66392840A>G	ENSP00000311747:p.Tyr498Cys		Somatic				RBM14_uc009yrh.2_Intron|RBM14_uc009yri.2_Intron|RBM4_uc009yrj.2_Intron|RBM4_uc009yrk.2_Intron	p.Y498C	NM_006328	NP_006319	WXS	Illumina HiSeq	Unspecified	Q96PK6	RBM14_HUMAN			2	1632	+			498			Ala-rich.		B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	c.1493A>G	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	A	10.20	1.286113	0.23478	2.27E-4	0.0	ENSG00000239306	ENST00000310137	D	0.85411	-1.98	5.75	4.61	0.57282	.	0.277341	0.37261	N	0.002179	T	0.78104	0.4231	N	0.19112	0.55	0.80722	D	1	D	0.64830	0.994	P	0.47075	0.536	T	0.79027	-0.1971	10	0.72032	D	0.01	-0.4875	9.8573	0.41092	0.8276:0.1724:0.0:0.0	.	498	Q96PK6	RBM14_HUMAN	C	498	ENSP00000311747:Y498C	ENSP00000311747:Y498C	Y	+	2	0	RBM14	66149416	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	3.754000	0.55189	0.984000	0.38629	0.533000	0.62120	TAT		0.622	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328		14	46	0	0	0	0.004007	0	14	46				
LRP5	4041	broad.mit.edu	37	11	68193529	68193529	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:68193529G>T	ENST00000294304.7	+	16	3617	c.3511G>T	c.(3511-3513)Gac>Tac	p.D1171Y		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1171	Beta-propeller 4.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTACTGGATCGACCGCCAGCA	0.642																																							uc001ont.2		NA																	0				lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						c.(3511-3513)GAC>TAC		low density lipoprotein receptor-related protein							100.0	86.0	91.0					11																	68193529		2200	4294	6494	SO:0001583	missense	4041				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity	g.chr11:68193529G>T	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.3511G>T	11.37:g.68193529G>T	ENSP00000294304:p.Asp1171Tyr		Somatic				LRP5_uc009ysg.2_Missense_Mutation_p.D581Y	p.D1171Y	NM_002335	NP_002326	WXS	Illumina HiSeq	Unspecified	O75197	LRP5_HUMAN			16	3586	+			1171			LDL-receptor class B 20.|Beta-propeller 4.|Extracellular (Potential).		Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	c.3511G>T	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573449	0.86542	.	.	ENSG00000162337	ENST00000294304	D	0.92752	-3.1	4.53	4.53	0.55603	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.50627	U	0.000115	D	0.96929	0.8997	M	0.93507	3.425	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67900	0.954;0.954	D	0.98115	1.0422	10	0.87932	D	0	.	17.4974	0.87722	0.0:0.0:1.0:0.0	.	1171;1171	Q9UES7;O75197	.;LRP5_HUMAN	Y	1171	ENSP00000294304:D1171Y	ENSP00000294304:D1171Y	D	+	1	0	LRP5	67950105	1.000000	0.71417	0.956000	0.39512	0.968000	0.65278	9.003000	0.93577	2.383000	0.81215	0.555000	0.69702	GAC		0.642	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		52	124	1	0	3.7469e-33	0.00361	4.90529e-33	52	124				
ANO1	55107	broad.mit.edu	37	11	69950235	69950235	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:69950235T>A	ENST00000355303.5	+	4	976	c.671T>A	c.(670-672)tTc>tAc	p.F224Y	ANO1_ENST00000316296.5_Missense_Mutation_p.F196Y|ANO1_ENST00000398543.2_Missense_Mutation_p.F108Y|ANO1_ENST00000530676.1_Missense_Mutation_p.F108Y|ANO1_ENST00000538023.1_Missense_Mutation_p.F224Y	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	224					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	TCCTATCCCTTCTCCCGGGAG	0.522																																							uc001opj.2		NA																	0				ovary(1)|pancreas(1)	2						c.(670-672)TTC>TAC		anoctamin 1, calcium activated chloride channel							37.0	39.0	38.0					11																	69950235		1868	4100	5968	SO:0001583	missense	55107				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity	g.chr11:69950235T>A	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.671T>A	11.37:g.69950235T>A	ENSP00000347454:p.Phe224Tyr		Somatic				ANO1_uc001opk.1_Missense_Mutation_p.F196Y|ANO1_uc001opl.1_RNA	p.F224Y	NM_018043	NP_060513	WXS	Illumina HiSeq	Unspecified	Q5XXA6	ANO1_HUMAN			4	976	+			224			Cytoplasmic (Potential).		A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	c.671T>A	CCDS44663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.3|22.3	4.276754|4.276754	0.80580|0.80580	.|.	.|.	ENSG00000131620|ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000531604;ENST00000316296;ENST00000530676|ENST00000530480	T;T;T;T;T;T|.	0.70516|.	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69477|0.69477	0.3115|0.3115	L|L	0.60067|0.60067	1.865|1.865	0.58432|0.58432	D|D	0.999991|0.999991	D;D|.	0.76494|.	0.999;0.985|.	D;P|.	0.87578|.	0.998;0.728|.	T|T	0.68603|0.68603	-0.5365|-0.5365	9|5	.|.	.|.	.|.	.|.	14.363|14.363	0.66785|0.66785	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	196;224|.	Q5XXA6-3;Q5XXA6|.	.;ANO1_HUMAN|.	Y|T	224;224;108;8;191;196;108|67	ENSP00000347454:F224Y;ENSP00000444689:F224Y;ENSP00000381551:F108Y;ENSP00000436392:F191Y;ENSP00000319477:F196Y;ENSP00000435797:F108Y|.	.|.	F|S	+|+	2|1	0|0	ANO1|ANO1	69627883|69627883	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.669000|0.669000	0.39330|0.39330	6.997000|6.997000	0.76270|0.76270	1.992000|1.992000	0.58205|0.58205	0.528000|0.528000	0.53228|0.53228	TTC|TCT		0.522	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043		7	13	0	0	0	0.004482	0	7	13				
C2CD3	26005	broad.mit.edu	37	11	73801966	73801966	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:73801966C>A	ENST00000334126.7	-	20	3759	c.3533G>T	c.(3532-3534)gGc>gTc	p.G1178V	C2CD3_ENST00000313663.7_Missense_Mutation_p.G1178V			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1178	C2 1.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GTACCTTAGGCCCACATCCAG	0.488																																							uc001ouu.2		NA																	0				ovary(4)|pancreas(2)|skin(1)	7						c.(3532-3534)GGC>GTC		C2 calcium-dependent domain containing 3							88.0	70.0	76.0					11																	73801966		2200	4293	6493	SO:0001583	missense	26005					centrosome		g.chr11:73801966C>A	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.3533G>T	11.37:g.73801966C>A	ENSP00000334379:p.Gly1178Val		Somatic					p.G1178V	NM_015531	NP_056346	WXS	Illumina HiSeq	Unspecified	Q4AC94	C2CD3_HUMAN			20	3760	-	Breast(11;4.16e-06)		1178			C2 1.		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37	c.3533G>T		.	.	.	.	.	.	.	.	.	.	C	5.951	0.359534	0.11239	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.09255	3.0;3.01	5.58	3.69	0.42338	.	0.647170	0.16933	N	0.193568	T	0.06826	0.0174	N	0.08118	0	0.52099	D	0.999948	B	0.12630	0.006	B	0.12156	0.007	T	0.25328	-1.0135	10	0.48119	T	0.1	-4.2184	13.2833	0.60228	0.2699:0.7301:0.0:0.0	.	1178	Q4AC94-1	.	V	1178	ENSP00000334379:G1178V;ENSP00000323339:G1178V	ENSP00000323339:G1178V	G	-	2	0	C2CD3	73479614	1.000000	0.71417	0.733000	0.30861	0.001000	0.01503	2.541000	0.45735	0.702000	0.31825	-0.749000	0.03505	GGC		0.488	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		12	26	1	0	1.5842e-08	0.001855	1.75567e-08	12	26				
TYR	7299	broad.mit.edu	37	11	88911070	88911070	+	5'UTR	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:88911070C>A	ENST00000263321.5	+	0	451				TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase						cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	AAAGAGAAATCTGTGACTCCA	0.458																																							uc001pcs.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(-53--49)ATCTG>ATATG		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						34.0	33.0	33.0					11																	88911070		874	1990	2864	SO:0001623	5_prime_UTR_variant	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:88911070C>A	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.-52C>A	11.37:g.88911070C>A			Somatic						NM_000372	NP_000363	WXS	Illumina HiSeq	Unspecified	P14679	TYRO_HUMAN			1	31	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)						Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Translation_Start_Site	SNP	ENST00000263321.5	37	c.-51C>A	CCDS8284.1																																																																																				0.458	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		5	15	1	0	0.000602214	0.000602	0.000625938	5	15				
CNTN5	53942	broad.mit.edu	37	11	99690455	99690455	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:99690455C>G	ENST00000524871.1	+	4	526	c.236C>G	c.(235-237)cCc>cGc	p.P79R	CNTN5_ENST00000418526.2_Intron|CNTN5_ENST00000279463.3_Missense_Mutation_p.P79R|CNTN5_ENST00000528682.1_Missense_Mutation_p.P79R|CNTN5_ENST00000527185.1_Missense_Mutation_p.P79R	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	79					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TATTATTCCCCCATCAATCTT	0.428																																							uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(235-237)CCC>CGC		contactin 5 isoform long							59.0	58.0	58.0					11																	99690455		1883	4085	5968	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:99690455C>G	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.236C>G	11.37:g.99690455C>G	ENSP00000435637:p.Pro79Arg		Somatic				CNTN5_uc009ywv.1_Missense_Mutation_p.P79R|CNTN5_uc001pfz.2_Missense_Mutation_p.P79R|CNTN5_uc001pgb.2_Intron	p.P79R	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	4	575	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	79					A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.236C>G	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880337	0.33162	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000279463	T;T;T;T	0.57907	0.37;0.42;0.42;0.42	5.06	4.06	0.47325	.	0.463681	0.20212	N	0.096861	T	0.47544	0.1451	N	0.19112	0.55	0.30172	N	0.80123	P;P	0.45348	0.856;0.856	P;P	0.49301	0.606;0.483	T	0.49986	-0.8880	10	0.49607	T	0.09	.	14.8513	0.70297	0.0:0.8555:0.1445:0.0	.	79;79	E9PKE8;O94779	.;CNTN5_HUMAN	R	79	ENSP00000433575:P79R;ENSP00000436185:P79R;ENSP00000435637:P79R;ENSP00000279463:P79R	ENSP00000279463:P79R	P	+	2	0	CNTN5	99195665	0.707000	0.27866	0.375000	0.26029	0.571000	0.35966	3.520000	0.53465	2.735000	0.93741	0.650000	0.86243	CCC		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		6	12	0	0	0	0.001168	0	6	12				
TRPC6	7225	broad.mit.edu	37	11	101347075	101347075	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:101347075C>A	ENST00000344327.3	-	6	2125	c.1701G>T	c.(1699-1701)ttG>ttT	p.L567F	TRPC6_ENST00000348423.4_Missense_Mutation_p.L451F|TRPC6_ENST00000532133.1_Intron|TRPC6_ENST00000360497.4_Missense_Mutation_p.L512F	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	567					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TTACTTTCGTCAAGTCCTTCA	0.363																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1699-1701)TTG>TTT		transient receptor potential cation channel,							98.0	85.0	89.0					11																	101347075		2203	4299	6502	SO:0001583	missense	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101347075C>A	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1701G>T	11.37:g.101347075C>A	ENSP00000340913:p.Leu567Phe		Somatic				TRPC6_uc009ywy.2_Missense_Mutation_p.L451F|TRPC6_uc009ywz.1_Missense_Mutation_p.L512F	p.L567F	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	6	2126	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	567			Extracellular (Potential).		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	c.1701G>T	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812704	0.70912	.	.	ENSG00000137672	ENST00000344327;ENST00000348423;ENST00000360497	D;T;T	0.88896	-2.44;-1.18;-1.44	5.67	3.82	0.43975	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.92446	0.7602	M	0.63428	1.95	0.53688	D	0.999976	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.986;1.0	D	0.91990	0.5602	10	0.72032	D	0.01	-14.1489	10.7054	0.45952	0.0:0.7951:0.0:0.2049	.	512;451;567	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	F	567;451;512	ENSP00000340913:L567F;ENSP00000343672:L451F;ENSP00000353687:L512F	ENSP00000340913:L567F	L	-	3	2	TRPC6	100852285	0.947000	0.32204	1.000000	0.80357	0.943000	0.58893	0.844000	0.27654	0.871000	0.35750	0.643000	0.83706	TTG		0.363	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		16	48	1	0	8.28177e-16	0.007413	9.89773e-16	16	48				
DYNC2H1	79659	broad.mit.edu	37	11	103153800	103153800	+	Missense_Mutation	SNP	G	G	A	rs201852557	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:103153800G>A	ENST00000375735.2	+	73	11020	c.10876G>A	c.(10876-10878)Gtg>Atg	p.V3626M	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.V3633M|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3626					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAGCTGGGCCGTGGCAACATT	0.353													G|||	3	0.000599042	0.0008	0.0014	5008	,	,		15746	0.0		0.001	False		,,,				2504	0.0						uc001pho.2		NA																	0					0						c.(10876-10878)GTG>ATG		dynein, cytoplasmic 2, heavy chain 1		G	MET/VAL,MET/VAL	0,3734		0,0,1867	77.0	78.0	77.0		10897,10876	5.4	1.0	11		77	1,8185		0,1,4092	no	missense,missense	DYNC2H1	NM_001080463.1,NM_001377.2	21,21	0,1,5959	AA,AG,GG		0.0122,0.0,0.0084	possibly-damaging,possibly-damaging	3633/4315,3626/4308	103153800	1,11919	1867	4093	5960	SO:0001583	missense	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:103153800G>A	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10876G>A	11.37:g.103153800G>A	ENSP00000364887:p.Val3626Met		Somatic				DYNC2H1_uc001phn.1_Missense_Mutation_p.V3633M|DYNC2H1_uc009yxe.1_Intron	p.V3626M	NM_001080463	NP_001073932	WXS	Illumina HiSeq	Unspecified	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	73	11020	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	3626					O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	c.10876G>A	CCDS53701.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	20.3	3.958841	0.74016	0.0	1.22E-4	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.12255	2.7;2.7	5.44	5.44	0.79542	Dynein heavy chain (1);	0.354783	0.26542	N	0.023790	T	0.33206	0.0855	M	0.73217	2.22	0.49130	D	0.999759	D;D	0.63046	0.992;0.978	P;P	0.58660	0.843;0.757	T	0.01256	-1.1404	10	0.34782	T	0.22	.	18.0381	0.89311	0.0:0.0:1.0:0.0	.	3626;3633	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	M	3626;3633	ENSP00000364887:V3626M;ENSP00000381167:V3633M	ENSP00000364887:V3626M	V	+	1	0	DYNC2H1	102659010	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	4.886000	0.63149	2.551000	0.86045	0.460000	0.39030	GTG		0.353	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		9	24	0	0	0	0.008291	0	9	24				
SIK2	23235	broad.mit.edu	37	11	111592583	111592583	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:111592583C>T	ENST00000304987.3	+	13	2147	c.1974C>T	c.(1972-1974)gtC>gtT	p.V658V		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	658					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.V658V(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AGGAAAGCGTCTCCACTCTCC	0.567																																							uc001plt.2		NA																	1	Substitution - coding silent(1)		upper_aerodigestive_tract(1)	central_nervous_system(2)|skin(1)	3						c.(1972-1974)GTC>GTT		SNF1-like kinase 2							75.0	71.0	72.0					11																	111592583		2201	4297	6498	SO:0001819	synonymous_variant	23235				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:111592583C>T	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1974C>T	11.37:g.111592583C>T			Somatic					p.V658V	NM_015191	NP_056006	WXS	Illumina HiSeq	Unspecified	Q9H0K1	SIK2_HUMAN			13	2092	+			658					A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Silent	SNP	ENST00000304987.3	37	c.1974C>T	CCDS8347.1																																																																																				0.567	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191		28	42	0	0	0	0.004289	0	28	42				
PIH1D2	120379	broad.mit.edu	37	11	111941400	111941400	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:111941400G>C	ENST00000280350.4	-	5	795	c.573C>G	c.(571-573)agC>agG	p.S191R	PIH1D2_ENST00000431456.1_Missense_Mutation_p.S191R|PIH1D2_ENST00000521853.2_5'Flank|PIH1D2_ENST00000528775.1_Missense_Mutation_p.S191R|PIH1D2_ENST00000530641.1_Missense_Mutation_p.S191R|PIH1D2_ENST00000532211.1_Missense_Mutation_p.S191R	NM_138789.3	NP_620144.1	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2	191										endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		TCATAGTACTGCTTCGTATCT	0.363																																							uc001pmq.3		NA																	0				ovary(1)	1						c.(571-573)AGC>AGG		PIH1 domain containing 2 isoform 1							112.0	107.0	109.0					11																	111941400		2201	4297	6498	SO:0001583	missense	120379							g.chr11:111941400G>C	BC019238	CCDS8355.1, CCDS44730.1	11q23.1	2007-01-31			ENSG00000150773	ENSG00000150773			25210	protein-coding gene	gene with protein product						12477932	Standard	NM_138789		Approved		uc001pmp.4	Q8WWB5	OTTHUMG00000166925	ENST00000280350.4:c.573C>G	11.37:g.111941400G>C	ENSP00000280350:p.Ser191Arg		Somatic				PIH1D2_uc009yyl.2_Missense_Mutation_p.S191R|PIH1D2_uc001pmp.3_Missense_Mutation_p.S191R|PIH1D2_uc010rws.1_Missense_Mutation_p.S191R	p.S191R	NM_138789	NP_620144	WXS	Illumina HiSeq	Unspecified	Q8WWB5	PIHD2_HUMAN		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)	5	655	-		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	191					B4DU48|E9PD82	Missense_Mutation	SNP	ENST00000280350.4	37	c.573C>G	CCDS8355.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.82|12.82	2.053994|2.053994	0.36277|0.36277	.|.	.|.	ENSG00000150773|ENSG00000150773	ENST00000525072|ENST00000528775;ENST00000431456;ENST00000532211;ENST00000280350;ENST00000530641	.|T;T;T;T;T	.|0.18657	.|2.2;2.2;2.2;2.2;2.2	5.84|5.84	2.91|2.91	0.33838|0.33838	.|.	.|0.977123	.|0.08506	.|N	.|0.935668	T|T	0.28400|0.28400	0.0702|0.0702	M|M	0.74881|0.74881	2.28|2.28	0.23889|0.23889	N|N	0.996553|0.996553	.|P;P;P	.|0.38617	.|0.64;0.64;0.515	.|B;B;B	.|0.40636	.|0.334;0.334;0.335	T|T	0.21381|0.21381	-1.0247|-1.0247	5|10	.|0.20519	.|T	.|0.43	-4.4044|-4.4044	10.0597|10.0597	0.42266|0.42266	0.2241:0.0:0.7759:0.0|0.2241:0.0:0.7759:0.0	.|.	.|191;191;191	.|B4DU48;E9PD82;Q8WWB5	.|.;.;PIHD2_HUMAN	E|R	147|191	.|ENSP00000434275:S191R;ENSP00000388209:S191R;ENSP00000431841:S191R;ENSP00000280350:S191R;ENSP00000431147:S191R	.|ENSP00000280350:S191R	Q|S	-|-	1|3	0|2	PIH1D2|PIH1D2	111446610|111446610	0.005000|0.005000	0.15991|0.15991	0.540000|0.540000	0.28089|0.28089	0.650000|0.650000	0.38633|0.38633	-0.203000|-0.203000	0.09438|0.09438	0.356000|0.356000	0.24157|0.24157	0.655000|0.655000	0.94253|0.94253	CAG|AGC		0.363	PIH1D2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391916.1	NM_138789		4	75	0	0	0	0.001168	0	4	75				
TTC12	54970	broad.mit.edu	37	11	113194080	113194080	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:113194080G>C	ENST00000529221.1	+	3	234	c.129G>C	c.(127-129)aaG>aaC	p.K43N	TTC12_ENST00000314756.3_Missense_Mutation_p.K43N|TTC12_ENST00000393020.1_Missense_Mutation_p.K43N|TTC12_ENST00000483239.2_Missense_Mutation_p.K43N	NM_017868.3	NP_060338.3	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	43										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		AGACAGAAAAGAGACTACTGC	0.433																																							uc001pnu.2		NA																	0				pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(127-129)AAG>AAC		tetratricopeptide repeat domain 12							147.0	138.0	141.0					11																	113194080		2201	4296	6497	SO:0001583	missense	54970						binding	g.chr11:113194080G>C	AK000542	CCDS8360.2	11q23.2	2013-01-10			ENSG00000149292	ENSG00000149292		"""Tetratricopeptide (TTC) repeat domain containing"""	23700	protein-coding gene	gene with protein product		610732				12964006	Standard	XM_005271607		Approved	FLJ13859, FLJ20535, TPARM	uc001pnu.3	Q9H892	OTTHUMG00000142832	ENST00000529221.1:c.129G>C	11.37:g.113194080G>C	ENSP00000433757:p.Lys43Asn		Somatic				TTC12_uc001pnv.2_Missense_Mutation_p.K43N|TTC12_uc001pnw.2_RNA|TTC12_uc001pnx.2_5'UTR	p.K43N	NM_017868	NP_060338	WXS	Illumina HiSeq	Unspecified	Q9H892	TTC12_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)	3	234	+		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)	43					Q8N5H9|Q9NWY3	Missense_Mutation	SNP	ENST00000529221.1	37	c.129G>C	CCDS8360.2	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095235	0.36952	.	.	ENSG00000149292	ENST00000529221;ENST00000429951;ENST00000442859;ENST00000531164;ENST00000529850;ENST00000314756;ENST00000525965;ENST00000393020;ENST00000455306;ENST00000483239	T;T;T;T;T;T;T;T;T;T	0.48836	2.43;0.8;1.48;1.47;0.88;2.41;0.88;2.41;1.47;2.43	5.23	3.01	0.34805	Armadillo-type fold (1);	2.526690	0.00932	N	0.002739	T	0.41834	0.1176	L	0.43152	1.355	0.29755	N	0.835998	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.29971	-0.9994	10	0.37606	T	0.19	-16.2205	5.0334	0.14421	0.1973:0.1682:0.6345:0.0	.	43;43	A8K8G6;Q9H892	.;TTC12_HUMAN	N	43;43;43;18;43;43;43;43;43;43	ENSP00000433757:K43N;ENSP00000413335:K43N;ENSP00000400039:K43N;ENSP00000433916:K18N;ENSP00000431806:K43N;ENSP00000315160:K43N;ENSP00000435308:K43N;ENSP00000376743:K43N;ENSP00000402004:K43N;ENSP00000419652:K43N	ENSP00000315160:K43N	K	+	3	2	TTC12	112699290	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	0.901000	0.28445	1.411000	0.46957	0.655000	0.94253	AAG		0.433	TTC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286455.2	NM_017868		37	68	0	0	0	0.005524	0	37	68				
APOA1	335	broad.mit.edu	37	11	116707841	116707841	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:116707841C>T	ENST00000236850.4	-	3	441	c.76G>A	c.(76-78)Gaa>Aaa	p.E26K	AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375320.1_Missense_Mutation_p.E26K|APOA1_ENST00000375329.2_Intron|APOA1_ENST00000375323.1_Missense_Mutation_p.E26K|APOA1_ENST00000359492.2_Missense_Mutation_p.E26K	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	26					adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		TGGGGGGGTTCATCTTGCTGC	0.602																																							uc001ppu.1		NA																	0					0						c.(76-78)GAA>AAA		apolipoprotein A-I preproprotein							58.0	65.0	63.0					11																	116707841		2201	4296	6497	SO:0001583	missense	335				Cdc42 protein signal transduction|cholesterol efflux|cholesterol homeostasis|cholesterol import|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|negative regulation of cytokine secretion involved in immune response|negative regulation of interleukin-1 beta secretion|negative regulation of very-low-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|phospholipid efflux|platelet activation|platelet degranulation|positive regulation of cholesterol esterification|positive regulation of hydrolase activity|protein stabilization|reverse cholesterol transport	endocytic vesicle|endoplasmic reticulum lumen|plasma membrane|spherical high-density lipoprotein particle|stored secretory granule|very-low-density lipoprotein particle	apolipoprotein A-I receptor binding|beta-amyloid binding|cholesterol binding|cholesterol transporter activity|enzyme binding|high-density lipoprotein particle receptor binding|identical protein binding|phosphatidylcholine-sterol O-acyltransferase activator activity|phospholipid binding	g.chr11:116707841C>T	X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.76G>A	11.37:g.116707841C>T	ENSP00000236850:p.Glu26Lys		Somatic				APOA1_uc001ppv.1_Missense_Mutation_p.E26K	p.E26K	NM_000039	NP_000030	WXS	Illumina HiSeq	Unspecified	P02647	APOA1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)	3	155	-	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)	26					A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	ENST00000236850.4	37	c.76G>A	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686341	0.88639	.	.	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375323;ENST00000236850	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	4.76	4.76	0.60689	.	0.126244	0.33023	U	0.005375	D	0.82499	0.5050	M	0.88570	2.965	0.52099	D	0.999943	D	0.64830	0.994	P	0.58820	0.846	D	0.85975	0.1479	10	0.52906	T	0.07	-7.8055	17.769	0.88486	0.0:1.0:0.0:0.0	.	26	P02647	APOA1_HUMAN	K	26	ENSP00000364469:E26K;ENSP00000352471:E26K;ENSP00000364472:E26K;ENSP00000236850:E26K	ENSP00000236850:E26K	E	-	1	0	APOA1	116213051	1.000000	0.71417	0.990000	0.47175	0.617000	0.37484	3.509000	0.53386	2.192000	0.70111	0.462000	0.41574	GAA		0.602	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106281.2	NM_000039		21	74	0	0	0	0.010504	0	21	74				
HYOU1	10525	broad.mit.edu	37	11	118926253	118926253	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:118926253C>G	ENST00000404233.3	-	4	340	c.216G>C	c.(214-216)gtG>gtC	p.V72V	HYOU1_ENST00000525859.1_Silent_p.V72V|HYOU1_ENST00000543287.1_5'UTR|HYOU1_ENST00000529972.1_Silent_p.V72V	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	72					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CTTTCAGGGTCACGATCACCG	0.532																																							uc001puu.2		NA																	0					0						c.(214-216)GTG>GTC		hypoxia up-regulated 1 precursor							106.0	105.0	105.0					11																	118926253		2200	4295	6495	SO:0001819	synonymous_variant	10525					endoplasmic reticulum lumen	ATP binding|protein binding	g.chr11:118926253C>G	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.216G>C	11.37:g.118926253C>G			Somatic				HYOU1_uc001put.2_Silent_p.V37V|HYOU1_uc010ryu.1_Silent_p.V92V|HYOU1_uc010ryv.1_Intron|HYOU1_uc001pux.3_Silent_p.V72V|HYOU1_uc010ryw.1_RNA|HYOU1_uc001puw.1_Silent_p.V72V	p.V72V	NM_006389	NP_006380	WXS	Illumina HiSeq	Unspecified	Q9Y4L1	HYOU1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)	4	409	-	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)	72					A8C1Z0|B7Z909|Q2I204|Q53H25	Silent	SNP	ENST00000404233.3	37	c.216G>C	CCDS8408.1																																																																																				0.532	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389		20	81	0	0	0	0.003954	0	20	81				
TRIM29	23650	broad.mit.edu	37	11	119989012	119989012	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:119989012C>A	ENST00000341846.5	-	7	1967	c.1546G>T	c.(1546-1548)Gtc>Ttc	p.V516F	TRIM29_ENST00000529044.1_Missense_Mutation_p.V255F|TRIM29_ENST00000524816.3_Missense_Mutation_p.V82F|TRIM29_ENST00000541857.1_Missense_Mutation_p.V249F|TRIM29_ENST00000528870.1_Missense_Mutation_p.V49F|TRIM29_ENST00000525887.1_5'UTR	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	516					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		TACTCCCAGACCCGGGAGGTG	0.602																																							uc001pwz.2		NA																	0				ovary(1)|breast(1)|kidney(1)|skin(1)	4						c.(1546-1548)GTC>TTC		tripartite motif protein TRIM29							105.0	87.0	93.0					11																	119989012		2199	4295	6494	SO:0001583	missense	23650				transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr11:119989012C>A	AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1546G>T	11.37:g.119989012C>A	ENSP00000343129:p.Val516Phe		Somatic				TRIM29_uc001pwx.2_RNA|TRIM29_uc001pwy.2_Missense_Mutation_p.V49F|TRIM29_uc010rzi.1_Missense_Mutation_p.V255F|TRIM29_uc010rzj.1_Missense_Mutation_p.V249F|TRIM29_uc001pxa.2_RNA	p.V516F	NM_012101	NP_036233	WXS	Illumina HiSeq	Unspecified	Q14134	TRI29_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)	7	1670	-		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	516					Q96AA9|Q9BZY7	Missense_Mutation	SNP	ENST00000341846.5	37	c.1546G>T	CCDS8428.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.93|17.93	3.510056|3.510056	0.64522|0.64522	.|.	.|.	ENSG00000137699|ENSG00000137699	ENST00000525327;ENST00000524956|ENST00000341846;ENST00000541857;ENST00000533302;ENST00000524816;ENST00000528870;ENST00000529044;ENST00000526881	.|T	.|0.41065	.|1.01	4.53|4.53	4.53|4.53	0.55603|0.55603	.|.	.|0.249000	.|0.27100	.|N	.|0.020925	T|T	0.36331|0.36331	0.0963|0.0963	N|N	0.24115|0.24115	0.695|0.695	0.39149|0.39149	D|D	0.962191|0.962191	.|P;P;B	.|0.48016	.|0.904;0.904;0.257	.|P;P;B	.|0.48921	.|0.595;0.595;0.08	T|T	0.16482|0.16482	-1.0401|-1.0401	5|9	.|.	.|.	.|.	.|.	12.7847|12.7847	0.57498|0.57498	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|249;255;516	.|B7Z8U9;E9PRL4;Q14134	.|.;.;TRI29_HUMAN	V|F	108;53|516;249;64;82;49;255;51	.|ENSP00000343129:V516F	.|.	G|V	-|-	2|1	0|0	TRIM29|TRIM29	119494222|119494222	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.867000|0.867000	0.49689|0.49689	3.826000|3.826000	0.55738|0.55738	2.064000|2.064000	0.61679|0.61679	0.407000|0.407000	0.27541|0.27541	GGT|GTC		0.602	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	NM_012101		20	29	1	0	7.41877e-09	0.001882	8.24843e-09	20	29				
TMEM225	338661	broad.mit.edu	37	11	123753962	123753962	+	Silent	SNP	A	A	G	rs148160664		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:123753962A>G	ENST00000375026.2	-	4	777	c.561T>C	c.(559-561)tcT>tcC	p.S187S		NM_001013743.1	NP_001013765.1	Q6GV28	TM225_HUMAN	transmembrane protein 225	187					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	28						TATCTTCGATAGAATTCTCAG	0.433																																							uc001pzi.2		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						c.(559-561)TCT>TCC		transmembrane protein 225		A		0,4404		0,0,2202	130.0	121.0	124.0		561	-7.5	0.0	11	dbSNP_134	124	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	TMEM225	NM_001013743.1		0,1,6500	GG,GA,AA		0.0116,0.0,0.0077		187/226	123753962	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	338661					integral to membrane		g.chr11:123753962A>G	AY634366	CCDS31697.1	11q24.1	2014-06-13			ENSG00000204300	ENSG00000204300			32390	protein-coding gene	gene with protein product	"""PMP22 claudin domain containing"", ""protein phosphatase 1, regulatory subunit 154"""						Standard	XM_006718832		Approved	PMP22CD, PPP1R154	uc001pzi.3	Q6GV28	OTTHUMG00000165959	ENST00000375026.2:c.561T>C	11.37:g.123753962A>G			Somatic					p.S187S	NM_001013743	NP_001013765	WXS	Illumina HiSeq	Unspecified	Q6GV28	TM225_HUMAN			4	769	-			187						Silent	SNP	ENST00000375026.2	37	c.561T>C	CCDS31697.1																																																																																				0.433	TMEM225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387260.1	NM_001013743		6	38	0	0	0	0.003163	0	6	38				
Unknown	0	broad.mit.edu	37	11	124096005	124096006	+	IGR	DNP	CC	CC	AA			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:124096005_124096006CC>AA								OR10D3 (39053 upstream) : OR8G1 (24416 downstream)																							CTCTCCTGCTCCAGCACCTACA	0.421																																							uc010saf.1		NA																	0					0						c.(607-609)TCC>TAA		olfactory receptor, family 8, subfamily G,																																				SO:0001628	intergenic_variant	26492					integral to membrane	olfactory receptor activity	g.chr11:124096005_124096006CC>AA																													11.37:g.124096005_124096006delinsAA			Somatic					p.S203*	NM_001007249	NP_001007250	WXS	Illumina HiSeq	Unspecified	Q15614	OR8G2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.91e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)	1	608_609	+		Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	203						Nonsense_Mutation	DNP		37	c.608_609CC>AA																																																																																				0	0.421									41	78	0	0	0	0.004672	0	41	78				
OR8B8	26493	broad.mit.edu	37	11	124310488	124310488	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:124310488C>T	ENST00000328064.2	-	1	566	c.494G>A	c.(493-495)gGt>gAt	p.G165D		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	165					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GAAGGTCACACCCATCATGCA	0.512																																							uc010sal.1		NA																	0		p.G165R(1)		ovary(1)	1						c.(493-495)GGT>GAT		olfactory receptor, family 8, subfamily B,							149.0	123.0	132.0					11																	124310488		2201	4299	6500	SO:0001583	missense	26493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124310488C>T	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.494G>A	11.37:g.124310488C>T	ENSP00000330280:p.Gly165Asp		Somatic					p.G165D	NM_012378	NP_036510	WXS	Illumina HiSeq	Unspecified	Q15620	OR8B8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	494	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	165			Extracellular (Potential).		A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	c.494G>A	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	C	5.232	0.228344	0.09916	.	.	ENSG00000197125	ENST00000328064	T	0.00063	8.78	3.52	-0.592	0.11671	GPCR, rhodopsin-like superfamily (1);	0.647619	0.14163	N	0.337224	T	0.00073	0.0002	N	0.12527	0.23	0.09310	N	1	B	0.19935	0.04	B	0.29440	0.102	T	0.19451	-1.0305	10	0.87932	D	0	.	4.6827	0.12743	0.0:0.396:0.1986:0.4054	.	165	Q15620	OR8B8_HUMAN	D	165	ENSP00000330280:G165D	ENSP00000330280:G165D	G	-	2	0	OR8B8	123815698	0.000000	0.05858	0.012000	0.15200	0.254000	0.26022	-2.690000	0.00831	-0.105000	0.12132	0.557000	0.71058	GGT		0.512	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378		11	35	0	0	0	0.008291	0	11	35				
ST14	6768	broad.mit.edu	37	11	130064080	130064080	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr11:130064080C>T	ENST00000278742.5	+	8	1330	c.912C>T	c.(910-912)acC>acT	p.T304T		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	304	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	ACAACCTGACCTTCCACTCCT	0.577																																							uc001qfw.2		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(910-912)ACC>ACT		matriptase	Urokinase(DB00013)						139.0	121.0	127.0					11																	130064080		2201	4297	6498	SO:0001819	synonymous_variant	6768				proteolysis	integral to plasma membrane	serine-type endopeptidase activity	g.chr11:130064080C>T	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.912C>T	11.37:g.130064080C>T			Somatic				ST14_uc010sca.1_Silent_p.T114T	p.T304T	NM_021978	NP_068813	WXS	Illumina HiSeq	Unspecified	Q9Y5Y6	ST14_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	8	1105	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	304			Extracellular (Potential).|CUB 1.		Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Silent	SNP	ENST00000278742.5	37	c.912C>T	CCDS8487.1																																																																																				0.577	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1			78	159	0	0	0	0.00361	0	78	159				
CACNA2D4	93589	broad.mit.edu	37	12	1910245	1910245	+	Silent	SNP	C	C	T	rs375441882		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:1910245C>T	ENST00000382722.5	-	31	3194	c.2832G>A	c.(2830-2832)tcG>tcA	p.S944S	CACNA2D4_ENST00000538450.1_Silent_p.S74S|CACNA2D4_ENST00000588077.1_Silent_p.S880S|CACNA2D4_ENST00000587995.1_Silent_p.S919S|CACNA2D4_ENST00000585708.1_Silent_p.S880S|CACNA2D4_ENST00000538027.2_Silent_p.S89S|CACNA2D4_ENST00000586184.1_Silent_p.S944S	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	944					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GGTGGTGACTCGAGGGTTTGC	0.607											OREG0021569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(2;101 179 21030 23310 28141)	Colon(2;101 179 21030 23310 28141)	uc001qjp.2		NA																	0				ovary(1)	1						c.(2830-2832)TCG>TCA		voltage-gated calcium channel alpha(2)delta-4		C		1,4401	2.1+/-5.4	0,1,2200	96.0	114.0	108.0		2832	-10.8	0.0	12		108	0,8598		0,0,4299	no	coding-synonymous	CACNA2D4	NM_172364.4		0,1,6499	TT,TC,CC		0.0,0.0227,0.0077		944/1138	1910245	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	93589					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr12:1910245C>T	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2832G>A	12.37:g.1910245C>T			Somatic	OREG0021569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	599	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc001qjo.2_Silent_p.S89S|CACNA2D4_uc001qjs.1_Silent_p.S11S|CACNA2D4_uc010sdw.1_Silent_p.S74S|CACNA2D4_uc009zdr.1_RNA	p.S944S	NM_172364	NP_758952	WXS	Illumina HiSeq	Unspecified	Q7Z3S7	CA2D4_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)	31	3063	-	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	944			Extracellular (Potential).		Q7Z3S8|Q86XZ5|Q8IZS9	Silent	SNP	ENST00000382722.5	37	c.2832G>A	CCDS44785.1																																																																																				0.607	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2			35	84	0	0	0	0.003214	0	35	84				
TPI1	7167	broad.mit.edu	37	12	6978853	6978853	+	Splice_Site	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:6978853T>C	ENST00000229270.4	+	5	907	c.570T>C	c.(568-570)gaT>gaC	p.D190D	TPI1_ENST00000488464.2_Splice_Site_p.D71D|TPI1_ENST00000396705.5_Splice_Site_p.D153D|TPI1_ENST00000535434.1_Splice_Site_p.D71D	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	190					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)			endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						GCCCTGCAGATAACGTGAAGG	0.577											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qrk.2		NA																	0					0						c.(457-459)GAT>GAC		triosephosphate isomerase 1 isoform 1							121.0	118.0	119.0					12																	6978853		2203	4300	6503	SO:0001630	splice_region_variant	7167				fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity	g.chr12:6978853T>C		CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.569-1T>C	12.37:g.6978853T>C			Somatic	OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	638	TPI1_uc010sfo.1_Silent_p.D71D	p.D153D	NM_000365	NP_000356	WXS	Illumina HiSeq	Unspecified	P60174	TPIS_HUMAN			5	497	+			153					B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Silent	SNP	ENST00000229270.4	37	c.459T>C	CCDS53740.1																																																																																				0.577	TPI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258252.1	NM_000365	Silent	63	128	0	0	0	0.00361	0	63	128				
LRRC23	10233	broad.mit.edu	37	12	7015087	7015087	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:7015087C>G	ENST00000007969.8	+	3	425	c.205C>G	c.(205-207)Cat>Gat	p.H69D	LRRC23_ENST00000449039.1_Intron|LRRC23_ENST00000443597.2_Missense_Mutation_p.H69D|LRRC23_ENST00000436789.1_Missense_Mutation_p.H69D|LRRC23_ENST00000429740.1_Missense_Mutation_p.H69D|LRRC23_ENST00000323702.5_Missense_Mutation_p.H69D|LRRC23_ENST00000433346.1_Missense_Mutation_p.H69D	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	69										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						TGGGCTGGCTCATGCTTATGT	0.542																																							uc001qrt.3		NA																	0				ovary(1)	1						c.(205-207)CAT>GAT		leucine rich repeat containing 23 isoform a							101.0	92.0	95.0					12																	7015087		2203	4300	6503	SO:0001583	missense	10233							g.chr12:7015087C>G	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.205C>G	12.37:g.7015087C>G	ENSP00000007969:p.His69Asp		Somatic				LRRC23_uc001qrn.1_Missense_Mutation_p.H69D|LRRC23_uc009zfg.2_Intron|LRRC23_uc001qrp.2_Missense_Mutation_p.H69D|LRRC23_uc001qrq.2_Missense_Mutation_p.H69D|LRRC23_uc001qrr.2_Intron|LRRC23_uc001qrs.2_Intron|LRRC23_uc009zfh.2_Missense_Mutation_p.H69D	p.H69D	NM_001135217	NP_001128689	WXS	Illumina HiSeq	Unspecified	Q53EV4	LRC23_HUMAN			3	597	+			69					A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	c.205C>G	CCDS8569.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484809	0.84854	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000415834;ENST00000436789;ENST00000429740	T;T;T;T;T;T;T	0.68331	1.82;-0.0;-0.32;-0.0;0.42;1.84;1.34	5.51	5.51	0.81932	.	.	.	.	.	T	0.81964	0.4934	M	0.73962	2.25	0.53005	D	0.999964	D;D;D;D	0.89917	0.994;1.0;0.999;0.999	D;D;D;D	0.76575	0.946;0.988;0.925;0.925	T	0.81182	-0.1049	9	0.42905	T	0.14	-21.2879	19.0027	0.92839	0.0:1.0:0.0:0.0	.	69;69;69;69	E9PDZ4;Q53EV4-2;Q53EV4;C9JKE8	.;.;LRC23_HUMAN;.	D	69	ENSP00000402554:H69D;ENSP00000007969:H69D;ENSP00000317464:H69D;ENSP00000390932:H69D;ENSP00000408066:H69D;ENSP00000396049:H69D;ENSP00000397192:H69D	ENSP00000007969:H69D	H	+	1	0	LRRC23	6885348	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	4.996000	0.63914	2.590000	0.87494	0.561000	0.74099	CAT		0.542	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992		23	55	0	0	0	0.00632	0	23	55				
ACSM4	341392	broad.mit.edu	37	12	7480967	7480967	+	Nonstop_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:7480967T>C	ENST00000399422.4	+	13	1789	c.1741T>C	c.(1741-1743)Tag>Cag	p.*581Q		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	0					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						GAGAGGAAGATAGTTTGATAA	0.348																																							uc001qsx.1		NA																	0					0						c.(1741-1743)TAG>CAG		acyl-CoA synthetase medium-chain family member 4							73.0	65.0	67.0					12																	7480967		1837	4094	5931	SO:0001578	stop_lost	341392				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding	g.chr12:7480967T>C		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1741T>C	12.37:g.7480967T>C	ENSP00000382349:p.*581Glnext*17		Somatic					p.*581Q	NM_001080454	NP_001073923	WXS	Illumina HiSeq	Unspecified	P0C7M7	ACSM4_HUMAN			13	1741	+			581					A8MTI6	Nonstop_Mutation	SNP	ENST00000399422.4	37	c.1741T>C	CCDS44825.1	.	.	.	.	.	.	.	.	.	.	T	5.076	0.199608	0.09652	.	.	ENSG00000215009	ENST00000399422	.	.	.	2.73	2.73	0.32206	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2477	0.37536	0.0:0.0:0.0:1.0	.	.	.	.	Q	581	.	.	X	+	1	0	ACSM4	7372234	0.652000	0.27349	0.024000	0.17045	0.083000	0.17756	1.181000	0.32017	1.500000	0.48636	0.533000	0.62120	TAG		0.348	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454		5	8	0	0	0	0.001168	0	5	8				
C3AR1	719	broad.mit.edu	37	12	8211415	8211415	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:8211415G>C	ENST00000307637.4	-	2	1570	c.1367C>G	c.(1366-1368)gCa>gGa	p.A456G		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	456					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		ACTGAAGGCTGCCTCCAGAAT	0.458																																							uc001qtv.1		NA																	0				ovary(1)	1						c.(1366-1368)GCA>GGA		complement component 3a receptor 1							106.0	100.0	102.0					12																	8211415		2203	4300	6503	SO:0001583	missense	719				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity	g.chr12:8211415G>C	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.1367C>G	12.37:g.8211415G>C	ENSP00000302079:p.Ala456Gly		Somatic					p.A456G	NM_004054	NP_004045	WXS	Illumina HiSeq	Unspecified	Q16581	C3AR_HUMAN		Kidney(36;0.0893)	2	1459	-			456			Cytoplasmic (Potential).		O43771|Q92868	Missense_Mutation	SNP	ENST00000307637.4	37	c.1367C>G	CCDS8588.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777219	0.31411	.	.	ENSG00000171860	ENST00000307637	T	0.72615	-0.67	5.26	4.36	0.52297	.	0.425026	0.19526	N	0.112159	T	0.61110	0.2321	L	0.39898	1.24	0.29678	N	0.841921	P	0.46395	0.877	P	0.45829	0.494	T	0.55224	-0.8174	10	0.16420	T	0.52	.	7.6026	0.28085	0.0873:0.1649:0.7478:0.0	.	456	Q16581	C3AR_HUMAN	G	456	ENSP00000302079:A456G	ENSP00000302079:A456G	A	-	2	0	C3AR1	8102682	0.000000	0.05858	0.998000	0.56505	0.923000	0.55619	0.414000	0.21164	1.436000	0.47453	0.655000	0.94253	GCA		0.458	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1			28	44	0	0	0	0.008361	0	28	44				
KLRD1	3824	broad.mit.edu	37	12	10462274	10462274	+	Silent	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:10462274A>T	ENST00000381907.4	+	4	352	c.150A>T	c.(148-150)atA>atT	p.I50I	KLRD1_ENST00000543777.1_Intron|KLRD1_ENST00000350274.5_Silent_p.I19I|KLRD1_ENST00000336164.4_Silent_p.I50I|KLRD1_ENST00000381908.3_Silent_p.I50I|KLRD1_ENST00000538997.1_3'UTR|KLRD1_ENST00000543420.1_Silent_p.I50I	NM_001114396.1	NP_001107868	Q13241	KLRD1_HUMAN	killer cell lectin-like receptor subfamily D, member 1	50					cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	10						GACCCAACATAGAACTCCAGA	0.333																																							uc001qxw.3		NA																	0					0						c.(148-150)ATA>ATT		killer cell lectin-like receptor subfamily D,							46.0	46.0	46.0					12																	10462274		2203	4297	6500	SO:0001819	synonymous_variant	3824				cell surface receptor linked signaling pathway|regulation of immune response	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity	g.chr12:10462274A>T	U30610	CCDS8621.1, CCDS8622.1	12p13	2009-12-03						"""Killer cell lectin-like receptors"", ""CD molecules"""	6378	protein-coding gene	gene with protein product		602894		CD94		7589107	Standard	NM_002262		Approved		uc001qxx.4	Q13241		ENST00000381907.4:c.150A>T	12.37:g.10462274A>T			Somatic				KLRD1_uc001qxx.3_Silent_p.I50I|KLRD1_uc001qxy.3_Silent_p.I19I|KLRD1_uc009zhh.2_Intron|KLRD1_uc009zhi.2_Silent_p.I50I|KLRD1_uc001qxz.3_Silent_p.I50I	p.I50I	NM_001114396	NP_001107868	WXS	Illumina HiSeq	Unspecified	Q13241	KLRD1_HUMAN			4	347	+			50			Extracellular (Potential).		O43321|O43773|Q9UBE3|Q9UEQ0	Silent	SNP	ENST00000381907.4	37	c.150A>T	CCDS8621.1																																																																																				0.333	KLRD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399684.2	NM_002262		18	12	0	0	0	0.005443	0	18	12				
PDE3A	5139	broad.mit.edu	37	12	20522876	20522876	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:20522876G>C	ENST00000359062.3	+	1	698	c.658G>C	c.(658-660)Gcg>Ccg	p.A220P	RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	220					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CTTGACTAGCGCGGTCAGGAC	0.657																																							uc001reh.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(658-660)GCG>CCG		phosphodiesterase 3A	Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)						33.0	36.0	35.0					12																	20522876		2202	4300	6502	SO:0001583	missense	5139				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:20522876G>C		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.658G>C	12.37:g.20522876G>C	ENSP00000351957:p.Ala220Pro		Somatic					p.A220P	NM_000921	NP_000912	WXS	Illumina HiSeq	Unspecified	Q14432	PDE3A_HUMAN			1	680	+	Esophageal squamous(101;0.125)	Breast(259;0.134)	220			Helical; (Potential).		O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	c.658G>C	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481506	0.63849	.	.	ENSG00000172572	ENST00000359062	T	0.63096	-0.02	4.45	4.45	0.53987	.	.	.	.	.	T	0.61664	0.2365	L	0.29908	0.895	0.26209	N	0.979337	D	0.54964	0.969	P	0.52672	0.706	T	0.55792	-0.8085	9	0.59425	D	0.04	.	13.0648	0.59028	0.0:0.1617:0.8383:0.0	.	220	Q14432	PDE3A_HUMAN	P	220	ENSP00000351957:A220P	ENSP00000351957:A220P	A	+	1	0	PDE3A	20414143	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.223000	0.51231	2.460000	0.83146	0.555000	0.69702	GCG		0.657	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			15	27	0	0	0	0.00499	0	15	27				
SLCO1C1	53919	broad.mit.edu	37	12	20885847	20885847	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:20885847C>T	ENST00000266509.2	+	10	1559	c.1191C>T	c.(1189-1191)ctC>ctT	p.L397L	SLCO1C1_ENST00000540354.1_Silent_p.L348L|SLCO1C1_ENST00000381552.1_Silent_p.L397L|SLCO1C1_ENST00000545604.1_Silent_p.L397L|SLCO1C1_ENST00000545102.1_Silent_p.L279L	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	397					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TCTCAGGGCTCATCAACATTC	0.353																																							uc001rej.3		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(1189-1191)CTC>CTT		solute carrier organic anion transporter family,							73.0	72.0	72.0					12																	20885847		2203	4300	6503	SO:0001819	synonymous_variant	53919				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr12:20885847C>T	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1191C>T	12.37:g.20885847C>T			Somatic				SLCO1C1_uc010sii.1_Silent_p.L397L|SLCO1C1_uc010sij.1_Silent_p.L348L|SLCO1C1_uc009zip.2_Silent_p.L231L|SLCO1C1_uc001rei.2_Silent_p.L397L|SLCO1C1_uc010sik.1_Silent_p.L279L	p.L397L	NM_017435	NP_059131	WXS	Illumina HiSeq	Unspecified	Q9NYB5	SO1C1_HUMAN			11	1546	+	Esophageal squamous(101;0.149)		397			Helical; Name=8; (Potential).		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Silent	SNP	ENST00000266509.2	37	c.1191C>T	CCDS8683.1																																																																																				0.353	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		24	17	0	0	0	0.007291	0	24	17				
C2CD5	9847	broad.mit.edu	37	12	22646262	22646262	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:22646262T>A	ENST00000333957.4	-	11	1412	c.1157A>T	c.(1156-1158)gAa>gTa	p.E386V	C2CD5_ENST00000446597.1_Missense_Mutation_p.E386V|C2CD5_ENST00000536386.1_Missense_Mutation_p.E388V|C2CD5_ENST00000544930.1_Missense_Mutation_p.E201V|C2CD5_ENST00000542676.1_Missense_Mutation_p.E386V|C2CD5_ENST00000545552.1_Missense_Mutation_p.E399V|C2CD5_ENST00000396028.2_Missense_Mutation_p.E377V	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	386					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										ATCTCGAGTTTCTGGTTCATC	0.328																																							uc001rfq.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						c.(1156-1158)GAA>GTA		hypothetical protein LOC9847							195.0	173.0	180.0					12																	22646262		2203	4300	6503	SO:0001583	missense	9847						protein binding	g.chr12:22646262T>A	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.1157A>T	12.37:g.22646262T>A	ENSP00000334229:p.Glu386Val		Somatic				KIAA0528_uc010sir.1_Missense_Mutation_p.E201V|KIAA0528_uc010sis.1_Missense_Mutation_p.E386V|KIAA0528_uc010sit.1_Missense_Mutation_p.E388V|KIAA0528_uc010siu.1_Missense_Mutation_p.E386V|KIAA0528_uc001rfr.2_Missense_Mutation_p.E377V|KIAA0528_uc009ziy.1_Missense_Mutation_p.E388V	p.E386V	NM_014802	NP_055617	WXS	Illumina HiSeq	Unspecified	Q86YS7	K0528_HUMAN			11	1385	-			386					B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	37	c.1157A>T	CCDS31758.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.153023|5.153023	0.94645|0.94645	.|.	.|.	ENSG00000111731|ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930|ENST00000535555	T;T;T;T;T;T;T|.	0.55930|.	0.49;0.49;0.49;0.49;0.49;0.49;0.49|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74329|0.74329	0.3702|0.3702	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	B;B;B;B;B;D|.	0.59767|.	0.01;0.037;0.003;0.009;0.003;0.986|.	B;B;B;B;B;P|.	0.56343|.	0.05;0.023;0.007;0.023;0.007;0.796|.	T|T	0.74910|0.74910	-0.3503|-0.3503	10|5	0.87932|.	D|.	0|.	-21.1315|-21.1315	14.5538|14.5538	0.68086|0.68086	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	388;386;201;388;377;386|.	F5H2A1;B4DRN7;F5H3N1;B7ZLL0;Q86YS7-2;Q86YS7|.	.;.;.;.;.;K0528_HUMAN|.	V|S	386;386;388;377;386;399;201|83	ENSP00000334229:E386V;ENSP00000388756:E386V;ENSP00000439392:E388V;ENSP00000379345:E377V;ENSP00000441951:E386V;ENSP00000443204:E399V;ENSP00000445288:E201V|.	ENSP00000334229:E386V|.	E|R	-|-	2|3	0|2	KIAA0528|KIAA0528	22537529|22537529	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.895000|7.895000	0.87343|0.87343	2.176000|2.176000	0.68965|0.68965	0.477000|0.477000	0.44152|0.44152	GAA|AGA		0.328	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802		34	45	0	0	0	0.005524	0	34	45				
C12orf71	728858	broad.mit.edu	37	12	27234319	27234319	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:27234319C>T	ENST00000429849.2	-	2	628	c.598G>A	c.(598-600)Gac>Aac	p.D200N		NM_001080406.1	NP_001073875.1	A8MTZ7	CL071_HUMAN	chromosome 12 open reading frame 71	200										endometrium(2)|large_intestine(1)|lung(4)|skin(1)	8						GAAGGAGTGTCATCCTTCTCT	0.562																																							uc001rhq.2		NA																	0					0						c.(598-600)GAC>AAC		hypothetical protein LOC728858							152.0	142.0	146.0					12																	27234319		2108	4238	6346	SO:0001583	missense	728858							g.chr12:27234319C>T		CCDS44851.1	12p11.23	2008-07-25			ENSG00000214700	ENSG00000214700			34452	protein-coding gene	gene with protein product							Standard	NM_001080406		Approved	LOC728858	uc001rhq.3	A8MTZ7	OTTHUMG00000169274	ENST00000429849.2:c.598G>A	12.37:g.27234319C>T	ENSP00000413728:p.Asp200Asn		Somatic					p.D200N	NM_001080406	NP_001073875	WXS	Illumina HiSeq	Unspecified	A8MTZ7	CL071_HUMAN			2	637	-			200						Missense_Mutation	SNP	ENST00000429849.2	37	c.598G>A	CCDS44851.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535386	0.45176	.	.	ENSG00000214700	ENST00000398815;ENST00000429849	T	0.49432	0.78	2.03	2.03	0.26663	.	.	.	.	.	T	0.41834	0.1176	L	0.29908	0.895	0.09310	N	1	D	0.61080	0.989	P	0.50231	0.635	T	0.21280	-1.0250	9	0.72032	D	0.01	.	7.5786	0.27950	0.0:1.0:0.0:0.0	.	200	A8MTZ7	CL071_HUMAN	N	232;200	ENSP00000413728:D200N	ENSP00000381796:D232N	D	-	1	0	C12orf71	27125586	0.000000	0.05858	0.164000	0.22755	0.090000	0.18270	0.459000	0.21908	1.455000	0.47813	0.407000	0.27541	GAC		0.562	C12orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403258.1	NM_001080406		38	34	0	0	0	0.006999	0	38	34				
CNTN1	1272	broad.mit.edu	37	12	41353010	41353010	+	Missense_Mutation	SNP	C	C	T	rs267603460		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:41353010C>T	ENST00000551295.2	+	15	1895	c.1778C>T	c.(1777-1779)tCa>tTa	p.S593L	CNTN1_ENST00000547702.1_Missense_Mutation_p.S593L|CNTN1_ENST00000547849.1_Missense_Mutation_p.S593L|CNTN1_ENST00000347616.1_Missense_Mutation_p.S593L|CNTN1_ENST00000360099.3_Missense_Mutation_p.S593L|CNTN1_ENST00000348761.2_Missense_Mutation_p.S582L	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	593	Ig-like C2-type 6.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GACAATTCTTCAGCTTCAGCT	0.383																																							uc001rmm.1		NA																	0				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(1777-1779)TCA>TTA		contactin 1 isoform 1 precursor							105.0	96.0	99.0					12																	41353010		2203	4300	6503	SO:0001583	missense	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41353010C>T	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1778C>T	12.37:g.41353010C>T	ENSP00000447006:p.Ser593Leu		Somatic				CNTN1_uc009zjy.1_Missense_Mutation_p.S593L|CNTN1_uc001rmn.1_Missense_Mutation_p.S582L|CNTN1_uc001rmo.2_Missense_Mutation_p.S593L	p.S593L	NM_001843	NP_001834	WXS	Illumina HiSeq	Unspecified	Q12860	CNTN1_HUMAN			15	1891	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	593			Ig-like C2-type 6.		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	c.1778C>T	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831527	0.71258	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48	5.3	5.3	0.74995	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.147964	0.47455	D	0.000228	T	0.49115	0.1538	M	0.83118	2.625	0.46981	D	0.999275	P;P;P	0.42871	0.749;0.753;0.792	B;B;P	0.46419	0.341;0.381;0.516	T	0.50329	-0.8841	10	0.42905	T	0.14	.	19.852	0.96744	0.0:1.0:0.0:0.0	.	593;582;593	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	L	593;593;593;593;593;582	ENSP00000448004:S593L;ENSP00000447006:S593L;ENSP00000448653:S593L;ENSP00000325660:S593L;ENSP00000353213:S593L;ENSP00000261160:S582L	ENSP00000325660:S593L	S	+	2	0	CNTN1	39639277	0.985000	0.35326	0.993000	0.49108	0.998000	0.95712	4.187000	0.58344	2.861000	0.98227	0.655000	0.94253	TCA		0.383	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		16	36	0	0	0	0.00499	0	16	36				
ARID2	196528	broad.mit.edu	37	12	46245869	46245869	+	Silent	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:46245869A>T	ENST00000334344.6	+	15	4135	c.3963A>T	c.(3961-3963)ctA>ctT	p.L1321L	ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Silent_p.L931L|ARID2_ENST00000422737.1_Silent_p.L1172L	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1321					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AGTGCTCACTAATCAGTAATG	0.393			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					0				ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(3961-3963)CTA>CTT		AT rich interactive domain 2 (ARID, RFX-like)							57.0	55.0	55.0					12																	46245869		2203	4300	6503	SO:0001819	synonymous_variant	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46245869A>T		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3963A>T	12.37:g.46245869A>T			Somatic				ARID2_uc001ror.2_Silent_p.L1321L|ARID2_uc009zkg.1_Silent_p.L777L|ARID2_uc009zkh.1_Silent_p.L948L|ARID2_uc001rou.1_Silent_p.L655L	p.L1321L	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	15	3963	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	1321					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	37	c.3963A>T	CCDS31783.1																																																																																				0.393	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		15	57	0	0	0	0.010504	0	15	57				
SMARCD1	6602	broad.mit.edu	37	12	50483734	50483734	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:50483734T>A	ENST00000394963.4	+	7	1237	c.839T>A	c.(838-840)gTa>gAa	p.V280E	SMARCD1_ENST00000548573.1_Missense_Mutation_p.V78E|SMARCD1_ENST00000381513.4_Missense_Mutation_p.V280E	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						GACGTGAATGTACGGTGTACT	0.557																																							uc001rvx.3		NA																	0				ovary(1)	1						c.(838-840)GTA>GAA		SWI/SNF-related matrix-associated							251.0	217.0	229.0					12																	50483734		2203	4300	6503	SO:0001583	missense	6602				chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity	g.chr12:50483734T>A	U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.839T>A	12.37:g.50483734T>A	ENSP00000378414:p.Val280Glu		Somatic				SMARCD1_uc001rvy.3_Missense_Mutation_p.V280E|SMARCD1_uc009zlp.2_Missense_Mutation_p.V239E	p.V280E	NM_003076	NP_003067	WXS	Illumina HiSeq	Unspecified	Q96GM5	SMRD1_HUMAN			7	1009	+			280			Necessary for GR/NR3C1-mediated remodeling and transcription from chromatin; required for GR/NR3C1 interaction with the BRG1/SMARCA4 complex in vivo.|Interaction with SMARCC1 and SMARCC2.			Missense_Mutation	SNP	ENST00000394963.4	37	c.839T>A	CCDS8797.2	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816363	0.90790	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000551966;ENST00000550477;ENST00000542914;ENST00000548573	T;T	0.53423	0.63;0.62	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.74465	0.3720	M	0.89715	3.055	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.994;0.996;0.986	T	0.80607	-0.1307	10	0.87932	D	0	-6.522	15.7617	0.78087	0.0:0.0:0.0:1.0	.	78;280;280	F8VRQ4;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	E	280;280;239;200;56;78	ENSP00000378414:V280E;ENSP00000370924:V280E	ENSP00000370924:V280E	V	+	2	0	SMARCD1	48770001	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.868000	0.87116	2.371000	0.80710	0.533000	0.62120	GTA		0.557	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076		25	56	0	0	0	0.002836	0	25	56				
SLC4A8	9498	broad.mit.edu	37	12	51865142	51865142	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:51865142T>C	ENST00000453097.2	+	14	1947	c.1730T>C	c.(1729-1731)cTt>cCt	p.L577P	SLC4A8_ENST00000535225.2_Missense_Mutation_p.L524P|SLC4A8_ENST00000514353.3_Missense_Mutation_p.L524P|SLC4A8_ENST00000358657.3_Missense_Mutation_p.L604P|SLC4A8_ENST00000546663.1_3'UTR|SLC4A8_ENST00000394856.1_Missense_Mutation_p.L524P	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TGTATTGTCCTTGTGGCAACT	0.438																																							uc001rys.1		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(1729-1731)CTT>CCT		solute carrier family 4, sodium bicarbonate							296.0	239.0	259.0					12																	51865142		2203	4300	6503	SO:0001583	missense	9498				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity	g.chr12:51865142T>C	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1730T>C	12.37:g.51865142T>C	ENSP00000405812:p.Leu577Pro		Somatic				SLC4A8_uc010sni.1_Missense_Mutation_p.L524P|SLC4A8_uc001rym.2_Missense_Mutation_p.L524P|SLC4A8_uc001ryn.2_Missense_Mutation_p.L524P|SLC4A8_uc001ryo.2_Missense_Mutation_p.L524P|SLC4A8_uc010snj.1_Missense_Mutation_p.L604P|SLC4A8_uc001ryq.3_Missense_Mutation_p.L577P|SLC4A8_uc001ryr.2_Missense_Mutation_p.L577P|SLC4A8_uc010snk.1_Missense_Mutation_p.L524P	p.L577P	NM_001039960	NP_001035049	WXS	Illumina HiSeq	Unspecified	Q2Y0W8	S4A8_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.15)	14	1908	+			577			Helical; (Potential).			Missense_Mutation	SNP	ENST00000453097.2	37	c.1730T>C	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	T	17.19	3.327202	0.60743	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	5.33	5.33	0.75918	Bicarbonate transporter, C-terminal (1);	0.061402	0.64402	N	0.000003	D	0.93112	0.7807	M	0.93854	3.465	0.80722	D	1	D;B;B;B;B;B	0.89917	1.0;0.189;0.106;0.14;0.022;0.301	D;B;B;B;B;B	0.91635	0.999;0.136;0.106;0.247;0.299;0.386	D	0.94732	0.7910	10	0.87932	D	0	.	14.5815	0.68295	0.0:0.0:0.0:1.0	.	524;604;524;577;577;577	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	P	524;604;577;524;577;524;524	ENSP00000441520:L524P;ENSP00000351483:L604P;ENSP00000405812:L577P;ENSP00000378325:L524P;ENSP00000442561:L524P	ENSP00000315789:L577P	L	+	2	0	SLC4A8	50151409	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.040000	0.89188	2.147000	0.66899	0.460000	0.39030	CTT		0.438	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858		40	77	0	0	0	0.00623	0	40	77				
SLC4A8	9498	broad.mit.edu	37	12	51865208	51865208	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:51865208C>T	ENST00000453097.2	+	14	2013	c.1796C>T	c.(1795-1797)tCc>tTc	p.S599F	SLC4A8_ENST00000535225.2_Missense_Mutation_p.S546F|SLC4A8_ENST00000514353.3_Missense_Mutation_p.S546F|SLC4A8_ENST00000358657.3_Missense_Mutation_p.S626F|SLC4A8_ENST00000546663.1_3'UTR|SLC4A8_ENST00000394856.1_Missense_Mutation_p.S546F	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		GCATTTGCCTCCCTAATTTGC	0.468																																							uc001rys.1		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(1795-1797)TCC>TTC		solute carrier family 4, sodium bicarbonate							194.0	172.0	180.0					12																	51865208		2203	4300	6503	SO:0001583	missense	9498				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity	g.chr12:51865208C>T	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1796C>T	12.37:g.51865208C>T	ENSP00000405812:p.Ser599Phe		Somatic				SLC4A8_uc010sni.1_Missense_Mutation_p.S546F|SLC4A8_uc001rym.2_Missense_Mutation_p.S546F|SLC4A8_uc001ryn.2_Missense_Mutation_p.S546F|SLC4A8_uc001ryo.2_Missense_Mutation_p.S546F|SLC4A8_uc010snj.1_Missense_Mutation_p.S626F|SLC4A8_uc001ryq.3_Missense_Mutation_p.S599F|SLC4A8_uc001ryr.2_Missense_Mutation_p.S599F|SLC4A8_uc010snk.1_Missense_Mutation_p.S546F	p.S599F	NM_001039960	NP_001035049	WXS	Illumina HiSeq	Unspecified	Q2Y0W8	S4A8_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.15)	14	1974	+			599			Helical; (Potential).			Missense_Mutation	SNP	ENST00000453097.2	37	c.1796C>T	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622508	0.87460	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.33	5.33	0.75918	Bicarbonate transporter, C-terminal (1);	0.160303	0.56097	D	0.000029	T	0.81588	0.4854	L	0.28740	0.885	0.58432	D	0.999993	D;B;P;P;P;P	0.65815	0.995;0.098;0.917;0.869;0.478;0.946	D;B;P;P;P;P	0.63283	0.913;0.06;0.789;0.797;0.789;0.847	D	0.83731	0.0198	10	0.87932	D	0	.	18.1668	0.89731	0.0:1.0:0.0:0.0	.	546;626;546;599;599;599	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	F	546;626;599;546;599;546;546	ENSP00000441520:S546F;ENSP00000351483:S626F;ENSP00000405812:S599F;ENSP00000378325:S546F;ENSP00000442561:S546F	ENSP00000315789:S599F	S	+	2	0	SLC4A8	50151475	0.995000	0.38212	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.658000	0.90341	0.563000	0.77884	TCC		0.468	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858		24	83	0	0	0	0.004656	0	24	83				
KRT75	9119	broad.mit.edu	37	12	52827669	52827670	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:52827669_52827670GG>TT	ENST00000252245.5	-	1	639_640	c.419_420CC>AA	c.(418-420)cCC>cAA	p.P140Q		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	140	Head.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		GCTGGATGGTGGGGTCGATTTG	0.599																																							uc001saj.2		NA																	0					0						c.(418-420)CCC>CAA		keratin 75																																				SO:0001583	missense	9119					keratin filament	structural molecule activity	g.chr12:52827669_52827670GG>TT	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.419_420delinsTT	12.37:g.52827669_52827670delinsTT	ENSP00000252245:p.Pro140Gln		Somatic					p.P140Q	NM_004693	NP_004684	WXS	Illumina HiSeq	Unspecified	O95678	K2C75_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.192)	1	441_442	-			140			Head.		B4DQU4|Q9NSA9	Missense_Mutation	DNP	ENST00000252245.5	37	c.419_420CC>AA	CCDS8827.1																																																																																				0.599	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693		42	113	0	0	0	0.004672	0	42	113				
KRT3	3850	broad.mit.edu	37	12	53189278	53189278	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:53189278G>T	ENST00000417996.2	-	1	623	c.549C>A	c.(547-549)ctC>ctA	p.L183L	KRT3_ENST00000309505.3_Silent_p.L183L	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	183	Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						TCTCCACATTGAGGGGCTGCA	0.562																																							uc001say.2		NA																	0					0						c.(547-549)CTC>CTA		keratin 3							74.0	97.0	89.0					12																	53189278		2203	4300	6503	SO:0001819	synonymous_variant	3850				epithelial cell differentiation|intermediate filament cytoskeleton organization	keratin filament	structural molecule activity	g.chr12:53189278G>T		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.549C>A	12.37:g.53189278G>T			Somatic					p.L183L	NM_057088	NP_476429	WXS	Illumina HiSeq	Unspecified	P12035	K2C3_HUMAN			1	615	-			183			Head.		A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	37	c.549C>A	CCDS44895.1																																																																																				0.562	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088		19	35	1	0	5.35267e-07	0.007413	5.78257e-07	19	35				
SP1	6667	broad.mit.edu	37	12	53776438	53776438	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:53776438T>C	ENST00000327443.4	+	3	805	c.707T>C	c.(706-708)gTc>gCc	p.V236A	SP1_ENST00000426431.2_Missense_Mutation_p.V229A	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	236	Transactivation domain A (Gln-rich).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		CAGCAGGCTGTCCCCCTCCAA	0.488																																							uc001scw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(706-708)GTC>GCC		Sp1 transcription factor isoform a							116.0	105.0	108.0					12																	53776438		2203	4300	6503	SO:0001583	missense	6667				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:53776438T>C	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.707T>C	12.37:g.53776438T>C	ENSP00000329357:p.Val236Ala		Somatic				SP1_uc010sog.1_Missense_Mutation_p.V229A	p.V236A	NM_138473	NP_612482	WXS	Illumina HiSeq	Unspecified	P08047	SP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.00527)	3	804	+			236			Transactivation domain A (Gln-rich).		E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	c.707T>C	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.523819	0.64747	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.10288	2.92;2.89	4.39	4.39	0.52855	.	0.000000	0.51477	D	0.000097	T	0.12902	0.0313	L	0.54323	1.7	0.47698	D	0.999496	P	0.46656	0.882	B	0.40534	0.332	T	0.02471	-1.1154	10	0.66056	D	0.02	.	13.0416	0.58901	0.0:0.0:0.0:1.0	.	236	P08047	SP1_HUMAN	A	236;229	ENSP00000329357:V236A;ENSP00000404263:V229A	ENSP00000329357:V236A	V	+	2	0	SP1	52062705	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.396000	0.79891	1.988000	0.58038	0.383000	0.25322	GTC		0.488	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1			3	136	0	0	0	0.009096	0	3	136				
MAP3K12	7786	broad.mit.edu	37	12	53875980	53875980	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:53875980C>G	ENST00000267079.2	-	14	2451	c.2226G>C	c.(2224-2226)ctG>ctC	p.L742L	MAP3K12_ENST00000547488.1_Silent_p.L775L|MAP3K12_ENST00000547035.1_Silent_p.L775L	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	742					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GGCGCATGTTCAGGCTCTGAG	0.498											OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001sdm.1		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(2224-2226)CTG>CTC		mitogen-activated protein kinase kinase kinase							208.0	184.0	192.0					12																	53875980		2203	4300	6503	SO:0001819	synonymous_variant	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53875980C>G	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.2226G>C	12.37:g.53875980C>G			Somatic	OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	996	MAP3K12_uc001sdn.1_Silent_p.L775L	p.L742L	NM_006301	NP_006292	WXS	Illumina HiSeq	Unspecified	Q12852	M3K12_HUMAN			14	2324	-			742					B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Silent	SNP	ENST00000267079.2	37	c.2226G>C	CCDS8860.1																																																																																				0.498	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		64	126	0	0	0	0.00361	0	64	126				
PPP1R1A	5502	broad.mit.edu	37	12	54975868	54975868	+	Missense_Mutation	SNP	C	C	T	rs369965740		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:54975868C>T	ENST00000257905.8	-	5	465	c.295G>A	c.(295-297)Gag>Aag	p.E99K	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	99					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						TCAGGTTCCTCTCCTTGCTGC	0.597																																							uc001sgg.2		NA																	0					0						c.(295-297)GAG>AAG		protein phosphatase 1, regulatory (inhibitor)							50.0	52.0	52.0					12																	54975868		1911	4129	6040	SO:0001583	missense	5502				glycogen metabolic process|signal transduction		protein binding|protein serine/threonine phosphatase inhibitor activity	g.chr12:54975868C>T	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.295G>A	12.37:g.54975868C>T	ENSP00000257905:p.Glu99Lys		Somatic					p.E99K	NM_006741	NP_006732	WXS	Illumina HiSeq	Unspecified	Q13522	PPR1A_HUMAN			5	466	-			99					Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	ENST00000257905.8	37	c.295G>A	CCDS44912.1	.	.	.	.	.	.	.	.	.	.	C	32	5.132121	0.94473	.	.	ENSG00000135447	ENST00000257905	T	0.35605	1.3	5.07	5.07	0.68467	.	0.374318	0.25762	N	0.028476	T	0.56337	0.1978	M	0.70595	2.14	0.37437	D	0.914286	D	0.65815	0.995	D	0.65140	0.932	T	0.61554	-0.7039	10	0.44086	T	0.13	.	14.3199	0.66479	0.0:1.0:0.0:0.0	.	99	Q13522	PPR1A_HUMAN	K	99	ENSP00000257905:E99K	ENSP00000257905:E99K	E	-	1	0	PPP1R1A	53262135	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.484000	0.60271	2.519000	0.84933	0.655000	0.94253	GAG		0.597	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406604.1	NM_006741		10	32	0	0	0	0.000978	0	10	32				
ANKRD52	283373	broad.mit.edu	37	12	56638527	56638527	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:56638527C>T	ENST00000267116.7	-	24	2752	c.2631G>A	c.(2629-2631)ctG>ctA	p.L877L	ANKRD52_ENST00000548241.1_5'Flank	NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	877										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						GATGCTGCAGCAGCATCCGGA	0.597																																							uc001skm.3		NA																	0				ovary(2)	2						c.(2629-2631)CTG>CTA		ankyrin repeat domain 52							55.0	58.0	57.0					12																	56638527		2171	4261	6432	SO:0001819	synonymous_variant	283373						protein binding	g.chr12:56638527C>T	AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.2631G>A	12.37:g.56638527C>T			Somatic					p.L877L	NM_173595	NP_775866	WXS	Illumina HiSeq	Unspecified	Q8NB46	ANR52_HUMAN			24	2721	-			877			ANK 25.		A6NE79|B1Q2K2	Silent	SNP	ENST00000267116.7	37	c.2631G>A	CCDS44920.1																																																																																				0.597	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595		20	56	0	0	0	0.002299	0	20	56				
GLS2	27165	broad.mit.edu	37	12	56872853	56872853	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:56872853C>T	ENST00000311966.4	-	4	795	c.517G>A	c.(517-519)Gag>Aag	p.E173K	GLS2_ENST00000476991.1_5'Flank|GLS2_ENST00000539272.1_Intron	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	173					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CCAGTGAGCTCTTTGACATCC	0.473																																							uc001slj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(517-519)GAG>AAG		glutaminase 2 precursor	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						108.0	106.0	107.0					12																	56872853		2203	4300	6503	SO:0001583	missense	27165				cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding	g.chr12:56872853C>T		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.517G>A	12.37:g.56872853C>T	ENSP00000310447:p.Glu173Lys		Somatic				GLS2_uc009zos.2_RNA|GLS2_uc001slk.2_Intron|GLS2_uc009zot.2_Intron	p.E173K	NM_013267	NP_037399	WXS	Illumina HiSeq	Unspecified	Q9UI32	GLSL_HUMAN			4	796	-			173					B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	ENST00000311966.4	37	c.517G>A	CCDS8921.1	.	.	.	.	.	.	.	.	.	.	C	6.519	0.463983	0.12402	.	.	ENSG00000135423	ENST00000311966	T	0.41065	1.01	4.75	3.84	0.44239	Beta-lactamase/transpeptidase-like (1);	0.650919	0.17281	N	0.180020	T	0.24044	0.0582	N	0.17474	0.49	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.04915	-1.0918	10	0.06099	T	0.92	-27.5639	12.4739	0.55801	0.0:0.8309:0.1691:0.0	.	173	Q9UI32	GLSL_HUMAN	K	173	ENSP00000310447:E173K	ENSP00000310447:E173K	E	-	1	0	GLS2	55159120	0.966000	0.33281	1.000000	0.80357	0.999000	0.98932	1.667000	0.37471	1.348000	0.45733	0.655000	0.94253	GAG		0.473	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267		50	97	0	0	0	0.00361	0	50	97				
NAB2	4665	broad.mit.edu	37	12	57485106	57485106	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:57485106C>T	ENST00000300131.3	+	2	660	c.282C>T	c.(280-282)ctC>ctT	p.L94L	NAB2_ENST00000342556.6_Silent_p.L94L|NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000357680.4_Silent_p.L94L	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	94	NCD1.				cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CCAAGCCCCTCCATGTCCGGC	0.622																																							uc001smz.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(280-282)CTC>CTT		NGFI-A binding protein 2							76.0	85.0	82.0					12																	57485106		2203	4300	6503	SO:0001819	synonymous_variant	4665				cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity	g.chr12:57485106C>T	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.282C>T	12.37:g.57485106C>T			Somatic					p.L94L	NM_005967	NP_005958	WXS	Illumina HiSeq	Unspecified	Q15742	NAB2_HUMAN			2	660	+			94			NCD1.		B2RAK3|O76006|Q14797	Silent	SNP	ENST00000300131.3	37	c.282C>T	CCDS8930.1																																																																																				0.622	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967		56	95	0	0	0	0.00361	0	56	95				
LRP1	4035	broad.mit.edu	37	12	57559724	57559724	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:57559724C>G	ENST00000243077.3	+	16	3133	c.2667C>G	c.(2665-2667)ctC>ctG	p.L889L		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	889	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCCCAGCCCTCTGCCGTGAGT	0.647																																							uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(2665-2667)CTC>CTG		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						68.0	55.0	59.0					12																	57559724		2203	4300	6503	SO:0001819	synonymous_variant	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57559724C>G	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2667C>G	12.37:g.57559724C>G			Somatic				LRP1_uc009zph.1_5'Flank|LRP1_uc009zpi.1_5'Flank	p.L889L	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	16	3133	+			889			LDL-receptor class A 3.|Extracellular (Potential).		Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	c.2667C>G	CCDS8932.1																																																																																				0.647	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		23	42	0	0	0	0.007291	0	23	42				
LRP1	4035	broad.mit.edu	37	12	57572344	57572344	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:57572344C>T	ENST00000243077.3	+	27	5030	c.4564C>T	c.(4564-4566)Ccc>Tcc	p.P1522S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1522					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CAACACCCAGCCCTTTGACCT	0.622																																							uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(4564-4566)CCC>TCC		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						90.0	91.0	90.0					12																	57572344		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57572344C>T	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.4564C>T	12.37:g.57572344C>T	ENSP00000243077:p.Pro1522Ser		Somatic					p.P1522S	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	27	5030	+			1522			LDL-receptor class B 12.|Extracellular (Potential).		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.4564C>T	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001099	0.74818	.	.	ENSG00000123384	ENST00000243077	D	0.93076	-3.16	4.5	4.5	0.54988	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.97028	0.9029	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97211	0.9871	10	0.52906	T	0.07	.	16.4915	0.84202	0.0:1.0:0.0:0.0	.	1522	Q07954	LRP1_HUMAN	S	1522	ENSP00000243077:P1522S	ENSP00000243077:P1522S	P	+	1	0	LRP1	55858611	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.609000	0.82925	2.503000	0.84419	0.561000	0.74099	CCC		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		55	128	0	0	0	0.00361	0	55	128				
GRIP1	23426	broad.mit.edu	37	12	66765480	66765480	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:66765480C>T	ENST00000398016.3	-	22	2918	c.2850G>A	c.(2848-2850)ctG>ctA	p.L950L	GRIP1_ENST00000359742.4_Silent_p.L1002L|GRIP1_ENST00000286445.7_Silent_p.L987L	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TGACCTTGTGCAGCTCCACAG	0.468																																							uc001stk.2		NA																	0				ovary(2)	2						c.(2848-2850)CTG>CTA		glutamate receptor interacting protein 1							130.0	134.0	133.0					12																	66765480		1958	4160	6118	SO:0001819	synonymous_variant	23426				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity	g.chr12:66765480C>T	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2850G>A	12.37:g.66765480C>T			Somatic				GRIP1_uc010sta.1_Silent_p.L894L|GRIP1_uc001stj.2_Silent_p.L717L|GRIP1_uc001stl.1_Silent_p.L827L|GRIP1_uc001stm.2_Silent_p.L935L	p.L950L	NM_021150	NP_066973	WXS	Illumina HiSeq	Unspecified	Q9Y3R0	GRIP1_HUMAN	GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)	22	3091	-			1002					B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	ENST00000398016.3	37	c.2850G>A	CCDS41807.1	.	.	.	.	.	.	.	.	.	.	C	4.180	0.032014	0.08101	.	.	ENSG00000155974	ENST00000538164	.	.	.	6.13	2.22	0.28083	.	.	.	.	.	T	0.44912	0.1316	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25328	-1.0135	4	.	.	.	-10.6288	2.3324	0.04239	0.1245:0.488:0.1211:0.2665	.	.	.	.	Y	802	.	.	C	-	2	0	GRIP1	65051747	0.994000	0.37717	0.999000	0.59377	0.605000	0.37080	0.297000	0.19101	0.147000	0.19030	0.650000	0.86243	TGC		0.468	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2			30	80	0	0	0	0.008361	0	30	80				
RAB21	23011	broad.mit.edu	37	12	72167776	72167776	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:72167776G>T	ENST00000261263.3	+	4	621	c.365G>T	c.(364-366)gGa>gTa	p.G122V		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	122					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						AAAATGTTGGGAAATGAAATC	0.289																																							uc001swt.2		NA																	0					0						c.(364-366)GGA>GTA		RAB21, member RAS oncogene family							74.0	79.0	78.0					12																	72167776		2203	4293	6496	SO:0001583	missense	23011				protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding	g.chr12:72167776G>T	AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	ENST00000261263.3:c.365G>T	12.37:g.72167776G>T	ENSP00000261263:p.Gly122Val		Somatic					p.G122V	NM_014999	NP_055814	WXS	Illumina HiSeq	Unspecified	Q9UL25	RAB21_HUMAN			4	617	+			122					Q14466|Q569H3	Missense_Mutation	SNP	ENST00000261263.3	37	c.365G>T	CCDS9003.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982401	0.93044	.	.	ENSG00000080371	ENST00000261263	T	0.77098	-1.07	5.79	5.79	0.91817	Small GTP-binding protein domain (1);	0.047302	0.85682	D	0.000000	D	0.86314	0.5903	L	0.52011	1.625	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86433	0.1762	10	0.72032	D	0.01	-1.6952	20.0498	0.97621	0.0:0.0:1.0:0.0	.	122	Q9UL25	RAB21_HUMAN	V	122	ENSP00000261263:G122V	ENSP00000261263:G122V	G	+	2	0	RAB21	70454043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.177000	0.94849	2.753000	0.94483	0.557000	0.71058	GGA		0.289	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404855.1			18	56	1	0	2.39556e-15	0.00278	2.84811e-15	18	56				
E2F7	144455	broad.mit.edu	37	12	77426850	77426850	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:77426850C>T	ENST00000322886.7	-	9	1597	c.1362G>A	c.(1360-1362)caG>caA	p.Q454Q	E2F7_ENST00000416496.2_Silent_p.Q454Q	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	454					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CTTCTATTTTCTGTCTATAGA	0.373																																							uc001sym.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(1360-1362)CAG>CAA		E2F transcription factor 7							85.0	88.0	87.0					12																	77426850		2203	4300	6503	SO:0001819	synonymous_variant	144455				cell cycle	transcription factor complex	DNA binding|identical protein binding	g.chr12:77426850C>T	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1362G>A	12.37:g.77426850C>T			Somatic				E2F7_uc009zse.2_5'Flank	p.Q454Q	NM_203394	NP_976328	WXS	Illumina HiSeq	Unspecified	Q96AV8	E2F7_HUMAN			9	1598	-			454					A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	ENST00000322886.7	37	c.1362G>A	CCDS9016.1																																																																																				0.373	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		19	29	0	0	0	0.003954	0	19	29				
GALNT4	8693	broad.mit.edu	37	12	89918168	89918168	+	Silent	SNP	C	C	T	rs372200160		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:89918168C>T	ENST00000529983.2	-	1	415	c.159G>A	c.(157-159)caG>caA	p.Q53Q	POC1B-GALNT4_ENST00000548729.1_Silent_p.Q50Q|RP11-734K2.4_ENST00000605233.1_RNA|GALNT4_ENST00000413530.1_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000549035.1_Intron|POC1B_ENST00000393179.4_Intron|POC1B-GALNT4_ENST00000547474.1_Intron|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000541909.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	53					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						CCGTATTTTTCTGGAGGTCTG	0.562											OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001tbd.2		NA																	0					0						c.(157-159)CAG>CAA		polypeptide N-acetylgalactosaminyltransferase 4							50.0	54.0	53.0					12																	89918168		1832	4086	5918	SO:0001819	synonymous_variant	8693				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:89918168C>T	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.159G>A	12.37:g.89918168C>T			Somatic	OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1271	POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Silent_p.Q50Q|GALNT4_uc010suo.1_Intron	p.Q53Q	NM_003774	NP_003765	WXS	Illumina HiSeq	Unspecified	Q8N4A0	GALT4_HUMAN			1	368	-			53			Lumenal (Potential).		B2R775|B4DMX6|O00208	Silent	SNP	ENST00000529983.2	37	c.159G>A	CCDS53817.1																																																																																				0.562	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774		9	12	0	0	0	0.008291	0	9	12				
PLXNC1	10154	broad.mit.edu	37	12	94642146	94642146	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:94642146C>G	ENST00000258526.4	+	14	2985	c.2736C>G	c.(2734-2736)atC>atG	p.I912M		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	912					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTAAAGGCATCAAGACTGCAA	0.393																																							uc001tdc.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2734-2736)ATC>ATG		plexin C1 precursor							76.0	78.0	78.0					12																	94642146		2203	4300	6503	SO:0001583	missense	10154				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding	g.chr12:94642146C>G	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2736C>G	12.37:g.94642146C>G	ENSP00000258526:p.Ile912Met		Somatic					p.I912M	NM_005761	NP_005752	WXS	Illumina HiSeq	Unspecified	O60486	PLXC1_HUMAN			14	2985	+			912			Extracellular (Potential).		Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	c.2736C>G	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	C	8.447	0.852085	0.17034	.	.	ENSG00000136040	ENST00000258526	T	0.06687	3.27	5.41	-1.02	0.10135	Cell surface receptor IPT/TIG (1);Immunoglobulin-like fold (1);	1.837080	0.02316	N	0.072582	T	0.09818	0.0241	L	0.36672	1.1	0.09310	N	0.999998	P	0.44578	0.838	P	0.44990	0.466	T	0.23013	-1.0200	10	0.44086	T	0.13	.	5.187	0.15189	0.1335:0.4728:0.0:0.3937	.	912	O60486	PLXC1_HUMAN	M	912	ENSP00000258526:I912M	ENSP00000258526:I912M	I	+	3	3	PLXNC1	93166277	0.019000	0.18553	0.009000	0.14445	0.058000	0.15608	0.146000	0.16180	-0.139000	0.11414	-0.142000	0.14014	ATC		0.393	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			33	45	0	0	0	0.007835	0	33	45				
PAH	5053	broad.mit.edu	37	12	103238149	103238149	+	Missense_Mutation	SNP	C	C	T	rs62508679		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:103238149C>T	ENST00000553106.1	-	10	1502	c.1030G>A	c.(1030-1032)Ggt>Agt	p.G344S	PAH_ENST00000307000.2_Missense_Mutation_p.G339S	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	344			G -> R (in PKU).|G -> V (in PKU).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AGCCCAGCACCATATGCCTTT	0.438																																							uc001tjq.1		NA																	0				ovary(4)	4	GRCh37	CM000549|CM981451	PAH	M	rs62508679	c.(1030-1032)GGT>AGT		phenylalanine hydroxylase	Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)						109.0	95.0	100.0					12																	103238149		2203	4300	6503	SO:0001583	missense	5053				catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity	g.chr12:103238149C>T	U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1030G>A	12.37:g.103238149C>T	ENSP00000448059:p.Gly344Ser		Somatic					p.G344S	NM_000277	NP_000268	WXS	Illumina HiSeq	Unspecified	P00439	PH4H_HUMAN			11	1502	-			344		G -> V (in PKU).|G -> R (in PKU).			Q16717|Q8TC14	Missense_Mutation	SNP	ENST00000553106.1	37	c.1030G>A	CCDS9092.1	.	.	.	.	.	.	.	.	.	.	C	36	5.862479	0.97036	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99953	-8.81;-8.81	5.81	5.81	0.92471	Aromatic amino acid hydroxylase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97010	0.9735	10	0.87932	D	0	-17.855	20.0776	0.97750	0.0:1.0:0.0:0.0	rs62508679	344	P00439	PH4H_HUMAN	S	344;339	ENSP00000448059:G344S;ENSP00000303500:G339S	ENSP00000303500:G339S	G	-	1	0	PAH	101762279	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.665000	0.83852	2.754000	0.94517	0.655000	0.94253	GGT		0.438	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1			10	12	0	0	0	0.004007	0	10	12				
STAB2	55576	broad.mit.edu	37	12	104056698	104056698	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:104056698G>A	ENST00000388887.2	+	18	2148	c.1944G>A	c.(1942-1944)ctG>ctA	p.L648L		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTTACACACTGACAGGAGTTC	0.413																																							uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.(1942-1944)CTG>CTA		stabilin 2 precursor							153.0	146.0	148.0					12																	104056698		2203	4300	6503	SO:0001819	synonymous_variant	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104056698G>A	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1944G>A	12.37:g.104056698G>A			Somatic					p.L648L	NM_017564	NP_060034	WXS	Illumina HiSeq	Unspecified	Q8WWQ8	STAB2_HUMAN			18	2130	+			648			Extracellular (Potential).|FAS1 2.			Silent	SNP	ENST00000388887.2	37	c.1944G>A	CCDS31888.1																																																																																				0.413	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			56	46	0	0	0	0.00361	0	56	46				
RPH3A	22895	broad.mit.edu	37	12	113316981	113316981	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:113316981A>G	ENST00000389385.4	+	14	1726	c.1229A>G	c.(1228-1230)cAg>cGg	p.Q410R	RPH3A_ENST00000543106.2_Missense_Mutation_p.Q410R|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000548866.1_Missense_Mutation_p.Q361R|RPH3A_ENST00000447659.2_Missense_Mutation_p.Q361R|RPH3A_ENST00000415485.3_Missense_Mutation_p.Q410R|RPH3A_ENST00000551052.1_Missense_Mutation_p.Q406R|RPH3A_ENST00000420983.2_Missense_Mutation_p.Q410R	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	410	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AGCTCCCTGCAGTGCACCATC	0.557																																							uc010syl.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1228-1230)CAG>CGG		rabphilin 3A homolog isoform 1							137.0	123.0	128.0					12																	113316981		2203	4300	6503	SO:0001583	missense	22895				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113316981A>G	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1229A>G	12.37:g.113316981A>G	ENSP00000374036:p.Gln410Arg		Somatic				RPH3A_uc001ttz.2_Missense_Mutation_p.Q410R|RPH3A_uc001tty.2_Missense_Mutation_p.Q406R|RPH3A_uc009zwe.1_Missense_Mutation_p.Q406R|RPH3A_uc010sym.1_Missense_Mutation_p.Q361R|RPH3A_uc001tua.2_Missense_Mutation_p.Q170R	p.Q410R	NM_001143854	NP_001137326	WXS	Illumina HiSeq	Unspecified	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	14	1591	+			410			C2 1.		B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	c.1229A>G	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850778	0.71719	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913;ENST00000552755	T;T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32;2.32	5.38	5.38	0.77491	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.336783	0.25456	N	0.030542	T	0.10121	0.0248	N	0.02960	-0.455	0.37802	D	0.927734	B;B;B;B	0.17667	0.023;0.001;0.001;0.023	B;B;B;B	0.32465	0.146;0.045;0.045;0.146	T	0.34229	-0.9837	10	0.27785	T	0.31	.	14.369	0.66826	1.0:0.0:0.0:0.0	.	361;410;410;406	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	R	410;410;361;406;410;361;410;62;62	ENSP00000440384:Q410R;ENSP00000374036:Q410R;ENSP00000413254:Q361R;ENSP00000448297:Q406R;ENSP00000405357:Q410R;ENSP00000450347:Q361R;ENSP00000408889:Q410R	ENSP00000374036:Q410R	Q	+	2	0	RPH3A	111801364	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.026000	0.93700	2.033000	0.60031	0.454000	0.30748	CAG		0.557	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		56	55	0	0	0	0.00361	0	56	55				
MLXIP	22877	broad.mit.edu	37	12	122623364	122623364	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:122623364C>T	ENST00000319080.7	+	15	2519	c.2387C>T	c.(2386-2388)tCc>tTc	p.S796F	MLXIP_ENST00000538698.1_Missense_Mutation_p.S403F					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		CATTTCAGCTCCTGCCAGCAG	0.602																																					Esophageal Squamous(105;787 1493 16200 18566 52466)	Esophageal Squamous(105;787 1493 16200 18566 52466)	uc001ubq.2		NA																	0				ovary(2)	2						c.(2386-2388)TCC>TTC		MLX interacting protein							19.0	22.0	21.0					12																	122623364		1957	4152	6109	SO:0001583	missense	22877				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding	g.chr12:122623364C>T	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2387C>T	12.37:g.122623364C>T	ENSP00000312834:p.Ser796Phe		Somatic				MLXIP_uc001ubt.2_Missense_Mutation_p.S403F	p.S796F	NM_014938	NP_055753	WXS	Illumina HiSeq	Unspecified	Q9HAP2	MLXIP_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)	15	2387	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)	796						Missense_Mutation	SNP	ENST00000319080.7	37	c.2387C>T		.	.	.	.	.	.	.	.	.	.	C	13.83	2.353008	0.41700	.	.	ENSG00000175727	ENST00000319080;ENST00000538698;ENST00000366272	D;D;D	0.98474	-4.95;-4.95;-4.95	5.45	5.45	0.79879	Helix-loop-helix DNA-binding (1);	0.180038	0.51477	D	0.000094	D	0.96163	0.8749	.	.	.	0.80722	D	1	P	0.49961	0.93	B	0.42214	0.38	D	0.95288	0.8392	9	0.14252	T	0.57	-33.9512	19.2864	0.94072	0.0:1.0:0.0:0.0	.	796	Q9HAP2	MLXIP_HUMAN	F	796;403;267	ENSP00000312834:S796F;ENSP00000440769:S403F;ENSP00000445891:S267F	ENSP00000312834:S796F	S	+	2	0	MLXIP	121189317	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.494000	0.35616	2.549000	0.85964	0.655000	0.94253	TCC		0.602	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938		10	9	0	0	0	0.000978	0	10	9				
TCTN2	79867	broad.mit.edu	37	12	124192153	124192153	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:124192153G>T	ENST00000303372.5	+	18	2115	c.1987G>T	c.(1987-1989)Gag>Tag	p.E663*	TCTN2_ENST00000426174.2_Nonsense_Mutation_p.E662*|RP11-338K17.8_ENST00000538837.1_lincRNA	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	663					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		TTTTTCAGGGGAGCTGCATTC	0.453																																							uc001ufp.2		NA																	0				ovary(1)	1						c.(1987-1989)GAG>TAG		tectonic family member 2 isoform 1							202.0	169.0	180.0					12																	124192153		2203	4300	6503	SO:0001587	stop_gained	79867				cilium assembly|smoothened signaling pathway	integral to membrane		g.chr12:124192153G>T	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.1987G>T	12.37:g.124192153G>T	ENSP00000304941:p.Glu663*		Somatic				TCTN2_uc009zya.2_Nonsense_Mutation_p.E662*	p.E663*	NM_024809	NP_079085	WXS	Illumina HiSeq	Unspecified	Q96GX1	TECT2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)	18	2115	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		663			Extracellular (Potential).		A8K7Y8|B3KPW5|Q9H966	Nonsense_Mutation	SNP	ENST00000303372.5	37	c.1987G>T	CCDS9253.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598408	0.87055	.	.	ENSG00000168778	ENST00000426174;ENST00000303372	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-35.6786	17.0498	0.86515	0.0:0.0:1.0:0.0	.	.	.	.	X	662;663	.	ENSP00000304941:E663X	E	+	1	0	TCTN2	122758106	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	6.279000	0.72620	2.834000	0.97654	0.585000	0.79938	GAG		0.453	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809		18	22	1	0	3.99206e-14	0.007413	4.6733e-14	18	22				
DNAH10	196385	broad.mit.edu	37	12	124272447	124272447	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr12:124272447G>A	ENST00000409039.3	+	10	1360	c.1335G>A	c.(1333-1335)gaG>gaA	p.E445E		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	445	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCAAGATAGAGGCTTCGGGGA	0.562																																							uc001uft.3		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1333-1335)GAG>GAA		dynein, axonemal, heavy chain 10							53.0	48.0	50.0					12																	124272447		2203	4300	6503	SO:0001819	synonymous_variant	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124272447G>A	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1335G>A	12.37:g.124272447G>A			Somatic				DNAH10_uc010tav.1_5'Flank|DNAH10_uc010taw.1_5'Flank	p.E445E	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	10	1360	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		445			Stem (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	c.1335G>A	CCDS9255.2																																																																																				0.562	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			4	9	0	0	0	0.000602	0	4	9				
CENPJ	55835	broad.mit.edu	37	13	25480420	25480420	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:25480420C>G	ENST00000381884.4	-	7	1941	c.1756G>C	c.(1756-1758)Gat>Cat	p.D586H	CENPJ_ENST00000545981.1_Missense_Mutation_p.D586H	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	586					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		GATATTTCATCAGCAGCTTGT	0.358																																							uc001upt.3		NA																	0				ovary(2)	2						c.(1756-1758)GAT>CAT		centromere protein J							50.0	55.0	53.0					13																	25480420		2203	4300	6503	SO:0001583	missense	55835				cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding	g.chr13:25480420C>G	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1756G>C	13.37:g.25480420C>G	ENSP00000371308:p.Asp586His		Somatic				CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA|CENPJ_uc001upu.2_5'Flank	p.D586H	NM_018451	NP_060921	WXS	Illumina HiSeq	Unspecified	Q9HC77	CENPJ_HUMAN		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)	7	2009	-		Lung SC(185;0.0225)|Breast(139;0.0602)	586					Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	c.1756G>C	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073731	0.76415	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.51574	0.7;1.24	6.02	6.02	0.97574	.	0.059739	0.64402	D	0.000004	T	0.70404	0.3220	M	0.77616	2.38	0.54753	D	0.999983	D	0.89917	1.0	D	0.66602	0.945	T	0.72164	-0.4373	10	0.87932	D	0	.	19.3185	0.94226	0.0:1.0:0.0:0.0	.	586	Q9HC77	CENPJ_HUMAN	H	586	ENSP00000371308:D586H;ENSP00000441090:D586H	ENSP00000371308:D586H	D	-	1	0	CENPJ	24378420	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.101000	0.76997	2.850000	0.98022	0.650000	0.86243	GAT		0.358	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		10	9	0	0	0	0.008291	0	10	9				
NBEA	26960	broad.mit.edu	37	13	35926326	35926326	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:35926326A>C	ENST00000400445.3	+	38	6579	c.6045A>C	c.(6043-6045)agA>agC	p.R2015S	NBEA_ENST00000379939.2_Missense_Mutation_p.R2012S|NBEA_ENST00000310336.4_Missense_Mutation_p.R2015S|NBEA_ENST00000540320.1_Missense_Mutation_p.R2015S	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2015					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTGATAGAAGAGAGGAAGAAA	0.338																																							uc001uvb.2		NA																	0				ovary(9)|large_intestine(2)	11						c.(6043-6045)AGA>AGC		neurobeachin							75.0	71.0	72.0					13																	35926326		1899	4122	6021	SO:0001583	missense	26960					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding	g.chr13:35926326A>C	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6045A>C	13.37:g.35926326A>C	ENSP00000383295:p.Arg2015Ser		Somatic				NBEA_uc010abi.2_Missense_Mutation_p.R671S	p.R2015S	NM_015678	NP_056493	WXS	Illumina HiSeq	Unspecified	Q8NFP9	NBEA_HUMAN		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)	38	6251	+		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)	2015					B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	c.6045A>C	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.984519	0.74474	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	4.88	-0.353	0.12594	Domain of unknown function DUF1088 (1);	0.108846	0.64402	D	0.000009	T	0.44498	0.1296	M	0.73962	2.25	0.80722	D	1	B;B	0.29590	0.173;0.25	B;B	0.33121	0.078;0.158	T	0.24870	-1.0148	10	0.34782	T	0.22	.	9.0082	0.36124	0.6249:0.0:0.3751:0.0	.	2015;2012	Q8NFP9;Q5T321	NBEA_HUMAN;.	S	2015;2015;2012;2015;642	ENSP00000440951:R2015S;ENSP00000383295:R2015S;ENSP00000369271:R2012S;ENSP00000308534:R2015S	ENSP00000308534:R2015S	R	+	3	2	NBEA	34824326	1.000000	0.71417	0.841000	0.33234	0.990000	0.78478	1.706000	0.37878	-0.213000	0.10094	0.482000	0.46254	AGA		0.338	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		7	7	0	0	0	0.006214	0	7	7				
DIS3	22894	broad.mit.edu	37	13	73345239	73345239	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:73345239G>A	ENST00000377767.4	-	12	1750	c.1650C>T	c.(1648-1650)tcC>tcT	p.S550S	DIS3_ENST00000377780.4_Silent_p.S520S|DIS3_ENST00000545453.1_Silent_p.S388S	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	550					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		CACATTTTAAGGAACACAAGT	0.343										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(1648-1650)TCC>TCT		DIS3 mitotic control isoform a							121.0	116.0	118.0					13																	73345239		2203	4300	6503	SO:0001819	synonymous_variant	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73345239G>A	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1650C>T	13.37:g.73345239G>A		Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Silent_p.S520S|DIS3_uc001viz.2_RNA	p.S550S	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	12	2024	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	550					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Silent	SNP	ENST00000377767.4	37	c.1650C>T	CCDS9447.1																																																																																				0.343	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		17	26	0	0	0	0.001882	0	17	26				
EDNRB	1910	broad.mit.edu	37	13	78477365	78477365	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:78477365T>C	ENST00000334286.5	-	3	963	c.727A>G	c.(727-729)Att>Gtt	p.I243V	EDNRB_ENST00000377211.4_Missense_Mutation_p.I333V|EDNRB_ENST00000446573.1_Missense_Mutation_p.I243V	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	243					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TCCATCGTAATTATATCAAAA	0.398																																							uc001vko.2		NA																	0					0						c.(727-729)ATT>GTT		endothelin receptor type B isoform 1 precursor	Bosentan(DB00559)						156.0	161.0	159.0					13																	78477365		2203	4300	6503	SO:0001583	missense	1910				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding	g.chr13:78477365T>C	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.727A>G	13.37:g.78477365T>C	ENSP00000335311:p.Ile243Val		Somatic				EDNRB_uc001vkq.1_Missense_Mutation_p.I243V|uc001vkn.1_Intron|EDNRB_uc010aez.1_Missense_Mutation_p.I243V|EDNRB_uc001vkp.1_Missense_Mutation_p.I326V	p.I243V	NM_001122659	NP_001116131	WXS	Illumina HiSeq	Unspecified	P24530	EDNRB_HUMAN		GBM - Glioblastoma multiforme(99;0.0933)	3	985	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)	243			Helical; Name=4; (Potential).		A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	c.727A>G	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	T	0.043	-1.275214	0.01410	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.71341	-0.56;-0.56;-0.56	5.62	3.17	0.36434	GPCR, rhodopsin-like superfamily (1);	0.090906	0.85682	N	0.000000	T	0.38108	0.1028	N	0.02275	-0.615	0.46356	D	0.999007	B;B;B	0.11235	0.004;0.0;0.001	B;B;B	0.12837	0.005;0.003;0.008	T	0.19418	-1.0306	10	0.06625	T	0.88	-8.5078	8.3694	0.32406	0.0:0.0687:0.1331:0.7982	.	243;333;243	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	V	333;243;243	ENSP00000366416:I333V;ENSP00000403401:I243V;ENSP00000335311:I243V	ENSP00000335311:I243V	I	-	1	0	EDNRB	77375366	1.000000	0.71417	0.495000	0.27527	0.046000	0.14306	2.635000	0.46537	0.401000	0.25424	-0.321000	0.08615	ATT		0.398	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1			51	100	0	0	0	0.00361	0	51	100				
RNF219	79596	broad.mit.edu	37	13	79233246	79233246	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:79233246T>C	ENST00000282003.6	-	1	68	c.10A>G	c.(10-12)Acc>Gcc	p.T4A		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	4							zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TTCTGCACGGTCTGAGCCATG	0.597																																							uc001vkw.1		NA																	0				large_intestine(2)	2						c.(10-12)ACC>GCC		ring finger protein 219							104.0	75.0	85.0					13																	79233246		2203	4300	6503	SO:0001583	missense	79596						zinc ion binding	g.chr13:79233246T>C	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.10A>G	13.37:g.79233246T>C	ENSP00000282003:p.Thr4Ala		Somatic				RNF219_uc010afb.1_Intron|RNF219_uc010afc.2_Missense_Mutation_p.T4A	p.T4A	NM_024546	NP_078822	WXS	Illumina HiSeq	Unspecified	Q5W0B1	RN219_HUMAN		GBM - Glioblastoma multiforme(99;0.0414)	1	69	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)	4					B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	c.10A>G	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.861424	0.51482	.	.	ENSG00000152193	ENST00000282003	.	.	.	5.06	5.06	0.68205	.	0.227977	0.41823	D	0.000815	T	0.23532	0.0569	N	0.08118	0	0.30803	N	0.73966	B	0.16603	0.018	B	0.14023	0.01	T	0.13629	-1.0502	9	0.52906	T	0.07	.	10.271	0.43483	0.0:0.0:0.1653:0.8347	.	4	Q5W0B1	RN219_HUMAN	A	4	.	ENSP00000282003:T4A	T	-	1	0	RNF219	78131247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.183000	0.50918	2.123000	0.65237	0.533000	0.62120	ACC		0.597	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546		11	18	0	0	0	0.001855	0	11	18				
SLITRK1	114798	broad.mit.edu	37	13	84453917	84453917	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:84453917C>A	ENST00000377084.2	-	1	2611	c.1726G>T	c.(1726-1728)Gag>Tag	p.E576*		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	576	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGGCAGATCTCGTCATTGGAG	0.542																																							uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1726-1728)GAG>TAG		slit and trk like 1 protein precursor							88.0	75.0	80.0					13																	84453917		2203	4300	6503	SO:0001587	stop_gained	114798					integral to membrane		g.chr13:84453917C>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1726G>T	13.37:g.84453917C>A	ENSP00000366288:p.Glu576*		Somatic					p.E576*	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2612	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	576			LRRCT 2.|Extracellular (Potential).		Q5U5I6|Q96SF9	Nonsense_Mutation	SNP	ENST00000377084.2	37	c.1726G>T	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	45	11.568842	0.99577	.	.	ENSG00000178235	ENST00000377084	.	.	.	5.22	5.22	0.72569	.	0.256908	0.39341	N	0.001381	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-15.6625	11.2346	0.48933	0.0:0.9148:0.0:0.0852	.	.	.	.	X	576	.	ENSP00000366288:E576X	E	-	1	0	SLITRK1	83351918	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.088000	0.57678	2.603000	0.88011	0.655000	0.94253	GAG		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		10	34	1	0	6.40141e-05	0.000978	6.73523e-05	10	34				
NALCN	259232	broad.mit.edu	37	13	101714406	101714406	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:101714406C>G	ENST00000251127.6	-	41	4750	c.4669G>C	c.(4669-4671)Gag>Cag	p.E1557Q	NALCN-AS1_ENST00000457843.1_RNA	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1557					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCAGCTGCTCCCTCGCCAGG	0.572																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(4669-4671)GAG>CAG		voltage gated channel like 1							119.0	85.0	97.0					13																	101714406		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101714406C>G	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4669G>C	13.37:g.101714406C>G	ENSP00000251127:p.Glu1557Gln		Somatic					p.E1557Q	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			41	4858	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1557			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.4669G>C	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	33	5.222946	0.95139	.	.	ENSG00000102452	ENST00000251127	D	0.98135	-4.74	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.99297	1.0900	10	0.87932	D	0	.	20.3658	0.98878	0.0:1.0:0.0:0.0	.	1557	Q8IZF0	NALCN_HUMAN	Q	1557	ENSP00000251127:E1557Q	ENSP00000251127:E1557Q	E	-	1	0	NALCN	100512407	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.298000	0.78815	2.820000	0.97059	0.650000	0.86243	GAG		0.572	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		28	57	0	0	0	0.00632	0	28	57				
COL4A2	1284	broad.mit.edu	37	13	111160490	111160490	+	Silent	SNP	G	G	T	rs562351783	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:111160490G>T	ENST00000360467.5	+	47	5109	c.4803G>T	c.(4801-4803)gcG>gcT	p.A1601A	COL4A2-AS1_ENST00000417970.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1601	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TCGCCATCGCGGTCCACAGTC	0.602																																							uc001vqx.2		NA																	0				skin(3)|central_nervous_system(2)|ovary(1)	6						c.(4801-4803)GCG>GCT		alpha 2 type IV collagen preproprotein							71.0	78.0	76.0					13																	111160490		2138	4265	6403	SO:0001819	synonymous_variant	1284				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	g.chr13:111160490G>T	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.4803G>T	13.37:g.111160490G>T			Somatic					p.A1601A	NM_001846	NP_001837	WXS	Illumina HiSeq	Unspecified	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		47	5092	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	1601			Collagen IV NC1.		Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	ENST00000360467.5	37	c.4803G>T	CCDS41907.1																																																																																				0.602	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846		31	64	1	0	5.77227e-19	0.008361	7.1219e-19	31	64				
NDRG2	57447	broad.mit.edu	37	14	21490336	21490336	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:21490336A>C	ENST00000556147.1	-	5	1169	c.229T>G	c.(229-231)Tct>Gct	p.S77A	NDRG2_ENST00000397855.3_Missense_Mutation_p.S63A|NDRG2_ENST00000555158.1_Missense_Mutation_p.S63A|NDRG2_ENST00000403829.3_Missense_Mutation_p.S73A|NDRG2_ENST00000397858.1_Missense_Mutation_p.S77A|NDRG2_ENST00000397853.3_Missense_Mutation_p.S77A|AL161668.5_ENST00000533984.1_lincRNA|NDRG2_ENST00000553503.1_Missense_Mutation_p.S63A|NDRG2_ENST00000554104.1_5'UTR|NDRG2_ENST00000298684.5_Missense_Mutation_p.S63A|NDRG2_ENST00000350792.3_Missense_Mutation_p.S63A|NDRG2_ENST00000298687.5_Missense_Mutation_p.S77A|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000554143.1_Missense_Mutation_p.S63A|NDRG2_ENST00000397844.2_Missense_Mutation_p.S63A|NDRG2_ENST00000397856.3_Missense_Mutation_p.S63A|NDRG2_ENST00000360463.3_Missense_Mutation_p.S63A|NDRG2_ENST00000397847.2_Missense_Mutation_p.S77A|NDRG2_ENST00000397851.2_Missense_Mutation_p.S77A			Q9UN36	NDRG2_HUMAN	NDRG family member 2	77					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TGGAAGCAAGATTTATCTAAA	0.502																																							uc001vyy.2		NA																	0				ovary(1)|breast(1)	2						c.(229-231)TCT>GCT		N-myc downstream-regulated gene 2 isoform a							85.0	84.0	85.0					14																	21490336		2203	4300	6503	SO:0001583	missense	57447				cell differentiation|nervous system development	centrosome|cytosol|Golgi apparatus|nucleus|perinuclear region of cytoplasm		g.chr14:21490336A>C	AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.229T>G	14.37:g.21490336A>C	ENSP00000451712:p.Ser77Ala		Somatic				NDRG2_uc010tll.1_Missense_Mutation_p.S73A|NDRG2_uc001vyt.2_5'UTR|NDRG2_uc001vyu.2_Missense_Mutation_p.S63A|NDRG2_uc001vyv.2_Missense_Mutation_p.S63A|NDRG2_uc001vyw.2_Missense_Mutation_p.S63A|NDRG2_uc001vzb.2_Intron|NDRG2_uc001vyx.2_Missense_Mutation_p.S77A|NDRG2_uc001vza.2_Missense_Mutation_p.S63A|NDRG2_uc001vyz.2_Missense_Mutation_p.S63A|NDRG2_uc001vzc.2_Missense_Mutation_p.S63A|NDRG2_uc001vze.2_Missense_Mutation_p.S77A|NDRG2_uc001vzd.2_Missense_Mutation_p.S77A|NDRG2_uc001vzg.2_Missense_Mutation_p.S63A|NDRG2_uc001vzf.2_Missense_Mutation_p.S63A|NDRG2_uc010aig.2_Missense_Mutation_p.S77A	p.S77A	NM_201540	NP_963834	WXS	Illumina HiSeq	Unspecified	Q9UN36	NDRG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)	6	379	-	all_cancers(95;0.00185)		77					B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	ENST00000556147.1	37	c.229T>G	CCDS9565.1	.	.	.	.	.	.	.	.	.	.	A	16.73	3.203753	0.58234	.	.	ENSG00000165795	ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000557633;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397855;ENST00000298684;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556974;ENST00000555026;ENST00000553867;ENST00000449431;ENST00000557169;ENST00000555869;ENST00000555733;ENST00000555384;ENST00000554094;ENST00000553442;ENST00000556420;ENST00000553784;ENST00000557149;ENST00000555142;ENST00000554531;ENST00000557264;ENST00000557676;ENST00000556924;ENST00000556329;ENST00000554398;ENST00000554472;ENST00000554483;ENST00000555657;ENST00000557274;ENST00000556457;ENST00000556688;ENST00000554561;ENST00000554419;ENST00000554489;ENST00000556561;ENST00000554893;ENST00000554833;ENST00000554415	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85	5.57	4.42	0.53409	.	0.402813	0.29692	N	0.011441	T	0.40171	0.1106	M	0.66939	2.045	0.40747	D	0.982886	B;B;B;B;B	0.28605	0.217;0.048;0.023;0.118;0.056	P;B;B;B;B	0.47402	0.546;0.129;0.115;0.403;0.066	T	0.35674	-0.9779	10	0.52906	T	0.07	-1.9258	7.6819	0.28518	0.5577:0.0:0.0:0.4423	.	73;77;63;77;63	B4DE86;Q9UN36-3;Q9UN36-5;Q9UN36;Q9UN36-4	.;.;.;NDRG2_HUMAN;.	A	77;63;58;77;20;63;63;77;63;77;63;77;77;63;63;63;63;73;63;63;63;77;38;63;63;77;77;63;63;63;77;63;63;66;63;63;63;63;77;77;63;63;63;77;77;63;77;63;77;63;77;77	ENSP00000298687:S77A;ENSP00000344620:S63A;ENSP00000380956:S77A;ENSP00000450835:S20A;ENSP00000452038:S63A;ENSP00000452306:S63A;ENSP00000380951:S77A;ENSP00000353649:S63A;ENSP00000451712:S77A;ENSP00000452006:S63A;ENSP00000380949:S77A;ENSP00000380945:S77A;ENSP00000380954:S63A;ENSP00000380953:S63A;ENSP00000298684:S63A;ENSP00000380943:S63A;ENSP00000385889:S73A;ENSP00000451966:S63A;ENSP00000452362:S63A;ENSP00000451274:S63A;ENSP00000450691:S77A;ENSP00000397250:S38A;ENSP00000452334:S63A;ENSP00000451105:S63A;ENSP00000452482:S77A;ENSP00000451094:S77A;ENSP00000452278:S63A;ENSP00000450493:S63A;ENSP00000451951:S63A;ENSP00000451059:S77A;ENSP00000452592:S63A;ENSP00000450513:S63A;ENSP00000451302:S66A;ENSP00000451471:S63A;ENSP00000452548:S63A;ENSP00000450504:S63A;ENSP00000452262:S63A;ENSP00000451185:S77A;ENSP00000451348:S77A;ENSP00000451472:S63A;ENSP00000452247:S63A;ENSP00000452344:S63A;ENSP00000450852:S77A;ENSP00000451981:S77A;ENSP00000451163:S63A;ENSP00000452179:S77A;ENSP00000452302:S63A;ENSP00000450825:S77A;ENSP00000450450:S63A;ENSP00000452458:S77A;ENSP00000452274:S77A	ENSP00000298684:S63A	S	-	1	0	NDRG2	20560176	0.952000	0.32445	0.999000	0.59377	0.997000	0.91878	0.717000	0.25851	0.913000	0.36797	0.456000	0.33151	TCT		0.502	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1			23	42	0	0	0	0.005443	0	23	42				
TPPP2	122664	broad.mit.edu	37	14	21499323	21499323	+	Splice_Site	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:21499323C>T	ENST00000321760.6	+	3	474	c.326C>T	c.(325-327)aCt>aTt	p.T109I	NDRG2_ENST00000403829.3_Intron|AL161668.5_ENST00000533984.1_lincRNA|RP11-998D10.1_ENST00000531638.1_5'Flank|TPPP2_ENST00000530140.2_Splice_Site_p.T109I|TPPP2_ENST00000460647.2_Missense_Mutation_p.T109I	NM_173846.4	NP_776245.2	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family member 2	109						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ACTGGCGCTACTGTGAGTGAC	0.532																																							uc001vzh.2		NA																	0					0						c.(325-327)ACT>ATT		tubulin polymerization-promoting protein family							87.0	84.0	85.0					14																	21499323		2203	4300	6503	SO:0001630	splice_region_variant	122664					cytoplasm		g.chr14:21499323C>T	AY072034	CCDS9566.1	14q11.2	2014-01-21	2007-05-02	2007-05-02	ENSG00000179636	ENSG00000179636			19293	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 8"""	C14orf8		15590652, 17105200	Standard	NM_173846		Approved	p25beta, p18, CT152	uc001vzh.3	P59282	OTTHUMG00000029642	ENST00000321760.6:c.327+1C>T	14.37:g.21499323C>T			Somatic				NDRG2_uc010tll.1_Intron	p.T109I	NM_173846	NP_776245	WXS	Illumina HiSeq	Unspecified	P59282	TPPP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)	3	514	+	all_cancers(95;0.000759)		109					Q2VYF3	Missense_Mutation	SNP	ENST00000321760.6	37	c.326C>T	CCDS9566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.40|10.40	1.338632|1.338632	0.24253|0.24253	.|.	.|.	ENSG00000179636|ENSG00000179636	ENST00000555751|ENST00000321760;ENST00000460647;ENST00000530140;ENST00000472458;ENST00000481535	.|T;T;T;T;T	.|0.47528	.|0.86;0.84;0.86;0.93;0.84	4.63|4.63	3.74|3.74	0.42951|0.42951	.|.	.|0.053325	.|0.85682	.|N	.|0.000000	T|T	0.60483|0.60483	0.2272|0.2272	M|M	0.93106|0.93106	3.38|3.38	0.58432|0.58432	D|D	0.999998|0.999998	.|B	.|0.25486	.|0.127	.|B	.|0.34536	.|0.185	T|T	0.66208|0.66208	-0.5981|-0.5981	5|10	.|0.72032	.|D	.|0.01	-4.1846|-4.1846	11.0943|11.0943	0.48134|0.48134	0.0:0.9085:0.0:0.0915|0.0:0.9085:0.0:0.0915	.|.	.|109	.|P59282	.|TPPP2_HUMAN	F|I	48|109;109;109;109;104	.|ENSP00000317595:T109I;ENSP00000427504:T109I;ENSP00000435356:T109I;ENSP00000423171:T109I;ENSP00000421438:T104I	.|ENSP00000317595:T109I	L|T	+|+	1|2	0|0	TPPP2|TPPP2	20569163|20569163	1.000000|1.000000	0.71417|0.71417	0.842000|0.842000	0.33263|0.33263	0.023000|0.023000	0.10783|0.10783	5.658000|5.658000	0.68003|0.68003	1.292000|1.292000	0.44672|0.44672	0.655000|0.655000	0.94253|0.94253	CTC|ACT		0.532	TPPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073914.3	NM_173846	Missense_Mutation	26	56	0	0	0	0.002445	0	26	56				
TRAV13-1	28671	broad.mit.edu	37	14	22337432	22337432	+	RNA	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:22337432G>T	ENST00000390436.2	+	0	246									T cell receptor alpha variable 13-1																		AAATGTGGGCGAAAAGAAAGA	0.428																																							uc010tmf.1		NA																	0					NA						c.(226-228)GAA>TAA		SubName: Full=Putative uncharacterized protein ENSP00000374943;							183.0	181.0	182.0					14																	22337432		1918	4150	6068			0							g.chr14:22337432G>T	AE000659		14q11.2	2012-02-07			ENSG00000211788	ENSG00000211788		"""T cell receptors / TRA locus"""	12108	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000168993		14.37:g.22337432G>T			Somatic				uc001wbw.2_Intron|uc010tmg.1_Intron|uc010tmh.1_Nonsense_Mutation_p.E75*|uc001wby.2_Intron	p.E76*			WXS	Illumina HiSeq	Unspecified					2	305	+									Nonsense_Mutation	SNP	ENST00000390436.2	37	c.226G>T																																																																																					0.428	TRAV13-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000401891.1	NG_001332		54	106	1	0	7.41606e-26	0.00361	9.42114e-26	54	106				
LRP10	26020	broad.mit.edu	37	14	23341964	23341964	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:23341964C>G	ENST00000359591.4	+	2	743	c.52C>G	c.(52-54)Cca>Gca	p.P18A	LRP10_ENST00000546834.1_Missense_Mutation_p.P18A	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	18					endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		TCTGGCCCATCCAGACCGGAT	0.547											OREG0022588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001whd.2		NA																	0				central_nervous_system(1)	1						c.(52-54)CCA>GCA		low density lipoprotein receptor-related protein							63.0	59.0	60.0					14																	23341964		2203	4300	6503	SO:0001583	missense	26020				endocytosis	coated pit|integral to membrane		g.chr14:23341964C>G	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.52C>G	14.37:g.23341964C>G	ENSP00000352601:p.Pro18Ala		Somatic	OREG0022588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	763	LRP10_uc001whe.2_5'Flank	p.P18A	NM_014045	NP_054764	WXS	Illumina HiSeq	Unspecified	Q7Z4F1	LRP10_HUMAN		GBM - Glioblastoma multiforme(265;0.00549)	2	605	+	all_cancers(95;4.69e-05)		18			Extracellular (Potential).		A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	37	c.52C>G	CCDS9578.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.041357	0.35989	.	.	ENSG00000197324	ENST00000359591;ENST00000546834	D;D	0.93189	-2.99;-3.18	5.12	2.27	0.28462	.	0.380247	0.26355	N	0.024857	D	0.84515	0.5489	L	0.27053	0.805	0.21184	N	0.999768	B	0.16603	0.018	B	0.14023	0.01	T	0.67094	-0.5757	10	0.10111	T	0.7	-0.7107	7.3999	0.26958	0.0:0.7218:0.0:0.2782	.	18	Q7Z4F1	LRP10_HUMAN	A	18	ENSP00000352601:P18A;ENSP00000447559:P18A	ENSP00000352601:P18A	P	+	1	0	LRP10	22411804	0.208000	0.23494	0.582000	0.28627	0.983000	0.72400	0.850000	0.27737	0.747000	0.32809	0.557000	0.71058	CCA		0.547	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3			20	34	0	0	0	0.005443	0	20	34				
DHRS4L1	728635	broad.mit.edu	37	14	24517419	24517419	+	RNA	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:24517419G>C	ENST00000558293.1	+	0	492					NR_102693.1																						AGTGGTGCCAGAAATGGAGAA	0.527																																							uc010alc.2		NA																	0					0						c.(472-474)GAA>CAA		dehydrogenase/reductase (SDR family) member 4							134.0	134.0	134.0					14																	24517419		2203	4300	6503			728635						binding|oxidoreductase activity	g.chr14:24517419G>C																													14.37:g.24517419G>C			Somatic				DHRS4L1_uc010tnu.1_RNA	p.E158Q	NM_001082488	NP_001075957	WXS	Illumina HiSeq	Unspecified	P0CG22	DR4L1_HUMAN			6	472	+			158						Missense_Mutation	SNP	ENST00000558293.1	37	c.472G>C		.	.	.	.	.	.	.	.	.	.	G	15.59	2.879354	0.51801	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.04	1.97	0.26223	NAD(P)-binding domain (1);	.	.	.	.	T	0.18551	0.0445	N	0.16656	0.425	0.25578	N	0.98683	P	0.43607	0.812	B	0.39971	0.315	T	0.09729	-1.0661	7	0.22109	T	0.4	.	4.4162	0.11457	0.1097:0.0:0.4905:0.3998	.	158	P0CG22	DR4L1_HUMAN	Q	158	.	ENSP00000380255:E158Q	E	+	1	0	AL136295.1	23587259	1.000000	0.71417	0.991000	0.47740	0.736000	0.42039	2.698000	0.47068	1.000000	0.39049	0.400000	0.26472	GAA		0.527	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1			8	28	0	0	0	0.008291	0	8	28				
RNF31	55072	broad.mit.edu	37	14	24617533	24617533	+	Missense_Mutation	SNP	G	G	A	rs200194901		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:24617533G>A	ENST00000324103.6	+	3	726	c.406G>A	c.(406-408)Gaa>Aaa	p.E136K	RP11-468E2.4_ENST00000558468.1_5'Flank|PSME2_ENST00000471700.2_5'Flank|PSME2_ENST00000216802.5_5'Flank|PSME2_ENST00000560410.1_5'Flank|RNF31_ENST00000557878.1_3'UTR|RNF31_ENST00000559275.1_5'UTR|RNF31_ENST00000382687.3_5'Flank	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	136	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GAGCTTCCCCGAAGGGCAGGA	0.567																																							uc001wmn.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(406-408)GAA>AAA		ring finger protein 31							56.0	60.0	59.0					14																	24617533		2089	4224	6313	SO:0001583	missense	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24617533G>A	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.406G>A	14.37:g.24617533G>A	ENSP00000315112:p.Glu136Lys		Somatic				PSME2_uc001wmj.2_5'Flank|PSME2_uc001wmk.2_5'Flank|RNF31_uc001wml.1_5'UTR|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_5'UTR|RNF31_uc001wmo.1_5'Flank|RNF31_uc001wmp.2_5'Flank	p.E136K	NM_017999	NP_060469	WXS	Illumina HiSeq	Unspecified	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	3	655	+			136			Polyubiquitin-binding.		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	c.406G>A	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	G	33	5.261091	0.95368	.	.	ENSG00000092098	ENST00000324103	T	0.48522	0.81	5.09	5.09	0.68999	PUB domain (1);	0.161372	0.44688	D	0.000430	T	0.41096	0.1144	L	0.29908	0.895	0.80722	D	1	P	0.50528	0.936	B	0.42625	0.393	T	0.45775	-0.9238	10	0.72032	D	0.01	-13.6925	17.4268	0.87528	0.0:0.0:1.0:0.0	.	136	Q96EP0	RNF31_HUMAN	K	136	ENSP00000315112:E136K	ENSP00000315112:E136K	E	+	1	0	RNF31	23687373	1.000000	0.71417	0.109000	0.21407	0.954000	0.61252	8.315000	0.89983	2.662000	0.90505	0.655000	0.94253	GAA		0.567	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		13	37	0	0	0	0.001855	0	13	37				
IPO4	79711	broad.mit.edu	37	14	24656911	24656911	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:24656911G>A	ENST00000354464.6	-	5	546	c.370C>T	c.(370-372)Cag>Tag	p.Q124*	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	124					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		GTACTGTGCTGAAGCAGCTGC	0.582																																							uc001wmv.1		NA																	0				kidney(1)	1						c.(370-372)CAG>TAG		importin 4							61.0	68.0	66.0					14																	24656911		2036	4199	6235	SO:0001587	stop_gained	79711				intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity	g.chr14:24656911G>A	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.370C>T	14.37:g.24656911G>A	ENSP00000346453:p.Gln124*		Somatic				IPO4_uc001wmt.1_5'Flank|IPO4_uc001wmu.2_5'UTR|IPO4_uc001wmx.1_5'UTR|IPO4_uc001wmy.1_5'UTR|IPO4_uc010tnz.1_RNA|IPO4_uc001wmw.1_RNA|IPO4_uc001wmz.1_Nonsense_Mutation_p.Q124*	p.Q124*	NM_024658	NP_078934	WXS	Illumina HiSeq	Unspecified	Q8TEX9	IPO4_HUMAN		GBM - Glioblastoma multiforme(265;0.0087)	5	501	-			124					B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Nonsense_Mutation	SNP	ENST00000354464.6	37	c.370C>T	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	35	5.441249	0.96187	.	.	ENSG00000196497	ENST00000354464	.	.	.	5.27	5.27	0.74061	.	0.257379	0.38436	N	0.001690	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-22.3943	14.2767	0.66184	0.0:0.0:1.0:0.0	.	.	.	.	X	124	.	ENSP00000346453:Q124X	Q	-	1	0	IPO4	23726751	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.066000	0.50002	2.735000	0.93741	0.655000	0.94253	CAG		0.582	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658		31	77	0	0	0	0.00623	0	31	77				
AKAP6	9472	broad.mit.edu	37	14	33015051	33015051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:33015051G>T	ENST00000280979.4	+	4	1362	c.1192G>T	c.(1192-1194)Gag>Tag	p.E398*	AKAP6_ENST00000557272.1_Nonsense_Mutation_p.E398*|AKAP6_ENST00000557354.1_Nonsense_Mutation_p.E398*	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	398					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TTTTCTTAAAGAGGAAACTTT	0.428																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(1192-1194)GAG>TAG		A-kinase anchor protein 6							76.0	82.0	80.0					14																	33015051		2203	4300	6503	SO:0001587	stop_gained	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33015051G>T	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.1192G>T	14.37:g.33015051G>T	ENSP00000280979:p.Glu398*		Somatic				AKAP6_uc010aml.2_Nonsense_Mutation_p.E395*	p.E398*	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	4	1362	+	Breast(36;0.0388)|Prostate(35;0.15)		398					A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	ENST00000280979.4	37	c.1192G>T	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	36	5.791684	0.96945	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272;ENST00000553547	.	.	.	5.74	3.79	0.43588	.	0.329485	0.29508	N	0.011947	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.5539	10.3535	0.43950	0.074:0.1357:0.7904:0.0	.	.	.	.	X	398;398;398;156	.	ENSP00000280979:E398X	E	+	1	0	AKAP6	32084802	1.000000	0.71417	0.975000	0.42487	0.995000	0.86356	4.216000	0.58540	1.399000	0.46721	0.655000	0.94253	GAG		0.428	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		23	64	1	0	5.35356e-11	0.00278	6.10057e-11	23	64				
AKAP6	9472	broad.mit.edu	37	14	33290675	33290675	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:33290675G>A	ENST00000280979.4	+	13	3826	c.3656G>A	c.(3655-3657)tGg>tAg	p.W1219*	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1219					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCCCTGGAATGGGATGAAATG	0.403																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(3655-3657)TGG>TAG		A-kinase anchor protein 6							111.0	103.0	106.0					14																	33290675		2203	4300	6503	SO:0001587	stop_gained	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33290675G>A	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3656G>A	14.37:g.33290675G>A	ENSP00000280979:p.Trp1219*		Somatic					p.W1219*	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	3826	+	Breast(36;0.0388)|Prostate(35;0.15)		1219					A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	ENST00000280979.4	37	c.3656G>A	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	40	8.229933	0.98717	.	.	ENSG00000151320	ENST00000280979	.	.	.	5.79	5.79	0.91817	.	0.123229	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0129	20.0313	0.97540	0.0:0.0:1.0:0.0	.	.	.	.	X	1219	.	ENSP00000280979:W1219X	W	+	2	0	AKAP6	32360426	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	9.211000	0.95120	2.746000	0.94184	0.655000	0.94253	TGG		0.403	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		25	63	0	0	0	0.005443	0	25	63				
NPAS3	64067	broad.mit.edu	37	14	34247779	34247779	+	Splice_Site	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:34247779G>T	ENST00000356141.4	+	9	1153		c.e9+1		NPAS3_ENST00000357798.5_Splice_Site|NPAS3_ENST00000346562.2_Splice_Site|NPAS3_ENST00000548645.1_Splice_Site|NPAS3_ENST00000551492.1_Splice_Site			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3						locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CACTTGGACTGTAAGTACCTC	0.488																																							uc001wru.2		NA																	0				ovary(1)|skin(1)	2						c.e9+1		neuronal PAS domain protein 3 isoform 3							91.0	77.0	82.0					14																	34247779		2203	4300	6503	SO:0001630	splice_region_variant	64067				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr14:34247779G>T	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1153+1G>T	14.37:g.34247779G>T			Somatic				NPAS3_uc001wrs.2_Splice_Site_p.L372_splice|NPAS3_uc001wrt.2_Splice_Site_p.L353_splice|NPAS3_uc001wrv.2_Splice_Site_p.L355_splice	p.L385_splice	NM_173159	NP_071406	WXS	Illumina HiSeq	Unspecified	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)	9	1217	+	Breast(36;0.0102)|Hepatocellular(127;0.133)							Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Splice_Site	SNP	ENST00000356141.4	37	c.1153_splice	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.953757	0.92660	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000552874	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5752	0.99366	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NPAS3	33317530	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.714000	0.98744	2.868000	0.98415	0.557000	0.71058	.		0.488	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		Intron	20	46	1	0	2.39556e-15	0.00278	2.84811e-15	20	46				
BAZ1A	11177	broad.mit.edu	37	14	35240752	35240752	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:35240752T>A	ENST00000382422.2	-	20	3593	c.3266A>T	c.(3265-3267)cAg>cTg	p.Q1089L	BAZ1A_ENST00000360310.1_Missense_Mutation_p.Q1089L|BAZ1A_ENST00000358716.4_Missense_Mutation_p.Q1057L			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1089					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		CTCAATGCCCTGCTCTATTTG	0.373																																							uc001wsk.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7						c.(3265-3267)CAG>CTG		bromodomain adjacent to zinc finger domain, 1A							209.0	205.0	207.0					14																	35240752		2203	4300	6503	SO:0001583	missense	11177				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding	g.chr14:35240752T>A	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.3266A>T	14.37:g.35240752T>A	ENSP00000371859:p.Gln1089Leu		Somatic				BAZ1A_uc001wsl.2_Missense_Mutation_p.Q1057L	p.Q1089L	NM_013448	NP_038476	WXS	Illumina HiSeq	Unspecified	Q9NRL2	BAZ1A_HUMAN	LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)	21	3834	-	Breast(36;0.0388)|Hepatocellular(127;0.158)		1089					Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	c.3266A>T	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	T	31	5.082182	0.94050	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.75367	-0.93;-0.93;-0.93	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.85813	0.5784	M	0.76574	2.34	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79784	0.993;0.989	D	0.87551	0.2465	10	0.87932	D	0	.	15.8893	0.79279	0.0:0.0:0.0:1.0	.	1057;1089	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	L	1057;1089;1089;741	ENSP00000351555:Q1057L;ENSP00000371859:Q1089L;ENSP00000353458:Q1089L	ENSP00000351555:Q1057L	Q	-	2	0	BAZ1A	34310503	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.727000	0.84838	2.153000	0.67306	0.528000	0.53228	CAG		0.373	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			39	111	0	0	0	0.00361	0	39	111				
MDGA2	161357	broad.mit.edu	37	14	47351289	47351289	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:47351289A>T	ENST00000399232.2	-	11	2531	c.2167T>A	c.(2167-2169)Ttt>Att	p.F723I	MDGA2_ENST00000439988.3_Missense_Mutation_p.F792I|MDGA2_ENST00000357362.3_Missense_Mutation_p.F494I|MDGA2_ENST00000426342.1_Missense_Mutation_p.F494I|MDGA2_ENST00000399222.3_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	723	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CCTTCACCAAATTTGGTGAGA	0.289																																							uc001wwj.3		NA																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(2167-2169)TTT>ATT		MAM domain containing 1 isoform 1							48.0	46.0	46.0					14																	47351289		1820	4087	5907	SO:0001583	missense	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47351289A>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2167T>A	14.37:g.47351289A>T	ENSP00000382178:p.Phe723Ile		Somatic				MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Missense_Mutation_p.F494I|MDGA2_uc010ani.2_Missense_Mutation_p.F283I	p.F723I	NM_001113498	NP_001106970	WXS	Illumina HiSeq	Unspecified	Q7Z553	MDGA2_HUMAN			11	2363	-			723					F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37	c.2167T>A		.	.	.	.	.	.	.	.	.	.	A	22.9	4.350618	0.82132	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	4.89	4.89	0.63831	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.53938	U	0.000054	T	0.58637	0.2136	M	0.63843	1.955	0.80722	D	1	P;P	0.52692	0.819;0.955	P;P	0.57468	0.667;0.821	T	0.55579	-0.8119	10	0.25106	T	0.35	.	13.6246	0.62157	1.0:0.0:0.0:0.0	.	494;723	F6W3S7;Q7Z553	.;MDGA2_HUMAN	I	723;494;792;494	ENSP00000400011:F723I;ENSP00000405456:F494I;ENSP00000382178:F792I;ENSP00000349925:F494I	ENSP00000349925:F494I	F	-	1	0	MDGA2	46421039	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.883000	0.92426	1.972000	0.57404	0.383000	0.25322	TTT		0.289	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		6	13	0	0	0	0.004482	0	6	13				
ERO1L	30001	broad.mit.edu	37	14	53138391	53138391	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:53138391C>A	ENST00000395686.3	-	6	688	c.465G>T	c.(463-465)tgG>tgT	p.W155C		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	155					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)		ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					CATGCTTGGTCCACTGAAGAA	0.274																																							uc001wzv.2		NA																	0					0						c.(463-465)TGG>TGT		ERO1-like precursor							47.0	47.0	47.0					14																	53138391		2203	4299	6502	SO:0001583	missense	30001				chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor	g.chr14:53138391C>A	AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.465G>T	14.37:g.53138391C>A	ENSP00000379042:p.Trp155Cys		Somatic				ERO1L_uc001wzw.2_RNA|ERO1L_uc010aof.2_RNA	p.W155C	NM_014584	NP_055399	WXS	Illumina HiSeq	Unspecified	Q96HE7	ERO1A_HUMAN			6	691	-	Breast(41;0.226)		155					A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Missense_Mutation	SNP	ENST00000395686.3	37	c.465G>T	CCDS9709.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714829	0.68730	.	.	ENSG00000197930	ENST00000395686;ENST00000554251	D;D	0.96913	-4.17;-4.17	4.74	4.74	0.60224	.	0.113614	0.64402	D	0.000004	D	0.98140	0.9386	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99289	1.0898	10	0.87932	D	0	-8.3677	17.6771	0.88233	0.0:1.0:0.0:0.0	.	155	Q96HE7	ERO1A_HUMAN	C	155;115	ENSP00000379042:W155C;ENSP00000452269:W115C	ENSP00000379042:W155C	W	-	3	0	ERO1L	52208141	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.702000	0.84576	2.363000	0.80096	0.591000	0.81541	TGG		0.274	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276892.1	NM_014584		10	37	1	0	3.27435e-08	0.00245	3.60547e-08	10	37				
TMEM260	54916	broad.mit.edu	37	14	57082682	57082682	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:57082682G>C	ENST00000261556.6	+	8	1000	c.878G>C	c.(877-879)aGg>aCg	p.R293T	TMEM260_ENST00000538838.1_Missense_Mutation_p.R293T|TMEM260_ENST00000553335.1_3'UTR|TMEM260_ENST00000536419.1_5'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	293						integral component of membrane (GO:0016021)											ACAAATATGAGGACCGAACTC	0.313																																							uc001xcm.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(877-879)AGG>ACG		hypothetical protein LOC54916							131.0	136.0	134.0					14																	57082682		2203	4299	6502	SO:0001583	missense	54916					integral to membrane		g.chr14:57082682G>C	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.878G>C	14.37:g.57082682G>C	ENSP00000261556:p.Arg293Thr		Somatic				C14orf101_uc001xcj.2_RNA|C14orf101_uc010aot.1_Missense_Mutation_p.R293T|C14orf101_uc001xcl.1_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_5'UTR|C14orf101_uc001xco.2_5'UTR	p.R293T	NM_017799	NP_060269	WXS	Illumina HiSeq	Unspecified	Q9NX78	CN101_HUMAN		OV - Ovarian serous cystadenocarcinoma(311;0.226)	8	1000	+			293					A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	c.878G>C	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	G	3.386	-0.125248	0.06795	.	.	ENSG00000070269	ENST00000261556;ENST00000538838	T;T	0.42131	1.55;0.98	5.89	-0.728	0.11162	.	0.493681	0.24808	N	0.035431	T	0.28797	0.0714	L	0.44542	1.39	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.11372	-1.0590	10	0.17369	T	0.5	-9.7491	10.0323	0.42107	0.6041:0.0:0.3959:0.0	.	293	Q9NX78	CN101_HUMAN	T	293	ENSP00000261556:R293T;ENSP00000441934:R293T	ENSP00000261556:R293T	R	+	2	0	C14orf101	56152435	0.973000	0.33851	0.978000	0.43139	0.356000	0.29392	0.296000	0.19083	-0.042000	0.13535	-0.237000	0.12165	AGG		0.313	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799		42	79	0	0	0	0.00361	0	42	79				
KIAA0586	9786	broad.mit.edu	37	14	58954712	58954712	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:58954712A>G	ENST00000556134.1	+	24	3641	c.3367A>G	c.(3367-3369)Att>Gtt	p.I1123V	KIAA0586_ENST00000423743.3_Missense_Mutation_p.I1094V|KIAA0586_ENST00000354386.6_Missense_Mutation_p.I1191V|KIAA0586_ENST00000261244.5_Missense_Mutation_p.I1062V|KIAA0586_ENST00000538571.2_3'UTR	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1123					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGATATTTCCATTGATAAATT	0.473																																							uc001xdv.3		NA																	0				ovary(1)	1						c.(3184-3186)ATT>GTT		talpid3 protein							51.0	49.0	49.0					14																	58954712		1851	4090	5941	SO:0001583	missense	9786							g.chr14:58954712A>G	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.3367A>G	14.37:g.58954712A>G	ENSP00000452351:p.Ile1123Val		Somatic				KIAA0586_uc010trr.1_Missense_Mutation_p.I1179V|KIAA0586_uc001xdt.3_Missense_Mutation_p.I1094V|KIAA0586_uc001xdu.3_Missense_Mutation_p.I1123V|KIAA0586_uc010trs.1_Missense_Mutation_p.I1053V|KIAA0586_uc010trt.1_Missense_Mutation_p.I998V|KIAA0586_uc010tru.1_Missense_Mutation_p.I998V	p.I1062V	NM_014749	NP_055564	WXS	Illumina HiSeq	Unspecified	E9PGW8	E9PGW8_HUMAN			22	3457	+			1062					B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	c.3184A>G	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	A	4.930	0.172807	0.09391	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	4.66	0.74	0.18330	.	0.530435	0.17613	N	0.167999	T	0.31702	0.0805	M	0.63428	1.95	0.20638	N	0.999876	B;B;B;B;B;B	0.16396	0.009;0.009;0.006;0.0;0.009;0.017	B;B;B;B;B;B	0.18871	0.005;0.005;0.023;0.001;0.005;0.009	T	0.23119	-1.0197	10	0.06365	T	0.9	.	0.9026	0.01277	0.4124:0.1601:0.2731:0.1544	.	998;998;1191;1062;1123;1094	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	V	1191;1123;1094;1062;998	ENSP00000346359:I1191V;ENSP00000452351:I1123V;ENSP00000399427:I1094V;ENSP00000261244:I1062V	ENSP00000261244:I1062V	I	+	1	0	KIAA0586	58024465	0.006000	0.16342	0.986000	0.45419	0.879000	0.50718	0.694000	0.25512	0.394000	0.25230	0.473000	0.43528	ATT		0.473	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		6	21	0	0	0	0.001984	0	6	21				
RHOJ	57381	broad.mit.edu	37	14	63735881	63735882	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:63735881_63735882GG>TT	ENST00000316754.3	+	2	694_695	c.232_233GG>TT	c.(232-234)GGa>TTa	p.G78L	RHOJ_ENST00000555125.1_Missense_Mutation_p.G78L|RHOJ_ENST00000557133.1_3'UTR	NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J	78					actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		TGACACCGCGGGACAGGTACAT	0.446																																							uc001xgb.1		NA																	0					0						c.(232-234)GGA>TTA		ras homolog gene family, member J precursor																																				SO:0001583	missense	57381				actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity	g.chr14:63735881_63735882GG>TT	AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	Exception_encountered	14.37:g.63735881_63735882delinsTT	ENSP00000316729:p.Gly78Leu		Somatic					p.G78L	NM_020663	NP_065714	WXS	Illumina HiSeq	Unspecified	Q9H4E5	RHOJ_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)	2	675_676	+			78			GTP (By similarity).		Q96KC1	Missense_Mutation	DNP	ENST00000316754.3	37	c.232_233GG>TT	CCDS9757.1																																																																																				0.446	RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276975.3			18	62	0	0	0	0.004672	0	18	62				
SYNE2	23224	broad.mit.edu	37	14	64447432	64447432	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:64447432G>C	ENST00000344113.4	+	15	1842	c.1630G>C	c.(1630-1632)Gaa>Caa	p.E544Q	SYNE2_ENST00000358025.3_Missense_Mutation_p.E544Q|SYNE2_ENST00000554584.1_Missense_Mutation_p.E544Q|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	544					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAATGTGGAGAAATTTATAA	0.294																																							uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(1630-1632)GAA>CAA		spectrin repeat containing, nuclear envelope 2							37.0	35.0	36.0					14																	64447432		1790	4052	5842	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64447432G>C	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.1630G>C	14.37:g.64447432G>C	ENSP00000341781:p.Glu544Gln		Somatic				SYNE2_uc001xgl.2_Missense_Mutation_p.E544Q	p.E544Q	NM_015180	NP_055995	WXS	Illumina HiSeq	Unspecified	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	15	1860	+			544			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.1630G>C	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	8.928	0.962660	0.18583	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.61158	0.48;0.48;0.13	5.93	4.87	0.63330	.	0.209202	0.33005	N	0.005388	T	0.68622	0.3021	M	0.71036	2.16	0.80722	D	1	D;D	0.63880	0.988;0.993	P;P	0.57776	0.676;0.827	T	0.71020	-0.4713	10	0.66056	D	0.02	.	11.4292	0.50029	0.1383:0.0:0.8617:0.0	.	544;544	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	Q	544	ENSP00000350719:E544Q;ENSP00000341781:E544Q;ENSP00000452570:E544Q	ENSP00000261678:E544Q	E	+	1	0	SYNE2	63517185	1.000000	0.71417	0.996000	0.52242	0.567000	0.35839	4.121000	0.57904	2.814000	0.96858	0.591000	0.81541	GAA		0.294	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		5	16	0	0	0	0.001168	0	5	16				
SPTB	6710	broad.mit.edu	37	14	65240051	65240051	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:65240051T>A	ENST00000389721.5	-	24	5097	c.5065A>T	c.(5065-5067)Atg>Ttg	p.M1689L	SPTB_ENST00000389722.3_Missense_Mutation_p.M1689L|SPTB_ENST00000542895.1_Missense_Mutation_p.M1689L|SPTB_ENST00000389720.3_Missense_Mutation_p.M1689L|SPTB_ENST00000556626.1_Missense_Mutation_p.M1689L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1689					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGGTGGTACATGTTCTCCAGC	0.562																																							uc001xht.2		NA																	0				ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11						c.(5065-5067)ATG>TTG		spectrin beta isoform b							134.0	112.0	120.0					14																	65240051		2203	4300	6503	SO:0001583	missense	6710				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton	g.chr14:65240051T>A		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5065A>T	14.37:g.65240051T>A	ENSP00000374371:p.Met1689Leu		Somatic				SPTB_uc001xhr.2_Missense_Mutation_p.M1689L|SPTB_uc001xhs.2_Missense_Mutation_p.M1689L|SPTB_uc001xhu.2_Missense_Mutation_p.M1689L|SPTB_uc010aqi.2_Missense_Mutation_p.M350L	p.M1689L	NM_000347	NP_000338	WXS	Illumina HiSeq	Unspecified	P11277	SPTB1_HUMAN		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)	24	5119	-		all_lung(585;4.15e-09)	1689			Spectrin 14.		Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	c.5065A>T	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	T	6.937	0.542633	0.13250	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.70399	-0.39;0.36;-0.39;-0.48;-0.48;-0.36	5.1	3.94	0.45596	.	0.198101	0.53938	D	0.000056	T	0.56381	0.1981	L	0.29908	0.895	0.28611	N	0.908668	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.10450	0.005;0.002;0.0	T	0.48547	-0.9026	10	0.31617	T	0.26	.	10.2415	0.43314	0.0:0.0805:0.0:0.9195	.	473;1689;1693	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	L	1693;1689;473;354;1689;1689;1689;1689	ENSP00000374372:M1689L;ENSP00000451324:M354L;ENSP00000451752:M1689L;ENSP00000374371:M1689L;ENSP00000443882:M1689L;ENSP00000374370:M1689L	ENSP00000334218:M473L	M	-	1	0	SPTB	64309804	0.335000	0.24748	1.000000	0.80357	0.341000	0.28922	1.292000	0.33342	0.885000	0.36088	-0.441000	0.05720	ATG		0.562	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			39	82	0	0	0	0.00874	0	39	82				
SPTB	6710	broad.mit.edu	37	14	65253478	65253478	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:65253478C>T	ENST00000389721.5	-	15	3237	c.3205G>A	c.(3205-3207)Gat>Aat	p.D1069N	SPTB_ENST00000389722.3_Missense_Mutation_p.D1069N|SPTB_ENST00000542895.1_Missense_Mutation_p.D1069N|SPTB_ENST00000389720.3_Missense_Mutation_p.D1069N|SPTB_ENST00000556626.1_Missense_Mutation_p.D1069N	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1069					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TCATCCAGATCCTGCAGGAAG	0.622																																							uc001xht.2		NA																	0				ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11						c.(3205-3207)GAT>AAT		spectrin beta isoform b							51.0	56.0	54.0					14																	65253478		2203	4300	6503	SO:0001583	missense	6710				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton	g.chr14:65253478C>T		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3205G>A	14.37:g.65253478C>T	ENSP00000374371:p.Asp1069Asn		Somatic				SPTB_uc001xhr.2_Missense_Mutation_p.D1069N|SPTB_uc001xhs.2_Missense_Mutation_p.D1069N|SPTB_uc001xhu.2_Missense_Mutation_p.D1069N	p.D1069N	NM_000347	NP_000338	WXS	Illumina HiSeq	Unspecified	P11277	SPTB1_HUMAN		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)	15	3259	-		all_lung(585;4.15e-09)	1069			Spectrin 8.		Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	c.3205G>A	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900322	0.52227	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	4.89	0.959	0.19624	.	0.231315	0.42420	N	0.000708	T	0.50735	0.1633	M	0.80332	2.49	0.43330	D	0.995369	B;B	0.15473	0.011;0.013	B;B	0.25405	0.06;0.033	T	0.43718	-0.9374	10	0.52906	T	0.07	.	6.3903	0.21583	0.0:0.6374:0.1316:0.231	.	1069;1073	P11277;Q59FP5	SPTB1_HUMAN;.	N	1073;1069;1069;1069;1069;1069	ENSP00000374372:D1069N;ENSP00000451752:D1069N;ENSP00000374371:D1069N;ENSP00000443882:D1069N;ENSP00000374370:D1069N	ENSP00000374370:D1069N	D	-	1	0	SPTB	64323231	0.805000	0.28982	0.991000	0.47740	0.862000	0.49288	1.601000	0.36773	-0.024000	0.13941	0.549000	0.68633	GAT		0.622	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			25	44	0	0	0	0.008361	0	25	44				
ZFYVE26	23503	broad.mit.edu	37	14	68220796	68220796	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:68220796C>T	ENST00000347230.4	-	38	7258	c.7120G>A	c.(7120-7122)Gcc>Acc	p.A2374T	RN7SL213P_ENST00000463482.2_RNA|ZFYVE26_ENST00000557306.1_Missense_Mutation_p.A220T	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2374					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ACCTTGCAGGCAACATCCATT	0.438																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.(7120-7122)GCC>ACC		zinc finger, FYVE domain containing 26							207.0	194.0	199.0					14																	68220796		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68220796C>T	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.7120G>A	14.37:g.68220796C>T	ENSP00000251119:p.Ala2374Thr		Somatic				ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkb.2_Missense_Mutation_p.A220T	p.A2374T	NM_015346	NP_056161	WXS	Illumina HiSeq	Unspecified	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	38	7259	-			2374					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.7120G>A	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	35	5.574827	0.96553	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000557306	T;T	0.51574	1.43;0.7	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.70482	0.3229	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.83275	0.948;0.996	T	0.71411	-0.4601	10	0.72032	D	0.01	-16.4659	20.0787	0.97763	0.0:1.0:0.0:0.0	.	220;2374	Q96H43;Q68DK2	.;ZFY26_HUMAN	T	2374;2353;220	ENSP00000251119:A2374T;ENSP00000452142:A220T	ENSP00000251119:A2374T	A	-	1	0	ZFYVE26	67290549	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.586000	0.82596	2.757000	0.94681	0.462000	0.41574	GCC		0.438	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		49	160	0	0	0	0.00361	0	49	160				
KIAA0247	9766	broad.mit.edu	37	14	70170113	70170113	+	Splice_Site	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:70170113G>T	ENST00000342745.4	+	3	436	c.123G>T	c.(121-123)gtG>gtT	p.V41V		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	41	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		TCTTTGCAGTGTGCCCCCTAC	0.592																																							uc001xlk.2		NA																	0				ovary(3)	3						c.(121-123)GTG>GTT		hypothetical protein LOC9766 precursor							81.0	81.0	81.0					14																	70170113		2203	4300	6503	SO:0001630	splice_region_variant	9766					integral to membrane		g.chr14:70170113G>T	D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.122-1G>T	14.37:g.70170113G>T			Somatic				KIAA0247_uc010aqz.2_Silent_p.V16V	p.V41V	NM_014734	NP_055549	WXS	Illumina HiSeq	Unspecified	Q92537	K0247_HUMAN		all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)	3	439	+			41			Sushi.|Extracellular (Potential).			Silent	SNP	ENST00000342745.4	37	c.123G>T	CCDS9796.1																																																																																				0.592	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412453.1	NM_014734	Silent	37	114	1	0	5.73435e-26	0.00361	7.29826e-26	37	114				
KIAA0247	9766	broad.mit.edu	37	14	70170115	70170115	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:70170115G>T	ENST00000342745.4	+	3	438	c.125G>T	c.(124-126)tGc>tTc	p.C42F		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	42	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		TTTGCAGTGTGCCCCCTACCA	0.587																																							uc001xlk.2		NA																	0				ovary(3)	3						c.(124-126)TGC>TTC		hypothetical protein LOC9766 precursor							81.0	81.0	81.0					14																	70170115		2203	4300	6503	SO:0001583	missense	9766					integral to membrane		g.chr14:70170115G>T	D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.125G>T	14.37:g.70170115G>T	ENSP00000344424:p.Cys42Phe		Somatic				KIAA0247_uc010aqz.2_Missense_Mutation_p.C17F	p.C42F	NM_014734	NP_055549	WXS	Illumina HiSeq	Unspecified	Q92537	K0247_HUMAN		all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)	3	441	+			42			Sushi.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000342745.4	37	c.125G>T	CCDS9796.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921743	0.92319	.	.	ENSG00000100647	ENST00000342745	D	0.99784	-6.74	5.9	5.9	0.94986	Complement control module (2);Sushi/SCR/CCP (3);	0.086330	0.85682	D	0.000000	D	0.99661	0.9874	M	0.81802	2.56	0.80722	D	1	P	0.41748	0.761	P	0.51487	0.671	D	0.97938	1.0324	10	0.87932	D	0	-11.0053	20.263	0.98456	0.0:0.0:1.0:0.0	.	42	Q92537	K0247_HUMAN	F	42	ENSP00000344424:C42F	ENSP00000344424:C42F	C	+	2	0	KIAA0247	69239868	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.476000	0.97823	2.788000	0.95919	0.655000	0.94253	TGC		0.587	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412453.1	NM_014734		37	110	1	0	2.9001e-28	0.00361	3.7117e-28	37	110				
AREL1	9870	broad.mit.edu	37	14	75131573	75131573	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:75131573A>G	ENST00000356357.4	-	18	2674	c.2159T>C	c.(2158-2160)gTa>gCa	p.V720A	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	720	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ACCAACAACTACTGCATGGGC	0.418																																							uc001xqb.2		NA																	0				ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5						c.(2158-2160)GTA>GCA		hypothetical protein LOC9870							97.0	95.0	96.0					14																	75131573		1978	4157	6135	SO:0001583	missense	9870				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity	g.chr14:75131573A>G	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.2159T>C	14.37:g.75131573A>G	ENSP00000348714:p.Val720Ala		Somatic				KIAA0317_uc010tut.1_Missense_Mutation_p.V559A	p.V720A	NM_001039479	NP_001034568	WXS	Illumina HiSeq	Unspecified	O15033	K0317_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00404)	18	2664	-			720			HECT.		B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	c.2159T>C	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126696	0.56721	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.58797	0.31;0.31	5.4	5.4	0.78164	HECT (4);	0.051592	0.85682	D	0.000000	T	0.47340	0.1440	L	0.33710	1.025	0.80722	D	1	B	0.29766	0.256	B	0.33960	0.173	T	0.38735	-0.9647	10	0.09843	T	0.71	.	15.7285	0.77784	1.0:0.0:0.0:0.0	.	720	O15033	K0317_HUMAN	A	720;559;559	ENSP00000348714:V720A;ENSP00000452101:V559A	ENSP00000348714:V720A	V	-	2	0	KIAA0317	74201326	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.034000	0.93747	2.173000	0.68751	0.528000	0.53228	GTA		0.418	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821		21	47	0	0	0	0.003954	0	21	47				
GPATCH2L	55668	broad.mit.edu	37	14	76638254	76638254	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:76638254C>T	ENST00000261530.7	+	4	862	c.796C>T	c.(796-798)Ctg>Ttg	p.L266L	GPATCH2L_ENST00000312858.5_Silent_p.L266L|GPATCH2L_ENST00000556663.1_Silent_p.L266L|GPATCH2L_ENST00000557263.1_Silent_p.L266L	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	266																	CCCTAATCTTCTGCCCAAGTG	0.413																																							uc001xsh.2		NA																	0				ovary(2)|skin(1)	3						c.(796-798)CTG>TTG		hypothetical protein LOC55668 isoform 1							179.0	172.0	174.0					14																	76638254		2203	4300	6503	SO:0001819	synonymous_variant	55668							g.chr14:76638254C>T	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.796C>T	14.37:g.76638254C>T			Somatic				C14orf118_uc001xsi.2_Silent_p.L266L|C14orf118_uc001xsj.1_Silent_p.L266L|C14orf118_uc001xsk.1_Silent_p.L266L|C14orf118_uc001xsl.2_RNA	p.L266L	NM_017926	NP_060396	WXS	Illumina HiSeq	Unspecified	Q9NWQ4	CN118_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0172)	4	882	+			266					B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Silent	SNP	ENST00000261530.7	37	c.796C>T	CCDS9848.1																																																																																				0.413	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000413698.2	NM_017926		50	104	0	0	0	0.00361	0	50	104				
CEP128	145508	broad.mit.edu	37	14	81209499	81209499	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:81209499T>A	ENST00000555265.1	-	19	3101	c.2726A>T	c.(2725-2727)aAg>aTg	p.K909M	CEP128_ENST00000281129.3_Missense_Mutation_p.K909M			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	909						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTCAGATTCCTTGTTTTCAGT	0.433																																							uc001xux.2		NA																	0					0						c.(2725-2727)AAG>ATG		hypothetical protein LOC145508							115.0	103.0	107.0					14																	81209499		2203	4300	6503	SO:0001583	missense	145508					centriole|spindle pole		g.chr14:81209499T>A	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2726A>T	14.37:g.81209499T>A	ENSP00000451162:p.Lys909Met		Somatic				C14orf145_uc010asz.1_RNA	p.K909M	NM_152446	NP_689659	WXS	Illumina HiSeq	Unspecified	Q6ZU80	CE128_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0586)	18	2897	-			909			Potential.		B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	c.2726A>T	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	T	12.98	2.100888	0.37048	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000554728	T;T	0.35236	1.32;1.32	5.34	4.17	0.49024	.	0.181870	0.39759	N	0.001272	T	0.45975	0.1369	L	0.50333	1.59	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	T	0.39820	-0.9595	10	0.44086	T	0.13	.	5.745	0.18114	0.0:0.1479:0.15:0.7022	.	909	Q6ZU80	CE128_HUMAN	M	909;909;909;110	ENSP00000281129:K909M;ENSP00000451162:K909M	ENSP00000281129:K909M	K	-	2	0	CEP128	80279252	1.000000	0.71417	0.997000	0.53966	0.055000	0.15305	1.689000	0.37700	2.150000	0.67090	0.459000	0.35465	AAG		0.433	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446		32	78	0	0	0	0.004878	0	32	78				
KCNK13	56659	broad.mit.edu	37	14	90650453	90650453	+	Splice_Site	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:90650453A>G	ENST00000282146.4	+	2	775		c.e2-1			NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13						synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TCTCTCCTGCAGGGTTTGGGA	0.458																																							uc001xye.1		NA																	0				skin(1)	1						c.e2-2		potassium channel, subfamily K, member 13							75.0	80.0	78.0					14																	90650453		2203	4300	6503	SO:0001630	splice_region_variant	56659					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:90650453A>G	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.335-1A>G	14.37:g.90650453A>G			Somatic					p.G112_splice	NM_022054	NP_071337	WXS	Illumina HiSeq	Unspecified	Q9HB14	KCNKD_HUMAN			2	777	+		all_cancers(154;0.186)						B5TJL8|Q96E79	Splice_Site	SNP	ENST00000282146.4	37	c.335_splice	CCDS9889.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912859	0.52439	.	.	ENSG00000152315	ENST00000282146	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2351	0.73422	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNK13	89720206	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	9.334000	0.96470	2.003000	0.58678	0.533000	0.62120	.		0.458	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	Intron	24	55	0	0	0	0.004656	0	24	55				
DICER1	23405	broad.mit.edu	37	14	95562743	95562743	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:95562743G>A	ENST00000526495.1	-	25	4805	c.4514C>T	c.(4513-4515)tCt>tTt	p.S1505F	DICER1_ENST00000393063.1_Missense_Mutation_p.S1505F|DICER1_ENST00000556045.1_Missense_Mutation_p.S403F|DICER1_ENST00000527414.1_Missense_Mutation_p.S1505F|DICER1_ENST00000343455.3_Missense_Mutation_p.S1505F|DICER1_ENST00000541352.1_Missense_Mutation_p.S1505F			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1505					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TGCATCCCAAGAGCTGTAGTC	0.408			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														uc001ydw.2		NA	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	Mis F|N	"""dicer 1, ribonuclease type III """			"""E, M, O"""		pleuropulmonary blastoma			0				skin(2)|ovary(1)|pancreas(1)|lung(1)	5						c.(4513-4515)TCT>TTT		dicer1							81.0	79.0	79.0					14																	95562743		2203	4300	6503	SO:0001583	missense	23405	DICER_1_syndrome_|Familial_Multinodular_Goiter_	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr14:95562743G>A	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.4514C>T	14.37:g.95562743G>A	ENSP00000437256:p.Ser1505Phe		Somatic				DICER1_uc010avh.1_Missense_Mutation_p.S403F|DICER1_uc001ydv.2_Missense_Mutation_p.S1495F|DICER1_uc001ydx.2_Missense_Mutation_p.S1505F|DICER1_uc001ydy.1_Missense_Mutation_p.S357F	p.S1505F	NM_030621	NP_085124	WXS	Illumina HiSeq	Unspecified	Q9UPY3	DICER_HUMAN		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)	24	4696	-		all_cancers(154;0.0621)|all_epithelial(191;0.223)	1505					A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	c.4514C>T	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284535	0.80803	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	T;T;T;T;D;T	0.89875	0.14;0.14;0.14;0.14;-2.58;0.44	5.74	5.74	0.90152	Ribonuclease III (3);	0.159824	0.56097	D	0.000021	D	0.91858	0.7423	L	0.40543	1.245	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.984	D;D;P	0.77557	0.99;0.977;0.857	D	0.88110	0.2825	10	0.19590	T	0.45	-18.6062	20.2825	0.98528	0.0:0.0:1.0:0.0	.	403;1505;1505	B3KRG4;E0AD28;Q9UPY3	.;.;DICER_HUMAN	F	1505;1505;1505;1505;403;1505	ENSP00000343745:S1505F;ENSP00000437256:S1505F;ENSP00000376783:S1505F;ENSP00000435681:S1505F;ENSP00000451041:S403F;ENSP00000444719:S1505F	ENSP00000343745:S1505F	S	-	2	0	DICER1	94632496	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.378000	0.97191	2.873000	0.98535	0.561000	0.74099	TCT		0.408	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1			20	44	0	0	0	0.008871	0	20	44				
TCL1A	8115	broad.mit.edu	37	14	96180344	96180345	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:96180344_96180345GG>TT	ENST00000402399.1	-	1	188_189	c.59_60CC>AA	c.(58-60)gCC>gAA	p.A20E	RP11-164H13.1_ENST00000556386.1_RNA|TCL1A_ENST00000554012.1_Missense_Mutation_p.A20E|TCL1A_ENST00000556450.1_Missense_Mutation_p.A20E|RP11-164H13.1_ENST00000553445.1_RNA|RP11-164H13.1_ENST00000547644.2_RNA|TCL1A_ENST00000555202.1_Missense_Mutation_p.A20E	NM_021966.2	NP_068801.1	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	20					multicellular organismal development (GO:0007275)|stem cell maintenance (GO:0019827)	cell cortex (GO:0005938)|endoplasmic reticulum (GO:0005783)|pronucleus (GO:0045120)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		ACTTCTCCCAGGCCCACAGGCG	0.653			T	TRA@	T-CLL																																Ovarian(96;1068 2019 35393 39316)	Ovarian(96;1068 2019 35393 39316)	uc001yfc.3		NA		Dom	yes		14	14q32.1	8115	T	T-cell leukemia/lymphoma 1A			L	TRA@		T-CLL		0				lung(1)	1						c.(58-60)GCC>GAA		T-cell leukemia/lymphoma 1A																																				SO:0001583	missense	8115				multicellular organismal development	endoplasmic reticulum|microsome		g.chr14:96180344_96180345GG>TT	X82240	CCDS9941.1	14q32.1	2008-07-03				ENSG00000100721			11648	protein-coding gene	gene with protein product		186960				2783489, 7809072	Standard	NM_021966		Approved	TCL1	uc001yfb.4	P56279		ENST00000402399.1:c.59_60delinsTT	14.37:g.96180344_96180345delinsTT	ENSP00000385036:p.Ala20Glu		Somatic				uc001yfd.1_5'Flank|TCL1A_uc001yfb.3_Missense_Mutation_p.A20E	p.A20E	NM_001098725	NP_001092195	WXS	Illumina HiSeq	Unspecified	P56279	TCL1A_HUMAN		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)	1	189_190	-		all_cancers(154;0.103)	20					Q6IBK7	Missense_Mutation	DNP	ENST00000402399.1	37	c.59_60CC>AA	CCDS9941.1																																																																																				0.653	TCL1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413246.1			46	89	0	0	0	0.004672	0	46	89				
LOC101927079	101927079	broad.mit.edu	37	15	22332432	22332432	+	RNA	SNP	C	C	T	rs376977769		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:22332432C>T	ENST00000558896.1	+	0	239																											AAGATTCTAACGTGACAGAAC	0.343																																							uc001yuc.1		NA																	0				ovary(4)|skin(1)	5						c.(-744--740)AACGT>AATGT		olfactory receptor, family 4, subfamily N,																																						283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22332432C>T																													15.37:g.22332432C>T			Somatic				LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron		NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	3	239	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)							Translation_Start_Site	SNP	ENST00000558896.1	37	c.-742C>T																																																																																					0.343	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000417625.1			4	39	0	0	0	0.009096	0	4	39				
HERC2	8924	broad.mit.edu	37	15	28369251	28369251	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:28369251C>A	ENST00000261609.7	-	85	13228	c.13120G>T	c.(13120-13122)Gac>Tac	p.D4374Y		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCAGTTTCGTCGAGCGAGCCT	0.562																																							uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(13120-13122)GAC>TAC		hect domain and RLD 2							100.0	92.0	95.0					15																	28369251		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28369251C>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13120G>T	15.37:g.28369251C>A	ENSP00000261609:p.Asp4374Tyr		Somatic					p.D4374Y	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	85	13226	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	4374						Missense_Mutation	SNP	ENST00000261609.7	37	c.13120G>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135433	0.37728	.	.	ENSG00000128731	ENST00000261609	T	0.39406	1.08	5.55	4.62	0.57501	.	0.230823	0.43919	D	0.000511	T	0.39036	0.1063	L	0.51422	1.61	0.51767	D	0.999935	P	0.44816	0.844	B	0.39339	0.297	T	0.22034	-1.0228	10	0.35671	T	0.21	.	15.9933	0.80223	0.0:0.8478:0.1522:0.0	.	4374	O95714	HERC2_HUMAN	Y	4374	ENSP00000261609:D4374Y	ENSP00000261609:D4374Y	D	-	1	0	HERC2	26042846	1.000000	0.71417	0.004000	0.12327	0.037000	0.13140	6.184000	0.72008	1.294000	0.44707	0.655000	0.94253	GAC		0.562	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		31	68	1	0	1.99505e-19	0.002445	2.47936e-19	31	68				
RYR3	6263	broad.mit.edu	37	15	33878235	33878235	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:33878235G>T	ENST00000389232.4	+	16	1776	c.1706G>T	c.(1705-1707)aGc>aTc	p.S569I	RYR3_ENST00000415757.3_Missense_Mutation_p.S569I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	569					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTAACTGAAAGCCCAGAAGCC	0.448																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(1705-1707)AGC>ATC		ryanodine receptor 3							143.0	130.0	134.0					15																	33878235		1922	4133	6055	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33878235G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1706G>T	15.37:g.33878235G>T	ENSP00000373884:p.Ser569Ile		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.S569I	p.S569I	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	16	1776	+		all_lung(180;7.18e-09)	569			Cytoplasmic (By similarity).		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.1706G>T	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869611	0.91587	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96104	-3.91;-3.91	5.14	5.14	0.70334	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.98090	0.9370	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.98715	1.0706	10	0.72032	D	0.01	.	18.8054	0.92035	0.0:0.0:1.0:0.0	.	569;569	Q15413-2;Q15413	.;RYR3_HUMAN	I	569	ENSP00000373884:S569I;ENSP00000399610:S569I	ENSP00000354735:S569I	S	+	2	0	RYR3	31665527	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.507000	0.97996	2.697000	0.92050	0.655000	0.94253	AGC		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			28	45	1	0	3.93418e-24	0.004289	4.96112e-24	28	45				
MFAP1	4236	broad.mit.edu	37	15	44106739	44106739	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:44106739C>T	ENST00000267812.3	-	4	809	c.577G>A	c.(577-579)Gat>Aat	p.D193N		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	193					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TCCATCTCATCTTCACTGTCT	0.448																																							uc001zth.1		NA																	0				skin(1)	1						c.(577-579)GAT>AAT		microfibrillar-associated protein 1							231.0	216.0	221.0					15																	44106739		2198	4298	6496	SO:0001583	missense	4236					microfibril		g.chr15:44106739C>T		CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.577G>A	15.37:g.44106739C>T	ENSP00000267812:p.Asp193Asn		Somatic					p.D193N	NM_005926	NP_005917	WXS	Illumina HiSeq	Unspecified	P55081	MFAP1_HUMAN		GBM - Glioblastoma multiforme(94;4.33e-07)	4	761	-		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	193					Q86TG6	Missense_Mutation	SNP	ENST00000267812.3	37	c.577G>A	CCDS10105.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696950	0.88830	.	.	ENSG00000140259	ENST00000267812	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.74619	0.3740	L	0.42529	1.33	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.74417	-0.3672	9	0.56958	D	0.05	-25.3127	19.5698	0.95407	0.0:1.0:0.0:0.0	.	193	P55081	MFAP1_HUMAN	N	193	.	ENSP00000267812:D193N	D	-	1	0	MFAP1	41894031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.797000	0.96272	0.563000	0.77884	GAT		0.448	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133491.2	NM_005926		71	128	0	0	0	0.00361	0	71	128				
PRTG	283659	broad.mit.edu	37	15	55964742	55964742	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:55964742T>A	ENST00000389286.4	-	11	1989	c.1942A>T	c.(1942-1944)Att>Ttt	p.I648F		NM_173814.4	NP_776175.2			protogenin									p.I648F(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		TAGCCCTGAATAGCAGCTGTG	0.488																																							uc002adg.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(1942-1944)ATT>TTT		protogenin precursor							113.0	111.0	112.0					15																	55964742		1943	4130	6073	SO:0001583	missense	283659				multicellular organismal development	integral to membrane		g.chr15:55964742T>A	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1942A>T	15.37:g.55964742T>A	ENSP00000373937:p.Ile648Phe		Somatic				PRTG_uc002adh.2_Missense_Mutation_p.I150F	p.I648F	NM_173814	NP_776175	WXS	Illumina HiSeq	Unspecified	Q2VWP7	PRTG_HUMAN		all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)	11	1990	-			648			Fibronectin type-III 3.			Missense_Mutation	SNP	ENST00000389286.4	37	c.1942A>T	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	T	13.75	2.331340	0.41297	.	.	ENSG00000166450	ENST00000389286	T	0.61040	0.14	5.52	0.0493	0.14289	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.604083	0.17708	N	0.164662	T	0.59459	0.2195	M	0.84683	2.71	0.80722	D	1	P	0.43542	0.81	B	0.40375	0.327	T	0.66260	-0.5968	10	0.87932	D	0	-12.192	11.099	0.48163	0.0:0.3586:0.0:0.6414	.	648	Q2VWP7	PRTG_HUMAN	F	648	ENSP00000373937:I648F	ENSP00000373937:I648F	I	-	1	0	PRTG	53752034	0.992000	0.36948	0.361000	0.25849	0.770000	0.43624	1.096000	0.30976	0.065000	0.16485	0.528000	0.53228	ATT		0.488	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814		17	41	0	0	0	0.008871	0	17	41				
SLTM	79811	broad.mit.edu	37	15	59193471	59193471	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:59193471C>A	ENST00000380516.2	-	6	664	c.577G>T	c.(577-579)Gaa>Taa	p.E193*	SLTM_ENST00000557950.1_5'UTR|SLTM_ENST00000536328.1_5'UTR	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	193	Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTCTCATTTTCTTCTTCCTCA	0.254																																							uc002afp.2		NA																	0				ovary(1)	1						c.(577-579)GAA>TAA		modulator of estrogen induced transcription							50.0	53.0	52.0					15																	59193471		2182	4269	6451	SO:0001587	stop_gained	79811				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding	g.chr15:59193471C>A	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.577G>T	15.37:g.59193471C>A	ENSP00000369887:p.Glu193*		Somatic				SLTM_uc002afo.2_Nonsense_Mutation_p.E193*|SLTM_uc002afq.2_5'UTR|SLTM_uc010bgd.2_5'UTR|SLTM_uc002afr.1_Nonsense_Mutation_p.E111*	p.E193*	NM_024755	NP_079031	WXS	Illumina HiSeq	Unspecified	Q9NWH9	SLTM_HUMAN			6	665	-			193			Glu-rich.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Nonsense_Mutation	SNP	ENST00000380516.2	37	c.577G>T	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469876	0.84533	.	.	ENSG00000137776	ENST00000380516;ENST00000249736	.	.	.	5.61	5.61	0.85477	.	0.000000	0.52532	D	0.000066	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.1798	0.89773	0.0:1.0:0.0:0.0	.	.	.	.	X	193	.	ENSP00000249736:E193X	E	-	1	0	SLTM	56980763	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.159000	0.71856	2.813000	0.96785	0.655000	0.94253	GAA		0.254	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755		21	38	1	0	7.68411e-24	0.008361	9.6544e-24	21	38				
PIF1	80119	broad.mit.edu	37	15	65108962	65108962	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:65108962G>T	ENST00000268043.4	-	12	1771	c.1677C>A	c.(1675-1677)ggC>ggA	p.G559G	PIF1_ENST00000559239.1_Silent_p.G559G|PIF1_ENST00000333425.6_Silent_p.G559G					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						CCAGGGTCATGCCCTGGGGGA	0.617																																							uc002ant.2		NA																	0					0						c.(1675-1677)GGC>GGA		DNA helicase homolog PIF1							34.0	30.0	31.0					15																	65108962		2194	4290	6484	SO:0001819	synonymous_variant	80119				negative regulation of telomerase activity|regulation of telomere maintenance|viral genome replication	nuclear chromosome, telomeric region	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' DNA/RNA helicase activity|magnesium ion binding|single-stranded DNA-dependent ATP-dependent DNA helicase activity|telomeric DNA binding	g.chr15:65108962G>T	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.1677C>A	15.37:g.65108962G>T			Somatic				PIF1_uc002anr.2_Silent_p.G107G|PIF1_uc002ans.2_Silent_p.G250G|PIF1_uc010uiq.1_Silent_p.G559G	p.G559G	NM_025049	NP_079325	WXS	Illumina HiSeq	Unspecified	Q9H611	PIF1_HUMAN			12	1743	-			559			Hydrolyzes ATP in the presence of both magnesium and single-stranded DNA; weak activity in the presence of RNA or double-stranded DNA; No unwinding activity.			Silent	SNP	ENST00000268043.4	37	c.1677C>A	CCDS10195.2																																																																																				0.617	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	NM_025049		13	34	1	0	0.00136819	0.001368	0.0014178	13	34				
PDCD7	10081	broad.mit.edu	37	15	65411716	65411716	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:65411716G>A	ENST00000204549.4	-	4	1386	c.1332C>T	c.(1330-1332)atC>atT	p.I444I		NM_005707.1	NP_005698.1	Q8N8D1	PDCD7_HUMAN	programmed cell death 7	444					apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of T cell apoptotic process (GO:0070234)|response to glucocorticoid (GO:0051384)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)				endometrium(4)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7						CCTCTGACCTGATCTGGATGA	0.473																																							uc002aol.2		NA																	0					0						c.(1330-1332)ATC>ATT		programmed cell death 7							46.0	46.0	46.0					15																	65411716		2202	4299	6501	SO:0001819	synonymous_variant	10081				apoptosis|induction of apoptosis|response to glucocorticoid stimulus	U12-type spliceosomal complex		g.chr15:65411716G>A	AF083930	CCDS10201.1	15q22.2	2012-06-07			ENSG00000090470	ENSG00000090470			8767	protein-coding gene	gene with protein product	"""U11/U12 snRNP 59K"""	608138				10037816	Standard	NM_005707		Approved	HES18, ES18	uc002aol.3	Q8N8D1	OTTHUMG00000133117	ENST00000204549.4:c.1332C>T	15.37:g.65411716G>A			Somatic					p.I444I	NM_005707	NP_005698	WXS	Illumina HiSeq	Unspecified	Q8N8D1	PDCD7_HUMAN			4	1387	-			444					Q96AK8|Q9Y6D7	Silent	SNP	ENST00000204549.4	37	c.1332C>T	CCDS10201.1																																																																																				0.473	PDCD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256784.2	NM_005707		12	24	0	0	0	0.00245	0	12	24				
ADPGK	83440	broad.mit.edu	37	15	73048727	73048727	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:73048727G>A	ENST00000311669.8	-	5	798	c.705C>T	c.(703-705)ctC>ctT	p.L235L	ADPGK_ENST00000456471.2_5'Flank|ADPGK_ENST00000567733.1_Intron	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	235	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						CCCCGTTGGAGAGGTCGTGAG	0.532																																							uc002avg.3		NA																	0					0						c.(703-705)CTC>CTT		ADP-dependent glucokinase							104.0	100.0	101.0					15																	73048727		1890	4129	6019	SO:0001819	synonymous_variant	83440				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding	g.chr15:73048727G>A	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.705C>T	15.37:g.73048727G>A			Somatic				ADPGK_uc002ave.3_5'UTR|ADPGK_uc010ukw.1_Silent_p.L177L|ADPGK_uc002avf.3_Silent_p.L235L|ADPGK_uc002avi.3_Silent_p.L113L|ADPGK_uc002avh.3_5'UTR	p.L235L	NM_031284	NP_112574	WXS	Illumina HiSeq	Unspecified	Q9BRR6	ADPGK_HUMAN			5	799	-			235			ADPK.		Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Silent	SNP	ENST00000311669.8	37	c.705C>T	CCDS42057.1																																																																																				0.532	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420434.1	NM_031284		40	70	0	0	0	0.00361	0	40	70				
REC114	283677	broad.mit.edu	37	15	73852120	73852120	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:73852120C>T	ENST00000331090.6	+	6	692	c.664C>T	c.(664-666)Cat>Tat	p.H222Y	C15orf60_ENST00000560581.1_Missense_Mutation_p.H194Y	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		222					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						GGAGCTGCCCCATGTCTATGA	0.468																																							uc002avq.2		NA																	0				pancreas(1)	1						c.(664-666)CAT>TAT		hypothetical protein LOC283677							84.0	82.0	83.0					15																	73852120		1856	4085	5941	SO:0001583	missense	283677							g.chr15:73852120C>T																												ENST00000331090.6:c.664C>T	15.37:g.73852120C>T	ENSP00000328423:p.His222Tyr		Somatic				C15orf60_uc010bjb.2_Missense_Mutation_p.H194Y	p.H222Y	NM_001042367	NP_001035826	WXS	Illumina HiSeq	Unspecified	Q7Z4M0	CO060_HUMAN			6	692	+			222						Missense_Mutation	SNP	ENST00000331090.6	37	c.664C>T	CCDS45296.1	.	.	.	.	.	.	.	.	.	.	C	8.284	0.816306	0.16607	.	.	ENSG00000183324	ENST00000331090	T	0.42131	0.98	5.87	2.92	0.33932	.	1.079560	0.07018	N	0.826347	T	0.22936	0.0554	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25047	-1.0143	10	0.29301	T	0.29	-0.029	5.7151	0.17956	0.1441:0.6437:0.1387:0.0735	.	222	Q7Z4M0	CO060_HUMAN	Y	222	ENSP00000328423:H222Y	ENSP00000328423:H222Y	H	+	1	0	C15orf60	71639173	0.000000	0.05858	0.017000	0.16124	0.960000	0.62799	0.406000	0.21032	0.354000	0.24105	0.650000	0.86243	CAT		0.468	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1			27	61	0	0	0	0.005443	0	27	61				
C15orf39	56905	broad.mit.edu	37	15	75500696	75500696	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:75500696A>G	ENST00000360639.2	+	2	2627	c.2307A>G	c.(2305-2307)ggA>ggG	p.G769G	RP11-69H7.3_ENST00000563568.1_RNA|C15orf39_ENST00000394987.4_Silent_p.G769G|C15orf39_ENST00000567617.1_Silent_p.G769G			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	769						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						ATTTTACAGGACTACATGCGT	0.622																																							uc002azp.3		NA																	0					0						c.(2305-2307)GGA>GGG		hypothetical protein LOC56905							35.0	31.0	32.0					15																	75500696		2191	4294	6485	SO:0001819	synonymous_variant	56905							g.chr15:75500696A>G	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2307A>G	15.37:g.75500696A>G			Somatic				C15orf39_uc002azq.3_Silent_p.G769G|C15orf39_uc002azr.3_Silent_p.G167G	p.G769G	NM_015492	NP_056307	WXS	Illumina HiSeq	Unspecified	Q6ZRI6	CO039_HUMAN			2	2627	+			769					B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Silent	SNP	ENST00000360639.2	37	c.2307A>G	CCDS10276.1																																																																																				0.622	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492		2	7	0	0	0	0.004672	0	2	7				
AP3B2	8120	broad.mit.edu	37	15	83349890	83349890	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:83349890C>G	ENST00000261722.3	-	6	769	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	AP3B2_ENST00000535348.1_Missense_Mutation_p.E156Q|AP3B2_ENST00000535359.1_Missense_Mutation_p.E188Q|RP11-752G15.3_ENST00000560650.1_RNA	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	188					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			AGAAGCTTCTCAATGACTTCT	0.582																																							uc010uoh.1		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(562-564)GAG>CAG		adaptor-related protein complex 3, beta 2							38.0	38.0	38.0					15																	83349890		2000	4164	6164	SO:0001583	missense	8120				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	g.chr15:83349890C>G	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.562G>C	15.37:g.83349890C>G	ENSP00000261722:p.Glu188Gln		Somatic				AP3B2_uc010uoi.1_Missense_Mutation_p.E188Q|AP3B2_uc010uoj.1_Missense_Mutation_p.E156Q|AP3B2_uc010uog.1_5'Flank	p.E188Q	NM_004644	NP_004635	WXS	Illumina HiSeq	Unspecified	Q13367	AP3B2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		6	739	-			188					A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	c.562G>C	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369661	0.82573	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359;ENST00000541693	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.62	5.62	0.85841	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.126204	0.64402	D	0.000015	T	0.43411	0.1246	L	0.39085	1.19	0.80722	D	1	D;P;B	0.71674	0.998;0.943;0.41	D;P;B	0.69307	0.963;0.823;0.349	T	0.21211	-1.0252	10	0.56958	D	0.05	-33.4805	19.653	0.95825	0.0:1.0:0.0:0.0	.	156;188;188	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	Q	188;156;188;144	ENSP00000261722:E188Q;ENSP00000438721:E156Q;ENSP00000440984:E188Q;ENSP00000441961:E144Q	ENSP00000261722:E188Q	E	-	1	0	AP3B2	81146944	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.794000	0.85869	2.642000	0.89623	0.563000	0.77884	GAG		0.582	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			7	17	0	0	0	0.00308	0	7	17				
ADAMTSL3	57188	broad.mit.edu	37	15	84527563	84527563	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:84527563G>A	ENST00000286744.5	+	8	997	c.773G>A	c.(772-774)aGa>aAa	p.R258K	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R258K	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	258						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CGAAGTGTGAGAATTACAGTG	0.358																																							uc002bjz.3		NA																	0				ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(772-774)AGA>AAA		ADAMTS-like 3 precursor							115.0	115.0	115.0					15																	84527563		2203	4300	6503	SO:0001583	missense	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84527563G>A	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.773G>A	15.37:g.84527563G>A	ENSP00000286744:p.Arg258Lys		Somatic				ADAMTSL3_uc002bjy.1_Missense_Mutation_p.R258K|ADAMTSL3_uc010bmt.1_Missense_Mutation_p.R258K|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.R258K	p.R258K	NM_207517	NP_997400	WXS	Illumina HiSeq	Unspecified	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		8	997	+			258					A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	c.773G>A	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191035	0.78789	.	.	ENSG00000156218	ENST00000286744	T	0.64085	-0.08	4.55	4.55	0.56014	.	0.053033	0.64402	D	0.000010	T	0.71476	0.3344	L	0.43757	1.38	0.41984	D	0.990819	D;D	0.69078	0.997;0.994	D;D	0.72625	0.978;0.97	T	0.72918	-0.4146	10	0.49607	T	0.09	.	14.8541	0.70323	0.0:0.0:1.0:0.0	.	258;258	P82987-2;P82987	.;ATL3_HUMAN	K	258	ENSP00000286744:R258K	ENSP00000286744:R258K	R	+	2	0	ADAMTSL3	82318567	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	5.608000	0.67654	2.340000	0.79590	0.591000	0.81541	AGA		0.358	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		33	71	0	0	0	0.006999	0	33	71				
AEN	64782	broad.mit.edu	37	15	89169692	89169692	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:89169692G>C	ENST00000332810.3	+	2	403	c.252G>C	c.(250-252)ctG>ctC	p.L84L	AEN_ENST00000379231.3_Silent_p.L84L	NM_022767.3	NP_073604.3	Q8WTP8	AEN_HUMAN	apoptosis enhancing nuclease	84					intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)	p.L84L(1)		NS(1)|kidney(1)|large_intestine(1)|lung(4)	7						AGCAGTGTCTGAGGGCTGGAT	0.637																																							uc002bmt.2		NA																	1	Substitution - coding silent(1)		NS(1)		0						c.(250-252)CTG>CTC		interferon stimulated exonuclease gene							39.0	41.0	40.0					15																	89169692		2200	4299	6499	SO:0001819	synonymous_variant	64782				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|response to ionizing radiation	nucleolus|nucleoplasm	exonuclease activity|nucleic acid binding	g.chr15:89169692G>C	BC020988	CCDS10344.1	15q26.1	2008-07-15	2008-07-15	2008-07-15	ENSG00000181026	ENSG00000181026			25722	protein-coding gene	gene with protein product		610177	"""interferon stimulated exonuclease gene 20kDa-like 1"""	ISG20L1		18264133, 16171785	Standard	NM_022767		Approved	FLJ12484, FLJ12562	uc002bmt.2	Q8WTP8	OTTHUMG00000148681	ENST00000332810.3:c.252G>C	15.37:g.89169692G>C			Somatic				AEN_uc010bnl.2_Silent_p.L84L|AEN_uc010bnm.1_Silent_p.L84L	p.L84L	NM_022767	NP_073604	WXS	Illumina HiSeq	Unspecified	Q8WTP8	AEN_HUMAN			2	403	+			84					C9J571|Q9BSA5|Q9H9X7	Silent	SNP	ENST00000332810.3	37	c.252G>C	CCDS10344.1																																																																																				0.637	AEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309071.1	NM_022767		6	26	0	0	0	0.001168	0	6	26				
MCTP2	55784	broad.mit.edu	37	15	95001379	95001379	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:95001379A>G	ENST00000357742.4	+	19	2264	c.2264A>G	c.(2263-2265)aAg>aGg	p.K755R	MCTP2_ENST00000451018.3_Missense_Mutation_p.K700R	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	755					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.K755R(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TCTGAGAAAAAGGGGTTGATT	0.294																																							uc002btj.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(2263-2265)AAG>AGG		multiple C2 domains, transmembrane 2 isoform 1							90.0	97.0	95.0					15																	95001379		2197	4298	6495	SO:0001583	missense	55784				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding	g.chr15:95001379A>G	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2264A>G	15.37:g.95001379A>G	ENSP00000350377:p.Lys755Arg		Somatic				MCTP2_uc010boj.2_Missense_Mutation_p.K484R|MCTP2_uc010bok.2_Missense_Mutation_p.K700R|MCTP2_uc002btl.2_Missense_Mutation_p.K343R	p.K755R	NM_018349	NP_060819	WXS	Illumina HiSeq	Unspecified	Q6DN12	MCTP2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)		19	2329	+	Lung NSC(78;0.0821)|all_lung(78;0.148)		755					A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	c.2264A>G	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	A	11.77	1.738753	0.30774	.	.	ENSG00000140563	ENST00000451018;ENST00000357742	T;T	0.68903	-0.36;-0.15	4.94	3.79	0.43588	Phosphoribosyltransferase C-terminal (1);	0.249247	0.46145	N	0.000308	T	0.60573	0.2279	L	0.53249	1.67	0.80722	D	1	B;B	0.16166	0.004;0.016	B;B	0.21708	0.009;0.036	T	0.56086	-0.8037	10	0.40728	T	0.16	.	10.9083	0.47092	0.9247:0.0:0.0753:0.0	.	700;755	Q6DN12-2;Q6DN12	.;MCTP2_HUMAN	R	700;755	ENSP00000395109:K700R;ENSP00000350377:K755R	ENSP00000350377:K755R	K	+	2	0	MCTP2	92802383	1.000000	0.71417	0.991000	0.47740	0.716000	0.41182	3.466000	0.53071	0.813000	0.34350	0.454000	0.30748	AAG		0.294	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349		3	45	0	0	0	0.004672	0	3	45				
PDIA2	64714	broad.mit.edu	37	16	335387	335387	+	Silent	SNP	C	C	A	rs201912828	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:335387C>A	ENST00000219406.6	+	6	889	c.871C>A	c.(871-873)Cgg>Agg	p.R291R	PDIA2_ENST00000404312.1_Silent_p.R288R|PDIA2_ENST00000462950.1_3'UTR	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	291					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GGCTGCGCACCGGGAGCTCCT	0.667																																							uc002cgn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(871-873)CGG>AGG		protein disulfide isomerase A2 precursor							30.0	33.0	32.0					16																	335387		1980	4156	6136	SO:0001819	synonymous_variant	64714				apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding	g.chr16:335387C>A	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.871C>A	16.37:g.335387C>A			Somatic				PDIA2_uc010bqt.1_Silent_p.R136R|PDIA2_uc002cgo.1_Silent_p.R291R	p.R291R	NM_006849	NP_006840	WXS	Illumina HiSeq	Unspecified	Q13087	PDIA2_HUMAN			11	1979	+		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)	291					A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Silent	SNP	ENST00000219406.6	37	c.871C>A	CCDS42089.1																																																																																				0.667	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849		22	27	1	0	2.89027e-11	0.002299	3.30454e-11	22	27				
SSTR5	6755	broad.mit.edu	37	16	1129519	1129519	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:1129519C>T	ENST00000293897.4	+	1	739	c.651C>T	c.(649-651)atC>atT	p.I217I	SSTR5_ENST00000562758.1_Intron|SSTR5_ENST00000397547.2_Silent_p.I217I|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	217					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	TGCTGGTCATCTGCCTGTGCT	0.697																																							uc002ckq.2		NA																	0				lung(1)	1						c.(649-651)ATC>ATT		somatostatin receptor 5	Octreotide(DB00104)						78.0	74.0	75.0					16																	1129519		2187	4293	6480	SO:0001819	synonymous_variant	6755				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity	g.chr16:1129519C>T	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.651C>T	16.37:g.1129519C>T			Somatic				LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	p.I217I	NM_001053	NP_001044	WXS	Illumina HiSeq	Unspecified	P35346	SSR5_HUMAN			1	739	+		Hepatocellular(780;0.00369)	217			Helical; Name=5; (Potential).		P34988|Q541E0|Q9UJI5	Silent	SNP	ENST00000293897.4	37	c.651C>T	CCDS10429.1																																																																																				0.697	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1			13	45	0	0	0	0.00245	0	13	45				
PTX4	390667	broad.mit.edu	37	16	1536191	1536191	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:1536191G>A	ENST00000447419.2	-	3	1211	c.1186C>T	c.(1186-1188)Ccc>Tcc	p.P396S	PTX4_ENST00000293922.1_Missense_Mutation_p.P391S|PTX4_ENST00000440447.2_3'UTR			Q96A99	PTX4_HUMAN	pentraxin 4, long	396	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CCTCCGGGGGGGATCTCATAG	0.657																																							uc010uvf.1		NA																	0					0						c.(1171-1173)CCC>TCC		neuronal pentraxin II-like							30.0	31.0	31.0					16																	1536191		2199	4300	6499	SO:0001583	missense	390667					extracellular region	metal ion binding	g.chr16:1536191G>A		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.1186C>T	16.37:g.1536191G>A	ENSP00000445277:p.Pro396Ser		Somatic					p.P391S	NM_001013658	NP_001013680	WXS	Illumina HiSeq	Unspecified	Q96A99	PTX4_HUMAN			3	1171	-			396			Pentaxin.			Missense_Mutation	SNP	ENST00000447419.2	37	c.1171C>T		.	.	.	.	.	.	.	.	.	.	G	14.29	2.492153	0.44352	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.62639	0.01;0.01	5.45	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.71592	0.3358	M	0.64170	1.965	0.53005	D	0.999965	P	0.35411	0.5	P	0.51266	0.664	T	0.73582	-0.3937	10	0.66056	D	0.02	.	12.1168	0.53870	0.084:0.0:0.916:0.0	.	391	Q96A99-2	.	S	396;391	ENSP00000445277:P396S;ENSP00000293922:P391S	ENSP00000293922:P391S	P	-	1	0	PTX4	1476192	1.000000	0.71417	0.994000	0.49952	0.204000	0.24138	5.347000	0.65998	1.307000	0.44944	0.563000	0.77884	CCC		0.657	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		14	57	0	0	0	0.004007	0	14	57				
KCTD5	54442	broad.mit.edu	37	16	2752431	2752431	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:2752431G>T	ENST00000301738.4	+	5	701	c.627G>T	c.(625-627)ctG>ctT	p.L209L	KCTD5_ENST00000564195.1_Missense_Mutation_p.A179S	NM_018992.3	NP_061865.1	Q9NXV2	KCTD5_HUMAN	potassium channel tetramerization domain containing 5	209					protein homooligomerization (GO:0051260)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						CCAAGGAGCTGCACAACACCC	0.612																																					Ovarian(56;981 1456 4301 50892)	Ovarian(56;981 1456 4301 50892)	uc002crd.2		NA																	0					0						c.(625-627)CTG>CTT		potassium channel tetramerisation domain							97.0	84.0	88.0					16																	2752431		2197	4300	6497	SO:0001819	synonymous_variant	54442				interspecies interaction between organisms	cytosol|nucleus|voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr16:2752431G>T	AK000047	CCDS10475.1	16p13.3	2013-06-20	2013-06-20		ENSG00000167977	ENSG00000167977			21423	protein-coding gene	gene with protein product		611285	"""potassium channel tetramerisation domain containing 5"""			12477932	Standard	NM_018992		Approved	FLJ20040	uc002crd.3	Q9NXV2	OTTHUMG00000128930	ENST00000301738.4:c.627G>T	16.37:g.2752431G>T			Somatic					p.L209L	NM_018992	NP_061865	WXS	Illumina HiSeq	Unspecified	Q9NXV2	KCTD5_HUMAN			5	682	+			209					D3DU96	Silent	SNP	ENST00000301738.4	37	c.627G>T	CCDS10475.1																																																																																				0.612	KCTD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250909.2	NM_018992		23	90	1	0	4.87955e-14	0.005443	5.69281e-14	23	90				
C16orf90	646174	broad.mit.edu	37	16	3544590	3544590	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:3544590G>T	ENST00000437192.3	-	2	336	c.334C>A	c.(334-336)Cca>Aca	p.P112T	LA16c-306E5.3_ENST00000574423.2_RNA	NM_001080524.1	NP_001073993.1	A8MZG2	CP090_HUMAN	chromosome 16 open reading frame 90	102										large_intestine(1)	1						CTGTTACGTGGGCCCAGAGTC	0.672																																							uc002cvi.2		NA																	0					0						c.(334-336)CCA>ACA		hypothetical protein LOC646174							26.0	27.0	26.0					16																	3544590		1943	4125	6068	SO:0001583	missense	646174							g.chr16:3544590G>T		CCDS45397.1	16p13.3	2009-01-29			ENSG00000215131	ENSG00000215131			34455	protein-coding gene	gene with protein product							Standard	NM_001080524		Approved	LOC646174	uc002cvi.3	A8MZG2	OTTHUMG00000154627	ENST00000437192.3:c.334C>A	16.37:g.3544590G>T	ENSP00000401335:p.Pro112Thr		Somatic					p.P112T	NM_001080524	NP_001073993	WXS	Illumina HiSeq	Unspecified	A8MZG2	CP090_HUMAN			2	334	-			102						Missense_Mutation	SNP	ENST00000437192.3	37	c.334C>A	CCDS45397.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.87|15.87	2.961994|2.961994	0.53400|0.53400	.|.	.|.	ENSG00000215131|ENSG00000215131	ENST00000399645|ENST00000437192	.|.	.|.	.|.	5.61|5.61	2.05|2.05	0.26809|0.26809	.|.	0.266538|0.266538	0.19021|0.19021	U|U	0.124819|0.124819	T|T	0.46210|0.46210	0.1381|0.1381	M|M	0.62723|0.62723	1.935|1.935	0.26532|0.26532	N|N	0.974234|0.974234	.|D	.|0.55385	.|0.971	.|P	.|0.52957	.|0.714	T|T	0.35574|0.35574	-0.9783|-0.9783	6|9	.|0.72032	.|D	.|0.01	-6.7574|-6.7574	5.2642|5.2642	0.15589|0.15589	0.1919:0.0:0.6388:0.1693|0.1919:0.0:0.6388:0.1693	.|.	.|112	.|A8MZG2-2	.|.	H|T	120|112	.|.	.|ENSP00000401335:P112T	P|P	-|-	2|1	0|0	C16orf90|C16orf90	3484591|3484591	0.015000|0.015000	0.18098|0.18098	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	0.537000|0.537000	0.23144|0.23144	0.700000|0.700000	0.31782|0.31782	0.655000|0.655000	0.94253|0.94253	CCC|CCA		0.672	C16orf90-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346319.2	NM_001080524		48	49	1	0	8.52622e-23	0.00361	1.06733e-22	48	49				
METTL22	79091	broad.mit.edu	37	16	8722634	8722634	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:8722634G>A	ENST00000381920.3	+	3	439	c.181G>A	c.(181-183)Gat>Aat	p.D61N	METTL22_ENST00000561758.1_Missense_Mutation_p.D61N	NM_024109.2	NP_077014.2	Q9BUU2	MET22_HUMAN	methyltransferase like 22	61						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			large_intestine(5)|lung(4)	9						CTCTTGGACAGATTCAGGAGC	0.488																																							uc002cyz.2		NA																	0					0						c.(181-183)GAT>AAT		hypothetical protein LOC79091							58.0	61.0	60.0					16																	8722634		1932	4159	6091	SO:0001583	missense	79091						methyltransferase activity	g.chr16:8722634G>A	AK022495	CCDS10533.2	16p13.2	2014-07-15	2011-03-03	2011-03-03	ENSG00000067365	ENSG00000067365			28368	protein-coding gene	gene with protein product		615261	"""chromosome 16 open reading frame 68"""	C16orf68		24140279	Standard	XM_005255570		Approved	FLJ12433,MGC2654	uc002cyz.3	Q9BUU2	OTTHUMG00000129694	ENST00000381920.3:c.181G>A	16.37:g.8722634G>A	ENSP00000371345:p.Asp61Asn		Somatic				C16orf68_uc002cza.2_Missense_Mutation_p.D61N	p.D61N	NM_024109	NP_077014	WXS	Illumina HiSeq	Unspecified	Q9BUU2	MET22_HUMAN			3	457	+			61					B2RD29|D3DUF2|Q6XYB4|Q9HA03	Missense_Mutation	SNP	ENST00000381920.3	37	c.181G>A	CCDS10533.2	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862149	0.71949	.	.	ENSG00000067365	ENST00000381920;ENST00000163678	T;T	0.50813	2.15;0.73	5.19	5.19	0.71726	.	0.318948	0.22329	N	0.061483	T	0.41351	0.1155	M	0.62723	1.935	0.35986	D	0.83637	P	0.35656	0.514	B	0.27887	0.084	T	0.57717	-0.7763	10	0.72032	D	0.01	-30.4928	9.8774	0.41211	0.0937:0.0:0.9063:0.0	.	61	Q9BUU2	MET22_HUMAN	N	61	ENSP00000371345:D61N;ENSP00000163678:D61N	ENSP00000163678:D61N	D	+	1	0	METTL22	8630135	0.869000	0.29996	0.823000	0.32752	0.550000	0.35303	3.247000	0.51422	2.429000	0.82318	0.561000	0.74099	GAT		0.488	METTL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251901.1	NM_024109		21	59	0	0	0	0.00278	0	21	59				
ERCC4	2072	broad.mit.edu	37	16	14026137	14026137	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:14026137G>T	ENST00000311895.7	+	6	1106	c.1097G>T	c.(1096-1098)gGg>gTg	p.G366V	ERCC4_ENST00000575156.1_Missense_Mutation_p.G366V|CTD-2135D7.2_ENST00000570663.1_RNA|CTD-2135D7.2_ENST00000575137.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	366	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						ATTAAAGAAGGGGAAGGTATC	0.323			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc002dce.2		NA	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""			E		skin basal cell|skin squamous cell|melanoma			0				lung(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(1096-1098)GGG>GTG	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							57.0	61.0	60.0					16																	14026137		2183	4292	6475	SO:0001583	missense	2072	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity	g.chr16:14026137G>T	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.1097G>T	16.37:g.14026137G>T	ENSP00000310520:p.Gly366Val		Somatic				ERCC4_uc010bva.2_Missense_Mutation_p.G366V|ERCC4_uc010uyz.1_5'UTR	p.G366V	NM_005236	NP_005227	WXS	Illumina HiSeq	Unspecified	Q92889	XPF_HUMAN			6	1106	+			366					A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	37	c.1097G>T	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	G	3.060	-0.193406	0.06259	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	T	0.68479	-0.33	5.4	-8.7	0.00851	.	1.232110	0.05178	N	0.500786	T	0.37785	0.1016	N	0.05078	-0.115	0.32182	N	0.580255	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.05451	-1.0884	10	0.29301	T	0.29	-0.2908	7.8036	0.29189	0.5991:0.0:0.2155:0.1853	.	366;366	A5PKV6;Q92889	.;XPF_HUMAN	V	366;355	ENSP00000310520:G366V	ENSP00000310520:G366V	G	+	2	0	ERCC4	13933638	0.002000	0.14202	0.002000	0.10522	0.136000	0.21042	-0.140000	0.10342	-1.452000	0.01931	-0.793000	0.03317	GGG		0.323	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236		33	37	1	0	3.33393e-15	0.004878	3.95005e-15	33	37				
NOMO2	283820	broad.mit.edu	37	16	18544400	18544400	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:18544400G>C	ENST00000381474.3	-	12	1387	c.1322C>G	c.(1321-1323)tCt>tGt	p.S441C	NOMO2_ENST00000330537.6_Missense_Mutation_p.S441C|NOMO2_ENST00000543392.1_Missense_Mutation_p.S274C	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	441						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						GGTGACCAAAGACTTGTCCTT	0.413																																							uc002dfe.2		NA																	0				skin(1)	1						c.(1321-1323)TCT>TGT		nodal modulator 2 isoform 1							71.0	55.0	61.0					16																	18544400		2197	4296	6493	SO:0001583	missense	283820					endoplasmic reticulum membrane|integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding	g.chr16:18544400G>C	AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.1322C>G	16.37:g.18544400G>C	ENSP00000370883:p.Ser441Cys		Somatic				NOMO2_uc002dff.2_Missense_Mutation_p.S441C|NOMO2_uc010bvx.2_Missense_Mutation_p.S274C	p.S441C	NM_001004060	NP_001004060	WXS	Illumina HiSeq	Unspecified	Q5JPE7	NOMO2_HUMAN			12	1394	-			441			Lumenal (Potential).		Q4G177	Missense_Mutation	SNP	ENST00000381474.3	37	c.1322C>G	CCDS32394.1	.	.	.	.	.	.	.	.	.	.	.	17.67	3.448114	0.63178	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.04502	3.65;3.61;3.64	2.71	2.71	0.32032	Immunoglobulin-like fold (1);	0.196102	0.45606	D	0.000357	T	0.06781	0.0173	L	0.56769	1.78	0.38528	D	0.948898	P;P	0.46020	0.856;0.871	B;B	0.40101	0.319;0.319	T	0.39333	-0.9619	10	0.48119	T	0.1	-8.5987	12.8531	0.57869	0.0:0.0:1.0:0.0	.	274;441	Q4G177;Q5JPE7	.;NOMO2_HUMAN	C	441;441;274	ENSP00000331851:S441C;ENSP00000370883:S441C;ENSP00000439970:S274C	ENSP00000331851:S441C	S	-	2	0	NOMO2	18451901	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	3.786000	0.55431	1.509000	0.48786	0.449000	0.29647	TCT		0.413	NOMO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435858.1	NM_001004060		33	114	0	0	0	0.003214	0	33	114				
SMG1	23049	broad.mit.edu	37	16	18826800	18826800	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:18826800G>T	ENST00000446231.2	-	59	10888	c.10476C>A	c.(10474-10476)atC>atA	p.I3492I	SMG1_ENST00000389467.3_Silent_p.I3493I			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3492					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I3492M(1)|p.I3488M(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						AGGTGGGAGTGATTTCCTGGA	0.373																																							uc002dfm.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						c.(10474-10476)ATC>ATA		PI-3-kinase-related kinase SMG-1							171.0	149.0	156.0					16																	18826800		1860	4112	5972	SO:0001819	synonymous_variant	23049				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr16:18826800G>T	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.10476C>A	16.37:g.18826800G>T			Somatic				SMG1_uc010bwb.2_Silent_p.I3352I|SMG1_uc010bwa.2_Silent_p.I2223I	p.I3492I	NM_015092	NP_055907	WXS	Illumina HiSeq	Unspecified	Q96Q15	SMG1_HUMAN			59	10839	-			3492					O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	c.10476C>A	CCDS45430.1																																																																																				0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092		6	110	1	0	3.59834e-05	0.001168	3.79763e-05	6	110				
GPRC5B	51704	broad.mit.edu	37	16	19883904	19883904	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:19883904C>G	ENST00000300571.2	-	2	455	c.264G>C	c.(262-264)gaG>gaC	p.E88D	GPRC5B_ENST00000569847.1_Missense_Mutation_p.E88D|GPRC5B_ENST00000535671.1_Missense_Mutation_p.E88D|GPRC5B_ENST00000537135.1_Missense_Mutation_p.E114D|GPRC5B_ENST00000569479.1_Missense_Mutation_p.E88D	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	88					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GGCTCTTCTTCTCCTTCTCCT	0.622																																							uc002dgt.2		NA																	0				lung(1)|breast(1)|skin(1)	3						c.(262-264)GAG>GAC		G protein-coupled receptor, family C, group 5,							33.0	38.0	36.0					16																	19883904		2197	4300	6497	SO:0001583	missense	51704							g.chr16:19883904C>G	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.264G>C	16.37:g.19883904C>G	ENSP00000300571:p.Glu88Asp		Somatic				GPRC5B_uc010vav.1_Missense_Mutation_p.E114D	p.E88D	NM_016235	NP_057319	WXS	Illumina HiSeq	Unspecified	Q9NZH0	GPC5B_HUMAN			2	372	-			88			Cytoplasmic (Potential).		D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	ENST00000300571.2	37	c.264G>C	CCDS10581.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057021	0.76074	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000537135	D;D;D	0.88124	-2.34;-2.34;-2.34	5.8	4.85	0.62838	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90618	0.7058	L	0.52364	1.645	0.58432	D	0.999996	D;D	0.69078	0.997;0.997	P;D	0.79108	0.89;0.992	D	0.89801	0.3975	9	.	.	.	.	13.0816	0.59117	0.0:0.9221:0.0:0.0779	.	114;88	B7Z831;Q9NZH0	.;GPC5B_HUMAN	D	88;88;114	ENSP00000300571:E88D;ENSP00000442858:E88D;ENSP00000441775:E114D	.	E	-	3	2	GPRC5B	19791405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.029000	0.57253	1.438000	0.47492	0.655000	0.94253	GAG		0.622	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1			10	55	0	0	0	0.001368	0	10	55				
ACSM5	54988	broad.mit.edu	37	16	20435296	20435296	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:20435296G>T	ENST00000331849.4	+	6	973	c.826G>T	c.(826-828)Gtg>Ttg	p.V276L		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	276					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CACTGGCTGGGTGAAGGCAGC	0.502																																							uc002dhe.2		NA																	0				ovary(2)	2						c.(826-828)GTG>TTG		acyl-CoA synthetase medium-chain family member 5							180.0	161.0	167.0					16																	20435296		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20435296G>T		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.826G>T	16.37:g.20435296G>T	ENSP00000327916:p.Val276Leu		Somatic					p.V276L	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			6	973	+			276					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.826G>T	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389406	0.61956	.	.	ENSG00000183549	ENST00000331849	T	0.46063	0.88	4.56	4.56	0.56223	AMP-dependent synthetase/ligase (1);	0.000000	0.53938	D	0.000055	T	0.47135	0.1429	L	0.48260	1.515	0.37990	D	0.933878	P	0.50443	0.935	P	0.53760	0.734	T	0.48019	-0.9071	10	0.36615	T	0.2	-17.1859	12.0231	0.53354	0.087:0.0:0.913:0.0	.	276	Q6NUN0	ACSM5_HUMAN	L	276	ENSP00000327916:V276L	ENSP00000327916:V276L	V	+	1	0	ACSM5	20342797	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.931000	0.48932	2.338000	0.79540	0.655000	0.94253	GTG		0.502	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		88	91	1	0	3.01496e-42	0.00361	3.96979e-42	88	91				
DNAH3	55567	broad.mit.edu	37	16	21139082	21139082	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:21139082C>A	ENST00000261383.3	-	8	1133	c.1134G>T	c.(1132-1134)ttG>ttT	p.L378F	DNAH3_ENST00000415178.1_Missense_Mutation_p.L378F|CTC-508F8.1_ENST00000575612.1_RNA	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	378	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCTGCAGAGGCAATTTTCCCG	0.473																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(1132-1134)TTG>TTT		dynein, axonemal, heavy chain 3							138.0	133.0	135.0					16																	21139082		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21139082C>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1134G>T	16.37:g.21139082C>A	ENSP00000261383:p.Leu378Phe		Somatic				DNAH3_uc002die.2_Missense_Mutation_p.L349F	p.L378F	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	8	1134	-			378			Stem (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.1134G>T	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179356	0.38511	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.23754	1.89;2.07	5.57	2.41	0.29592	.	0.000000	0.51477	D	0.000091	T	0.40743	0.1129	M	0.67397	2.05	0.44702	D	0.99769	D;D	0.89917	0.999;1.0	D;D	0.87578	0.957;0.998	T	0.17048	-1.0382	10	0.26408	T	0.33	.	5.7954	0.18383	0.1532:0.6768:0.0:0.17	.	378;349	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	F	378;378;349	ENSP00000261383:L378F;ENSP00000394245:L378F	ENSP00000261383:L378F	L	-	3	2	DNAH3	21046583	1.000000	0.71417	0.974000	0.42286	0.971000	0.66376	0.968000	0.29357	0.246000	0.21394	0.563000	0.77884	TTG		0.473	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		92	107	1	0	3.01496e-42	0.00361	3.96979e-42	92	107				
CACNG3	10368	broad.mit.edu	37	16	24373034	24373034	+	Silent	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:24373034C>A	ENST00000005284.3	+	4	2000	c.798C>A	c.(796-798)acC>acA	p.T266T		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	266					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CGATGTTCACCCTCTCCCGGG	0.577																																							uc002dmf.2		NA																	0					0						c.(796-798)ACC>ACA		voltage-dependent calcium channel gamma-3							105.0	112.0	109.0					16																	24373034		2197	4300	6497	SO:0001819	synonymous_variant	10368				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr16:24373034C>A	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.798C>A	16.37:g.24373034C>A			Somatic					p.T266T	NM_006539	NP_006530	WXS	Illumina HiSeq	Unspecified	O60359	CCG3_HUMAN		GBM - Glioblastoma multiforme(48;0.0809)	4	1998	+			266						Silent	SNP	ENST00000005284.3	37	c.798C>A	CCDS10620.1																																																																																				0.577	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539		80	99	1	0	1.22797e-34	0.00361	1.61068e-34	80	99				
LCMT1	51451	broad.mit.edu	37	16	25175941	25175941	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:25175941G>C	ENST00000399069.3	+	7	747	c.592G>C	c.(592-594)Gaa>Caa	p.E198Q	LCMT1_ENST00000380966.4_Missense_Mutation_p.E143Q|LCMT1_ENST00000572869.1_3'UTR	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	198					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)								GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	CCTGATAGCTGAATGTGTGCT	0.423																																					Colon(200;565 2072 24396 47922 50898)	Colon(200;565 2072 24396 47922 50898)	uc002dnx.1		NA																	0					0						c.(592-594)GAA>CAA		leucine carboxyl methyltransferase 1 isoform a	L-Leucine(DB00149)						96.0	90.0	92.0					16																	25175941		1922	4145	6067	SO:0001583	missense	51451						protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity	g.chr16:25175941G>C	AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.592G>C	16.37:g.25175941G>C	ENSP00000382021:p.Glu198Gln		Somatic				LCMT1_uc002dny.1_Missense_Mutation_p.E143Q|LCMT1_uc002dnz.1_Missense_Mutation_p.E98Q|LCMT1_uc002doa.1_Missense_Mutation_p.E43Q	p.E198Q	NM_016309	NP_057393	WXS	Illumina HiSeq	Unspecified	Q9UIC8	LCMT1_HUMAN		GBM - Glioblastoma multiforme(48;0.0336)	7	750	+			198				S-adenosyl-L-methionine; via carbonyl oxygen.	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	c.592G>C	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977997	0.92982	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.36157	1.27;1.52	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.74068	0.3668	H	0.96943	3.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82806	-0.0275	10	0.87932	D	0	-27.0532	17.602	0.88028	0.0:0.0:1.0:0.0	.	143;198	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	Q	198;143;215	ENSP00000382021:E198Q;ENSP00000370353:E143Q	ENSP00000370349:E215Q	E	+	1	0	LCMT1	25083442	1.000000	0.71417	0.942000	0.38095	0.996000	0.88848	8.915000	0.92740	2.745000	0.94114	0.563000	0.77884	GAA		0.423	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309		43	44	0	0	0	0.002522	0	43	44				
KIAA0556	23247	broad.mit.edu	37	16	27765513	27765513	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:27765513C>T	ENST00000261588.4	+	18	3591	c.3572C>T	c.(3571-3573)cCa>cTa	p.P1191L		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1191						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CTAGAGCTCCCATCCAGTTCC	0.572																																							uc002dow.2		NA																	0				ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.(3571-3573)CCA>CTA		hypothetical protein LOC23247							132.0	116.0	122.0					16																	27765513		2197	4300	6497	SO:0001583	missense	23247							g.chr16:27765513C>T	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3572C>T	16.37:g.27765513C>T	ENSP00000261588:p.Pro1191Leu		Somatic					p.P1191L	NM_015202	NP_056017	WXS	Illumina HiSeq	Unspecified	O60303	K0556_HUMAN			18	3596	+			1191					A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	c.3572C>T	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	C	8.273	0.813796	0.16537	.	.	ENSG00000047578	ENST00000261588	T	0.10288	2.89	4.57	3.58	0.41010	.	0.569411	0.19286	N	0.118037	T	0.15046	0.0363	M	0.73598	2.24	0.35050	D	0.76052	B	0.25486	0.127	B	0.27076	0.076	T	0.06826	-1.0805	10	0.49607	T	0.09	-24.624	9.6778	0.40052	0.2164:0.7836:0.0:0.0	.	1191	O60303	K0556_HUMAN	L	1191	ENSP00000261588:P1191L	ENSP00000261588:P1191L	P	+	2	0	KIAA0556	27673014	0.046000	0.20272	0.744000	0.31058	0.061000	0.15899	1.321000	0.33678	1.192000	0.43071	0.650000	0.86243	CCA		0.572	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		76	78	0	0	0	0.00361	0	76	78				
ZNF768	79724	broad.mit.edu	37	16	30537139	30537139	+	Missense_Mutation	SNP	C	C	A	rs200652900	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:30537139C>A	ENST00000380412.5	-	2	497	c.322G>T	c.(322-324)Gat>Tat	p.D108Y	ZNF768_ENST00000562803.1_Missense_Mutation_p.D77Y	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	108	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						CTCTGAGAATCTGATTCAGGG	0.597																																							uc002dyk.3		NA																	0					0						c.(322-324)GAT>TAT		zinc finger protein 768							34.0	40.0	38.0					16																	30537139		2139	4276	6415	SO:0001583	missense	79724				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding	g.chr16:30537139C>A	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.322G>T	16.37:g.30537139C>A	ENSP00000369777:p.Asp108Tyr		Somatic				ZNF768_uc010vex.1_Missense_Mutation_p.D77Y|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Missense_Mutation_p.D77Y	p.D108Y	NM_024671	NP_078947	WXS	Illumina HiSeq	Unspecified	Q9H5H4	ZN768_HUMAN			2	498	-			108			Pro-rich.		Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	37	c.322G>T	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609809	0.66558	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.06849	3.25	4.03	4.03	0.46877	.	0.000000	0.48767	D	0.000161	T	0.07683	0.0193	N	0.08118	0	0.44402	D	0.997317	P	0.47350	0.894	P	0.47206	0.541	T	0.40924	-0.9537	10	0.66056	D	0.02	-13.2063	16.1523	0.81632	0.0:1.0:0.0:0.0	.	108	Q9H5H4	ZN768_HUMAN	Y	108;77	ENSP00000369777:D108Y	ENSP00000369777:D108Y	D	-	1	0	ZNF768	30444640	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	0.706000	0.25690	2.541000	0.85698	0.561000	0.74099	GAT		0.597	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671		19	67	1	0	6.21321e-17	0.00278	7.50398e-17	19	67				
ITGAM	3684	broad.mit.edu	37	16	31340616	31340616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:31340616C>T	ENST00000287497.8	+	24	2935	c.2860C>T	c.(2860-2862)Caa>Taa	p.Q954*	ITGAM_ENST00000544665.3_Nonsense_Mutation_p.Q955*			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	954					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CATGCAGCATCAATATCAGGT	0.517																																							uc002ebq.2		NA																	0				kidney(1)	1						c.(2860-2862)CAA>TAA		integrin alpha M isoform 2 precursor							62.0	62.0	62.0					16																	31340616		1968	4160	6128	SO:0001587	stop_gained	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31340616C>T	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2860C>T	16.37:g.31340616C>T	ENSP00000287497:p.Gln954*		Somatic				ITGAM_uc002ebr.2_Nonsense_Mutation_p.Q955*|ITGAM_uc010can.2_Nonsense_Mutation_p.Q360*	p.Q954*	NM_000632	NP_000623	WXS	Illumina HiSeq	Unspecified	P11215	ITAM_HUMAN			24	2958	+			954			Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Nonsense_Mutation	SNP	ENST00000287497.8	37	c.2860C>T	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498659	0.85069	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	.	.	.	4.96	-1.22	0.09494	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	4.3556	0.11176	0.1535:0.3041:0.4513:0.0911	.	.	.	.	X	955;954	.	ENSP00000287497:Q954X	Q	+	1	0	ITGAM	31248117	0.000000	0.05858	0.080000	0.20451	0.044000	0.14063	-0.973000	0.03798	0.004000	0.14682	-0.172000	0.13284	CAA		0.517	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		20	13	0	0	0	0.003954	0	20	13				
SALL1	6299	broad.mit.edu	37	16	51175993	51175993	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:51175993C>A	ENST00000251020.4	-	2	173	c.140G>T	c.(139-141)cGg>cTg	p.R47L	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_5'UTR|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	47					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGCACAGCACCGGCCACAGAC	0.443																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	0				skin(5)|ovary(3)	8						c.(139-141)CGG>CTG		sal-like 1 isoform a							96.0	101.0	99.0					16																	51175993		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51175993C>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.140G>T	16.37:g.51175993C>A	ENSP00000251020:p.Arg47Leu		Somatic				SALL1_uc010vgr.1_5'UTR|SALL1_uc010cbv.2_Intron	p.R47L	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	171	-		all_cancers(37;0.0322)	47					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.140G>T	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007121	0.75046	.	.	ENSG00000103449	ENST00000251020;ENST00000457559	T	0.43688	0.94	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	P	0.61592	0.891	T	0.64499	-0.6393	10	0.87932	D	0	.	19.1099	0.93313	0.0:1.0:0.0:0.0	.	47	Q9NSC2	SALL1_HUMAN	L	47	ENSP00000251020:R47L	ENSP00000251020:R47L	R	-	2	0	SALL1	49733494	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.978000	0.63799	2.499000	0.84300	0.555000	0.69702	CGG		0.443	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		55	53	1	0	8.83742e-36	0.00361	1.16139e-35	55	53				
ADAMTS18	170692	broad.mit.edu	37	16	77389862	77389862	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:77389862G>A	ENST00000282849.5	-	9	1853	c.1435C>T	c.(1435-1437)Cgc>Tgc	p.R479C		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	479	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AGATACTGGCGGCTGCAGGAA	0.488																																							uc002ffc.3		NA																	0				large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(1435-1437)CGC>TGC		ADAM metallopeptidase with thrombospondin type 1							110.0	97.0	101.0					16																	77389862		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77389862G>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1435C>T	16.37:g.77389862G>A	ENSP00000282849:p.Arg479Cys		Somatic				ADAMTS18_uc010chc.1_Missense_Mutation_p.R67C|ADAMTS18_uc002ffe.1_Missense_Mutation_p.R175C|ADAMTS18_uc010vni.1_RNA	p.R479C	NM_199355	NP_955387	WXS	Illumina HiSeq	Unspecified	Q8TE60	ATS18_HUMAN			9	1854	-			479			Peptidase M12B.		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.1435C>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242750	0.58995	.	.	ENSG00000140873	ENST00000282849	T	0.08896	3.04	5.19	4.17	0.49024	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.31888	0.0811	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.04454	-1.0950	10	0.87932	D	0	.	11.1126	0.48241	0.0:0.0:0.6938:0.3062	.	479;479	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	C	479	ENSP00000282849:R479C	ENSP00000282849:R479C	R	-	1	0	ADAMTS18	75947363	1.000000	0.71417	0.997000	0.53966	0.344000	0.29017	3.281000	0.51685	2.865000	0.98341	0.655000	0.94253	CGC		0.488	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			29	54	0	0	0	0.007291	0	29	54				
BCO1	53630	broad.mit.edu	37	16	81272546	81272546	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:81272546A>G	ENST00000258168.2	+	1	494	c.33A>G	c.(31-33)gaA>gaG	p.E11E	BCMO1_ENST00000425577.2_5'UTR|BCMO1_ENST00000564552.1_Silent_p.E11E	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						ATAGGAAAGAACAGCTGGAGC	0.428																																							uc002fgn.1		NA																	0					0						c.(31-33)GAA>GAG		beta-carotene 15,15'-monooxygenase							73.0	74.0	74.0					16																	81272546		2202	4300	6502	SO:0001819	synonymous_variant	53630				retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity	g.chr16:81272546A>G																												ENST00000258168.2:c.33A>G	16.37:g.81272546A>G			Somatic				BCMO1_uc002fgm.1_Silent_p.E11E|BCMO1_uc010vnp.1_5'UTR	p.E11E	NM_017429	NP_059125	WXS	Illumina HiSeq	Unspecified	Q9HAY6	BCDO1_HUMAN			1	251	+			11						Silent	SNP	ENST00000258168.2	37	c.33A>G	CCDS10934.1																																																																																				0.428	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1			22	56	0	0	0	0.002096	0	22	56				
ANKRD11	29123	broad.mit.edu	37	16	89351075	89351075	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:89351075C>T	ENST00000301030.4	-	9	2335	c.1875G>A	c.(1873-1875)gaG>gaA	p.E625E	ANKRD11_ENST00000378330.2_Silent_p.E625E	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	625	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CAACTTTCCCCTCCTTGTCCA	0.498																																							uc002fmx.1		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)	6						c.(1873-1875)GAG>GAA		ankyrin repeat domain 11							62.0	67.0	65.0					16																	89351075		2198	4299	6497	SO:0001819	synonymous_variant	29123					nucleus		g.chr16:89351075C>T	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1875G>A	16.37:g.89351075C>T			Somatic				ANKRD11_uc002fmy.1_Silent_p.E625E|ANKRD11_uc002fnc.1_Silent_p.E625E|ANKRD11_uc002fnb.1_Silent_p.E582E	p.E625E	NM_013275	NP_037407	WXS	Illumina HiSeq	Unspecified	Q6UB99	ANR11_HUMAN		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)	9	2336	-		all_hematologic(23;0.00824)|Colorectal(91;0.0475)	625			Lys-rich.		Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	c.1875G>A	CCDS32513.1																																																																																				0.498	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275		27	71	0	0	0	0.005443	0	27	71				
PRDM7	11105	broad.mit.edu	37	16	90126912	90126912	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr16:90126912G>T	ENST00000449207.2	-	9	1089	c.1070C>A	c.(1069-1071)tCt>tAt	p.S357Y	PRDM7_ENST00000325921.6_Intron|PRDM7_ENST00000407825.1_Intron	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	357	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.			S -> Y (in Ref. 2; AAF78084). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CTCATCCCCAGACCAGACCAG	0.532																																							uc010cje.2		NA																	0				ovary(1)	1						c.(1069-1071)TCT>TAT		PR domain containing 7 isoform 1							96.0	94.0	95.0					16																	90126912		1943	4141	6084	SO:0001583	missense	11105					chromosome|nucleus	nucleic acid binding	g.chr16:90126912G>T	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.1070C>A	16.37:g.90126912G>T	ENSP00000396732:p.Ser357Tyr		Somatic				PRDM7_uc002fqo.2_Intron|PRDM7_uc010cjf.2_Intron|PRDM7_uc010cjg.1_Missense_Mutation_p.S151Y	p.S357Y	NM_001098173	NP_001091643	WXS	Illumina HiSeq	Unspecified	Q9NQW5	PRDM7_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0278)	9	1090	-		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)	357	S -> Y (in Ref. 2; AAF78084).		SET.		A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	37	c.1070C>A	CCDS45557.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-4.292468	0.00001	.	.	ENSG00000126856	ENST00000449207	T	0.51325	0.71	1.03	-2.05	0.07321	SET domain (2);	.	.	.	.	T	0.07234	0.0183	N	0.00034	-2.56	0.58432	D	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.36359	-0.9751	8	.	.	.	-4.4407	4.493	0.11822	0.0:0.0:0.3252:0.6748	.	357	Q9NQW5	PRDM7_HUMAN	Y	357	ENSP00000396732:S357Y	.	S	-	2	0	PRDM7	88654413	0.958000	0.32768	0.006000	0.13384	0.144000	0.21451	1.035000	0.30216	-2.081000	0.00869	-1.919000	0.00516	TCT		0.532	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1			4	93	1	0	0.00909568	0.009096	0.00929901	4	93				
TRPV1	7442	broad.mit.edu	37	17	3477008	3477008	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:3477008G>A	ENST00000571088.1	-	13	2235	c.2022C>T	c.(2020-2022)ctC>ctT	p.L674L	SHPK_ENST00000572705.1_Silent_p.L674L|TRPV1_ENST00000310522.5_Silent_p.L614L|TRPV1_ENST00000174621.6_Silent_p.L672L|TRPV1_ENST00000576351.1_Silent_p.L664L|TRPV1_ENST00000399756.4_Silent_p.L674L|TRPV1_ENST00000425167.2_Silent_p.L685L|TRPV1_ENST00000399759.3_Silent_p.L674L	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	674					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	TGTTGAGCAGGAGGATGTAGG	0.532																																					Melanoma(38;962 1762 15789)	Melanoma(38;962 1762 15789)	uc010vrr.1		NA																	0				ovary(1)	1						c.(2020-2022)CTC>CTT		transient receptor potential cation channel,	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)						142.0	142.0	142.0					17																	3477008		2202	4300	6502	SO:0001819	synonymous_variant	7442				cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding	g.chr17:3477008G>A	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.2022C>T	17.37:g.3477008G>A			Somatic				TRPV1_uc010vro.1_Silent_p.L685L|TRPV1_uc010vrp.1_Silent_p.L614L|TRPV1_uc010vrq.1_Silent_p.L672L|TRPV1_uc010vrs.1_Silent_p.L674L|TRPV1_uc010vrt.1_Silent_p.L674L|TRPV1_uc010vru.1_Silent_p.L674L	p.L674L	NM_080706	NP_542437	WXS	Illumina HiSeq	Unspecified	Q8NER1	TRPV1_HUMAN		Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	12	2549	-			674			Helical; (Potential).		A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Silent	SNP	ENST00000571088.1	37	c.2022C>T	CCDS45576.1																																																																																				0.532	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727		21	21	0	0	0	0.00278	0	21	21				
FBXO39	162517	broad.mit.edu	37	17	6683381	6683381	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:6683381G>T	ENST00000321535.4	+	2	324	c.194G>T	c.(193-195)gGg>gTg	p.G65V		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	65										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						ACCTTCAGCGGGAGACCTTCC	0.498																																							uc010vtg.1		NA																	0				ovary(1)|skin(1)	2						c.(193-195)GGG>GTG		F-box protein 39							122.0	116.0	118.0					17																	6683381		2203	4300	6503	SO:0001583	missense	162517							g.chr17:6683381G>T	BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.194G>T	17.37:g.6683381G>T	ENSP00000321386:p.Gly65Val		Somatic					p.G65V	NM_153230	NP_694962	WXS	Illumina HiSeq	Unspecified	Q8N4B4	FBX39_HUMAN			2	314	+			65						Missense_Mutation	SNP	ENST00000321535.4	37	c.194G>T	CCDS11082.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593344	0.66219	.	.	ENSG00000177294	ENST00000321535	T	0.55760	0.5	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000003	T	0.60483	0.2272	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51084	-0.8750	10	0.18276	T	0.48	-39.7249	15.399	0.74823	0.0:0.0:1.0:0.0	.	65	Q8N4B4	FBX39_HUMAN	V	65	ENSP00000321386:G65V	ENSP00000321386:G65V	G	+	2	0	FBXO39	6624105	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.397000	0.73239	2.797000	0.96272	0.561000	0.74099	GGG		0.498	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219866.2	NM_153230		42	35	1	0	1.32136e-16	0.00874	1.58748e-16	42	35				
TP53	7157	broad.mit.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y205C|TP53_ENST00000420246.2_Missense_Mutation_p.Y205C|TP53_ENST00000455263.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000445888.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	p.Y205C(55)|p.Y205D(13)|p.Y205S(11)|p.Y205F(8)|p.0?(7)|p.Y205H(5)|p.Y205*(4)|p.Y205N(2)|p.K164_P219del(1)|p.Y205fs*42(1)|p.Y112C(1)|p.Y205fs*43(1)|p.E204fs*39(1)|p.Y73C(1)|p.E204_N210delEYLDDRN(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(613-615)TAT>TGT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							136.0	121.0	126.0					17																	7578235		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578235T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	17.37:g.7578235T>C	ENSP00000269305:p.Tyr205Cys	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.Y205C|TP53_uc002gih.2_Missense_Mutation_p.Y205C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y73C|TP53_uc010cng.1_Missense_Mutation_p.Y73C|TP53_uc002gii.1_Missense_Mutation_p.Y73C|TP53_uc010cnh.1_Missense_Mutation_p.Y205C|TP53_uc010cni.1_Missense_Mutation_p.Y205C|TP53_uc002gij.2_Missense_Mutation_p.Y205C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y112C|TP53_uc002gio.2_Missense_Mutation_p.Y73C|TP53_uc010vug.1_Missense_Mutation_p.Y166C	p.Y205C	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	808	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	205		Y -> N (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> C (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.614A>G	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		14	26	0	0	0	0.003163	0	14	26				
ALOX12B	242	broad.mit.edu	37	17	7977019	7977019	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:7977019T>C	ENST00000319144.4	-	13	1971	c.1711A>G	c.(1711-1713)Atc>Gtc	p.I571V	ALOX12B_ENST00000577351.1_Intron	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	571	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CAGGTGTAGATGACTATAGTG	0.592										Multiple Myeloma(8;0.094)	OREG0024152	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002gjy.1		NA																	0					0						c.(1711-1713)ATC>GTC		arachidonate 12-lipoxygenase, 12R type							95.0	78.0	84.0					17																	7977019		2203	4300	6503	SO:0001583	missense	242				epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity	g.chr17:7977019T>C	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1711A>G	17.37:g.7977019T>C	ENSP00000315167:p.Ile571Val	Multiple Myeloma(8;0.094)	Somatic	OREG0024152	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	645		p.I571V	NM_001139	NP_001130	WXS	Illumina HiSeq	Unspecified	O75342	LX12B_HUMAN			13	1972	-			571			Lipoxygenase.			Missense_Mutation	SNP	ENST00000319144.4	37	c.1711A>G	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179163	0.57800	.	.	ENSG00000179477	ENST00000319144	D	0.92397	-3.03	5.08	5.08	0.68730	Lipoxygenase, C-terminal (3);	0.328129	0.33477	N	0.004880	D	0.91958	0.7453	M	0.73430	2.235	0.29210	N	0.874665	P	0.34800	0.469	B	0.39465	0.3	D	0.88418	0.3026	10	0.36615	T	0.2	-20.9624	13.8337	0.63398	0.0:0.0:0.0:1.0	.	571	O75342	LX12B_HUMAN	V	571	ENSP00000315167:I571V	ENSP00000315167:I571V	I	-	1	0	ALOX12B	7917744	1.000000	0.71417	0.998000	0.56505	0.853000	0.48598	3.486000	0.53215	1.913000	0.55393	0.528000	0.53228	ATC		0.592	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3			18	24	0	0	0	0.00333	0	18	24				
MYH2	4620	broad.mit.edu	37	17	10428230	10428230	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:10428230G>C	ENST00000245503.5	-	34	5199	c.4815C>G	c.(4813-4815)agC>agG	p.S1605R	RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.S1605R|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1605					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CATCCAGCGTGCTCTGCATGG	0.453																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(4813-4815)AGC>AGG		myosin heavy chain IIa							241.0	209.0	220.0					17																	10428230		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10428230G>C		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4815C>G	17.37:g.10428230G>C	ENSP00000245503:p.Ser1605Arg		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.S1605R|MYH2_uc010coj.2_Intron	p.S1605R	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			34	4943	-			1605			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.4815C>G	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902014	0.33535	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.77877	-1.13;-1.13	5.55	2.47	0.30058	Myosin tail (1);	0.303544	0.22867	U	0.054661	T	0.76421	0.3985	M	0.77103	2.36	0.38126	D	0.938006	B	0.06786	0.001	B	0.15052	0.012	T	0.77451	-0.2583	10	0.87932	D	0	.	11.4468	0.50127	0.1982:0.0:0.8018:0.0	.	1605	Q9UKX2	MYH2_HUMAN	R	1605	ENSP00000245503:S1605R;ENSP00000380367:S1605R	ENSP00000245503:S1605R	S	-	3	2	MYH2	10368955	1.000000	0.71417	0.892000	0.35008	0.981000	0.71138	3.472000	0.53114	0.916000	0.36871	0.591000	0.81541	AGC		0.453	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		47	47	0	0	0	0.00361	0	47	47				
MYO15A	51168	broad.mit.edu	37	17	18023816	18023816	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:18023816C>T	ENST00000205890.5	+	2	2040	c.1702C>T	c.(1702-1704)Cct>Tct	p.P568S		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	568					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGTGCCTCGCCCTGCCACCTC	0.746																																							uc010vxh.1		NA																	0				skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(1702-1704)CCT>TCT		myosin XV							5.0	6.0	6.0					17																	18023816		1748	3877	5625	SO:0001583	missense	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18023816C>T	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1702C>T	17.37:g.18023816C>T	ENSP00000205890:p.Pro568Ser		Somatic					p.P568S	NM_016239	NP_057323	WXS	Illumina HiSeq	Unspecified	Q9UKN7	MYO15_HUMAN			2	2040	+	all_neural(463;0.228)		568			Myosin head-like.		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	c.1702C>T	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678929	0.47886	.	.	ENSG00000091536	ENST00000205890	D	0.90732	-2.72	4.42	4.42	0.53409	.	.	.	.	.	D	0.91663	0.7365	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.92314	0.5860	9	0.62326	D	0.03	.	13.8803	0.63678	0.0:1.0:0.0:0.0	.	568	Q9UKN7	MYO15_HUMAN	S	568	ENSP00000205890:P568S	ENSP00000205890:P568S	P	+	1	0	MYO15A	17964541	0.010000	0.17322	0.558000	0.28319	0.119000	0.20118	0.552000	0.23376	2.295000	0.77249	0.448000	0.29417	CCT		0.746	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		7	6	0	0	0	0.001984	0	7	6				
GRAP	10750	broad.mit.edu	37	17	18927649	18927649	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:18927649C>T	ENST00000284154.5	-	4	1057	c.347G>A	c.(346-348)gGg>gAg	p.G116E	GRAP_ENST00000395635.1_Missense_Mutation_p.G87E|GRAP_ENST00000573099.1_Intron	NM_006613.3	NP_006604.1	Q13588	GRAP_HUMAN	GRB2-related adaptor protein	116	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|urinary_tract(1)	2	all_cancers(12;0.0183)					GAAGTACTTCCCCGAGGCCTC	0.617																																							uc002guy.2		NA																	0					0						c.(346-348)GGG>GAG		GRB2-related adaptor protein							51.0	39.0	43.0					17																	18927649		2203	4300	6503	SO:0001583	missense	10750				cell-cell signaling|Ras protein signal transduction	cytoplasm	SH3/SH2 adaptor activity	g.chr17:18927649C>T	U52518	CCDS11202.1	17p11.2	2013-02-14			ENSG00000154016	ENSG00000154016		"""SH2 domain containing"""	4562	protein-coding gene	gene with protein product		604330				8647802, 8995379	Standard	NM_006613		Approved		uc002guy.3	Q13588	OTTHUMG00000059436	ENST00000284154.5:c.347G>A	17.37:g.18927649C>T	ENSP00000284154:p.Gly116Glu		Somatic					p.G116E	NM_006613	NP_006604	WXS	Illumina HiSeq	Unspecified	Q13588	GRAP_HUMAN			4	444	-	all_cancers(12;0.0183)		116			SH2.			Missense_Mutation	SNP	ENST00000284154.5	37	c.347G>A	CCDS11202.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826722	0.71143	.	.	ENSG00000154016	ENST00000284154;ENST00000395635	T;T	0.70164	-0.46;-0.46	5.53	5.53	0.82687	SH2 motif (4);	0.056242	0.64402	U	0.000001	D	0.86377	0.5918	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88998	0.3419	10	0.87932	D	0	.	19.4513	0.94869	0.0:1.0:0.0:0.0	.	116	Q13588	GRAP_HUMAN	E	116;87	ENSP00000284154:G116E;ENSP00000378997:G87E	ENSP00000284154:G116E	G	-	2	0	GRAP	18868374	1.000000	0.71417	0.991000	0.47740	0.098000	0.18820	5.993000	0.70616	2.612000	0.88384	0.486000	0.48141	GGG		0.617	GRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132176.2	NM_006613		11	18	0	0	0	0.000978	0	11	18				
ALDH3A1	218	broad.mit.edu	37	17	19645475	19645475	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:19645475G>C	ENST00000457500.2	-	4	860	c.531C>G	c.(529-531)ctC>ctG	p.L177L	ALDH3A1_ENST00000444455.1_Silent_p.L177L|ALDH3A1_ENST00000485231.1_5'Flank|ALDH3A1_ENST00000395555.3_Silent_p.L177L|ALDH3A1_ENST00000494157.2_Silent_p.L104L|ALDH3A1_ENST00000225740.6_Silent_p.L177L	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	177					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		ACCTCTCCTTGAGCAGCTCCG	0.597																																							uc010cqu.2		NA																	0				ovary(1)|pancreas(1)	2						c.(529-531)CTC>CTG		aldehyde dehydrogenase 3A1	NADH(DB00157)						139.0	100.0	113.0					17																	19645475		2203	4300	6503	SO:0001819	synonymous_variant	218				cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase	g.chr17:19645475G>C	M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.531C>G	17.37:g.19645475G>C			Somatic				ALDH3A1_uc010vzd.1_Silent_p.L177L|ALDH3A1_uc002gwj.2_Silent_p.L177L|ALDH3A1_uc010cqv.2_Silent_p.L177L|ALDH3A1_uc002gwk.2_Silent_p.L294L|ALDH3A1_uc002gwl.1_Silent_p.L104L	p.L177L	NM_001135168	NP_001128640	WXS	Illumina HiSeq	Unspecified	P30838	AL3A1_HUMAN		Colorectal(15;0.0829)	4	861	-	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)		177					A8K828|Q9BT37	Silent	SNP	ENST00000457500.2	37	c.531C>G	CCDS11212.1																																																																																				0.597	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132265.4	NM_000691		31	79	0	0	0	0.005524	0	31	79				
ULK2	9706	broad.mit.edu	37	17	19687055	19687055	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:19687055G>A	ENST00000395544.4	-	22	2914	c.2415C>T	c.(2413-2415)ctC>ctT	p.L805L	ULK2_ENST00000361658.2_Silent_p.L805L	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	805					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CAAAGGTGATGAGCCCCTCTA	0.552																																							uc002gwm.3		NA																	0				skin(2)|large_intestine(1)|stomach(1)	4						c.(2413-2415)CTC>CTT		unc-51-like kinase 2							89.0	101.0	97.0					17																	19687055		2203	4300	6503	SO:0001819	synonymous_variant	9706				signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:19687055G>A	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2415C>T	17.37:g.19687055G>A			Somatic				ULK2_uc002gwn.2_Silent_p.L805L	p.L805L	NM_001142610	NP_001136082	WXS	Illumina HiSeq	Unspecified	Q8IYT8	ULK2_HUMAN			22	2924	-	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)		805					A8MY69|O75119	Silent	SNP	ENST00000395544.4	37	c.2415C>T	CCDS11213.1																																																																																				0.552	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683		85	46	0	0	0	0.00361	0	85	46				
SLC35G3	146861	broad.mit.edu	37	17	33520613	33520613	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:33520613G>T	ENST00000297307.5	-	1	799	c.714C>A	c.(712-714)ctC>ctA	p.L238L	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	238						integral component of membrane (GO:0016021)											GCAGCACAAAGAGGCCTGGCA	0.612																																							uc002hjd.2		NA																	0					0						c.(712-714)CTC>CTA		acyl-malonyl condensing enzyme 1							67.0	71.0	69.0					17																	33520613		2203	4298	6501	SO:0001819	synonymous_variant	146861					integral to membrane		g.chr17:33520613G>T	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.714C>A	17.37:g.33520613G>T			Somatic					p.L238L	NM_152462	NP_689675	WXS	Illumina HiSeq	Unspecified	Q8N808	AMAC1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0917)	1	800	-			238			Helical; (Potential).		B9EGE9	Silent	SNP	ENST00000297307.5	37	c.714C>A	CCDS11293.1																																																																																				0.612	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2	NM_152462		26	67	1	0	2.12542e-12	0.00632	2.4546e-12	26	67				
SLC35G3	146861	broad.mit.edu	37	17	33521035	33521035	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:33521035G>C	ENST00000297307.5	-	1	377	c.292C>G	c.(292-294)Cct>Gct	p.P98A	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	98	EamA 1.					integral component of membrane (GO:0016021)											CGGATGTCAGGAGTTCCCAGA	0.602																																							uc002hjd.2		NA																	0					0						c.(292-294)CCT>GCT		acyl-malonyl condensing enzyme 1							135.0	142.0	139.0					17																	33521035		2203	4300	6503	SO:0001583	missense	146861					integral to membrane		g.chr17:33521035G>C	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.292C>G	17.37:g.33521035G>C	ENSP00000297307:p.Pro98Ala		Somatic					p.P98A	NM_152462	NP_689675	WXS	Illumina HiSeq	Unspecified	Q8N808	AMAC1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0917)	1	378	-			98			DUF6 1.		B9EGE9	Missense_Mutation	SNP	ENST00000297307.5	37	c.292C>G	CCDS11293.1	.	.	.	.	.	.	.	.	.	.	G	3.390	-0.124537	0.06795	.	.	ENSG00000164729	ENST00000297307	T	0.49720	0.77	.	.	.	.	0.000000	0.36740	N	0.002435	T	0.24198	0.0586	N	0.24115	0.695	0.25938	N	0.982917	B	0.20550	0.046	B	0.22601	0.04	T	0.09796	-1.0658	9	0.15952	T	0.53	-6.0004	2.6646	0.05037	0.4962:0.0:0.5037:0.0	.	98	Q8N808	S35G3_HUMAN	A	98	ENSP00000297307:P98A	ENSP00000297307:P98A	P	-	1	0	SLC35G3	30545148	0.258000	0.24033	0.095000	0.20976	0.096000	0.18686	-0.018000	0.12568	0.064000	0.16427	0.064000	0.15345	CCT		0.602	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2	NM_152462		64	123	0	0	0	0.00361	0	64	123				
MYO19	80179	broad.mit.edu	37	17	34883390	34883390	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:34883390G>C	ENST00000431794.3	-	5	814	c.292C>G	c.(292-294)Cag>Gag	p.Q98E	MYO19_ENST00000268852.9_Missense_Mutation_p.Q98E|MYO19_ENST00000586007.1_Missense_Mutation_p.Q98E|MYO19_ENST00000544606.1_Intron	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	98	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ACCTGGGGCTGAGGCGCAGCA	0.572																																							uc010wcy.1		NA																	0				ovary(1)	1						c.(292-294)CAG>GAG		myosin XIX isoform 2							63.0	68.0	66.0					17																	34883390		2013	4172	6185	SO:0001583	missense	80179					mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr17:34883390G>C	BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.292C>G	17.37:g.34883390G>C	ENSP00000409936:p.Gln98Glu		Somatic				MYO19_uc002hmw.2_Missense_Mutation_p.Q98E|MYO19_uc010cuu.2_RNA|MYO19_uc010wcz.1_RNA|MYO19_uc010wda.1_Intron|MYO19_uc002hmx.2_Missense_Mutation_p.Q98E	p.Q98E	NM_001163735	NP_001157207	WXS	Illumina HiSeq	Unspecified	Q96H55	MYO19_HUMAN	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	6	1284	-		Breast(25;0.00957)|Ovarian(249;0.17)	98			Myosin head-like.		Q59GS4|Q9H5X2	Missense_Mutation	SNP	ENST00000431794.3	37	c.292C>G	CCDS54112.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846385	0.32606	.	.	ENSG00000141140	ENST00000431794;ENST00000268852	D;D	0.86865	-2.18;-2.18	5.35	5.35	0.76521	Myosin head, motor domain (2);	0.179052	0.27092	N	0.020978	T	0.77253	0.4103	N	0.21583	0.68	0.80722	D	1	B;B;B	0.28208	0.203;0.01;0.029	B;B;B	0.24974	0.057;0.022;0.02	T	0.73733	-0.3890	10	0.49607	T	0.09	.	8.7847	0.34814	0.0772:0.0:0.7719:0.1508	.	98;98;98	Q96H55;Q96H55-2;Q96H55-4	MYO19_HUMAN;.;.	E	98	ENSP00000409936:Q98E;ENSP00000268852:Q98E	ENSP00000268852:Q98E	Q	-	1	0	MYO19	31957503	1.000000	0.71417	0.967000	0.41034	0.980000	0.70556	4.279000	0.58953	2.941000	0.99782	0.655000	0.94253	CAG		0.572	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109		8	24	0	0	0	0.008291	0	8	24				
PCGF2	7703	broad.mit.edu	37	17	36895085	36895085	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:36895085C>T	ENST00000580830.1	-	8	1047	c.346G>A	c.(346-348)Gag>Aag	p.E116K	PCGF2_ENST00000360797.2_Missense_Mutation_p.E116K|PCGF2_ENST00000585100.1_Missense_Mutation_p.E116K|PCGF2_ENST00000579882.1_Missense_Mutation_p.E116K|PCGF2_ENST00000578109.1_Missense_Mutation_p.E62K|PCGF2_ENST00000581345.1_Missense_Mutation_p.E116K			P35227	PCGF2_HUMAN	polycomb group ring finger 2	116					anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					TCCAAGACCTCGCCGCGGTCC	0.597																																							uc002hqp.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(346-348)GAG>AAG		ring finger protein 110							66.0	70.0	68.0					17																	36895085		2203	4300	6503	SO:0001583	missense	7703				negative regulation of transcription from RNA polymerase II promoter	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:36895085C>T	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.346G>A	17.37:g.36895085C>T	ENSP00000461961:p.Glu116Lys		Somatic				PCGF2_uc002hqn.1_Missense_Mutation_p.E116K|PCGF2_uc002hqo.1_Missense_Mutation_p.E116K|PCGF2_uc010cvo.1_5'UTR|PCGF2_uc002hqq.1_Missense_Mutation_p.E116K	p.E116K	NM_007144	NP_009075	WXS	Illumina HiSeq	Unspecified	P35227	PCGF2_HUMAN			7	589	-	Breast(7;9.07e-22)		116					A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	c.346G>A	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076434	0.36662	.	.	ENSG00000056661	ENST00000360797	T	0.34472	1.36	4.14	4.14	0.48551	.	0.460469	0.22435	N	0.060094	T	0.23133	0.0559	L	0.41079	1.255	0.46131	D	0.998886	P	0.41475	0.751	B	0.34346	0.18	T	0.02829	-1.1105	10	0.17832	T	0.49	-20.2708	9.0304	0.36256	0.0:0.8973:0.0:0.1027	.	116	P35227	PCGF2_HUMAN	K	116	ENSP00000354033:E116K	ENSP00000354033:E116K	E	-	1	0	PCGF2	34148611	1.000000	0.71417	0.976000	0.42696	0.519000	0.34347	3.696000	0.54757	2.124000	0.65301	0.313000	0.20887	GAG		0.597	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144		33	239	0	0	0	0.00623	0	33	239				
THRA	7067	broad.mit.edu	37	17	38240976	38240976	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:38240976C>G	ENST00000264637.4	+	6	1064	c.484C>G	c.(484-486)Cct>Gct	p.P162A	THRA_ENST00000450525.2_Missense_Mutation_p.P162A|THRA_ENST00000546243.1_Missense_Mutation_p.P162A|THRA_ENST00000584985.1_Missense_Mutation_p.P162A|THRA_ENST00000394121.4_Missense_Mutation_p.P162A	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	162					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	AGAGCCCACTCCTGAAGAGTG	0.597																																							uc002htw.2		NA																	0					0						c.(484-486)CCT>GCT		thyroid hormone receptor, alpha isoform 2	Levothyroxine(DB00451)|Liothyronine(DB00279)						101.0	98.0	99.0					17																	38240976		2203	4300	6503	SO:0001583	missense	7067				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr17:38240976C>G	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.484C>G	17.37:g.38240976C>G	ENSP00000264637:p.Pro162Ala		Somatic				THRA_uc010cwp.1_Missense_Mutation_p.P162A|THRA_uc002htv.2_Missense_Mutation_p.P162A|THRA_uc002htx.2_Missense_Mutation_p.P162A	p.P162A	NM_003250	NP_003241	WXS	Illumina HiSeq	Unspecified	P10827	THA_HUMAN			6	967	+	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)	162					A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	ENST00000264637.4	37	c.484C>G	CCDS11360.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647198	0.29246	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.93604	-3.11;-3.11;-3.25;-3.25	4.48	4.48	0.54585	Nuclear hormone receptor, ligand-binding (1);	0.758904	0.12765	N	0.441056	D	0.83954	0.5366	N	0.08118	0	0.23956	N	0.996357	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.72004	-0.4421	10	0.33940	T	0.23	.	7.938	0.29941	0.1579:0.6173:0.2248:0.0	.	162;162;162	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	A	162	ENSP00000377679:P162A;ENSP00000264637:P162A;ENSP00000395641:P162A;ENSP00000443972:P162A	ENSP00000264637:P162A	P	+	1	0	THRA	35494502	0.000000	0.05858	0.994000	0.49952	0.985000	0.73830	1.195000	0.32186	2.310000	0.77875	0.436000	0.28706	CCT		0.597	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2			53	122	0	0	0	0.00361	0	53	122				
KRT25	147183	broad.mit.edu	37	17	38907553	38907553	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:38907553G>T	ENST00000312150.4	-	4	755	c.695C>A	c.(694-696)gCt>gAt	p.A232D		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				GTTGCCTCCAGCTGCGCACTG	0.542																																							uc002hve.2		NA																	0				ovary(2)	2						c.(694-696)GCT>GAT		keratin 25							68.0	62.0	64.0					17																	38907553		2203	4300	6503	SO:0001583	missense	147183					cytoplasm|intermediate filament	structural molecule activity	g.chr17:38907553G>T	AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.695C>A	17.37:g.38907553G>T	ENSP00000310573:p.Ala232Asp		Somatic					p.A232D	NM_181534	NP_853512	WXS	Illumina HiSeq	Unspecified	Q7Z3Z0	K1C25_HUMAN			4	756	-		Breast(137;0.00526)	232			Rod.|Linker 12.			Missense_Mutation	SNP	ENST00000312150.4	37	c.695C>A	CCDS11373.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221170	0.58560	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.89196	-2.48	5.69	5.69	0.88448	Filament (1);	0.000000	0.64402	D	0.000004	D	0.92257	0.7544	M	0.85373	2.75	0.24750	N	0.992984	P	0.47034	0.889	P	0.53035	0.716	D	0.87823	0.2639	10	0.62326	D	0.03	.	8.9967	0.36057	0.0756:0.0:0.7753:0.1491	.	232	Q7Z3Z0	K1C25_HUMAN	D	232	ENSP00000310573:A232D	ENSP00000310573:A232D	A	-	2	0	KRT25	36161079	0.001000	0.12720	0.180000	0.23079	0.767000	0.43475	0.355000	0.20163	2.682000	0.91365	0.655000	0.94253	GCT		0.542	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534		34	22	1	0	1.96642e-18	0.006999	2.4175e-18	34	22				
KRTAP4-12	83755	broad.mit.edu	37	17	39279911	39279911	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:39279911C>A	ENST00000394014.1	-	1	508	c.464G>T	c.(463-465)tGc>tTc	p.C155F		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	155	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ggattcacagcaagaggggca	0.652																																							uc002hwa.2		NA																	0					0						c.(463-465)TGC>TTC		keratin associated protein 4-12							17.0	22.0	20.0					17																	39279911		2198	4291	6489	SO:0001583	missense	83755					keratin filament		g.chr17:39279911C>A	AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.464G>T	17.37:g.39279911C>A	ENSP00000377582:p.Cys155Phe		Somatic					p.C155F	NM_031854	NP_114060	WXS	Illumina HiSeq	Unspecified	Q9BQ66	KR412_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	509	-		Breast(137;0.000496)	155			31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].|28.		A3KMC5|Q495I0	Missense_Mutation	SNP	ENST00000394014.1	37	c.464G>T	CCDS32649.1	.	.	.	.	.	.	.	.	.	.	.	4.422	0.078130	0.08485	.	.	ENSG00000213416	ENST00000394014	T	0.00609	6.24	4.06	1.95	0.26073	.	2.117000	0.02699	U	0.111505	T	0.03220	0.0094	M	0.93638	3.44	0.28833	N	0.897018	D	0.55385	0.971	P	0.55161	0.77	T	0.28964	-1.0027	10	0.62326	D	0.03	.	6.4543	0.21920	0.0:0.5022:0.3933:0.1045	.	155	Q9BQ66	KR412_HUMAN	F	155	ENSP00000377582:C155F	ENSP00000377582:C155F	C	-	2	0	KRTAP4-12	36533437	0.010000	0.17322	0.006000	0.13384	0.007000	0.05969	0.916000	0.28651	0.253000	0.21552	0.491000	0.48974	TGC		0.652	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257777.1			3	43	1	0	0.00909568	0.009096	0.00929901	3	43				
CNTNAP1	8506	broad.mit.edu	37	17	40844610	40844610	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:40844610G>A	ENST00000264638.4	+	17	2841	c.2624G>A	c.(2623-2625)tGg>tAg	p.W875*	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	875	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GATGACGAGTGGCACCTGGTC	0.577																																							uc002iay.2		NA																	0				ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8						c.(2623-2625)TGG>TAG		contactin associated protein 1 precursor							144.0	127.0	133.0					17																	40844610		2203	4300	6503	SO:0001587	stop_gained	8506				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr17:40844610G>A	U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2624G>A	17.37:g.40844610G>A	ENSP00000264638:p.Trp875*		Somatic				CNTNAP1_uc010wgs.1_RNA	p.W875*	NM_003632	NP_003623	WXS	Illumina HiSeq	Unspecified	P78357	CNTP1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.143)	17	2840	+		Breast(137;0.000143)	875			Laminin G-like 3.|Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000264638.4	37	c.2624G>A	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	G	42	9.397433	0.99159	.	.	ENSG00000108797	ENST00000264638	.	.	.	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1626	0.93539	0.0:0.0:1.0:0.0	.	.	.	.	X	875	.	ENSP00000264638:W875X	W	+	2	0	CNTNAP1	38098136	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.869000	0.99810	2.768000	0.95171	0.561000	0.74099	TGG		0.577	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632		100	63	0	0	0	0.00361	0	100	63				
CDC27	996	broad.mit.edu	37	17	45234726	45234726	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:45234726G>C	ENST00000066544.3	-	6	593	c.500C>G	c.(499-501)aCa>aGa	p.T167R	CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000531206.1_Missense_Mutation_p.T167R|CDC27_ENST00000527547.1_Missense_Mutation_p.T167R|CDC27_ENST00000446365.2_Missense_Mutation_p.T106R	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GAATTTAAATGTTTGGTCAGG	0.368																																							uc002ild.3		NA																	0				lung(2)|breast(2)|ovary(1)	5						c.(499-501)ACA>AGA		cell division cycle protein 27 isoform 2							73.0	74.0	73.0					17																	45234726		2203	4300	6503	SO:0001583	missense	996				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding	g.chr17:45234726G>C	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.500C>G	17.37:g.45234726G>C	ENSP00000066544:p.Thr167Arg		Somatic				CDC27_uc002ile.3_Missense_Mutation_p.T167R|CDC27_uc002ilf.3_Missense_Mutation_p.T167R|CDC27_uc010wkp.1_Missense_Mutation_p.T106R|CDC27_uc010wkq.1_RNA	p.T167R	NM_001256	NP_001247	WXS	Illumina HiSeq	Unspecified	P30260	CDC27_HUMAN			6	627	-			167					G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	c.500C>G	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344226	0.41498	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.27;-0.27;0.02;-0.27;0.87	5.39	5.39	0.77823	.	0.119985	0.64402	D	0.000020	T	0.50257	0.1605	N	0.08118	0	0.46437	D	0.999044	B;B;B;B	0.18461	0.017;0.017;0.028;0.004	B;B;B;B	0.21151	0.006;0.033;0.031;0.009	T	0.51466	-0.8702	10	0.87932	D	0	-19.1215	16.6644	0.85248	0.0:0.0:1.0:0.0	.	106;167;167;167	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	R	167;167;106;167;167	ENSP00000066544:T167R;ENSP00000434614:T167R;ENSP00000392802:T106R;ENSP00000437339:T167R;ENSP00000432105:T167R	ENSP00000066544:T167R	T	-	2	0	CDC27	42589725	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.764000	0.74960	2.538000	0.85594	0.650000	0.86243	ACA		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			3	79	0	0	0	0.001984	0	3	79				
WFIKKN2	124857	broad.mit.edu	37	17	48917367	48917367	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:48917367G>A	ENST00000311378.4	+	2	1246	c.718G>A	c.(718-720)Gag>Aag	p.E240K	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_Missense_Mutation_p.E147K	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	240	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GCCCCGGCCTGAGATCACCTG	0.622																																							uc002isv.3		NA																	0				ovary(2)|skin(1)	3						c.(718-720)GAG>AAG		WFIKKN2 protein							94.0	93.0	93.0					17																	48917367		2203	4300	6503	SO:0001583	missense	124857					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity	g.chr17:48917367G>A	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.718G>A	17.37:g.48917367G>A	ENSP00000311184:p.Glu240Lys		Somatic				WFIKKN2_uc010dbu.2_Missense_Mutation_p.E147K	p.E240K	NM_175575	NP_783165	WXS	Illumina HiSeq	Unspecified	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)		2	1412	+			240			Ig-like C2-type.		Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	37	c.718G>A	CCDS11575.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835870	0.71373	.	.	ENSG00000173714	ENST00000426127;ENST00000311378	T;T	0.67698	-0.28;-0.28	5.44	5.44	0.79542	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.157611	0.56097	D	0.000038	T	0.64371	0.2592	L	0.39245	1.2	0.53688	D	0.999977	B	0.30211	0.273	B	0.37198	0.243	T	0.59478	-0.7447	10	0.27082	T	0.32	.	19.2584	0.93957	0.0:0.0:1.0:0.0	.	240	Q8TEU8	WFKN2_HUMAN	K	147;240	ENSP00000405889:E147K;ENSP00000311184:E240K	ENSP00000311184:E240K	E	+	1	0	WFIKKN2	46272366	1.000000	0.71417	0.948000	0.38648	0.984000	0.73092	6.627000	0.74258	2.533000	0.85409	0.651000	0.88453	GAG		0.622	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575		32	63	0	0	0	0.005524	0	32	63				
VEZF1	7716	broad.mit.edu	37	17	56060700	56060700	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:56060700G>C	ENST00000581208.1	-	2	128	c.88C>G	c.(88-90)Ctc>Gtc	p.L30V	VEZF1_ENST00000584396.1_Missense_Mutation_p.L21V	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	30					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						GAGCTCAGGAGGGGCAGCAAG	0.498																																							uc002ivf.1		NA																	0				ovary(1)|breast(1)	2						c.(88-90)CTC>GTC		zinc finger protein 161							84.0	92.0	89.0					17																	56060700		2203	4299	6502	SO:0001583	missense	7716				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr17:56060700G>C	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.88C>G	17.37:g.56060700G>C	ENSP00000462337:p.Leu30Val		Somatic				VEZF1_uc010dcn.1_5'UTR	p.L30V	NM_007146	NP_009077	WXS	Illumina HiSeq	Unspecified	Q14119	VEZF1_HUMAN			2	231	-			30						Missense_Mutation	SNP	ENST00000581208.1	37	c.88C>G	CCDS32687.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467280	0.43839	.	.	ENSG00000136451	ENST00000258963	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.65626	0.2709	L	0.27053	0.805	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.64415	-0.6413	9	0.48119	T	0.1	-9.5332	20.3812	0.98933	0.0:0.0:1.0:0.0	.	30	Q14119	VEZF1_HUMAN	V	30	.	ENSP00000258963:L30V	L	-	1	0	VEZF1	53415699	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.466000	0.97665	2.823000	0.97156	0.643000	0.83706	CTC		0.498	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1			26	99	0	0	0	0.007291	0	26	99				
EPX	8288	broad.mit.edu	37	17	56280473	56280473	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:56280473C>T	ENST00000225371.5	+	11	1850	c.1740C>T	c.(1738-1740)ctC>ctT	p.L580L		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	580					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	TCTGTGGGCTCTCCCAGCCCC	0.522																																							uc002ivq.2		NA																	0				ovary(2)	2						c.(1738-1740)CTC>CTT		eosinophil peroxidase preproprotein							65.0	67.0	66.0					17																	56280473		2203	4300	6503	SO:0001819	synonymous_variant	8288				hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding	g.chr17:56280473C>T	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1740C>T	17.37:g.56280473C>T			Somatic					p.L580L	NM_000502	NP_000493	WXS	Illumina HiSeq	Unspecified	P11678	PERE_HUMAN			11	1826	+			580					Q4TVP3	Silent	SNP	ENST00000225371.5	37	c.1740C>T	CCDS11602.1																																																																																				0.522	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502		37	56	0	0	0	0.00623	0	37	56				
MPO	4353	broad.mit.edu	37	17	56356990	56356990	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:56356990G>T	ENST00000225275.3	-	4	618	c.442C>A	c.(442-444)Cag>Aag	p.Q148K	MPO_ENST00000340482.3_Missense_Mutation_p.Q148K|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	148					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	ACATTCAGCTGGGCGGGCGTC	0.617																																							uc002ivu.1		NA																	0				ovary(2)|large_intestine(1)|pancreas(1)	4						c.(442-444)CAG>AAG		myeloperoxidase	Cefdinir(DB00535)						29.0	31.0	30.0					17																	56356990		2203	4300	6503	SO:0001583	missense	4353				anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity	g.chr17:56356990G>T		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.442C>A	17.37:g.56356990G>T	ENSP00000225275:p.Gln148Lys		Somatic					p.Q148K	NM_000250	NP_000241	WXS	Illumina HiSeq	Unspecified	P05164	PERM_HUMAN			4	619	-			148					A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	c.442C>A	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335405	0.24253	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.69040	-0.37;-0.37	5.17	5.17	0.71159	.	0.127608	0.52532	D	0.000065	T	0.82190	0.4983	M	0.83483	2.645	0.46131	D	0.998882	D	0.69078	0.997	D	0.70016	0.967	T	0.81090	-0.1090	10	0.29301	T	0.29	-27.8609	17.6592	0.88187	0.0:0.0:1.0:0.0	.	148	P05164	PERM_HUMAN	K	148	ENSP00000344419:Q148K;ENSP00000225275:Q148K	ENSP00000225275:Q148K	Q	-	1	0	MPO	53711989	1.000000	0.71417	0.954000	0.39281	0.029000	0.11900	6.029000	0.70895	2.420000	0.82092	0.561000	0.74099	CAG		0.617	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1			40	24	1	0	6.34439e-16	0.00361	7.59555e-16	40	24				
DHX40	79665	broad.mit.edu	37	17	57684443	57684443	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:57684443C>A	ENST00000251241.4	+	18	2397	c.2250C>A	c.(2248-2250)gaC>gaA	p.D750E	DHX40_ENST00000451169.2_Missense_Mutation_p.D702E|DHX40_ENST00000425628.3_Missense_Mutation_p.D673E	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	750							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GAAATGATGACAAATCCATAT	0.403																																							uc002ixn.1		NA																	0					0						c.(2248-2250)GAC>GAA		DEAH (Asp-Glu-Ala-His) box polypeptide 40							114.0	117.0	116.0					17																	57684443		2203	4300	6503	SO:0001583	missense	79665						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr17:57684443C>A	AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.2250C>A	17.37:g.57684443C>A	ENSP00000251241:p.Asp750Glu		Somatic				DHX40_uc010woe.1_Missense_Mutation_p.D673E|DHX40_uc010wof.1_Missense_Mutation_p.D265E	p.D750E	NM_024612	NP_078888	WXS	Illumina HiSeq	Unspecified	Q8IX18	DHX40_HUMAN			18	2397	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		750					B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Missense_Mutation	SNP	ENST00000251241.4	37	c.2250C>A	CCDS11617.1	.	.	.	.	.	.	.	.	.	.	C	3.844	-0.033303	0.07543	.	.	ENSG00000108406	ENST00000251241;ENST00000538926;ENST00000451169	T;T	0.03801	4.17;3.8	5.88	-0.367	0.12541	.	0.101331	0.64402	D	0.000002	T	0.01421	0.0046	N	0.02539	-0.55	0.42524	D	0.993015	B;B	0.15930	0.015;0.009	B;B	0.16722	0.016;0.011	T	0.49051	-0.8979	10	0.02654	T	1	.	6.1147	0.20120	0.0:0.3782:0.1318:0.49	.	673;750	F5H625;Q8IX18	.;DHX40_HUMAN	E	750;673;702	ENSP00000251241:D750E;ENSP00000396039:D702E	ENSP00000251241:D750E	D	+	3	2	DHX40	55039225	0.944000	0.32072	1.000000	0.80357	0.997000	0.91878	-0.082000	0.11304	0.306000	0.22856	0.561000	0.74099	GAC		0.403	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446095.1	NM_024612		19	54	1	0	1.01871e-10	0.008871	1.15893e-10	19	54				
KCNJ2	3759	broad.mit.edu	37	17	68171623	68171623	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:68171623G>T	ENST00000243457.3	+	2	826	c.443G>T	c.(442-444)aGa>aTa	p.R148I	KCNJ2_ENST00000535240.1_Missense_Mutation_p.R148I	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	148					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					TATGGTTTCAGATGTGTCACG	0.512																																							uc010dfg.2		NA																	0					0						c.(442-444)AGA>ATA		potassium inwardly-rectifying channel J2							172.0	166.0	168.0					17																	68171623		2203	4300	6503	SO:0001583	missense	3759				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding	g.chr17:68171623G>T	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.443G>T	17.37:g.68171623G>T	ENSP00000243457:p.Arg148Ile		Somatic				KCNJ2_uc002jir.2_Missense_Mutation_p.R148I	p.R148I	NM_000891	NP_000882	WXS	Illumina HiSeq	Unspecified	P63252	IRK2_HUMAN			2	844	+	Breast(10;1.64e-08)		148			Extracellular (By similarity).		O15110|P48049	Missense_Mutation	SNP	ENST00000243457.3	37	c.443G>T	CCDS11688.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088213	0.76642	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.97016	-4.21;-4.21	5.82	5.82	0.92795	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98617	0.9537	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98982	1.0805	9	.	.	.	.	20.1041	0.97884	0.0:0.0:1.0:0.0	.	148	P63252	IRK2_HUMAN	I	148	ENSP00000441848:R148I;ENSP00000243457:R148I	.	R	+	2	0	KCNJ2	65683218	1.000000	0.71417	0.350000	0.25708	0.944000	0.59088	9.869000	0.99810	2.755000	0.94549	0.555000	0.69702	AGA		0.512	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450889.1	NM_000891		80	36	1	0	9.07295e-45	0.00361	1.20155e-44	80	36				
TTYH2	94015	broad.mit.edu	37	17	72249298	72249298	+	Silent	SNP	G	G	A	rs138705961		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:72249298G>A	ENST00000269346.4	+	12	1412	c.1338G>A	c.(1336-1338)ccG>ccA	p.P446P	TTYH2_ENST00000529107.1_Silent_p.P425P|TTYH2_ENST00000441391.2_Silent_p.P125P	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	446						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						ACAGTCCCCCGAGGGGACAGC	0.587																																							uc002jkc.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(1336-1338)CCG>CCA		tweety 2 isoform 1		G	,	0,4406		0,0,2203	96.0	98.0	97.0		1338,375	-6.1	0.0	17	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TTYH2	NM_032646.5,NM_052869.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	446/535,125/214	72249298	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	94015					chloride channel complex|plasma membrane	chloride channel activity|protein binding	g.chr17:72249298G>A		CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.1338G>A	17.37:g.72249298G>A			Somatic				TTYH2_uc010wqw.1_Silent_p.P425P|TTYH2_uc002jkd.2_Silent_p.P125P	p.P446P	NM_032646	NP_116035	WXS	Illumina HiSeq	Unspecified	Q9BSA4	TTYH2_HUMAN			12	1369	+			446			Cytoplasmic (Potential).		B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	ENST00000269346.4	37	c.1338G>A	CCDS32717.1																																																																																				0.587	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1			11	171	0	0	0	0.001368	0	11	171				
KIAA0195	9772	broad.mit.edu	37	17	73492070	73492070	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr17:73492070A>G	ENST00000314256.7	+	23	3362	c.2968A>G	c.(2968-2970)Atg>Gtg	p.M990V	KIAA0195_ENST00000375248.5_Missense_Mutation_p.M1000V|KIAA0195_ENST00000579208.1_Missense_Mutation_p.M641V|AC100787.1_ENST00000579379.1_RNA	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	990						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GATAAAGATCATGCAAGAGTA	0.602																																							uc002jnz.3		NA																	0				ovary(1)	1						c.(2968-2970)ATG>GTG		hypothetical protein LOC9772							46.0	36.0	39.0					17																	73492070		2203	4300	6503	SO:0001583	missense	9772				ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism	g.chr17:73492070A>G		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2968A>G	17.37:g.73492070A>G	ENSP00000313885:p.Met990Val		Somatic				KIAA0195_uc010wsa.1_Missense_Mutation_p.M1000V|KIAA0195_uc010wsb.1_Missense_Mutation_p.M630V|KIAA0195_uc002job.3_5'UTR	p.M990V	NM_014738	NP_055553	WXS	Illumina HiSeq	Unspecified	Q12767	K0195_HUMAN	all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)		23	3243	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		990					O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	c.2968A>G	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.776128	0.49786	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.53640	0.61;0.61	5.84	5.84	0.93424	ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.70351	0.3214	M	0.81112	2.525	0.80722	D	1	P;D;D	0.58268	0.924;0.982;0.969	P;D;D	0.68943	0.878;0.961;0.914	T	0.74578	-0.3619	10	0.72032	D	0.01	-41.0438	16.2045	0.82114	1.0:0.0:0.0:0.0	.	1000;1000;990	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	V	990;1000	ENSP00000313885:M990V;ENSP00000364397:M1000V	ENSP00000313885:M990V	M	+	1	0	KIAA0195	71003665	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.858000	0.92256	2.234000	0.73211	0.459000	0.35465	ATG		0.602	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		33	19	0	0	0	0.005524	0	33	19				
THOC1	9984	broad.mit.edu	37	18	265526	265526	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:265526G>C	ENST00000261600.6	-	2	66	c.59C>G	c.(58-60)tCt>tGt	p.S20C	THOC1_ENST00000582313.1_5'UTR|RP11-705O1.8_ENST00000581677.1_lincRNA	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	20					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CTCTCTGGTAGACTTCTAAAA	0.313																																							uc002kkj.3		NA																	0				ovary(1)	1						c.(58-60)TCT>TGT		THO complex 1							54.0	50.0	51.0					18																	265526		1808	4060	5868	SO:0001583	missense	9984				apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding	g.chr18:265526G>C	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.59C>G	18.37:g.265526G>C	ENSP00000261600:p.Ser20Cys		Somatic				THOC1_uc002kkk.3_RNA|THOC1_uc002kkl.2_Missense_Mutation_p.S20C	p.S20C	NM_005131	NP_005122	WXS	Illumina HiSeq	Unspecified	Q96FV9	THOC1_HUMAN			2	99	-		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)	20					B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	37	c.59C>G	CCDS45820.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653398	0.47362	.	.	ENSG00000079134	ENST00000261600	.	.	.	6.06	6.06	0.98353	.	0.174450	0.51477	D	0.000094	T	0.55800	0.1943	N	0.19112	0.55	0.47009	D	0.999286	P;D	0.56746	0.948;0.977	P;P	0.50617	0.646;0.525	T	0.53816	-0.8385	9	0.39692	T	0.17	-13.8607	20.2348	0.98355	0.0:0.0:1.0:0.0	.	20;20	Q96FV9-2;Q96FV9	.;THOC1_HUMAN	C	20	.	ENSP00000261600:S20C	S	-	2	0	THOC1	255526	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.229000	0.95273	2.879000	0.98667	0.650000	0.86243	TCT		0.313	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131		2	10	0	0	0	0.004672	0	2	10				
MTCL1	23255	broad.mit.edu	37	18	8819032	8819032	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:8819032C>T	ENST00000306329.11	+	11	3888	c.3888C>T	c.(3886-3888)ccC>ccT	p.P1296P	SOGA2_ENST00000359865.3_Silent_p.P977P|SOGA2_ENST00000518815.1_Intron|SOGA2_ENST00000306285.7_Intron|SOGA2_ENST00000517570.1_Silent_p.P936P|SOGA2_ENST00000400050.3_Silent_p.P936P																							ACGTTCGCCCCTTTCCCCACC	0.527																																							uc002knr.2		NA																	0					0						c.(2929-2931)CCC>CCT		hypothetical protein LOC23255							58.0	63.0	61.0					18																	8819032		2203	4300	6503	SO:0001819	synonymous_variant	23255							g.chr18:8819032C>T																												ENST00000306329.11:c.3888C>T	18.37:g.8819032C>T			Somatic				KIAA0802_uc002knq.2_Silent_p.P936P|KIAA0802_uc002kns.2_Intron	p.P977P	NM_015210	NP_056025	WXS	Illumina HiSeq	Unspecified	Q9Y4B5	CC165_HUMAN			13	3073	+			1287						Silent	SNP	ENST00000306329.11	37	c.2931C>T																																																																																					0.527	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			45	101	0	0	0	0.00361	0	45	101				
DSG4	147409	broad.mit.edu	37	18	28993456	28993456	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:28993456G>A	ENST00000308128.4	+	16	3156	c.3021G>A	c.(3019-3021)atG>atA	p.M1007I	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.M1026I|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	1007					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGCAAATGATGAGTCCAGACC	0.473																																							uc002kwq.2		NA																	0				central_nervous_system(5)|ovary(3)	8						c.(3019-3021)ATG>ATA		desmoglein 4 isoform 2 preproprotein							107.0	108.0	107.0					18																	28993456		2203	4300	6503	SO:0001583	missense	147409				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28993456G>A	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.3021G>A	18.37:g.28993456G>A	ENSP00000311859:p.Met1007Ile		Somatic				DSG4_uc002kwr.2_Missense_Mutation_p.M1026I	p.M1007I	NM_177986	NP_817123	WXS	Illumina HiSeq	Unspecified	Q86SJ6	DSG4_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		16	3156	+			1007			Cytoplasmic (Potential).		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	c.3021G>A	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	G	2.980	-0.210600	0.06140	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.58652	0.39;0.32	5.56	2.35	0.29111	.	0.827351	0.09854	N	0.747124	T	0.42810	0.1219	L	0.36672	1.1	0.20975	N	0.999816	B;B	0.14438	0.01;0.001	B;B	0.13407	0.009;0.002	T	0.28808	-1.0032	10	0.15952	T	0.53	.	6.6639	0.23029	0.3078:0.1293:0.5629:0.0	.	1026;1007	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	I	1007;1026	ENSP00000311859:M1007I;ENSP00000352785:M1026I	ENSP00000311859:M1007I	M	+	3	0	DSG4	27247454	0.647000	0.27304	0.202000	0.23494	0.005000	0.04900	0.118000	0.15605	0.702000	0.31825	-0.218000	0.12543	ATG		0.473	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		9	82	0	0	0	0.000978	0	9	82				
PIK3C3	5289	broad.mit.edu	37	18	39637886	39637886	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:39637886G>T	ENST00000262039.4	+	22	2389	c.2303G>T	c.(2302-2304)cGg>cTg	p.R768L	PIK3C3_ENST00000588156.1_5'UTR|PIK3C3_ENST00000398870.3_Missense_Mutation_p.R705L|PIK3C3_ENST00000593098.1_Missense_Mutation_p.R253L	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	768	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						ATTTTGGGTCGGGATCCAAAG	0.428										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	NSCLC(37;552 1060 2683 16430 37914)	uc002lap.2		NA																	0				lung(8)|ovary(1)|breast(1)	10						c.(2302-2304)CGG>CTG		catalytic phosphatidylinositol 3-kinase 3							72.0	72.0	72.0					18																	39637886		2203	4300	6503	SO:0001583	missense	5289				cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding	g.chr18:39637886G>T	Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.2303G>T	18.37:g.39637886G>T	ENSP00000262039:p.Arg768Leu	TSP Lung(28;0.18)	Somatic				PIK3C3_uc010xcl.1_Missense_Mutation_p.R705L|PIK3C3_uc002laq.2_Missense_Mutation_p.R253L	p.R768L	NM_002647	NP_002638	WXS	Illumina HiSeq	Unspecified	Q8NEB9	PK3C3_HUMAN			22	2361	+			768			PI3K/PI4K.		Q15134	Missense_Mutation	SNP	ENST00000262039.4	37	c.2303G>T	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	G	33	5.251098	0.95305	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	T;T	0.76316	-1.01;-1.01	5.09	5.09	0.68999	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.87661	0.6233	M	0.89163	3.01	0.80722	D	1	D;P	0.53619	0.961;0.834	P;B	0.54544	0.755;0.367	D	0.89655	0.3872	9	.	.	.	.	18.1078	0.89526	0.0:0.0:1.0:0.0	.	705;768	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	L	768;705	ENSP00000262039:R768L;ENSP00000381845:R705L	.	R	+	2	0	PIK3C3	37891884	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	9.397000	0.97276	2.362000	0.80069	0.555000	0.69702	CGG		0.428	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647		17	30	1	0	6.33239e-15	0.010504	7.47679e-15	17	30				
LIPG	9388	broad.mit.edu	37	18	47091756	47091756	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:47091756C>G	ENST00000261292.4	+	2	445	c.167C>G	c.(166-168)tCc>tGc	p.S56C	LIPG_ENST00000427224.2_Missense_Mutation_p.S56C|LIPG_ENST00000580036.1_Missense_Mutation_p.S56C|LIPG_ENST00000577628.1_Missense_Mutation_p.S92C	NM_006033.2	NP_006024.1	Q9Y5X9	LIPE_HUMAN	lipase, endothelial	56					cell proliferation (GO:0008283)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle remodeling (GO:0034375)|lipid metabolic process (GO:0006629)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|regulation of lipoprotein metabolic process (GO:0050746)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)	extracellular space (GO:0005615)	heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phospholipase activity (GO:0004620)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(2)	18						CTCCGCACCTCCAAGGACCCA	0.507																																					Pancreas(126;280 1778 12814 26243 34948)	Pancreas(126;280 1778 12814 26243 34948)	uc002ldv.2		NA																	0				ovary(1)|skin(1)	2						c.(166-168)TCC>TGC		endothelial lipase precursor							117.0	96.0	103.0					18																	47091756		2203	4300	6503	SO:0001583	missense	9388				cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity	g.chr18:47091756C>G	AF118767	CCDS11938.1	18q21.1	2006-04-22				ENSG00000101670			6623	protein-coding gene	gene with protein product		603684				10318835, 10192396	Standard	XM_005258390		Approved	EDL	uc002ldv.3	Q9Y5X9		ENST00000261292.4:c.167C>G	18.37:g.47091756C>G	ENSP00000261292:p.Ser56Cys		Somatic				LIPG_uc002ldu.1_Missense_Mutation_p.S56C|LIPG_uc010xdh.1_Missense_Mutation_p.S56C	p.S56C	NM_006033	NP_006024	WXS	Illumina HiSeq	Unspecified	Q9Y5X9	LIPE_HUMAN			2	419	+			56					B0LPG6|Q6P9C8|Q6UW82	Missense_Mutation	SNP	ENST00000261292.4	37	c.167C>G	CCDS11938.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663121	0.47572	.	.	ENSG00000101670	ENST00000261292;ENST00000427224	D;D	0.91124	-2.79;-2.79	5.34	4.47	0.54385	Lipase, N-terminal (1);	0.288222	0.39341	N	0.001397	D	0.92961	0.7760	L	0.51914	1.62	0.38177	D	0.939514	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.69479	0.964;0.959;0.957	D	0.93936	0.7219	10	0.59425	D	0.04	-14.666	13.4117	0.60946	0.0:0.9236:0.0:0.0764	.	56;56;56	B4DTR8;Q9Y5X9;Q9Y5X9-2	.;LIPE_HUMAN;.	C	56	ENSP00000261292:S56C;ENSP00000387978:S56C	ENSP00000261292:S56C	S	+	2	0	LIPG	45345754	0.177000	0.23109	0.826000	0.32828	0.548000	0.35241	3.555000	0.53727	1.250000	0.43966	0.561000	0.74099	TCC		0.507	LIPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447546.1	NM_006033		20	29	0	0	0	0.001882	0	20	29				
ZNF407	55628	broad.mit.edu	37	18	72343820	72343820	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:72343820A>G	ENST00000299687.5	+	1	845	c.845A>G	c.(844-846)cAg>cGg	p.Q282R	ZNF407_ENST00000582337.1_Missense_Mutation_p.Q282R|ZNF407_ENST00000309902.6_Missense_Mutation_p.Q282R|ZNF407_ENST00000577538.1_Missense_Mutation_p.Q282R	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GGATTTGTACAGATCTTAACA	0.363																																							uc002llw.2		NA																	0				ovary(2)	2						c.(844-846)CAG>CGG		zinc finger protein 407 isoform 1							102.0	100.0	101.0					18																	72343820		1874	4111	5985	SO:0001583	missense	55628				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:72343820A>G	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.845A>G	18.37:g.72343820A>G	ENSP00000299687:p.Gln282Arg		Somatic				ZNF407_uc010xfc.1_Missense_Mutation_p.Q282R|ZNF407_uc010dqu.1_Missense_Mutation_p.Q282R|ZNF407_uc002llu.2_Missense_Mutation_p.Q281R	p.Q282R	NM_017757	NP_060227	WXS	Illumina HiSeq	Unspecified	Q9C0G0	ZN407_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.184)	1	902	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	282					B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	c.845A>G	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.428853	0.83667	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.12255	2.7;3.26	5.18	5.18	0.71444	.	0.481209	0.13144	U	0.410449	T	0.15782	0.0380	N	0.16790	0.44	0.28513	N	0.913447	P;D;P	0.56287	0.886;0.975;0.818	P;P;B	0.50570	0.631;0.644;0.299	T	0.10800	-1.0614	10	0.40728	T	0.16	.	15.3342	0.74238	1.0:0.0:0.0:0.0	.	282;282;282	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	R	282	ENSP00000299687:Q282R;ENSP00000310359:Q282R	ENSP00000299687:Q282R	Q	+	2	0	ZNF407	70472808	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.672000	0.54583	1.315000	0.45114	0.655000	0.94253	CAG		0.363	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757		38	36	0	0	0	0.003214	0	38	36				
GALR1	2587	broad.mit.edu	37	18	74962762	74962762	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr18:74962762C>G	ENST00000299727.3	+	1	258	c.258C>G	c.(256-258)ctC>ctG	p.L86L		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	86					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.L86L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCTACCTGCTCTTCTGCATCC	0.622																																							uc002lms.3		NA																	1	Substitution - coding silent(1)		breast(1)	lung(1)	1						c.(256-258)CTC>CTG		galanin receptor 1							125.0	111.0	116.0					18																	74962762		2203	4300	6503	SO:0001819	synonymous_variant	2587				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity	g.chr18:74962762C>G	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.258C>G	18.37:g.74962762C>G			Somatic					p.L86L	NM_001480	NP_001471	WXS	Illumina HiSeq	Unspecified	P47211	GALR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)	1	755	+		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)	86			Helical; Name=2; (Potential).		Q4VBL7	Silent	SNP	ENST00000299727.3	37	c.258C>G	CCDS12012.1																																																																																				0.622	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1			61	48	0	0	0	0.00361	0	61	48				
LPPR3	79948	broad.mit.edu	37	19	814446	814446	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:814446G>T	ENST00000520876.3	-	7	897	c.819C>A	c.(817-819)atC>atA	p.I273I	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Silent_p.I301I	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		273						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										GGTAGGCAGCGATGCCCGCCC	0.667																																							uc002lpx.1		NA																	0					0						c.(817-819)ATC>ATA		plasticity-related protein 2							25.0	27.0	26.0					19																	814446		2191	4294	6485	SO:0001819	synonymous_variant	79948					integral to membrane	phosphatidate phosphatase activity	g.chr19:814446G>T																												ENST00000520876.3:c.819C>A	19.37:g.814446G>T			Somatic				LPPR3_uc010dru.1_Silent_p.I185I|LPPR3_uc002lpw.1_Silent_p.I301I|LPPR3_uc002lpy.1_Silent_p.I54I	p.I273I	NM_024888	NP_079164	WXS	Illumina HiSeq	Unspecified	Q6T4P5	LPPR3_HUMAN			7	883	-			273			Helical; (Potential).		Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	ENST00000520876.3	37	c.819C>A	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	G	5.540	0.284619	0.10513	.	.	ENSG00000129951	ENST00000517665	.	.	.	4.66	-1.55	0.08558	.	.	.	.	.	T	0.54695	0.1874	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51052	-0.8754	4	.	.	.	-13.7024	9.3954	0.38399	0.5567:0.0:0.4433:0.0	.	.	.	.	S	62	.	.	R	-	1	0	AC006273.1	765446	0.594000	0.26849	0.997000	0.53966	0.279000	0.26890	-0.173000	0.09854	-0.089000	0.12484	0.555000	0.69702	CGC		0.667	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3			9	15	1	0	2.68362e-12	0.001368	3.08886e-12	9	15				
KISS1R	84634	broad.mit.edu	37	19	917741	917741	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:917741A>G	ENST00000234371.5	+	1	392	c.239A>G	c.(238-240)tAc>tGc	p.Y80C	KISS1R_ENST00000606939.1_Missense_Mutation_p.Y80C	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	80					activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAACTTCTACATCGGTGAG	0.701																																							uc002lqk.3		NA																	0				pancreas(1)	1						c.(238-240)TAC>TGC		G protein-coupled receptor 54							25.0	20.0	21.0					19																	917741		2199	4295	6494	SO:0001583	missense	84634				behavior	integral to membrane|plasma membrane	neuropeptide receptor activity|protein binding	g.chr19:917741A>G	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.239A>G	19.37:g.917741A>G	ENSP00000234371:p.Tyr80Cys		Somatic					p.Y80C	NM_032551	NP_115940	WXS	Illumina HiSeq	Unspecified	Q969F8	KISSR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	1	400	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	80			Helical; Name=2; (Potential).		A5D8U2|B2RTV1|Q96QG0	Missense_Mutation	SNP	ENST00000234371.5	37	c.239A>G	CCDS12049.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779017	0.70107	.	.	ENSG00000116014	ENST00000234371	T	0.75704	-0.96	3.94	3.94	0.45596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.86619	0.5976	M	0.89030	3	0.51012	D	0.999904	D	0.89917	1.0	D	0.80764	0.994	D	0.88459	0.3054	10	0.87932	D	0	.	11.0588	0.47936	1.0:0.0:0.0:0.0	.	80	Q969F8	KISSR_HUMAN	C	80	ENSP00000234371:Y80C	ENSP00000234371:Y80C	Y	+	2	0	KISS1R	868741	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.896000	0.48656	1.561000	0.49584	0.329000	0.21502	TAC		0.701	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3	NM_032551		5	16	0	0	0	0.001984	0	5	16				
HMHA1	23526	broad.mit.edu	37	19	1079762	1079762	+	Missense_Mutation	SNP	G	G	A	rs542909389		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:1079762G>A	ENST00000313093.2	+	12	1666	c.1435G>A	c.(1435-1437)Gag>Aag	p.E479K	HMHA1_ENST00000590577.1_Missense_Mutation_p.E114K|HMHA1_ENST00000536472.1_Missense_Mutation_p.E319K|HMHA1_ENST00000590214.1_Missense_Mutation_p.E506K|HMHA1_ENST00000543365.1_Missense_Mutation_p.E362K|HMHA1_ENST00000586866.1_Missense_Mutation_p.E483K|HMHA1_ENST00000539243.2_Missense_Mutation_p.E495K	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	479					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGAAGCAGGAGCTGGAGGA	0.687																																							uc002lqz.1		NA																	0				lung(1)	1						c.(1435-1437)GAG>AAG		minor histocompatibility antigen HA-1							48.0	40.0	43.0					19																	1079762		2202	4298	6500	SO:0001583	missense	23526				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding	g.chr19:1079762G>A	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.1435G>A	19.37:g.1079762G>A	ENSP00000316772:p.Glu479Lys		Somatic				HMHA1_uc010xgd.1_Missense_Mutation_p.E495K|HMHA1_uc010xge.1_Missense_Mutation_p.E319K|HMHA1_uc002lra.1_Missense_Mutation_p.E319K|HMHA1_uc002lrb.1_Missense_Mutation_p.E362K|HMHA1_uc002lrc.1_Missense_Mutation_p.E114K	p.E479K	NM_012292	NP_036424	WXS	Illumina HiSeq	Unspecified	Q92619	HMHA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	12	1666	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	479			Potential.		B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	37	c.1435G>A	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	G	36	5.712987	0.96830	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	4.61	4.61	0.57282	.	0.000000	0.85682	U	0.000000	T	0.65575	0.2704	M	0.79258	2.445	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.926;0.998;0.997	T	0.69866	-0.5029	10	0.54805	T	0.06	-30.9466	15.9879	0.80176	0.0:0.0:1.0:0.0	.	319;495;114;362;479	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	K	495;479;479;319;473;362	ENSP00000439601:E495K;ENSP00000316772:E479K;ENSP00000445109:E319K;ENSP00000438979:E362K	ENSP00000316772:E479K	E	+	1	0	HMHA1	1030762	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.138000	0.77305	2.112000	0.64535	0.561000	0.74099	GAG		0.687	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1			32	51	0	0	0	0.003755	0	32	51				
PLIN5	440503	broad.mit.edu	37	19	4529859	4529859	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:4529859G>A	ENST00000381848.3	-	4	356	c.276C>T	c.(274-276)ctC>ctT	p.L92L	CTB-50L17.14_ENST00000586020.1_3'UTR	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	92	Essential for lipid droplet targeting. {ECO:0000250}.|Interaction with LIPE. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						CCCTGCAGGCGAGGCTGTTCA	0.607																																							uc002mas.2		NA																	0					0						c.(274-276)CTC>CTT		lipid storage droplet protein 5							50.0	55.0	53.0					19																	4529859		1985	4148	6133	SO:0001819	synonymous_variant	440503					lipid particle		g.chr19:4529859G>A	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.276C>T	19.37:g.4529859G>A			Somatic				PLIN5_uc002mat.1_Silent_p.L92L	p.L92L	NM_001013706	NP_001013728	WXS	Illumina HiSeq	Unspecified	Q00G26	PLIN5_HUMAN			4	329	-			92					A2RRC1|Q6ZS68	Silent	SNP	ENST00000381848.3	37	c.276C>T	CCDS42473.1																																																																																				0.607	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706		27	57	0	0	0	0.008361	0	27	57				
DENND1C	79958	broad.mit.edu	37	19	6475302	6475302	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:6475302C>T	ENST00000381480.2	-	14	1148	c.1036G>A	c.(1036-1038)Gca>Aca	p.A346T	DENND1C_ENST00000591030.1_5'Flank|DENND1C_ENST00000543576.1_Missense_Mutation_p.A302T	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	346	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						CAGACGAGTGCGTCGCGGTAC	0.657																																							uc002mfe.2		NA																	0				large_intestine(1)	1						c.(1036-1038)GCA>ACA		DENN/MADD domain containing 1C							23.0	29.0	27.0					19																	6475302		1994	4155	6149	SO:0001583	missense	79958					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity	g.chr19:6475302C>T	AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.1036G>A	19.37:g.6475302C>T	ENSP00000370889:p.Ala346Thr		Somatic				DENND1C_uc002mfb.2_5'UTR|DENND1C_uc002mfc.2_5'UTR|DENND1C_uc002mfd.2_5'UTR|DENND1C_uc010xje.1_Missense_Mutation_p.A302T	p.A346T	NM_024898	NP_079174	WXS	Illumina HiSeq	Unspecified	Q8IV53	DEN1C_HUMAN			14	1128	-			346			dDENN.		B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Missense_Mutation	SNP	ENST00000381480.2	37	c.1036G>A	CCDS45938.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631550	0.67015	.	.	ENSG00000205744	ENST00000381480;ENST00000543576	T;T	0.45668	0.89;0.89	4.87	4.87	0.63330	dDENN (3);	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	M	0.75085	2.285	0.54753	D	0.999984	D	0.76494	0.999	D	0.70487	0.969	T	0.66771	-0.5839	10	0.52906	T	0.07	-18.5479	15.4796	0.75514	0.0:1.0:0.0:0.0	.	346	Q8IV53	DEN1C_HUMAN	T	346;302	ENSP00000370889:A346T;ENSP00000437805:A302T	ENSP00000370889:A346T	A	-	1	0	DENND1C	6426302	1.000000	0.71417	0.186000	0.23195	0.040000	0.13550	4.725000	0.61979	2.232000	0.73038	0.462000	0.41574	GCA		0.657	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453332.2	NM_024898		7	21	0	0	0	0.008291	0	7	21				
CD70	970	broad.mit.edu	37	19	6590912	6590912	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:6590912G>C	ENST00000245903.3	-	1	251	c.102C>G	c.(100-102)ctC>ctG	p.L34L	CD70_ENST00000423145.3_Silent_p.L34L	NM_001252.3	NP_001243.1	P32970	CD70_HUMAN	CD70 molecule	34					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protease binding (GO:0002020)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|skin(1)	11						TGCACACCACGAGGCAGATCA	0.622																																					Pancreas(183;2617 2876 10173 34193)	Pancreas(183;2617 2876 10173 34193)	uc002mfi.2		NA																	0					0						c.(100-102)CTC>CTG		tumor necrosis factor ligand superfamily, member							67.0	69.0	68.0					19																	6590912		2203	4300	6503	SO:0001819	synonymous_variant	970				cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to membrane of membrane fraction|integral to plasma membrane	cytokine activity|protease binding|tumor necrosis factor receptor binding	g.chr19:6590912G>C	L08096	CCDS12170.1	19p13	2013-05-22	2006-10-27	2006-10-27		ENSG00000125726		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11937	protein-coding gene	gene with protein product		602840	"""tumor necrosis factor (ligand) superfamily, member 7"""	CD27LG, TNFSF7		8387892, 8120384	Standard	NM_001252		Approved	CD27L	uc002mfi.3	P32970		ENST00000245903.3:c.102C>G	19.37:g.6590912G>C			Somatic				CD70_uc010xjf.1_Silent_p.L34L	p.L34L	NM_001252	NP_001243	WXS	Illumina HiSeq	Unspecified	P32970	CD70_HUMAN			1	252	-			34			Helical; Signal-anchor for type II membrane protein; (Potential).		B4DPR8|Q53XX4|Q96J57	Silent	SNP	ENST00000245903.3	37	c.102C>G	CCDS12170.1																																																																																				0.622	CD70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457860.1			25	83	0	0	0	0.005443	0	25	83				
MUC16	94025	broad.mit.edu	37	19	8969281	8969281	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:8969281C>A	ENST00000397910.4	-	79	43266	c.43063G>T	c.(43063-43065)Gat>Tat	p.D14355Y	MUC16_ENST00000380951.5_Missense_Mutation_p.D996Y	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14451	SEA 15. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCACCGCATCCTCAATATTC	0.473																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(43063-43065)GAT>TAT		mucin 16							226.0	216.0	219.0					19																	8969281		1997	4165	6162	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:8969281C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.43063G>T	19.37:g.8969281C>A	ENSP00000381008:p.Asp14355Tyr		Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.D1155Y|MUC16_uc010xki.1_RNA	p.D14355Y	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			79	43267	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.43063G>T	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.283|9.283	1.048737|1.048737	0.19827|0.19827	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.38887|.	1.11;1.11|.	4.3|4.3	-7.21|-7.21	0.01490|0.01490	SEA (3);|.	2.275610|.	0.02272|.	N|.	0.068589|.	T|T	0.35278|0.35278	0.0926|0.0926	M|M	0.63428|0.63428	1.95|1.95	.|.	.|.	.|.	B;D|.	0.64830|.	0.046;0.994|.	B;D|.	0.78314|.	0.031;0.991|.	T|T	0.38112|0.38112	-0.9676|-0.9676	9|4	0.36615|.	T|.	0.2|.	.|.	2.7628|2.7628	0.05312|0.05312	0.1301:0.211:0.1281:0.5309|0.1301:0.211:0.1281:0.5309	.|.	22000;14355|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	Y|S	14355;996|1177	ENSP00000381008:D14355Y;ENSP00000370338:D996Y|.	ENSP00000370338:D996Y|.	D|R	-|-	1|3	0|2	MUC16|MUC16	8830281|8830281	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-1.505000|-1.505000	0.02273|0.02273	-1.484000|-1.484000	0.01856|0.01856	-0.150000|-0.150000	0.13652|0.13652	GAT|AGG		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		55	109	1	0	4.52765e-18	0.00361	5.52663e-18	55	109				
MUC16	94025	broad.mit.edu	37	19	8994195	8994195	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:8994195G>A	ENST00000397910.4	-	65	41693	c.41490C>T	c.(41488-41490)ttC>ttT	p.F13830F	MUC16_ENST00000380951.5_Silent_p.F471F	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13833	SEA 12. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTGTTCTTGAACAAGGGCC	0.537																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(41488-41490)TTC>TTT		mucin 16							117.0	105.0	109.0					19																	8994195		2006	4178	6184	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:8994195G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41490C>T	19.37:g.8994195G>A			Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.F647F|MUC16_uc010xki.1_RNA	p.F13830F	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			65	41694	-			13833	Missing (in Ref. 3; AAK74120).		Extracellular (Potential).|SEA 12.		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.41490C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	4.243	0.044084	0.08196	.	.	ENSG00000181143	ENST00000542240	.	.	.	3.74	2.6	0.31112	.	.	.	.	.	T	0.44498	0.1296	.	.	.	.	.	.	.	.	.	.	.	.	T	0.53143	-0.8480	3	.	.	.	.	8.5933	0.33701	0.0:0.2369:0.7631:0.0	.	.	.	.	L	670	.	.	S	-	2	0	MUC16	8855195	0.055000	0.20627	0.075000	0.20258	0.194000	0.23727	0.734000	0.26101	2.113000	0.64589	0.650000	0.86243	TCA		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		33	64	0	0	0	0.009718	0	33	64				
MUC16	94025	broad.mit.edu	37	19	9049135	9049135	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:9049135G>A	ENST00000397910.4	-	5	32699	c.32496C>T	c.(32494-32496)agC>agT	p.S10832S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10834	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAACTGTTGGGCTGGTCTGTG	0.483																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(32494-32496)AGC>AGT		mucin 16							160.0	145.0	149.0					19																	9049135		1962	4154	6116	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9049135G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32496C>T	19.37:g.9049135G>A			Somatic					p.S10832S	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			5	32700	-			10834			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.32496C>T	CCDS54212.1																																																																																				0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		44	89	0	0	0	0.00361	0	44	89				
MUC16	94025	broad.mit.edu	37	19	9062050	9062050	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:9062050G>C	ENST00000397910.4	-	3	25599	c.25396C>G	c.(25396-25398)Cag>Gag	p.Q8466E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8468	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGGTGAACTGATCAGGCCCT	0.498																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(25396-25398)CAG>GAG		mucin 16							168.0	157.0	161.0					19																	9062050		1980	4162	6142	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9062050G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.25396C>G	19.37:g.9062050G>C	ENSP00000381008:p.Gln8466Glu		Somatic					p.Q8466E	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	25600	-			8468			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.25396C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.139	-0.176810	0.06380	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	2.57	0.174	0.15040	.	.	.	.	.	T	0.02929	0.0087	L	0.34521	1.04	.	.	.	D	0.61697	0.99	P	0.50049	0.629	T	0.43845	-0.9366	8	0.87932	D	0	.	4.6963	0.12806	0.0:0.2474:0.499:0.2536	.	8466	B5ME49	.	E	8466	ENSP00000381008:Q8466E	ENSP00000381008:Q8466E	Q	-	1	0	MUC16	8923050	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.339000	0.07832	0.121000	0.18284	-0.553000	0.04205	CAG		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		56	142	0	0	0	0.00361	0	56	142				
KEAP1	9817	broad.mit.edu	37	19	10610405	10610405	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:10610405G>A	ENST00000171111.5	-	2	852	c.305C>T	c.(304-306)tCa>tTa	p.S102L	KEAP1_ENST00000393623.2_Missense_Mutation_p.S102L|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	102	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AGGGCTGGATGAGGCCAGCAC	0.627																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(304-306)TCA>TTA		kelch-like ECH-associated protein 1							83.0	67.0	72.0					19																	10610405		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610405G>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.305C>T	19.37:g.10610405G>A	ENSP00000171111:p.Ser102Leu		Somatic				KEAP1_uc002mor.1_Missense_Mutation_p.S102L	p.S102L	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	461	-			102			BTB.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.305C>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765581	0.69878	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.68025	-0.3;-0.3	4.68	4.68	0.58851	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.059190	0.64402	D	0.000001	T	0.81128	0.4758	M	0.77103	2.36	0.58432	D	0.999999	D	0.76494	0.999	D	0.70935	0.971	D	0.84225	0.0463	10	0.87932	D	0	.	15.0979	0.72250	0.0:0.0:1.0:0.0	.	102	Q14145	KEAP1_HUMAN	L	102	ENSP00000171111:S102L;ENSP00000377245:S102L	ENSP00000171111:S102L	S	-	2	0	KEAP1	10471405	1.000000	0.71417	0.958000	0.39756	0.262000	0.26303	7.863000	0.87023	2.162000	0.67917	0.462000	0.41574	TCA		0.627	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		16	21	0	0	0	0.004007	0	16	21				
AP1M2	10053	broad.mit.edu	37	19	10692432	10692432	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:10692432G>A	ENST00000250244.6	-	4	472	c.390C>T	c.(388-390)atC>atT	p.I130I	AP1M2_ENST00000590923.1_Silent_p.I130I	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	130					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			ACTCCTGCAGGATCTTGCTGT	0.602																																							uc002mpc.2		NA																	0				ovary(2)	2						c.(388-390)ATC>ATT		adaptor-related protein complex 1, mu 2 subunit							65.0	67.0	66.0					19																	10692432		2203	4300	6503	SO:0001819	synonymous_variant	10053				cellular membrane organization|post-Golgi vesicle-mediated transport|protein targeting|regulation of defense response to virus by virus|vesicle targeting|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding	g.chr19:10692432G>A	AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.390C>T	19.37:g.10692432G>A			Somatic				AP1M2_uc002mpd.2_Silent_p.I130I	p.I130I	NM_005498	NP_005489	WXS	Illumina HiSeq	Unspecified	Q9Y6Q5	AP1M2_HUMAN	Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)		4	474	-			130					B2RDV5|Q9BSI8	Silent	SNP	ENST00000250244.6	37	c.390C>T	CCDS45964.1																																																																																				0.602	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452034.1			16	30	0	0	0	0.006122	0	16	30				
DOCK6	57572	broad.mit.edu	37	19	11347230	11347230	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:11347230G>A	ENST00000294618.7	-	20	2195	c.2184C>T	c.(2182-2184)ttC>ttT	p.F728F	C19orf80_ENST00000591200.1_5'Flank|RN7SL298P_ENST00000581369.1_RNA|DOCK6_ENST00000319867.7_Silent_p.F32F	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	728					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCACCAGGGTGAAGAATTTGT	0.617																																							uc002mqs.3		NA																	0				ovary(2)|skin(1)	3						c.(2182-2184)TTC>TTT		dedicator of cytokinesis 6							34.0	39.0	37.0					19																	11347230		2028	4178	6206	SO:0001819	synonymous_variant	57572				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr19:11347230G>A		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2184C>T	19.37:g.11347230G>A			Somatic				DOCK6_uc010xlq.1_Silent_p.F32F|LOC55908_uc010dxw.2_5'Flank|LOC55908_uc010dxx.2_5'Flank	p.F728F	NM_020812	NP_065863	WXS	Illumina HiSeq	Unspecified	Q96HP0	DOCK6_HUMAN			20	2225	-			728			DHR-1.		A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	c.2184C>T	CCDS45975.1																																																																																				0.617	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812		4	12	0	0	0	0.009096	0	4	12				
PLVAP	83483	broad.mit.edu	37	19	17488060	17488061	+	Missense_Mutation	DNP	CG	CG	GA	rs145946398|rs370989890		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:17488060_17488061CG>GA	ENST00000252590.4	-	1	98_99	c.37_38CG>TC	c.(37-39)CGg>TCg	p.R13S		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	13					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GCCCCCCGCCCGAGCGTAGGAC	0.653																																							uc002ngk.1		NA																	0					0						c.(37-39)CGG>TCG		plasmalemma vesicle associated protein																																				SO:0001583	missense	83483					caveola|integral to membrane|perinuclear region of cytoplasm		g.chr19:17488060_17488061CG>GA	AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.37_38delinsGA	19.37:g.17488060_17488061delinsGA	ENSP00000252590:p.Arg13Ser		Somatic					p.R13S	NM_031310	NP_112600	WXS	Illumina HiSeq	Unspecified	Q9BX97	PLVAP_HUMAN			1	87_88	-			13			Cytoplasmic (Potential).		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	DNP	ENST00000252590.4	37	c.37_38CG>TC	CCDS32952.1																																																																																				0.653	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310		37	110	0	0	0	0.004672	0	37	110				
PDE4C	5143	broad.mit.edu	37	19	18331046	18331046	+	Silent	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:18331046C>A	ENST00000355502.3	-	11	1663	c.792G>T	c.(790-792)cgG>cgT	p.R264R	PDE4C_ENST00000447275.3_Silent_p.R158R|PDE4C_ENST00000539010.1_Silent_p.R33R|PDE4C_ENST00000598111.2_Silent_p.R34R|PDE4C_ENST00000594465.3_Silent_p.R264R|PDE4C_ENST00000597297.1_Silent_p.R34R|PDE4C_ENST00000262805.12_Silent_p.R232R|PDE4C_ENST00000594617.3_Silent_p.R264R|AC068499.10_ENST00000594805.3_RNA			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	264					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CCAGGAAGGTCCGGGAGATGT	0.542																																							uc010xqc.1		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(790-792)CGG>CGT		phosphodiesterase 4C isoform PDE4C-2	Dyphylline(DB00651)						117.0	124.0	121.0					19																	18331046		2203	4300	6503	SO:0001819	synonymous_variant	5143				signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	g.chr19:18331046C>A		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.792G>T	19.37:g.18331046C>A			Somatic				PDE4C_uc002nik.3_Silent_p.R264R|PDE4C_uc002nil.3_Silent_p.R264R|PDE4C_uc002nif.3_Silent_p.R33R|PDE4C_uc002nig.3_Silent_p.R34R|PDE4C_uc002nih.3_Silent_p.R34R|PDE4C_uc010ebk.2_Silent_p.R158R|PDE4C_uc002nii.3_Silent_p.R232R|PDE4C_uc010ebl.2_5'UTR|PDE4C_uc010xqd.1_Silent_p.R33R|PDE4C_uc010ebm.1_RNA	p.R264R	NM_001098819	NP_001092289	WXS	Illumina HiSeq	Unspecified	Q08493	PDE4C_HUMAN			7	1272	-			264					B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	ENST00000355502.3	37	c.792G>T	CCDS12373.1																																																																																				0.542	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1			74	169	1	0	8.20938e-55	0.00361	1.09352e-54	74	169				
ELL	8178	broad.mit.edu	37	19	18561707	18561707	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:18561707G>A	ENST00000262809.4	-	8	1116	c.1045C>T	c.(1045-1047)Cag>Tag	p.Q349*	ELL_ENST00000596124.3_Nonsense_Mutation_p.Q216*	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	349					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		ACGGCAGGCTGAGCTCTCTGA	0.627			T	MLL	AL						OREG0025365	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002njh.2		NA		Dom	yes		19	19p13.1	8178	T	ELL gene (11-19 lysine-rich leukemia gene)			L	MLL		AL		0				lung(1)	1						c.(1045-1047)CAG>TAG		elongation factor RNA polymerase II							16.0	22.0	20.0					19																	18561707		2192	4294	6486	SO:0001587	stop_gained	8178				positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding	g.chr19:18561707G>A	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1045C>T	19.37:g.18561707G>A	ENSP00000262809:p.Gln349*		Somatic	OREG0025365	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	726	ELL_uc010ebq.2_Nonsense_Mutation_p.Q292*|ELL_uc002njg.2_Nonsense_Mutation_p.Q216*	p.Q349*	NM_006532	NP_006523	WXS	Illumina HiSeq	Unspecified	P55199	ELL_HUMAN		GBM - Glioblastoma multiforme(1328;7.81e-07)	8	1117	-			349						Nonsense_Mutation	SNP	ENST00000262809.4	37	c.1045C>T	CCDS12380.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546794	0.65198	.	.	ENSG00000105656	ENST00000262809	.	.	.	4.53	4.53	0.55603	.	0.478425	0.22156	N	0.063851	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-18.65	16.4372	0.83880	0.0:0.0:1.0:0.0	.	.	.	.	X	349	.	ENSP00000262809:Q349X	Q	-	1	0	ELL	18422707	1.000000	0.71417	0.529000	0.27951	0.030000	0.12068	6.777000	0.75028	2.356000	0.79943	0.643000	0.83706	CAG		0.627	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466362.1	NM_006532		7	24	0	0	0	0.00308	0	7	24				
ZNF93	81931	broad.mit.edu	37	19	20026089	20026089	+	Splice_Site	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:20026089G>T	ENST00000343769.5	+	2	32	c.4G>T	c.(4-6)Gga>Tga	p.G2*	ZNF93_ENST00000591366.1_Splice_Site_p.G2*|AC007204.2_ENST00000592245.1_lincRNA|ZNF93_ENST00000592160.1_Splice_Site_p.G2*	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						TGTTTTTCAGGGACCATTGCA	0.413																																							uc002non.2		NA																	0				pancreas(1)	1						c.(4-6)GGA>TGA		zinc finger protein 93							101.0	110.0	107.0					19																	20026089		2203	4300	6503	SO:0001630	splice_region_variant	81931					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:20026089G>T	M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.4-1G>T	19.37:g.20026089G>T			Somatic				ZNF93_uc002nom.2_Nonsense_Mutation_p.G2*	p.G2*	NM_031218	NP_112495	WXS	Illumina HiSeq	Unspecified	P35789	ZNF93_HUMAN			2	115	+			2					A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Nonsense_Mutation	SNP	ENST00000343769.5	37	c.4G>T	CCDS32973.1	.	.	.	.	.	.	.	.	.	.	g	18.38	3.610949	0.66558	.	.	ENSG00000184635	ENST00000343769;ENST00000427325	.	.	.	0.832	0.832	0.18867	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.7551	0.13080	0.0:0.0:1.0:0.0	.	.	.	.	X	2	.	.	G	+	1	0	ZNF93	19887089	0.049000	0.20398	0.282000	0.24776	0.310000	0.27922	-0.098000	0.11024	0.171000	0.19730	0.174000	0.16983	GGA		0.413	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460808.2	NM_031218	Nonsense_Mutation	39	137	1	0	1.30916e-28	0.00361	1.67867e-28	39	137				
ZNF91	7644	broad.mit.edu	37	19	23542380	23542380	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:23542380T>A	ENST00000300619.7	-	4	3606	c.3401A>T	c.(3400-3402)tAc>tTc	p.Y1134F	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.Y1102F	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	1134					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTCACATTTGTAGGGTTTCTC	0.393																																							uc002nre.2		NA																	0					0						c.(3400-3402)TAC>TTC		zinc finger protein 91							54.0	61.0	59.0					19																	23542380		2161	4273	6434	SO:0001583	missense	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23542380T>A	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.3401A>T	19.37:g.23542380T>A	ENSP00000300619:p.Tyr1134Phe		Somatic				ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.Y1102F	p.Y1134F	NM_003430	NP_003421	WXS	Illumina HiSeq	Unspecified	Q05481	ZNF91_HUMAN			4	3514	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	1134			C2H2-type 36.		A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.3401A>T	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	T	9.034	0.988069	0.18966	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.18338	2.22;2.22	0.927	-0.72	0.11195	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24890	0.0604	L	0.42686	1.345	0.09310	N	1	P;D	0.89917	0.926;1.0	P;D	0.76575	0.504;0.988	T	0.13656	-1.0501	9	0.49607	T	0.09	.	2.1591	0.03820	0.2442:0.2708:0.0:0.485	.	1102;1134	Q05481-2;Q05481	.;ZNF91_HUMAN	F	1134;1102	ENSP00000300619:Y1134F;ENSP00000380272:Y1102F	ENSP00000300619:Y1134F	Y	-	2	0	ZNF91	23334220	0.000000	0.05858	0.005000	0.12908	0.720000	0.41350	-0.076000	0.11412	-0.252000	0.09528	0.165000	0.16767	TAC		0.393	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		16	31	0	0	0	0.003163	0	16	31				
ZNF675	171392	broad.mit.edu	37	19	23836495	23836495	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:23836495G>A	ENST00000359788.4	-	4	1408	c.1240C>T	c.(1240-1242)Cat>Tat	p.H414Y	ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	414					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATTCTCTTATGTGTAGTAAGG	0.373																																							uc002nri.2		NA																	0				ovary(1)|kidney(1)	2						c.(1240-1242)CAT>TAT		zinc finger protein 675							58.0	61.0	60.0					19																	23836495		2203	4300	6503	SO:0001583	missense	171392				bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr19:23836495G>A		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1240C>T	19.37:g.23836495G>A	ENSP00000352836:p.His414Tyr		Somatic					p.H414Y	NM_138330	NP_612203	WXS	Illumina HiSeq	Unspecified	Q8TD23	ZN675_HUMAN			4	1422	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	414			C2H2-type 10.		Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	c.1240C>T	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	13.17	2.157849	0.38119	.	.	ENSG00000197372	ENST00000359788	D	0.86769	-2.17	1.04	-2.08	0.07254	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92731	0.7689	M	0.90252	3.1	0.28231	N	0.926106	D	0.89917	1.0	D	0.85130	0.997	D	0.85291	0.1067	9	0.87932	D	0	.	6.8103	0.23801	0.0:0.0:0.7229:0.2771	.	414	Q8TD23	ZN675_HUMAN	Y	414	ENSP00000352836:H414Y	ENSP00000352836:H414Y	H	-	1	0	ZNF675	23628335	1.000000	0.71417	0.001000	0.08648	0.001000	0.01503	6.576000	0.74023	-0.520000	0.06435	-0.532000	0.04303	CAT		0.373	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330		21	45	0	0	0	0.00278	0	21	45				
CCNE1	898	broad.mit.edu	37	19	30313407	30313407	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:30313407T>C	ENST00000262643.3	+	11	1286	c.1007T>C	c.(1006-1008)aTg>aCg	p.M336T	CCNE1_ENST00000357943.5_Missense_Mutation_p.M293T|CCNE1_ENST00000444983.2_Missense_Mutation_p.M321T	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	336					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			CCATTTGCCATGGTTATAAGG	0.498			A		serous ovarian																																		uc002nsn.2		NA		Dom	yes		19	19q12	898		cyclin E1			E					0				lung(2)	2						c.(1006-1008)ATG>ACG		cyclin E1 isoform 1							192.0	173.0	179.0					19																	30313407		2203	4300	6503	SO:0001583	missense	898				androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity	g.chr19:30313407T>C	M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.1007T>C	19.37:g.30313407T>C	ENSP00000262643:p.Met336Thr		Somatic				CCNE1_uc002nso.2_Missense_Mutation_p.M321T|CCNE1_uc002nsp.2_Missense_Mutation_p.M83T	p.M336T	NM_001238	NP_001229	WXS	Illumina HiSeq	Unspecified	P24864	CCNE1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)		11	1190	+	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		336					A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	SNP	ENST00000262643.3	37	c.1007T>C	CCDS12419.1	.	.	.	.	.	.	.	.	.	.	T	7.249	0.602892	0.13939	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	T;T;T	0.21031	2.03;2.03;2.03	6.17	5.14	0.70334	Cyclin, C-terminal (1);Cyclin-like (1);	0.179811	0.64402	D	0.000001	T	0.26195	0.0639	L	0.46741	1.465	0.80722	D	1	P	0.39157	0.662	P	0.47827	0.558	T	0.02909	-1.1095	10	0.13470	T	0.59	.	12.0532	0.53518	0.1291:0.0:0.0:0.8709	.	336	P24864	CCNE1_HUMAN	T	336;293;321	ENSP00000262643:M336T;ENSP00000350625:M293T;ENSP00000410179:M321T	ENSP00000262643:M336T	M	+	2	0	CCNE1	35005247	1.000000	0.71417	0.999000	0.59377	0.227000	0.25037	6.295000	0.72744	1.113000	0.41760	0.533000	0.62120	ATG		0.498	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438138.1	NM_001238		58	103	0	0	0	0.00361	0	58	103				
ZNF536	9745	broad.mit.edu	37	19	31039132	31039132	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:31039132A>T	ENST00000355537.3	+	4	2753	c.2606A>T	c.(2605-2607)cAc>cTc	p.H869L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	869					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCTGGAGATCACTCGGGGCAG	0.582																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2605-2607)CAC>CTC		zinc finger protein 536							68.0	72.0	71.0					19																	31039132		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31039132A>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2606A>T	19.37:g.31039132A>T	ENSP00000347730:p.His869Leu		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.H869L	p.H869L	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	2744	+	Esophageal squamous(110;0.0834)		869					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2606A>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	A	2.837	-0.241338	0.05906	.	.	ENSG00000198597	ENST00000355537	T	0.08008	3.14	5.71	4.67	0.58626	.	0.163866	0.53938	D	0.000041	T	0.05410	0.0143	N	0.24115	0.695	0.36952	D	0.892901	B;B	0.31125	0.309;0.309	B;B	0.19666	0.026;0.026	T	0.35101	-0.9802	10	0.66056	D	0.02	-11.8076	7.4003	0.26960	0.783:0.1453:0.0717:0.0	.	869;869	A7E228;O15090	.;ZN536_HUMAN	L	869	ENSP00000347730:H869L	ENSP00000347730:H869L	H	+	2	0	ZNF536	35730972	0.996000	0.38824	0.600000	0.28864	0.088000	0.18126	3.347000	0.52200	0.963000	0.38082	0.472000	0.43445	CAC		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		24	60	0	0	0	0.005443	0	24	60				
ZNF599	148103	broad.mit.edu	37	19	35251243	35251243	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:35251243C>T	ENST00000329285.8	-	4	836	c.463G>A	c.(463-465)Gat>Aat	p.D155N		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TCCAAATCATCATGTTTATAA	0.438																																							uc010edn.1		NA																	0				ovary(1)|skin(1)	2						c.(463-465)GAT>AAT		zinc finger protein 599							136.0	139.0	138.0					19																	35251243		2203	4300	6503	SO:0001583	missense	148103				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:35251243C>T	AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.463G>A	19.37:g.35251243C>T	ENSP00000333802:p.Asp155Asn		Somatic				ZNF599_uc010edm.1_Missense_Mutation_p.D118N	p.D155N	NM_001007248	NP_001007249	WXS	Illumina HiSeq	Unspecified	Q96NL3	ZN599_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.138)		4	851	-	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		155					Q569K0|Q5PRG1	Missense_Mutation	SNP	ENST00000329285.8	37	c.463G>A	CCDS32991.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.496506	0.00159	.	.	ENSG00000153896	ENST00000392231;ENST00000329285	T	0.29655	1.56	2.27	1.22	0.21188	.	.	.	.	.	T	0.19287	0.0463	L	0.43152	1.355	0.19775	N	0.99996	B	0.02656	0.0	B	0.04013	0.001	T	0.36817	-0.9732	9	0.02654	T	1	.	6.9316	0.24444	0.0:0.8464:0.0:0.1536	.	155	Q96NL3	ZN599_HUMAN	N	154;155	ENSP00000333802:D155N	ENSP00000333802:D155N	D	-	1	0	ZNF599	39943083	0.000000	0.05858	0.033000	0.17914	0.009000	0.06853	-0.103000	0.10940	0.526000	0.28541	0.491000	0.48974	GAT		0.438	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460648.2	XM_086046		41	103	0	0	0	0.002522	0	41	103				
HPN	3249	broad.mit.edu	37	19	35556566	35556566	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:35556566G>A	ENST00000262626.2	+	11	1856	c.1031G>A	c.(1030-1032)gGt>gAt	p.G344D	HPN_ENST00000392226.1_Missense_Mutation_p.G344D|HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000597419.1_Missense_Mutation_p.G186D	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	344	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	TACCCCGAGGGTGGCATTGAT	0.602																																							uc002nxq.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1030-1032)GGT>GAT		hepsin	Coagulation factor VIIa(DB00036)						65.0	65.0	65.0					19																	35556566		2203	4300	6503	SO:0001583	missense	3249				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr19:35556566G>A		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.1031G>A	19.37:g.35556566G>A	ENSP00000262626:p.Gly344Asp		Somatic				HPN_uc002nxr.1_Missense_Mutation_p.G344D|HPN_uc002nxs.1_Missense_Mutation_p.G186D|HPN_uc010xsh.1_Missense_Mutation_p.G313D|HPN_uc002nxt.1_Missense_Mutation_p.G228D|LOC100128675_uc010xsi.1_Intron	p.G344D	NM_002151	NP_002142	WXS	Illumina HiSeq	Unspecified	P05981	HEPS_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0849)		12	1276	+	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		344			Extracellular (Potential).|Peptidase S1.		B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	37	c.1031G>A	CCDS32993.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839407	0.91117	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	D;D	0.89875	-2.58;-2.58	5.37	5.37	0.77165	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.94338	0.8180	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94838	0.8002	10	0.87932	D	0	.	16.5932	0.84781	0.0:0.0:1.0:0.0	.	316;344;344	B7Z1L4;B2ZDQ2;P05981	.;.;HEPS_HUMAN	D	344;344;316	ENSP00000262626:G344D;ENSP00000376060:G344D	ENSP00000262626:G344D	G	+	2	0	HPN	40248406	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.506000	0.97992	2.529000	0.85273	0.561000	0.74099	GGT		0.602	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151		6	103	0	0	0	0.00308	0	6	103				
CD22	933	broad.mit.edu	37	19	35823807	35823807	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:35823807G>C	ENST00000085219.5	+	3	458	c.392G>C	c.(391-393)cGa>cCa	p.R131P	CD22_ENST00000270311.6_Missense_Mutation_p.R11P|CD22_ENST00000341773.6_Missense_Mutation_p.R131P|CD22_ENST00000595419.1_3'UTR|CD22_ENST00000594250.1_Missense_Mutation_p.R131P|CD22_ENST00000419549.2_5'UTR|U62631.5_ENST00000597110.1_RNA|CD22_ENST00000536635.2_Missense_Mutation_p.R131P|CD22_ENST00000544992.2_Missense_Mutation_p.R131P	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	131	Ig-like V-type.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGGATGGAACGAATACACCTC	0.552																																					Ovarian(42;1009 1133 23674 26041)	Ovarian(42;1009 1133 23674 26041)	uc010edt.2		NA																	0				ovary(5)|lung(3)|breast(1)	9						c.(391-393)CGA>CCA		CD22 molecule precursor	OspA lipoprotein(DB00045)						83.0	74.0	77.0					19																	35823807		2203	4300	6503	SO:0001583	missense	933				cell adhesion		protein binding|sugar binding	g.chr19:35823807G>C	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.392G>C	19.37:g.35823807G>C	ENSP00000085219:p.Arg131Pro		Somatic				CD22_uc010xst.1_5'UTR|CD22_uc010edu.2_Missense_Mutation_p.R131P|CD22_uc010edv.2_Missense_Mutation_p.R131P|CD22_uc002nzb.3_Missense_Mutation_p.R131P	p.R131P	NM_001771	NP_001762	WXS	Illumina HiSeq	Unspecified	P20273	CD22_HUMAN	Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		3	469	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		131			Extracellular (Potential).|Ig-like V-type.		F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	c.392G>C	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	G	9.928	1.214109	0.22289	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000270311	T;T;T;T;T	0.46819	0.91;0.91;0.91;0.91;0.86	5.26	-6.72	0.01755	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	5.021920	0.00166	N	0.000015	T	0.24044	0.0582	N	0.08118	0	0.28188	N	0.927878	B;B;B;P	0.38642	0.001;0.003;0.001;0.641	B;B;B;B	0.36186	0.003;0.014;0.002;0.219	T	0.14811	-1.0459	10	0.27785	T	0.31	.	7.7137	0.28692	0.2854:0.5024:0.2122:0.0	.	131;131;131;131	F5GYU4;F5H7U3;P20273;P20273-2	.;.;CD22_HUMAN;.	P	131;131;131;131;11	ENSP00000085219:R131P;ENSP00000442279:R131P;ENSP00000339349:R131P;ENSP00000441237:R131P;ENSP00000270311:R11P	ENSP00000085219:R131P	R	+	2	0	CD22	40515647	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.389000	0.02530	-1.394000	0.02077	-0.635000	0.03985	CGA		0.552	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771		25	58	0	0	0	0.007291	0	25	58				
SAMD4B	55095	broad.mit.edu	37	19	39876822	39876822	+	IGR	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:39876822C>T	ENST00000314471.6	+	0	4519				PAF1_ENST00000221265.3_Missense_Mutation_p.E469K|PAF1_ENST00000595564.1_Missense_Mutation_p.M397I|PAF1_ENST00000221266.7_Missense_Mutation_p.M374I	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CCTCTGTCCTCATCATCAGAG	0.617																																							uc002old.2		NA																	0				pancreas(1)	1						c.(1405-1407)GAG>AAG		Paf1, RNA polymerase II associated factor,							157.0	131.0	140.0					19																	39876822		2203	4300	6503	SO:0001628	intergenic_variant	54623				histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding	g.chr19:39876822C>T		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9			19.37:g.39876822C>T			Somatic				PAF1_uc002ole.1_Missense_Mutation_p.M397I	p.E469K	NM_019088	NP_061961	WXS	Illumina HiSeq	Unspecified	Q8N7H5	PAF1_HUMAN	Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)		14	1580	-	all_cancers(60;9.14e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		469					A5Z0M6|Q6P194	Missense_Mutation	SNP	ENST00000314471.6	37	c.1405G>A	CCDS33020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.74|14.74	2.626555|2.626555	0.46840|0.46840	.|.	.|.	ENSG00000006712|ENSG00000006712	ENST00000221265|ENST00000221266	.|.	.|.	.|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.778073|.	0.12271|.	N|.	0.483796|.	T|T	0.44871|0.44871	0.1314|0.1314	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|B	0.27498|0.09022	0.18|0.002	B|B	0.17098|0.13407	0.017|0.009	T|T	0.41752|0.41752	-0.9491|-0.9491	9|8	0.32370|0.87932	T|D	0.25|0	-11.4041|-11.4041	14.2926|14.2926	0.66289|0.66289	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	469|374	Q8N7H5|F8W9Q2	PAF1_HUMAN|.	K|I	469|374	.|.	ENSP00000221265:E469K|ENSP00000221266:M374I	E|M	-|-	1|3	0|0	PAF1|PAF1	44568662|44568662	1.000000|1.000000	0.71417|0.71417	0.913000|0.913000	0.36048|0.36048	0.578000|0.578000	0.36192|0.36192	5.135000|5.135000	0.64777|0.64777	2.444000|2.444000	0.82710|0.82710	0.552000|0.552000	0.68991|0.68991	GAG|ATG		0.617	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028		70	115	0	0	0	0.00361	0	70	115				
LGALS14	56891	broad.mit.edu	37	19	40199894	40199894	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:40199894G>A	ENST00000392052.3	+	4	584	c.361G>A	c.(361-363)Gtg>Atg	p.V121M	LGALS14_ENST00000360675.3_Missense_Mutation_p.V150M	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14	121	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			GCCAGCATCTGTGAAGATGCT	0.458																																							uc002omg.2		NA																	0				ovary(1)|skin(1)	2						c.(361-363)GTG>ATG		lectin, galactoside-binding, soluble, 14 isoform							100.0	94.0	96.0					19																	40199894		2203	4300	6503	SO:0001583	missense	56891					nucleus	sugar binding	g.chr19:40199894G>A	AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.361G>A	19.37:g.40199894G>A	ENSP00000375905:p.Val121Met		Somatic				LGALS14_uc002omf.2_Missense_Mutation_p.V150M	p.V121M	NM_020129	NP_064514	WXS	Illumina HiSeq	Unspecified	Q8TCE9	PPL13_HUMAN	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)		4	584	+	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	121			Galectin.		A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Missense_Mutation	SNP	ENST00000392052.3	37	c.361G>A	CCDS46073.1	.	.	.	.	.	.	.	.	.	.	.	10.71	1.427123	0.25726	.	.	ENSG00000006659	ENST00000392052;ENST00000360675	T;T	0.07800	3.16;3.16	0.902	0.902	0.19290	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.30198	0.0757	M	0.91717	3.235	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.04427	-1.0952	9	0.87932	D	0	.	5.118	0.14845	0.0:0.0:1.0:0.0	.	121;150	Q8TCE9;A8MPV8	PPL13_HUMAN;.	M	121;150	ENSP00000375905:V121M;ENSP00000353893:V150M	ENSP00000353893:V150M	V	+	1	0	LGALS14	44891734	0.035000	0.19736	0.009000	0.14445	0.024000	0.10985	1.444000	0.35068	0.782000	0.33613	0.313000	0.20887	GTG		0.458	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465222.1	NM_020129		15	60	0	0	0	0.006122	0	15	60				
FCGBP	8857	broad.mit.edu	37	19	40433429	40433429	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:40433429A>G	ENST00000221347.6	-	2	847	c.840T>C	c.(838-840)caT>caC	p.H280H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	280	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGATACCCCCATGGTTGTAGG	0.592																																							uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(838-840)CAT>CAC		Fc fragment of IgG binding protein precursor							53.0	47.0	49.0					19																	40433429		2203	4300	6503	SO:0001819	synonymous_variant	8857					extracellular region	protein binding	g.chr19:40433429A>G	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.840T>C	19.37:g.40433429A>G			Somatic					p.H280H	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		2	848	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		280			IgGFc-binding.		O95784	Silent	SNP	ENST00000221347.6	37	c.840T>C	CCDS12546.1																																																																																				0.592	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		17	40	0	0	0	0.008871	0	17	40				
HNRNPUL1	11100	broad.mit.edu	37	19	41778021	41778021	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:41778021C>T	ENST00000392006.3	+	3	626	c.453C>T	c.(451-453)acC>acT	p.T151T	HNRNPUL1_ENST00000602130.1_Silent_p.T151T|HNRNPUL1_ENST00000593587.1_Silent_p.T51T|HNRNPUL1_ENST00000378215.4_Silent_p.T108T|HNRNPUL1_ENST00000352456.3_Silent_p.T51T|HNRNPUL1_ENST00000594207.1_3'UTR|HNRNPUL1_ENST00000263367.3_Silent_p.T62T|HNRNPUL1_ENST00000595018.1_Silent_p.T51T	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	151					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GAGCACCCACCAGCTTCCTCC	0.502																																							uc002oqb.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(451-453)ACC>ACT		heterogeneous nuclear ribonucleoprotein U-like 1							116.0	123.0	121.0					19																	41778021		2203	4300	6503	SO:0001819	synonymous_variant	11100				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding	g.chr19:41778021C>T	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.453C>T	19.37:g.41778021C>T			Somatic				CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Silent_p.T51T|HNRNPUL1_uc002oqa.3_Silent_p.T51T|HNRNPUL1_uc010ehm.2_Silent_p.T151T|HNRNPUL1_uc002oqc.3_Silent_p.T108T|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Silent_p.T51T|HNRNPUL1_uc010ehn.2_Silent_p.T51T|HNRNPUL1_uc010eho.2_Silent_p.T51T|HNRNPUL1_uc010xvy.1_Silent_p.T51T|HNRNPUL1_uc010ehp.2_Silent_p.T7T|HNRNPUL1_uc010ehl.1_Silent_p.T51T	p.T151T	NM_007040	NP_008971	WXS	Illumina HiSeq	Unspecified	Q9BUJ2	HNRL1_HUMAN			3	742	+			151					B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Silent	SNP	ENST00000392006.3	37	c.453C>T	CCDS12576.1																																																																																				0.502	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040		58	103	0	0	0	0.00361	0	58	103				
TMEM145	284339	broad.mit.edu	37	19	42818843	42818843	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:42818843G>T	ENST00000301204.3	+	4	393	c.352G>T	c.(352-354)Ggc>Tgc	p.G118C	TMEM145_ENST00000598766.1_Missense_Mutation_p.G128C|TMEM145_ENST00000601020.1_3'UTR	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	118					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				TGCCTGGTCCGGCTGTCAGGT	0.622																																							uc002otk.1		NA																	0					0						c.(352-354)GGC>TGC		transmembrane protein 145							82.0	82.0	82.0					19																	42818843		2203	4300	6503	SO:0001583	missense	284339					integral to membrane		g.chr19:42818843G>T	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.352G>T	19.37:g.42818843G>T	ENSP00000301204:p.Gly118Cys		Somatic					p.G118C	NM_173633	NP_775904	WXS	Illumina HiSeq	Unspecified	Q8NBT3	TM145_HUMAN			4	404	+		Prostate(69;0.00682)	118						Missense_Mutation	SNP	ENST00000301204.3	37	c.352G>T	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826472	0.71143	.	.	ENSG00000167619	ENST00000301204	T	0.54071	0.59	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.71558	0.3354	M	0.76328	2.33	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.71513	-0.4570	10	0.39692	T	0.17	-22.4885	15.9473	0.79803	0.0:0.0:1.0:0.0	.	118	Q8NBT3	TM145_HUMAN	C	118	ENSP00000301204:G118C	ENSP00000301204:G118C	G	+	1	0	TMEM145	47510683	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	6.062000	0.71155	2.460000	0.83146	0.557000	0.71058	GGC		0.622	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633		60	101	1	0	1.72039e-30	0.00361	2.23098e-30	60	101				
ZNF223	7766	broad.mit.edu	37	19	44570323	44570323	+	Silent	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:44570323T>C	ENST00000434772.3	+	5	597	c.342T>C	c.(340-342)ccT>ccC	p.P114P	ZNF223_ENST00000591793.1_Silent_p.P224P	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				TAACCAGGCCTCAAGACTCTA	0.473																																							uc002oyf.1		NA																	0				ovary(1)	1						c.(340-342)CCT>CCC		zinc finger protein 223							75.0	68.0	70.0					19																	44570323		2203	4300	6503	SO:0001819	synonymous_variant	7766				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44570323T>C	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.342T>C	19.37:g.44570323T>C			Somatic				ZNF284_uc010ejd.2_RNA	p.P114P	NM_013361	NP_037493	WXS	Illumina HiSeq	Unspecified	Q9UK11	ZN223_HUMAN			5	595	+		Prostate(69;0.0352)	114					Q15736|Q8TBJ3|Q9HCA9	Silent	SNP	ENST00000434772.3	37	c.342T>C	CCDS12635.1																																																																																				0.473	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2			12	41	0	0	0	0.001368	0	12	41				
PRKD2	25865	broad.mit.edu	37	19	47197300	47197300	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:47197300C>G	ENST00000291281.4	-	10	1633	c.1408G>C	c.(1408-1410)Gtc>Ctc	p.V470L	PRKD2_ENST00000433867.1_Missense_Mutation_p.V470L|PRKD2_ENST00000601806.1_Missense_Mutation_p.V313L|PRKD2_ENST00000600194.1_Missense_Mutation_p.V313L|PRKD2_ENST00000595515.1_Missense_Mutation_p.V470L			Q9BZL6	KPCD2_HUMAN	protein kinase D2	470	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TTGGCAGTGACGATCTCAAAG	0.652																																							uc002pfh.2		NA																	0				ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7						c.(1408-1410)GTC>CTC		protein kinase D2 isoform A							71.0	57.0	62.0					19																	47197300		2203	4300	6503	SO:0001583	missense	25865				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity	g.chr19:47197300C>G	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1408G>C	19.37:g.47197300C>G	ENSP00000291281:p.Val470Leu		Somatic				PRKD2_uc010ekt.2_5'Flank|PRKD2_uc002pfe.2_5'UTR|PRKD2_uc002pff.2_5'UTR|PRKD2_uc002pfg.2_Missense_Mutation_p.V313L|PRKD2_uc002pfi.2_Missense_Mutation_p.V470L|PRKD2_uc002pfj.2_Missense_Mutation_p.V470L|PRKD2_uc010xye.1_Missense_Mutation_p.V470L|PRKD2_uc002pfk.2_Missense_Mutation_p.V313L	p.V470L	NM_001079881	NP_001073350	WXS	Illumina HiSeq	Unspecified	Q9BZL6	KPCD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)	11	1750	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	470			PH.		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	c.1408G>C	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	6.783	0.513400	0.12944	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.75589	-0.95;-0.95	4.73	-4.06	0.03986	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.419940	0.21573	N	0.072378	T	0.41259	0.1151	N	0.02960	-0.455	0.20638	N	0.999878	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.42103	-0.9471	10	0.07813	T	0.8	-24.9848	12.1249	0.53910	0.0:0.2972:0.0:0.7028	.	470;470	E7ER94;Q9BZL6	.;KPCD2_HUMAN	L	470	ENSP00000291281:V470L;ENSP00000393978:V470L	ENSP00000291281:V470L	V	-	1	0	PRKD2	51889140	0.001000	0.12720	0.348000	0.25681	0.450000	0.32258	-0.792000	0.04594	-0.654000	0.05394	-1.319000	0.01295	GTC		0.652	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457		25	56	0	0	0	0.00632	0	25	56				
KPTN	11133	broad.mit.edu	37	19	47986462	47986462	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:47986462C>T	ENST00000338134.3	-	4	512	c.405G>A	c.(403-405)ctG>ctA	p.L135L	NAPA-AS1_ENST00000594367.1_RNA|KPTN_ENST00000536339.1_5'UTR|NAPA-AS1_ENST00000593284.1_RNA|KPTN_ENST00000595484.1_5'UTR	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	135					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		GCTCCAGGTTCAGGCAGCTCT	0.612																																							uc002pgy.2		NA																	0				ovary(1)	1						c.(403-405)CTG>CTA		kaptin (actin binding protein)							119.0	135.0	130.0					19																	47986462		2128	4239	6367	SO:0001819	synonymous_variant	11133				actin filament organization|cellular component movement|sensory perception of sound	actin cytoskeleton|growth cone|microtubule organizing center|nucleus|perinuclear region of cytoplasm|stereocilium	actin binding	g.chr19:47986462C>T	AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.405G>A	19.37:g.47986462C>T			Somatic				KPTN_uc010xys.1_RNA|uc002pgz.1_5'Flank	p.L135L	NM_007059	NP_008990	WXS	Illumina HiSeq	Unspecified	Q9Y664	KPTN_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)	4	509	-		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	135					B3KN86|B4DQ76|Q96GT1	Silent	SNP	ENST00000338134.3	37	c.405G>A	CCDS42583.1																																																																																				0.612	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2			67	143	0	0	0	0.00361	0	67	143				
PNKP	11284	broad.mit.edu	37	19	50373285	50373285	+	5'Flank	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:50373285C>T	ENST00000322344.3	-	0	0				PNKP_ENST00000600573.1_5'Flank|AKT1S1_ENST00000391834.2_Silent_p.A220A|AKT1S1_ENST00000344175.5_Silent_p.A220A|PNKP_ENST00000596014.1_5'Flank|AKT1S1_ENST00000391833.1_Silent_p.A220A|AKT1S1_ENST00000391835.1_Silent_p.A240A|PNKP_ENST00000600910.1_5'Flank|AKT1S1_ENST00000391831.1_Silent_p.A220A|AKT1S1_ENST00000391832.3_Silent_p.A220A|PNKP_ENST00000595792.1_5'Flank	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase						dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		CGCGCATGCTCGCCGCGATGC	0.716								Other BER factors																															uc002pql.3		NA																	0					0						c.(658-660)GCG>GCA		AKT1 substrate 1 (proline-rich)							11.0	10.0	10.0					19																	50373285		2161	4222	6383	SO:0001631	upstream_gene_variant	84335				negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|nerve growth factor receptor signaling pathway|neuroprotection|phosphatidylinositol-mediated signaling|regulation of survival gene product expression	cytosolic part	protein binding	g.chr19:50373285C>T	AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60			19.37:g.50373285C>T	Exception_encountered		Somatic				PNKP_uc002pqh.2_5'Flank|PNKP_uc002pqi.2_5'Flank|PNKP_uc002pqj.2_5'Flank|PNKP_uc010enm.2_5'Flank|PNKP_uc002pqk.2_5'Flank|AKT1S1_uc002pqn.3_Silent_p.A220A|AKT1S1_uc002pqm.3_Silent_p.A220A	p.A220A	NM_032375	NP_115751	WXS	Illumina HiSeq	Unspecified	Q96B36	AKTS1_HUMAN		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)	5	1386	-		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	220					Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Silent	SNP	ENST00000322344.3	37	c.660G>A	CCDS12783.1																																																																																				0.716	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465830.1	NM_007254		10	14	0	0	0	0.000978	0	10	14				
VRK3	51231	broad.mit.edu	37	19	50498136	50498136	+	Missense_Mutation	SNP	C	C	A	rs200821018		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:50498136C>A	ENST00000599538.1	-	9	1469	c.805G>T	c.(805-807)Gcc>Tcc	p.A269S	VRK3_ENST00000601341.1_Missense_Mutation_p.A219S|VRK3_ENST00000594948.1_Missense_Mutation_p.A269S|VRK3_ENST00000601912.1_Missense_Mutation_p.A219S|VRK3_ENST00000424804.2_5'UTR|VRK3_ENST00000316763.3_Missense_Mutation_p.A269S|VRK3_ENST00000377011.2_Missense_Mutation_p.A219S|VRK3_ENST00000593919.1_Missense_Mutation_p.A269S|VRK3_ENST00000443401.2_Missense_Mutation_p.A38S|VRK3_ENST00000594092.1_Missense_Mutation_p.A269S			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	269	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		ACATCCAGGGCCGACTGAAGG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		18799	0.0		0.001	False		,,,				2504	0.0				Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)	Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)	uc002prg.2		NA																	0				stomach(1)|skin(1)	2						c.(805-807)GCC>TCC		vaccinia related kinase 3 isoform 1							65.0	56.0	59.0					19																	50498136		2203	4300	6503	SO:0001583	missense	51231					nucleus	ATP binding|protein kinase activity	g.chr19:50498136C>A	AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.805G>T	19.37:g.50498136C>A	ENSP00000469880:p.Ala269Ser		Somatic				VRK3_uc002prh.1_Missense_Mutation_p.A269S|VRK3_uc002pri.1_Missense_Mutation_p.A219S|VRK3_uc010ens.2_Missense_Mutation_p.A269S|VRK3_uc010ybl.1_Missense_Mutation_p.A219S|VRK3_uc010ybm.1_Missense_Mutation_p.A38S|VRK3_uc002prj.1_Missense_Mutation_p.A219S|VRK3_uc002prk.1_Missense_Mutation_p.A269S|VRK3_uc010ent.1_Missense_Mutation_p.A25S|VRK3_uc002prl.2_Missense_Mutation_p.A269S|VRK3_uc010ybn.1_Silent_p.R246R	p.A269S	NM_016440	NP_057524	WXS	Illumina HiSeq	Unspecified	Q8IV63	VRK3_HUMAN		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)	9	903	-		all_neural(266;0.0459)|Ovarian(192;0.0481)	269			Protein kinase.		A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	SNP	ENST00000599538.1	37	c.805G>T	CCDS12791.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.671	1.146701	0.21288	.	.	ENSG00000105053	ENST00000316763;ENST00000377011;ENST00000443401	T;T;T	0.19938	2.11;2.11;2.11	5.58	2.04	0.26737	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.946629	0.08848	N	0.884937	T	0.36635	0.0974	M	0.66297	2.02	0.09310	N	1	B;P;P;P	0.45126	0.018;0.821;0.718;0.851	B;P;P;P	0.56916	0.256;0.71;0.754;0.809	T	0.17684	-1.0361	10	0.66056	D	0.02	-3.3943	5.598	0.17337	0.1574:0.659:0.0:0.1836	.	38;269;219;269	B4DGW1;Q8IV63-2;A6NEG5;Q8IV63	.;.;.;VRK3_HUMAN	S	269;219;38	ENSP00000324636:A269S;ENSP00000366210:A219S;ENSP00000414907:A38S	ENSP00000324636:A269S	A	-	1	0	VRK3	55189948	0.001000	0.12720	0.004000	0.12327	0.094000	0.18550	0.058000	0.14301	0.741000	0.32674	-0.182000	0.12963	GCC		0.622	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464815.1	NM_016440		20	49	1	0	1.10513e-12	0.002299	1.28061e-12	20	49				
CEACAM18	729767	broad.mit.edu	37	19	51983826	51983826	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:51983826G>T	ENST00000396477.4	+	2	313	c.292G>T	c.(292-294)Ggc>Tgc	p.G98C	CEACAM18_ENST00000451626.1_Missense_Mutation_p.G159C	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	98										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GAACAGAGAAGGCAGCCTGTT	0.557																																							uc002pwv.1		NA																	0				skin(1)	1						c.(475-477)GGC>TGC		carcinoembryonic antigen-related cell adhesion							74.0	74.0	74.0					19																	51983826		1995	4171	6166	SO:0001583	missense	729767					integral to membrane		g.chr19:51983826G>T			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.292G>T	19.37:g.51983826G>T	ENSP00000379738:p.Gly98Cys		Somatic					p.G159C	NM_001080405	NP_001073874	WXS	Illumina HiSeq	Unspecified	A8MTB9	CEA18_HUMAN		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	3	475	+		all_neural(266;0.0529)	159					C9JN24	Missense_Mutation	SNP	ENST00000396477.4	37	c.475G>T		.	.	.	.	.	.	.	.	.	.	.	12.79	2.042266	0.35989	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.02498	4.27	2.92	1.88	0.25563	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.14184	0.0343	M	0.86573	2.825	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.04128	-1.0975	9	0.87932	D	0	-17.1795	5.9749	0.19373	0.1468:0.0:0.8532:0.0	.	159	A8MTB9	CEA18_HUMAN	C	159;98;98	ENSP00000402203:G159C	ENSP00000379738:G98C	G	+	1	0	CEACAM18	56675638	0.004000	0.15560	0.002000	0.10522	0.002000	0.02628	1.556000	0.36288	0.834000	0.34852	0.650000	0.86243	GGC		0.557	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2			16	46	1	0	1.37285e-15	0.004007	1.63787e-15	16	46				
ZNF528	84436	broad.mit.edu	37	19	52909814	52909814	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:52909814G>A	ENST00000360465.3	+	6	615	c.189G>A	c.(187-189)aaG>aaA	p.K63K	ZNF528_ENST00000391788.2_Silent_p.K53K|ZNF528_ENST00000598192.1_Silent_p.K63K|ZNF528_ENST00000594530.1_Silent_p.K63K	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	63	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TAGAGCAAAAGAGAGATCCCT	0.478																																							uc002pzh.2		NA																	0				ovary(1)|skin(1)	2						c.(187-189)AAG>AAA		zinc finger protein 528							116.0	111.0	112.0					19																	52909814		2203	4300	6503	SO:0001819	synonymous_variant	84436				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52909814G>A	AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.189G>A	19.37:g.52909814G>A			Somatic				ZNF528_uc002pzi.2_5'UTR	p.K63K	NM_032423	NP_115799	WXS	Illumina HiSeq	Unspecified	Q3MIS6	ZN528_HUMAN		GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)	6	615	+			63			KRAB.		B3KPN4|Q86T88|Q96JK0	Silent	SNP	ENST00000360465.3	37	c.189G>A	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	G	2.032	-0.422251	0.04734	.	.	ENSG00000167555	ENST00000448954	.	.	.	2.03	0.933	0.19471	.	.	.	.	.	T	0.31231	0.0790	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25082	-1.0142	4	.	.	.	.	6.4746	0.22028	0.0:0.3078:0.6922:0.0	.	.	.	.	K	33	.	.	E	+	1	0	ZNF528	57601626	0.018000	0.18449	0.000000	0.03702	0.004000	0.04260	1.588000	0.36633	0.190000	0.20209	-0.365000	0.07479	GAG		0.478	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423		30	68	0	0	0	0.003271	0	30	68				
ZNF765	91661	broad.mit.edu	37	19	53911769	53911769	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:53911769C>T	ENST00000396408.3	+	4	1078	c.961C>T	c.(961-963)Cat>Tat	p.H321Y	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		TAGGAGAATTCATACTGGAGA	0.403																																							uc010ydx.1		NA																	0					0						c.(961-963)CAT>TAT		zinc finger protein 765							70.0	74.0	72.0					19																	53911769		2203	4298	6501	SO:0001583	missense	91661				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53911769C>T	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.961C>T	19.37:g.53911769C>T	ENSP00000379689:p.His321Tyr		Somatic				ZNF765_uc002qbm.2_Missense_Mutation_p.H321Y|ZNF765_uc002qbn.2_Intron	p.H321Y	NM_001040185	NP_001035275	WXS	Illumina HiSeq	Unspecified	Q7L2R6	ZN765_HUMAN		GBM - Glioblastoma multiforme(134;0.00379)	6	1288	+			321			C2H2-type 4.		A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Missense_Mutation	SNP	ENST00000396408.3	37	c.961C>T	CCDS46171.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787838	0.49997	.	.	ENSG00000196417	ENST00000396408	T	0.67523	-0.27	1.28	1.28	0.21552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75824	0.3902	H	0.95950	3.745	0.29107	N	0.881126	P	0.37398	0.593	B	0.38921	0.285	T	0.73780	-0.3875	8	.	.	.	.	9.4276	0.38590	0.0:1.0:0.0:0.0	.	321	Q7L2R6	ZN765_HUMAN	Y	321	ENSP00000379689:H321Y	.	H	+	1	0	ZNF765	58603581	0.727000	0.28069	0.009000	0.14445	0.037000	0.13140	3.151000	0.50670	0.646000	0.30693	0.289000	0.19496	CAT		0.403	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372		28	86	0	0	0	0.00632	0	28	86				
NLRP12	91662	broad.mit.edu	37	19	54313954	54313954	+	Missense_Mutation	SNP	G	G	T	rs560825505	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:54313954G>T	ENST00000324134.6	-	3	1127	c.959C>A	c.(958-960)aCg>aAg	p.T320K	NLRP12_ENST00000391772.1_Missense_Mutation_p.T320K|NLRP12_ENST00000345770.5_Missense_Mutation_p.T320K|NLRP12_ENST00000391775.3_Missense_Mutation_p.T320K|NLRP12_ENST00000391773.1_Missense_Mutation_p.T320K|NLRP12_ENST00000354278.3_Missense_Mutation_p.T320K|NLRP12_ENST00000351894.4_Missense_Mutation_p.T320K|NLRP12_ENST00000535162.1_Missense_Mutation_p.T320K	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	320	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AAGCAGCTCCGTGGGCCGTTT	0.567																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(958-960)ACG>AAG		NLR family, pyrin domain containing 12 isoform							45.0	48.0	47.0					19																	54313954		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54313954G>T	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.959C>A	19.37:g.54313954G>T	ENSP00000319377:p.Thr320Lys		Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.T320K|NLRP12_uc002qcj.3_Missense_Mutation_p.T320K|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.T320K	p.T320K	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	1179	-	Ovarian(34;0.19)		320			NACHT.		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.959C>A	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999545	0.35320	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	4.32	1.76	0.24704	NACHT nucleoside triphosphatase (1);	0.502393	0.16863	N	0.196431	T	0.74839	0.3769	L	0.37850	1.14	0.25152	N	0.990413	D;P;P;P	0.54601	0.967;0.911;0.911;0.929	P;P;P;P	0.57911	0.829;0.735;0.735;0.809	T	0.62440	-0.6854	10	0.48119	T	0.1	.	4.8024	0.13303	0.332:0.0:0.668:0.0	.	320;320;320;320	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	K	320	ENSP00000319377:T320K;ENSP00000438030:T320K;ENSP00000340473:T320K;ENSP00000346231:T320K;ENSP00000375655:T320K;ENSP00000375653:T320K;ENSP00000375652:T320K	ENSP00000319377:T320K	T	-	2	0	NLRP12	59005766	0.091000	0.21658	0.017000	0.16124	0.534000	0.34807	3.434000	0.52841	0.965000	0.38133	0.306000	0.20318	ACG		0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		21	25	1	0	3.62473e-10	0.001882	4.09648e-10	21	25				
LAIR2	3904	broad.mit.edu	37	19	55021737	55021737	+	Splice_Site	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:55021737G>A	ENST00000301202.2	+	5	539	c.417G>A	c.(415-417)ggG>ggA	p.G139G	LAIR2_ENST00000351841.2_Splice_Site_p.G122G	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	139						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		TCCTCACAGGGACTGTGCCAG	0.468																																							uc002qgc.2		NA																	0				ovary(1)	1						c.(415-417)GGG>GGA		leukocyte-associated immunoglobulin-like							68.0	66.0	67.0					19																	55021737		2203	4299	6502	SO:0001630	splice_region_variant	3904					extracellular region	receptor activity	g.chr19:55021737G>A	AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.416-1G>A	19.37:g.55021737G>A			Somatic				LAIR2_uc002qgd.2_Silent_p.G122G|LAIR2_uc010erl.2_Missense_Mutation_p.G108E	p.G139G	NM_002288	NP_002279	WXS	Illumina HiSeq	Unspecified	Q6ISS4	LAIR2_HUMAN		GBM - Glioblastoma multiforme(193;0.0967)	5	539	+	Ovarian(34;0.19)		139					Q6PEZ4	Silent	SNP	ENST00000301202.2	37	c.417G>A	CCDS12897.1																																																																																				0.468	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140801.1		Silent	21	65	0	0	0	0.00278	0	21	65				
BRSK1	84446	broad.mit.edu	37	19	55816287	55816287	+	Splice_Site	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:55816287G>T	ENST00000309383.1	+	14	1993	c.1716G>T	c.(1714-1716)caG>caT	p.Q572H	BRSK1_ENST00000590333.1_Splice_Site_p.Q588H|BRSK1_ENST00000326848.7_Splice_Site_p.Q267H|BRSK1_ENST00000588584.1_3'UTR	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	572					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GCAAGATGCAGGGTATGGGGG	0.627																																							uc002qkg.2		NA																	0				ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(1714-1716)CAG>CAT		BR serine/threonine kinase 1							28.0	30.0	29.0					19																	55816287		2198	4285	6483	SO:0001630	splice_region_variant	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55816287G>T	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1717+1G>T	19.37:g.55816287G>T			Somatic				BRSK1_uc002qkf.2_Missense_Mutation_p.Q588H|BRSK1_uc002qkh.2_Missense_Mutation_p.Q267H	p.Q572H	NM_032430	NP_115806	WXS	Illumina HiSeq	Unspecified	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	14	1993	+		Renal(1328;0.245)	572					F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	c.1716G>T	CCDS12921.1	.	.	.	.	.	.	.	.	.	.	.	14.37	2.516148	0.44763	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	T;T	0.55413	0.52;0.52	4.71	3.67	0.42095	.	0.000000	0.64402	D	0.000001	T	0.65037	0.2653	M	0.69358	2.11	0.58432	D	0.999997	D;D	0.64830	0.99;0.994	D;D	0.78314	0.979;0.991	T	0.64076	-0.6492	10	0.45353	T	0.12	.	7.038	0.25004	0.2757:0.0:0.7243:0.0	.	572;588	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	H	572;267;267	ENSP00000310649:Q572H;ENSP00000320853:Q267H	ENSP00000310649:Q572H	Q	+	3	2	BRSK1	60508099	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.419000	0.52728	1.314000	0.45095	0.555000	0.69702	CAG		0.627	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	Missense_Mutation	21	48	1	0	7.92952e-12	0.003954	9.11165e-12	21	48				
NLRP9	338321	broad.mit.edu	37	19	56244602	56244602	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr19:56244602G>T	ENST00000332836.2	-	2	622	c.595C>A	c.(595-597)Ctg>Atg	p.L199M		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	199	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGGAGCTCCAGTAAGCTGGTC	0.473																																							uc002qly.2		NA																	0				skin(4)|ovary(2)|breast(1)	7						c.(595-597)CTG>ATG		NLR family, pyrin domain containing 9							45.0	38.0	40.0					19																	56244602		2203	4300	6503	SO:0001583	missense	338321					cytoplasm	ATP binding	g.chr19:56244602G>T	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.595C>A	19.37:g.56244602G>T	ENSP00000331857:p.Leu199Met		Somatic					p.L199M	NM_176820	NP_789790	WXS	Illumina HiSeq	Unspecified	Q7RTR0	NALP9_HUMAN		GBM - Glioblastoma multiforme(193;0.123)	2	623	-		Colorectal(82;0.000133)|Ovarian(87;0.133)	199			NACHT.		B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	c.595C>A	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680738	0.29872	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.67698	-0.28	2.63	0.361	0.16107	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.50769	0.1635	N	0.02539	-0.55	0.09310	N	1	P	0.49358	0.923	P	0.53266	0.722	T	0.51309	-0.8722	9	0.72032	D	0.01	.	10.0964	0.42478	0.0:0.5819:0.418:0.0	.	199	Q7RTR0	NALP9_HUMAN	M	199	ENSP00000331857:L199M	ENSP00000331857:L199M	L	-	1	2	NLRP9	60936414	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.038000	0.13862	0.192000	0.20272	-0.178000	0.13098	CTG		0.473	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820		7	18	1	0	3.09899e-07	0.004482	3.35846e-07	7	18				
SNTG2	54221	broad.mit.edu	37	2	1133490	1133490	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:1133490G>C	ENST00000308624.5	+	6	535	c.406G>C	c.(406-408)Gaa>Caa	p.E136Q	SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	136	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AACTCATGAAGAAGTGGTAAG	0.269																																							uc002qwq.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(406-408)GAA>CAA		syntrophin, gamma 2							172.0	164.0	166.0					2																	1133490		1826	4085	5911	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1133490G>C	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.406G>C	2.37:g.1133490G>C	ENSP00000311837:p.Glu136Gln		Somatic				SNTG2_uc002qwp.2_RNA|SNTG2_uc010ewi.2_Intron	p.E136Q	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	6	534	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	136			PDZ.		Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.406G>C	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717590	0.68844	.	.	ENSG00000172554	ENST00000308624	T	0.44083	0.93	4.69	4.69	0.59074	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.50905	0.1643	L	0.28344	0.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52646	-0.8548	10	0.49607	T	0.09	.	14.552	0.68073	0.0:0.0:1.0:0.0	.	136	Q9NY99	SNTG2_HUMAN	Q	136	ENSP00000311837:E136Q	ENSP00000311837:E136Q	E	+	1	0	SNTG2	1123490	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	3.625000	0.54238	2.144000	0.66660	0.460000	0.39030	GAA		0.269	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		26	47	0	0	0	0.003271	0	26	47				
PXDN	7837	broad.mit.edu	37	2	1684106	1684106	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:1684106C>T	ENST00000252804.4	-	7	639	c.589G>A	c.(589-591)Gac>Aac	p.D197N		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	197	LRRCT.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ATTTCACAGTCGCAGTGAAGT	0.582																																							uc002qxa.2		NA																	0				pancreas(6)|ovary(2)	8						c.(589-591)GAC>AAC		peroxidasin precursor							95.0	100.0	99.0					2																	1684106		2181	4278	6459	SO:0001583	missense	7837				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity	g.chr2:1684106C>T	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.589G>A	2.37:g.1684106C>T	ENSP00000252804:p.Asp197Asn		Somatic				PXDN_uc002qxb.1_Missense_Mutation_p.D197N|PXDN_uc002qxc.1_Missense_Mutation_p.D14N	p.D197N	NM_012293	NP_036425	WXS	Illumina HiSeq	Unspecified	Q92626	PXDN_HUMAN		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	7	653	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	197			LRRCT.		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	c.589G>A	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	16.05|16.05	3.012614|3.012614	0.54468|0.54468	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000252804;ENST00000425171|ENST00000447941	T;D|.	0.91068|.	0.54;-2.78|.	4.64|4.64	4.64|4.64	0.57946|0.57946	Cysteine-rich flanking region, C-terminal (1);|.	0.205944|.	0.39687|.	N|.	0.001299|.	T|T	0.72495|0.72495	0.3467|0.3467	M|M	0.64567|0.64567	1.98|1.98	0.44966|0.44966	D|D	0.997984|0.997984	B;B|.	0.31893|.	0.345;0.029|.	B;B|.	0.33846|.	0.171;0.015|.	T|T	0.72450|0.72450	-0.4290|-0.4290	10|5	0.25751|.	T|.	0.34|.	-57.4627|-57.4627	17.5839|17.5839	0.87976|0.87976	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	197;197|.	Q92626-2;Q92626|.	.;PXDN_HUMAN|.	N|Q	197;173|120	ENSP00000252804:D197N;ENSP00000398363:D173N|.	ENSP00000252804:D197N|.	D|R	-|-	1|2	0|0	PXDN|PXDN	1663113|1663113	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.034000|0.034000	0.12701|0.12701	5.966000|5.966000	0.70395|0.70395	2.139000|2.139000	0.66308|0.66308	0.444000|0.444000	0.29173|0.29173	GAC|CGA		0.582	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455		18	48	0	0	0	0.001882	0	18	48				
APOB	338	broad.mit.edu	37	2	21250865	21250865	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:21250865A>G	ENST00000233242.1	-	14	2029	c.1902T>C	c.(1900-1902)tcT>tcC	p.S634S	APOB_ENST00000399256.4_Silent_p.S634S	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	634	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATAGTTCCGAGAGAATTTTC	0.363																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(1900-1902)TCT>TCC		apolipoprotein B precursor	Atorvastatin(DB01076)						117.0	121.0	120.0					2																	21250865		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21250865A>G	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1902T>C	2.37:g.21250865A>G			Somatic					p.S634S	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			14	2030	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		634			Vitellogenin.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.1902T>C	CCDS1703.1																																																																																				0.363	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			37	82	0	0	0	0.007835	0	37	82				
ASXL2	55252	broad.mit.edu	37	2	25973043	25973043	+	Nonsense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:25973043G>C	ENST00000435504.4	-	12	1675	c.1382C>G	c.(1381-1383)tCa>tGa	p.S461*	ASXL2_ENST00000336112.4_Nonsense_Mutation_p.S433*|ASXL2_ENST00000404843.1_Nonsense_Mutation_p.S201*|ASXL2_ENST00000272341.4_Nonsense_Mutation_p.S201*			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	461					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGGCTCTGAAGATGTGGA	0.483																																							uc002rgs.2		NA																	0				pancreas(1)	1						c.(1381-1383)TCA>TGA		additional sex combs like 2							264.0	258.0	260.0					2																	25973043		2023	4191	6214	SO:0001587	stop_gained	55252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding	g.chr2:25973043G>C			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1382C>G	2.37:g.25973043G>C	ENSP00000391447:p.Ser461*		Somatic				ASXL2_uc002rgt.1_Nonsense_Mutation_p.S201*	p.S461*	NM_018263	NP_060733	WXS	Illumina HiSeq	Unspecified	Q76L83	ASXL2_HUMAN			11	1603	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		461					Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Nonsense_Mutation	SNP	ENST00000435504.4	37	c.1382C>G		.	.	.	.	.	.	.	.	.	.	G	42	9.454073	0.99175	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	.	.	.	5.78	5.78	0.91487	.	0.765147	0.12681	N	0.447979	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	0.4422	14.2097	0.65756	0.0:0.1495:0.8505:0.0	.	.	.	.	X	461;433;201;201	.	ENSP00000272341:S201X	S	-	2	0	ASXL2	25826547	0.124000	0.22315	0.856000	0.33681	0.090000	0.18270	1.566000	0.36396	2.727000	0.93392	0.585000	0.79938	TCA		0.483	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263		86	144	0	0	0	0.00361	0	86	144				
TRIM54	57159	broad.mit.edu	37	2	27505683	27505683	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:27505683C>T	ENST00000380075.2	+	1	424	c.84C>T	c.(82-84)atC>atT	p.I28I	TRIM54_ENST00000296098.4_Silent_p.I28I	NM_187841.2	NP_912730.2	Q9BYV2	TRI54_HUMAN	tripartite motif containing 54	28					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|negative regulation of microtubule depolymerization (GO:0007026)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGCCCCATCTGCCTGGAGA	0.587																																							uc002rjo.2		NA																	0				ovary(1)	1						c.(82-84)ATC>ATT		ring finger protein 30 isoform 2							261.0	218.0	232.0					2																	27505683		2203	4300	6503	SO:0001819	synonymous_variant	57159				cell differentiation|microtubule-based process|multicellular organismal development|negative regulation of microtubule depolymerization	microtubule|sarcomere	signal transducer activity|zinc ion binding	g.chr2:27505683C>T	AJ291714	CCDS1745.2, CCDS1746.2	2p23.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000138100	ENSG00000138100		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16008	protein-coding gene	gene with protein product		606474	"""ring finger protein 30"", ""tripartite motif-containing 54"""	RNF30		11243782	Standard	NM_032546		Approved	MURF, MURF-3	uc002rjn.3	Q9BYV2	OTTHUMG00000097078	ENST00000380075.2:c.84C>T	2.37:g.27505683C>T			Somatic				TRIM54_uc002rjn.2_Silent_p.I28I	p.I28I	NM_187841	NP_912730	WXS	Illumina HiSeq	Unspecified	Q9BYV2	TRI54_HUMAN			1	84	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		28			RING-type.		A5D8T7|Q53SY4|Q9BYV3	Silent	SNP	ENST00000380075.2	37	c.84C>T	CCDS1746.2																																																																																				0.587	TRIM54-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214199.2	NM_187841		126	249	0	0	0	0.00361	0	126	249				
MAP4K3	8491	broad.mit.edu	37	2	39552700	39552700	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:39552700C>A	ENST00000263881.3	-	12	1201	c.877G>T	c.(877-879)Gat>Tat	p.D293Y	MAP4K3_ENST00000536018.1_5'UTR|MAP4K3_ENST00000341681.5_Missense_Mutation_p.D293Y|RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000437545.1_Missense_Mutation_p.D230Y	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	293					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GTGGAATGATCTGGATTATTT	0.348																																							uc002rro.2		NA																	0				ovary(3)|lung(3)|stomach(1)|pancreas(1)	8						c.(877-879)GAT>TAT		mitogen-activated protein kinase kinase kinase							107.0	105.0	106.0					2																	39552700		2203	4300	6503	SO:0001583	missense	8491				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr2:39552700C>A	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.877G>T	2.37:g.39552700C>A	ENSP00000263881:p.Asp293Tyr		Somatic				MAP4K3_uc002rrp.2_Missense_Mutation_p.D293Y|MAP4K3_uc010yns.1_5'UTR	p.D293Y	NM_003618	NP_003609	WXS	Illumina HiSeq	Unspecified	Q8IVH8	M4K3_HUMAN			12	968	-		all_hematologic(82;0.211)	293					Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	c.877G>T	CCDS1803.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044343	0.93685	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.28454	1.61;1.61;1.61	5.86	5.86	0.93980	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.52484	0.1737	M	0.72894	2.215	0.80722	D	1	P;D	0.56287	0.917;0.975	P;P	0.56751	0.725;0.805	T	0.44726	-0.9309	9	.	.	.	.	20.1739	0.98173	0.0:1.0:0.0:0.0	.	293;293	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	Y	293;230;293	ENSP00000263881:D293Y;ENSP00000416958:D230Y;ENSP00000345434:D293Y	.	D	-	1	0	MAP4K3	39406204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.473000	0.60196	2.774000	0.95407	0.585000	0.79938	GAT		0.348	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618		24	60	1	0	2.2171e-23	0.009535	2.7805e-23	24	60				
RHOQ	23433	broad.mit.edu	37	2	46808133	46808133	+	Nonsense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:46808133G>T	ENST00000238738.4	+	5	848	c.529G>T	c.(529-531)Gag>Tag	p.E177*	PIGF_ENST00000281382.6_3'UTR|RP11-417F21.1_ENST00000506009.2_RNA	NM_012249.3	NP_036381.2	P17081	RHOQ_HUMAN	ras homolog family member Q	177					cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|GTP catabolic process (GO:0006184)|insulin receptor signaling pathway (GO:0008286)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin filament (GO:0005884)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GBD domain binding (GO:0032427)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|profilin binding (GO:0005522)			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			TGTTTTTGATGAGGCTATCAT	0.348																																							uc002rva.2		NA																	0				skin(2)	2						c.(529-531)GAG>TAG		ras-like protein TC10 precursor							82.0	81.0	81.0					2																	46808133		2203	4297	6500	SO:0001587	stop_gained	23433				cortical actin cytoskeleton organization|insulin receptor signaling pathway|negative regulation of establishment of protein localization in plasma membrane|positive regulation of filopodium assembly|positive regulation of glucose import|positive regulation of transcription from RNA polymerase II promoter|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	actin filament|cytosol|plasma membrane	GBD domain binding|GTP binding|GTPase activity|profilin binding	g.chr2:46808133G>T	M31470	CCDS33191.1	2p21	2012-02-27	2012-02-27	2004-03-24	ENSG00000119729	ENSG00000119729			17736	protein-coding gene	gene with protein product		605857	"""RAS-like, family 7, member A"", ""ras homolog gene family, member Q"""	RASL7A, ARHQ		2108320	Standard	NM_012249		Approved	TC10	uc002rva.3	P17081	OTTHUMG00000150653	ENST00000238738.4:c.529G>T	2.37:g.46808133G>T	ENSP00000238738:p.Glu177*		Somatic				uc002rvb.2_5'Flank	p.E177*	NM_012249	NP_036381	WXS	Illumina HiSeq	Unspecified	P17081	RHOQ_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.114)		5	848	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	177					D6W5A6|Q0VGN1|Q52LS8|Q53SJ1|Q6NS39|Q6P146|Q7Z480	Nonsense_Mutation	SNP	ENST00000238738.4	37	c.529G>T	CCDS33191.1	.	.	.	.	.	.	.	.	.	.	G	37	6.436970	0.97568	.	.	ENSG00000119729	ENST00000238738	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.7547	0.91827	0.0:0.0:1.0:0.0	.	.	.	.	X	177	.	ENSP00000238738:E177X	E	+	1	0	RHOQ	46661637	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.665000	0.90641	0.650000	0.86243	GAG		0.348	RHOQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319409.1	NM_012249		32	65	1	0	2.1956e-27	0.004289	2.80481e-27	32	65				
USP34	9736	broad.mit.edu	37	2	61415551	61415551	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:61415551T>C	ENST00000398571.2	-	80	10403	c.10327A>G	c.(10327-10329)Aga>Gga	p.R3443G	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3443					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCGTCATATCTACCATTGTTG	0.398																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(10327-10329)AGA>GGA		ubiquitin specific protease 34							100.0	93.0	95.0					2																	61415551		1909	4141	6050	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61415551T>C	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.10327A>G	2.37:g.61415551T>C	ENSP00000381577:p.Arg3443Gly		Somatic				USP34_uc002sbd.2_Missense_Mutation_p.R245G	p.R3443G	NM_014709	NP_055524	WXS	Illumina HiSeq	Unspecified	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		80	10349	-			3443					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.10327A>G	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	1.716|1.716	-0.497724|-0.497724	0.04291|0.04291	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269|ENST00000411912	T|.	0.03553|.	3.89|.	5.52|5.52	1.32|1.32	0.21799|0.21799	.|.	0.224065|.	0.45126|.	D|.	0.000388|.	T|.	0.25568|.	0.0622|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.09377|.	0.004|.	T|.	0.19745|.	-1.0296|.	10|.	0.72032|.	D|.	0.01|.	.|.	14.4876|14.4876	0.67629|0.67629	0.0:0.0:0.5044:0.4956|0.0:0.0:0.5044:0.4956	.|.	3443|.	Q70CQ2|.	UBP34_HUMAN|.	G|W	3291;3208;3443;321|1119	ENSP00000381577:R3443G|.	ENSP00000263989:R3291G|.	R|X	-|-	1|2	2|0	USP34|USP34	61269055|61269055	0.835000|0.835000	0.29415|0.29415	0.097000|0.097000	0.21041|0.21041	0.050000|0.050000	0.14768|0.14768	1.012000|1.012000	0.29924|0.29924	0.398000|0.398000	0.25338|0.25338	0.482000|0.482000	0.46254|0.46254	AGA|TAG		0.398	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			22	62	0	0	0	0.010504	0	22	62				
ALMS1	7840	broad.mit.edu	37	2	73676206	73676206	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:73676206C>G	ENST00000264448.6	+	8	2660	c.2549C>G	c.(2548-2550)cCa>cGa	p.P850R	ALMS1_ENST00000377715.1_Missense_Mutation_p.P850R|ALMS1_ENST00000409009.1_Missense_Mutation_p.P808R	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	850	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ACTGGGACACCAGCTGTAACC	0.498																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(2554-2556)CCA>CGA		Alstrom syndrome 1							76.0	79.0	78.0					2																	73676206		1900	4120	6020	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73676206C>G	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2549C>G	2.37:g.73676206C>G	ENSP00000264448:p.Pro850Arg		Somatic				ALMS1_uc002sjf.1_Missense_Mutation_p.P808R|ALMS1_uc002sjg.2_Missense_Mutation_p.P238R|ALMS1_uc002sjh.1_Missense_Mutation_p.P238R	p.P852R	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			10	2666	+			850			7.|34 X 47 AA approximate tandem repeat.		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.2555C>G	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724662	0.30593	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.17054	3.18;3.18;2.3	3.45	1.59	0.23543	.	1.059850	0.07537	N	0.913244	T	0.23133	0.0559	L	0.42245	1.32	0.09310	N	1	D;P;P	0.55800	0.973;0.886;0.886	P;P;B	0.54759	0.76;0.495;0.414	T	0.16335	-1.0406	10	0.49607	T	0.09	.	4.008	0.09610	0.2334:0.6413:0.0:0.1252	.	850;808;850	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	R	808;850;850	ENSP00000386627:P808R;ENSP00000264448:P850R;ENSP00000366944:P850R	ENSP00000264448:P850R	P	+	2	0	ALMS1	73529714	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.516000	0.06282	0.438000	0.26450	0.655000	0.94253	CCA		0.498	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		16	47	0	0	0	0.00499	0	16	47				
ALMS1	7840	broad.mit.edu	37	2	73676340	73676340	+	Missense_Mutation	SNP	C	C	G	rs376834704		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:73676340C>G	ENST00000264448.6	+	8	2794	c.2683C>G	c.(2683-2685)Cag>Gag	p.Q895E	ALMS1_ENST00000377715.1_Missense_Mutation_p.Q895E|ALMS1_ENST00000409009.1_Missense_Mutation_p.Q853E	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	895	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ACCAGGTGATCAGAAGACTGG	0.458																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(2689-2691)CAG>GAG		Alstrom syndrome 1		C	GLU/GLN	1,3739		0,1,1869	103.0	106.0	105.0		2683	3.5	0.5	2		105	0,8206		0,0,4103	no	missense	ALMS1	NM_015120.4	29	0,1,5972	GG,GC,CC		0.0,0.0267,0.0084	possibly-damaging	895/4168	73676340	1,11945	1870	4103	5973	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73676340C>G	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2683C>G	2.37:g.73676340C>G	ENSP00000264448:p.Gln895Glu		Somatic				ALMS1_uc002sjf.1_Missense_Mutation_p.Q853E|ALMS1_uc002sjg.2_Missense_Mutation_p.Q283E|ALMS1_uc002sjh.1_Missense_Mutation_p.Q283E	p.Q897E	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			10	2800	+			895			8.|34 X 47 AA approximate tandem repeat.		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.2689C>G	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.517138	0.27123	2.67E-4	0.0	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.14640	3.38;3.38;2.49	3.55	3.55	0.40652	.	0.138560	0.33854	N	0.004483	T	0.24275	0.0588	L	0.50333	1.59	0.20489	N	0.999892	D;B;B	0.63046	0.992;0.126;0.404	P;B;B	0.59056	0.851;0.058;0.124	T	0.01508	-1.1337	10	0.59425	D	0.04	.	10.8903	0.46992	0.0:1.0:0.0:0.0	.	895;853;895	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	E	853;895;895	ENSP00000386627:Q853E;ENSP00000264448:Q895E;ENSP00000366944:Q895E	ENSP00000264448:Q895E	Q	+	1	0	ALMS1	73529848	0.070000	0.21116	0.466000	0.27168	0.034000	0.12701	3.012000	0.49575	2.259000	0.74868	0.591000	0.81541	CAG		0.458	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		37	71	0	0	0	0.00874	0	37	71				
ALMS1	7840	broad.mit.edu	37	2	73826634	73826634	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:73826634A>G	ENST00000264448.6	+	17	11762	c.11651A>G	c.(11650-11652)aAg>aGg	p.K3884R	ALMS1_ENST00000409009.1_Missense_Mutation_p.K3842R	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3884					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ATGTTAAACAAGGGCATACAA	0.338																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(11656-11658)AAG>AGG		Alstrom syndrome 1							167.0	149.0	154.0					2																	73826634		1844	4101	5945	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73826634A>G	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.11651A>G	2.37:g.73826634A>G	ENSP00000264448:p.Lys3884Arg		Somatic				ALMS1_uc002sjf.1_Missense_Mutation_p.K3842R|ALMS1_uc002sjh.1_Missense_Mutation_p.K3272R	p.K3886R	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			19	11768	+			3884					Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.11657A>G	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814387	0.70912	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.17054	2.3;2.3	4.83	4.83	0.62350	.	0.000000	0.56097	D	0.000024	T	0.32823	0.0842	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.85130	0.997;0.99	T	0.03818	-1.1001	10	0.87932	D	0	.	10.7123	0.45990	1.0:0.0:0.0:0.0	.	3842;3884	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	R	3842;3884	ENSP00000386627:K3842R;ENSP00000264448:K3884R	ENSP00000264448:K3884R	K	+	2	0	ALMS1	73680142	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	3.994000	0.56994	2.035000	0.60131	0.528000	0.53228	AAG		0.338	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		43	96	0	0	0	0.00361	0	43	96				
IGKV2D-40	28878	broad.mit.edu	37	2	89890585	89890585	+	RNA	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:89890585G>C	ENST00000560045.1	+	0	0									immunoglobulin kappa variable 2D-40																		TCCCTGCTCAGCTCCTGGGGC	0.552																																							uc010yts.1		NA																	0					NA						c.(16-18)CAG>CAC		RecName: Full=Ig kappa chain V-II region Cum;																																						0							g.chr2:89890585G>C	X59311		2p11.2	2012-02-08			ENSG00000251039	ENSG00000251039		"""Immunoglobulins / IGK locus"""	5804	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000159963		2.37:g.89890585G>C			Somatic					p.Q6H			WXS	Illumina HiSeq	Unspecified					1	24	+									Missense_Mutation	SNP	ENST00000560045.1	37	c.18G>C																																																																																					0.552	IGKV2D-40-201	KNOWN	basic|appris_principal	IG_V_gene	IG_V_gene		NG_000833		16	158	0	0	0	0.002299	0	16	158				
IL18RAP	8807	broad.mit.edu	37	2	103040355	103040355	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:103040355A>T	ENST00000264260.2	+	4	744	c.155A>T	c.(154-156)cAg>cTg	p.Q52L	IL18RAP_ENST00000409369.1_Intron	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	52					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						CCAGAGCCACAGAAATCACAT	0.403																																							uc002tbx.2		NA																	0				skin(3)|ovary(2)	5						c.(154-156)CAG>CTG		interleukin 18 receptor accessory protein							64.0	63.0	63.0					2																	103040355		2203	4300	6503	SO:0001583	missense	8807				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity	g.chr2:103040355A>T	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.155A>T	2.37:g.103040355A>T	ENSP00000264260:p.Gln52Leu		Somatic				IL18RAP_uc010fiz.2_Intron	p.Q52L	NM_003853	NP_003844	WXS	Illumina HiSeq	Unspecified	O95256	I18RA_HUMAN			4	639	+			52			Extracellular (Potential).		B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	c.155A>T	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.203797	0.38905	.	.	ENSG00000115607	ENST00000264260	T	0.02446	4.29	4.47	2.08	0.27032	.	1.533070	0.03666	N	0.243328	T	0.04543	0.0124	M	0.63428	1.95	0.09310	N	1	B	0.29432	0.244	B	0.24701	0.055	T	0.45469	-0.9259	10	0.29301	T	0.29	.	4.7228	0.12926	0.7099:0.192:0.0981:0.0	.	52	O95256	I18RA_HUMAN	L	52	ENSP00000264260:Q52L	ENSP00000264260:Q52L	Q	+	2	0	IL18RAP	102406787	0.000000	0.05858	0.001000	0.08648	0.340000	0.28889	-0.424000	0.07025	0.467000	0.27218	0.460000	0.39030	CAG		0.403	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853		15	26	0	0	0	0.004007	0	15	26				
SLC9A4	389015	broad.mit.edu	37	2	103149081	103149081	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:103149081G>T	ENST00000295269.4	+	12	2788	c.2331G>T	c.(2329-2331)tgG>tgT	p.W777C		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	777					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GGTCGAGGTGGACAGCTGACC	0.507																																							uc002tbz.3		NA																	0				skin(2)|central_nervous_system(1)	3						c.(2329-2331)TGG>TGT		solute carrier family 9 (sodium/hydrogen							80.0	50.0	60.0					2																	103149081		2203	4300	6503	SO:0001583	missense	389015				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity	g.chr2:103149081G>T		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.2331G>T	2.37:g.103149081G>T	ENSP00000295269:p.Trp777Cys		Somatic					p.W777C	NM_001011552	NP_001011552	WXS	Illumina HiSeq	Unspecified	Q6AI14	SL9A4_HUMAN			12	2788	+			777			Cytoplasmic (Potential).		Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	c.2331G>T	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672229	0.67928	.	.	ENSG00000180251	ENST00000295269	T	0.52057	0.68	5.31	5.31	0.75309	.	0.550022	0.19175	N	0.120839	T	0.47432	0.1445	L	0.32530	0.975	0.53688	D	0.999971	D	0.59767	0.986	P	0.49708	0.62	T	0.37430	-0.9706	10	0.39692	T	0.17	.	16.2452	0.82437	0.0:0.0:1.0:0.0	.	777	Q6AI14	SL9A4_HUMAN	C	777	ENSP00000295269:W777C	ENSP00000295269:W777C	W	+	3	0	SLC9A4	102515513	0.996000	0.38824	0.192000	0.23308	0.137000	0.21094	4.925000	0.63425	2.642000	0.89623	0.655000	0.94253	TGG		0.507	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3		5	20	1	0	5.9392e-07	0.001168	6.40612e-07	5	20				
CKAP2L	150468	broad.mit.edu	37	2	113514362	113514362	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:113514362C>G	ENST00000302450.6	-	4	664	c.586G>C	c.(586-588)Gag>Cag	p.E196Q	CKAP2L_ENST00000481732.1_5'UTR|CKAP2L_ENST00000541405.1_Missense_Mutation_p.E31Q	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	196						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						GGCTTCCTCTCAGGTTCTGTT	0.338																																							uc002tie.2		NA																	0					0						c.(586-588)GAG>CAG		cytoskeleton associated protein 2-like							102.0	107.0	105.0					2																	113514362		2202	4300	6502	SO:0001583	missense	150468					centrosome		g.chr2:113514362C>G	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.586G>C	2.37:g.113514362C>G	ENSP00000305204:p.Glu196Gln		Somatic				CKAP2L_uc002tif.2_Intron|CKAP2L_uc010yxp.1_Missense_Mutation_p.E31Q|CKAP2L_uc010yxq.1_Missense_Mutation_p.E31Q	p.E196Q	NM_152515	NP_689728	WXS	Illumina HiSeq	Unspecified	Q8IYA6	CKP2L_HUMAN			4	665	-			196					A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	37	c.586G>C	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	C	6.185	0.402321	0.11696	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.14516	2.5;3.2	5.0	-1.5	0.08691	.	0.646937	0.14434	N	0.319880	T	0.13114	0.0318	M	0.69823	2.125	0.09310	N	1	B	0.22909	0.077	B	0.21917	0.037	T	0.24728	-1.0152	10	0.32370	T	0.25	-0.9187	5.6894	0.17821	0.0:0.4353:0.1451:0.4196	.	196	Q8IYA6	CKP2L_HUMAN	Q	31;196	ENSP00000438763:E31Q;ENSP00000305204:E196Q	ENSP00000305204:E196Q	E	-	1	0	CKAP2L	113230833	0.000000	0.05858	0.006000	0.13384	0.059000	0.15707	0.049000	0.14099	-0.420000	0.07427	0.585000	0.79938	GAG		0.338	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	NM_152515		7	23	0	0	0	0.001984	0	7	23				
GYPC	2995	broad.mit.edu	37	2	127451438	127451438	+	Splice_Site	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:127451438A>G	ENST00000259254.4	+	3	437		c.e3-1		GYPC_ENST00000464053.1_Splice_Site|GYPC_ENST00000409836.3_Splice_Site|GYPC_ENST00000356887.7_Splice_Site	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)							cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		CTCTGTTCACAGAGCCTGATC	0.542																																					Melanoma(110;806 1600 6704 9981 33404)	Melanoma(110;806 1600 6704 9981 33404)	uc002tnq.2		NA																	0				central_nervous_system(1)	1						c.e3-2		glycophorin C isoform 1							145.0	120.0	129.0					2																	127451438		2203	4300	6503	SO:0001630	splice_region_variant	2995					cortical cytoskeleton|integral to plasma membrane	protein binding	g.chr2:127451438A>G		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.107-1A>G	2.37:g.127451438A>G			Somatic				GYPC_uc002tnr.2_Splice_Site_p.E17_splice|GYPC_uc010flv.2_Splice_Site	p.E36_splice	NM_002101	NP_002092	WXS	Illumina HiSeq	Unspecified	P04921	GLPC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.075)	3	263	+	Colorectal(110;0.0533)							B2R522|Q53SV9|Q92642	Splice_Site	SNP	ENST00000259254.4	37	c.107_splice	CCDS2136.1	.	.	.	.	.	.	.	.	.	.	a	16.65	3.181440	0.57800	.	.	ENSG00000136732	ENST00000259254;ENST00000356887;ENST00000409836	.	.	.	3.45	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5816	0.33632	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GYPC	127167908	0.944000	0.32072	0.841000	0.33234	0.562000	0.35680	3.154000	0.50693	1.808000	0.52836	0.358000	0.22013	.		0.542	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101	Intron	28	74	0	0	0	0.009535	0	28	74				
MGAT5	4249	broad.mit.edu	37	2	135076221	135076221	+	Splice_Site	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:135076221T>A	ENST00000409645.1	+	5	736	c.484T>A	c.(484-486)Tgg>Agg	p.W162R	MGAT5_ENST00000281923.2_Splice_Site_p.W162R			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	162					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CTTGTTTCAGTGGATGAAAGA	0.488																																							uc002ttv.1		NA																	0				ovary(2)|skin(1)	3						c.(484-486)TGG>AGG		N-acetylglucosaminyltransferase V							229.0	215.0	220.0					2																	135076221		2203	4300	6503	SO:0001630	splice_region_variant	4249				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity	g.chr2:135076221T>A	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.484-1T>A	2.37:g.135076221T>A			Somatic					p.W162R	NM_002410	NP_002401	WXS	Illumina HiSeq	Unspecified	Q09328	MGT5A_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0964)	4	629	+			162			Lumenal (Potential).		D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	c.484T>A	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.393724	0.83011	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.69	5.69	0.88448	.	0.117452	0.64402	D	0.000007	T	0.78886	0.4354	M	0.77486	2.375	0.80722	D	1	D	0.64830	0.994	D	0.78314	0.991	T	0.80160	-0.1498	8	.	.	.	-9.8788	14.5178	0.67830	0.0:0.0:0.0:1.0	.	162	Q09328	MGT5A_HUMAN	R	162	.	.	W	+	1	0	MGAT5	134792691	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.673000	0.83973	2.169000	0.68431	0.533000	0.62120	TGG		0.488	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	Missense_Mutation	48	131	0	0	0	0.00361	0	48	131				
PABPC1P2	728773	broad.mit.edu	37	2	147346258	147346258	+	IGR	SNP	G	G	A	rs201992881		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:147346258G>A								RNU7-2P (443473 upstream) : AC103881.1 (249058 downstream)																							CCAGAACCGTGCTGCATACTA	0.517																																							uc002twf.3		NA																	0					0						c.(718-720)GCT>ACT		RecName: Full=Putative protein PABPC1-like; AltName: Full=Polyadenylate-binding protein pseudogene 2;																																				SO:0001628	intergenic_variant	728773							g.chr2:147346258G>A																													2.37:g.147346258G>A			Somatic					p.A240T	NR_026904		WXS	Illumina HiSeq	Unspecified					1	1634	+									Missense_Mutation	SNP		37	c.718G>A																																																																																				0	0.517									28	55	0	0	0	0.009535	0	28	55				
MBD5	55777	broad.mit.edu	37	2	149226874	149226874	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:149226874G>T	ENST00000407073.1	+	9	2359	c.1362G>T	c.(1360-1362)gaG>gaT	p.E454D	MBD5_ENST00000404807.1_Missense_Mutation_p.E454D	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	454					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GAAGGATTGAGGCATCGCCCC	0.502																																							uc002twm.3		NA																	0				skin(3)|ovary(2)	5						c.(1360-1362)GAG>GAT		methyl-CpG binding domain protein 5							77.0	70.0	72.0					2																	149226874		2203	4300	6503	SO:0001583	missense	55777					chromosome|nucleus	chromatin binding|DNA binding	g.chr2:149226874G>T	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.1362G>T	2.37:g.149226874G>T	ENSP00000386049:p.Glu454Asp		Somatic				MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.E454D|MBD5_uc002twn.1_5'Flank	p.E454D	NM_018328	NP_060798	WXS	Illumina HiSeq	Unspecified	Q9P267	MBD5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0569)	9	2350	+			454					A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	c.1362G>T	CCDS33302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.06|15.06	2.720454|2.720454	0.48728|0.48728	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000407073;ENST00000404807|ENST00000416015	T;T|.	0.56611|.	0.48;0.45|.	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	0.000000|.	0.56097|.	D|.	0.000032|.	T|T	0.56262|0.56262	0.1973|0.1973	L|L	0.27053|0.27053	0.805|0.805	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.67145|.	0.996|.	D|.	0.75484|.	0.986|.	T|T	0.52102|0.52102	-0.8620|-0.8620	10|5	0.32370|.	T|.	0.25|.	-5.0142|-5.0142	18.4913|18.4913	0.90849|0.90849	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	454|.	Q9P267|.	MBD5_HUMAN|.	D|M	454|194	ENSP00000386049:E454D;ENSP00000384672:E454D|.	ENSP00000384672:E454D|.	E|R	+|+	3|2	2|0	MBD5|MBD5	148943344|148943344	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.379000|4.379000	0.59575|0.59575	2.445000|2.445000	0.82738|0.82738	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.502	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2			12	18	1	0	1.3612e-06	0.003163	1.45904e-06	12	18				
ACVR1C	130399	broad.mit.edu	37	2	158390463	158390463	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:158390463A>G	ENST00000243349.8	-	9	1809	c.1449T>C	c.(1447-1449)tcT>tcC	p.S483S	ACVR1C_ENST00000335450.7_Silent_p.S403S|ACVR1C_ENST00000409680.3_Silent_p.S433S|ACVR1C_ENST00000348328.5_Silent_p.S326S	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						CACAAAGTTGAGATATAGTCT	0.403																																							uc002tzk.3		NA																	0				lung(3)|ovary(2)|skin(2)	7						c.(1447-1449)TCT>TCC		activin A receptor, type IC isoform 1							96.0	105.0	102.0					2																	158390463		2203	4300	6503	SO:0001819	synonymous_variant	130399				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity	g.chr2:158390463A>G	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1449T>C	2.37:g.158390463A>G			Somatic				ACVR1C_uc002tzl.3_Silent_p.S403S|ACVR1C_uc010fof.2_Silent_p.S326S|ACVR1C_uc010foe.2_Silent_p.S433S	p.S483S	NM_145259	NP_660302	WXS	Illumina HiSeq	Unspecified	Q8NER5	ACV1C_HUMAN			9	1692	-			483			Protein kinase.|Cytoplasmic (Potential).			Silent	SNP	ENST00000243349.8	37	c.1449T>C	CCDS2205.1																																																																																				0.403	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259		30	56	0	0	0	0.002096	0	30	56				
SCN1A	6323	broad.mit.edu	37	2	166903286	166903286	+	Silent	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:166903286T>C	ENST00000303395.4	-	9	1370	c.1371A>G	c.(1369-1371)gcA>gcG	p.A457A	AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000423058.2_Silent_p.A457A|SCN1A_ENST00000375405.3_Silent_p.A457A|SCN1A_ENST00000409050.1_Silent_p.A457A			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	457					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTACCTGAGCTGCCTCCTGTT	0.458																																							uc010zcz.1		NA																	0				ovary(6)|skin(6)|large_intestine(1)	13						c.(1369-1371)GCA>GCG		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						94.0	83.0	86.0					2																	166903286		2203	4300	6503	SO:0001819	synonymous_variant	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166903286T>C	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1371A>G	2.37:g.166903286T>C			Somatic				SCN1A_uc002udo.3_Silent_p.A326A|SCN1A_uc010fpk.2_Silent_p.A326A	p.A457A	NM_006920	NP_008851	WXS	Illumina HiSeq	Unspecified	P35498	SCN1A_HUMAN			9	1389	-			457					E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	c.1371A>G	CCDS54413.1																																																																																				0.458	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		14	40	0	0	0	0.003163	0	14	40				
ABCB11	8647	broad.mit.edu	37	2	169869891	169869891	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:169869891C>G	ENST00000263817.6	-	5	404	c.280G>C	c.(280-282)Gac>Cac	p.D94H		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	94	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)	p.D94N(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	AACTCAACGTCGTAGTCAATA	0.428																																							uc002ueo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)	5						c.(280-282)GAC>CAC		ATP-binding cassette, sub-family B (MDR/TAP),	Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)						213.0	202.0	205.0					2																	169869891		1891	4139	6030	SO:0001583	missense	8647				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism	g.chr2:169869891C>G	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.280G>C	2.37:g.169869891C>G	ENSP00000263817:p.Asp94His		Somatic					p.D94H	NM_003742	NP_003733	WXS	Illumina HiSeq	Unspecified	O95342	ABCBB_HUMAN			5	406	-			94			ABC transmembrane type-1 1.|Extracellular (Potential).		Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	c.280G>C	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305029	0.60305	.	.	ENSG00000073734	ENST00000263817	T	0.80123	-1.34	5.41	5.41	0.78517	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.043338	0.85682	D	0.000000	D	0.86506	0.5949	L	0.42744	1.35	0.80722	D	1	D	0.65815	0.995	D	0.70016	0.967	D	0.86324	0.1694	10	0.49607	T	0.09	.	19.2026	0.93717	0.0:1.0:0.0:0.0	.	94	O95342	ABCBB_HUMAN	H	94	ENSP00000263817:D94H	ENSP00000263817:D94H	D	-	1	0	ABCB11	169578137	1.000000	0.71417	0.735000	0.30896	0.279000	0.26890	6.968000	0.76086	2.526000	0.85167	0.555000	0.69702	GAC		0.428	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742		54	106	0	0	0	0.00361	0	54	106				
PPIG	9360	broad.mit.edu	37	2	170462555	170462555	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:170462555A>G	ENST00000260970.3	+	5	363	c.143A>G	c.(142-144)aAg>aGg	p.K48R	PPIG_ENST00000409714.3_Missense_Mutation_p.K48R|PPIG_ENST00000448752.2_Missense_Mutation_p.K48R|PPIG_ENST00000462903.1_Missense_Mutation_p.K48R	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	48	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	ATAGGTGAAAAGGGGACCGGG	0.353																																							uc002uez.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(142-144)AAG>AGG		peptidylprolyl isomerase G	L-Proline(DB00172)						74.0	77.0	76.0					2																	170462555		2203	4300	6503	SO:0001583	missense	9360				protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr2:170462555A>G	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.143A>G	2.37:g.170462555A>G	ENSP00000260970:p.Lys48Arg		Somatic				PPIG_uc010fpx.2_Missense_Mutation_p.K48R|PPIG_uc010fpy.2_Missense_Mutation_p.K44R|PPIG_uc002ufa.2_Missense_Mutation_p.K48R|PPIG_uc002ufb.2_Missense_Mutation_p.K48R|PPIG_uc002ufc.1_Missense_Mutation_p.K48R|PPIG_uc002ufd.2_Missense_Mutation_p.K48R	p.K48R	NM_004792	NP_004783	WXS	Illumina HiSeq	Unspecified	Q13427	PPIG_HUMAN			5	363	+			48			PPIase cyclophilin-type.		D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	c.143A>G	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.551212	0.27739	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000433207;ENST00000409714;ENST00000462903;ENST00000448752;ENST00000418888;ENST00000414307	T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.51	5.51	0.81932	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.057926	0.64402	D	0.000003	T	0.40094	0.1103	L	0.45470	1.425	0.45139	D	0.998153	B;B;B;B;B	0.30584	0.247;0.113;0.113;0.203;0.286	B;B;B;B;B	0.36959	0.112;0.04;0.04;0.073;0.237	T	0.35624	-0.9781	10	0.51188	T	0.08	-10.3797	10.0508	0.42214	0.9249:0.0:0.0751:0.0	.	44;48;48;48;48	C9JM79;E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;.;PPIG_HUMAN	R	48;48;44;48;48;48;48;48	ENSP00000260970:K48R;ENSP00000408683:K44R;ENSP00000386245:K48R;ENSP00000435987:K48R;ENSP00000407083:K48R;ENSP00000394202:K48R;ENSP00000402222:K48R	ENSP00000260970:K48R	K	+	2	0	PPIG	170170801	1.000000	0.71417	1.000000	0.80357	0.154000	0.21943	4.496000	0.60360	2.089000	0.63090	0.528000	0.53228	AAG		0.353	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2			3	71	0	0	0	0.009096	0	3	71				
EVX2	344191	broad.mit.edu	37	2	176948242	176948242	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:176948242A>G	ENST00000308618.4	-	1	399	c.263T>C	c.(262-264)gTc>gCc	p.V88A		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	88					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		TTCGGAGGAGACGGTGCTTTC	0.627																																							uc010zeu.1		NA																	0				ovary(2)	2						c.(262-264)GTC>GCC		even-skipped homeobox 2							54.0	62.0	60.0					2																	176948242		2203	4300	6503	SO:0001583	missense	344191					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176948242A>G		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.263T>C	2.37:g.176948242A>G	ENSP00000312385:p.Val88Ala		Somatic					p.V88A	NM_001080458	NP_001073927	WXS	Illumina HiSeq	Unspecified	Q03828	EVX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)	1	449	-			88						Missense_Mutation	SNP	ENST00000308618.4	37	c.263T>C	CCDS33333.1	.	.	.	.	.	.	.	.	.	.	A	1.002	-0.690595	0.03303	.	.	ENSG00000174279	ENST00000308618	D	0.90676	-2.71	5.84	5.84	0.93424	.	0.368291	0.28560	N	0.014906	T	0.78836	0.4346	N	0.14661	0.345	0.28587	N	0.909821	B	0.02656	0.0	B	0.04013	0.001	T	0.64011	-0.6507	10	0.08179	T	0.78	-34.4427	8.0166	0.30385	0.725:0.1405:0.0:0.1345	.	88	Q03828	EVX2_HUMAN	A	88	ENSP00000312385:V88A	ENSP00000312385:V88A	V	-	2	0	EVX2	176656488	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.677000	0.61634	2.234000	0.73211	0.459000	0.35465	GTC		0.627	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1			19	59	0	0	0	0.001882	0	19	59				
HOXD3	3232	broad.mit.edu	37	2	177036264	177036264	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:177036264G>C	ENST00000468418.3	+	4	2651	c.561G>C	c.(559-561)aaG>aaC	p.K187N	HOXD3_ENST00000249440.3_Missense_Mutation_p.K187N|HOXD-AS1_ENST00000416928.2_RNA|HOXD3_ENST00000410016.1_Missense_Mutation_p.K187N			P31249	HXD3_HUMAN	homeobox D3	187					anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		GCGAGGACAAGAGCCCGCCAG	0.637																																							uc002ukt.1		NA																	0					0						c.(559-561)AAG>AAC		homeobox D3							27.0	30.0	29.0					2																	177036264		2203	4300	6503	SO:0001583	missense	3232				anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:177036264G>C		CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517	ENST00000468418.3:c.561G>C	2.37:g.177036264G>C	ENSP00000424734:p.Lys187Asn		Somatic					p.K187N	NM_006898	NP_008829	WXS	Illumina HiSeq	Unspecified	P31249	HXD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)	3	737	+			187					Q99955|Q9BSC5	Missense_Mutation	SNP	ENST00000468418.3	37	c.561G>C	CCDS2270.1	.	.	.	.	.	.	.	.	.	.	g	14.91	2.675213	0.47781	.	.	ENSG00000128652	ENST00000468418;ENST00000410016;ENST00000249440	D;D;D	0.95554	-3.74;-3.74;-3.74	5.33	4.44	0.53790	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96898	0.8987	M	0.80508	2.5	0.50632	D	0.999889	D	0.71674	0.998	D	0.73708	0.981	D	0.95434	0.8519	10	0.24483	T	0.36	.	9.8587	0.41101	0.1588:0.0:0.8412:0.0	.	187	P31249	HXD3_HUMAN	N	187	ENSP00000424734:K187N;ENSP00000386498:K187N;ENSP00000249440:K187N	ENSP00000249440:K187N	K	+	3	2	HOXD3	176744510	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.013000	0.40942	1.236000	0.43740	0.550000	0.68814	AAG		0.637	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334246.4			17	27	0	0	0	0.00499	0	17	27				
TTN	7273	broad.mit.edu	37	2	179397734	179397734	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:179397734G>A	ENST00000591111.1	-	308	98909	c.98685C>T	c.(98683-98685)ctC>ctT	p.L32895L	TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342175.6_Silent_p.L25663L|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.L25596L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000460472.2_Silent_p.L25471L|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN_ENST00000342992.6_Silent_p.L31968L|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Silent_p.L34536L|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588716.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32895					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGGCATCCGGAGTTTTCTCT	0.453																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(95902-95904)CTC>CTT		titin isoform N2-A							171.0	177.0	175.0					2																	179397734		1971	4157	6128	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179397734G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98685C>T	2.37:g.179397734G>A			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L25663L|TTN_uc010zfi.1_Silent_p.L25596L|TTN_uc010zfj.1_Silent_p.L25471L	p.L31968L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	96128	-			32895					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.95904C>T																																																																																					0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		5	159	0	0	0	0.001984	0	5	159				
TTN	7273	broad.mit.edu	37	2	179430662	179430662	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:179430662C>A	ENST00000591111.1	-	276	75498	c.75274G>T	c.(75274-75276)Gtg>Ttg	p.V25092L	TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V17860L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V17793L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V17668L|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V24165L|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V26733L			Q8WZ42	TITIN_HUMAN	titin	25092	Fibronectin type-III 82. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACTACTCACATTAGCATAC	0.418																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(72493-72495)GTG>TTG		titin isoform N2-A							168.0	154.0	158.0					2																	179430662		1925	4133	6058	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179430662C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75274G>T	2.37:g.179430662C>A	ENSP00000465570:p.Val25092Leu		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V17860L|TTN_uc010zfi.1_Missense_Mutation_p.V17793L|TTN_uc010zfj.1_Missense_Mutation_p.V17668L	p.V24165L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	72717	-			25092					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.72493G>T		.	.	.	.	.	.	.	.	.	.	C	11.97	1.796764	0.31777	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.72	5.72	0.89469	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51517	0.1679	L	0.60455	1.87	0.53688	D	0.999971	P;P;P;P	0.38788	0.532;0.532;0.532;0.647	B;B;B;B	0.32533	0.096;0.096;0.096;0.147	T	0.58584	-0.7611	9	0.87932	D	0	.	19.8509	0.96740	0.0:1.0:0.0:0.0	.	17668;17793;17860;25092	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	24165;17668;17860;17793;17666	ENSP00000343764:V24165L;ENSP00000434586:V17668L;ENSP00000340554:V17860L;ENSP00000352154:V17793L	ENSP00000340554:V17860L	V	-	1	0	TTN	179138908	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.743000	0.62110	2.700000	0.92200	0.555000	0.69702	GTG		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		25	65	1	0	2.44723e-14	0.004656	2.87466e-14	25	65				
TTN	7273	broad.mit.edu	37	2	179436378	179436378	+	Silent	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:179436378A>T	ENST00000591111.1	-	276	69782	c.69558T>A	c.(69556-69558)acT>acA	p.T23186T	TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Silent_p.T15954T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.T15887T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Silent_p.T15762T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Silent_p.T22259T|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Silent_p.T24827T			Q8WZ42	TITIN_HUMAN	titin	23186	Fibronectin type-III 68. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCAGGAAAGAGTAATACTAT	0.433																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(66775-66777)ACT>ACA		titin isoform N2-A							77.0	70.0	72.0					2																	179436378		1850	4099	5949	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179436378A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.69558T>A	2.37:g.179436378A>T			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.T15954T|TTN_uc010zfi.1_Silent_p.T15887T|TTN_uc010zfj.1_Silent_p.T15762T	p.T22259T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	67001	-			23186					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.66777T>A																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		20	29	0	0	0	0.008871	0	20	29				
TTN	7273	broad.mit.edu	37	2	179642232	179642232	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:179642232G>T	ENST00000591111.1	-	26	4784	c.4560C>A	c.(4558-4560)gcC>gcA	p.A1520A	TTN_ENST00000342175.6_Silent_p.A1474A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.A1474A|TTN_ENST00000360870.5_Silent_p.A1520A|TTN_ENST00000460472.2_Silent_p.A1474A|TTN_ENST00000342992.6_Silent_p.A1520A|TTN_ENST00000589042.1_Silent_p.A1520A|TTN-AS1_ENST00000584485.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA			Q8WZ42	TITIN_HUMAN	titin	12384	Ig-like 6.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTGGGTGTGGCAGGGACAA	0.388																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(4558-4560)GCC>GCA		titin isoform N2-A							48.0	49.0	49.0					2																	179642232		2203	4300	6503	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179642232G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4560C>A	2.37:g.179642232G>T			Somatic				TTN_uc010zfh.1_Silent_p.A1474A|TTN_uc010zfi.1_Silent_p.A1474A|TTN_uc010zfj.1_Silent_p.A1474A|TTN_uc002unb.2_Silent_p.A1520A|uc002unc.1_RNA	p.A1520A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		26	4784	-			1520					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.4560C>A																																																																																					0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		14	44	1	0	3.27435e-08	0.00245	3.60547e-08	14	44				
SDPR	8436	broad.mit.edu	37	2	192701335	192701335	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:192701335G>A	ENST00000304141.4	-	2	921	c.592C>T	c.(592-594)Cac>Tac	p.H198Y		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			TCCACGGTGTGCAGGGTTTCC	0.547																																							uc002utb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(592-594)CAC>TAC		serum deprivation response protein	Phosphatidylserine(DB00144)						76.0	82.0	80.0					2																	192701335		2203	4300	6503	SO:0001583	missense	8436					caveola|cytosol	phosphatidylserine binding|protein binding	g.chr2:192701335G>A	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.592C>T	2.37:g.192701335G>A	ENSP00000305675:p.His198Tyr		Somatic					p.H198Y	NM_004657	NP_004648	WXS	Illumina HiSeq	Unspecified	O95810	SDPR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0647)		2	922	-			198						Missense_Mutation	SNP	ENST00000304141.4	37	c.592C>T	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877736	0.91664	.	.	ENSG00000168497	ENST00000304141	T	0.59224	0.28	5.16	5.16	0.70880	.	0.240595	0.43579	D	0.000557	T	0.67739	0.2925	M	0.61703	1.905	0.53688	D	0.999977	D	0.62365	0.991	P	0.56088	0.791	T	0.61845	-0.6979	10	0.18276	T	0.48	-26.146	18.8456	0.92205	0.0:0.0:1.0:0.0	.	198	O95810	SDPR_HUMAN	Y	198	ENSP00000305675:H198Y	ENSP00000305675:H198Y	H	-	1	0	SDPR	192409580	1.000000	0.71417	0.999000	0.59377	0.925000	0.55904	9.263000	0.95617	2.698000	0.92095	0.563000	0.77884	CAC		0.547	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657		13	38	0	0	0	0.006122	0	13	38				
AOX1	316	broad.mit.edu	37	2	201477456	201477456	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:201477456A>G	ENST00000374700.2	+	14	1629	c.1388A>G	c.(1387-1389)tAt>tGt	p.Y463C	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	463					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.Y463C(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGCATCTCATATGGAGGCGTT	0.468																																							uc002uvx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(1387-1389)TAT>TGT		aldehyde oxidase 1	Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)						97.0	91.0	93.0					2																	201477456		2203	4300	6503	SO:0001583	missense	316				inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity	g.chr2:201477456A>G	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1388A>G	2.37:g.201477456A>G	ENSP00000363832:p.Tyr463Cys		Somatic				AOX1_uc010zhf.1_Missense_Mutation_p.Y19C|AOX1_uc010fsu.2_Translation_Start_Site	p.Y463C	NM_001159	NP_001150	WXS	Illumina HiSeq	Unspecified	Q06278	ADO_HUMAN			14	1489	+			463					O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	c.1388A>G	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.105970	0.56291	.	.	ENSG00000138356	ENST00000374700	T	0.26373	1.74	5.94	5.94	0.96194	CO dehydrogenase flavoprotein, C-terminal (3);	0.059173	0.64402	D	0.000001	T	0.64594	0.2612	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.76364	-0.2986	10	0.87932	D	0	-37.7963	16.3947	0.83586	1.0:0.0:0.0:0.0	.	463	Q06278	ADO_HUMAN	C	463	ENSP00000363832:Y463C	ENSP00000363832:Y463C	Y	+	2	0	AOX1	201185701	1.000000	0.71417	0.954000	0.39281	0.311000	0.27955	5.460000	0.66691	2.272000	0.75746	0.459000	0.35465	TAT		0.468	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159		19	49	0	0	0	0.001882	0	19	49				
NBEAL1	65065	broad.mit.edu	37	2	204078335	204078335	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:204078335G>A	ENST00000449802.1	+	54	8275	c.7942G>A	c.(7942-7944)Gat>Aat	p.D2648N		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2648										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGGTTTAGAAGATGGCAAATT	0.423																																							uc002uzt.3		NA																	0				ovary(1)|skin(1)	2						c.(7942-7944)GAT>AAT		neurobeachin-like 1 isoform 3							152.0	139.0	143.0					2																	204078335		1894	4116	6010	SO:0001583	missense	65065						binding	g.chr2:204078335G>A	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.7942G>A	2.37:g.204078335G>A	ENSP00000399903:p.Asp2648Asn		Somatic				NBEAL1_uc002uzs.3_Missense_Mutation_p.D1289N|NBEAL1_uc002uzu.2_Missense_Mutation_p.D143N	p.D2648N	NM_001114132	NP_001107604	WXS	Illumina HiSeq	Unspecified	Q6ZS30	NBEL1_HUMAN			54	8275	+			2648					A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	c.7942G>A	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	35	5.510802	0.96386	.	.	ENSG00000144426	ENST00000449802;ENST00000340268;ENST00000414576	T;T	0.50813	4.47;0.73	5.61	5.61	0.85477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72423	0.3458	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	T	0.74526	-0.3636	10	0.59425	D	0.04	.	19.6278	0.95687	0.0:0.0:1.0:0.0	.	1358;2648;2637	D1MPS9;Q6ZS30;C9JGK5	.;NBEL1_HUMAN;.	N	2648;2558;663	ENSP00000399903:D2648N;ENSP00000388466:D663N	ENSP00000344985:D2558N	D	+	1	0	NBEAL1	203786580	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.458000	0.97634	2.629000	0.89072	0.650000	0.86243	GAT		0.423	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4			49	94	0	0	0	0.00361	0	49	94				
DYTN	391475	broad.mit.edu	37	2	207527684	207527684	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:207527684C>G	ENST00000452335.2	-	11	1692	c.1576G>C	c.(1576-1578)Gaa>Caa	p.E526Q		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	526	Poly-Glu.					plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TCTTGCAGTTCCTCTTCCTCC	0.453																																							uc002vbr.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1576-1578)GAA>CAA		dystrotelin							265.0	257.0	260.0					2																	207527684		1972	4151	6123	SO:0001583	missense	391475					plasma membrane	zinc ion binding	g.chr2:207527684C>G	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1576G>C	2.37:g.207527684C>G	ENSP00000396593:p.Glu526Gln		Somatic					p.E526Q	NM_001093730	NP_001087199	WXS	Illumina HiSeq	Unspecified	A2CJ06	DYTN_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)	11	1693	-			526			Potential.|Poly-Glu.			Missense_Mutation	SNP	ENST00000452335.2	37	c.1576G>C	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987558	0.53934	.	.	ENSG00000232125	ENST00000452335	T	0.25250	1.81	4.89	4.01	0.46588	.	.	.	.	.	T	0.22126	0.0533	L	0.27053	0.805	0.23506	N	0.997531	D	0.60160	0.987	P	0.47981	0.563	T	0.05131	-1.0904	9	0.33940	T	0.23	-3.4441	9.2912	0.37789	0.0:0.9027:0.0:0.0973	.	526	A2CJ06	DYTN_HUMAN	Q	526	ENSP00000396593:E526Q	ENSP00000396593:E526Q	E	-	1	0	DYTN	207235929	0.631000	0.27164	0.984000	0.44739	0.735000	0.41995	1.283000	0.33237	1.439000	0.47511	0.655000	0.94253	GAA		0.453	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1			38	106	0	0	0	0.002852	0	38	106				
FN1	2335	broad.mit.edu	37	2	216286823	216286823	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:216286823G>A	ENST00000359671.1	-	10	1802	c.1537C>T	c.(1537-1539)Cag>Tag	p.Q513*	FN1_ENST00000426059.1_Nonsense_Mutation_p.Q513*|FN1_ENST00000336916.4_Nonsense_Mutation_p.Q513*|FN1_ENST00000446046.1_Nonsense_Mutation_p.Q513*|FN1_ENST00000356005.4_Nonsense_Mutation_p.Q513*|FN1_ENST00000357009.2_Nonsense_Mutation_p.Q513*|FN1_ENST00000323926.6_Nonsense_Mutation_p.Q513*|FN1_ENST00000354785.4_Nonsense_Mutation_p.Q513*|FN1_ENST00000346544.3_Nonsense_Mutation_p.Q513*|FN1_ENST00000421182.1_Nonsense_Mutation_p.Q513*|FN1_ENST00000443816.1_Nonsense_Mutation_p.Q513*|FN1_ENST00000345488.5_Nonsense_Mutation_p.Q513*|FN1_ENST00000432072.2_Nonsense_Mutation_p.Q513*|FN1_ENST00000357867.4_Nonsense_Mutation_p.Q513*			P02751	FINC_HUMAN	fibronectin 1	513	Collagen-binding.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCTCGAAGCTGCGAGTAGGCA	0.448																																							uc002vfa.2		NA																	0				central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13						c.(1537-1539)CAG>TAG		fibronectin 1 isoform 1 preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						212.0	173.0	186.0					2																	216286823		2203	4300	6503	SO:0001587	stop_gained	2335				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding	g.chr2:216286823G>A		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1537C>T	2.37:g.216286823G>A	ENSP00000352696:p.Gln513*		Somatic				FN1_uc002vfb.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfc.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfd.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfe.2_Nonsense_Mutation_p.Q513*|FN1_uc002vff.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfg.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfh.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfi.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfj.2_Nonsense_Mutation_p.Q513*|FN1_uc002vfl.2_Nonsense_Mutation_p.Q513*	p.Q513*	NM_212482	NP_997647	WXS	Illumina HiSeq	Unspecified	P02751	FINC_HUMAN		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	10	1803	-		Renal(323;0.127)	513			Collagen-binding.		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Nonsense_Mutation	SNP	ENST00000359671.1	37	c.1537C>T		.	.	.	.	.	.	.	.	.	.	G	41	8.706234	0.98922	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	.	.	.	5.43	4.55	0.56014	.	0.090549	0.47852	D	0.000206	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	15.4935	0.75632	0.0:0.0:0.8604:0.1396	.	.	.	.	X	513	.	ENSP00000265313:Q513X	Q	-	1	0	FN1	215995068	1.000000	0.71417	0.999000	0.59377	0.747000	0.42532	6.620000	0.74224	1.267000	0.44247	0.650000	0.86243	CAG		0.448	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476		50	111	0	0	0	0.00361	0	50	111				
VIL1	7429	broad.mit.edu	37	2	219299291	219299291	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:219299291A>G	ENST00000248444.5	+	14	1631	c.1543A>G	c.(1543-1545)Aca>Gca	p.T515A	VIL1_ENST00000392114.2_Missense_Mutation_p.T204A	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	515	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGGGCCCTCCACACGGCTGTT	0.557																																							uc002via.2		NA																	0				ovary(1)	1						c.(1543-1545)ACA>GCA		villin 1							80.0	80.0	80.0					2																	219299291		2203	4300	6503	SO:0001583	missense	7429				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity	g.chr2:219299291A>G	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1543A>G	2.37:g.219299291A>G	ENSP00000248444:p.Thr515Ala		Somatic				VIL1_uc010zke.1_Missense_Mutation_p.T204A|VIL1_uc002vib.2_Missense_Mutation_p.T515A	p.T515A	NM_007127	NP_009058	WXS	Illumina HiSeq	Unspecified	P09327	VILI_HUMAN		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	14	1608	+		Renal(207;0.0474)	515			Core.		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	c.1543A>G	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	A	10.97	1.500339	0.26861	.	.	ENSG00000127831	ENST00000248444;ENST00000392114;ENST00000419986	T;T;T	0.22945	1.93;1.93;1.93	4.32	4.32	0.51571	.	0.169330	0.42548	D	0.000683	T	0.27205	0.0667	M	0.64080	1.96	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05716	-1.0868	10	0.30854	T	0.27	-9.3733	13.6306	0.62193	1.0:0.0:0.0:0.0	.	515	P09327	VILI_HUMAN	A	515;204;84	ENSP00000248444:T515A;ENSP00000375962:T204A;ENSP00000394030:T84A	ENSP00000248444:T515A	T	+	1	0	VIL1	219007535	1.000000	0.71417	0.842000	0.33263	0.626000	0.37791	3.945000	0.56637	1.810000	0.52873	0.459000	0.35465	ACA		0.557	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127		28	75	0	0	0	0.002836	0	28	75				
USP37	57695	broad.mit.edu	37	2	219418306	219418306	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:219418306C>G	ENST00000258399.3	-	5	710	c.298G>C	c.(298-300)Gat>Cat	p.D100H	USP37_ENST00000454775.1_Missense_Mutation_p.D100H|USP37_ENST00000338465.5_Missense_Mutation_p.D100H|USP37_ENST00000415516.1_Missense_Mutation_p.D28H|USP37_ENST00000418019.1_Missense_Mutation_p.D100H	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	100					G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TGGACTGCATCTAGAAACAAC	0.413																																							uc002vie.2		NA																	0				skin(3)|ovary(1)|prostate(1)	5						c.(298-300)GAT>CAT		ubiquitin specific peptidase 37							159.0	133.0	141.0					2																	219418306		2203	4300	6503	SO:0001583	missense	57695				ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr2:219418306C>G	AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.298G>C	2.37:g.219418306C>G	ENSP00000258399:p.Asp100His		Somatic				USP37_uc010fvs.1_Missense_Mutation_p.D100H|USP37_uc010zkf.1_Missense_Mutation_p.D100H|USP37_uc002vif.2_Missense_Mutation_p.D100H|USP37_uc002vig.2_Missense_Mutation_p.D28H|USP37_uc010zkg.1_Missense_Mutation_p.D100H	p.D100H	NM_020935	NP_065986	WXS	Illumina HiSeq	Unspecified	Q86T82	UBP37_HUMAN		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)	5	751	-		Renal(207;0.0915)	100			D-box 2.		A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	ENST00000258399.3	37	c.298G>C	CCDS2418.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043977	0.75732	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019;ENST00000338465	T;T;T;T;T	0.59502	0.26;0.26;0.52;0.26;0.35	5.19	5.19	0.71726	.	0.112113	0.64402	D	0.000011	T	0.74465	0.3720	M	0.71036	2.16	0.50467	D	0.999876	D;D;P	0.89917	1.0;0.98;0.952	D;P;B	0.67725	0.953;0.847;0.407	T	0.77824	-0.2444	10	0.87932	D	0	-17.2908	16.8923	0.86090	0.0:1.0:0.0:0.0	.	100;28;100	Q86W68;Q86T82-2;Q86T82	.;.;UBP37_HUMAN	H	100;100;28;100;100	ENSP00000258399:D100H;ENSP00000393662:D100H;ENSP00000400902:D28H;ENSP00000396585:D100H;ENSP00000345043:D100H	ENSP00000258399:D100H	D	-	1	0	USP37	219126550	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.932000	0.63476	2.433000	0.82419	0.561000	0.74099	GAT		0.413	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935		16	37	0	0	0	0.008871	0	16	37				
CCDC108	255101	broad.mit.edu	37	2	219870856	219870856	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:219870856G>A	ENST00000341552.5	-	31	4892	c.4809C>T	c.(4807-4809)tgC>tgT	p.C1603C	AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000453220.1_Silent_p.C1603C|CCDC108_ENST00000441968.1_Silent_p.C1603C	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1603						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.C1603W(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGGCTGGGGGCAGGGCCAGG	0.617																																							uc002vjl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(4807-4809)TGC>TGT		coiled-coil domain containing 108 isoform 1							52.0	60.0	57.0					2																	219870856		2203	4300	6503	SO:0001819	synonymous_variant	255101					integral to membrane	structural molecule activity	g.chr2:219870856G>A	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4809C>T	2.37:g.219870856G>A			Somatic					p.C1603C	NM_194302	NP_919278	WXS	Illumina HiSeq	Unspecified	Q6ZU64	CC108_HUMAN		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	31	4893	-		Renal(207;0.0915)	1603					A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	c.4809C>T	CCDS2430.2																																																																																				0.617	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302		27	88	0	0	0	0.002445	0	27	88				
NYAP2	57624	broad.mit.edu	37	2	226446730	226446730	+	Silent	SNP	G	G	C	rs529456486		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:226446730G>C	ENST00000272907.6	+	4	1010	c.597G>C	c.(595-597)ccG>ccC	p.P199P	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	199					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												AGCGAAATCCGAACACTCAGC	0.507																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(595-597)CCG>CCC		hypothetical protein LOC57624							123.0	127.0	125.0					2																	226446730		1934	4141	6075	SO:0001819	synonymous_variant	57624							g.chr2:226446730G>C	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.597G>C	2.37:g.226446730G>C			Somatic				KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_5'UTR	p.P199P	NM_020864	NP_065915	WXS	Illumina HiSeq	Unspecified	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	772	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	199					A2RRN4|Q96NL2	Silent	SNP	ENST00000272907.6	37	c.597G>C	CCDS46529.1																																																																																				0.507	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		55	105	0	0	0	0.00361	0	55	105				
CHRND	1144	broad.mit.edu	37	2	233399876	233399876	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:233399876G>A	ENST00000258385.3	+	12	1440	c.1408G>A	c.(1408-1410)Gac>Aac	p.D470N	CHRND_ENST00000457943.2_Missense_Mutation_p.D276N|CHRND_ENST00000543200.1_Missense_Mutation_p.D455N	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	470					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	CCGCACAGTGGACCGCCTCTG	0.627																																							uc002vsw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1408-1410)GAC>AAC		nicotinic acetylcholine receptor delta							99.0	101.0	100.0					2																	233399876		2203	4300	6503	SO:0001583	missense	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233399876G>A	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1408G>A	2.37:g.233399876G>A	ENSP00000258385:p.Asp470Asn		Somatic				CHRND_uc010zmg.1_Missense_Mutation_p.D455N|CHRND_uc010fyc.2_Missense_Mutation_p.D343N|CHRND_uc010zmh.1_Missense_Mutation_p.D276N	p.D470N	NM_000751	NP_000742	WXS	Illumina HiSeq	Unspecified	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	12	1412	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	470			Cytoplasmic (Potential).		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	c.1408G>A	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	G	31	5.097703	0.94197	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	D;D;D	0.98419	-4.92;-4.92;-4.92	5.13	5.13	0.70059	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.045766	0.85682	D	0.000000	D	0.99426	0.9797	H	0.98111	4.15	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.98239	1.0487	10	0.87932	D	0	.	18.5973	0.91234	0.0:0.0:1.0:0.0	.	276;455;470;470	B4E3W4;B4DT92;A8K661;Q07001	.;.;.;ACHD_HUMAN	N	455;470;276	ENSP00000438380:D455N;ENSP00000258385:D470N;ENSP00000391055:D276N	ENSP00000258385:D470N	D	+	1	0	CHRND	233108120	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.806000	0.86020	2.389000	0.81357	0.655000	0.94253	GAC		0.627	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			38	114	0	0	0	0.00874	0	38	114				
EIF4E2	9470	broad.mit.edu	37	2	233421133	233421133	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:233421133G>A	ENST00000258416.3	+	2	701	c.28G>A	c.(28-30)Gat>Aat	p.D10N	EIF4E2_ENST00000409098.1_Missense_Mutation_p.D10N|EIF4E2_ENST00000409394.1_Missense_Mutation_p.D10N|EIF4E2_ENST00000409514.1_Missense_Mutation_p.D10N|EIF4E2_ENST00000479834.1_3'UTR|EIF4E2_ENST00000409322.1_Missense_Mutation_p.D10N|EIF4E2_ENST00000409495.1_Missense_Mutation_p.D10N|EIF4E2_ENST00000409167.3_Missense_Mutation_p.D10N	NM_004846.2	NP_004837.1	O60573	IF4E2_HUMAN	eukaryotic translation initiation factor 4E family member 2	10				MNNKFDALKDDDSGDHDQNEENSTQKD -> MMTVGTMIRM KKTAHRKI (in Ref. 3; AAC39871). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|in utero embryonic development (GO:0001701)|negative regulation of translation (GO:0017148)	cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2.3e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000912)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CAGTTTGAAAGATGATGACAG	0.413																																							uc002vta.2		NA																	0					0						c.(28-30)GAT>AAT		eukaryotic translation initiation factor 4E							151.0	128.0	136.0					2																	233421133		2203	4300	6503	SO:0001583	missense	9470				regulation of translation	cytoplasm|mRNA cap binding complex	RNA cap binding|translation initiation factor activity|ubiquitin protein ligase binding	g.chr2:233421133G>A	AF038957	CCDS2496.1, CCDS63158.1, CCDS63159.1, CCDS74671.1	2q37.1	2008-02-05	2006-11-13	2004-10-30	ENSG00000135930	ENSG00000135930			3293	protein-coding gene	gene with protein product		605895	"""eukaryotic translation initiation factor 4E-like 3"""	EIF4EL3		9653160, 9582349	Standard	XM_005246975		Approved	IF4e, 4EHP	uc002vta.3	O60573	OTTHUMG00000133256	ENST00000258416.3:c.28G>A	2.37:g.233421133G>A	ENSP00000258416:p.Asp10Asn		Somatic				EIF4E2_uc002vtb.1_Missense_Mutation_p.D10N|EIF4E2_uc002vsz.2_Missense_Mutation_p.D10N|EIF4E2_uc010zmi.1_Missense_Mutation_p.D10N	p.D10N	NM_004846	NP_004837	WXS	Illumina HiSeq	Unspecified	O60573	IF4E2_HUMAN		Epithelial(121;2.3e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000912)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	2	106	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	10	MNNKFDALKDDDSGDHDQNEENSTQKD -> MMTVGTMIRM KKTAHRKI (in Ref. 3; AAC39871).				B8ZZJ9|O75349	Missense_Mutation	SNP	ENST00000258416.3	37	c.28G>A	CCDS2496.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917483	0.73098	.	.	ENSG00000135930	ENST00000258416;ENST00000409514;ENST00000409098;ENST00000409495;ENST00000409167;ENST00000409322;ENST00000409394;ENST00000454501	T;T;T;T;T;T;T;T	0.51071	1.18;1.18;1.18;1.18;0.72;0.72;0.73;1.18	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.45276	0.1334	L	0.52364	1.645	0.58432	D	0.999991	B;B;B;B	0.22414	0.005;0.008;0.069;0.014	B;B;B;B	0.16722	0.002;0.006;0.016;0.004	T	0.24261	-1.0165	10	0.35671	T	0.21	-24.5429	17.5056	0.87745	0.0:0.0:1.0:0.0	.	10;10;10;10	B4E1E4;B8ZZJ9;O60573;B8ZZ50	.;.;IF4E2_HUMAN;.	N	10;10;10;10;10;10;10;5	ENSP00000258416:D10N;ENSP00000387336:D10N;ENSP00000386996:D10N;ENSP00000386876:D10N;ENSP00000387328:D10N;ENSP00000386424:D10N;ENSP00000386983:D10N;ENSP00000390904:D5N	ENSP00000258416:D10N	D	+	1	0	EIF4E2	233129377	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.203000	0.95033	2.742000	0.94016	0.650000	0.86243	GAT		0.413	EIF4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257033.2	NM_004846		6	22	0	0	0	0.001984	0	6	22				
DTYMK	1841	broad.mit.edu	37	2	242626193	242626193	+	Silent	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr2:242626193C>A	ENST00000305784.2	-	1	213	c.6G>T	c.(4-6)gcG>gcT	p.A2A	DTYMK_ENST00000493095.1_5'Flank	NM_001165031.1|NM_012145.3	NP_001158503.1|NP_036277.2	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)	2					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|cellular response to growth factor stimulus (GO:0071363)|dTDP biosynthetic process (GO:0006233)|dTTP biosynthetic process (GO:0006235)|myoblast differentiation (GO:0045445)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside monophosphate phosphorylation (GO:0046940)|nucleotide phosphorylation (GO:0046939)|response to cadmium ion (GO:0046686)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|nucleoside phosphate kinase activity (GO:0050145)|thymidylate kinase activity (GO:0004798)			NS(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CGCGCCGGGCCGCCATGACTG	0.706																																							uc002wbz.1		NA																	0					0						c.(4-6)GCG>GCT		deoxythymidylate kinase (thymidylate kinase)							5.0	6.0	6.0					2																	242626193		1407	3125	4532	SO:0001819	synonymous_variant	1841				cell cycle|cell proliferation|nucleobase, nucleoside and nucleotide interconversion	cytosol	ATP binding|nucleoside phosphate kinase activity|thymidylate kinase activity	g.chr2:242626193C>A	X54729	CCDS2552.1	2q37	2008-02-05			ENSG00000168393	ENSG00000168393	2.7.4.9		3061	protein-coding gene	gene with protein product	"""dTMP kinase"", ""thymidylate (dTMP) kinase"""	188345				2017365, 8024690	Standard	NM_001165031		Approved	CDC8, TYMK, TMPK	uc002wbz.2	P23919	OTTHUMG00000133409	ENST00000305784.2:c.6G>T	2.37:g.242626193C>A			Somatic				DTYMK_uc010zpa.1_Silent_p.A2A|DTYMK_uc010zpb.1_RNA|DTYMK_uc002wca.1_RNA	p.A2A	NM_012145	NP_036277	WXS	Illumina HiSeq	Unspecified	P23919	KTHY_HUMAN		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)	1	35	-		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	2					B7ZW70|Q6FGX1|Q9BUX4	Silent	SNP	ENST00000305784.2	37	c.6G>T	CCDS2552.1																																																																																				0.706	DTYMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257266.2	NM_012145		4	9	1	0	0.00024832	0.009096	0.000259281	4	9				
SIRPB2	284759	broad.mit.edu	37	20	1456860	1456860	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:1456860G>A	ENST00000359801.3	-	5	1017	c.981C>T	c.(979-981)ggC>ggT	p.G327G	SIRPB2_ENST00000608747.1_5'Flank|SIRPB2_ENST00000444444.2_Silent_p.G229G	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	361	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CTCCTGCTGGGCCTGTGGTCT	0.607																																							uc002wfg.2		NA																	0					0						c.(979-981)GGC>GGT		signal-regulatory protein beta 2 isoform 1							137.0	119.0	124.0					20																	1456860		1568	3582	5150	SO:0001819	synonymous_variant	284759					integral to membrane		g.chr20:1456860G>A	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.981C>T	20.37:g.1456860G>A			Somatic				SIRPB2_uc002wfh.3_Silent_p.G229G	p.G327G	NM_001122962	NP_001116434	WXS	Illumina HiSeq	Unspecified	Q5JXA9	SIRB2_HUMAN			5	1209	-			327			Cytoplasmic (Potential).		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000359801.3	37	c.981C>T	CCDS42849.1																																																																																				0.607	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077544.1	NM_178459		37	100	0	0	0	0.003214	0	37	100				
SIRPG	55423	broad.mit.edu	37	20	1616208	1616208	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:1616208C>A	ENST00000303415.3	-	4	850	c.786G>T	c.(784-786)agG>agT	p.R262S	SIRPG_ENST00000344103.4_Intron|RP11-77C3.3_ENST00000437384.1_RNA|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Missense_Mutation_p.R229S|SIRPG_ENST00000216927.4_Intron|SIRPG_ENST00000381583.2_Intron	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	262	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GGTTCCCCACCCTCATGGGCT	0.552																																							uc002wfm.1		NA																	0				ovary(1)	1						c.(784-786)AGG>AGT		signal-regulatory protein gamma isoform 1							86.0	78.0	80.0					20																	1616208		2203	4300	6503	SO:0001583	missense	55423				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding	g.chr20:1616208C>A	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.786G>T	20.37:g.1616208C>A	ENSP00000305529:p.Arg262Ser		Somatic				SIRPG_uc002wfn.1_Intron|SIRPG_uc002wfo.1_Intron|uc002wfp.1_Intron	p.R262S	NM_018556	NP_061026	WXS	Illumina HiSeq	Unspecified	Q9P1W8	SIRPG_HUMAN			4	851	-			262			Extracellular (Potential).|Ig-like C1-type 2.		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	37	c.786G>T	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	0.013	-1.618957	0.00828	.	.	ENSG00000089012	ENST00000381580;ENST00000303415	T;T	0.02709	4.19;4.19	0.662	0.662	0.17880	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	1.741500	0.04374	U	0.359612	T	0.03564	0.0102	L	0.50333	1.59	0.09310	N	1	B	0.15473	0.013	B	0.17098	0.017	T	0.51004	-0.8760	9	0.08837	T	0.75	.	.	.	.	.	262	Q9P1W8	SIRPG_HUMAN	S	229;262	ENSP00000370992:R229S;ENSP00000305529:R262S	ENSP00000305529:R262S	R	-	3	2	SIRPG	1564208	0.000000	0.05858	0.001000	0.08648	0.209000	0.24338	-0.621000	0.05559	0.627000	0.30340	0.195000	0.17529	AGG		0.552	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556		25	42	1	0	2.36697e-06	0.007291	2.5292e-06	25	42				
HAO1	54363	broad.mit.edu	37	20	7866418	7866418	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:7866418C>A	ENST00000378789.3	-	6	958	c.907G>T	c.(907-909)Gct>Tct	p.A303S		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	303	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AGAGCCAGAGCTTTCAGAACA	0.498																																							uc002wmw.1		NA																	0				ovary(3)	3						c.(907-909)GCT>TCT		hydroxyacid oxidase 1							132.0	132.0	132.0					20																	7866418		2203	4300	6503	SO:0001583	missense	54363				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity	g.chr20:7866418C>A	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.907G>T	20.37:g.7866418C>A	ENSP00000368066:p.Ala303Ser		Somatic				HAO1_uc010gbu.2_Missense_Mutation_p.A303S	p.A303S	NM_017545	NP_060015	WXS	Illumina HiSeq	Unspecified	Q9UJM8	HAOX1_HUMAN			6	931	-			303			FMN hydroxy acid dehydrogenase.|FMN (By similarity).		Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	c.907G>T	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	C	34	5.347439	0.95807	.	.	ENSG00000101323	ENST00000378789	T	0.49432	0.78	5.94	5.94	0.96194	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.78310	0.4263	M	0.92784	3.345	0.80722	D	1	P;P	0.51933	0.949;0.949	D;D	0.76071	0.987;0.987	T	0.81797	-0.0768	10	0.72032	D	0.01	-19.2101	20.3523	0.98815	0.0:1.0:0.0:0.0	.	303;303	A8K058;Q9UJM8	.;HAOX1_HUMAN	S	303	ENSP00000368066:A303S	ENSP00000368066:A303S	A	-	1	0	HAO1	7814418	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.456000	0.80751	2.821000	0.97095	0.484000	0.47621	GCT		0.498	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2			48	102	1	0	7.50695e-29	0.00361	9.66186e-29	48	102				
JAG1	182	broad.mit.edu	37	20	10639247	10639247	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:10639247T>C	ENST00000254958.5	-	4	1078	c.563A>G	c.(562-564)gAt>gGt	p.D188G	JAG1_ENST00000423891.2_Missense_Mutation_p.D29G	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	188	DSL. {ECO:0000255|PROSITE- ProRule:PRU00377}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GTAGTAGTCATCACAGGTCAC	0.532									Alagille Syndrome																														uc002wnw.2		NA																	0				lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(562-564)GAT>GGT		jagged 1 precursor							164.0	141.0	149.0					20																	10639247		2203	4300	6503	SO:0001583	missense	182	Alagille_Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity	g.chr20:10639247T>C	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.563A>G	20.37:g.10639247T>C	ENSP00000254958:p.Asp188Gly		Somatic					p.D188G	NM_000214	NP_000205	WXS	Illumina HiSeq	Unspecified	P78504	JAG1_HUMAN			4	1079	-			188			Extracellular (Potential).|DSL.		A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	c.563A>G	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.140240	0.77775	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.96554	-4.05;-4.05	5.58	5.58	0.84498	Delta/Serrate/lag-2 (DSL) protein (3);	0.155049	0.56097	D	0.000039	D	0.97798	0.9277	M	0.86502	2.82	0.43628	D	0.99601	P	0.47910	0.902	P	0.59221	0.854	D	0.98128	1.0429	10	0.56958	D	0.05	.	12.5065	0.55984	0.0:0.0:0.1487:0.8513	.	188	P78504	JAG1_HUMAN	G	188;29	ENSP00000254958:D188G;ENSP00000389519:D29G	ENSP00000254958:D188G	D	-	2	0	JAG1	10587247	1.000000	0.71417	0.987000	0.45799	0.891000	0.51852	5.165000	0.64959	2.124000	0.65301	0.460000	0.39030	GAT		0.532	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214		33	76	0	0	0	0.004289	0	33	76				
MACROD2	140733	broad.mit.edu	37	20	14665577	14665577	+	Missense_Mutation	SNP	C	C	G	rs372182684		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:14665577C>G	ENST00000310348.4	+	5	390	c.390C>G	c.(388-390)atC>atG	p.I130M	MACROD2_ENST00000217246.4_Missense_Mutation_p.I130M|MACROD2_ENST00000464883.1_3'UTR			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	130	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ATGCAAAAATCACATGTGGCT	0.428																																							uc002wou.2		NA																	0					0						c.(388-390)ATC>ATG		MACRO domain containing 2 isoform 1							139.0	130.0	133.0					20																	14665577		1925	4152	6077	SO:0001583	missense	140733							g.chr20:14665577C>G	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.390C>G	20.37:g.14665577C>G	ENSP00000309809:p.Ile130Met		Somatic				MACROD2_uc002wot.2_Missense_Mutation_p.I130M|MACROD2_uc002wox.2_RNA	p.I130M	NM_080676	NP_542407	WXS	Illumina HiSeq	Unspecified	A1Z1Q3	MACD2_HUMAN			5	654	+		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)	130			Macro.		A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	c.390C>G	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523312	0.64747	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.25579	1.79;1.79	5.62	2.47	0.30058	Appr-1-p processing (3);	0.000000	0.64402	D	0.000007	T	0.43919	0.1269	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;0.97	D;P	0.91635	0.999;0.813	T	0.20672	-1.0268	10	0.51188	T	0.08	-7.5076	5.1435	0.14971	0.2855:0.546:0.0:0.1685	.	130;130	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	M	130	ENSP00000217246:I130M;ENSP00000309809:I130M	ENSP00000217246:I130M	I	+	3	3	MACROD2	14613577	0.987000	0.35691	1.000000	0.80357	0.996000	0.88848	0.298000	0.19120	0.249000	0.21456	0.655000	0.94253	ATC		0.428	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676		44	85	0	0	0	0.00361	0	44	85				
CSRP2BP	57325	broad.mit.edu	37	20	18165313	18165313	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:18165313C>G	ENST00000435364.3	+	9	2393	c.2052C>G	c.(2050-2052)atC>atG	p.I684M	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.I556M|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.I683M	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	684	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						AAAAAGTCATCATTGCCTTTG	0.413																																							uc002wqj.2		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(2050-2052)ATC>ATG		CSRP2 binding protein							223.0	192.0	202.0					20																	18165313		2203	4300	6503	SO:0001583	missense	57325				histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity	g.chr20:18165313C>G	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2052C>G	20.37:g.18165313C>G	ENSP00000392318:p.Ile684Met		Somatic				CSRP2BP_uc002wqk.2_Missense_Mutation_p.I556M|CSRP2BP_uc010zru.1_Missense_Mutation_p.I555M	p.I684M	NM_020536	NP_065397	WXS	Illumina HiSeq	Unspecified	Q9H8E8	CSR2B_HUMAN			10	2674	+			684			N-acetyltransferase.		A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	c.2052C>G	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400546	0.62177	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.99	1.45	0.22620	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.053285	0.85682	D	0.000000	T	0.37128	0.0992	M	0.67700	2.07	0.42852	D	0.994086	D;D	0.56968	0.973;0.978	P;P	0.58454	0.668;0.839	T	0.15549	-1.0433	10	0.87932	D	0	-16.8965	5.8333	0.18593	0.1749:0.4986:0.0:0.3265	.	556;684	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	M	684;683;684;556	ENSP00000278816:I684M;ENSP00000366909:I683M;ENSP00000392318:I684M;ENSP00000425909:I556M	ENSP00000278816:I684M	I	+	3	3	CSRP2BP	18113313	0.989000	0.36119	1.000000	0.80357	0.997000	0.91878	0.260000	0.18424	0.420000	0.25954	0.655000	0.94253	ATC		0.413	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536		28	70	0	0	0	0.00632	0	28	70				
BPIFB3	359710	broad.mit.edu	37	20	31647283	31647283	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:31647283C>T	ENST00000375494.3	+	3	381	c.381C>T	c.(379-381)tgC>tgT	p.C127C	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	127	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										GCATGCATTGCTCTGGGTGAG	0.602																																							uc002wym.1		NA																	0				ovary(4)	4						c.(379-381)TGC>TGT		antimicrobial peptide RYA3 precursor							64.0	57.0	59.0					20																	31647283		2203	4300	6503	SO:0001819	synonymous_variant	359710				innate immune response	cytoplasm|extracellular region	lipid binding|protein binding	g.chr20:31647283C>T	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.381C>T	20.37:g.31647283C>T			Somatic					p.C127C	NM_182658	NP_872599	WXS	Illumina HiSeq	Unspecified	P59826	LPLC3_HUMAN			3	381	+			127			Leu-rich.		Q5TDX7	Silent	SNP	ENST00000375494.3	37	c.381C>T	CCDS13212.1																																																																																				0.602	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658		7	22	0	0	0	0.001984	0	7	22				
BPIFB3	359710	broad.mit.edu	37	20	31647285	31647285	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:31647285C>G	ENST00000375494.3	+	3	383	c.383C>G	c.(382-384)tCt>tGt	p.S128C	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	128	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										ATGCATTGCTCTGGGTGAGTG	0.602																																							uc002wym.1		NA																	0				ovary(4)	4						c.(382-384)TCC>TGC		antimicrobial peptide RYA3 precursor							63.0	56.0	59.0					20																	31647285		2203	4300	6503	SO:0001583	missense	359710				innate immune response	cytoplasm|extracellular region	lipid binding|protein binding	g.chr20:31647285C>G	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.383C>G	20.37:g.31647285C>G	ENSP00000364643:p.Ser128Cys		Somatic					p.S128C	NM_182658	NP_872599	WXS	Illumina HiSeq	Unspecified	P59826	LPLC3_HUMAN			3	383	+			128			Leu-rich.		Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	c.383C>G	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.108532	0.56291	.	.	ENSG00000186190	ENST00000375494	T	0.07021	3.23	4.34	4.34	0.51931	.	0.274129	0.26435	N	0.024396	T	0.21674	0.0522	L	0.51422	1.61	0.31797	N	0.6289	D	0.76494	0.999	D	0.85130	0.997	T	0.02526	-1.1146	10	0.56958	D	0.05	-13.8739	12.2269	0.54465	0.0:1.0:0.0:0.0	.	128	P59826	BPIB3_HUMAN	C	128	ENSP00000364643:S128C	ENSP00000364643:S128C	S	+	2	0	BPIFB3	31110946	0.874000	0.30092	0.995000	0.50966	0.777000	0.43975	1.334000	0.33827	2.253000	0.74438	0.561000	0.74099	TCT		0.602	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658		7	22	0	0	0	0.001984	0	7	22				
E2F1	1869	broad.mit.edu	37	20	32264541	32264541	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:32264541G>C	ENST00000343380.5	-	7	1450	c.1311C>G	c.(1309-1311)ttC>ttG	p.F437L	RP1-63M2.5_ENST00000606866.1_RNA|NECAB3_ENST00000375238.4_5'Flank|NECAB3_ENST00000246190.6_5'Flank	NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	437	Transactivation.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						AGCCCTGTCAGAAATCCAGGG	0.627																																							uc002wzu.3		NA																	0					0						c.(1309-1311)TTC>TTG		E2F transcription factor 1							21.0	18.0	19.0					20																	32264541		2203	4293	6496	SO:0001583	missense	1869				apoptosis|cell proliferation|G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|mRNA stabilization|negative regulation of transcription involved in G1/S phase of mitotic cell cycle|positive regulation of fibroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle	mitochondrion|Rb-E2F complex	sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding	g.chr20:32264541G>C		CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.1311C>G	20.37:g.32264541G>C	ENSP00000345571:p.Phe437Leu		Somatic				NECAB3_uc002wzm.3_5'Flank|NECAB3_uc002wzn.3_5'Flank|NECAB3_uc002wzo.3_5'Flank|NECAB3_uc002wzp.3_5'Flank|NECAB3_uc002wzq.3_5'Flank|NECAB3_uc002wzr.3_5'Flank|NECAB3_uc010geo.2_5'Flank	p.F437L	NM_005225	NP_005216	WXS	Illumina HiSeq	Unspecified	Q01094	E2F1_HUMAN			7	1451	-			437			Transactivation.		Q13143|Q92768	Missense_Mutation	SNP	ENST00000343380.5	37	c.1311C>G	CCDS13224.1	.	.	.	.	.	.	.	.	.	.	G	9.748	1.166800	0.21621	.	.	ENSG00000101412	ENST00000343380	T	0.08807	3.05	3.62	3.62	0.41486	.	0.374912	0.29218	N	0.012788	T	0.04318	0.0119	N	0.12182	0.205	0.42362	D	0.992417	B	0.32071	0.355	B	0.24974	0.057	T	0.51537	-0.8693	10	0.19147	T	0.46	-16.6857	12.1359	0.53970	0.0:0.1741:0.8259:0.0	.	437	Q01094	E2F1_HUMAN	L	437	ENSP00000345571:F437L	ENSP00000345571:F437L	F	-	3	2	E2F1	31728202	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.426000	0.52778	2.323000	0.78572	0.462000	0.41574	TTC		0.627	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078731.2			7	15	0	0	0	0.004482	0	7	15				
TRPC4AP	26133	broad.mit.edu	37	20	33588488	33588488	+	IGR	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:33588488C>T	ENST00000252015.2	-	0	3226				MYH7B_ENST00000262873.7_Missense_Mutation_p.S1767L			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CTTCTGCATTCGCAGGTGGGG	0.662																																							uc002xbi.1		NA																	0				ovary(1)|breast(1)	2						c.(5299-5301)TCG>TTG		myosin, heavy polypeptide 7B, cardiac muscle,							12.0	15.0	14.0					20																	33588488		1966	4166	6132	SO:0001628	intergenic_variant	57644					membrane|myosin filament	actin binding|ATP binding|motor activity	g.chr20:33588488C>T	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319		20.37:g.33588488C>T			Somatic					p.S1767L	NM_020884	NP_065935	WXS	Illumina HiSeq	Unspecified	A7E2Y1	MYH7B_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00691)		37	5392	+			1725			Potential.		E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	c.5300C>T	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.460385	0.63401	.	.	ENSG00000078814	ENST00000262873	T	0.78707	-1.2	4.24	4.24	0.50183	Myosin tail (1);	0.000000	0.30901	N	0.008653	T	0.78892	0.4355	M	0.83483	2.645	0.54753	D	0.999988	P	0.49090	0.919	B	0.38655	0.278	D	0.85292	0.1068	10	0.87932	D	0	.	16.8832	0.86069	0.0:1.0:0.0:0.0	.	1725	A7E2Y1	MYH7B_HUMAN	L	1767	ENSP00000262873:S1767L	ENSP00000262873:S1767L	S	+	2	0	MYH7B	33052149	1.000000	0.71417	0.961000	0.40146	0.682000	0.39822	7.647000	0.83462	2.207000	0.71202	0.460000	0.39030	TCG		0.662	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638		4	9	0	0	0	0.001168	0	4	9				
TTI1	9675	broad.mit.edu	37	20	36625251	36625251	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:36625251G>A	ENST00000373448.2	-	7	3136	c.2898C>T	c.(2896-2898)atC>atT	p.I966I	TTI1_ENST00000373447.3_Silent_p.I966I|TTI1_ENST00000449821.1_Silent_p.I966I	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	966					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CCCTGGCACTGATGGGGGCCT	0.597																																							uc002xhl.2		NA																	0					0						c.(2896-2898)ATC>ATT		hypothetical protein LOC9675							94.0	99.0	97.0					20																	36625251		2203	4300	6503	SO:0001819	synonymous_variant	9675						binding	g.chr20:36625251G>A	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.2898C>T	20.37:g.36625251G>A			Somatic				KIAA0406_uc002xhm.2_Silent_p.I966I	p.I966I	NM_014657	NP_055472	WXS	Illumina HiSeq	Unspecified	O43156	TTI1_HUMAN			7	3107	-		Myeloproliferative disorder(115;0.00874)	966					D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	ENST00000373448.2	37	c.2898C>T	CCDS13300.1																																																																																				0.597	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		53	141	0	0	0	0.00361	0	53	141				
PIGT	51604	broad.mit.edu	37	20	44049006	44049006	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:44049006C>T	ENST00000279036.6	+	7	884	c.804C>T	c.(802-804)ctC>ctT	p.L268L	PIGT_ENST00000535404.1_Silent_p.L113L|PIGT_ENST00000372689.5_Silent_p.L268L|PIGT_ENST00000279035.9_Silent_p.L166L|PIGT_ENST00000545755.1_Silent_p.L6L|PIGT_ENST00000543458.2_Silent_p.L212L|PIGT_ENST00000341555.5_Silent_p.L74L	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	268					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				CCCGAACCCTCACGGAGCCCT	0.592																																							uc002xoh.1		NA																	0				pancreas(1)	1						c.(802-804)CTC>CTT		phosphatidylinositol glycan anchor biosynthesis,							49.0	51.0	50.0					20																	44049006		2203	4300	6503	SO:0001819	synonymous_variant	51604				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding	g.chr20:44049006C>T		CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.804C>T	20.37:g.44049006C>T			Somatic				PIGT_uc010ghb.1_Silent_p.L258L|PIGT_uc010zwt.1_RNA|PIGT_uc010ghd.1_Silent_p.L175L|PIGT_uc010ghc.1_RNA|PIGT_uc010ghe.1_Silent_p.L231L|PIGT_uc010ghf.1_Silent_p.L221L|PIGT_uc002xoj.1_Silent_p.L268L|PIGT_uc002xok.1_Silent_p.L233L|PIGT_uc010zwu.1_Silent_p.L6L|PIGT_uc002xoi.1_RNA|PIGT_uc010zwv.1_Silent_p.L6L|PIGT_uc010zww.1_Silent_p.L212L|PIGT_uc010zwx.1_Silent_p.L103L|PIGT_uc010zwy.1_Silent_p.L166L|PIGT_uc010zwz.1_Silent_p.L6L|PIGT_uc010zxa.1_Silent_p.L106L|PIGT_uc002xol.1_Silent_p.L124L|PIGT_uc010zxb.1_5'UTR	p.L268L	NM_015937	NP_057021	WXS	Illumina HiSeq	Unspecified	Q969N2	PIGT_HUMAN			7	877	+		Myeloproliferative disorder(115;0.0122)	268			Lumenal (Potential).		B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	c.804C>T	CCDS13353.1	.	.	.	.	.	.	.	.	.	.	C	9.985	1.229167	0.22542	.	.	ENSG00000124155	ENST00000432270	.	.	.	5.38	1.1	0.20463	.	.	.	.	.	T	0.42988	0.1227	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21348	-1.0248	4	.	.	.	-36.6475	2.1285	0.03744	0.1273:0.2709:0.3721:0.2298	.	.	.	.	Y	66	.	.	H	+	1	0	PIGT	43482420	0.960000	0.32886	0.985000	0.45067	0.945000	0.59286	0.023000	0.13533	0.070000	0.16634	0.655000	0.94253	CAC		0.592	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2	NM_015937		14	14	0	0	0	0.007413	0	14	14				
SULF2	55959	broad.mit.edu	37	20	46290572	46290572	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:46290572C>T	ENST00000359930.4	-	18	3290	c.2439G>A	c.(2437-2439)ctG>ctA	p.L813L	SULF2_ENST00000467815.1_Silent_p.L813L|SULF2_ENST00000484875.1_Silent_p.L813L|SULF2_ENST00000361612.4_Silent_p.L813L	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	813					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TGCAGCTCCTCAGCTCCATGA	0.547																																							uc002xto.2		NA																	0				ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(2437-2439)CTG>CTA		sulfatase 2 isoform a precursor							172.0	133.0	146.0					20																	46290572		2203	4300	6503	SO:0001819	synonymous_variant	55959				bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr20:46290572C>T	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.2439G>A	20.37:g.46290572C>T			Somatic				SULF2_uc002xtr.2_Silent_p.L813L|SULF2_uc002xtq.2_Silent_p.L813L|SULF2_uc010zyd.1_Silent_p.L92L	p.L813L	NM_018837	NP_061325	WXS	Illumina HiSeq	Unspecified	Q8IWU5	SULF2_HUMAN			18	2769	-			813					E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	ENST00000359930.4	37	c.2439G>A	CCDS13408.1																																																																																				0.547	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837		31	137	0	0	0	0.002836	0	31	137				
DDX27	55661	broad.mit.edu	37	20	47835954	47835954	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:47835954T>G	ENST00000371764.4	+	1	71	c.62T>G	c.(61-63)gTg>gGg	p.V21G	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	21						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CCGCAGGCTGTGCTCGCTTCC	0.622																																							uc002xuh.2		NA																	0				kidney(2)	2						c.(61-63)GTG>GGG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							78.0	65.0	70.0					20																	47835954		2203	4300	6503	SO:0001583	missense	55661					nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr20:47835954T>G	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.62T>G	20.37:g.47835954T>G	ENSP00000360828:p.Val21Gly		Somatic					p.V21G	NM_017895	NP_060365	WXS	Illumina HiSeq	Unspecified	Q96GQ7	DDX27_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		1	123	+			21					A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	c.62T>G	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	T	8.760	0.923401	0.18056	.	.	ENSG00000124228	ENST00000535160;ENST00000371764	T	0.01446	4.88	5.11	-3.08	0.05347	.	2.575510	0.01274	N	0.009538	T	0.01029	0.0034	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45629	-0.9248	10	0.15952	T	0.53	-0.0037	1.2193	0.01921	0.4146:0.2728:0.126:0.1866	.	21	Q96GQ7	DDX27_HUMAN	G	21	ENSP00000360828:V21G	ENSP00000360828:V21G	V	+	2	0	DDX27	47269361	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.730000	0.04915	-0.787000	0.04510	-1.140000	0.01884	GTG		0.622	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1			20	35	0	0	0	0.010504	0	20	35				
KCNB1	3745	broad.mit.edu	37	20	47990541	47990541	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:47990541G>A	ENST00000371741.4	-	2	1722	c.1556C>T	c.(1555-1557)tCt>tTt	p.S519F		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	519	Poly-Ser.				energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CTGAGGACTAGAAGACGATCT	0.468																																							uc002xur.1		NA																	0				pancreas(1)|skin(1)	2						c.(1555-1557)TCT>TTT		potassium voltage-gated channel, Shab-related							278.0	257.0	264.0					20																	47990541		2203	4300	6503	SO:0001583	missense	3745				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr20:47990541G>A	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1556C>T	20.37:g.47990541G>A	ENSP00000360806:p.Ser519Phe		Somatic				KCNB1_uc002xus.1_Missense_Mutation_p.S519F	p.S519F	NM_004975	NP_004966	WXS	Illumina HiSeq	Unspecified	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		2	1720	-			519			Poly-Ser.|Cytoplasmic (Potential).		Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	c.1556C>T	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700147	0.48307	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.38560	1.13	6.07	5.07	0.68467	.	0.352008	0.29225	N	0.012762	T	0.59404	0.2191	M	0.66939	2.045	0.47584	D	0.99946	P	0.44734	0.842	P	0.54312	0.748	T	0.60924	-0.7166	10	0.72032	D	0.01	.	18.7274	0.91718	0.0:0.1257:0.8743:0.0	.	519	Q14721	KCNB1_HUMAN	F	519;474	ENSP00000360806:S519F	ENSP00000360806:S519F	S	-	2	0	KCNB1	47423948	1.000000	0.71417	0.975000	0.42487	0.758000	0.43043	5.176000	0.65026	2.884000	0.98904	0.655000	0.94253	TCT		0.468	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975		181	194	0	0	0	0.00361	0	181	194				
C20orf85	128602	broad.mit.edu	37	20	56728612	56728612	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:56728612G>A	ENST00000371168.3	+	2	142	c.81G>A	c.(79-81)ctG>ctA	p.L27L		NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85	27										kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			AATACCGTCTGAAGGCTGAAT	0.473																																							uc002xyv.2		NA																	0				ovary(1)	1						c.(79-81)CTG>CTA		hypothetical protein LOC128602							98.0	101.0	100.0					20																	56728612		2203	4300	6503	SO:0001819	synonymous_variant	128602							g.chr20:56728612G>A	AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.81G>A	20.37:g.56728612G>A			Somatic					p.L27L	NM_178456	NP_848551	WXS	Illumina HiSeq	Unspecified	Q9H1P6	CT085_HUMAN	BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)		2	119	+	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		27						Silent	SNP	ENST00000371168.3	37	c.81G>A	CCDS13465.1																																																																																				0.473	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079866.2	NM_178456		105	115	0	0	0	0.00361	0	105	115				
MRGBP	55257	broad.mit.edu	37	20	61428022	61428022	+	Splice_Site	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:61428022C>T	ENST00000370487.3	+	1	218	c.147C>T	c.(145-147)gtC>gtT	p.V49V		NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	49					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											ACAAGCCCGTCGGTGAGCGCC	0.791																																							uc002ydi.2		NA																	0					0						c.(145-147)GTC>GTT		MRG-binding protein							14.0	13.0	13.0					20																	61428022		2071	4067	6138	SO:0001630	splice_region_variant	55257				chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex		g.chr20:61428022C>T	AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.148+1C>T	20.37:g.61428022C>T			Somatic					p.V49V	NM_018270	NP_060740	WXS	Illumina HiSeq	Unspecified	Q9NV56	MRGBP_HUMAN			1	218	+	Breast(26;3.65e-08)		49					A8C4L5	Silent	SNP	ENST00000370487.3	37	c.147C>T	CCDS13503.1																																																																																				0.791	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080080.1	NM_018270	Silent	6	7	0	0	0	0.001984	0	6	7				
DIDO1	11083	broad.mit.edu	37	20	61528345	61528345	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr20:61528345G>A	ENST00000266070.4	-	7	1917	c.1592C>T	c.(1591-1593)aCg>aTg	p.T531M	DIDO1_ENST00000395335.2_Missense_Mutation_p.T531M|DIDO1_ENST00000395343.1_Missense_Mutation_p.T531M|DIDO1_ENST00000395340.1_Missense_Mutation_p.T531M	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	531					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GTCTTCCTTCGTGGCTACAAA	0.562																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(1591-1593)ACG>ATG		death inducer-obliterator 1 isoform c							20.0	20.0	20.0					20																	61528345		2202	4297	6499	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61528345G>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1592C>T	20.37:g.61528345G>A	ENSP00000266070:p.Thr531Met		Somatic				DIDO1_uc002yds.1_Missense_Mutation_p.T531M|DIDO1_uc002ydt.1_Missense_Mutation_p.T531M|DIDO1_uc002ydu.1_Missense_Mutation_p.T531M	p.T531M	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			7	1856	-	Breast(26;5.68e-08)		531					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.1592C>T	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	9.331	1.060449	0.19987	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.12255	3.08;3.08;2.7;2.7	5.48	-0.248	0.13015	.	1.420260	0.04855	N	0.442931	T	0.05868	0.0153	N	0.05124	-0.11	0.09310	N	1	B;B	0.20261	0.014;0.043	B;B	0.08055	0.003;0.002	T	0.33675	-0.9859	10	0.33141	T	0.24	-0.3489	1.2704	0.02019	0.3576:0.1253:0.3365:0.1806	.	531;531	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	M	531	ENSP00000266070:T531M;ENSP00000378752:T531M;ENSP00000378749:T531M;ENSP00000378744:T531M	ENSP00000266070:T531M	T	-	2	0	DIDO1	60998790	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.140000	0.10342	-0.327000	0.08551	-0.253000	0.11424	ACG		0.562	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		10	18	0	0	0	0.001368	0	10	18				
TMPRSS15	5651	broad.mit.edu	37	21	19698834	19698834	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:19698834C>A	ENST00000284885.3	-	16	1869	c.1836G>T	c.(1834-1836)atG>atT	p.M612I		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	612	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GAAGCACAGTCATTCTGTTGG	0.458																																							uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(1834-1836)ATG>ATT		enterokinase precursor							221.0	181.0	194.0					21																	19698834		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19698834C>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1836G>T	21.37:g.19698834C>A	ENSP00000284885:p.Met612Ile		Somatic					p.M612I	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			16	1867	-			612			Extracellular (Potential).|CUB 2.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.1836G>T	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880712	0.51801	.	.	ENSG00000154646	ENST00000284885	T	0.19250	2.16	5.27	5.27	0.74061	CUB (5);	0.000000	0.85682	D	0.000000	T	0.34919	0.0914	M	0.71206	2.165	0.50813	D	0.99989	D	0.52996	0.957	P	0.49561	0.615	T	0.06588	-1.0818	9	.	.	.	.	16.7401	0.85457	0.0:1.0:0.0:0.0	.	612	P98073	ENTK_HUMAN	I	612	ENSP00000284885:M612I	.	M	-	3	0	TMPRSS15	18620705	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	5.518000	0.67068	2.612000	0.88384	0.650000	0.86243	ATG		0.458	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		41	77	1	0	5.44703e-19	0.009718	6.74488e-19	41	77				
CCT8	10694	broad.mit.edu	37	21	30435737	30435737	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:30435737T>A	ENST00000286788.4	-	8	1083	c.877A>T	c.(877-879)Aca>Tca	p.T293S	CCT8_ENST00000542732.1_Missense_Mutation_p.T274S|CCT8_ENST00000540844.1_Missense_Mutation_p.T220S|CCT8_ENST00000470450.1_5'UTR	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	293					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						TTGCCACCTGTTACTACGACA	0.353																																							uc002ynb.2		NA																	0					0						c.(877-879)ACA>TCA		chaperonin containing TCP1, subunit 8 (theta)							123.0	119.0	120.0					21																	30435737		2203	4300	6503	SO:0001583	missense	10694				'de novo' posttranslational protein folding	aggresome|cytosol|intermediate filament cytoskeleton|microtubule organizing center	ATP binding|ATPase activity, coupled|unfolded protein binding	g.chr21:30435737T>A	Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.877A>T	21.37:g.30435737T>A	ENSP00000286788:p.Thr293Ser		Somatic				CCT8_uc002ymz.2_5'Flank|CCT8_uc011acp.1_Missense_Mutation_p.T274S|CCT8_uc002yna.2_Missense_Mutation_p.T242S|CCT8_uc002ync.2_Missense_Mutation_p.T292S|CCT8_uc010glm.2_Missense_Mutation_p.T234S|CCT8_uc011acq.1_Missense_Mutation_p.T220S	p.T293S	NM_006585	NP_006576	WXS	Illumina HiSeq	Unspecified	P50990	TCPQ_HUMAN			8	976	-			293					A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	ENST00000286788.4	37	c.877A>T	CCDS33528.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.51|10.51	1.370897|1.370897	0.24771|0.24771	.|.	.|.	ENSG00000156261|ENSG00000156261	ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844|ENST00000431234	T;T;T|.	0.79141|.	-1.24;-1.24;-1.24|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.046738|.	0.85682|.	D|.	0.000000|.	T|.	0.39886|.	0.1095|.	N|N	0.05608|0.05608	-0.01|-0.01	0.50813|0.50813	D|D	0.999899|0.999899	B;B;B;B;B|.	0.14805|.	0.006;0.003;0.003;0.003;0.011|.	B;B;B;B;B|.	0.19946|.	0.027;0.012;0.018;0.011;0.006|.	T|.	0.34104|.	-0.9842|.	10|.	0.10377|.	T|.	0.69|.	-18.8976|-18.8976	15.9201|15.9201	0.79556|0.79556	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	220;274;293;292;293|.	B4DQH4;B4DEM7;Q53HU0;G5E9B2;P50990|.	.;.;.;.;TCPQ_HUMAN|.	S|Y	292;293;274;220|238	ENSP00000286788:T293S;ENSP00000444984:T274S;ENSP00000442730:T220S|.	ENSP00000286788:T293S|.	T|X	-|-	1|3	0|2	CCT8|CCT8	29357608|29357608	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.993000|0.993000	0.82548|0.82548	4.730000|4.730000	0.62015|0.62015	2.221000|2.221000	0.72209|0.72209	0.383000|0.383000	0.25322|0.25322	ACA|TAA		0.353	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1			30	53	0	0	0	0.004878	0	30	53				
KRTAP13-1	140258	broad.mit.edu	37	21	31768547	31768547	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:31768547T>A	ENST00000355459.2	+	1	156	c.143T>A	c.(142-144)cTg>cAg	p.L48Q		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	48	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACGTGCCAGCTGGGTTCCTCT	0.612																																							uc002yoa.2		NA																	0				ovary(1)	1						c.(142-144)CTG>CAG		keratin associated protein 13-1							75.0	76.0	75.0					21																	31768547		2203	4300	6503	SO:0001583	missense	140258					intermediate filament		g.chr21:31768547T>A	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.143T>A	21.37:g.31768547T>A	ENSP00000347635:p.Leu48Gln		Somatic					p.L48Q	NM_181599	NP_853630	WXS	Illumina HiSeq	Unspecified	Q8IUC0	KR131_HUMAN			1	156	+			48			1.|5 X 10 AA approximate repeats.		Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	c.143T>A	CCDS13590.2	.	.	.	.	.	.	.	.	.	.	T	11.13	1.547941	0.27652	.	.	ENSG00000198390	ENST00000355459	T	0.03496	3.91	4.51	-1.07	0.09968	.	0.543554	0.13924	N	0.353367	T	0.07279	0.0184	M	0.80183	2.485	0.20563	N	0.999881	P	0.34977	0.478	B	0.41236	0.351	T	0.33954	-0.9848	10	0.12766	T	0.61	.	10.5658	0.45171	0.699:0.0:0.0:0.3009	.	48	Q8IUC0	KR131_HUMAN	Q	48	ENSP00000347635:L48Q	ENSP00000347635:L48Q	L	+	2	0	KRTAP13-1	30690418	0.002000	0.14202	0.408000	0.26446	0.113000	0.19764	-0.114000	0.10757	-0.159000	0.11021	0.455000	0.32223	CTG		0.612	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128252.3			22	59	0	0	0	0.00278	0	22	59				
IGSF5	150084	broad.mit.edu	37	21	41151172	41151172	+	Missense_Mutation	SNP	C	C	T	rs369163594		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:41151172C>T	ENST00000380588.4	+	5	977	c.874C>T	c.(874-876)Cgt>Tgt	p.R292C	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	292	Cys-rich.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				ctgctgccgccgtcgttgttg	0.458																																							uc002yyo.2		NA																	0					0						c.(874-876)CGT>TGT		immunoglobulin superfamily 5 like		C	CYS/ARG	0,4406		0,0,2203	57.0	55.0	56.0		874	1.9	0.0	21		56	1,8599	1.2+/-3.3	0,1,4299	no	missense	IGSF5	NM_001080444.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	292/408	41151172	1,13005	2203	4300	6503	SO:0001583	missense	150084					integral to membrane|tight junction		g.chr21:41151172C>T		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.874C>T	21.37:g.41151172C>T	ENSP00000369962:p.Arg292Cys		Somatic					p.R292C	NM_001080444	NP_001073913	WXS	Illumina HiSeq	Unspecified	Q9NSI5	IGSF5_HUMAN			5	977	+		Prostate(19;5.35e-06)	292			Cytoplasmic (Potential).|Cys-rich.			Missense_Mutation	SNP	ENST00000380588.4	37	c.874C>T	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102942	0.20632	0.0	1.16E-4	ENSG00000183067	ENST00000380588	T	0.06933	3.24	4.24	1.91	0.25777	.	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38564	-0.9655	9	0.87932	D	0	.	5.8945	0.18931	0.0:0.2079:0.0:0.7921	.	292	Q9NSI5	IGSF5_HUMAN	C	292	ENSP00000369962:R292C	ENSP00000369962:R292C	R	+	1	0	IGSF5	40073042	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.096000	0.11059	0.423000	0.26033	-0.294000	0.09567	CGT		0.458	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1			17	27	0	0	0	0.004007	0	17	27				
DSCAM	1826	broad.mit.edu	37	21	41450791	41450791	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:41450791C>G	ENST00000400454.1	-	26	5011	c.4534G>C	c.(4534-4536)Gag>Cag	p.E1512Q		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1512	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGCCTGTACTCTAGTGTGAAG	0.552																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(4534-4536)GAG>CAG		Down syndrome cell adhesion molecule isoform							44.0	49.0	47.0					21																	41450791		2062	4211	6273	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41450791C>G	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4534G>C	21.37:g.41450791C>G	ENSP00000383303:p.Glu1512Gln		Somatic				DSCAM_uc002yyr.1_RNA	p.E1512Q	NM_001389	NP_001380	WXS	Illumina HiSeq	Unspecified	O60469	DSCAM_HUMAN			26	4986	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	1512			Extracellular (Potential).|Fibronectin type-III 6.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.4534G>C	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349457	0.61183	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.57436	0.4;0.4	4.33	4.33	0.51752	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.052252	0.85682	D	0.000000	T	0.50480	0.1618	L	0.54323	1.7	0.58432	D	0.99999	B	0.21606	0.058	B	0.23716	0.048	T	0.49504	-0.8933	10	0.34782	T	0.22	.	17.3858	0.87415	0.0:1.0:0.0:0.0	.	1512	O60469	DSCAM_HUMAN	Q	1512;1264	ENSP00000383303:E1512Q;ENSP00000385342:E1264Q	ENSP00000383303:E1512Q	E	-	1	0	DSCAM	40372661	1.000000	0.71417	0.942000	0.38095	0.975000	0.68041	7.517000	0.81783	2.397000	0.81536	0.563000	0.77884	GAG		0.552	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		13	26	0	0	0	0.003163	0	13	26				
KRTAP10-8	386681	broad.mit.edu	37	21	46032559	46032559	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:46032559C>T	ENST00000334662.2	+	1	564	c.542C>T	c.(541-543)tCt>tTt	p.S181F	TSPEAR_ENST00000323084.4_Intron	NM_198695.2	NP_941968.2	P60410	KR108_HUMAN	keratin associated protein 10-8	181	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	17						CCTGTCTGCTCTGGGGCTTCC	0.632																																							uc002zfo.1		NA																	0				large_intestine(1)|breast(1)	2						c.(541-543)TCT>TTT		keratin associated protein 10-8							194.0	193.0	193.0					21																	46032559		2203	4300	6503	SO:0001583	missense	386681					keratin filament		g.chr21:46032559C>T	AB076355	CCDS13713.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000187766	ENSG00000187766		"""Keratin associated proteins"""	20525	protein-coding gene	gene with protein product			"""keratin associated protein 18-8"""	KRTAP18-8			Standard	NM_198695		Approved	KRTAP18.8, KAP10.8	uc002zfo.1	P60410	OTTHUMG00000057632	ENST00000334662.2:c.542C>T	21.37:g.46032559C>T	ENSP00000335565:p.Ser181Phe		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S181F	NM_198695	NP_941968	WXS	Illumina HiSeq	Unspecified	P60410	KR108_HUMAN			1	564	+			181			19 X 5 AA repeats of C-C-X(3).		A0JNW4	Missense_Mutation	SNP	ENST00000334662.2	37	c.542C>T	CCDS13713.1	.	.	.	.	.	.	.	.	.	.	c	3.716	-0.058522	0.07317	.	.	ENSG00000187766	ENST00000334662	T	0.01516	4.81	2.98	-0.526	0.11913	.	.	.	.	.	T	0.05914	0.0154	L	0.61387	1.9	0.21802	N	0.99954	D	0.61697	0.99	P	0.59357	0.856	T	0.20338	-1.0278	9	0.41790	T	0.15	.	11.8567	0.52441	0.0:0.4883:0.5117:0.0	.	181	P60410	KR108_HUMAN	F	181	ENSP00000335565:S181F	ENSP00000335565:S181F	S	+	2	0	KRTAP10-8	44856987	0.103000	0.21917	0.018000	0.16275	0.025000	0.11179	-0.033000	0.12246	-0.244000	0.09639	0.467000	0.42956	TCT		0.632	KRTAP10-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128035.1	NM_198695		97	257	0	0	0	0.00361	0	97	257				
MCM3AP	8888	broad.mit.edu	37	21	47678951	47678951	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr21:47678951G>A	ENST00000397708.1	-	17	3890	c.3636C>T	c.(3634-3636)gtC>gtT	p.V1212V	MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP_ENST00000291688.1_Silent_p.V1212V			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1212	CID.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AGTGGGCACAGACATCCTCAC	0.537																																							uc002zir.1		NA																	0				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						c.(3634-3636)GTC>GTT		minichromosome maintenance complex component 3							120.0	108.0	112.0					21																	47678951		2203	4300	6503	SO:0001819	synonymous_variant	8888				DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding	g.chr21:47678951G>A	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.3636C>T	21.37:g.47678951G>A			Somatic				MCM3AP_uc002zip.1_5'UTR|MCM3AP_uc002ziq.1_Silent_p.V139V	p.V1212V	NM_003906	NP_003897	WXS	Illumina HiSeq	Unspecified	O60318	MCM3A_HUMAN			16	3672	-	Breast(49;0.112)		1212					C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	c.3636C>T	CCDS13734.1																																																																																				0.537	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		31	84	0	0	0	0.002096	0	31	84				
ZNF280B	140883	broad.mit.edu	37	22	22842707	22842708	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:22842707_22842708CC>AA	ENST00000406426.1	-	4	1758_1759	c.1016_1017GG>TT	c.(1015-1017)tGG>tTT	p.W339F	ZNF280B_ENST00000360412.2_Missense_Mutation_p.W339F			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TGTGGTTTTCCCAGCTGTCGTT	0.48																																							uc002zwc.1		NA																	0				ovary(2)	2						c.(1015-1017)TGG>TTT		zinc finger protein 280B																																				SO:0001583	missense	140883				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr22:22842707_22842708CC>AA	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1016_1017delinsAA	22.37:g.22842707_22842708delinsAA	ENSP00000385998:p.Trp339Phe		Somatic				LOC96610_uc011aim.1_Intron	p.W339F	NM_080764	NP_542942	WXS	Illumina HiSeq	Unspecified	Q86YH2	Z280B_HUMAN		READ - Rectum adenocarcinoma(21;0.145)	4	1792_1793	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)	339						Missense_Mutation	DNP	ENST00000406426.1	37	c.1016_1017GG>TT	CCDS13799.1																																																																																				0.480	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764		78	33	0	0	0	0.004672	0	78	33				
CHEK2	11200	broad.mit.edu	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	TG	CA	rs142470496|rs146546850	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:29091840_29091841TG>CA	ENST00000405598.1	-	12	1307_1308	c.1116_1117CA>TG	c.(1114-1119)tcCAag>tcTGag	p.K373E	CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E|CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)|p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCAA	0.416			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															uc003adu.1		NA	yes	Rec		familial breast cancer	22	22q12.1	11200	F	CHK2 checkpoint homolog (S. pombe)			E		breast 			17	Substitution - Missense(9)|Substitution - coding silent(8)	p.K373E(2)|p.S372S(1)	kidney(8)|prostate(4)|endometrium(2)|central_nervous_system(2)|stomach(1)	central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						c.(1114-1119)TCCAAG>TCTGAG	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	protein kinase CHK2 isoform a																																				SO:0001583	missense	11200	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer			cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr22:29091840_29091841TG>CA	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116_1117delinsCA	22.37:g.29091840_29091841delinsCA	ENSP00000386087:p.Lys373Glu		Somatic				CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	p.K373E	NM_007194	NP_009125	WXS	Illumina HiSeq	Unspecified	O96017	CHK2_HUMAN			11	1188_1189	-			373			Protein kinase.		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	DNP	ENST00000405598.1	37	c.1116_1117CA>TG	CCDS13843.1																																																																																				0.416	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735		10	71	0	0	0	0.004672	0	10	71				
APOL5	80831	broad.mit.edu	37	22	36122339	36122339	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:36122339C>A	ENST00000249044.2	+	3	224	c.224C>A	c.(223-225)tCc>tAc	p.S75Y		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	75					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						GGTATGCTGTCCTACTTTCTG	0.418																																							uc003aof.2		NA																	0					0						c.(223-225)TCC>TAC		apolipoprotein L5							123.0	108.0	113.0					22																	36122339		2203	4300	6503	SO:0001583	missense	80831				lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding	g.chr22:36122339C>A	AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.224C>A	22.37:g.36122339C>A	ENSP00000249044:p.Ser75Tyr		Somatic					p.S75Y	NM_030642	NP_085145	WXS	Illumina HiSeq	Unspecified	Q9BWW9	APOL5_HUMAN			3	224	+			75					Q5TFL9|Q9UGW5	Missense_Mutation	SNP	ENST00000249044.2	37	c.224C>A	CCDS13920.1	.	.	.	.	.	.	.	.	.	.	C	4.093	0.015298	0.07959	.	.	ENSG00000128313	ENST00000249044	T	0.03524	3.9	2.39	-3.77	0.04346	.	4.166980	0.00995	N	0.003592	T	0.01254	0.0041	N	0.02539	-0.55	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.38650	-0.9651	10	0.02654	T	1	.	0.5518	0.00664	0.2547:0.2171:0.325:0.2032	.	75	Q9BWW9	APOL5_HUMAN	Y	75	ENSP00000249044:S75Y	ENSP00000249044:S75Y	S	+	2	0	APOL5	34452285	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	-0.844000	0.04345	-0.403000	0.07622	-0.347000	0.07816	TCC		0.418	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1	NM_030642		33	22	1	0	4.34086e-07	0.005524	4.6969e-07	33	22				
FAM109B	150368	broad.mit.edu	37	22	42473379	42473379	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:42473379G>C	ENST00000321753.3	+	3	269	c.82G>C	c.(82-84)Ggg>Cgg	p.G28R	snoU13_ENST00000458891.1_RNA|SMDT1_ENST00000331479.3_5'Flank	NM_001002034.2	NP_001002034.2	Q6ICB4	SESQ2_HUMAN	family with sequence similarity 109, member B	28	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|liver(2)|lung(1)|prostate(1)	8						GCGCACCTGGGGGGGCCCAGG	0.637																																							uc003bbz.2		NA																	0					0						c.(82-84)GGG>CGG		hypothetical protein LOC150368							52.0	57.0	55.0					22																	42473379		2203	4300	6503	SO:0001583	missense	150368				endosome organization|receptor recycling|retrograde transport, endosome to Golgi	clathrin-coated vesicle|early endosome|recycling endosome|trans-Golgi network	protein homodimerization activity	g.chr22:42473379G>C	BX648402	CCDS33655.1	22q13.2	2013-01-10			ENSG00000177096	ENSG00000177096		"""Pleckstrin homology (PH) domain containing"""	27161	protein-coding gene	gene with protein product		614240				12477932	Standard	NM_001002034		Approved	DKFZp686J07229	uc003bbz.3	Q6ICB4	OTTHUMG00000151285	ENST00000321753.3:c.82G>C	22.37:g.42473379G>C	ENSP00000312753:p.Gly28Arg		Somatic				C22orf32_uc003bca.2_5'Flank	p.G28R	NM_001002034	NP_001002034	WXS	Illumina HiSeq	Unspecified	Q6ICB4	SESQ2_HUMAN			3	269	+			28			PH.		Q3SXQ3|Q8N6L9	Missense_Mutation	SNP	ENST00000321753.3	37	c.82G>C	CCDS33655.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741929	0.69418	.	.	ENSG00000177096	ENST00000321753;ENST00000419475	T;T	0.76186	-1.0;-1.0	5.07	3.98	0.46160	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.170754	0.51477	D	0.000095	T	0.74107	0.3673	M	0.75777	2.31	0.49483	D	0.999792	P	0.41710	0.76	P	0.45538	0.484	T	0.76402	-0.2972	10	0.62326	D	0.03	-20.868	6.0156	0.19601	0.2382:0.0:0.7618:0.0	.	28	Q6ICB4	SESQ2_HUMAN	R	28	ENSP00000312753:G28R;ENSP00000396170:G28R	ENSP00000312753:G28R	G	+	1	0	FAM109B	40803325	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.782000	0.62396	2.333000	0.79357	0.591000	0.81541	GGG		0.637	FAM109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322084.1	NM_001002034		73	46	0	0	0	0.00361	0	73	46				
CYP2D6	1565	broad.mit.edu	37	22	42524885	42524885	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:42524885G>A	ENST00000360608.5	-	4	681	c.567C>T	c.(565-567)ctC>ctT	p.L189L	CYP2D6_ENST00000389970.3_Silent_p.L189L|NDUFA6-AS1_ENST00000416037.2_RNA|CYP2D6_ENST00000359033.4_Silent_p.L138L|NDUFA6-AS1_ENST00000439129.1_RNA	NM_000106.5	NP_000097	P10635	CP2D6_HUMAN	cytochrome P450, family 2, subfamily D, polypeptide 6	189					alkaloid catabolic process (GO:0009822)|alkaloid metabolic process (GO:0009820)|coumarin metabolic process (GO:0009804)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|isoquinoline alkaloid metabolic process (GO:0033076)|monoterpenoid metabolic process (GO:0016098)|negative regulation of binding (GO:0051100)|negative regulation of cellular organofluorine metabolic process (GO:0090350)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(4)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21					Abiraterone(DB05812)|Acebutolol(DB01193)|Acetaminophen(DB00316)|Ajmaline(DB01426)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alprenolol(DB00866)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amoxapine(DB00543)|Amphetamine(DB00182)|Amprenavir(DB00701)|Amsacrine(DB00276)|Antipyrine(DB01435)|Aprindine(DB01429)|Arformoterol(DB01274)|Aripiprazole(DB01238)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzatropine(DB00245)|Benzyl alcohol(DB06770)|Bepridil(DB01244)|Betaxolol(DB00195)|Bicalutamide(DB01128)|Biperiden(DB00810)|Bisoprolol(DB00612)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Caffeine(DB00201)|Captopril(DB01197)|Carbinoxamine(DB00748)|Carteolol(DB00521)|Carvedilol(DB01136)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Cisapride(DB00604)|Citalopram(DB00215)|Clemastine(DB00283)|Clevidipine(DB04920)|Clomipramine(DB01242)|Clonidine(DB00575)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Darifenacin(DB00496)|Debrisoquin(DB04840)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dihydrocodeine(DB01551)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronedarone(DB04855)|Duloxetine(DB00476)|Efavirenz(DB00625)|Eletriptan(DB00216)|Encainide(DB01228)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erlotinib(DB00530)|Escitalopram(DB01175)|Ethylmorphine(DB01466)|Etoricoxib(DB01628)|Felodipine(DB01023)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fingolimod(DB08868)|Flecainide(DB01195)|Flunarizine(DB04841)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Galantamine(DB00674)|Gefitinib(DB00317)|Glutethimide(DB01437)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Histamine Phosphate(DB00667)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Hydroxychloroquine(DB01611)|Hydroxyurea(DB01005)|Hydroxyzine(DB00557)|Idarubicin(DB01177)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Isoniazid(DB00951)|Itraconazole(DB01167)|Ketoconazole(DB01026)|L-DOPA(DB01235)|Labetalol(DB00598)|Lansoprazole(DB00448)|Lercanidipine(DB00528)|Levomilnacipran(DB08918)|Lidocaine(DB00281)|Lisuride(DB00589)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Lovastatin(DB00227)|Lumefantrine(DB06708)|Maprotiline(DB00934)|Mefloquine(DB00358)|Mepyramine(DB06691)|Mequitazine(DB01071)|Mesoridazine(DB00933)|Methadone(DB00333)|Methamphetamine(DB01577)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Methylnaltrexone(DB06800)|Methylphenidate(DB00422)|Methyprylon(DB01107)|Metoclopramide(DB01233)|Metoprolol(DB00264)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midodrine(DB00211)|Mifepristone(DB00834)|Minaprine(DB00805)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Morphine(DB00295)|Nateglinide(DB00731)|Nebivolol(DB04861)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niacin(DB00627)|Nicardipine(DB00622)|Nicergoline(DB00699)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitrofural(DB00336)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxamniquine(DB01096)|Oxprenolol(DB01580)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paliperidone(DB01267)|Palonosetron(DB00377)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Pergolide(DB01186)|Perhexiline(DB01074)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenformin(DB00914)|Phentermine(DB00191)|Pimozide(DB01100)|Pindolol(DB00960)|Pioglitazone(DB01132)|Piperazine(DB00592)|Pipotiazine(DB01621)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Primaquine(DB01087)|Procainamide(DB01035)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Pyrimethamine(DB00205)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Remoxipride(DB00409)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivastigmine(DB00989)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tapentadol(DB06204)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Terbinafine(DB00857)|Tetrabenazine(DB04844)|Theophylline(DB00277)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Timolol(DB00373)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tolterodine(DB01036)|Trabectedin(DB05109)|Tramadol(DB00193)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Trospium(DB00209)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vinorelbine(DB00361)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GCCCGCAGGTGAGGGAGGCGA	0.662																																							uc003bce.2		NA																	0				breast(1)|skin(1)	2						c.(565-567)CTC>CTT		cytochrome P450, family 2, subfamily D,							21.0	18.0	19.0					22																	42524885		2192	4269	6461	SO:0001819	synonymous_variant	1565						electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	g.chr22:42524885G>A	M20403	CCDS33657.1, CCDS46721.1	22q13.1	2014-09-17	2003-01-14		ENSG00000100197	ENSG00000100197		"""Cytochrome P450s"""	2625	protein-coding gene	gene with protein product		124030	"""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolizing), polypeptide 6"", ""cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 2"", ""cytochrome P450, subfamily II (debrisoquine, sparteine, etc., -metabolising), polypeptide 7 pseudogene 2"", ""cytochrome P450, family 2, subfamily D, polypeptide 8 pseudogene 2"", ""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolising), polypeptide 8 pseudogene 2"""	CYP2DL1, CYP2D7P2, CYP2D7BP, CYP2D8P2, CYP2D7AP		8449513	Standard	NM_000106		Approved	CPD6, P450-DB1, CYP2D, P450C2D	uc003bce.3	P10635	OTTHUMG00000150918	ENST00000360608.5:c.567C>T	22.37:g.42524885G>A			Somatic				uc003bcd.1_Intron|CYP2D6_uc010gyu.2_5'UTR|CYP2D6_uc003bcf.2_Silent_p.L138L	p.L189L	NM_000106	NP_000097	WXS	Illumina HiSeq	Unspecified	Q6NWU0	Q6NWU0_HUMAN			4	657	-			189					Q16752|Q2XND6|Q2XND7|Q2XNE0|Q6B012|Q6NXU8	Silent	SNP	ENST00000360608.5	37	c.567C>T	CCDS46721.1																																																																																				0.662	CYP2D6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320525.1			4	0	0	0	0	0.001168	0	4	0				
CYP2D6	1565	broad.mit.edu	37	22	42525130	42525130	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:42525130G>A	ENST00000360608.5	-	3	524	c.410C>T	c.(409-411)tCc>tTc	p.S137F	CYP2D6_ENST00000389970.3_Missense_Mutation_p.S137F|NDUFA6-AS1_ENST00000416037.2_RNA|CYP2D6_ENST00000359033.4_Intron|NDUFA6-AS1_ENST00000608491.1_RNA|NDUFA6-AS1_ENST00000439129.1_RNA|NDUFA6-AS1_ENST00000608288.1_RNA	NM_000106.5	NP_000097	P10635	CP2D6_HUMAN	cytochrome P450, family 2, subfamily D, polypeptide 6	137					alkaloid catabolic process (GO:0009822)|alkaloid metabolic process (GO:0009820)|coumarin metabolic process (GO:0009804)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|isoquinoline alkaloid metabolic process (GO:0033076)|monoterpenoid metabolic process (GO:0016098)|negative regulation of binding (GO:0051100)|negative regulation of cellular organofluorine metabolic process (GO:0090350)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(4)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21					Abiraterone(DB05812)|Acebutolol(DB01193)|Acetaminophen(DB00316)|Ajmaline(DB01426)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alprenolol(DB00866)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amoxapine(DB00543)|Amphetamine(DB00182)|Amprenavir(DB00701)|Amsacrine(DB00276)|Antipyrine(DB01435)|Aprindine(DB01429)|Arformoterol(DB01274)|Aripiprazole(DB01238)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzatropine(DB00245)|Benzyl alcohol(DB06770)|Bepridil(DB01244)|Betaxolol(DB00195)|Bicalutamide(DB01128)|Biperiden(DB00810)|Bisoprolol(DB00612)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Caffeine(DB00201)|Captopril(DB01197)|Carbinoxamine(DB00748)|Carteolol(DB00521)|Carvedilol(DB01136)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Cisapride(DB00604)|Citalopram(DB00215)|Clemastine(DB00283)|Clevidipine(DB04920)|Clomipramine(DB01242)|Clonidine(DB00575)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Darifenacin(DB00496)|Debrisoquin(DB04840)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dihydrocodeine(DB01551)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronedarone(DB04855)|Duloxetine(DB00476)|Efavirenz(DB00625)|Eletriptan(DB00216)|Encainide(DB01228)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erlotinib(DB00530)|Escitalopram(DB01175)|Ethylmorphine(DB01466)|Etoricoxib(DB01628)|Felodipine(DB01023)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fingolimod(DB08868)|Flecainide(DB01195)|Flunarizine(DB04841)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Galantamine(DB00674)|Gefitinib(DB00317)|Glutethimide(DB01437)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Histamine Phosphate(DB00667)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Hydroxychloroquine(DB01611)|Hydroxyurea(DB01005)|Hydroxyzine(DB00557)|Idarubicin(DB01177)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Isoniazid(DB00951)|Itraconazole(DB01167)|Ketoconazole(DB01026)|L-DOPA(DB01235)|Labetalol(DB00598)|Lansoprazole(DB00448)|Lercanidipine(DB00528)|Levomilnacipran(DB08918)|Lidocaine(DB00281)|Lisuride(DB00589)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Lovastatin(DB00227)|Lumefantrine(DB06708)|Maprotiline(DB00934)|Mefloquine(DB00358)|Mepyramine(DB06691)|Mequitazine(DB01071)|Mesoridazine(DB00933)|Methadone(DB00333)|Methamphetamine(DB01577)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Methylnaltrexone(DB06800)|Methylphenidate(DB00422)|Methyprylon(DB01107)|Metoclopramide(DB01233)|Metoprolol(DB00264)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midodrine(DB00211)|Mifepristone(DB00834)|Minaprine(DB00805)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Morphine(DB00295)|Nateglinide(DB00731)|Nebivolol(DB04861)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niacin(DB00627)|Nicardipine(DB00622)|Nicergoline(DB00699)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitrofural(DB00336)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxamniquine(DB01096)|Oxprenolol(DB01580)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paliperidone(DB01267)|Palonosetron(DB00377)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Pergolide(DB01186)|Perhexiline(DB01074)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenformin(DB00914)|Phentermine(DB00191)|Pimozide(DB01100)|Pindolol(DB00960)|Pioglitazone(DB01132)|Piperazine(DB00592)|Pipotiazine(DB01621)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Primaquine(DB01087)|Procainamide(DB01035)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Pyrimethamine(DB00205)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Remoxipride(DB00409)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivastigmine(DB00989)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tapentadol(DB06204)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Terbinafine(DB00857)|Tetrabenazine(DB04844)|Theophylline(DB00277)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Timolol(DB00373)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tolterodine(DB01036)|Trabectedin(DB05109)|Tramadol(DB00193)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Trospium(DB00209)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vinorelbine(DB00361)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GCGCAAGGTGGAGACGGAGAA	0.687																																							uc003bce.2		NA																	0				breast(1)|skin(1)	2						c.(409-411)TCC>TTC		cytochrome P450, family 2, subfamily D,							23.0	28.0	26.0					22																	42525130		2035	4163	6198	SO:0001583	missense	1565						electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	g.chr22:42525130G>A	M20403	CCDS33657.1, CCDS46721.1	22q13.1	2014-09-17	2003-01-14		ENSG00000100197	ENSG00000100197		"""Cytochrome P450s"""	2625	protein-coding gene	gene with protein product		124030	"""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolizing), polypeptide 6"", ""cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 2"", ""cytochrome P450, subfamily II (debrisoquine, sparteine, etc., -metabolising), polypeptide 7 pseudogene 2"", ""cytochrome P450, family 2, subfamily D, polypeptide 8 pseudogene 2"", ""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolising), polypeptide 8 pseudogene 2"""	CYP2DL1, CYP2D7P2, CYP2D7BP, CYP2D8P2, CYP2D7AP		8449513	Standard	NM_000106		Approved	CPD6, P450-DB1, CYP2D, P450C2D	uc003bce.3	P10635	OTTHUMG00000150918	ENST00000360608.5:c.410C>T	22.37:g.42525130G>A	ENSP00000353820:p.Ser137Phe		Somatic				uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Intron|CYP2D6_uc003bcf.2_Intron	p.S137F	NM_000106	NP_000097	WXS	Illumina HiSeq	Unspecified	Q6NWU0	Q6NWU0_HUMAN			3	500	-			137					Q16752|Q2XND6|Q2XND7|Q2XNE0|Q6B012|Q6NXU8	Missense_Mutation	SNP	ENST00000360608.5	37	c.410C>T	CCDS46721.1	.	.	.	.	.	.	.	.	.	.	g	12.85	2.062108	0.36373	.	.	ENSG00000100197	ENST00000360608;ENST00000389970;ENST00000413640	T;T	0.80033	-1.33;-1.33	4.09	3.06	0.35304	.	0.440006	0.20316	N	0.094740	D	0.90865	0.7130	H	0.96142	3.775	0.46356	D	0.999002	D	0.89917	1.0	D	0.70716	0.97	D	0.89609	0.3840	10	0.72032	D	0.01	.	6.272	0.20959	0.1079:0.1892:0.7029:0.0	.	137	Q6NWU0	.	F	137;137;86	ENSP00000353820:S137F;ENSP00000374620:S137F	ENSP00000353820:S137F	S	-	2	0	CYP2D6	40855074	0.018000	0.18449	0.603000	0.28903	0.016000	0.09150	1.627000	0.37050	1.013000	0.39391	0.305000	0.20034	TCC		0.687	CYP2D6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320525.1			16	40	0	0	0	0.004007	0	16	40				
GRAMD4	23151	broad.mit.edu	37	22	47022849	47022849	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:47022849G>C	ENST00000406902.1	+	2	366	c.153G>C	c.(151-153)ctG>ctC	p.L51L	GRAMD4_ENST00000361034.3_Silent_p.L51L|GRAMD4_ENST00000490378.1_Intron			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	51					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		GCGAGGAGCTGAGGGACCCTG	0.652																																							uc003bhx.2		NA																	0				ovary(1)	1						c.(151-153)CTG>CTC		death-inducing-protein							71.0	60.0	64.0					22																	47022849		2203	4300	6503	SO:0001819	synonymous_variant	23151				apoptosis	integral to membrane|mitochondrial membrane		g.chr22:47022849G>C		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.153G>C	22.37:g.47022849G>C			Somatic					p.L51L	NM_015124	NP_055939	WXS	Illumina HiSeq	Unspecified	Q6IC98	GRAM4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)	1	192	+		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)	51					A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Silent	SNP	ENST00000406902.1	37	c.153G>C	CCDS33672.1																																																																																				0.652	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124		6	84	0	0	0	0.001168	0	6	84				
TUBGCP6	85378	broad.mit.edu	37	22	50667893	50667893	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:50667893C>G	ENST00000248846.5	-	4	1334	c.1230G>C	c.(1228-1230)ctG>ctC	p.L410L	TUBGCP6_ENST00000439308.2_Silent_p.L410L			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	410					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGAAATGACTCAGGCGCGTGT	0.587																																							uc003bkb.1		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1228-1230)CTG>CTC		tubulin, gamma complex associated protein 6							80.0	56.0	65.0					22																	50667893		2203	4300	6503	SO:0001819	synonymous_variant	85378				G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding	g.chr22:50667893C>G	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1230G>C	22.37:g.50667893C>G			Somatic				TUBGCP6_uc010har.1_Silent_p.L410L|TUBGCP6_uc010has.1_RNA	p.L410L	NM_020461	NP_065194	WXS	Illumina HiSeq	Unspecified	Q96RT7	GCP6_HUMAN		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)	4	1742	-		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	410					Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Silent	SNP	ENST00000248846.5	37	c.1230G>C	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	C	4.770	0.143248	0.09083	.	.	ENSG00000128159	ENST00000434349	.	.	.	5.04	-6.68	0.01778	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9173	0.47144	0.0:0.2934:0.5047:0.2019	.	.	.	.	S	154	.	.	X	-	2	2	TUBGCP6	49010020	0.201000	0.23410	0.956000	0.39512	0.376000	0.30014	-0.552000	0.06020	-0.766000	0.04639	0.462000	0.41574	TGA		0.587	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461		10	23	0	0	0	0.001368	0	10	23				
PLXNB2	23654	broad.mit.edu	37	22	50728234	50728234	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:50728234C>T	ENST00000449103.1	-	3	920	c.780G>A	c.(778-780)ctG>ctA	p.L260L	PLXNB2_ENST00000359337.4_Silent_p.L260L			O15031	PLXB2_HUMAN	plexin B2	260	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGTCCATCTCCAGGTAGGAGT	0.642																																							uc003bkv.3		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(778-780)CTG>CTA		plexin B2 precursor							47.0	50.0	49.0					22																	50728234		2064	4185	6249	SO:0001819	synonymous_variant	23654				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity	g.chr22:50728234C>T		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.780G>A	22.37:g.50728234C>T			Somatic					p.L260L	NM_012401	NP_036533	WXS	Illumina HiSeq	Unspecified	O15031	PLXB2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	3	886	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	260			Extracellular (Potential).|Sema.		A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	c.780G>A	CCDS43035.1																																																																																				0.642	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		29	42	0	0	0	0.004878	0	29	42				
TAMM41	132001	broad.mit.edu	37	3	11851124	11851124	+	Missense_Mutation	SNP	C	C	G	rs140106641	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:11851124C>G	ENST00000444133.2	-	6	883	c.741G>C	c.(739-741)caG>caC	p.Q247H	TAMM41_ENST00000455809.1_Missense_Mutation_p.Q247H|TAMM41_ENST00000273037.5_Missense_Mutation_p.Q247H			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)	247					cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										ATGTCATCAGCTGAGTGAACT	0.398																																							uc003bwh.2		NA																	0					0						c.(739-741)CAG>CAC		MMP37-like protein, mitochondrial precursor							141.0	137.0	138.0					3																	11851124		2203	4300	6503	SO:0001583	missense	132001				protein import into mitochondrial matrix	extrinsic to mitochondrial inner membrane		g.chr3:11851124C>G		CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.741G>C	3.37:g.11851124C>G	ENSP00000388598:p.Gln247His		Somatic				C3orf31_uc003bwj.2_Missense_Mutation_p.Q247H|C3orf31_uc003bwi.2_RNA|C3orf31_uc011auo.1_Missense_Mutation_p.Q247H	p.Q247H	NM_138807	NP_620162	WXS	Illumina HiSeq	Unspecified	Q96BW9	MMP37_HUMAN			6	983	-			247					B4DIY7|C9J2U4	Missense_Mutation	SNP	ENST00000444133.2	37	c.741G>C		.	.	.	.	.	.	.	.	.	.	C	12.13	1.846863	0.32606	.	.	ENSG00000144559	ENST00000455809;ENST00000273037;ENST00000444133	T;T;T	0.30448	1.53;1.53;1.53	5.49	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.23054	0.0557	L	0.33245	0.995	0.52099	D	0.999942	B;B;B	0.27166	0.166;0.17;0.016	B;B;B	0.33568	0.097;0.166;0.009	T	0.03728	-1.1009	10	0.10636	T	0.68	-45.1893	10.1644	0.42871	0.0:0.8303:0.0:0.1697	.	247;247;247	B4DIY7;C9J2U4;Q96BW9	.;.;TAM41_HUMAN	H	247	ENSP00000398596:Q247H;ENSP00000273037:Q247H;ENSP00000388598:Q247H	ENSP00000273037:Q247H	Q	-	3	2	TAMM41	11826124	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.966000	0.49208	1.301000	0.44836	0.655000	0.94253	CAG		0.398	TAMM41-008	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000339258.2	NM_138807		20	27	0	0	0	0.004656	0	20	27				
SATB1	6304	broad.mit.edu	37	3	18419677	18419677	+	Silent	SNP	T	T	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:18419677T>G	ENST00000338745.6	-	9	3294	c.1560A>C	c.(1558-1560)gcA>gcC	p.A520A	SATB1_ENST00000417717.2_Silent_p.A520A|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Silent_p.A520A	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	520					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						TTTTGGTTGCTGCAACCTTTG	0.388																																							uc003cbh.2		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(1558-1560)GCA>GCC		special AT-rich sequence binding protein 1							153.0	145.0	148.0					3																	18419677		2203	4300	6503	SO:0001819	synonymous_variant	6304				cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding	g.chr3:18419677T>G		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1560A>C	3.37:g.18419677T>G			Somatic				SATB1_uc003cbi.2_Silent_p.A520A|SATB1_uc003cbj.2_Silent_p.A520A	p.A520A	NM_002971	NP_002962	WXS	Illumina HiSeq	Unspecified	Q01826	SATB1_HUMAN			9	3295	-			520			CUT 2.		B3KXF1|C9JTR6|Q59EQ0	Silent	SNP	ENST00000338745.6	37	c.1560A>C	CCDS2631.1																																																																																				0.388	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010		34	46	0	0	0	0.00361	0	34	46				
TRANK1	9881	broad.mit.edu	37	3	36896758	36896758	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:36896758G>A	ENST00000429976.2	-	12	4570	c.4323C>T	c.(4321-4323)ttC>ttT	p.F1441F	TRANK1_ENST00000301807.6_Silent_p.F891F|TRANK1_ENST00000428977.2_Silent_p.F891F	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1441							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TGGCATAATGGAACAGAGAGC	0.537																																							uc003cgj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2671-2673)TTC>TTT		lupus brain antigen 1							113.0	109.0	111.0					3																	36896758		2056	4204	6260	SO:0001819	synonymous_variant	9881				DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr3:36896758G>A	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4323C>T	3.37:g.36896758G>A			Somatic					p.F891F	NM_014831	NP_055646	WXS	Illumina HiSeq	Unspecified	O15050	TRNK1_HUMAN			3	2975	-			1441					Q8N8K0	Silent	SNP	ENST00000429976.2	37	c.2673C>T	CCDS46789.2																																																																																				0.537	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		29	33	0	0	0	0.007291	0	29	33				
XIRP1	165904	broad.mit.edu	37	3	39226540	39226540	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:39226540C>T	ENST00000340369.3	-	2	4625	c.4397G>A	c.(4396-4398)aGa>aAa	p.R1466K	XIRP1_ENST00000396251.1_3'UTR|XIRP1_ENST00000421646.1_Missense_Mutation_p.R149K	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1466					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TTTCTGGTTTCTTTGCAGACT	0.637																																							uc003cjk.1		NA																	0				ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8						c.(4396-4398)AGA>AAA		xin actin-binding repeat containing 1							43.0	53.0	49.0					3																	39226540		2188	4284	6472	SO:0001583	missense	165904						actin binding	g.chr3:39226540C>T	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4397G>A	3.37:g.39226540C>T	ENSP00000343140:p.Arg1466Lys		Somatic				XIRP1_uc003cji.2_3'UTR|XIRP1_uc003cjj.2_Missense_Mutation_p.R149K	p.R1466K	NM_194293	NP_919269	WXS	Illumina HiSeq	Unspecified	Q702N8	XIRP1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)	2	4618	-			1466			Potential.		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	c.4397G>A	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	0.546	-0.851707	0.02651	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.18502	3.81;2.21	4.42	4.42	0.53409	.	2.048850	0.03292	U	0.187743	T	0.15089	0.0364	N	0.25890	0.77	0.36338	D	0.859275	B	0.26002	0.139	B	0.24006	0.05	T	0.31081	-0.9956	10	0.05833	T	0.94	.	15.3214	0.74124	0.0:1.0:0.0:0.0	.	1466	Q702N8	XIRP1_HUMAN	K	1466;149	ENSP00000343140:R1466K;ENSP00000391645:R149K	ENSP00000343140:R1466K	R	-	2	0	XIRP1	39201544	0.587000	0.26791	0.870000	0.34147	0.028000	0.11728	3.154000	0.50693	2.404000	0.81709	0.655000	0.94253	AGA		0.637	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		32	37	0	0	0	0.002836	0	32	37				
CELSR3	1951	broad.mit.edu	37	3	48688384	48688384	+	Missense_Mutation	SNP	C	C	A	rs2171560		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:48688384C>A	ENST00000164024.4	-	15	6591	c.6311G>T	c.(6310-6312)gGc>gTc	p.G2104V	CELSR3_ENST00000544264.1_Missense_Mutation_p.G2104V	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2104	Laminin EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCACTGGCGGCCAAGGGCTCC	0.662																																							uc003cul.2		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(6310-6312)GGC>GTC		cadherin EGF LAG seven-pass G-type receptor 3							38.0	42.0	40.0					3																	48688384		2198	4295	6493	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48688384C>A	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6311G>T	3.37:g.48688384C>A	ENSP00000164024:p.Gly2104Val		Somatic				CELSR3_uc003cuf.1_Missense_Mutation_p.G2174V|CELSR3_uc010hkg.2_Missense_Mutation_p.G82V	p.G2104V	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	15	6592	-			2104			Extracellular (Potential).|Laminin EGF-like.		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.6311G>T	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416266	0.83449	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	D;D	0.85556	-2.0;-2.0	5.05	5.05	0.67936	EGF-like, laminin (4);EGF-like region, conserved site (1);	.	.	.	.	D	0.96399	0.8825	H	0.99712	4.72	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.988;1.0	D	0.98591	1.0654	9	0.87932	D	0	.	18.7659	0.91873	0.0:1.0:0.0:0.0	.	2104;2174	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	V	2104	ENSP00000164024:G2104V;ENSP00000445694:G2104V	ENSP00000164024:G2104V	G	-	2	0	CELSR3	48663388	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.392000	0.79840	2.515000	0.84797	0.655000	0.94253	GGC		0.662	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		42	34	1	0	2.43468e-25	0.00361	3.08723e-25	42	34				
SEMA3F	6405	broad.mit.edu	37	3	50223354	50223354	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:50223354C>T	ENST00000002829.3	+	16	2104	c.1620C>T	c.(1618-1620)gtC>gtT	p.V540V	SEMA3F_ENST00000413852.1_Silent_p.V441V|SEMA3F_ENST00000434342.1_Silent_p.V509V	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	540	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CCGTGGGTGTCACACACCTGA	0.642																																							uc003cyj.2		NA																	0				lung(1)|skin(1)	2						c.(1618-1620)GTC>GTT		semaphorin 3F precursor							88.0	83.0	85.0					3																	50223354		2203	4300	6503	SO:0001819	synonymous_variant	6405				axon guidance	extracellular space|membrane	chemorepellent activity|receptor activity	g.chr3:50223354C>T	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1620C>T	3.37:g.50223354C>T			Somatic				SEMA3F_uc003cyk.2_Silent_p.V509V	p.V540V	NM_004186	NP_004177	WXS	Illumina HiSeq	Unspecified	Q13275	SEM3F_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)	16	1818	+			540			Sema.		C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	37	c.1620C>T	CCDS2811.1																																																																																				0.642	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186		34	67	0	0	0	0.00874	0	34	67				
POC1A	25886	broad.mit.edu	37	3	52130587	52130587	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:52130587G>C	ENST00000296484.2	-	10	1162	c.1123C>G	c.(1123-1125)Cag>Gag	p.Q375E	POC1A_ENST00000394970.2_Intron|POC1A_ENST00000474012.1_Missense_Mutation_p.Q337E	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	375					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						TGGCCTACCTGAGTGAGGACA	0.567																																							uc003dcu.2		NA																	0					0						c.(1123-1125)CAG>GAG		WD repeat domain 51A isoform 1							125.0	124.0	124.0					3																	52130587		2203	4300	6503	SO:0001583	missense	25886					centriole|microtubule basal body		g.chr3:52130587G>C	AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.1123C>G	3.37:g.52130587G>C	ENSP00000296484:p.Gln375Glu		Somatic				POC1A_uc003dcv.2_Missense_Mutation_p.Q337E|POC1A_uc003dcw.2_Intron	p.Q375E	NM_015426	NP_056241	WXS	Illumina HiSeq	Unspecified	Q8NBT0	POC1A_HUMAN			10	1441	-			375			Potential.		A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Missense_Mutation	SNP	ENST00000296484.2	37	c.1123C>G	CCDS2846.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531803	0.27387	.	.	ENSG00000164087	ENST00000296484;ENST00000474012	T;T	0.61980	0.06;0.06	5.45	5.45	0.79879	.	0.064346	0.64402	D	0.000005	T	0.58047	0.2095	M	0.68593	2.085	0.37831	D	0.928711	P	0.41313	0.745	B	0.37480	0.251	T	0.60806	-0.7190	10	0.16420	T	0.52	.	14.7841	0.69787	0.0:0.0:1.0:0.0	.	375	Q8NBT0	POC1A_HUMAN	E	375;337	ENSP00000296484:Q375E;ENSP00000418968:Q337E	ENSP00000296484:Q375E	Q	-	1	0	POC1A	52105627	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	5.735000	0.68587	2.568000	0.86640	0.655000	0.94253	CAG		0.567	POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349685.1	NM_015426		71	71	0	0	0	0.00361	0	71	71				
ADAMTS9	56999	broad.mit.edu	37	3	64601146	64601146	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:64601146C>T	ENST00000498707.1	-	21	3382	c.3040G>A	c.(3040-3042)Gac>Aac	p.D1014N	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.D986N	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1014	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GTCCCACCGTCACAGCTTTTT	0.403																																							uc003dmg.2		NA																	0				ovary(2)|urinary_tract(1)|skin(1)	4						c.(3040-3042)GAC>AAC		ADAM metallopeptidase with thrombospondin type 1							96.0	80.0	86.0					3																	64601146		2203	4300	6503	SO:0001583	missense	56999				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr3:64601146C>T	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3040G>A	3.37:g.64601146C>T	ENSP00000418735:p.Asp1014Asn		Somatic				ADAMTS9_uc011bfo.1_Missense_Mutation_p.D986N|ADAMTS9_uc003dmh.1_Missense_Mutation_p.D843N|ADAMTS9_uc003dmk.1_Missense_Mutation_p.D1014N|ADAMTS9_uc011bfp.1_5'UTR	p.D1014N	NM_182920	NP_891550	WXS	Illumina HiSeq	Unspecified	Q9P2N4	ATS9_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)	21	3072	-		Lung NSC(201;0.00682)	1014			TSP type-1 4.		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	c.3040G>A	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.209277	0.79240	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.60672	0.17;0.17	5.88	5.88	0.94601	.	0.119212	0.56097	D	0.000037	T	0.62804	0.2458	L	0.52266	1.64	0.80722	D	1	B;P;P;B	0.47545	0.027;0.486;0.897;0.027	B;B;P;B	0.47299	0.038;0.236;0.543;0.038	T	0.63229	-0.6684	10	0.54805	T	0.06	.	20.221	0.98325	0.0:1.0:0.0:0.0	.	986;1014;1014;1014	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	N	986;1014	ENSP00000295903:D986N;ENSP00000418735:D1014N	ENSP00000295903:D986N	D	-	1	0	ADAMTS9	64576186	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	7.487000	0.81328	2.792000	0.96026	0.555000	0.69702	GAC		0.403	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			20	13	0	0	0	0.00333	0	20	13				
PDZRN3	23024	broad.mit.edu	37	3	73433423	73433423	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:73433423C>A	ENST00000263666.4	-	10	2408	c.2294G>T	c.(2293-2295)cGc>cTc	p.R765L	PDZRN3_ENST00000479530.1_Missense_Mutation_p.R482L|PDZRN3_ENST00000462146.2_Missense_Mutation_p.R422L|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.R487L|PDZRN3_ENST00000466780.1_Missense_Mutation_p.R422L	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	765					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CGGGGTGCTGCGGCAGCTCTC	0.647																																							uc003dpl.1		NA																	0				pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(2293-2295)CGC>CTC		PDZ domain containing ring finger 3							29.0	31.0	30.0					3																	73433423		2203	4300	6503	SO:0001583	missense	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73433423C>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2294G>T	3.37:g.73433423C>A	ENSP00000263666:p.Arg765Leu		Somatic				PDZRN3_uc011bgh.1_Missense_Mutation_p.R422L|PDZRN3_uc010hoe.1_Missense_Mutation_p.R463L|PDZRN3_uc011bgf.1_Missense_Mutation_p.R482L|PDZRN3_uc011bgg.1_Missense_Mutation_p.R485L	p.R765L	NM_015009	NP_055824	WXS	Illumina HiSeq	Unspecified	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	10	2390	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	765					A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	c.2294G>T	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534655	0.85812	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000492909	T;T;T;T;T;T	0.18174	2.23;3.02;2.94;2.94;3.03;2.91	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.49592	0.1566	M	0.86420	2.815	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.997;0.998;0.978;0.994	T	0.58624	-0.7604	10	0.72032	D	0.01	.	18.1478	0.89663	0.0:1.0:0.0:0.0	.	487;482;482;765	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	L	765;487;422;422;482;463	ENSP00000263666:R765L;ENSP00000442026:R487L;ENSP00000418168:R422L;ENSP00000418484:R422L;ENSP00000418624:R482L;ENSP00000419250:R463L	ENSP00000263666:R765L	R	-	2	0	PDZRN3	73516113	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.451000	0.80668	2.370000	0.80446	0.655000	0.94253	CGC		0.647	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		10	18	1	0	4.36969e-10	0.001855	4.93028e-10	10	18				
ZPLD1	131368	broad.mit.edu	37	3	102187849	102187849	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:102187849G>A	ENST00000491959.1	+	15	1685	c.803G>A	c.(802-804)cGa>cAa	p.R268Q	ZPLD1_ENST00000306176.1_Missense_Mutation_p.R284Q|ZPLD1_ENST00000466937.1_Missense_Mutation_p.R268Q			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	268	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						GAGAATGGCCGAAGCCAGCGG	0.478																																							uc003dvs.1		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(802-804)CGA>CAA		zona pellucida-like domain containing 1							73.0	73.0	73.0					3																	102187849		2203	4300	6503	SO:0001583	missense	131368					integral to membrane		g.chr3:102187849G>A	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.803G>A	3.37:g.102187849G>A	ENSP00000420265:p.Arg268Gln		Somatic				ZPLD1_uc003dvt.1_Missense_Mutation_p.R284Q|ZPLD1_uc011bhg.1_Missense_Mutation_p.R268Q	p.R268Q	NM_175056	NP_778226	WXS	Illumina HiSeq	Unspecified	Q8TCW7	ZPLD1_HUMAN			15	1685	+			268			ZP.|Extracellular (Potential).		Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37	c.803G>A		.	.	.	.	.	.	.	.	.	.	G	13.74	2.328121	0.41197	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.81499	-1.5;-1.5;-1.5	5.46	3.4	0.38934	Zona pellucida sperm-binding protein (3);	0.085474	0.85682	D	0.000000	T	0.49813	0.1579	N	0.03608	-0.345	0.35690	D	0.8148	B;B	0.31680	0.335;0.044	B;B	0.24394	0.024;0.053	T	0.51631	-0.8681	10	0.13853	T	0.58	-0.9162	4.1468	0.10220	0.4932:0.0:0.5067:0.0	.	284;268	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	Q	268;284;268	ENSP00000420265:R268Q;ENSP00000307801:R284Q;ENSP00000418253:R268Q	ENSP00000307801:R284Q	R	+	2	0	ZPLD1	103670539	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.338000	0.59316	1.299000	0.44798	0.455000	0.32223	CGA		0.478	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056		14	60	0	0	0	0.004007	0	14	60				
CD47	961	broad.mit.edu	37	3	107798905	107798905	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:107798905G>C	ENST00000361309.5	-	2	438	c.333C>G	c.(331-333)aaC>aaG	p.N111K	CD47_ENST00000355354.7_Missense_Mutation_p.N111K	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule	111	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			CACAAGTGTAGTTTCCTGTGT	0.363																																							uc003dwt.1		NA																	0				ovary(1)	1						c.(331-333)AAC>AAG		CD47 antigen isoform 1 precursor							245.0	215.0	224.0					3																	107798905		1885	4127	6012	SO:0001583	missense	961				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity	g.chr3:107798905G>C		CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.333C>G	3.37:g.107798905G>C	ENSP00000355361:p.Asn111Lys		Somatic				CD47_uc003dwu.1_Missense_Mutation_p.N111K|CD47_uc003dwv.1_Missense_Mutation_p.N111K|CD47_uc003dww.1_Missense_Mutation_p.N111K	p.N111K	NM_001777	NP_001768	WXS	Illumina HiSeq	Unspecified	Q08722	CD47_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)		2	513	-			111			Extracellular (Potential).|Ig-like V-type.		A8K198|D3DN59|Q53Y71|Q96A60	Missense_Mutation	SNP	ENST00000361309.5	37	c.333C>G	CCDS43126.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914596	0.33815	.	.	ENSG00000196776	ENST00000355354;ENST00000361309	T;T	0.02525	4.26;4.26	6.04	1.75	0.24633	Immunoglobulin-like (1);CD47 immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.05593	0.0147	L	0.57536	1.79	0.38995	D	0.95923	D;D;D;D	0.62365	0.989;0.989;0.991;0.991	P;P;P;P	0.52554	0.577;0.577;0.702;0.702	T	0.39375	-0.9617	10	0.52906	T	0.07	.	4.8499	0.13531	0.2874:0.0:0.56:0.1526	.	111;111;111;111	Q08722-2;Q08722-3;E9PB22;Q08722	.;.;.;CD47_HUMAN	K	111	ENSP00000347512:N111K;ENSP00000355361:N111K	ENSP00000347512:N111K	N	-	3	2	CD47	109281595	1.000000	0.71417	0.999000	0.59377	0.008000	0.06430	1.804000	0.38873	0.441000	0.26529	-0.291000	0.09656	AAC		0.363	CD47-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000102793.1	NM_001777		51	190	0	0	0	0.00361	0	51	190				
CD47	961	broad.mit.edu	37	3	107798924	107798924	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:107798924G>C	ENST00000361309.5	-	2	419	c.314C>G	c.(313-315)gCt>gGt	p.A105G	CD47_ENST00000355354.7_Missense_Mutation_p.A105G	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule	105	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			GTGTGAGACAGCATCACTCTT	0.393																																							uc003dwt.1		NA																	0				ovary(1)	1						c.(313-315)GCT>GGT		CD47 antigen isoform 1 precursor							238.0	209.0	218.0					3																	107798924		1896	4125	6021	SO:0001583	missense	961				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity	g.chr3:107798924G>C		CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.314C>G	3.37:g.107798924G>C	ENSP00000355361:p.Ala105Gly		Somatic				CD47_uc003dwu.1_Missense_Mutation_p.A105G|CD47_uc003dwv.1_Missense_Mutation_p.A105G|CD47_uc003dww.1_Missense_Mutation_p.A105G	p.A105G	NM_001777	NP_001768	WXS	Illumina HiSeq	Unspecified	Q08722	CD47_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)		2	494	-			105			Extracellular (Potential).|Ig-like V-type.		A8K198|D3DN59|Q53Y71|Q96A60	Missense_Mutation	SNP	ENST00000361309.5	37	c.314C>G	CCDS43126.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397964	0.62177	.	.	ENSG00000196776	ENST00000355354;ENST00000361309	T;T	0.02812	4.15;4.15	6.04	5.17	0.71159	Immunoglobulin-like (1);CD47 immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.077307	0.56097	D	0.000034	T	0.07773	0.0195	M	0.66939	2.045	0.34363	D	0.691245	D;D;P;P	0.53745	0.962;0.962;0.9;0.9	P;P;P;P	0.49361	0.608;0.608;0.502;0.502	T	0.13953	-1.0490	10	0.62326	D	0.03	.	12.3381	0.55079	0.0784:0.0:0.9216:0.0	.	105;105;105;105	Q08722-2;Q08722-3;E9PB22;Q08722	.;.;.;CD47_HUMAN	G	105	ENSP00000347512:A105G;ENSP00000355361:A105G	ENSP00000347512:A105G	A	-	2	0	CD47	109281614	0.978000	0.34361	0.075000	0.20258	0.012000	0.07955	4.193000	0.58385	1.572000	0.49736	0.561000	0.74099	GCT		0.393	CD47-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000102793.1	NM_001777		52	185	0	0	0	0.00361	0	52	185				
MYH15	22989	broad.mit.edu	37	3	108129526	108129526	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:108129526G>C	ENST00000273353.3	-	32	4515	c.4459C>G	c.(4459-4461)Cag>Gag	p.Q1487E		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1487						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CTGAGAGCCTGAACTTCCTTC	0.572																																							uc003dxa.1		NA																	0				ovary(5)|central_nervous_system(2)	7						c.(4459-4461)CAG>GAG		myosin, heavy polypeptide 15							79.0	78.0	79.0					3																	108129526		2061	4225	6286	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108129526G>C	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4459C>G	3.37:g.108129526G>C	ENSP00000273353:p.Gln1487Glu		Somatic					p.Q1487E	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			32	4516	-			1487			Potential.			Missense_Mutation	SNP	ENST00000273353.3	37	c.4459C>G	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	G	8.377	0.836685	0.16891	.	.	ENSG00000144821	ENST00000273353	T	0.77489	-1.1	5.39	-1.08	0.09936	Myosin tail (1);	.	.	.	.	T	0.54854	0.1884	N	0.08118	0	0.09310	N	1	B	0.23128	0.08	B	0.26614	0.071	T	0.48091	-0.9065	9	0.87932	D	0	.	3.7903	0.08718	0.19:0.1167:0.5736:0.1197	.	1487	Q9Y2K3	MYH15_HUMAN	E	1487	ENSP00000273353:Q1487E	ENSP00000273353:Q1487E	Q	-	1	0	MYH15	109612216	0.006000	0.16342	0.000000	0.03702	0.005000	0.04900	0.978000	0.29488	-0.205000	0.10219	0.561000	0.74099	CAG		0.572	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		14	74	0	0	0	0.004007	0	14	74				
DZIP3	9666	broad.mit.edu	37	3	108355516	108355516	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:108355516G>T	ENST00000361582.3	+	11	1202	c.972G>T	c.(970-972)agG>agT	p.R324S	DZIP3_ENST00000463306.1_Missense_Mutation_p.R324S	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	324					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ACATGGTAAGGATGCTGCAAT	0.284																																							uc003dxd.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(970-972)AGG>AGT		DAZ interacting protein 3, zinc finger							246.0	236.0	239.0					3																	108355516		2203	4300	6503	SO:0001583	missense	9666				protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:108355516G>T	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.972G>T	3.37:g.108355516G>T	ENSP00000355028:p.Arg324Ser		Somatic				DZIP3_uc003dxf.1_Missense_Mutation_p.R324S|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Missense_Mutation_p.R324S|DZIP3_uc003dxg.1_Missense_Mutation_p.R47S	p.R324S	NM_014648	NP_055463	WXS	Illumina HiSeq	Unspecified	Q86Y13	DZIP3_HUMAN			11	1394	+			324					B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	c.972G>T	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460366	0.43736	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.40476	1.03;1.03;1.03	4.96	4.09	0.47781	.	0.105230	0.42821	D	0.000642	T	0.39332	0.1074	N	0.14661	0.345	0.33329	D	0.568367	D;B	0.61697	0.99;0.02	P;B	0.59115	0.852;0.019	T	0.54801	-0.8239	10	0.72032	D	0.01	-14.051	8.9011	0.35495	0.1005:0.0:0.8995:0.0	.	324;324	C9J9M8;Q86Y13	.;DZIP3_HUMAN	S	324	ENSP00000355028:R324S;ENSP00000418115:R324S;ENSP00000419981:R324S	ENSP00000355028:R324S	R	+	3	2	DZIP3	109838206	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.879000	0.28146	1.308000	0.44962	0.557000	0.71058	AGG		0.284	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648		46	143	1	0	3.63617e-18	0.00361	4.45431e-18	46	143				
TMPRSS7	344805	broad.mit.edu	37	3	111769520	111769520	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:111769520T>A	ENST00000452346.2	+	9	1096	c.1093T>A	c.(1093-1095)Tgt>Agt	p.C365S	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.C239S			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	365	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTTTCCAGAGTGTGAAAACAC	0.398																																							uc010hqb.2		NA																	0				ovary(1)|kidney(1)	2						c.(715-717)TGT>AGT		transmembrane protease, serine 7							205.0	190.0	195.0					3																	111769520		1867	4102	5969	SO:0001583	missense	344805				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity	g.chr3:111769520T>A	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1093T>A	3.37:g.111769520T>A	ENSP00000398236:p.Cys365Ser		Somatic				TMPRSS7_uc011bhr.1_Missense_Mutation_p.C94S	p.C239S	NM_001042575	NP_001036040	WXS	Illumina HiSeq	Unspecified	Q7RTY8	TMPS7_HUMAN			7	885	+			365			Extracellular (Potential).|CUB 2.		C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37	c.715T>A		.	.	.	.	.	.	.	.	.	.	T	14.78	2.638044	0.47153	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	D;D	0.91686	-2.89;-2.77	4.86	4.86	0.63082	CUB (3);	0.061525	0.64402	D	0.000005	D	0.94272	0.8160	L	0.58101	1.795	0.41583	D	0.988755	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.93282	0.6661	10	0.33940	T	0.23	.	12.2556	0.54621	0.0:0.0:0.0:1.0	.	365;239	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	S	365;353;339;239	ENSP00000398236:C365S;ENSP00000411645:C239S	ENSP00000411645:C239S	C	+	1	0	TMPRSS7	113252210	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.258000	0.72487	1.946000	0.56461	0.377000	0.23210	TGT		0.398	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599		81	258	0	0	0	0.00361	0	81	258				
BOC	91653	broad.mit.edu	37	3	112987214	112987214	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:112987214G>C	ENST00000495514.1	+	5	1149	c.445G>C	c.(445-447)Gcc>Ccc	p.A149P	BOC_ENST00000355385.3_Missense_Mutation_p.A149P|BOC_ENST00000273395.4_Missense_Mutation_p.A149P			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	149	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			AGCAGTCATTGCCTGCCACCT	0.572																																							uc003dzx.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(445-447)GCC>CCC		brother of CDO precursor							134.0	109.0	117.0					3																	112987214		2203	4300	6503	SO:0001583	missense	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112987214G>C	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.445G>C	3.37:g.112987214G>C	ENSP00000418663:p.Ala149Pro		Somatic				BOC_uc010hqi.2_Missense_Mutation_p.A149P|BOC_uc003dzy.2_Missense_Mutation_p.A149P|BOC_uc003dzz.2_Missense_Mutation_p.A149P|BOC_uc003eab.2_5'Flank	p.A149P	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		5	1066	+			149			Extracellular (Potential).|Ig-like C2-type 2.		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	c.445G>C	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900835	0.72754	.	.	ENSG00000144857	ENST00000495514;ENST00000498710;ENST00000273395;ENST00000355385	T;T;T	0.12147	2.71;2.71;2.71	5.72	5.72	0.89469	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.058210	0.64402	D	0.000001	T	0.09069	0.0224	N	0.02345	-0.59	0.58432	D	0.999999	B;B	0.28026	0.198;0.115	B;B	0.34346	0.171;0.18	T	0.44574	-0.9319	10	0.39692	T	0.17	.	19.8744	0.96864	0.0:0.0:1.0:0.0	.	149;149	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	P	149;46;149;149	ENSP00000418663:A149P;ENSP00000273395:A149P;ENSP00000347546:A149P	ENSP00000273395:A149P	A	+	1	0	BOC	114469904	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.540000	0.82074	2.696000	0.92011	0.585000	0.79938	GCC		0.572	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		26	23	0	0	0	0.009535	0	26	23				
KIAA2018	205717	broad.mit.edu	37	3	113375045	113375045	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:113375045G>A	ENST00000478658.1	-	5	5501	c.5484C>T	c.(5482-5484)ctC>ctT	p.L1828L	KIAA2018_ENST00000316407.4_Silent_p.L1828L|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1828						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CCTGATCACTGAGGTGAGGGG	0.468																																							uc003eam.2		NA																	0				skin(2)|ovary(1)	3						c.(5482-5484)CTC>CTT		hypothetical protein LOC205717							112.0	111.0	111.0					3																	113375045		1980	4170	6150	SO:0001819	synonymous_variant	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113375045G>A	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5484C>T	3.37:g.113375045G>A			Somatic				KIAA2018_uc003eal.2_Silent_p.L1772L	p.L1828L	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			7	5895	-			1828					Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	c.5484C>T	CCDS43133.1																																																																																				0.468	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		43	143	0	0	0	0.003214	0	43	143				
C3orf30	152405	broad.mit.edu	37	3	118867070	118867070	+	Missense_Mutation	SNP	G	G	C	rs138537972		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:118867070G>C	ENST00000295622.1	+	2	1482	c.1442G>C	c.(1441-1443)cGc>cCc	p.R481P	IGSF11_ENST00000425327.2_5'Flank|RP11-484M3.5_ENST00000490594.1_Intron|IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	481										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TATCATATACGCAATCAAACT	0.368																																							uc003ecb.1		NA																	0				ovary(2)	2						c.(1441-1443)CGC>CCC		hypothetical protein LOC152405							82.0	87.0	85.0					3																	118867070		2203	4300	6503	SO:0001583	missense	152405							g.chr3:118867070G>C	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.1442G>C	3.37:g.118867070G>C	ENSP00000295622:p.Arg481Pro		Somatic				IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.R481P	p.R481P	NM_152539	NP_689752	WXS	Illumina HiSeq	Unspecified	Q96M34	CC030_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	2	1482	+			481					A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	c.1442G>C	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	G	8.319	0.823843	0.16678	.	.	ENSG00000163424	ENST00000295622;ENST00000470341	T	0.12361	2.69	4.74	-9.42	0.00610	.	2.912760	0.01334	N	0.011339	T	0.06690	0.0171	N	0.22421	0.69	0.09310	N	1	B;P	0.44521	0.001;0.837	B;B	0.39419	0.003;0.299	T	0.35674	-0.9779	10	0.35671	T	0.21	3.7245	2.1383	0.03768	0.2517:0.3365:0.2987:0.113	.	481;481	E9PFE5;Q96M34	.;CC030_HUMAN	P	481	ENSP00000295622:R481P	ENSP00000295622:R481P	R	+	2	0	C3orf30	120349760	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.370000	0.07523	-1.711000	0.01395	-1.862000	0.00560	CGC		0.368	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		55	49	0	0	0	0.00361	0	55	49				
UPK1B	7348	broad.mit.edu	37	3	118909142	118909142	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:118909142C>T	ENST00000264234.3	+	4	470	c.321C>T	c.(319-321)atC>atT	p.I107I	UPK1B_ENST00000497685.1_Silent_p.I27I|UPK1B_ENST00000460625.1_Silent_p.I107I	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	107					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		CATCTTGTATCACAGCAGCAA	0.318																																							uc003ecc.2		NA																	0					0						c.(319-321)ATC>ATT		uroplakin 1B							152.0	152.0	152.0					3																	118909142		2203	4300	6503	SO:0001819	synonymous_variant	7348				epithelial cell differentiation	integral to membrane	structural molecule activity	g.chr3:118909142C>T	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.321C>T	3.37:g.118909142C>T			Somatic				UPK1B_uc011bix.1_Silent_p.I27I|UPK1B_uc003ecd.2_Silent_p.I107I	p.I107I	NM_006952	NP_008883	WXS	Illumina HiSeq	Unspecified	O75841	UPK1B_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	4	410	+			107			Helical; (Potential).		O60753|Q9UIM2|Q9UNX6	Silent	SNP	ENST00000264234.3	37	c.321C>T	CCDS2985.1																																																																																				0.318	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354883.2			85	117	0	0	0	0.00361	0	85	117				
TMEM39A	55254	broad.mit.edu	37	3	119180904	119180904	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:119180904C>G	ENST00000319172.5	-	2	438	c.18G>C	c.(16-18)agG>agC	p.R6S	TMEM39A_ENST00000486159.1_5'UTR	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	6						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		GACTAGGGCCCCTCCTTCCAC	0.522																																							uc003eck.1		NA																	0				ovary(1)|breast(1)	2						c.(16-18)AGG>AGC		transmembrane protein 39A							77.0	68.0	71.0					3																	119180904		2203	4300	6503	SO:0001583	missense	55254					integral to membrane		g.chr3:119180904C>G	BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.18G>C	3.37:g.119180904C>G	ENSP00000326063:p.Arg6Ser		Somatic				TMEM39A_uc003ecl.1_5'UTR	p.R6S	NM_018266	NP_060736	WXS	Illumina HiSeq	Unspecified	Q9NV64	TM39A_HUMAN		GBM - Glioblastoma multiforme(114;0.244)	2	381	-			6					D3DN80|Q53FN4|Q53GI1|Q6PKB5	Missense_Mutation	SNP	ENST00000319172.5	37	c.18G>C	CCDS2987.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996411	0.93167	.	.	ENSG00000176142	ENST00000319172;ENST00000491685;ENST00000468676;ENST00000497993;ENST00000461654	T	0.62788	-0.0	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.76140	0.3946	L	0.59436	1.845	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.77606	-0.2525	10	0.87932	D	0	-10.2771	18.1318	0.89604	0.0:1.0:0.0:0.0	.	6	Q9NV64	TM39A_HUMAN	S	6	ENSP00000326063:R6S	ENSP00000326063:R6S	R	-	3	2	TMEM39A	120663594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.278000	0.78587	2.832000	0.97577	0.655000	0.94253	AGG		0.522	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266		6	46	0	0	0	0.001984	0	6	46				
POLQ	10721	broad.mit.edu	37	3	121264695	121264695	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:121264695C>T	ENST00000264233.5	-	1	158	c.30G>A	c.(28-30)cgG>cgA	p.R10R		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	10					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CTGAACGCCGCCGTTTCCCAC	0.647								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	0				ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(28-30)CGG>CGA	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							30.0	31.0	31.0					3																	121264695		2203	4300	6503	SO:0001819	synonymous_variant	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121264695C>T	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.30G>A	3.37:g.121264695C>T			Somatic					p.R10R	NM_199420	NP_955452	WXS	Illumina HiSeq	Unspecified	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	1	159	-			10					O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	37	c.30G>A	CCDS33833.1																																																																																				0.647	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		9	35	0	0	0	0.008291	0	9	35				
IQCB1	9657	broad.mit.edu	37	3	121547718	121547718	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:121547718C>G	ENST00000310864.6	-	3	304	c.90G>C	c.(88-90)ttG>ttC	p.L30F	IQCB1_ENST00000349820.6_Missense_Mutation_p.L30F	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	30					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		CTTTTAACTTCAACAGTATAA	0.333																																							uc010hre.1		NA																	0					0						c.(88-90)TTG>TTC		IQ motif containing B1 isoform a							71.0	72.0	72.0					3																	121547718		2203	4300	6503	SO:0001583	missense	9657				cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding	g.chr3:121547718C>G	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.90G>C	3.37:g.121547718C>G	ENSP00000311505:p.Leu30Phe		Somatic				IQCB1_uc003eek.2_Missense_Mutation_p.L30F|IQCB1_uc010hrf.1_RNA	p.L30F	NM_001023570	NP_001018864	WXS	Illumina HiSeq	Unspecified	Q15051	IQCB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0983)	3	305	-			30					Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	37	c.90G>C	CCDS33837.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811109	0.50421	.	.	ENSG00000173226	ENST00000310864;ENST00000349820;ENST00000462442	T;T;T	0.10192	2.9;2.9;2.9	5.35	3.58	0.41010	.	0.089340	0.46442	D	0.000290	T	0.19127	0.0459	L	0.32530	0.975	0.24382	N	0.994781	D;D	0.76494	0.995;0.999	D;D	0.87578	0.979;0.998	T	0.02190	-1.1198	10	0.72032	D	0.01	-4.4921	7.7871	0.29097	0.0:0.8157:0.0:0.1843	.	30;30	Q15051;Q15051-2	IQCB1_HUMAN;.	F	30	ENSP00000311505:L30F;ENSP00000323756:L30F;ENSP00000419376:L30F	ENSP00000311505:L30F	L	-	3	2	IQCB1	123030408	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.002000	0.40835	0.845000	0.35118	-0.136000	0.14681	TTG		0.333	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642		5	69	0	0	0	0.000602	0	5	69				
CASR	846	broad.mit.edu	37	3	122003742	122003742	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:122003742G>A	ENST00000490131.1	+	7	3313	c.2941G>A	c.(2941-2943)Gag>Aag	p.E981K	CASR_ENST00000296154.5_Missense_Mutation_p.E981K|CASR_ENST00000498619.1_Missense_Mutation_p.E991K|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	981					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GAGCTTTGATGAGCCTCAGAA	0.572																																							uc003eev.3		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7						c.(2941-2943)GAG>AAG		calcium-sensing receptor precursor	Cinacalcet(DB01012)						72.0	67.0	69.0					3																	122003742		2203	4300	6503	SO:0001583	missense	846				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity	g.chr3:122003742G>A	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2941G>A	3.37:g.122003742G>A	ENSP00000418685:p.Glu981Lys		Somatic				CASR_uc003eew.3_Missense_Mutation_p.E991K	p.E981K	NM_000388	NP_000379	WXS	Illumina HiSeq	Unspecified	P41180	CASR_HUMAN		GBM - Glioblastoma multiforme(114;0.226)	7	3313	+			981			Cytoplasmic (Potential).		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	c.2941G>A	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406625	0.83230	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.92495	-3.05;-3.04;-3.05	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.93930	0.8057	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.73380	0.98;0.98	D	0.94451	0.7667	10	0.87932	D	0	.	19.0289	0.92946	0.0:0.0:1.0:0.0	.	991;981	E7ENE0;P41180	.;CASR_HUMAN	K	981;991;981	ENSP00000418685:E981K;ENSP00000420194:E991K;ENSP00000296154:E981K	ENSP00000296154:E981K	E	+	1	0	CASR	123486432	1.000000	0.71417	0.991000	0.47740	0.906000	0.53458	8.994000	0.93529	2.746000	0.94184	0.561000	0.74099	GAG		0.572	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388		18	68	0	0	0	0.006122	0	18	68				
COPG1	22820	broad.mit.edu	37	3	128973901	128973901	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:128973901C>T	ENST00000314797.6	+	7	577	c.473C>T	c.(472-474)tCt>tTt	p.S158F		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	158					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										GTCTCCAGCTCTGCCCTCGTG	0.517																																							uc003els.2		NA																	0				ovary(3)|breast(1)	4						c.(472-474)TCT>TTT		coatomer protein complex, subunit gamma 1							113.0	88.0	97.0					3																	128973901		2203	4300	6503	SO:0001583	missense	22820				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity	g.chr3:128973901C>T	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.473C>T	3.37:g.128973901C>T	ENSP00000325002:p.Ser158Phe		Somatic				COPG_uc010htb.2_Missense_Mutation_p.S64F	p.S158F	NM_016128	NP_057212	WXS	Illumina HiSeq	Unspecified	Q9Y678	COPG_HUMAN			7	573	+			158					A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	c.473C>T	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515358	0.85389	.	.	ENSG00000181789	ENST00000314797	T	0.27557	1.66	4.15	4.15	0.48705	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.157646	0.44285	D	0.000468	T	0.52549	0.1741	M	0.67397	2.05	0.58432	D	0.999998	D	0.60160	0.987	D	0.77557	0.99	T	0.57505	-0.7800	10	0.87932	D	0	-7.9714	13.9738	0.64257	0.0:1.0:0.0:0.0	.	158	Q9Y678	COPG_HUMAN	F	158	ENSP00000325002:S158F	ENSP00000325002:S158F	S	+	2	0	COPG	130456591	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	7.342000	0.79310	2.151000	0.67156	0.591000	0.81541	TCT		0.517	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128		19	62	0	0	0	0.002299	0	19	62				
COL6A6	131873	broad.mit.edu	37	3	130284269	130284269	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:130284269C>A	ENST00000358511.6	+	3	1124	c.1093C>A	c.(1093-1095)Ctg>Atg	p.L365M	COL6A6_ENST00000453409.2_Missense_Mutation_p.L365M	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	365	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.L365M(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CATCTTCACCCTGGGCATAGA	0.572																																							uc010htl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(1093-1095)CTG>ATG		collagen type VI alpha 6 precursor							132.0	144.0	140.0					3																	130284269		2037	4196	6233	SO:0001583	missense	131873				axon guidance|cell adhesion	collagen		g.chr3:130284269C>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1093C>A	3.37:g.130284269C>A	ENSP00000351310:p.Leu365Met		Somatic					p.L365M	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			3	1124	+			365			Nonhelical region.|VWFA 2.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	c.1093C>A	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	2.565	-0.300891	0.05495	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.83914	-1.78;-1.78	5.01	-2.4	0.06583	von Willebrand factor, type A (3);	0.506793	0.20231	N	0.096472	T	0.55210	0.1906	N	0.10685	0.025	0.26657	N	0.971998	B	0.16166	0.016	B	0.15870	0.014	T	0.40403	-0.9565	10	0.21014	T	0.42	.	1.0798	0.01640	0.3067:0.2685:0.2856:0.1392	.	365	A6NMZ7	CO6A6_HUMAN	M	365	ENSP00000351310:L365M;ENSP00000399236:L365M	ENSP00000351310:L365M	L	+	1	2	COL6A6	131766959	0.000000	0.05858	0.995000	0.50966	0.827000	0.46813	-1.071000	0.03437	-0.253000	0.09514	-0.367000	0.07326	CTG		0.572	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		93	101	1	0	5.77035e-48	0.00361	7.65659e-48	93	101				
TOPBP1	11073	broad.mit.edu	37	3	133362198	133362198	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:133362198G>C	ENST00000260810.5	-	12	1998	c.1867C>G	c.(1867-1869)Cag>Gag	p.Q623E	TOPBP1_ENST00000511439.1_5'Flank	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	623	BRCT 4. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						AACAAAGTCTGATAGTCTATG	0.373								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	Ovarian(21;193 658 4424 15423 17362)	uc003eps.2		NA																	0				ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						c.(1867-1869)CAG>GAG	Other_conserved_DNA_damage_response_genes	topoisomerase (DNA) II binding protein 1							56.0	53.0	54.0					3																	133362198		1835	4085	5920	SO:0001583	missense	11073				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding	g.chr3:133362198G>C	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.1867C>G	3.37:g.133362198G>C	ENSP00000260810:p.Gln623Glu		Somatic					p.Q623E	NM_007027	NP_008958	WXS	Illumina HiSeq	Unspecified	Q92547	TOPB1_HUMAN			12	1999	-			623			BRCT 4.		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	c.1867C>G	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	G	1.555	-0.538156	0.04082	.	.	ENSG00000163781	ENST00000260810	T	0.11277	2.79	5.86	4.0	0.46444	BRCT (3);	0.170115	0.52532	N	0.000068	T	0.06690	0.0171	N	0.17082	0.46	0.39860	D	0.973367	B	0.18166	0.026	B	0.15052	0.012	T	0.15093	-1.0449	10	0.02654	T	1	.	16.1251	0.81386	0.0:0.4477:0.5523:0.0	.	623	Q92547	TOPB1_HUMAN	E	623	ENSP00000260810:Q623E	ENSP00000260810:Q623E	Q	-	1	0	TOPBP1	134844888	1.000000	0.71417	0.861000	0.33841	0.779000	0.44077	2.842000	0.48230	0.704000	0.31869	0.655000	0.94253	CAG		0.373	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027		5	28	0	0	0	0.000602	0	5	28				
PLSCR5	389158	broad.mit.edu	37	3	146307453	146307453	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:146307453G>C	ENST00000443512.1	-	6	1767	c.764C>G	c.(763-765)gCc>gGc	p.A255G	PLSCR5-AS1_ENST00000473817.1_RNA|PLSCR5_ENST00000492200.1_Missense_Mutation_p.A255G|PLSCR5_ENST00000482567.1_Missense_Mutation_p.A243G	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	255										endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						GAGAAAACAGGCACCGATCAT	0.383																																							uc003ewb.2		NA																	0					0						c.(763-765)GCC>GGC		phospholipid scramblase family, member 5							137.0	130.0	132.0					3																	146307453		1901	4124	6025	SO:0001583	missense	389158							g.chr3:146307453G>C	AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.764C>G	3.37:g.146307453G>C	ENSP00000390111:p.Ala255Gly		Somatic				PLSCR5_uc010hvb.2_Missense_Mutation_p.A243G|PLSCR5_uc010hvc.2_Missense_Mutation_p.A255G	p.A255G	NM_001085420	NP_001078889	WXS	Illumina HiSeq	Unspecified	A0PG75	PLS5_HUMAN			6	1768	-			255					B2RXK5	Missense_Mutation	SNP	ENST00000443512.1	37	c.764C>G	CCDS46931.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324799	0.60634	.	.	ENSG00000231213	ENST00000492200;ENST00000482567;ENST00000443512	T;T;T	0.31247	1.5;1.5;1.5	5.26	5.26	0.73747	Tubby, C-terminal (1);	.	.	.	.	T	0.72542	0.3473	H	0.97874	4.095	0.54753	D	0.999983	D;D	0.89917	0.998;1.0	D;D	0.85130	0.975;0.997	D	0.84206	0.0453	9	0.87932	D	0	-13.5404	18.8599	0.92267	0.0:0.0:1.0:0.0	.	243;255	B2RXK5;A0PG75	.;PLS5_HUMAN	G	255;243;255	ENSP00000417184:A255G;ENSP00000418626:A243G;ENSP00000390111:A255G	ENSP00000390111:A255G	A	-	2	0	PLSCR5	147790143	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	9.420000	0.97426	2.460000	0.83146	0.557000	0.71058	GCC		0.383	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1	XM_371670		19	69	0	0	0	0.001882	0	19	69				
NMD3	51068	broad.mit.edu	37	3	160960298	160960298	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:160960298G>T	ENST00000460469.1	+	10	1329	c.874G>T	c.(874-876)Gca>Tca	p.A292S	NMD3_ENST00000351193.2_Missense_Mutation_p.A292S|NMD3_ENST00000472947.1_Missense_Mutation_p.A292S			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	292					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			ATTTTTAGTGGCAGATATTGA	0.333																																							uc003feb.1		NA																	0				ovary(1)	1						c.(874-876)GCA>TCA		NMD3 homolog							81.0	80.0	80.0					3																	160960298		2203	4300	6503	SO:0001583	missense	51068				protein transport	cytoplasm|nucleolus|nucleoplasm		g.chr3:160960298G>T	BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.874G>T	3.37:g.160960298G>T	ENSP00000419004:p.Ala292Ser		Somatic				NMD3_uc003fec.2_Missense_Mutation_p.A292S|NMD3_uc003fed.1_Missense_Mutation_p.A292S|NMD3_uc010hwh.2_Missense_Mutation_p.A112S	p.A292S	NM_015938	NP_057022	WXS	Illumina HiSeq	Unspecified	Q96D46	NMD3_HUMAN	Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)		11	993	+			292					D3DNM7|Q9Y2Z6	Missense_Mutation	SNP	ENST00000460469.1	37	c.874G>T	CCDS3194.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429856	0.62844	.	.	ENSG00000169251	ENST00000351193;ENST00000472947;ENST00000460469;ENST00000540137	T;T;T	0.49720	0.79;0.77;0.79	4.47	4.47	0.54385	.	0.051128	0.85682	D	0.000000	T	0.53094	0.1775	M	0.76002	2.32	0.80722	D	1	B;P;B	0.39326	0.413;0.668;0.264	B;B;B	0.40066	0.175;0.318;0.044	T	0.62412	-0.6860	10	0.59425	D	0.04	-42.7562	16.9983	0.86375	0.0:0.0:1.0:0.0	.	292;292;292	B3KT11;C9JA08;Q96D46	.;.;NMD3_HUMAN	S	292;292;292;172	ENSP00000307525:A292S;ENSP00000417559:A292S;ENSP00000419004:A292S	ENSP00000307525:A292S	A	+	1	0	NMD3	162442992	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.094000	0.94168	2.407000	0.81776	0.650000	0.86243	GCA		0.333	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353114.1	NM_015938		52	71	1	0	6.05568e-20	0.00361	7.53938e-20	52	71				
SI	6476	broad.mit.edu	37	3	164767629	164767629	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:164767629G>A	ENST00000264382.3	-	14	1609	c.1547C>T	c.(1546-1548)tCa>tTa	p.S516L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	516	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TCCTTTTGTTGAACCTTGAAT	0.284										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(1546-1548)TCA>TTA		sucrase-isomaltase	Acarbose(DB00284)						90.0	100.0	97.0					3																	164767629		2202	4285	6487	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164767629G>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1547C>T	3.37:g.164767629G>A	ENSP00000264382:p.Ser516Leu	HNSCC(35;0.089)	Somatic					p.S516L	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			14	1609	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	516			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.1547C>T	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249872	0.80024	.	.	ENSG00000090402	ENST00000264382	D	0.90620	-2.7	5.58	5.58	0.84498	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.95249	0.8459	M	0.88450	2.955	0.46396	D	0.999029	D	0.55800	0.973	P	0.56163	0.793	D	0.95735	0.8778	10	0.72032	D	0.01	.	18.5615	0.91101	0.0:0.0:1.0:0.0	.	516	P14410	SUIS_HUMAN	L	516	ENSP00000264382:S516L	ENSP00000264382:S516L	S	-	2	0	SI	166250323	1.000000	0.71417	0.966000	0.40874	0.637000	0.38172	7.163000	0.77524	2.622000	0.88805	0.585000	0.79938	TCA		0.284	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		16	83	0	0	0	0.006122	0	16	83				
SPATA16	83893	broad.mit.edu	37	3	172634193	172634193	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:172634193C>T	ENST00000351008.3	-	9	1600	c.1417G>A	c.(1417-1419)Gag>Aag	p.E473K		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	473					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TGGGACTGCTCCTTTACTCTC	0.463																																							uc003fin.3		NA																	0				ovary(2)|skin(1)	3						c.(1417-1419)GAG>AAG		spermatogenesis associated 16							223.0	208.0	213.0					3																	172634193		2203	4300	6503	SO:0001583	missense	83893				cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding	g.chr3:172634193C>T	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1417G>A	3.37:g.172634193C>T	ENSP00000341765:p.Glu473Lys		Somatic					p.E473K	NM_031955	NP_114161	WXS	Illumina HiSeq	Unspecified	Q9BXB7	SPT16_HUMAN	LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)		9	1575	-	Ovarian(172;0.00319)|Breast(254;0.197)		473					Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	c.1417G>A	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005019	0.93287	.	.	ENSG00000144962	ENST00000351008	T	0.23754	1.89	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.45013	0.1321	L	0.32530	0.975	0.41933	D	0.990572	D	0.89917	1.0	D	0.85130	0.997	T	0.26985	-1.0087	10	0.87932	D	0	-22.3122	20.8794	0.99867	0.0:1.0:0.0:0.0	.	473	Q9BXB7	SPT16_HUMAN	K	473	ENSP00000341765:E473K	ENSP00000341765:E473K	E	-	1	0	SPATA16	174116887	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.599000	0.67592	2.941000	0.99782	0.655000	0.94253	GAG		0.463	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955		122	177	0	0	0	0.00361	0	122	177				
PIK3CA	5290	broad.mit.edu	37	3	178928079	178928079	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:178928079G>C	ENST00000263967.3	+	8	1514	c.1357G>C	c.(1357-1359)Gaa>Caa	p.E453Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	453	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> Q (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).|Missing (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E453K(11)|p.E453Q(5)|p.H450fs*9(1)|p.G451_L456>V(1)|p.P449_L455del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCATGGATTAGAAGATTTGCT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2		57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		19	Substitution - Missense(16)|Complex - frameshift(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	p.E453K(5)|p.E453Q(1)|p.E453A(1)|p.P449_L455del(1)|p.G451_L456>V(1)|p.E453del(1)	endometrium(8)|breast(6)|lung(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1357-1359)GAA>CAA		phosphoinositide-3-kinase, catalytic, alpha							137.0	130.0	132.0					3																	178928079		1829	4090	5919	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178928079G>C		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1357G>C	3.37:g.178928079G>C	ENSP00000263967:p.Glu453Gln	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E453Q	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		8	1514	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		453		E -> Q (in cancer; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).	C2 PI3K-type.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1357G>C	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316818	0.81469	.	.	ENSG00000121879	ENST00000263967	T	0.71461	-0.57	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.71626	0.3362	L	0.55481	1.735	0.80722	D	1	B	0.32324	0.364	B	0.38106	0.265	T	0.66925	-0.5800	10	0.27785	T	0.31	-22.2286	19.6973	0.96031	0.0:0.0:1.0:0.0	.	453	P42336	PK3CA_HUMAN	Q	453	ENSP00000263967:E453Q	ENSP00000263967:E453Q	E	+	1	0	PIK3CA	180410773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.448000	0.97600	2.674000	0.91012	0.655000	0.94253	GAA		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			75	69	0	0	0	0.00361	0	75	69				
USP13	8975	broad.mit.edu	37	3	179478938	179478938	+	Missense_Mutation	SNP	G	G	C	rs61733591		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:179478938G>C	ENST00000263966.3	+	17	2458	c.1987G>C	c.(1987-1989)Gag>Cag	p.E663Q	USP13_ENST00000496897.1_Missense_Mutation_p.E598Q	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	663	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.|USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GCAGCTGGCCGAGATGGGTTT	0.493																																							uc003fkh.2		NA																	0				ovary(1)	1						c.(1987-1989)GAG>CAG		ubiquitin thiolesterase 13							140.0	131.0	134.0					3																	179478938		2203	4300	6503	SO:0001583	missense	8975				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr3:179478938G>C	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1987G>C	3.37:g.179478938G>C	ENSP00000263966:p.Glu663Gln		Somatic					p.E663Q	NM_003940	NP_003931	WXS	Illumina HiSeq	Unspecified	Q92995	UBP13_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)		17	2068	+	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		663			UBA 1.		A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	ENST00000263966.3	37	c.1987G>C	CCDS3235.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952339	0.73787	.	.	ENSG00000058056	ENST00000263966;ENST00000496897	T;T	0.31510	1.49;1.49	4.81	4.81	0.61882	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	M	0.67625	2.065	0.80722	D	1	P	0.45044	0.849	P	0.50490	0.642	T	0.37079	-0.9721	10	0.37606	T	0.19	-22.4049	18.2312	0.89936	0.0:0.0:1.0:0.0	.	663	Q92995	UBP13_HUMAN	Q	663;598	ENSP00000263966:E663Q;ENSP00000417146:E598Q	ENSP00000263966:E663Q	E	+	1	0	USP13	180961632	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	9.420000	0.97426	2.377000	0.81083	0.585000	0.79938	GAG		0.493	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1			40	135	0	0	0	0.00361	0	40	135				
CCDC39	339829	broad.mit.edu	37	3	180334372	180334372	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:180334372C>T	ENST00000442201.2	-	18	2637	c.2518G>A	c.(2518-2520)Gaa>Aaa	p.E840K	TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	840					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ACTAACATTTCATCAATAACT	0.308																																							uc010hxe.2		NA																	0				ovary(4)	4						c.(2518-2520)GAA>AAA		coiled-coil domain containing 39							64.0	60.0	61.0					3																	180334372		1828	4067	5895	SO:0001583	missense	339829				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton		g.chr3:180334372C>T	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2518G>A	3.37:g.180334372C>T	ENSP00000405708:p.Glu840Lys		Somatic				CCDC39_uc003fkn.2_RNA|TTC14_uc003fkm.2_Intron	p.E840K	NM_181426	NP_852091	WXS	Illumina HiSeq	Unspecified	Q9UFE4	CCD39_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		18	2633	-	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		840					B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	c.2518G>A	CCDS46964.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.20|15.20	2.761997|2.761997	0.49468|0.49468	.|.	.|.	ENSG00000145075|ENSG00000145075	ENST00000489868;ENST00000442201|ENST00000473854	T|.	0.78364|.	-1.17|.	5.24|5.24	2.06|2.06	0.26882|0.26882	.|.	.|.	.|.	.|.	.|.	T|T	0.25044|0.25044	0.0608|0.0608	N|N	0.11201|0.11201	0.11|0.11	0.80722|0.80722	D|D	1|1	B|.	0.10296|.	0.003|.	B|.	0.06405|.	0.002|.	T|T	0.03534|0.03534	-1.1027|-1.1027	9|5	0.05351|.	T|.	0.99|.	.|.	3.9865|3.9865	0.09517|0.09517	0.0:0.2428:0.4:0.3571|0.0:0.2428:0.4:0.3571	.|.	840|.	Q9UFE4|.	CCD39_HUMAN|.	K|I	12;840|23	ENSP00000405708:E840K|.	ENSP00000405708:E840K|.	E|M	-|-	1|3	0|0	CCDC39|CCDC39	181817066|181817066	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.819000|0.819000	0.46315|0.46315	2.685000|2.685000	0.46959|0.46959	0.677000|0.677000	0.31305|0.31305	0.460000|0.460000	0.39030|0.39030	GAA|ATG		0.308	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		14	11	0	0	0	0.004007	0	14	11				
CCDC39	339829	broad.mit.edu	37	3	180378460	180378460	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:180378460C>A	ENST00000442201.2	-	4	533	c.414G>T	c.(412-414)tgG>tgT	p.W138C	CCDC39_ENST00000273654.4_Missense_Mutation_p.W222C	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	138					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTTGCTGGTCCCAGTTCATTT	0.373																																							uc010hxe.2		NA																	0				ovary(4)	4						c.(412-414)TGG>TGT		coiled-coil domain containing 39							87.0	77.0	80.0					3																	180378460		1837	4087	5924	SO:0001583	missense	339829				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton		g.chr3:180378460C>A	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.414G>T	3.37:g.180378460C>A	ENSP00000405708:p.Trp138Cys		Somatic				CCDC39_uc003fkn.2_RNA	p.W138C	NM_181426	NP_852091	WXS	Illumina HiSeq	Unspecified	Q9UFE4	CCD39_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		4	529	-	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		138					B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	c.414G>T	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.671982	0.47781	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.72827	0.3509	M	0.84683	2.71	0.80722	D	1	P	0.47762	0.9	P	0.49387	0.609	T	0.74100	-0.3774	9	0.34782	T	0.22	-7.2915	14.7673	0.69648	0.1451:0.8548:0.0:0.0	.	138	Q9UFE4	CCD39_HUMAN	C	222;138	.	ENSP00000273654:W222C	W	-	3	0	CCDC39	181861154	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.250000	0.43178	2.596000	0.87737	0.585000	0.79938	TGG		0.373	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		10	11	1	0	3.07112e-06	0.000978	3.26634e-06	10	11				
LIPH	200879	broad.mit.edu	37	3	185245369	185245369	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:185245369G>C	ENST00000296252.4	-	4	672	c.531C>G	c.(529-531)ctC>ctG	p.L177L	LIPH_ENST00000424591.2_Intron	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	177			Missing (in HYPT7). {ECO:0000269|PubMed:17095700}.		lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTGCAGGGTCGAGGCCTGGAA	0.547																																							uc003fpm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(529-531)CTC>CTG		lipase, member H precursor							165.0	140.0	149.0					3																	185245369		2203	4300	6503	SO:0001819	synonymous_variant	200879				lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity	g.chr3:185245369G>C	AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.531C>G	3.37:g.185245369G>C			Somatic				LIPH_uc010hyh.2_Intron	p.L177L	NM_139248	NP_640341	WXS	Illumina HiSeq	Unspecified	Q8WWY8	LIPH_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)		4	641	-	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		177		Missing (in LAH2).			A2IBA7|Q8TEC7	Silent	SNP	ENST00000296252.4	37	c.531C>G	CCDS3272.1																																																																																				0.547	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345153.1			40	34	0	0	0	0.006999	0	40	34				
PDE6B	5158	broad.mit.edu	37	4	649750	649750	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:649750G>T	ENST00000496514.1	+	7	1035	c.1014G>T	c.(1012-1014)tgG>tgT	p.W338C	RP11-1191J2.2_ENST00000599030.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA|PDE6B_ENST00000255622.6_Missense_Mutation_p.W338C|PDE6B_ENST00000429163.2_Missense_Mutation_p.W59C|RP11-1191J2.2_ENST00000598370.1_RNA|RP11-1191J2.2_ENST00000489312.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	338	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CCGATCACTGGGCCCTGGCCA	0.652																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	0					0						c.(1012-1014)TGG>TGT		phosphodiesterase 6B isoform 1							85.0	77.0	80.0					4																	649750		2203	4300	6503	SO:0001583	missense	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:649750G>T	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1014G>T	4.37:g.649750G>T	ENSP00000420295:p.Trp338Cys		Somatic				PDE6B_uc003gao.3_Missense_Mutation_p.W338C|PDE6B_uc011buy.1_Missense_Mutation_p.W59C|uc003gaq.1_5'Flank	p.W338C	NM_000283	NP_000274	WXS	Illumina HiSeq	Unspecified	P35913	PDE6B_HUMAN			7	1067	+			338			GAF 2.		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	c.1014G>T	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460243	0.84317	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000487902;ENST00000429163	T;T;T;T	0.80214	-0.21;-0.21;-1.35;-0.21	4.85	4.85	0.62838	GAF (2);	0.000000	0.85682	D	0.000000	D	0.91061	0.7187	M	0.89658	3.05	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.975	D	0.92614	0.6102	10	0.59425	D	0.04	.	15.4478	0.75243	0.0:0.0:1.0:0.0	.	338;338	P35913;P35913-2	PDE6B_HUMAN;.	C	338;338;59;59	ENSP00000255622:W338C;ENSP00000420295:W338C;ENSP00000418256:W59C;ENSP00000406334:W59C	ENSP00000255622:W338C	W	+	3	0	PDE6B	639750	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.409000	0.97331	2.227000	0.72691	0.491000	0.48974	TGG		0.652	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		33	92	1	0	1.03484e-13	0.005524	1.20526e-13	33	92				
MYL5	4636	broad.mit.edu	37	4	673776	673776	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:673776G>T	ENST00000400159.2	+	4	366	c.261G>T	c.(259-261)atG>atT	p.M87I	MYL5_ENST00000506838.1_Missense_Mutation_p.M46I|MYL5_ENST00000505477.1_Missense_Mutation_p.M46I|MYL5_ENST00000511290.1_Missense_Mutation_p.M46I	NM_002477.1	NP_002468.1	Q02045	MYL5_HUMAN	myosin, light chain 5, regulatory	87					regulation of muscle contraction (GO:0006937)	muscle myosin complex (GO:0005859)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(1)|kidney(1)|lung(1)	3						ACTTCACCATGTTTCTGAACC	0.567																																							uc003gav.2		NA																	0					0						c.(259-261)ATG>ATT		myosin regulatory light chain 5							82.0	97.0	92.0					4																	673776		2197	4300	6497	SO:0001583	missense	4636				regulation of muscle contraction	muscle myosin complex	calcium ion binding|structural constituent of muscle	g.chr4:673776G>T		CCDS43197.1	4p16	2013-01-10	2006-09-29		ENSG00000215375	ENSG00000215375		"""Myosins / Light chain"", ""EF-hand domain containing"""	7586	protein-coding gene	gene with protein product		160782	"""myosin, light polypeptide 5, regulatory"""			1284596	Standard	NM_002477		Approved		uc003gav.3	Q02045	OTTHUMG00000159971	ENST00000400159.2:c.261G>T	4.37:g.673776G>T	ENSP00000383023:p.Met87Ile		Somatic				MYL5_uc003gat.2_RNA|MYL5_uc003gau.2_RNA	p.M87I	NM_002477	NP_002468	WXS	Illumina HiSeq	Unspecified	Q02045	MYL5_HUMAN			4	366	+			87					Q8IXL8	Missense_Mutation	SNP	ENST00000400159.2	37	c.261G>T	CCDS43197.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313481	0.40996	.	.	ENSG00000215375	ENST00000506838;ENST00000505477;ENST00000511290;ENST00000400159;ENST00000507804	T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16	4.12	4.12	0.48240	EF-hand-like domain (1);	0.000000	0.37304	U	0.002147	T	0.77280	0.4107	M	0.78916	2.43	0.28866	N	0.895252	B	0.09022	0.002	B	0.04013	0.001	T	0.72646	-0.4230	10	0.48119	T	0.1	.	13.8469	0.63472	0.0:0.0:1.0:0.0	.	87	Q02045	MYL5_HUMAN	I	46;46;46;87;92	ENSP00000427153:M46I;ENSP00000423118:M46I;ENSP00000425162:M46I;ENSP00000383023:M87I;ENSP00000427317:M92I	ENSP00000383023:M87I	M	+	3	0	MYL5	663776	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	3.248000	0.51430	1.843000	0.53566	0.561000	0.74099	ATG		0.567	MYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358570.2	NM_002477		25	52	1	0	1.06801e-11	0.009535	1.22518e-11	25	52				
KLHL5	51088	broad.mit.edu	37	4	39077583	39077583	+	Splice_Site	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:39077583A>G	ENST00000504108.1	+	2	804		c.e2-1		KLHL5_ENST00000381930.3_Splice_Site|KLHL5_ENST00000261426.5_Intron|KLHL5_ENST00000508137.2_Splice_Site|KLHL5_ENST00000359687.2_Splice_Site|KLHL5_ENST00000261425.3_Splice_Site	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						TTTTCTTTTCAGGACTTCCAA	0.323																																							uc003gts.2		NA																	0				ovary(1)	1						c.e2-2		kelch-like 5 isoform 1							91.0	93.0	92.0					4																	39077583		2203	4300	6503	SO:0001630	splice_region_variant	51088					cytoplasm|cytoskeleton	actin binding	g.chr4:39077583A>G	AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.522-1A>G	4.37:g.39077583A>G			Somatic				KLHL5_uc003gtp.2_Splice_Site_p.R128_splice|KLHL5_uc003gtq.2_Splice_Site|KLHL5_uc003gtr.1_Splice_Site_p.R174_splice|KLHL5_uc003gtt.2_Intron	p.R174_splice	NM_015990	NP_057074	WXS	Illumina HiSeq	Unspecified	Q96PQ7	KLHL5_HUMAN			2	597	+								A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Splice_Site	SNP	ENST00000504108.1	37	c.522_splice	CCDS33974.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.947191	0.73672	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000504108;ENST00000359687;ENST00000381930	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6139	0.76750	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLHL5	38753978	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.693000	0.68264	2.154000	0.67381	0.383000	0.25322	.		0.323	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1		Intron	18	52	0	0	0	0.00278	0	18	52				
NSUN7	79730	broad.mit.edu	37	4	40810350	40810350	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:40810350G>C	ENST00000381782.2	+	12	2046	c.1551G>C	c.(1549-1551)gtG>gtC	p.V517V	NSUN7_ENST00000316607.5_Nonstop_Mutation_p.*476S	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	517							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CAGTGTCTGTGAATGATGTTT	0.413																																							uc003gvj.3		NA																	0					0						c.(1549-1551)GTG>GTC		NOL1/NOP2/Sun domain family, member 7							91.0	85.0	87.0					4																	40810350		2203	4300	6503	SO:0001819	synonymous_variant	79730							g.chr4:40810350G>C	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1551G>C	4.37:g.40810350G>C			Somatic				NSUN7_uc003gvi.3_Nonstop_Mutation_p.*476S	p.V517V	NM_024677	NP_078953	WXS	Illumina HiSeq	Unspecified					12	2046	+								C9JI19|Q8N9K8|Q9H815	Silent	SNP	ENST00000381782.2	37	c.1551G>C	CCDS3461.2	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921555	0.52653	.	.	ENSG00000179299	ENST00000316607	.	.	.	5.6	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.7061	5.7462	0.18122	0.0799:0.2983:0.5068:0.1151	.	.	.	.	S	476	.	.	X	+	2	2	NSUN7	40505107	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	0.521000	0.22893	1.320000	0.45209	0.591000	0.81541	TGA		0.413	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677		7	117	0	0	0	0.006214	0	7	117				
GABRG1	2565	broad.mit.edu	37	4	46067385	46067385	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:46067385G>C	ENST00000295452.4	-	4	705	c.538C>G	c.(538-540)Cta>Gta	p.L180V		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	180					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TATTACCTTAGAGTATACAGA	0.313																																							uc003gxb.2		NA																	0				ovary(2)	2						c.(538-540)CTA>GTA		gamma-aminobutyric acid A receptor, gamma 1							59.0	59.0	59.0					4																	46067385		2203	4300	6503	SO:0001583	missense	2565				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr4:46067385G>C	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.538C>G	4.37:g.46067385G>C	ENSP00000295452:p.Leu180Val		Somatic					p.L180V	NM_173536	NP_775807	WXS	Illumina HiSeq	Unspecified	Q8N1C3	GBRG1_HUMAN		Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	4	690	-			180			Extracellular (Probable).		Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	c.538C>G	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872479	0.33069	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.78924	-1.22	5.08	-1.27	0.09347	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	D	0.000003	T	0.77061	0.4075	L	0.33339	1.005	0.30031	N	0.813481	P	0.41265	0.744	P	0.54924	0.764	T	0.76688	-0.2867	10	0.87932	D	0	.	13.5386	0.61659	0.5489:0.0:0.4511:0.0	.	180	Q8N1C3	GBRG1_HUMAN	V	180	ENSP00000295452:L180V	ENSP00000295452:L180V	L	-	1	2	GABRG1	45762142	0.127000	0.22367	0.006000	0.13384	0.081000	0.17604	0.473000	0.22132	-0.536000	0.06298	-1.338000	0.01255	CTA		0.313	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		16	30	0	0	0	0.004007	0	16	30				
GABRB1	2560	broad.mit.edu	37	4	47427732	47427732	+	Silent	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:47427732C>A	ENST00000295454.3	+	9	1414	c.1122C>A	c.(1120-1122)atC>atA	p.I374I	GABRB1_ENST00000538619.1_Silent_p.I304I	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	374					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCCTGGAAATCCGGAATGAGA	0.562																																							uc003gxh.2		NA																	0				ovary(2)	2						c.(1120-1122)ATC>ATA		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						75.0	75.0	75.0					4																	47427732		2203	4300	6503	SO:0001819	synonymous_variant	2560				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:47427732C>A		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1122C>A	4.37:g.47427732C>A			Somatic				GABRB1_uc011bze.1_Silent_p.I304I	p.I374I	NM_000812	NP_000803	WXS	Illumina HiSeq	Unspecified	P18505	GBRB1_HUMAN			9	1496	+			374			Cytoplasmic (Probable).		B2R6U7|D6REL3|Q16166|Q8TBK3	Silent	SNP	ENST00000295454.3	37	c.1122C>A	CCDS3474.1																																																																																				0.562	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1			27	55	1	0	8.73648e-17	0.004289	1.05144e-16	27	55				
FRYL	285527	broad.mit.edu	37	4	48611798	48611798	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:48611798G>C	ENST00000503238.1	-	5	453	c.454C>G	c.(454-456)Cta>Gta	p.L152V	FRYL_ENST00000358350.4_Missense_Mutation_p.L152V|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Missense_Mutation_p.L152V|FRYL_ENST00000537810.1_Missense_Mutation_p.L152V			O94915	FRYL_HUMAN	FRY-like	152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GCTAAGTTTAGAACTTCATGA	0.303																																							uc003gyh.1		NA																	0				skin(1)	1						c.(454-456)CTA>GTA		furry-like							68.0	62.0	64.0					4																	48611798		1822	4078	5900	SO:0001583	missense	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48611798G>C	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.454C>G	4.37:g.48611798G>C	ENSP00000426064:p.Leu152Val		Somatic				FRYL_uc003gyk.2_Missense_Mutation_p.L152V	p.L152V	NM_015030	NP_055845	WXS	Illumina HiSeq	Unspecified	O94915	FRYL_HUMAN			8	1059	-			152					O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	c.454C>G	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	G	2.439	-0.329090	0.05314	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.14	4.89	3.12	0.35913	Armadillo-type fold (1);	0.000000	0.53938	U	0.000048	T	0.49406	0.1555	N	0.19112	0.55	0.80722	D	1	B;B	0.24882	0.113;0.044	B;B	0.25140	0.052;0.058	T	0.43376	-0.9395	10	0.02654	T	1	.	11.7036	0.51585	0.1529:0.0:0.8471:0.0	.	152;152	F2Z2S2;O94915	.;FRYL_HUMAN	V	152	ENSP00000426064:L152V;ENSP00000351113:L152V;ENSP00000441114:L152V;ENSP00000421584:L152V	ENSP00000351113:L152V	L	-	1	2	FRYL	48306555	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.377000	0.34317	1.193000	0.43086	0.460000	0.39030	CTA		0.303	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			4	29	0	0	0	0.001168	0	4	29				
LRRC66	339977	broad.mit.edu	37	4	52860629	52860629	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:52860629C>A	ENST00000343457.3	-	4	2565	c.2559G>T	c.(2557-2559)caG>caT	p.Q853H		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	853						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTGGTGTTTGCTGTAAAACGT	0.398																																							uc003gzi.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2557-2559)CAG>CAT		leucine rich repeat containing 66							89.0	86.0	87.0					4																	52860629		1893	4114	6007	SO:0001583	missense	339977					integral to membrane		g.chr4:52860629C>A	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2559G>T	4.37:g.52860629C>A	ENSP00000341944:p.Gln853His		Somatic					p.Q853H	NM_001024611	NP_001019782	WXS	Illumina HiSeq	Unspecified	Q68CR7	LRC66_HUMAN			4	2572	-			853						Missense_Mutation	SNP	ENST00000343457.3	37	c.2559G>T	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	9.196	1.027352	0.19512	.	.	ENSG00000188993	ENST00000343457	T	0.29142	1.58	4.11	-2.67	0.06059	.	0.546120	0.15523	N	0.257946	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	P	0.35542	0.508	B	0.26094	0.066	T	0.16070	-1.0415	10	0.66056	D	0.02	-3.941	5.0277	0.14393	0.0:0.4264:0.1854:0.3882	.	853	Q68CR7	LRC66_HUMAN	H	853	ENSP00000341944:Q853H	ENSP00000341944:Q853H	Q	-	3	2	LRRC66	52555386	0.239000	0.23836	0.001000	0.08648	0.000000	0.00434	-0.087000	0.11215	-0.306000	0.08818	-1.077000	0.02231	CAG		0.398	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611		35	77	1	0	1.04594e-18	0.00623	1.28818e-18	35	77				
PDCL2	132954	broad.mit.edu	37	4	56448305	56448305	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:56448305G>T	ENST00000295645.4	-	2	208	c.106C>A	c.(106-108)Cgt>Agt	p.R36S		NM_152401.2	NP_689614.2	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	36								p.R36C(1)		endometrium(1)|kidney(1)|lung(4)|ovary(1)	7	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			TTCTGTAAACGTAAAACCATT	0.363																																							uc003hbb.2		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(106-108)CGT>AGT		phosducin-like 2							188.0	171.0	176.0					4																	56448305		1878	4108	5986	SO:0001583	missense	132954							g.chr4:56448305G>T	BC034431	CCDS47059.1	4q12	2008-02-05			ENSG00000163440	ENSG00000163440			29524	protein-coding gene	gene with protein product		611676				12424248	Standard	NM_152401		Approved	GCPHLP	uc003hbb.3	Q8N4E4	OTTHUMG00000160674	ENST00000295645.4:c.106C>A	4.37:g.56448305G>T	ENSP00000295645:p.Arg36Ser		Somatic					p.R36S	NM_152401	NP_689614	WXS	Illumina HiSeq	Unspecified	Q8N4E4	PDCL2_HUMAN	LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)		2	209	-	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		36					A8MWA2|B9ZVQ9	Missense_Mutation	SNP	ENST00000295645.4	37	c.106C>A	CCDS47059.1	.	.	.	.	.	.	.	.	.	.	G	6.895	0.534657	0.13188	.	.	ENSG00000163440	ENST00000295645	T	0.48836	0.8	4.99	3.27	0.37495	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);	0.095855	0.46758	D	0.000280	T	0.30262	0.0759	N	0.21373	0.66	0.28708	N	0.903704	B	0.14438	0.01	B	0.23716	0.048	T	0.21484	-1.0244	10	0.14656	T	0.56	-32.764	9.1689	0.37069	0.081:0.1436:0.7754:0.0	.	36	Q8N4E4	PDCL2_HUMAN	S	36	ENSP00000295645:R36S	ENSP00000295645:R36S	R	-	1	0	PDCL2	56143062	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.155000	0.50700	0.624000	0.30286	-2.057000	0.00402	CGT		0.363	PDCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361659.1	NM_152401		8	40	1	0	0.00307968	0.00308	0.00316741	8	40				
PAICS	10606	broad.mit.edu	37	4	57314715	57314715	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:57314715A>G	ENST00000512576.1	+	4	686	c.525A>G	c.(523-525)atA>atG	p.I175M	PAICS_ENST00000514888.1_Missense_Mutation_p.I83M|PAICS_ENST00000399688.3_Missense_Mutation_p.I182M|PAICS_ENST00000264221.2_Missense_Mutation_p.I175M	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	175	SAICAR synthetase.				'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	TATTTGAAATACTGGAGAAAT	0.383																																					GBM(53;429 1144 8755 40726)	GBM(53;429 1144 8755 40726)	uc003hbs.1		NA																	0					0						c.(523-525)ATA>ATG		phosphoribosylaminoimidazole carboxylase,	L-Aspartic Acid(DB00128)						42.0	37.0	38.0					4																	57314715		1823	4089	5912	SO:0001583	missense	10606				'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|identical protein binding|phosphoribosylaminoimidazole carboxylase activity|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity	g.chr4:57314715A>G	X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.525A>G	4.37:g.57314715A>G	ENSP00000421096:p.Ile175Met		Somatic				PAICS_uc011cac.1_Missense_Mutation_p.I175M|PAICS_uc003hbt.1_Missense_Mutation_p.I182M|PAICS_uc003hbu.1_Missense_Mutation_p.I175M|PAICS_uc010ihd.1_Missense_Mutation_p.I176M	p.I175M	NM_006452	NP_006443	WXS	Illumina HiSeq	Unspecified	P22234	PUR6_HUMAN			5	756	+	Glioma(25;0.08)|all_neural(26;0.101)		175			SAICAR synthetase.		E9PDH9|Q68CQ5	Missense_Mutation	SNP	ENST00000512576.1	37	c.525A>G	CCDS47061.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.479690	0.63849	.	.	ENSG00000128050	ENST00000514888;ENST00000264221;ENST00000505164;ENST00000399688;ENST00000512576	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.53	-1.99	0.07457	ATP-grasp fold, subdomain 2 (1);	0.041680	0.85682	D	0.000000	T	0.53530	0.1802	M	0.83483	2.645	0.51233	D	0.999915	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.66351	0.943;0.934;0.943	T	0.54063	-0.8349	10	0.87932	D	0	-20.3416	2.064	0.03598	0.3503:0.2853:0.0692:0.2952	.	175;182;175	E9PBS1;P22234-2;P22234	.;.;PUR6_HUMAN	M	83;175;175;182;175	ENSP00000424907:I83M;ENSP00000264221:I175M;ENSP00000424053:I175M;ENSP00000382595:I182M;ENSP00000421096:I175M	ENSP00000264221:I175M	I	+	3	3	PAICS	57009472	0.968000	0.33430	0.997000	0.53966	0.993000	0.82548	0.183000	0.16919	-0.116000	0.11893	-0.290000	0.09829	ATA		0.383	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363136.2	NM_006452		4	8	0	0	0	0.009096	0	4	8				
LPHN3	23284	broad.mit.edu	37	4	62679579	62679579	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:62679579C>T	ENST00000514591.1	+	8	1577	c.1248C>T	c.(1246-1248)gaC>gaT	p.D416D	LPHN3_ENST00000506700.1_Silent_p.D416D|LPHN3_ENST00000512091.2_Silent_p.D416D|LPHN3_ENST00000504896.1_Silent_p.D416D|LPHN3_ENST00000506720.1_Silent_p.D484D|LPHN3_ENST00000545650.1_Silent_p.D416D|LPHN3_ENST00000514996.1_Silent_p.D416D|LPHN3_ENST00000514157.1_Silent_p.D416D|LPHN3_ENST00000507625.1_Silent_p.D484D|LPHN3_ENST00000506746.1_Silent_p.D484D|LPHN3_ENST00000509896.1_Silent_p.D484D|LPHN3_ENST00000508946.1_Silent_p.D416D|LPHN3_ENST00000511324.1_Silent_p.D484D|LPHN3_ENST00000507164.1_Silent_p.D484D|LPHN3_ENST00000508693.1_Silent_p.D484D			Q9HAR2	LPHN3_HUMAN	latrophilin 3	416					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ttcaccttgactctgagctag	0.378																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(1246-1248)GAC>GAT		latrophilin 3 precursor							120.0	111.0	113.0					4																	62679579		1925	4127	6052	SO:0001819	synonymous_variant	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62679579C>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1248C>T	4.37:g.62679579C>T			Somatic				LPHN3_uc003hcq.3_Silent_p.D416D|LPHN3_uc003hcs.1_Silent_p.D245D	p.D416D	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			6	1421	+			416			Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	37	c.1248C>T	CCDS54768.1																																																																																				0.378	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			5	46	0	0	0	0.001984	0	5	46				
UGT2B27P	54569	broad.mit.edu	37	4	69870669	69870669	+	IGR	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:69870669C>A								UGT2A3 (53160 upstream) : UGT2B7 (46524 downstream)																							GCCACACAGGCCAGCAGGAAC	0.448																																						Melanoma(133;755 1763 25578 26334 46021)	uc011cao.1		NA																	0				skin(3)|ovary(2)	5						c.(1381-1383)GCT>TCT		RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;							194.0	143.0	159.0					4																	69870669		692	1591	2283	SO:0001628	intergenic_variant	7365				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69870669C>A																													4.37:g.69870669C>A			Somatic				UGT2B10_uc011can.1_Missense_Mutation_p.A377S	p.A461S			WXS	Illumina HiSeq	Unspecified	P36537	UDB10_HUMAN			9	1517	-			498			Helical; (Potential).			Missense_Mutation	SNP		37	c.1381G>T																																																																																				0	0.448									8	126	1	0	0.00307968	0.00308	0.00316741	8	126				
SLC4A4	8671	broad.mit.edu	37	4	72215656	72215656	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:72215656A>G	ENST00000264485.5	+	5	534	c.417A>G	c.(415-417)gaA>gaG	p.E139E	SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000340595.3_Silent_p.E95E|SLC4A4_ENST00000351898.6_Silent_p.E139E|SLC4A4_ENST00000425175.1_Silent_p.E139E|SLC4A4_ENST00000512686.1_Silent_p.E95E	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	139					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AAAAAGTGGAACAGGGTGGGG	0.433																																							uc003hfy.2		NA																	0				ovary(3)|kidney(1)|skin(1)	5						c.(415-417)GAA>GAG		solute carrier family 4, sodium bicarbonate							127.0	124.0	125.0					4																	72215656		2203	4300	6503	SO:0001819	synonymous_variant	8671					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity	g.chr4:72215656A>G	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.417A>G	4.37:g.72215656A>G			Somatic				SLC4A4_uc010iic.2_Silent_p.E139E|SLC4A4_uc010iib.2_Silent_p.E139E|SLC4A4_uc003hfz.2_Silent_p.E139E|SLC4A4_uc003hgc.3_Silent_p.E95E|SLC4A4_uc003hga.2_Silent_p.E17E|SLC4A4_uc003hgb.3_Silent_p.E95E	p.E139E	NM_001098484	NP_001091954	WXS	Illumina HiSeq	Unspecified	Q9Y6R1	S4A4_HUMAN	Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		5	534	+			139			Cytoplasmic (Potential).		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	c.417A>G	CCDS43236.1																																																																																				0.433	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759		24	51	0	0	0	0.007291	0	24	51				
USO1	8615	broad.mit.edu	37	4	76726444	76726444	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:76726444G>C	ENST00000538159.1	+	20	2304	c.2304G>C	c.(2302-2304)atG>atC	p.M768I	USO1_ENST00000514213.2_Missense_Mutation_p.M744I			O60763	USO1_HUMAN	USO1 vesicle transport factor	759					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGGACTCTATGATTGAAAATA	0.333																																							uc003hiu.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2275-2277)ATG>ATC		USO1 homolog, vesicle docking protein							38.0	36.0	37.0					4																	76726444		1818	4073	5891	SO:0001583	missense	8615				intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity	g.chr4:76726444G>C	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.2304G>C	4.37:g.76726444G>C	ENSP00000440586:p.Met768Ile		Somatic				USO1_uc003hiv.2_Missense_Mutation_p.M601I|USO1_uc003hiw.2_Missense_Mutation_p.M594I	p.M759I	NM_003715	NP_003706	WXS	Illumina HiSeq	Unspecified	O60763	USO1_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		18	2452	+			759			Potential.		B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	ENST00000538159.1	37	c.2277G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.874|3.874	-0.027364|-0.027364	0.07589|0.07589	.|.	.|.	ENSG00000138768|ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904|ENST00000441296	.|.	.|.	.|.	5.8|5.8	-0.529|-0.529	0.11901|0.11901	Armadillo-type fold (1);|.	0.530337|.	0.19763|.	N|.	0.106634|.	T|.	0.10981|.	0.0268|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999996|0.999996	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|.	0.25745|.	-1.0123|.	9|.	0.36615|.	T|.	0.2|.	.|.	1.5293|1.5293	0.02532|0.02532	0.288:0.2283:0.3663:0.1174|0.288:0.2283:0.3663:0.1174	.|.	768;759|.	F5GYR8;O60763|.	.;USO1_HUMAN|.	I|S	594;768;744;687|435	.|.	ENSP00000264904:M687I|.	M|X	+|+	3|2	0|2	USO1|USO1	76945468|76945468	0.999000|0.999000	0.42202|0.42202	0.322000|0.322000	0.25334|0.25334	0.030000|0.030000	0.12068|0.12068	0.464000|0.464000	0.21988|0.21988	-0.485000|-0.485000	0.06754|0.06754	-0.519000|-0.519000	0.04390|0.04390	ATG|TGA		0.333	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715		5	7	0	0	0	0.001168	0	5	7				
FRAS1	80144	broad.mit.edu	37	4	79350311	79350311	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:79350311C>T	ENST00000325942.6	+	36	5214	c.4774C>T	c.(4774-4776)Cag>Tag	p.Q1592*	FRAS1_ENST00000264895.6_Nonsense_Mutation_p.Q1592*	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1592					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCCCAGTGATCAGCAACTGCC	0.512																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.(4774-4776)CAG>TAG		Fraser syndrome 1							59.0	62.0	61.0					4																	79350311		2082	4205	6287	SO:0001587	stop_gained	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79350311C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4774C>T	4.37:g.79350311C>T	ENSP00000326330:p.Gln1592*		Somatic				FRAS1_uc003hkw.2_Nonsense_Mutation_p.Q1592*|FRAS1_uc010ijj.1_Nonsense_Mutation_p.Q12*	p.Q1592*	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			36	5214	+			1591			CSPG 5.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Nonsense_Mutation	SNP	ENST00000325942.6	37	c.4774C>T	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.399|9.399	1.077418|1.077418	0.20227|0.20227	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000545316|ENST00000510944	.|.	.|.	.|.	5.61|5.61	1.49|1.49	0.22878|0.22878	.|.	0.758549|.	0.12898|.	N|.	0.430066|.	.|T	.|0.52108	.|0.1714	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999999|0.999999	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.50693	.|-0.8798	.|4	0.13853|.	T|.	0.58|.	.|.	18.665|18.665	0.91486|0.91486	0.0:0.4188:0.5812:0.0|0.0:0.4188:0.5812:0.0	.|.	.|.	.|.	.|.	X|L	1592;1592;12|41	.|.	ENSP00000264895:Q1592X|.	Q|S	+|+	1|2	0|0	FRAS1|FRAS1	79569335|79569335	0.375000|0.375000	0.25089|0.25089	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	2.236000|2.236000	0.43052|0.43052	0.249000|0.249000	0.21456|0.21456	-0.175000|-0.175000	0.13238|0.13238	CAG|TCA		0.512	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			3	12	0	0	0	0.004672	0	3	12				
FRAS1	80144	broad.mit.edu	37	4	79436952	79436952	+	Splice_Site	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:79436952G>A	ENST00000264895.6	+	66	10614		c.e66-1			NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1						cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CTCCCTGGCAGAGGCAGGGTT	0.557																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.e66-1		Fraser syndrome 1							91.0	95.0	93.0					4																	79436952		2047	4189	6236	SO:0001630	splice_region_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79436952G>A	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.10175-1G>A	4.37:g.79436952G>A			Somatic					p.E3392_splice	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			66	10615	+								A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Splice_Site	SNP	ENST00000264895.6	37	c.10175_splice	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921441	0.73213	.	.	ENSG00000138759	ENST00000264895;ENST00000512123	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7782	0.96405	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRAS1	79655976	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	9.174000	0.94824	2.759000	0.94783	0.591000	0.81541	.		0.557	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Intron	19	47	0	0	0	0.007413	0	19	47				
PRKG2	5593	broad.mit.edu	37	4	82126147	82126147	+	Missense_Mutation	SNP	C	C	A	rs192577898		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:82126147C>A	ENST00000395578.1	-	2	171	c.55G>T	c.(55-57)Ggg>Tgg	p.G19W	PRKG2_ENST00000264399.1_Missense_Mutation_p.G19W|PRKG2_ENST00000418486.2_Missense_Mutation_p.G19W			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	19					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						GTGAGGTTCCCAGAGTGTCCA	0.498																																							uc003hmh.2		NA																	0				breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						c.(55-57)GGG>TGG		protein kinase, cGMP-dependent, type II							79.0	72.0	74.0					4																	82126147		2203	4300	6503	SO:0001583	missense	5593				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr4:82126147C>A	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.55G>T	4.37:g.82126147C>A	ENSP00000378945:p.Gly19Trp		Somatic				PRKG2_uc011cch.1_Missense_Mutation_p.G19W	p.G19W	NM_006259	NP_006250	WXS	Illumina HiSeq	Unspecified	Q13237	KGP2_HUMAN			1	69	-			19					B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	c.55G>T	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752356	0.31046	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	T;T;T	0.70164	-0.35;-0.35;-0.46	5.1	4.25	0.50352	.	0.347831	0.30109	N	0.010398	T	0.49406	0.1555	N	0.08118	0	0.80722	D	1	P;P	0.50369	0.934;0.934	B;B	0.43680	0.427;0.427	T	0.59337	-0.7473	10	0.72032	D	0.01	-23.5071	13.0681	0.59045	0.0:0.9223:0.0:0.0777	.	19;19	E7EPE6;Q13237	.;KGP2_HUMAN	W	19	ENSP00000378945:G19W;ENSP00000264399:G19W;ENSP00000389038:G19W	ENSP00000264399:G19W	G	-	1	0	PRKG2	82345171	0.946000	0.32159	0.875000	0.34327	0.088000	0.18126	2.948000	0.49066	1.384000	0.46424	0.585000	0.79938	GGG		0.498	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259		14	24	1	0	1.5739e-10	0.004007	1.78757e-10	14	24				
WDFY3	23001	broad.mit.edu	37	4	85686979	85686979	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:85686979C>A	ENST00000295888.4	-	32	5579	c.5172G>T	c.(5170-5172)aaG>aaT	p.K1724N	WDFY3_ENST00000322366.6_Missense_Mutation_p.K1724N	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1724					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAGTTCCAATCTTATTAGTTA	0.353																																							uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(5170-5172)AAG>AAT		WD repeat and FYVE domain containing 3 isoform							86.0	83.0	84.0					4																	85686979		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85686979C>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5172G>T	4.37:g.85686979C>A	ENSP00000295888:p.Lys1724Asn		Somatic					p.K1724N	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	32	5580	-		Hepatocellular(203;0.114)	1724					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.5172G>T	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.718519	0.68844	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.65178	-0.14;-0.14	5.8	0.561	0.17285	.	0.000000	0.85682	D	0.000000	T	0.69797	0.3151	M	0.66939	2.045	0.80722	D	1	D	0.65815	0.995	P	0.59357	0.856	T	0.68172	-0.5479	10	0.41790	T	0.15	.	11.6625	0.51356	0.0:0.6604:0.0:0.3396	.	1724	Q8IZQ1	WDFY3_HUMAN	N	1724	ENSP00000318466:K1724N;ENSP00000295888:K1724N	ENSP00000295888:K1724N	K	-	3	2	WDFY3	85906003	1.000000	0.71417	0.986000	0.45419	0.955000	0.61496	1.075000	0.30716	0.106000	0.17784	-0.142000	0.14014	AAG		0.353	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		19	62	1	0	5.26018e-13	0.001882	6.10572e-13	19	62				
WDFY3	23001	broad.mit.edu	37	4	85729562	85729562	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:85729562T>A	ENST00000295888.4	-	15	2761	c.2354A>T	c.(2353-2355)gAa>gTa	p.E785V	WDFY3_ENST00000322366.6_Missense_Mutation_p.E785V|WDFY3-AS1_ENST00000510449.1_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	785					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGGGATCTGTTCTGCACGACT	0.468																																							uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2353-2355)GAA>GTA		WD repeat and FYVE domain containing 3 isoform							154.0	146.0	149.0					4																	85729562		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85729562T>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2354A>T	4.37:g.85729562T>A	ENSP00000295888:p.Glu785Val		Somatic					p.E785V	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	15	2762	-		Hepatocellular(203;0.114)	785					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.2354A>T	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341164	0.81911	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.65364	-0.15;-0.14	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.72061	0.3414	L	0.44542	1.39	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.69658	-0.5086	10	0.33141	T	0.24	.	16.0325	0.80588	0.0:0.0:0.0:1.0	.	785	Q8IZQ1	WDFY3_HUMAN	V	785	ENSP00000318466:E785V;ENSP00000295888:E785V	ENSP00000295888:E785V	E	-	2	0	WDFY3	85948586	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.587000	0.82613	2.180000	0.69256	0.528000	0.53228	GAA		0.468	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		51	92	0	0	0	0.00361	0	51	92				
STPG2	285555	broad.mit.edu	37	4	98762043	98762043	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:98762043T>A	ENST00000295268.3	-	9	1174	c.1085A>T	c.(1084-1086)tAt>tTt	p.Y362F	STPG2_ENST00000506482.1_Intron	NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	362																	GGACATCTCATATGATTTGTG	0.358																																							uc003htt.1		NA																	0					0						c.(1084-1086)TAT>TTT		hypothetical protein LOC285555							80.0	82.0	81.0					4																	98762043		2203	4298	6501	SO:0001583	missense	285555							g.chr4:98762043T>A	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.1085A>T	4.37:g.98762043T>A	ENSP00000295268:p.Tyr362Phe		Somatic					p.Y362F	NM_174952	NP_777612	WXS	Illumina HiSeq	Unspecified	Q8N412	CD037_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)	9	1175	-			362						Missense_Mutation	SNP	ENST00000295268.3	37	c.1085A>T	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	9.122	1.009173	0.19277	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.39592	1.07;2.88	5.47	4.24	0.50183	.	0.157867	0.40908	D	0.000988	T	0.30293	0.0760	L	0.34521	1.04	0.27103	N	0.962575	B	0.26902	0.163	B	0.32022	0.139	T	0.15665	-1.0429	10	0.16420	T	0.52	-14.1107	9.3026	0.37856	0.2523:0.0:0.0:0.7477	.	362	Q8N412	CD037_HUMAN	F	76;362	ENSP00000428346:Y76F;ENSP00000295268:Y362F	ENSP00000295268:Y362F	Y	-	2	0	C4orf37	98981066	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	2.013000	0.40942	2.084000	0.62774	0.477000	0.44152	TAT		0.358	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952		26	32	0	0	0	0.00333	0	26	32				
TBC1D9	23158	broad.mit.edu	37	4	141578791	141578791	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:141578791G>A	ENST00000442267.2	-	12	2171	c.2097C>T	c.(2095-2097)ttC>ttT	p.F699F		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	699	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TTCCTTCATAGAAGAAACAGT	0.473																																							uc010ioj.2		NA																	0				ovary(1)	1						c.(2095-2097)TTC>TTT		TBC1 domain family, member 9 (with GRAM domain)							174.0	166.0	169.0					4																	141578791		2005	4193	6198	SO:0001819	synonymous_variant	23158					intracellular	calcium ion binding|Rab GTPase activator activity	g.chr4:141578791G>A	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2097C>T	4.37:g.141578791G>A			Somatic					p.F699F	NM_015130	NP_055945	WXS	Illumina HiSeq	Unspecified	Q6ZT07	TBCD9_HUMAN			12	2369	-	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)	699			Rab-GAP TBC.		A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	37	c.2097C>T	CCDS47136.1																																																																																				0.473	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130		45	44	0	0	0	0.00361	0	45	44				
KLHL2	11275	broad.mit.edu	37	4	166199383	166199383	+	Intron	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:166199383C>T	ENST00000226725.6	+	5	803				KLHL2_ENST00000509028.1_Intron|KLHL2_ENST00000514860.1_Intron|KLHL2_ENST00000421009.2_Intron|KLHL2_ENST00000506761.1_Intron|KLHL2_ENST00000538127.1_Intron	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2						protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		TTCAAGACTCCATACGTCGAC	0.502																																							uc003ird.3		NA																	0					0						c.(1414-1416)TGG>TAG		glycerol kinase isoform b																																				SO:0001627	intron_variant	2713							g.chr4:166199383C>T	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.544+14872C>T	4.37:g.166199383C>T			Somatic				KLHL2_uc003irb.2_Intron|KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	p.W472*	NM_000167	NP_000158	WXS	Illumina HiSeq	Unspecified					1	1793	-								A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Nonsense_Mutation	SNP	ENST00000226725.6	37	c.1415G>A	CCDS34094.1																																																																																				0.502	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1			13	7	0	0	0	0.001855	0	13	7				
KLHL2	11275	broad.mit.edu	37	4	166199718	166199718	+	Intron	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:166199718G>T	ENST00000226725.6	+	5	803				KLHL2_ENST00000509028.1_Intron|KLHL2_ENST00000514860.1_Intron|KLHL2_ENST00000421009.2_Intron|KLHL2_ENST00000506761.1_Intron|KLHL2_ENST00000538127.1_Intron	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2						protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		ATGCTGGGACGAAGTAGCAGC	0.413																																							uc003ird.3		NA																	0					0						c.(1078-1080)TTC>TTA		glycerol kinase isoform b																																				SO:0001627	intron_variant	2713							g.chr4:166199718G>T	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.544+15207G>T	4.37:g.166199718G>T			Somatic				KLHL2_uc003irb.2_Intron|KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	p.F360L	NM_000167	NP_000158	WXS	Illumina HiSeq	Unspecified					1	1458	-								A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Missense_Mutation	SNP	ENST00000226725.6	37	c.1080C>A	CCDS34094.1																																																																																				0.413	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1			36	32	1	0	4.00472e-15	0.00361	4.73662e-15	36	32				
CDH9	1007	broad.mit.edu	37	5	26915822	26915822	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:26915822T>C	ENST00000231021.4	-	3	611	c.439A>G	c.(439-441)Att>Gtt	p.I147V		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	147	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGTATTTTAATGATAAATTCC	0.378																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(439-441)ATT>GTT		cadherin 9, type 2 preproprotein							105.0	105.0	105.0					5																	26915822		2203	4299	6502	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26915822T>C	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.439A>G	5.37:g.26915822T>C	ENSP00000231021:p.Ile147Val		Somatic				CDH9_uc010iug.2_Missense_Mutation_p.I147V	p.I147V	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			3	608	-			147			Extracellular (Potential).|Cadherin 1.		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.439A>G	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.054455	0.55218	.	.	ENSG00000113100	ENST00000231021	T	0.56941	0.43	4.62	4.62	0.57501	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.050306	0.85682	D	0.000000	T	0.52948	0.1766	L	0.35854	1.095	0.42902	D	0.99423	B	0.31893	0.345	P	0.46026	0.501	T	0.50931	-0.8769	9	.	.	.	.	13.1548	0.59511	0.0:0.0:0.0:1.0	.	147	Q9ULB4	CADH9_HUMAN	V	147	ENSP00000231021:I147V	.	I	-	1	0	CDH9	26951579	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.012000	0.64017	1.846000	0.53633	0.528000	0.53228	ATT		0.378	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		4	217	0	0	0	0.000602	0	4	217				
CDH9	1007	broad.mit.edu	37	5	26988330	26988331	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	TA	TA	-	-	TA	TA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:26988330_26988331TA>AT	ENST00000231021.4	-	2	282_283	c.110_111TA>AT	c.(109-111)aTA>aAT	p.I37N		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	37					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TCAGACCCGCTATCTTTTTGCT	0.391																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(109-111)ATA>AAT		cadherin 9, type 2 preproprotein																																				SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26988330_26988331TA>AT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.110_111delinsAT	5.37:g.26988330_26988331delinsAT	ENSP00000231021:p.Ile37Asn		Somatic				CDH9_uc010iug.2_Missense_Mutation_p.I37N	p.I37N	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			2	279_280	-			37					Q3B7I5	Missense_Mutation	DNP	ENST00000231021.4	37	c.110_111TA>AT	CCDS3893.1																																																																																				0.391	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		20	66	0	0	0	0.004672	0	20	66				
ADAMTS12	81792	broad.mit.edu	37	5	33881259	33881259	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:33881259C>A	ENST00000504830.1	-	2	789	c.454G>T	c.(454-456)Gtt>Ttt	p.V152F	ADAMTS12_ENST00000515401.1_Missense_Mutation_p.V152F|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.V152F	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	152					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCCGTCCCAACTCTGGTGCCC	0.587										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(454-456)GTT>TTT		ADAM metallopeptidase with thrombospondin type 1							57.0	55.0	56.0					5																	33881259		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33881259C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.454G>T	5.37:g.33881259C>A	ENSP00000422554:p.Val152Phe	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.V152F|ADAMTS12_uc003jib.1_Missense_Mutation_p.V152F	p.V152F	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			2	617	-			152					A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.454G>T	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	6.371	0.436512	0.12104	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.58940	0.3;0.3;2.11	5.65	-2.42	0.06542	Peptidase M12B, propeptide (1);	0.617926	0.16486	N	0.212330	T	0.36358	0.0964	N	0.22421	0.69	0.09310	N	1	B;B;B	0.28470	0.178;0.213;0.01	B;B;B	0.27262	0.075;0.078;0.027	T	0.21930	-1.0231	10	0.54805	T	0.06	.	7.349	0.26680	0.1076:0.3619:0.0:0.5304	.	152;152;152	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	F	152	ENSP00000422554:V152F;ENSP00000344847:V152F;ENSP00000421638:V152F	ENSP00000344847:V152F	V	-	1	0	ADAMTS12	33917016	0.000000	0.05858	0.000000	0.03702	0.954000	0.61252	0.000000	0.12993	-0.319000	0.08652	0.467000	0.42956	GTT		0.587	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		20	144	1	0	1.87028e-06	0.001882	2.00158e-06	20	144				
C9	735	broad.mit.edu	37	5	39331837	39331837	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:39331837C>T	ENST00000263408.4	-	5	651	c.556G>A	c.(556-558)Gat>Aat	p.D186N	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	186	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			GTGTTTCCATCCCGATCCCGG	0.438																																							uc003jlv.3		NA																	0					0						c.(556-558)GAT>AAT		complement component 9 precursor							185.0	179.0	181.0					5																	39331837		2203	4300	6503	SO:0001583	missense	735				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex		g.chr5:39331837C>T		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.556G>A	5.37:g.39331837C>T	ENSP00000263408:p.Asp186Asn		Somatic					p.D186N	NM_001737	NP_001728	WXS	Illumina HiSeq	Unspecified	P02748	CO9_HUMAN	Epithelial(62;0.158)		5	645	-	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	186			MACPF.			Missense_Mutation	SNP	ENST00000263408.4	37	c.556G>A	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459718	0.63401	.	.	ENSG00000113600	ENST00000263408	T	0.27890	1.64	5.72	5.72	0.89469	Membrane attack complex component/perforin (MACPF) domain (1);	0.048183	0.85682	D	0.000000	T	0.37183	0.0994	N	0.14661	0.345	0.51767	D	0.999938	D	0.89917	1.0	D	0.91635	0.999	T	0.08680	-1.0710	10	0.09084	T	0.74	-42.4373	18.6485	0.91421	0.0:1.0:0.0:0.0	.	186	P02748	CO9_HUMAN	N	186	ENSP00000263408:D186N	ENSP00000263408:D186N	D	-	1	0	C9	39367594	1.000000	0.71417	0.998000	0.56505	0.621000	0.37620	4.135000	0.57997	2.709000	0.92574	0.561000	0.74099	GAT		0.438	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3			46	201	0	0	0	0.00361	0	46	201				
MROH2B	133558	broad.mit.edu	37	5	41012727	41012727	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:41012727C>T	ENST00000399564.4	-	30	3543	c.3093G>A	c.(3091-3093)atG>atA	p.M1031I	MROH2B_ENST00000506092.2_Missense_Mutation_p.M586I	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1031																	GGACAGTGATCATCCATATGC	0.458																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(3091-3093)ATG>ATA		HEAT repeat family member 7B2							94.0	95.0	95.0					5																	41012727		1946	4160	6106	SO:0001583	missense	133558						binding	g.chr5:41012727C>T		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3093G>A	5.37:g.41012727C>T	ENSP00000382476:p.Met1031Ile		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.M586I	p.M1031I	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			30	3583	-			1031			HEAT 11.		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.3093G>A	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	0.412	-0.912515	0.02415	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.61980	0.06;0.06	6.04	5.0	0.66597	Armadillo-like helical (1);Armadillo-type fold (1);	0.087903	0.51477	D	0.000084	T	0.35248	0.0925	N	0.12746	0.255	0.33258	D	0.559386	B	0.30146	0.27	B	0.21917	0.037	T	0.41324	-0.9515	10	0.02654	T	1	.	11.052	0.47896	0.0:0.9044:0.0:0.0956	.	1031	Q7Z745	HTRB2_HUMAN	I	586;736;1031	ENSP00000441504:M586I;ENSP00000382476:M1031I	ENSP00000296803:M736I	M	-	3	0	HEATR7B2	41048484	0.997000	0.39634	0.990000	0.47175	0.235000	0.25334	2.294000	0.43567	2.873000	0.98535	0.561000	0.74099	ATG		0.458	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		18	65	0	0	0	0.006122	0	18	65				
HCN1	348980	broad.mit.edu	37	5	45645327	45645327	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:45645327C>T	ENST00000303230.4	-	2	866	c.809G>A	c.(808-810)cGa>cAa	p.R270Q		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	270					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CCTTGAAAGTCGTAATAAACG	0.328																																							uc003jok.2		NA																	0				ovary(1)	1						c.(808-810)CGA>CAA		hyperpolarization activated cyclic							43.0	43.0	43.0					5																	45645327		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45645327C>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.809G>A	5.37:g.45645327C>T	ENSP00000307342:p.Arg270Gln		Somatic					p.R270Q	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			2	834	-			270			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.809G>A	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	34	5.370931	0.95923	.	.	ENSG00000164588	ENST00000303230	D	0.98777	-5.13	5.5	5.5	0.81552	Ion transport (1);	0.000000	0.51477	D	0.000099	D	0.99456	0.9807	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98446	1.0589	10	0.87932	D	0	.	19.403	0.94639	0.0:1.0:0.0:0.0	.	270	O60741	HCN1_HUMAN	Q	270	ENSP00000307342:R270Q	ENSP00000307342:R270Q	R	-	2	0	HCN1	45681084	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.589000	0.87451	0.650000	0.86243	CGA		0.328	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		9	23	0	0	0	0.006214	0	9	23				
MAST4	375449	broad.mit.edu	37	5	66449351	66449351	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:66449351C>G	ENST00000403625.2	+	26	3886	c.3591C>G	c.(3589-3591)atC>atG	p.I1197M	MAST4_ENST00000405643.1_Missense_Mutation_p.I1018M|MAST4_ENST00000403666.1_Missense_Mutation_p.I1008M|MAST4_ENST00000261569.7_Missense_Mutation_p.I1003M|MAST4_ENST00000404260.3_Missense_Mutation_p.I1200M	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1200	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCACTCACATCAATGGAGAAC	0.453																																							uc003jut.1		NA																	0				lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.(3022-3024)ATC>ATG		microtubule associated serine/threonine kinase							99.0	103.0	102.0					5																	66449351		1967	4145	6112	SO:0001583	missense	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66449351C>G	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3591C>G	5.37:g.66449351C>G	ENSP00000385727:p.Ile1197Met		Somatic				MAST4_uc003juw.2_Missense_Mutation_p.I936M	p.I1008M	NM_015183	NP_055998	WXS	Illumina HiSeq	Unspecified	O15021	MAST4_HUMAN		Lung(70;0.011)	25	3092	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	1200			PDZ.		A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	c.3024C>G	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.50|18.50	3.638269|3.638269	0.67130|0.67130	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399|ENST00000443808	T;T;T;T;T|.	0.56941|.	0.43;0.43;0.43;0.43;0.43|.	6.05|6.05	6.05|6.05	0.98169|0.98169	PDZ/DHR/GLGF (4);|.	0.107276|.	0.64402|.	D|.	0.000005|.	T|T	0.65554|0.65554	0.2702|0.2702	L|L	0.52905|0.52905	1.665|1.665	0.41464|0.41464	D|D	0.988065|0.988065	D;D|.	0.60160|.	0.981;0.987|.	D;P|.	0.67725|.	0.953;0.894|.	T|T	0.61549|0.61549	-0.7040|-0.7040	10|5	0.87932|.	D|.	0|.	-14.8059|-14.8059	15.3397|15.3397	0.74287|0.74287	0.1396:0.8604:0.0:0.0|0.1396:0.8604:0.0:0.0	.|.	1200;1008|.	O15021;O15021-3|.	MAST4_HUMAN;.|.	M|E	1200;1197;1008;1018;1018;1003;936|254	ENSP00000385048:I1200M;ENSP00000385727:I1197M;ENSP00000384313:I1008M;ENSP00000384099:I1018M;ENSP00000261569:I1003M|.	ENSP00000261569:I1003M|.	I|Q	+|+	3|1	3|0	MAST4|MAST4	66485107|66485107	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	2.248000|2.248000	0.43160|0.43160	2.866000|2.866000	0.98385|0.98385	0.650000|0.650000	0.86243|0.86243	ATC|CAA		0.453	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			2	7	0	0	0	0.004672	0	2	7				
MARVELD2	153562	broad.mit.edu	37	5	68728870	68728870	+	Missense_Mutation	SNP	G	G	C	rs200109050		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:68728870G>C	ENST00000325631.5	+	5	1527	c.1453G>C	c.(1453-1455)Gag>Cag	p.E485Q	MARVELD2_ENST00000413223.2_Missense_Mutation_p.E369Q	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	485					cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		GAAGTTTGATGAGCTGGATGC	0.473																																							uc003jwq.2		NA																	0					0						c.(1453-1455)GAG>CAG		MARVEL domain containing 2 isoform 1							137.0	129.0	132.0					5																	68728870		2203	4300	6503	SO:0001583	missense	153562				sensory perception of sound	integral to membrane|tight junction		g.chr5:68728870G>C	AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.1453G>C	5.37:g.68728870G>C	ENSP00000323264:p.Glu485Gln		Somatic				MARVELD2_uc010ixf.2_Missense_Mutation_p.E473Q|MARVELD2_uc003jwr.1_Intron|MARVELD2_uc003jws.1_RNA	p.E485Q	NM_001038603	NP_001033692	WXS	Illumina HiSeq	Unspecified	Q8N4S9	MALD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)	5	1512	+		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)	485			Potential.|Cytoplasmic (Potential).		A1BQX0|A1BQX1|A8KA97|Q96NM9	Missense_Mutation	SNP	ENST00000325631.5	37	c.1453G>C	CCDS34175.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291113	0.80914	.	.	ENSG00000152939	ENST00000325631;ENST00000454295;ENST00000512803;ENST00000436532;ENST00000413223	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.74	5.74	0.90152	Occludin/RNA polymerase II elongation factor, ELL domain (1);	0.000000	0.85682	D	0.000000	T	0.44159	0.1280	L	0.39566	1.225	0.58432	D	0.999996	D;D	0.89917	0.985;1.0	D;D	0.97110	0.918;1.0	T	0.06607	-1.0817	10	0.35671	T	0.21	-8.8126	18.6994	0.91615	0.0:0.0:1.0:0.0	.	473;485	Q8N4S9-3;Q8N4S9	.;MALD2_HUMAN	Q	485;473;485;369;369	ENSP00000323264:E485Q;ENSP00000396244:E473Q;ENSP00000423490:E485Q;ENSP00000414776:E369Q;ENSP00000398922:E369Q	ENSP00000323264:E485Q	E	+	1	0	MARVELD2	68764626	1.000000	0.71417	0.974000	0.42286	0.795000	0.44927	7.530000	0.81962	2.715000	0.92844	0.655000	0.94253	GAG		0.473	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724		52	62	0	0	0	0.00361	0	52	62				
FAM169A	26049	broad.mit.edu	37	5	74109750	74109750	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:74109750C>G	ENST00000389156.4	-	6	675	c.585G>C	c.(583-585)ggG>ggC	p.G195G	FAM169A_ENST00000380515.3_3'UTR|FAM169A_ENST00000510496.1_Intron	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	195						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						GCATGTGAAGCCCAAAATCTT	0.408																																							uc003kdm.2		NA																	0					0						c.(583-585)GGG>GGC		hypothetical protein LOC26049							125.0	122.0	123.0					5																	74109750		1865	4091	5956	SO:0001819	synonymous_variant	26049							g.chr5:74109750C>G		CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.585G>C	5.37:g.74109750C>G			Somatic				FAM169A_uc010izm.2_Intron|FAM169A_uc003kdl.2_Silent_p.G13G	p.G195G	NM_015566	NP_056381	WXS	Illumina HiSeq	Unspecified	Q9Y6X4	F169A_HUMAN			6	628	-			195					A8K1T9|Q6MZT0|Q9H989	Silent	SNP	ENST00000389156.4	37	c.585G>C	CCDS43330.1																																																																																				0.408	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2			4	78	0	0	0	0.000602	0	4	78				
CMYA5	202333	broad.mit.edu	37	5	79084793	79084793	+	Splice_Site	SNP	G	G	C	rs57346823		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:79084793G>C	ENST00000446378.2	+	10	11586		c.e10-1		CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5						negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CTTGTATTTAGATCTTTCTCT	0.333																																							uc003kgc.2		NA																	0				ovary(6)|pancreas(2)|lung(1)	9						c.e10-1		cardiomyopathy associated 5							96.0	92.0	93.0					5																	79084793		1822	4087	5909	SO:0001630	splice_region_variant	202333					perinuclear region of cytoplasm		g.chr5:79084793G>C	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11556-1G>C	5.37:g.79084793G>C			Somatic					p.R3852_splice	NM_153610	NP_705838	WXS	Illumina HiSeq	Unspecified	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	10	11628	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)						A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Splice_Site	SNP	ENST00000446378.2	37	c.11556_splice	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109229	0.77096	.	.	ENSG00000164309	ENST00000446378	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2128	0.93765	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CMYA5	79120549	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	8.817000	0.91985	2.632000	0.89209	0.650000	0.86243	.		0.333	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	Intron	19	13	0	0	0	0.010504	0	19	13				
PCDHA2	56146	broad.mit.edu	37	5	140175601	140175601	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140175601C>T	ENST00000526136.1	+	1	1052	c.1052C>T	c.(1051-1053)tCa>tTa	p.S351L	PCDHA2_ENST00000520672.2_Missense_Mutation_p.S351L|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.S351L|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	351	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGAAGTCTCAATAACGTCT	0.453																																							uc003lhd.2		NA																	0				ovary(4)	4						c.(1051-1053)TCA>TTA		protocadherin alpha 2 isoform 1 precursor							85.0	74.0	78.0					5																	140175601		2203	4300	6503	SO:0001583	missense	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140175601C>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1052C>T	5.37:g.140175601C>T	ENSP00000431748:p.Ser351Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.S351L|PCDHA2_uc011czy.1_Missense_Mutation_p.S351L	p.S351L	NM_018905	NP_061728	WXS	Illumina HiSeq	Unspecified	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1158	+			351			Cadherin 4.|Extracellular (Potential).		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	c.1052C>T	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	9.004	0.980867	0.18812	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.58358	0.34;0.34;0.34	3.92	0.95	0.19572	Cadherin (2);Cadherin-like (1);	0.794025	0.10147	U	0.710169	T	0.40767	0.1130	L	0.46885	1.475	0.09310	N	1	B;B;B	0.16802	0.019;0.003;0.019	B;B;B	0.19148	0.01;0.004;0.024	T	0.40059	-0.9583	10	0.56958	D	0.05	.	2.2665	0.04080	0.2632:0.4526:0.1284:0.1559	.	351;351;351	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	L	351	ENSP00000430584:S351L;ENSP00000367372:S351L;ENSP00000431748:S351L	ENSP00000367372:S351L	S	+	2	0	PCDHA2	140155785	0.000000	0.05858	0.021000	0.16686	0.991000	0.79684	-2.810000	0.00755	0.056000	0.16144	0.650000	0.86243	TCA		0.453	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		21	41	0	0	0	0.00278	0	21	41				
PCDHA5	56143	broad.mit.edu	37	5	140202977	140202977	+	Silent	SNP	G	G	C	rs200444377	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140202977G>C	ENST00000529859.1	+	1	1617	c.1617G>C	c.(1615-1617)gcG>gcC	p.A539A	PCDHA5_ENST00000378126.3_Silent_p.A539A|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Silent_p.A539A	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	539	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCGACGCGGGCGTGCCGC	0.692																																							uc003lhl.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1615-1617)GCG>GCC		protocadherin alpha 5 isoform 1 precursor							45.0	52.0	50.0					5																	140202977		2201	4295	6496	SO:0001819	synonymous_variant	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140202977G>C	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1617G>C	5.37:g.140202977G>C			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.A539A|PCDHA5_uc003lhj.1_Silent_p.A539A	p.A539A	NM_018908	NP_061731	WXS	Illumina HiSeq	Unspecified	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1617	+			539			Extracellular (Potential).|Cadherin 5.		O75284|Q8N4R3	Silent	SNP	ENST00000529859.1	37	c.1617G>C	CCDS54917.1																																																																																				0.692	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		43	59	0	0	0	0.00361	0	43	59				
PCDHA7	56141	broad.mit.edu	37	5	140216280	140216280	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140216280C>T	ENST00000525929.1	+	1	2312	c.2312C>T	c.(2311-2313)gCc>gTc	p.A771V	PCDHA7_ENST00000378125.3_Missense_Mutation_p.A771V|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	771					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCTCATGGCCTTCAGTCCC	0.522																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(2311-2313)GCC>GTC		protocadherin alpha 7 isoform 1 precursor							53.0	53.0	53.0					5																	140216280		2203	4300	6503	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140216280C>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2312C>T	5.37:g.140216280C>T	ENSP00000436426:p.Ala771Val		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A771V	p.A771V	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2312	+			771			Cytoplasmic (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.2312C>T	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441634	0.25900	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.21031	2.03;2.03	3.67	3.67	0.42095	.	0.000000	0.31531	U	0.007491	T	0.17365	0.0417	M	0.74467	2.265	0.23449	N	0.997653	B;B	0.33755	0.424;0.193	B;B	0.34093	0.175;0.058	T	0.29212	-1.0019	10	0.02654	T	1	.	4.6669	0.12670	0.0:0.7045:0.0:0.2955	.	771;771	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	771	ENSP00000436426:A771V;ENSP00000367365:A771V	ENSP00000367365:A771V	A	+	2	0	PCDHA7	140196464	0.390000	0.25213	1.000000	0.80357	0.844000	0.47949	0.345000	0.19979	2.028000	0.59812	0.462000	0.41574	GCC		0.522	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		16	42	0	0	0	0.008871	0	16	42				
PCDHA8	56140	broad.mit.edu	37	5	140222831	140222831	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140222831C>G	ENST00000531613.1	+	1	1925	c.1925C>G	c.(1924-1926)tCt>tGt	p.S642C	PCDHA8_ENST00000378123.3_Missense_Mutation_p.S642C|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	642	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S642C(4)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCGGACTCTCCGCGCCAC	0.657																																							uc003lhs.2		NA																	4	Substitution - Missense(4)		lung(2)|breast(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1924-1926)TCT>TGT		protocadherin alpha 8 isoform 1 precursor							106.0	105.0	105.0					5																	140222831		2197	4266	6463	SO:0001583	missense	56140				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140222831C>G	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1925C>G	5.37:g.140222831C>G	ENSP00000434655:p.Ser642Cys		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.S642C	p.S642C	NM_018911	NP_061734	WXS	Illumina HiSeq	Unspecified	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1925	+			642			Cadherin 6.|Extracellular (Potential).		B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	c.1925C>G	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	7.011	0.556714	0.13436	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.53206	0.63;0.63	2.93	0.85	0.18980	Cadherin (4);Cadherin-like (1);	0.496290	0.14270	U	0.330185	T	0.38665	0.1049	L	0.53249	1.67	0.09310	N	1	B;B	0.26809	0.149;0.16	B;B	0.24974	0.057;0.021	T	0.38972	-0.9636	10	0.87932	D	0	.	5.9794	0.19399	0.0:0.3912:0.4704:0.1385	.	642;642	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	C	642	ENSP00000434655:S642C;ENSP00000367363:S642C	ENSP00000367363:S642C	S	+	2	0	PCDHA8	140203015	0.000000	0.05858	0.004000	0.12327	0.411000	0.31082	-1.126000	0.03254	0.550000	0.28991	0.313000	0.20887	TCT		0.657	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		57	139	0	0	0	0.00361	0	57	139				
PCDHA9	9752	broad.mit.edu	37	5	140389491	140389491	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140389491G>T	ENST00000532602.1	+	4	3855	c.2822G>T	c.(2821-2823)gGg>gTg	p.G941V	PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.G676V|PCDHA1_ENST00000504120.2_Missense_Mutation_p.G941V|PCDHAC1_ENST00000253807.2_Missense_Mutation_p.G954V|PCDHA1_ENST00000394633.3_Missense_Mutation_p.G677V|PCDHA7_ENST00000525929.1_Missense_Mutation_p.G928V|PCDHAC2_ENST00000289269.5_Missense_Mutation_p.G998V|PCDHA11_ENST00000398640.2_Missense_Mutation_p.G940V|PCDHA6_ENST00000527624.1_Missense_Mutation_p.G677V|PCDHA13_ENST00000409494.1_Intron|PCDHA5_ENST00000529859.1_Missense_Mutation_p.G927V|PCDHA10_ENST00000307360.5_Missense_Mutation_p.G939V|PCDHA3_ENST00000522353.2_Missense_Mutation_p.G941V|PCDHA4_ENST00000530339.1_Missense_Mutation_p.G938V|PCDHA6_ENST00000529310.1_Missense_Mutation_p.G941V|PCDHA8_ENST00000531613.1_Missense_Mutation_p.G941V|PCDHA2_ENST00000526136.1_Missense_Mutation_p.G939V|PCDHA13_ENST00000289272.2_Missense_Mutation_p.G941V|PCDHA12_ENST00000398631.2_Missense_Mutation_p.G932V|PCDHA4_ENST00000512229.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	941					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAGAGAAAGGGAACAGCACG	0.413																																					Melanoma(55;1800 1972 14909)	Melanoma(190;638 2083 3390 11909 52360)	uc003lii.2		NA																	0				ovary(2)|skin(2)	4						c.(2992-2994)GGG>GTG		protocadherin alpha subfamily C, 2 isoform 1							93.0	101.0	98.0					5																	140389491		2203	4300	6503	SO:0001583	missense	56134				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140389491G>T	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2822G>T	5.37:g.140389491G>T	ENSP00000436042:p.Gly941Val		Somatic				PCDHA1_uc003lha.2_Missense_Mutation_p.G677V|PCDHA1_uc003lhb.2_Missense_Mutation_p.G941V|PCDHA2_uc003lhd.2_Missense_Mutation_p.G939V|PCDHA3_uc003lhf.2_Missense_Mutation_p.G941V|PCDHA4_uc003lhi.2_Missense_Mutation_p.G938V|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Missense_Mutation_p.G927V|PCDHA6_uc003lhn.2_Missense_Mutation_p.G677V|PCDHA6_uc003lho.2_Missense_Mutation_p.G941V|PCDHA7_uc003lhq.2_Missense_Mutation_p.G928V|PCDHA8_uc003lhs.2_Missense_Mutation_p.G941V|PCDHA9_uc003lhu.2_Missense_Mutation_p.G941V|PCDHA10_uc003lhw.2_Missense_Mutation_p.G676V|PCDHA10_uc003lhx.2_Missense_Mutation_p.G939V|PCDHA11_uc003lia.2_Missense_Mutation_p.G940V|PCDHA12_uc003lic.2_Missense_Mutation_p.G932V|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Missense_Mutation_p.G941V|PCDHAC1_uc003lih.2_Missense_Mutation_p.G954V	p.G998V	NM_018899	NP_061722	WXS	Illumina HiSeq	Unspecified	Q9Y5I4	PCDC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		4	3233	+			998			Cytoplasmic (Potential).		O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	c.2993G>T	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143920	0.57044	.	.	ENSG00000204970;ENSG00000204970;ENSG00000204969;ENSG00000255408;ENSG00000204967;ENSG00000204965;ENSG00000081842;ENSG00000081842;ENSG00000204963;ENSG00000204962;ENSG00000204961;ENSG00000250120;ENSG00000250120;ENSG00000249158;ENSG00000251664;ENSG00000239389;ENSG00000248383;ENSG00000243232	ENST00000504120;ENST00000394633;ENST00000526136;ENST00000522353;ENST00000530339;ENST00000529859;ENST00000529310;ENST00000527624;ENST00000525929;ENST00000531613;ENST00000532602;ENST00000506939;ENST00000307360;ENST00000398640;ENST00000398631;ENST00000289272;ENST00000253807;ENST00000289269	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60797	0.39;0.19;0.42;0.41;0.41;0.38;0.42;0.16;0.33;0.47;0.47;0.17;0.33;0.4;0.42;0.53;0.28;0.61	5.87	5.87	0.94306	.	0.000000	0.34338	N	0.004049	T	0.64929	0.2643	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;B;D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.982;0.996;0.998;0.041;1.0;0.998;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;P;D;D;B;D;D;D;D;D;D	0.97110	0.916;0.973;0.992;1.0;1.0;1.0;0.984;0.987;0.887;0.938;0.931;0.022;1.0;0.951;1.0;0.988;1.0;0.976	T	0.69698	-0.5075	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	998;954;941;932;940;939;676;941;941;928;941;677;927;938;941;939;941;677	Q9Y5I4;Q9H158;Q9Y5I0;Q9UN75;Q9Y5I1;Q9Y5I2;Q9Y5I2-2;Q9Y5H5;Q9Y5H6;Q9UN72;Q9UN73;Q9UN73-2;Q9Y5H7;Q9UN74;Q9Y5H8;Q9Y5H9;Q9Y5I3;Q9Y5I3-2	PCDC2_HUMAN;PCDC1_HUMAN;PCDAD_HUMAN;PCDAC_HUMAN;PCDAB_HUMAN;PCDAA_HUMAN;.;PCDA9_HUMAN;PCDA8_HUMAN;PCDA7_HUMAN;PCDA6_HUMAN;.;PCDA5_HUMAN;PCDA4_HUMAN;PCDA3_HUMAN;PCDA2_HUMAN;PCDA1_HUMAN;.	V	941;677;939;941;938;927;941;677;928;941;941;676;939;940;932;941;954;998	ENSP00000420840:G941V;ENSP00000378129:G677V;ENSP00000431748:G939V;ENSP00000429808:G941V;ENSP00000435300:G938V;ENSP00000436557:G927V;ENSP00000433378:G941V;ENSP00000434113:G677V;ENSP00000436426:G928V;ENSP00000434655:G941V;ENSP00000436042:G941V;ENSP00000421030:G676V;ENSP00000304234:G939V;ENSP00000381636:G940V;ENSP00000381628:G932V;ENSP00000289272:G941V;ENSP00000253807:G954V;ENSP00000289269:G998V	ENSP00000304234:G939V	G	+	2	0	PCDHA6;PCDHA7;PCDHA8;PCDHA9;PCDHA2;PCDHA3;PCDHA4;PCDHA5;PCDHA10;PCDHA11;PCDHA12;PCDHA1;PCDHA13;PCDHAC2;PCDHAC1	140369675	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.103000	0.77014	2.941000	0.99782	0.655000	0.94253	GGG		0.413	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		25	77	1	0	4.72057e-08	0.003954	5.1896e-08	25	77				
PCDHB7	56129	broad.mit.edu	37	5	140552615	140552615	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140552615G>T	ENST00000231137.3	+	1	373	c.199G>T	c.(199-201)Gtt>Ttt	p.V67F		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	67	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACTAGAATTGTTTCAGACCA	0.483																																							uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(199-201)GTT>TTT		protocadherin beta 7 precursor							84.0	88.0	87.0					5																	140552615		2203	4300	6503	SO:0001583	missense	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140552615G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.199G>T	5.37:g.140552615G>T	ENSP00000231137:p.Val67Phe		Somatic					p.V67F	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	373	+			67			Extracellular (Potential).|Cadherin 1.		A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	c.199G>T	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637346	0.47049	.	.	ENSG00000113212	ENST00000231137	T	0.33216	1.42	4.61	-1.28	0.09318	Cadherin, N-terminal (1);	.	.	.	.	T	0.44746	0.1308	M	0.85542	2.76	0.09310	N	0.999999	P	0.41546	0.754	P	0.52424	0.698	T	0.43669	-0.9377	9	0.87932	D	0	.	3.043	0.06145	0.2186:0.117:0.5445:0.1198	.	67	Q9Y5E2	PCDB7_HUMAN	F	67	ENSP00000231137:V67F	ENSP00000231137:V67F	V	+	1	0	PCDHB7	140532799	0.000000	0.05858	0.991000	0.47740	0.906000	0.53458	0.575000	0.23729	-0.166000	0.10890	-0.137000	0.14449	GTT		0.483	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		18	46	1	0	2.4624e-09	0.008871	2.75563e-09	18	46				
PCDHB8	56128	broad.mit.edu	37	5	140559546	140559546	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140559546T>A	ENST00000239444.2	+	1	2176	c.1931T>A	c.(1930-1932)cTg>cAg	p.L644Q	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGGTGGTGCTGGTCAAGGAC	0.697																																							uc011dai.1		NA																	0				skin(4)	4						c.(1930-1932)CTG>CAG		protocadherin beta 8 precursor							19.0	22.0	21.0					5																	140559546		2140	4198	6338	SO:0001583	missense	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140559546T>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1931T>A	5.37:g.140559546T>A	ENSP00000239444:p.Leu644Gln		Somatic				PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	p.L644Q	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2117	+			644			Cadherin 6.|Extracellular (Potential).		B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	c.1931T>A	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	T	11.31	1.600123	0.28534	.	.	ENSG00000120322	ENST00000239444	T	0.68624	-0.34	4.22	3.03	0.35002	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.66036	0.2749	L	0.49699	1.58	0.25618	N	0.986436	B	0.25441	0.126	B	0.41813	0.367	T	0.62388	-0.6865	9	0.56958	D	0.05	.	5.3518	0.16040	0.1571:0.0883:0.0:0.7546	.	644	Q9UN66	PCDB8_HUMAN	Q	644	ENSP00000239444:L644Q	ENSP00000239444:L644Q	L	+	2	0	PCDHB8	140539730	0.000000	0.05858	0.755000	0.31263	0.231000	0.25187	0.224000	0.17738	0.490000	0.27771	0.248000	0.18094	CTG		0.697	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		33	31	0	0	0	0.004289	0	33	31				
PCDHGA3	56112	broad.mit.edu	37	5	140725741	140725741	+	Missense_Mutation	SNP	T	T	A	rs372047139	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140725741T>A	ENST00000253812.6	+	1	2141	c.2141T>A	c.(2140-2142)cTc>cAc	p.L714H	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	714					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTGGCGCTCAGGCTGCGG	0.682													.|||	2	0.000399361	0.0008	0.0	5008	,	,		16067	0.0		0.0	False		,,,				2504	0.001						uc003ljm.1		NA																	0				breast(1)	1						c.(2140-2142)CTC>CAC		protocadherin gamma subfamily A, 3 isoform 1		A	,,HIS/LEU,HIS/LEU	0,4406		0,0,2203	69.0	75.0	73.0		,,2141,2141	4.0	0.8	5		73	1,8591		0,1,4295	no	intron,intron,missense,missense	PCDHGA3,PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_018916.3,NM_032011.1	,,99,99	0,1,6498	AA,AT,TT		0.0116,0.0,0.0077	,,,	,,714/933,714/830	140725741	1,12997	2203	4296	6499	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725741T>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2141T>A	5.37:g.140725741T>A	ENSP00000253812:p.Leu714His		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.L474H|PCDHGA3_uc011dap.1_Missense_Mutation_p.L714H	p.L714H	NM_018916	NP_061739	WXS	Illumina HiSeq	Unspecified	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2141	+			714			Cytoplasmic (Potential).		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.2141T>A	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	12.31	1.899593	0.33535	0.0	1.16E-4	ENSG00000254245	ENST00000253812	T	0.18810	2.19	5.16	3.99	0.46301	.	0.301433	0.17535	N	0.170727	T	0.28267	0.0698	M	0.73598	2.24	0.40570	D	0.981292	B;B	0.29341	0.242;0.007	B;B	0.36335	0.222;0.071	T	0.03000	-1.1084	10	0.52906	T	0.07	.	8.0095	0.30344	0.1255:0.0713:0.0:0.8032	.	714;714	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	H	714	ENSP00000253812:L714H	ENSP00000253812:L714H	L	+	2	0	PCDHGA3	140705925	0.001000	0.12720	0.802000	0.32245	0.324000	0.28378	1.128000	0.31369	0.375000	0.24679	-1.439000	0.01073	CTC		0.682	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		28	89	0	0	0	0.00361	0	28	89				
PCDHGB2	56103	broad.mit.edu	37	5	140741192	140741192	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:140741192A>T	ENST00000522605.1	+	1	1490	c.1490A>T	c.(1489-1491)aAg>aTg	p.K497M	PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	497	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGACCTGAAGCCGCGGGAG	0.612																																							uc003ljs.1		NA																	0					0						c.(1489-1491)AAG>ATG		protocadherin gamma subfamily B, 2 isoform 1							38.0	40.0	39.0					5																	140741192		1939	4130	6069	SO:0001583	missense	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140741192A>T	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1490A>T	5.37:g.140741192A>T	ENSP00000429018:p.Lys497Met		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.K497M|PCDHGA5_uc011das.1_5'Flank	p.K497M	NM_018923	NP_061746	WXS	Illumina HiSeq	Unspecified	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1490	+			497			Extracellular (Potential).|Cadherin 5.		Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	c.1490A>T	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	11.60	1.688463	0.29962	.	.	ENSG00000253910	ENST00000522605	T	0.51574	0.7	5.18	-0.321	0.12717	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.39091	0.1065	N	0.16066	0.365	0.09310	N	0.999997	P;P	0.52170	0.617;0.951	B;P	0.56343	0.353;0.796	T	0.23261	-1.0193	9	0.72032	D	0.01	.	4.4216	0.11482	0.4215:0.3174:0.2611:0.0	.	497;497	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	M	497	ENSP00000429018:K497M	ENSP00000429018:K497M	K	+	2	0	PCDHGB2	140721376	0.977000	0.34250	0.978000	0.43139	0.076000	0.17211	0.768000	0.26590	0.320000	0.23234	0.383000	0.25322	AAG		0.612	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		27	29	0	0	0	0.002096	0	27	29				
PCDH1	5097	broad.mit.edu	37	5	141236903	141236903	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:141236903C>A	ENST00000287008.3	-	4	3380	c.3233G>T	c.(3232-3234)cGa>cTa	p.R1078L	PCDH1_ENST00000503492.1_Missense_Mutation_p.R346L	NM_032420.2	NP_115796.2	Q08174	PCDH1_HUMAN	protocadherin 1	0					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GGGACCGAGTCGAGGCCCTGA	0.627																																					Ovarian(132;1609 1739 4190 14731 45037)	Ovarian(132;1609 1739 4190 14731 45037)	uc003llp.2		NA																	0				ovary(5)	5						c.(3232-3234)CGA>CTA		protocadherin 1 isoform 2 precursor							79.0	71.0	73.0					5																	141236903		2203	4300	6503	SO:0001583	missense	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141236903C>A	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000287008.3:c.3233G>T	5.37:g.141236903C>A	ENSP00000287008:p.Arg1078Leu		Somatic					p.R1078L	NM_032420	NP_115796	WXS	Illumina HiSeq	Unspecified	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	4	3350	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	Error:Variant_position_missing_in_Q08174_after_alignment					Q8IUP2	Missense_Mutation	SNP	ENST00000287008.3	37	c.3233G>T	CCDS4267.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016726	0.75161	.	.	ENSG00000156453	ENST00000503492;ENST00000287008	T;T	0.59906	0.23;0.34	5.04	5.04	0.67666	.	0.000000	0.36555	U	0.002537	T	0.70090	0.3184	L	0.52759	1.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67503	-0.5654	10	0.33141	T	0.24	.	15.8904	0.79293	0.0:1.0:0.0:0.0	.	1078	Q08174-2	.	L	346;1078	ENSP00000424667:R346L;ENSP00000287008:R1078L	ENSP00000287008:R1078L	R	-	2	0	PCDH1	141217087	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.487000	0.81328	2.330000	0.79161	0.455000	0.32223	CGA		0.627	PCDH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320587.2	NM_032420		21	34	1	0	6.21321e-17	0.00278	7.50398e-17	21	34				
TCOF1	6949	broad.mit.edu	37	5	149758943	149758943	+	Missense_Mutation	SNP	G	G	T	rs372635193		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:149758943G>T	ENST00000504761.2	+	16	2630	c.2630G>T	c.(2629-2631)aGt>aTt	p.S877I	TCOF1_ENST00000513346.1_Missense_Mutation_p.S877I|TCOF1_ENST00000323668.7_Missense_Mutation_p.S800I|TCOF1_ENST00000445265.2_Missense_Mutation_p.S800I|TCOF1_ENST00000439160.2_Missense_Mutation_p.S877I|TCOF1_ENST00000451292.1_Missense_Mutation_p.S877I|TCOF1_ENST00000377797.3_Missense_Mutation_p.S877I|TCOF1_ENST00000394269.3_Missense_Mutation_p.S877I|TCOF1_ENST00000506063.1_3'UTR			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	877					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGTCAGACAGTGAGGAGGAG	0.607																																							uc003lry.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(2629-2631)AGT>ATT		Treacher Collins-Franceschetti syndrome 1							67.0	82.0	77.0					5																	149758943		2203	4300	6503	SO:0001583	missense	6949				skeletal system development	nucleolus	protein binding|transporter activity	g.chr5:149758943G>T		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.2630G>T	5.37:g.149758943G>T	ENSP00000421655:p.Ser877Ile		Somatic				TCOF1_uc003lrw.2_Missense_Mutation_p.S877I|TCOF1_uc011dch.1_Missense_Mutation_p.S877I|TCOF1_uc003lrz.2_Missense_Mutation_p.S877I|TCOF1_uc003lrx.2_Missense_Mutation_p.S800I|TCOF1_uc003lsa.2_Missense_Mutation_p.S800I|TCOF1_uc011dci.1_Intron	p.S877I	NM_001135243	NP_001128715	WXS	Illumina HiSeq	Unspecified	Q13428	TCOF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		16	2738	+		all_hematologic(541;0.224)	877					A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	c.2630G>T	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359554	0.41801	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78	5.5	4.62	0.57501	Treacher Collins syndrome, treacle (1);	0.129084	0.36002	N	0.002845	T	0.81178	0.4768	M	0.83483	2.645	0.32095	N	0.591403	P;P;P;P;P;P	0.44816	0.728;0.728;0.728;0.476;0.728;0.844	B;B;B;B;B;P	0.49421	0.313;0.313;0.313;0.418;0.313;0.61	D	0.86414	0.1750	10	0.87932	D	0	-0.2931	11.9677	0.53044	0.0:0.0:0.8264:0.1736	.	877;800;877;877;800;877	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;TCOF_HUMAN;.;.	I	877;877;800;800;877;877;877;877;877	ENSP00000400939:S877I;ENSP00000367028:S877I;ENSP00000409944:S800I;ENSP00000325223:S800I;ENSP00000406888:S877I;ENSP00000377811:S877I;ENSP00000390717:S877I;ENSP00000421655:S877I;ENSP00000427484:S877I	ENSP00000325223:S800I	S	+	2	0	TCOF1	149739136	0.998000	0.40836	0.947000	0.38551	0.621000	0.37620	2.496000	0.45346	1.428000	0.47296	0.462000	0.41574	AGT		0.607	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656		15	29	1	0	5.01169e-05	0.00499	5.28114e-05	15	29				
SAP30L	79685	broad.mit.edu	37	5	153833008	153833008	+	Missense_Mutation	SNP	G	G	T	rs148495748		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:153833008G>T	ENST00000297109.6	+	3	1019	c.371G>T	c.(370-372)cGa>cTa	p.R124L	SAP30L_ENST00000440364.2_Missense_Mutation_p.R83L|SAP30L_ENST00000523198.1_3'UTR|SAP30L_ENST00000426761.2_Missense_Mutation_p.R78L	NM_024632.5	NP_078908.1	Q9HAJ7	SP30L_HUMAN	SAP30-like	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|lung(3)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CGTTATAAACGACACTACAAG	0.483																																							uc003lvk.2		NA																	0					0						c.(370-372)CGA>CTA		SAP30-like isoform 1							146.0	125.0	132.0					5																	153833008		2203	4300	6503	SO:0001583	missense	79685				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|metal ion binding	g.chr5:153833008G>T	AY341060	CCDS4326.1, CCDS47321.1, CCDS47322.1	5q33.2	2008-02-05			ENSG00000164576	ENSG00000164576			25663	protein-coding gene	gene with protein product		610398				14680513	Standard	NM_001131062		Approved	FLJ11526, NS4ATP2	uc003lvk.3	Q9HAJ7	OTTHUMG00000130146	ENST00000297109.6:c.371G>T	5.37:g.153833008G>T	ENSP00000297109:p.Arg124Leu		Somatic				SAP30L_uc003lvm.3_RNA|SAP30L_uc011ddc.1_Missense_Mutation_p.R83L|SAP30L_uc011ddd.1_Missense_Mutation_p.R78L	p.R124L	NM_024632	NP_078908	WXS	Illumina HiSeq	Unspecified	Q9HAJ7	SP30L_HUMAN	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)		3	1019	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	124	RRYKRHYK->AAAAAAAA: Abolishes nucleolar localization.				E9PAU7|E9PAY2	Missense_Mutation	SNP	ENST00000297109.6	37	c.371G>T	CCDS4326.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951015	0.92660	.	.	ENSG00000164576	ENST00000297109;ENST00000440364;ENST00000426761	.	.	.	5.84	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.79656	0.4483	M	0.81802	2.56	0.80722	D	1	D;D;D	0.76494	0.997;0.997;0.999	D;D;D	0.75484	0.949;0.949;0.986	T	0.82920	-0.0218	9	0.87932	D	0	-12.624	14.6758	0.68978	0.0693:0.0:0.9307:0.0	.	78;83;124	E9PAY2;E9PAU7;Q9HAJ7	.;.;SP30L_HUMAN	L	124;83;78	.	ENSP00000297109:R124L	R	+	2	0	SAP30L	153813201	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.640000	0.98453	1.468000	0.48064	0.655000	0.94253	CGA		0.483	SAP30L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252454.3	NM_024632		39	61	1	0	1.8453e-21	0.002522	2.30578e-21	39	61				
MRPL22	29093	broad.mit.edu	37	5	154346452	154346452	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:154346452C>G	ENST00000523037.1	+	7	657	c.616C>G	c.(616-618)Cta>Gta	p.L206V	MRPL22_ENST00000518364.1_3'UTR|MRPL22_ENST00000265229.8_Missense_Mutation_p.L126V|MRPL22_ENST00000522038.1_Missense_Mutation_p.L212V|MRPL22_ENST00000439747.3_Missense_Mutation_p.L232V	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	206					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGTTCACACTCTATGATGAGG	0.433																																							uc003lvy.3		NA																	0					0						c.(616-618)CTA>GTA		mitochondrial ribosomal protein L22 isoform a							37.0	31.0	33.0					5																	154346452		2203	4300	6503	SO:0001583	missense	29093				translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome	g.chr5:154346452C>G	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.616C>G	5.37:g.154346452C>G	ENSP00000431040:p.Leu206Val		Somatic				MRPL22_uc003lvz.3_Missense_Mutation_p.L126V	p.L206V	NM_014180	NP_054899	WXS	Illumina HiSeq	Unspecified	Q9NWU5	RM22_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		7	654	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	206					A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	c.616C>G	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401497	0.42613	.	.	ENSG00000082515	ENST00000523037;ENST00000265229;ENST00000439747;ENST00000522038	T;T;T;T	0.61158	0.27;0.6;0.13;0.27	5.8	4.02	0.46733	.	2.576260	0.01255	N	0.008981	T	0.77916	0.4202	M	0.80422	2.495	0.58432	D	0.999998	D	0.67145	0.996	P	0.62740	0.906	T	0.55573	-0.8120	10	0.87932	D	0	.	9.7195	0.40295	0.0:0.7883:0.0:0.2117	.	206	Q9NWU5	RM22_HUMAN	V	206;126;232;212	ENSP00000431040:L206V;ENSP00000265229:L126V;ENSP00000411177:L232V;ENSP00000429039:L212V	ENSP00000265229:L126V	L	+	1	2	MRPL22	154326645	0.967000	0.33354	0.026000	0.17262	0.019000	0.09904	2.260000	0.43267	0.797000	0.33971	0.563000	0.77884	CTA		0.433	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2			4	4	0	0	0	0.000602	0	4	4				
KIF4B	285643	broad.mit.edu	37	5	154394711	154394711	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:154394711A>T	ENST00000435029.4	+	1	1452	c.1292A>T	c.(1291-1293)aAc>aTc	p.N431I		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	431					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAAAAACTGAACGCCAAGCTA	0.453																																							uc010jih.1		NA																	0				ovary(1)	1						c.(1291-1293)AAC>ATC		kinesin family member 4B							109.0	111.0	110.0					5																	154394711		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154394711A>T	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1292A>T	5.37:g.154394711A>T	ENSP00000387875:p.Asn431Ile		Somatic					p.N431I	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	1452	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	431			Potential.			Missense_Mutation	SNP	ENST00000435029.4	37	c.1292A>T	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	a	4.654	0.121656	0.08881	.	.	ENSG00000226650	ENST00000435029	T	0.50001	0.76	2.27	-2.5	0.06384	.	.	.	.	.	T	0.33089	0.0851	L	0.47716	1.5	0.32232	N	0.57384	B	0.02656	0.0	B	0.06405	0.002	T	0.19516	-1.0303	9	0.35671	T	0.21	.	4.2971	0.10906	0.3956:0.1929:0.4115:0.0	.	431	Q2VIQ3	KIF4B_HUMAN	I	431	ENSP00000387875:N431I	ENSP00000387875:N431I	N	+	2	0	KIF4B	154374904	0.937000	0.31787	0.890000	0.34922	0.708000	0.40852	1.133000	0.31430	-0.770000	0.04614	-1.098000	0.02139	AAC		0.453	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			32	65	0	0	0	0.004878	0	32	65				
HAVCR1	26762	broad.mit.edu	37	5	156464271	156464271	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:156464271G>A	ENST00000339252.3	-	6	1471	c.939C>T	c.(937-939)gtC>gtT	p.V313V	HAVCR1_ENST00000523175.1_Silent_p.V313V|HAVCR1_ENST00000522693.1_Silent_p.V313V|HAVCR1_ENST00000517644.1_5'UTR|HAVCR1_ENST00000544197.1_Silent_p.V313V|HAVCR1_ENST00000425854.1_Silent_p.V313V	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	308					viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGCAATGATGACACCCAAAA	0.408																																							uc010jij.1		NA																	0				ovary(1)|skin(1)	2						c.(937-939)GTC>GTT		hepatitis A virus cellular receptor 1							144.0	138.0	140.0					5																	156464271		1929	4155	6084	SO:0001819	synonymous_variant	26762				interspecies interaction between organisms	integral to membrane	receptor activity	g.chr5:156464271G>A	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.939C>T	5.37:g.156464271G>A			Somatic				HAVCR1_uc011ddl.1_Silent_p.V144V|HAVCR1_uc003lwi.2_Silent_p.V313V	p.V313V	NM_001099414	NP_001092884	WXS	Illumina HiSeq	Unspecified	Q96D42	HAVR1_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		7	1124	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	308			Helical; (Potential).		O43656	Silent	SNP	ENST00000339252.3	37	c.939C>T	CCDS43392.1																																																																																				0.408	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1			41	92	0	0	0	0.00361	0	41	92				
ADAM19	8728	broad.mit.edu	37	5	156920137	156920137	+	Silent	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:156920137G>C	ENST00000517905.1	-	16	1796	c.1752C>G	c.(1750-1752)ccC>ccG	p.P584P	ADAM19_ENST00000257527.4_Silent_p.P584P|ADAM19_ENST00000394020.1_Silent_p.P586P|ADAM19_ENST00000430702.2_Silent_p.P317P			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	584	Cys-rich.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGACTCCAGGGGCCGGGCCT	0.597																																							uc003lwz.2		NA																	0				ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(1750-1752)CCC>CCG		ADAM metallopeptidase domain 19 preproprotein							72.0	71.0	72.0					5																	156920137		2203	4300	6503	SO:0001819	synonymous_variant	8728				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding	g.chr5:156920137G>C	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.1752C>G	5.37:g.156920137G>C			Somatic				ADAM19_uc003lww.1_Silent_p.P317P|ADAM19_uc003lwy.2_Silent_p.P183P|ADAM19_uc011ddr.1_Silent_p.P515P	p.P584P	NM_033274	NP_150377	WXS	Illumina HiSeq	Unspecified	Q9H013	ADA19_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		16	1816	-	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	584			Extracellular (Potential).|Cys-rich.		Q9BZL5|Q9UHP2	Silent	SNP	ENST00000517905.1	37	c.1752C>G		.	.	.	.	.	.	.	.	.	.	G	9.895	1.205254	0.22205	.	.	ENSG00000135074	ENST00000517374	T	0.24151	1.87	5.08	3.21	0.36854	.	0.099135	0.44902	D	0.000402	T	0.37265	0.0997	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.10109	-1.0644	7	0.87932	D	0	.	8.2708	0.31842	0.1182:0.2601:0.6217:0.0	.	.	.	.	R	155	ENSP00000431027:P155R	ENSP00000431027:P155R	P	-	2	0	ADAM19	156852715	0.987000	0.35691	0.982000	0.44146	0.978000	0.69477	0.338000	0.19858	0.464000	0.27142	0.563000	0.77884	CCC		0.597	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274		33	105	0	0	0	0.00874	0	33	105				
EBF1	1879	broad.mit.edu	37	5	158267057	158267057	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:158267057G>A	ENST00000313708.6	-	7	898	c.616C>T	c.(616-618)Cgt>Tgt	p.R206C	EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.R183C|EBF1_ENST00000517373.1_Missense_Mutation_p.R206C	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	206					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGCATGTCACGTGGGTTTCCC	0.383			T	HMGA2	lipoma																																		uc010jip.2		NA		Dom	yes		5	5q34	1879	T	early B-cell factor 1			M	HMGA2		lipoma	HMGA2/EBF1(2)	0				soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(616-618)CGT>TGT		early B-cell factor							113.0	120.0	118.0					5																	158267057		2203	4300	6503	SO:0001583	missense	1879				multicellular organismal development	nucleus	DNA binding|metal ion binding	g.chr5:158267057G>A	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.616C>T	5.37:g.158267057G>A	ENSP00000322898:p.Arg206Cys		Somatic				EBF1_uc011ddw.1_Missense_Mutation_p.R73C|EBF1_uc011ddx.1_Missense_Mutation_p.R206C|EBF1_uc003lxl.3_Missense_Mutation_p.R183C	p.R206C	NM_024007	NP_076870	WXS	Illumina HiSeq	Unspecified	Q9UH73	COE1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		7	918	-	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	206					Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	37	c.616C>T	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954556	0.92726	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.60040	0.22;0.4;0.34	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.80670	0.4667	M	0.86502	2.82	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.953;0.979;0.988;0.997	D	0.83818	0.0245	10	0.87932	D	0	-2.9826	19.3968	0.94610	0.0:0.0:1.0:0.0	.	206;192;206;183	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	C	206;206;183;206	ENSP00000322898:R206C;ENSP00000370029:R183C;ENSP00000428020:R206C	ENSP00000322898:R206C	R	-	1	0	EBF1	158199635	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.091000	0.64505	2.565000	0.86533	0.655000	0.94253	CGT		0.383	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007		21	64	0	0	0	0.00333	0	21	64				
ATP10B	23120	broad.mit.edu	37	5	160047577	160047578	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:160047577_160047578GG>CC	ENST00000327245.5	-	15	3038_3039	c.2192_2193CC>GG	c.(2191-2193)gCC>gGG	p.A731G	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	731					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGTAGGCATGGGCAGCGTGCAC	0.649																																							uc003lym.1		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(2191-2193)GCC>GGG		ATPase, class V, type 10B																																				SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160047577_160047578GG>CC	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2192_2193delinsCC	5.37:g.160047577_160047578delinsCC	ENSP00000313600:p.Ala731Gly		Somatic				ATP10B_uc010jit.1_Missense_Mutation_p.A48G|ATP10B_uc003lyn.2_Missense_Mutation_p.A289G	p.A731G	NM_025153	NP_079429	WXS	Illumina HiSeq	Unspecified	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		15	3039_3040	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	731			Cytoplasmic (Potential).		Q9H725	Missense_Mutation	DNP	ENST00000327245.5	37	c.2192_2193CC>GG	CCDS43394.1																																																																																				0.649	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		15	38	0	0	0	0.004672	0	15	38				
FBLL1	345630	broad.mit.edu	37	5	167957247	167957247	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:167957247C>G	ENST00000338333.4	+	1	1127	c.738C>G	c.(736-738)ttC>ttG	p.F246L				A6NHQ2	FBLL1_HUMAN	fibrillarin-like 1	246					rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)										ACGTGATCTTCGCCGACGTGG	0.627																																							uc011dep.1		NA																	0					0						c.(451-453)TTC>TTG		RecName: Full=rRNA/tRNA 2'-O-methyltransferase fibrillarin-like protein 1;          EC=2.1.1.-;							57.0	52.0	54.0					5																	167957247		876	1991	2867	SO:0001583	missense	345630							g.chr5:167957247C>G			5q35.1	2013-03-06			ENSG00000188573	ENSG00000188573			35458	other	unknown							Standard	NR_024356		Approved	LOC345630	uc011dep.2	A6NHQ2	OTTHUMG00000157012	ENST00000338333.4:c.738C>G	5.37:g.167957247C>G	ENSP00000473383:p.Phe246Leu		Somatic					p.F151L	NR_024356		WXS	Illumina HiSeq	Unspecified					1	666	+									Missense_Mutation	SNP	ENST00000338333.4	37	c.453C>G																																																																																					0.627	FBLL1-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000347089.3	NR_024356		13	40	0	0	0	0.007413	0	13	40				
STC2	8614	broad.mit.edu	37	5	172745196	172745196	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:172745196G>A	ENST00000265087.4	-	4	1872	c.563C>T	c.(562-564)gCc>gTc	p.A188V	STC2_ENST00000520593.1_5'UTR	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	188					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GTGGGTGATGGCCTCCTTCAC	0.567																																							uc003mco.1		NA																	0				skin(2)|ovary(1)	3						c.(562-564)GCC>GTC		stanniocalcin 2 precursor							55.0	44.0	48.0					5																	172745196		2203	4300	6503	SO:0001583	missense	8614				cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity	g.chr5:172745196G>A	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.563C>T	5.37:g.172745196G>A	ENSP00000265087:p.Ala188Val		Somatic				STC2_uc003mcn.1_Missense_Mutation_p.A103V	p.A188V	NM_003714	NP_003705	WXS	Illumina HiSeq	Unspecified	O76061	STC2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		4	1873	-	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	188						Missense_Mutation	SNP	ENST00000265087.4	37	c.563C>T	CCDS4388.1	.	.	.	.	.	.	.	.	.	.	G	34	5.294888	0.95546	.	.	ENSG00000113739	ENST00000265087	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.74943	0.3783	L	0.46741	1.465	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.74520	-0.3638	9	0.48119	T	0.1	-24.4009	19.196	0.93689	0.0:0.0:1.0:0.0	.	188	O76061	STC2_HUMAN	V	188	.	ENSP00000265087:A188V	A	-	2	0	STC2	172677802	1.000000	0.71417	0.989000	0.46669	0.999000	0.98932	7.634000	0.83273	2.531000	0.85337	0.650000	0.86243	GCC		0.567	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714		10	27	0	0	0	0.001368	0	10	27				
IRF4	3662	broad.mit.edu	37	6	401593	401593	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:401593G>C	ENST00000380956.4	+	7	1041	c.915G>C	c.(913-915)gaG>gaC	p.E305D		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	305					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		AAAACATTGAGAAGCTGCTGA	0.602			T	IGH@	MM																																		uc003msz.3		NA		Dom	yes		6	6p25-p23	3662	T	interferon regulatory factor 4			L	IGH@		MM 		0				ovary(1)	1						c.(913-915)GAG>GAC		interferon regulatory factor 4							53.0	45.0	48.0					6																	401593		2203	4300	6503	SO:0001583	missense	3662				interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr6:401593G>C	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.915G>C	6.37:g.401593G>C	ENSP00000370343:p.Glu305Asp		Somatic				IRF4_uc010jne.1_Missense_Mutation_p.E305D|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Missense_Mutation_p.E304D|IRF4_uc003mtc.1_Missense_Mutation_p.E135D	p.E305D	NM_002460	NP_002451	WXS	Illumina HiSeq	Unspecified	Q15306	IRF4_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)	7	1028	+		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)	305					Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	c.915G>C	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	G	8.517	0.867924	0.17250	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.95377	-3.69	5.76	2.61	0.31194	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.248243	0.45606	D	0.000351	D	0.88284	0.6395	L	0.48986	1.54	0.43494	D	0.995738	B;B;B;B	0.24483	0.012;0.054;0.01;0.104	B;B;B;B	0.32211	0.082;0.142;0.033;0.131	D	0.83441	0.0043	10	0.30854	T	0.27	-30.6705	7.0427	0.25029	0.4467:0.0:0.5533:0.0	.	305;335;304;305	F2Z3D5;Q99419;Q15306-2;Q15306	.;.;.;IRF4_HUMAN	D	305;334	ENSP00000370343:E305D	ENSP00000370343:E305D	E	+	3	2	IRF4	346593	1.000000	0.71417	0.999000	0.59377	0.102000	0.19082	1.776000	0.38594	0.782000	0.33613	-0.140000	0.14226	GAG		0.602	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1			17	26	0	0	0	0.007413	0	17	26				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7987073	7987073	+	Intron	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:7987073G>A	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)																		AGATTTCTACGTGGTGGAGAG	0.522																																							uc003mxx.3		NA																	0					0						c.(304-306)GTG>ATG		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7987073G>A			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+39526C>T	6.37:g.7987073G>A			Somatic				TXNDC5_uc003mxw.2_Intron	p.V102M	NR_027712		WXS	Illumina HiSeq	Unspecified					1	739	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.304G>A																																																																																					0.522	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		21	46	0	0	0	0.003954	0	21	46				
HIST1H3D	8351	broad.mit.edu	37	6	26197311	26197311	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:26197311C>T	ENST00000356476.2	-	1	167	c.168G>A	c.(166-168)caG>caA	p.Q56Q	HIST1H3D_ENST00000377831.5_Silent_p.Q56Q|HIST1H2BF_ENST00000359985.1_5'Flank			P68431	H31_HUMAN	histone cluster 1, H3d	56					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				CGGTCGACTTCTGGTAGCGGC	0.632																																					GBM(108;3816 4467)	GBM(108;3816 4467)	uc003ngv.2		NA																	0					0						c.(166-168)CAG>CAA		histone cluster 1, H3d							60.0	62.0	61.0					6																	26197311		2203	4300	6503	SO:0001819	synonymous_variant	8351				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26197311C>T	Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.168G>A	6.37:g.26197311C>T			Somatic				HIST1H2BF_uc003ngx.2_5'Flank	p.Q56Q	NM_003530	NP_003521	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			2	565	-		all_hematologic(11;0.196)	56					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000356476.2	37	c.168G>A	CCDS4590.1																																																																																				0.632	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040096.1	NM_003530		16	79	0	0	0	0.003954	0	16	79				
HIST1H2AH	85235	broad.mit.edu	37	6	27114968	27114968	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:27114968C>G	ENST00000377459.1	+	1	108	c.61C>G	c.(61-63)Cgg>Ggg	p.R21G	HIST1H2BK_ENST00000396891.4_5'Flank|MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000356950.1_5'Flank	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	21						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R21R(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						CCGCTCTTCTCGGGCTGGGCT	0.622																																							uc003niz.2		NA																	1	Substitution - coding silent(1)		breast(1)		0						c.(61-63)CGG>GGG		histone cluster 1, H2ah							61.0	69.0	66.0					6																	27114968		2203	4300	6503	SO:0001583	missense	85235				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27114968C>G	AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.61C>G	6.37:g.27114968C>G	ENSP00000366679:p.Arg21Gly		Somatic				HIST1H2BK_uc003nix.1_5'Flank|hsa-mir-3143|MI0014167_5'Flank	p.R21G	NM_080596	NP_542163	WXS	Illumina HiSeq	Unspecified	Q96KK5	H2A1H_HUMAN			1	61	+			21						Missense_Mutation	SNP	ENST00000377459.1	37	c.61C>G	CCDS4622.1	.	.	.	.	.	.	.	.	.	.	C	3.255	-0.152512	0.06585	.	.	ENSG00000184825	ENST00000377459	D	0.88046	-2.33	3.95	2.05	0.26809	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.37669	N	0.001993	D	0.83156	0.5193	M	0.93594	3.435	0.29904	N	0.82415	B	0.25312	0.123	B	0.19946	0.027	T	0.79356	-0.1837	10	0.87932	D	0	.	10.6144	0.45441	0.3482:0.6518:0.0:0.0	.	21	Q96KK5	H2A1H_HUMAN	G	21	ENSP00000366679:R21G	ENSP00000366679:R21G	R	+	1	2	HIST1H2AH	27222947	0.426000	0.25506	0.036000	0.18154	0.010000	0.07245	0.945000	0.29056	0.358000	0.24211	0.655000	0.94253	CGG		0.622	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040136.1	NM_080596		28	79	0	0	0	0.002096	0	28	79				
OR2B6	26212	broad.mit.edu	37	6	27925535	27925535	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:27925535G>T	ENST00000244623.1	+	1	517	c.517G>T	c.(517-519)Gtg>Ttg	p.V173L		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGACCCCTATGTGATAGATCA	0.483																																							uc011dkx.1		NA																	0				skin(1)	1						c.(517-519)GTG>TTG		olfactory receptor, family 2, subfamily B,							144.0	146.0	145.0					6																	27925535		2203	4300	6503	SO:0001583	missense	26212				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:27925535G>T	U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.517G>T	6.37:g.27925535G>T	ENSP00000244623:p.Val173Leu		Somatic					p.V173L	NM_012367	NP_036499	WXS	Illumina HiSeq	Unspecified	P58173	OR2B6_HUMAN			1	517	+			173			Extracellular (Potential).		O43883|Q6IF89|Q9H5B0	Missense_Mutation	SNP	ENST00000244623.1	37	c.517G>T	CCDS4642.1	.	.	.	.	.	.	.	.	.	.	g	3.629	-0.075992	0.07184	.	.	ENSG00000124657	ENST00000244623	T	0.00145	8.67	3.55	1.34	0.21922	GPCR, rhodopsin-like superfamily (1);	1.150940	0.07048	U	0.831460	T	0.00039	0.0001	N	0.17674	0.51	0.09310	N	1	B	0.13594	0.008	B	0.24006	0.05	T	0.10064	-1.0646	10	0.27082	T	0.32	.	3.2016	0.06651	0.2819:0.2243:0.4939:0.0	.	173	P58173	OR2B6_HUMAN	L	173	ENSP00000244623:V173L	ENSP00000244623:V173L	V	+	1	0	OR2B6	28033514	0.000000	0.05858	0.001000	0.08648	0.335000	0.28730	-2.282000	0.01156	0.687000	0.31509	0.467000	0.42956	GTG		0.483	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040165.1			49	90	1	0	7.50695e-29	0.00361	9.66186e-29	49	90				
ZBED9	114821	broad.mit.edu	37	6	28540642	28540642	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:28540642C>G	ENST00000452236.2	-	4	3641	c.3024G>C	c.(3022-3024)atG>atC	p.M1008I		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						atatttttttcatggcaagac	0.299																																							uc003nlo.2		NA																	0				ovary(1)	1						c.(3022-3024)ATG>ATC		SCAN domain containing 3							65.0	67.0	66.0					6																	28540642		2201	4300	6501	SO:0001583	missense	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28540642C>G																												ENST00000452236.2:c.3024G>C	6.37:g.28540642C>G	ENSP00000395259:p.Met1008Ile		Somatic					p.M1008I	NM_052923	NP_443155	WXS	Illumina HiSeq	Unspecified	Q6R2W3	SCND3_HUMAN			4	3642	-			1008						Missense_Mutation	SNP	ENST00000452236.2	37	c.3024G>C	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	9.397	1.077111	0.20227	.	.	ENSG00000232040	ENST00000452236	T	0.20881	2.04	2.14	2.14	0.27477	Ribonuclease H-like (1);	3.499020	0.01373	N	0.012647	T	0.06962	0.0177	L	0.29908	0.895	0.25277	N	0.98946	B	0.06786	0.001	B	0.08055	0.003	T	0.20605	-1.0270	10	0.48119	T	0.1	.	7.8439	0.29414	0.0:1.0:0.0:0.0	.	1008	Q6R2W3	SCND3_HUMAN	I	1008	ENSP00000395259:M1008I	ENSP00000395259:M1008I	M	-	3	0	SCAND3	28648621	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	1.852000	0.39348	1.507000	0.48752	0.561000	0.74099	ATG		0.299	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			26	68	0	0	0	0.005443	0	26	68				
DHX16	8449	broad.mit.edu	37	6	30639018	30639018	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:30639018G>T	ENST00000376442.3	-	2	436	c.241C>A	c.(241-243)Cgg>Agg	p.R81R		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	81					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						TCTGCTGCCCGAGCTGGCTTT	0.557																																							uc003nqz.2		NA																	0				ovary(2)|kidney(2)	4						c.(241-243)CGG>AGG		DEAH (Asp-Glu-Ala-His) box polypeptide 16							220.0	272.0	253.0					6																	30639018		1510	2707	4217	SO:0001819	synonymous_variant	8449				mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity	g.chr6:30639018G>T	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.241C>A	6.37:g.30639018G>T			Somatic				DHX16_uc011dmo.1_Silent_p.R21R	p.R81R	NM_003587	NP_003578	WXS	Illumina HiSeq	Unspecified	O60231	DHX16_HUMAN			2	453	-			81					O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	c.241C>A	CCDS4685.1																																																																																				0.557	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587		112	282	1	0	1.77217e-65	0.00361	2.36519e-65	112	282				
TNXB	7148	broad.mit.edu	37	6	32036752	32036752	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:32036752C>A	ENST00000375244.3	-	16	5950	c.5749G>T	c.(5749-5751)Gat>Tat	p.D1917Y	TNXB_ENST00000375247.2_Missense_Mutation_p.D1917Y			P22105	TENX_HUMAN	tenascin XB	1999	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCGTCTCTATCTGTGTACTGG	0.552																																							uc003nzl.2		NA																	0					0						c.(5749-5751)GAT>TAT		tenascin XB isoform 1 precursor							134.0	151.0	145.0					6																	32036752		1325	2581	3906	SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32036752C>A	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5749G>T	6.37:g.32036752C>A	ENSP00000364393:p.Asp1917Tyr		Somatic					p.D1917Y	NM_019105	NP_061978	WXS	Illumina HiSeq	Unspecified	P22105	TENX_HUMAN			16	5951	-			1999			Fibronectin type-III 12.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37	c.5749G>T		.	.	.	.	.	.	.	.	.	.	C	20.1	3.935388	0.73442	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.58210	0.35;0.35	4.41	3.54	0.40534	.	0.139498	0.32884	N	0.005521	T	0.62011	0.2393	M	0.85197	2.74	0.09310	N	0.999991	D	0.89917	1.0	D	0.74023	0.982	T	0.56805	-0.7918	10	0.72032	D	0.01	.	9.9423	0.41587	0.0:0.9028:0.0:0.0972	.	1917	P22105-3	.	Y	1917	ENSP00000364393:D1917Y;ENSP00000364396:D1917Y	ENSP00000364393:D1917Y	D	-	1	0	TNXB	32144730	0.798000	0.28890	0.301000	0.25044	0.666000	0.39218	4.024000	0.57218	1.233000	0.43693	0.655000	0.94253	GAT		0.552	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		48	143	1	0	1.35996e-42	0.00361	1.79756e-42	48	143				
LRFN2	57497	broad.mit.edu	37	6	40400156	40400156	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:40400156G>T	ENST00000338305.6	-	2	1239	c.697C>A	c.(697-699)Cca>Aca	p.P233T		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	233						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GACAAGGGTGGGGCAAAGGGT	0.602																																							uc003oph.1		NA																	0				ovary(2)|skin(1)	3						c.(697-699)CCA>ACA		leucine rich repeat and fibronectin type III							35.0	41.0	39.0					6																	40400156		2203	4300	6503	SO:0001583	missense	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40400156G>T	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.697C>A	6.37:g.40400156G>T	ENSP00000345985:p.Pro233Thr		Somatic					p.P233T	NM_020737	NP_065788	WXS	Illumina HiSeq	Unspecified	Q9ULH4	LRFN2_HUMAN			2	1162	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		233			Extracellular (Potential).		A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	c.697C>A	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	9.395	1.076574	0.20227	.	.	ENSG00000156564	ENST00000338305	T	0.02258	4.37	5.42	4.53	0.55603	.	0.047684	0.85682	N	0.000000	T	0.01222	0.0040	L	0.46947	1.48	0.80722	D	1	B	0.15141	0.012	B	0.15870	0.014	T	0.50906	-0.8772	10	0.29301	T	0.29	.	14.0798	0.64914	0.0:0.0:0.8482:0.1518	.	233	Q9ULH4	LRFN2_HUMAN	T	233	ENSP00000345985:P233T	ENSP00000345985:P233T	P	-	1	0	LRFN2	40508134	1.000000	0.71417	0.936000	0.37596	0.579000	0.36224	7.987000	0.88182	1.248000	0.43934	0.563000	0.77884	CCA		0.602	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		12	41	1	0	0.00010058	0.001368	0.000105501	12	41				
GLTSCR1L	23506	broad.mit.edu	37	6	42797548	42797548	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:42797548C>T	ENST00000314073.5	+	6	1653	c.1477C>T	c.(1477-1479)Cag>Tag	p.Q493*	GLTSCR1L_ENST00000394168.1_Nonsense_Mutation_p.Q493*			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	493																	TGCCTCTCCTCAGCTTGTGGG	0.542																																							uc003osn.1		NA																	0				ovary(1)	1						c.(1477-1479)CAG>TAG		hypothetical protein LOC23506							112.0	99.0	103.0					6																	42797548		2203	4300	6503	SO:0001587	stop_gained	23506							g.chr6:42797548C>T	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1477C>T	6.37:g.42797548C>T	ENSP00000313933:p.Gln493*		Somatic				KIAA0240_uc003osm.1_Nonsense_Mutation_p.Q493*|KIAA0240_uc011duw.1_Nonsense_Mutation_p.Q493*|KIAA0240_uc003oso.1_Nonsense_Mutation_p.Q493*|KIAA0240_uc003osp.1_Nonsense_Mutation_p.Q493*	p.Q493*	NM_015349	NP_056164	WXS	Illumina HiSeq	Unspecified	Q6AI39	K0240_HUMAN	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)		6	1628	+	Colorectal(47;0.196)		493					A1L3W2|Q5TFZ3|Q92514	Nonsense_Mutation	SNP	ENST00000314073.5	37	c.1477C>T	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	C	38	6.846463	0.97881	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	.	.	.	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-10.2145	20.3627	0.98863	0.0:1.0:0.0:0.0	.	.	.	.	X	493	.	ENSP00000313933:Q493X	Q	+	1	0	KIAA0240	42905526	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.726000	0.54977	2.885000	0.99019	0.655000	0.94253	CAG		0.542	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349		37	94	0	0	0	0.009718	0	37	94				
PTK7	5754	broad.mit.edu	37	6	43111325	43111325	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:43111325G>A	ENST00000230419.4	+	14	2439	c.2218G>A	c.(2218-2220)Gag>Aag	p.E740K	PTK7_ENST00000349241.2_Missense_Mutation_p.E610K|PTK7_ENST00000481273.1_Missense_Mutation_p.E748K|PTK7_ENST00000345201.2_Missense_Mutation_p.E700K|PTK7_ENST00000352931.2_Missense_Mutation_p.E684K	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	740					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GAAGCAGCCCGAGGGCGAGGA	0.667											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003oub.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(2218-2220)GAG>AAG		PTK7 protein tyrosine kinase 7 isoform a							33.0	32.0	32.0					6																	43111325		2203	4300	6503	SO:0001583	missense	5754				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:43111325G>A	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2218G>A	6.37:g.43111325G>A	ENSP00000230419:p.Glu740Lys		Somatic	OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	913	PTK7_uc003ouc.1_Missense_Mutation_p.E684K|PTK7_uc003oud.1_Missense_Mutation_p.E700K|PTK7_uc003oue.1_Missense_Mutation_p.E610K|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Missense_Mutation_p.E748K|PTK7_uc010jyj.1_Intron	p.E740K	NM_002821	NP_002812	WXS	Illumina HiSeq	Unspecified	Q13308	PTK7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)		14	2416	+			740			Cytoplasmic (Potential).		A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	37	c.2218G>A	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598015	0.87055	.	.	ENSG00000112655	ENST00000230419;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273	T;T;T;T;T	0.73789	-0.68;-0.78;-0.63;-0.7;-0.71	5.79	5.79	0.91817	.	0.097575	0.64402	D	0.000001	T	0.78298	0.4261	L	0.56769	1.78	0.54753	D	0.99998	D;P;D;P;P	0.64830	0.982;0.605;0.994;0.605;0.896	P;B;P;B;B	0.55391	0.734;0.151;0.775;0.151;0.236	T	0.77742	-0.2474	10	0.51188	T	0.08	.	20.04	0.97581	0.0:0.0:1.0:0.0	.	748;610;700;684;740	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308	.;.;.;.;PTK7_HUMAN	K	740;610;684;700;748	ENSP00000230419:E740K;ENSP00000325462:E610K;ENSP00000326029:E684K;ENSP00000325992:E700K;ENSP00000418754:E748K	ENSP00000230418:E740K	E	+	1	0	PTK7	43219303	1.000000	0.71417	0.970000	0.41538	0.992000	0.81027	9.293000	0.96082	2.733000	0.93635	0.655000	0.94253	GAG		0.667	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2			8	17	0	0	0	0.006214	0	8	17				
TTBK1	84630	broad.mit.edu	37	6	43251427	43251427	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:43251427C>T	ENST00000259750.4	+	14	3032	c.2949C>T	c.(2947-2949)ctC>ctT	p.L983L		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	983					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			AGAACGGCCTCGCCCTGTCAG	0.682																																							uc003ouq.1		NA																	0				lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(2947-2949)CTC>CTT		tau tubulin kinase 1							19.0	24.0	23.0					6																	43251427		2200	4296	6496	SO:0001819	synonymous_variant	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43251427C>T	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2949C>T	6.37:g.43251427C>T			Somatic					p.L983L	NM_032538	NP_115927	WXS	Illumina HiSeq	Unspecified	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		14	3228	+			983					A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	c.2949C>T	CCDS34455.1																																																																																				0.682	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			20	39	0	0	0	0.008871	0	20	39				
POLR1C	9533	broad.mit.edu	37	6	43488713	43488713	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:43488713C>T	ENST00000372389.3	+	8	937	c.849C>T	c.(847-849)ttC>ttT	p.F283F	RP3-337H4.9_ENST00000607571.1_RNA|POLR1C_ENST00000304004.3_Silent_p.F283F|POLR1C_ENST00000372344.2_Silent_p.F233F	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	283					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TGGATACCTTCAGCAGAGAAA	0.443																																							uc003ovn.2		NA																	0					0						c.(847-849)TTC>TTT		RNA polymerase I subunit isoform 1							93.0	99.0	97.0					6																	43488713		2203	4300	6503	SO:0001819	synonymous_variant	9533				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity	g.chr6:43488713C>T	AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.849C>T	6.37:g.43488713C>T			Somatic				POLR1C_uc003ovo.1_Silent_p.F283F	p.F283F	NM_203290	NP_976035	WXS	Illumina HiSeq	Unspecified	O15160	RPAC1_HUMAN	Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)		8	906	+	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		283					O75395|Q5JTE3	Silent	SNP	ENST00000372389.3	37	c.849C>T	CCDS4901.1																																																																																				0.443	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040652.3	NM_004875		35	80	0	0	0	0.004289	0	35	80				
PTCHD4	442213	broad.mit.edu	37	6	47846746	47846746	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:47846746C>A	ENST00000339488.4	-	3	1867	c.1834G>T	c.(1834-1836)Gcc>Tcc	p.A612S		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	612						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										CTAGTCCTGGCCACCAGATAC	0.438																																							uc011dwm.1		NA																	0				central_nervous_system(1)	1						c.(1783-1785)GCC>TCC		hypothetical protein LOC442213							103.0	102.0	102.0					6																	47846746		2203	4300	6503	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846746C>A		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1834G>T	6.37:g.47846746C>A	ENSP00000341914:p.Ala612Ser		Somatic				C6orf138_uc011dwn.1_Missense_Mutation_p.A359S	p.A595S	NM_001013732	NP_001013754	WXS	Illumina HiSeq	Unspecified	Q6ZW05	CF138_HUMAN			3	1868	-			612					B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.1783G>T	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855786	0.71834	.	.	ENSG00000244694	ENST00000339488	D	0.87029	-2.2	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.90393	0.6993	M	0.66939	2.045	0.80722	D	1	P	0.52463	0.953	P	0.61940	0.896	D	0.86123	0.1570	10	0.20046	T	0.44	.	20.3052	0.98627	0.0:1.0:0.0:0.0	.	612	Q6ZW05	CF138_HUMAN	S	612	ENSP00000341914:A612S	ENSP00000341914:A612S	A	-	1	0	C6orf138	47954705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.814000	0.96858	0.650000	0.86243	GCC		0.438	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		17	37	1	0	1.15088e-07	0.004007	1.25717e-07	17	37				
TFAP2D	83741	broad.mit.edu	37	6	50683113	50683113	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:50683113G>T	ENST00000008391.3	+	2	552	c.324G>T	c.(322-324)ggG>ggT	p.G108G		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					TCCACCACGGGGAGCCCACCG	0.622																																							uc003paf.2		NA																	0				ovary(6)|breast(1)	7						c.(322-324)GGG>GGT		transcription factor AP-2 beta-like 1							109.0	100.0	103.0					6																	50683113		2203	4300	6503	SO:0001819	synonymous_variant	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50683113G>T	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.324G>T	6.37:g.50683113G>T			Somatic				TFAP2D_uc011dwt.1_RNA	p.G108G	NM_172238	NP_758438	WXS	Illumina HiSeq	Unspecified	Q7Z6R9	AP2D_HUMAN			2	836	+	Lung NSC(77;0.0334)		108						Silent	SNP	ENST00000008391.3	37	c.324G>T	CCDS4933.1																																																																																				0.622	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		26	59	1	0	1.50538e-07	0.00632	1.63919e-07	26	59				
PHIP	55023	broad.mit.edu	37	6	79655973	79655973	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:79655973C>T	ENST00000275034.4	-	38	4542	c.4375G>A	c.(4375-4377)Gaa>Aaa	p.E1459K	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1459					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TTTTTCCTTTCAGGGCTGTAA	0.343																																							uc003pir.2		NA																	0				large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(4375-4377)GAA>AAA		pleckstrin homology domain interacting protein							134.0	139.0	137.0					6																	79655973		2203	4300	6503	SO:0001583	missense	55023				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding	g.chr6:79655973C>T	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4375G>A	6.37:g.79655973C>T	ENSP00000275034:p.Glu1459Lys		Somatic				PHIP_uc003piq.2_Missense_Mutation_p.E483K|PHIP_uc011dyp.1_Missense_Mutation_p.E1458K|IRAK1BP1_uc010kbg.1_RNA|PHIP_uc003pio.3_Missense_Mutation_p.E345K	p.E1459K	NM_017934	NP_060404	WXS	Illumina HiSeq	Unspecified	Q8WWQ0	PHIP_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.231)	38	4601	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)	1459					A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	c.4375G>A	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166797	0.57476	.	.	ENSG00000146247	ENST00000275034;ENST00000355098	T	0.39787	1.06	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	L	0.32530	0.975	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.73380	0.98;0.98	T	0.14172	-1.0482	9	.	.	.	-26.2421	19.8676	0.96824	0.0:1.0:0.0:0.0	.	1459;1459	A7J992;Q8WWQ0	.;PHIP_HUMAN	K	1459;185	ENSP00000275034:E1459K	.	E	-	1	0	PHIP	79712692	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.343000	0.65976	2.941000	0.99782	0.655000	0.94253	GAA		0.343	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2			31	67	0	0	0	0.002445	0	31	67				
SYNCRIP	10492	broad.mit.edu	37	6	86346828	86346828	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:86346828C>T	ENST00000369622.3	-	6	1023	c.523G>A	c.(523-525)Gag>Aag	p.E175K	SYNCRIP_ENST00000355238.6_Missense_Mutation_p.E175K	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	175	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		AGTTCATCCTCAAATAGATCT	0.363																																							uc003pla.2		NA																	0				ovary(2)	2						c.(523-525)GAG>AAG		synaptotagmin binding, cytoplasmic RNA							50.0	48.0	49.0					6																	86346828		2203	4300	6503	SO:0001583	missense	10492				CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding	g.chr6:86346828C>T	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.523G>A	6.37:g.86346828C>T	ENSP00000358635:p.Glu175Lys		Somatic				SYNCRIP_uc003pku.2_Missense_Mutation_p.E175K|SYNCRIP_uc003pkw.2_Missense_Mutation_p.E175K|SYNCRIP_uc003pky.2_Missense_Mutation_p.E77K|SYNCRIP_uc003pkv.2_Missense_Mutation_p.E175K|SYNCRIP_uc003pkx.2_Missense_Mutation_p.E23K|SYNCRIP_uc003pkz.2_Missense_Mutation_p.E175K	p.E175K	NM_006372	NP_006363	WXS	Illumina HiSeq	Unspecified	O60506	HNRPQ_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0389)	6	1064	-		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)	175			RRM 1.		E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	c.523G>A	CCDS5005.1	.	.	.	.	.	.	.	.	.	.	C	36	5.634287	0.96682	.	.	ENSG00000135316	ENST00000355238;ENST00000369622;ENST00000444272	T;T;T	0.53206	2.03;2.03;0.63	5.77	5.77	0.91146	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	M	0.76433	2.335	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.997;1.0;0.999;0.992;0.999;0.992;0.997	T	0.68622	-0.5360	10	0.87932	D	0	.	19.5889	0.95499	0.0:1.0:0.0:0.0	.	175;175;77;23;175;175;175	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	K	175	ENSP00000347380:E175K;ENSP00000358635:E175K;ENSP00000397782:E175K	ENSP00000347380:E175K	E	-	1	0	SYNCRIP	86403547	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.729000	0.93468	0.655000	0.94253	GAG		0.363	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372		9	29	0	0	0	0.006214	0	9	29				
RNGTT	8732	broad.mit.edu	37	6	89388103	89388103	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:89388103C>T	ENST00000369485.4	-	14	1661	c.1475G>A	c.(1474-1476)gGa>gAa	p.G492E	RNGTT_ENST00000369475.3_Missense_Mutation_p.G492E|RNGTT_ENST00000265607.6_Missense_Mutation_p.G469E|RNGTT_ENST00000538899.1_Missense_Mutation_p.G409E	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	492	GTase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		TTCATAACCTCCAACATACAG	0.328																																							uc003pmr.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1474-1476)GGA>GAA		RNA guanylyltransferase and 5'-phosphatase							80.0	75.0	77.0					6																	89388103		2203	4300	6503	SO:0001583	missense	8732				interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:89388103C>T	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.1475G>A	6.37:g.89388103C>T	ENSP00000358497:p.Gly492Glu		Somatic				RNGTT_uc003pms.2_Missense_Mutation_p.G469E|RNGTT_uc011dzu.1_Missense_Mutation_p.G409E|RNGTT_uc003pmt.2_Missense_Mutation_p.G492E	p.G492E	NM_003800	NP_003791	WXS	Illumina HiSeq	Unspecified	O60942	MCE1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.151)	14	1695	-		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)	492			GTase.		E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Missense_Mutation	SNP	ENST00000369485.4	37	c.1475G>A	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015843	0.75161	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	T;T;T;T	0.38401	1.88;1.82;1.84;1.14	5.42	5.42	0.78866	Nucleic acid-binding, OB-fold-like (1);mRNA capping enzyme, C-terminal (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.63838	0.2545	M	0.93197	3.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.993;0.996;0.998	T	0.70769	-0.4782	10	0.49607	T	0.09	.	15.0634	0.71973	0.0:1.0:0.0:0.0	.	409;492;469;492	B4DSJ8;Q5TCW7;O60942-2;O60942	.;.;.;MCE1_HUMAN	E	492;469;409;463;492	ENSP00000358497:G492E;ENSP00000265607:G469E;ENSP00000442609:G409E;ENSP00000358487:G492E	ENSP00000265607:G469E	G	-	2	0	RNGTT	89444822	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	4.680000	0.61656	2.687000	0.91594	0.655000	0.94253	GGA		0.328	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1			20	41	0	0	0	0.004656	0	20	41				
MDN1	23195	broad.mit.edu	37	6	90455280	90455280	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:90455280C>G	ENST00000369393.3	-	28	4085	c.3970G>C	c.(3970-3972)Gag>Cag	p.E1324Q	MDN1_ENST00000428876.1_Missense_Mutation_p.E1324Q			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1324					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAATGTTTCTCAAGGACTTCT	0.423																																							uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(3970-3972)GAG>CAG		MDN1, midasin homolog							88.0	85.0	86.0					6																	90455280		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90455280C>G	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.3970G>C	6.37:g.90455280C>G	ENSP00000358400:p.Glu1324Gln		Somatic					p.E1324Q	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	28	4086	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	1324					O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.3970G>C	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120024	0.37436	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.04809	3.55;3.55	5.95	4.15	0.48705	.	0.110717	0.64402	N	0.000011	T	0.02494	0.0076	L	0.60067	1.865	0.44611	D	0.997584	B	0.09022	0.002	B	0.06405	0.002	T	0.20706	-1.0267	10	0.48119	T	0.1	.	8.5889	0.33674	0.0:0.7428:0.1258:0.1314	.	1324	Q9NU22	MDN1_HUMAN	Q	1324	ENSP00000358400:E1324Q;ENSP00000413970:E1324Q	ENSP00000358400:E1324Q	E	-	1	0	MDN1	90512001	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.021000	0.49651	1.510000	0.48803	0.650000	0.86243	GAG		0.423	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			19	71	0	0	0	0.010504	0	19	71				
FIG4	9896	broad.mit.edu	37	6	110056358	110056358	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:110056358G>T	ENST00000230124.3	+	6	627	c.503G>T	c.(502-504)aGc>aTc	p.S168I	FIG4_ENST00000368941.1_Missense_Mutation_p.S91I|FIG4_ENST00000441478.2_Missense_Mutation_p.S22I	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	168	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		CTCAGTTACAGCTATGATTTG	0.368																																							uc003ptt.2		NA																	0				ovary(1)	1						c.(502-504)AGC>ATC		Sac domain-containing inositol phosphatase 3							110.0	110.0	110.0					6																	110056358		2203	4300	6503	SO:0001583	missense	9896				cell death	endosome membrane	protein binding	g.chr6:110056358G>T	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.503G>T	6.37:g.110056358G>T	ENSP00000230124:p.Ser168Ile		Somatic				FIG4_uc011eau.1_Missense_Mutation_p.S22I	p.S168I	NM_014845	NP_055660	WXS	Illumina HiSeq	Unspecified	Q92562	FIG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)	6	718	+		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)	168			SAC.		Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	c.503G>T	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.837623	0.71373	.	.	ENSG00000112367	ENST00000441478;ENST00000230124;ENST00000454215;ENST00000368941	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.4	5.4	0.78164	Synaptojanin, N-terminal (2);	0.230843	0.51477	D	0.000085	T	0.79753	0.4500	M	0.91972	3.26	0.40778	D	0.983147	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.83308	-0.0024	10	0.62326	D	0.03	-10.4482	19.5283	0.95215	0.0:0.0:1.0:0.0	.	22;168	F5H8L9;Q92562	.;FIG4_HUMAN	I	22;168;147;91	ENSP00000399443:S22I;ENSP00000230124:S168I;ENSP00000412156:S147I;ENSP00000357937:S91I	ENSP00000230124:S168I	S	+	2	0	FIG4	110163051	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.655000	0.98512	2.689000	0.91719	0.491000	0.48974	AGC		0.368	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845		24	72	1	0	3.08376e-08	0.00333	3.40654e-08	24	72				
LAMA4	3910	broad.mit.edu	37	6	112476083	112476083	+	Missense_Mutation	SNP	C	C	T	rs397516721		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:112476083C>T	ENST00000230538.7	-	16	2423	c.2026G>A	c.(2026-2028)Gcc>Acc	p.A676T	RP1-142L7.5_ENST00000425503.1_RNA|RP1-142L7.5_ENST00000588689.1_RNA|RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000522006.1_Missense_Mutation_p.A669T|LAMA4_ENST00000389463.4_Missense_Mutation_p.A669T|LAMA4_ENST00000424408.2_Missense_Mutation_p.A669T	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	676	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGTTCTCTGGCTTGATTGAGG	0.398																																							uc003pvu.2		NA																	0				ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(2026-2028)GCC>ACC		laminin, alpha 4 isoform 1 precursor							196.0	191.0	192.0					6																	112476083		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112476083C>T		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2026G>A	6.37:g.112476083C>T	ENSP00000230538:p.Ala676Thr		Somatic				LAMA4_uc003pvv.2_Missense_Mutation_p.A669T|LAMA4_uc003pvt.2_Missense_Mutation_p.A669T	p.A676T	NM_001105206	NP_001098676	WXS	Illumina HiSeq	Unspecified	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	16	2335	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	676			Domain II and I.|Potential.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.2026G>A	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046478	0.75846	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.21932	2.05;1.98;1.98;1.98	5.17	5.17	0.71159	.	0.164094	0.53938	D	0.000054	T	0.24275	0.0588	L	0.55481	1.735	0.80722	D	1	P;D	0.55385	0.877;0.971	B;P	0.50825	0.265;0.651	T	0.01007	-1.1483	10	0.59425	D	0.04	.	18.4753	0.90790	0.0:1.0:0.0:0.0	.	676;669	Q16363;Q16363-2	LAMA4_HUMAN;.	T	676;669;669;669	ENSP00000230538:A676T;ENSP00000429488:A669T;ENSP00000374114:A669T;ENSP00000416470:A669T	ENSP00000230538:A676T	A	-	1	0	LAMA4	112582776	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.487000	0.53222	2.686000	0.91538	0.591000	0.81541	GCC		0.398	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		22	78	0	0	0	0.004656	0	22	78				
LAMA4	3910	broad.mit.edu	37	6	112476086	112476086	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:112476086G>A	ENST00000230538.7	-	16	2420	c.2023C>T	c.(2023-2025)Caa>Taa	p.Q675*	RP1-142L7.5_ENST00000425503.1_RNA|RP1-142L7.5_ENST00000588689.1_RNA|RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000522006.1_Nonsense_Mutation_p.Q668*|LAMA4_ENST00000389463.4_Nonsense_Mutation_p.Q668*|LAMA4_ENST00000424408.2_Nonsense_Mutation_p.Q668*	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	675	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.Q668E(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TCTCTGGCTTGATTGAGGAGG	0.398																																							uc003pvu.2		NA																	1	Substitution - Missense(1)		breast(1)	ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(2023-2025)CAA>TAA		laminin, alpha 4 isoform 1 precursor							196.0	191.0	193.0					6																	112476086		2203	4300	6503	SO:0001587	stop_gained	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112476086G>A		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2023C>T	6.37:g.112476086G>A	ENSP00000230538:p.Gln675*		Somatic				LAMA4_uc003pvv.2_Nonsense_Mutation_p.Q668*|LAMA4_uc003pvt.2_Nonsense_Mutation_p.Q668*	p.Q675*	NM_001105206	NP_001098676	WXS	Illumina HiSeq	Unspecified	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	16	2332	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	675			Domain II and I.|Potential.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Nonsense_Mutation	SNP	ENST00000230538.7	37	c.2023C>T	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	44	10.644433	0.99443	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	.	.	.	5.17	4.29	0.51040	.	0.348517	0.32952	N	0.005451	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	15.4473	0.75240	0.0:0.1395:0.8605:0.0	.	.	.	.	X	675;668;668;668	.	ENSP00000230538:Q675X	Q	-	1	0	LAMA4	112582779	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.705000	0.54823	1.390000	0.46547	0.591000	0.81541	CAA		0.398	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		22	77	0	0	0	0.004656	0	22	77				
THEMIS	387357	broad.mit.edu	37	6	128134640	128134640	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:128134640G>T	ENST00000368248.2	-	4	1294	c.1146C>A	c.(1144-1146)tcC>tcA	p.S382S	THEMIS_ENST00000543064.1_Silent_p.S382S|THEMIS_ENST00000537166.1_Silent_p.S347S|THEMIS_ENST00000368250.1_Silent_p.S303S	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	382	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						CAACAGATACGGATGACAGCT	0.488																																							uc003qbi.2		NA																	0				ovary(2)|skin(2)	4						c.(1144-1146)TCC>TCA		thymocyte selection pathway associated isoform							94.0	96.0	95.0					6																	128134640		2203	4300	6503	SO:0001819	synonymous_variant	387357				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus		g.chr6:128134640G>T	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1146C>A	6.37:g.128134640G>T			Somatic				THEMIS_uc010kfa.2_Silent_p.S285S|THEMIS_uc011ebt.1_Silent_p.S382S|THEMIS_uc010kfb.2_Silent_p.S347S	p.S382S	NM_001010923	NP_001010923	WXS	Illumina HiSeq	Unspecified	Q8N1K5	THMS1_HUMAN			5	1465	-			382			CABIT 2.		A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Silent	SNP	ENST00000368248.2	37	c.1146C>A	CCDS34534.1																																																																																				0.488	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923		22	45	1	0	2.79863e-10	0.004656	3.16809e-10	22	45				
ALDH8A1	64577	broad.mit.edu	37	6	135263570	135263570	+	Missense_Mutation	SNP	G	G	A	rs533886052		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:135263570G>A	ENST00000265605.2	-	3	487	c.419C>T	c.(418-420)aCg>aTg	p.T140M	ALDH8A1_ENST00000367845.2_Missense_Mutation_p.T140M|RP11-349J5.2_ENST00000416448.2_RNA|ALDH8A1_ENST00000367847.2_Missense_Mutation_p.T140M	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	140					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.T140M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		GGCCCGCACCGTGTAGTGCAT	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		17593	0.0		0.0	False		,,,				2504	0.001						uc003qew.2		NA																	1	Substitution - Missense(1)		NS(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(418-420)ACG>ATG		aldehyde dehydrogenase 8A1 isoform 1							86.0	80.0	82.0					6																	135263570		2203	4300	6503	SO:0001583	missense	64577				retinal metabolic process	cytoplasm	retinal dehydrogenase activity	g.chr6:135263570G>A	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.419C>T	6.37:g.135263570G>A	ENSP00000265605:p.Thr140Met		Somatic				ALDH8A1_uc003qex.2_Missense_Mutation_p.T140M|ALDH8A1_uc010kgh.2_Translation_Start_Site|ALDH8A1_uc011ecx.1_Missense_Mutation_p.T140M	p.T140M	NM_022568	NP_072090	WXS	Illumina HiSeq	Unspecified	Q9H2A2	AL8A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)	3	472	-	Colorectal(23;0.221)		140					B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	c.419C>T	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506159	0.85282	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.78126	-1.15;-1.15;1.48	5.32	5.32	0.75619	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.85026	0.5603	M	0.62154	1.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.982;0.99	D	0.86419	0.1753	10	0.87932	D	0	.	19.0055	0.92849	0.0:0.0:1.0:0.0	.	140;140;140	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	M	140	ENSP00000265605:T140M;ENSP00000356819:T140M;ENSP00000356821:T140M	ENSP00000265605:T140M	T	-	2	0	ALDH8A1	135305263	1.000000	0.71417	0.939000	0.37840	0.459000	0.32528	9.807000	0.99171	2.472000	0.83506	0.655000	0.94253	ACG		0.582	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			30	68	0	0	0	0.002836	0	30	68				
BCLAF1	9774	broad.mit.edu	37	6	136597195	136597195	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:136597195C>A	ENST00000531224.1	-	5	1720	c.1468G>T	c.(1468-1470)Gta>Tta	p.V490L	BCLAF1_ENST00000353331.4_Missense_Mutation_p.V488L|BCLAF1_ENST00000527536.1_Missense_Mutation_p.V490L|BCLAF1_ENST00000392348.2_Missense_Mutation_p.V488L|BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000527759.1_Missense_Mutation_p.V488L	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	490					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCTTTCTTTACTGTTATTCTT	0.368																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	0				ovary(1)	1						c.(1468-1470)GTA>TTA		BCL2-associated transcription factor 1 isoform							173.0	180.0	178.0					6																	136597195		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136597195C>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1468G>T	6.37:g.136597195C>A	ENSP00000435210:p.Val490Leu		Somatic				BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Missense_Mutation_p.V488L|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.V488L	p.V490L	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	5	1721	-	Colorectal(23;0.24)		490					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.1468G>T	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604073	0.28534	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T	0.15718	2.4;2.4;2.4;2.4;2.4;2.4	5.22	5.22	0.72569	.	0.110429	0.40144	N	0.001178	T	0.04861	0.0131	L	0.36672	1.1	0.36797	D	0.885158	B;B;B	0.13145	0.007;0.005;0.007	B;B;B	0.14023	0.01;0.005;0.01	T	0.17107	-1.0380	10	0.08837	T	0.75	-5.9881	10.4589	0.44567	0.0:0.8798:0.0:0.1202	.	488;488;490	Q9NYF8-2;Q9NYF8-3;Q9NYF8	.;.;BCLF1_HUMAN	L	490;488;490;488;488;490	ENSP00000435210:V490L;ENSP00000229446:V488L;ENSP00000435441:V490L;ENSP00000434826:V488L;ENSP00000376159:V488L;ENSP00000431734:V490L	ENSP00000229446:V488L	V	-	1	0	BCLAF1	136638888	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.708000	0.37899	2.628000	0.89032	0.454000	0.30748	GTA		0.368	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		22	130	1	0	7.41877e-09	0.001882	8.24843e-09	22	130				
TXLNB	167838	broad.mit.edu	37	6	139609632	139609632	+	Missense_Mutation	SNP	C	C	A	rs532444744		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:139609632C>A	ENST00000358430.3	-	2	637	c.405G>T	c.(403-405)aaG>aaT	p.K135N	RP11-445F6.2_ENST00000441249.1_RNA|RP11-445F6.2_ENST00000440518.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	135						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TTAGGATTTTCTTTTCCAATT	0.413													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21230	0.0		0.0	False		,,,				2504	0.0						uc011eds.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(403-405)AAG>AAT		taxilin beta							139.0	136.0	137.0					6																	139609632		2203	4300	6503	SO:0001583	missense	167838					cytoplasm		g.chr6:139609632C>A		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.405G>T	6.37:g.139609632C>A	ENSP00000351206:p.Lys135Asn		Somatic					p.K135N	NM_153235	NP_694967	WXS	Illumina HiSeq	Unspecified	Q8N3L3	TXLNB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)	2	570	-			135			Potential.		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	ENST00000358430.3	37	c.405G>T	CCDS34545.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.920802	0.73213	.	.	ENSG00000164440	ENST00000358430	T	0.19250	2.16	6.07	6.07	0.98685	.	0.127109	0.64402	D	0.000001	T	0.37758	0.1015	M	0.66939	2.045	0.53688	D	0.99997	D	0.71674	0.998	D	0.63597	0.916	T	0.01345	-1.1379	9	.	.	.	-31.1759	20.6452	0.99591	0.0:1.0:0.0:0.0	.	135	Q8N3L3	TXLNB_HUMAN	N	135	ENSP00000351206:K135N	.	K	-	3	2	TXLNB	139651325	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	4.083000	0.57643	2.885000	0.99019	0.650000	0.86243	AAG		0.413	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235		28	77	1	0	4.74835e-14	0.002096	5.54918e-14	28	77				
FBXO5	26271	broad.mit.edu	37	6	153296105	153296105	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:153296105C>T	ENST00000229758.3	-	2	813	c.755G>A	c.(754-756)cGa>cAa	p.R252Q	FBXO5_ENST00000367241.3_Missense_Mutation_p.R206Q|FBXO5_ENST00000477822.1_5'Flank	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	252	F-box.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		GAGTCCCCTTCGAAAGAGTTC	0.358																																					NSCLC(121;372 1757 17721 17977 29669)	NSCLC(121;372 1757 17721 17977 29669)	uc003qpg.2		NA																	0					0						c.(754-756)CGA>CAA		F-box only protein 5 isoform a							121.0	123.0	122.0					6																	153296105		2203	4300	6503	SO:0001583	missense	26271				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding	g.chr6:153296105C>T	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.755G>A	6.37:g.153296105C>T	ENSP00000229758:p.Arg252Gln		Somatic				FBXO5_uc003qph.2_Missense_Mutation_p.R206Q	p.R252Q	NM_012177	NP_036309	WXS	Illumina HiSeq	Unspecified	Q9UKT4	FBX5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)	2	864	-		Ovarian(120;0.125)	252			F-box.		B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	ENST00000229758.3	37	c.755G>A	CCDS5242.1	.	.	.	.	.	.	.	.	.	.	C	8.311	0.822087	0.16678	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.40756	1.02;1.02	6.07	-0.725	0.11174	.	0.667620	0.16246	N	0.222939	T	0.08714	0.0216	N	0.25890	0.77	0.30798	N	0.740212	B	0.30104	0.268	B	0.25405	0.06	T	0.16778	-1.0391	10	0.31617	T	0.26	0.0089	4.1723	0.10336	0.2474:0.3257:0.0:0.4269	.	252	Q9UKT4	FBX5_HUMAN	Q	252;206	ENSP00000229758:R252Q;ENSP00000356210:R206Q	ENSP00000229758:R252Q	R	-	2	0	FBXO5	153337798	0.776000	0.28616	0.701000	0.30321	0.427000	0.31564	0.141000	0.16076	-0.052000	0.13311	-1.740000	0.00687	CGA		0.358	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1			35	72	0	0	0	0.00874	0	35	72				
TFB1M	51106	broad.mit.edu	37	6	155606413	155606413	+	Splice_Site	SNP	T	T	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:155606413T>C	ENST00000367166.4	-	5	602		c.e5-2			NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		TGCAAGTCTCTAGAGAGAGAC	0.398																																							uc003qqj.3		NA																	0				skin(1)	1						c.e5-1		transcription factor B1, mitochondrial							94.0	82.0	86.0					6																	155606413		2203	4300	6503	SO:0001630	splice_region_variant	51106				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity	g.chr6:155606413T>C	AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.547-2A>G	6.37:g.155606413T>C			Somatic				TFB1M_uc003qqk.2_Intron	p.R183_splice	NM_016020	NP_057104	WXS	Illumina HiSeq	Unspecified	Q8WVM0	TFB1M_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)	5	611	-		Ovarian(120;0.196)						Q05DR0|Q9Y384	Splice_Site	SNP	ENST00000367166.4	37	c.547_splice	CCDS5248.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818770	0.32145	.	.	ENSG00000029639	ENST00000367166	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3245	0.82970	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TFB1M	155648105	1.000000	0.71417	0.993000	0.49108	0.129000	0.20672	7.265000	0.78442	2.254000	0.74563	0.460000	0.39030	.		0.398	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042809.1		Intron	11	21	0	0	0	0.008291	0	11	21				
PSMB1	5689	broad.mit.edu	37	6	170846376	170846376	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:170846376G>A	ENST00000262193.6	-	5	584	c.486C>T	c.(484-486)tcC>tcT	p.S162S	PSMB1_ENST00000462957.1_5'UTR	NM_002793.3	NP_002784.1	P20618	PSB1_HUMAN	proteasome (prosome, macropain) subunit, beta type, 1	162					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)|Carfilzomib(DB08889)	CAGCCTTGAAGGAGTCTCTCT	0.453																																							uc011ehe.1		NA																	0				ovary(1)	1						c.(484-486)TCC>TCT		proteasome beta 1 subunit precursor	Bortezomib(DB00188)						101.0	82.0	88.0					6																	170846376		2203	4300	6503	SO:0001819	synonymous_variant	5689				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cell junction|cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity	g.chr6:170846376G>A	D00761	CCDS34577.1	6q27	2008-02-05			ENSG00000008018	ENSG00000008018		"""Proteasome (prosome, macropain) subunits"""	9537	protein-coding gene	gene with protein product		602017				2025653	Standard	NM_002793		Approved	PMSB1, HC5	uc011ehe.2	P20618	OTTHUMG00000016087	ENST00000262193.6:c.486C>T	6.37:g.170846376G>A			Somatic				PSMB1_uc003qxq.2_RNA|PSMB1_uc003qxr.2_Silent_p.S61S	p.S162S	NM_002793	NP_002784	WXS	Illumina HiSeq	Unspecified	P20618	PSB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	5	573	-		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)	162					B5BU76|Q9BWA8	Silent	SNP	ENST00000262193.6	37	c.486C>T	CCDS34577.1																																																																																				0.453	PSMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043278.2	NM_002793		22	39	0	0	0	0.004656	0	22	39				
CARD11	84433	broad.mit.edu	37	7	2954905	2954905	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:2954905C>G	ENST00000396946.4	-	21	3208	c.2805G>C	c.(2803-2805)ctG>ctC	p.L935L		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	935					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGGTGGCGTCCAGCGAGGACC	0.627			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(2803-2805)CTG>CTC		caspase recruitment domain family, member 11							102.0	94.0	97.0					7																	2954905		2203	4300	6503	SO:0001819	synonymous_variant	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2954905C>G	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2805G>C	7.37:g.2954905C>G			Somatic					p.L935L	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	21	3209	-		Ovarian(82;0.0115)	935					A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	ENST00000396946.4	37	c.2805G>C	CCDS5336.2																																																																																				0.627	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		72	43	0	0	0	0.00361	0	72	43				
GLCCI1	113263	broad.mit.edu	37	7	8095167	8095167	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:8095167C>G	ENST00000223145.5	+	4	1358	c.801C>G	c.(799-801)atC>atG	p.I267M	GLCCI1_ENST00000474269.1_3'UTR	NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	267						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		ATATAACAATCAGTCACACTC	0.398																																							uc003srk.2		NA																	0					0						c.(799-801)ATC>ATG		glucocorticoid induced transcript 1							208.0	174.0	186.0					7																	8095167		2203	4300	6503	SO:0001583	missense	113263							g.chr7:8095167C>G	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.801C>G	7.37:g.8095167C>G	ENSP00000223145:p.Ile267Met		Somatic					p.I267M	NM_138426	NP_612435	WXS	Illumina HiSeq	Unspecified	Q86VQ1	GLCI1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)	4	1360	+		Ovarian(82;0.0608)	267					A4D103|Q96FD0	Missense_Mutation	SNP	ENST00000223145.5	37	c.801C>G	CCDS34601.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549352	0.45383	.	.	ENSG00000106415	ENST00000223145;ENST00000414914;ENST00000430798	.	.	.	5.71	4.82	0.62117	.	0.351137	0.32533	N	0.005973	T	0.31136	0.0787	L	0.27053	0.805	0.29348	N	0.865529	P	0.44946	0.846	B	0.39258	0.295	T	0.16808	-1.0390	9	0.41790	T	0.15	-37.4037	14.7692	0.69662	0.0:0.9308:0.0:0.0692	.	267	Q86VQ1	GLCI1_HUMAN	M	267;125;155	.	ENSP00000223145:I267M	I	+	3	3	GLCCI1	8061692	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	3.837000	0.55820	1.545000	0.49373	0.655000	0.94253	ATC		0.398	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426		76	43	0	0	0	0.00361	0	76	43				
PHF14	9678	broad.mit.edu	37	7	11068308	11068308	+	Splice_Site	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:11068308G>C	ENST00000403050.3	+	7	1770	c.1318G>C	c.(1318-1320)Gag>Cag	p.E440Q	PHF14_ENST00000445996.2_Splice_Site_p.E155Q	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	440					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.E440*(1)		NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		TTTGTTGTAGGAGTGTAGCTT	0.393																																							uc003sry.1		NA																	1	Substitution - Nonsense(1)		lung(1)	kidney(2)|skin(1)	3						c.(1318-1320)GAG>CAG		PHD finger protein 14 isoform 2							106.0	96.0	99.0					7																	11068308		1876	4126	6002	SO:0001630	splice_region_variant	9678						zinc ion binding	g.chr7:11068308G>C	AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.1318-1G>C	7.37:g.11068308G>C			Somatic				PHF14_uc011jxi.1_Missense_Mutation_p.E155Q|PHF14_uc003srz.2_Missense_Mutation_p.E440Q|PHF14_uc011jxj.1_Missense_Mutation_p.E155Q	p.E440Q	NM_014660	NP_055475	WXS	Illumina HiSeq	Unspecified	O94880	PHF14_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.205)	7	1753	+			440					A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	37	c.1318G>C	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738464	0.69304	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	T;T	0.13901	2.55;2.55	5.19	5.19	0.71726	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.25269	0.0614	N	0.21282	0.65	0.80722	D	1	D;D;D;D	0.69078	0.989;0.991;0.997;0.99	D;D;D;D	0.81914	0.979;0.982;0.995;0.933	T	0.03315	-1.1049	9	.	.	.	.	19.0759	0.93161	0.0:0.0:1.0:0.0	.	155;155;440;440	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	Q	440;155	ENSP00000385795:E440Q;ENSP00000403907:E155Q	.	E	+	1	0	PHF14	11034833	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	9.752000	0.98900	2.561000	0.86390	0.557000	0.71058	GAG		0.393	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660	Missense_Mutation	15	8	0	0	0	0.006122	0	15	8				
SP4	6671	broad.mit.edu	37	7	21469387	21469387	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:21469387G>A	ENST00000222584.3	+	3	822	c.604G>A	c.(604-606)Ggt>Agt	p.G202S		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	202					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						CATTTCTGCAGGTAATAATCA	0.418																																							uc003sva.2		NA																	0				ovary(3)|skin(2)	5						c.(604-606)GGT>AGT		Sp4 transcription factor							78.0	76.0	77.0					7																	21469387		2203	4300	6503	SO:0001583	missense	6671				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr7:21469387G>A		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.604G>A	7.37:g.21469387G>A	ENSP00000222584:p.Gly202Ser		Somatic				SP4_uc003svb.2_5'UTR	p.G202S	NM_003112	NP_003103	WXS	Illumina HiSeq	Unspecified	Q02446	SP4_HUMAN			3	785	+			202					O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	c.604G>A	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060855	0.55432	.	.	ENSG00000105866	ENST00000222584	T	0.15256	2.44	4.58	4.58	0.56647	.	0.048603	0.85682	D	0.000000	T	0.22513	0.0543	M	0.69358	2.11	0.54753	D	0.999986	P	0.47762	0.9	B	0.41332	0.354	T	0.06516	-1.0822	10	0.31617	T	0.26	.	17.554	0.87885	0.0:0.0:1.0:0.0	.	202	Q02446	SP4_HUMAN	S	202	ENSP00000222584:G202S	ENSP00000222584:G202S	G	+	1	0	SP4	21435912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.670000	0.74467	2.372000	0.80975	0.655000	0.94253	GGT		0.418	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112		54	281	0	0	0	0.00361	0	54	281				
MPP6	51678	broad.mit.edu	37	7	24690293	24690293	+	Missense_Mutation	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:24690293A>T	ENST00000222644.5	+	5	863	c.613A>T	c.(613-615)Atc>Ttc	p.I205F	MPP6_ENST00000409761.1_Missense_Mutation_p.I93F|MPP6_ENST00000396475.2_Missense_Mutation_p.I205F			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						CACCCTAAAAATCTTACCAAG	0.303																																							uc003swx.2		NA																	0					0						c.(613-615)ATC>TTC		membrane protein, palmitoylated 6							59.0	62.0	61.0					7																	24690293		2203	4300	6503	SO:0001583	missense	51678				protein complex assembly		protein binding	g.chr7:24690293A>T	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.613A>T	7.37:g.24690293A>T	ENSP00000222644:p.Ile205Phe		Somatic				MPP6_uc003swy.2_Missense_Mutation_p.I205F	p.I205F	NM_016447	NP_057531	WXS	Illumina HiSeq	Unspecified	Q9NZW5	MPP6_HUMAN			6	912	+			205			PDZ.		B2RAF0	Missense_Mutation	SNP	ENST00000222644.5	37	c.613A>T	CCDS5388.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056724	0.76074	.	.	ENSG00000105926	ENST00000432190;ENST00000222644;ENST00000409761;ENST00000396475;ENST00000430180	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	6.17	5.01	0.66863	Src homology-3 domain (1);PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000020	T	0.67268	0.2875	H	0.94964	3.605	0.80722	D	1	D	0.67145	0.996	D	0.68483	0.958	T	0.76000	-0.3119	10	0.87932	D	0	.	11.3772	0.49735	0.9307:0.0:0.0693:0.0	.	205	Q9NZW5	MPP6_HUMAN	F	205;205;93;205;205	ENSP00000395859:I205F;ENSP00000222644:I205F;ENSP00000386262:I93F;ENSP00000379737:I205F;ENSP00000391020:I205F	ENSP00000222644:I205F	I	+	1	0	MPP6	24656818	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.434000	0.59935	2.371000	0.80710	0.533000	0.62120	ATC		0.303	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4			58	70	0	0	0	0.00361	0	58	70				
NFE2L3	9603	broad.mit.edu	37	7	26224622	26224622	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:26224622C>G	ENST00000056233.3	+	4	1563	c.1304C>G	c.(1303-1305)tCt>tGt	p.S435C		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	435					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						GTCATCAAGTCTAATTCCTCT	0.403																																							uc003sxq.2		NA																	0				skin(3)|ovary(1)	4						c.(1303-1305)TCT>TGT		nuclear factor erythroid 2-like 3							126.0	134.0	131.0					7																	26224622		2203	4300	6503	SO:0001583	missense	9603				transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr7:26224622C>G	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1304C>G	7.37:g.26224622C>G	ENSP00000056233:p.Ser435Cys		Somatic					p.S435C	NM_004289	NP_004280	WXS	Illumina HiSeq	Unspecified	Q9Y4A8	NF2L3_HUMAN			4	1576	+			435					Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	ENST00000056233.3	37	c.1304C>G	CCDS5396.1	.	.	.	.	.	.	.	.	.	.	C	6.439	0.449123	0.12223	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.40756	1.02	5.23	2.33	0.28932	.	0.228514	0.46758	D	0.000274	T	0.42787	0.1218	M	0.85630	2.765	0.09310	N	1	B	0.17038	0.02	B	0.16722	0.016	T	0.48843	-0.8999	10	0.87932	D	0	-0.6589	4.5559	0.12136	0.1269:0.6134:0.1227:0.137	.	435	Q9Y4A8	NF2L3_HUMAN	C	435;141	ENSP00000056233:S435C	ENSP00000056233:S435C	S	+	2	0	NFE2L3	26191147	0.000000	0.05858	0.003000	0.11579	0.058000	0.15608	0.488000	0.22371	0.262000	0.21774	-0.216000	0.12614	TCT		0.403	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1			36	222	0	0	0	0.004878	0	36	222				
HOXA3	3200	broad.mit.edu	37	7	27149900	27149900	+	Silent	SNP	C	C	A	rs369217098		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:27149900C>A	ENST00000396352.4	-	2	559	c.360G>T	c.(358-360)ccG>ccT	p.P120P	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Silent_p.P120P|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	120	Pro-rich.				angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						AAGAGggaggcgggggcgcgg	0.731																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	Esophageal Squamous(136;1368 1743 5685 7935 50360)	uc011jzl.1		NA																	0				breast(2)	2						c.(358-360)CCG>CCT		homeobox A3 isoform a		C	,	1,4397		0,1,2198	27.0	31.0	29.0		360,360	0.6	0.2	7		29	1,8595		0,1,4297	no	coding-synonymous,coding-synonymous	HOXA3	NM_030661.4,NM_153631.2	,	0,2,6495	AA,AC,CC		0.0116,0.0227,0.0154	,	120/444,120/444	27149900	2,12992	2199	4298	6497	SO:0001819	synonymous_variant	3200				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27149900C>A		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.360G>T	7.37:g.27149900C>A			Somatic				HOXA3_uc011jzk.1_Splice_Site|HOXA3_uc003syk.2_Silent_p.P120P	p.P120P	NM_030661	NP_109377	WXS	Illumina HiSeq	Unspecified	O43365	HXA3_HUMAN			2	560	-			120			Pro-rich.		A4D181	Silent	SNP	ENST00000396352.4	37	c.360G>T	CCDS5404.1																																																																																				0.731	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2			13	55	1	0	1.62849e-17	0.004007	1.97725e-17	13	55				
POU6F2	11281	broad.mit.edu	37	7	39125535	39125535	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:39125535G>A	ENST00000403058.1	+	3	248	c.94G>A	c.(94-96)Gag>Aag	p.E32K	POU6F2_ENST00000559001.1_Missense_Mutation_p.E24K|POU6F2_ENST00000518318.2_Missense_Mutation_p.E32K|POU6F2_ENST00000517348.1_3'UTR|POU6F2_ENST00000464276.2_Missense_Mutation_p.E24K	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	32					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						GTTGAGAGGTGAGGACAAGGC	0.527																																							uc003thb.1		NA																	0				central_nervous_system(1)	1						c.(94-96)GAG>AAG		POU class 6 homeobox 2 isoform 1							153.0	123.0	133.0					7																	39125535		2203	4300	6503	SO:0001583	missense	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39125535G>A	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.94G>A	7.37:g.39125535G>A	ENSP00000384004:p.Glu32Lys		Somatic				POU6F2_uc010kxo.2_Missense_Mutation_p.E24K	p.E32K	NM_007252	NP_009183	WXS	Illumina HiSeq	Unspecified	P78424	PO6F2_HUMAN			2	136	+			32					A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	c.94G>A	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873393	0.91664	.	.	ENSG00000106536	ENST00000403058;ENST00000518318;ENST00000451021	D;D	0.87103	-2.14;-2.21	5.43	5.43	0.79202	.	2.461510	0.01868	N	0.037005	D	0.91005	0.7171	N	0.22421	0.69	0.40701	D	0.98248	D;P	0.69078	0.997;0.799	P;B	0.61800	0.894;0.152	T	0.79773	-0.1662	10	0.72032	D	0.01	.	19.2398	0.93877	0.0:0.0:1.0:0.0	.	32;32	P78424-2;P78424	.;PO6F2_HUMAN	K	32;32;33	ENSP00000384004:E32K;ENSP00000430514:E32K	ENSP00000384004:E32K	E	+	1	0	POU6F2	39092060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.026000	0.93700	2.542000	0.85734	0.637000	0.83480	GAG		0.527	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		13	45	0	0	0	0.006122	0	13	45				
GRB10	2887	broad.mit.edu	37	7	50671734	50671735	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:50671734_50671735TC>AT	ENST00000401949.1	-	17	1973_1974	c.1504_1505GA>AT	c.(1504-1506)GAa>ATa	p.E502I	GRB10_ENST00000403097.1_Missense_Mutation_p.E496I|GRB10_ENST00000398812.2_Missense_Mutation_p.E502I|GRB10_ENST00000357271.5_Missense_Mutation_p.E456I|GRB10_ENST00000402497.1_Missense_Mutation_p.E444I|GRB10_ENST00000406641.1_Missense_Mutation_p.E444I|GRB10_ENST00000407526.1_Missense_Mutation_p.E444I|GRB10_ENST00000335866.3_Missense_Mutation_p.E444I|GRB10_ENST00000439599.1_Missense_Mutation_p.E496I|GRB10_ENST00000398810.2_Missense_Mutation_p.E444I|GRB10_ENST00000402578.1_Missense_Mutation_p.E444I			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	502	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					CCTGTGGGATTCCTCCCTGGAG	0.535									Russell-Silver syndrome																														uc003tpi.2		NA																	0				lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1504-1506)GAA>ATA		growth factor receptor-bound protein 10 isoform																																				SO:0001583	missense	2887	Russell-Silver_syndrome	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity	g.chr7:50671734_50671735TC>AT		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.1504_1505delinsAT	7.37:g.50671734_50671735delinsAT	ENSP00000385770:p.Glu502Ile		Somatic				GRB10_uc003tph.3_Missense_Mutation_p.E444I|GRB10_uc003tpj.2_Missense_Mutation_p.E456I|GRB10_uc003tpk.2_Missense_Mutation_p.E502I|GRB10_uc010kzb.2_Missense_Mutation_p.E444I|GRB10_uc003tpl.2_Missense_Mutation_p.E496I|GRB10_uc003tpm.2_Missense_Mutation_p.E444I|GRB10_uc003tpn.2_Missense_Mutation_p.E444I	p.E502I	NM_005311	NP_005302	WXS	Illumina HiSeq	Unspecified	Q13322	GRB10_HUMAN			14	1535_1536	-	Glioma(55;0.08)|all_neural(89;0.245)		502			SH2.		A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	DNP	ENST00000401949.1	37	c.1504_1505GA>AT	CCDS43582.1																																																																																				0.535	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1			70	223	0	0	0	0.004672	0	70	223				
EGFR	1956	broad.mit.edu	37	7	55211028	55211028	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:55211028A>G	ENST00000275493.2	+	3	448	c.271A>G	c.(271-273)Att>Gtt	p.I91V	EGFR_ENST00000455089.1_Missense_Mutation_p.I91V|EGFR_ENST00000442591.1_Missense_Mutation_p.I91V|EGFR_ENST00000454757.2_Missense_Mutation_p.I38V|EGFR_ENST00000344576.2_Missense_Mutation_p.I91V|EGFR_ENST00000420316.2_Missense_Mutation_p.I91V|EGFR_ENST00000342916.3_Missense_Mutation_p.I91V	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	91			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.I91L(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TTATGTCCTCATTGCCCTCAA	0.413		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1	Substitution - Missense(1)	p.V30_R297>G(5)|p.I91L(1)	central_nervous_system(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(271-273)ATT>GTT		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						109.0	108.0	108.0					7																	55211028		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55211028A>G		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.271A>G	7.37:g.55211028A>G	ENSP00000275493:p.Ile91Val	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc003tqh.2_Missense_Mutation_p.I91V|EGFR_uc003tqi.2_Missense_Mutation_p.I91V|EGFR_uc003tqj.2_Missense_Mutation_p.I91V|EGFR_uc010kzg.1_Missense_Mutation_p.I91V|EGFR_uc011kco.1_Missense_Mutation_p.I38V	p.I91V	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		3	517	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		91			Approximate.|Extracellular (Potential).		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.271A>G	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064500	0.36470	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000450046;ENST00000454757	D;D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.31	4.16	0.48862	EGF receptor, L domain (1);	0.045100	0.85682	N	0.000000	D	0.84515	0.5489	L	0.59436	1.845	0.51012	D	0.999903	B;B;B;B;P	0.48407	0.059;0.003;0.049;0.007;0.91	B;B;B;B;P	0.55615	0.116;0.019;0.09;0.038;0.78	T	0.80341	-0.1423	10	0.20519	T	0.43	.	10.103	0.42517	0.92:0.0:0.08:0.0	.	91;91;91;91;91	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	V	91;91;91;91;91;91;38;38	ENSP00000415559:I91V;ENSP00000342376:I91V;ENSP00000345973:I91V;ENSP00000413843:I91V;ENSP00000275493:I91V;ENSP00000410031:I91V;ENSP00000413354:I38V;ENSP00000395243:I38V	ENSP00000275493:I91V	I	+	1	0	EGFR	55178522	1.000000	0.71417	0.972000	0.41901	0.966000	0.64601	7.454000	0.80714	0.978000	0.38470	0.533000	0.62120	ATT		0.413	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		36	95	0	0	0	0.006999	0	36	95				
EGFR	1956	broad.mit.edu	37	7	55269468	55269468	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:55269468G>T	ENST00000275493.2	+	26	3332	c.3155G>T	c.(3154-3156)aGa>aTa	p.R1052I	EGFR_ENST00000455089.1_Missense_Mutation_p.R1007I|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Missense_Mutation_p.R999I	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	1052					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGCATTGATAGAAATGGGGTA	0.398		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		0				lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(3154-3156)AGA>ATA		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						150.0	141.0	144.0					7																	55269468		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55269468G>T		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.3155G>T	7.37:g.55269468G>T	ENSP00000275493:p.Arg1052Ile	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_Missense_Mutation_p.R1007I|EGFR_uc011kco.1_Missense_Mutation_p.R999I	p.R1052I	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		26	3401	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		1052			Cytoplasmic (Potential).|Ser-rich.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.3155G>T	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.796871	0.31777	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.74737	-0.84;-0.87;-0.87	6.06	6.06	0.98353	.	0.312430	0.38005	N	0.001847	T	0.77061	0.4075	M	0.77616	2.38	0.58432	D	0.999999	B;B	0.13145	0.007;0.007	B;B	0.12156	0.007;0.004	T	0.70912	-0.4743	10	0.37606	T	0.19	.	19.1882	0.93653	0.0:0.0:1.0:0.0	.	1007;1052	Q504U8;P00533	.;EGFR_HUMAN	I	1007;922;1052;999	ENSP00000415559:R1007I;ENSP00000275493:R1052I;ENSP00000395243:R999I	ENSP00000275493:R1052I	R	+	2	0	EGFR	55236962	1.000000	0.71417	0.792000	0.32020	0.181000	0.23173	4.617000	0.61204	2.879000	0.98667	0.650000	0.86243	AGA		0.398	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		48	156	1	0	1.13205e-32	0.00361	1.47921e-32	48	156				
ELN	2006	broad.mit.edu	37	7	73470702	73470702	+	Missense_Mutation	SNP	G	G	T	rs142438174		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:73470702G>T	ENST00000252034.7	+	20	1651	c.1252G>T	c.(1252-1254)Gca>Tca	p.A418S	ELN_ENST00000320492.7_Intron|ELN_ENST00000320399.6_Missense_Mutation_p.A418S|ELN_ENST00000380553.4_Missense_Mutation_p.A301S|ELN_ENST00000380562.4_Missense_Mutation_p.A418S|ELN_ENST00000458204.1_Missense_Mutation_p.A408S|ELN_ENST00000380576.5_Missense_Mutation_p.A418S|ELN_ENST00000380575.4_Missense_Mutation_p.A408S|ELN_ENST00000358929.4_Missense_Mutation_p.A418S|ELN_ENST00000357036.5_Missense_Mutation_p.A423S|ELN_ENST00000414324.1_Missense_Mutation_p.A413S|ELN_ENST00000380584.4_Missense_Mutation_p.A404S|ELN_ENST00000429192.1_Missense_Mutation_p.A423S|ELN_ENST00000445912.1_Missense_Mutation_p.A418S	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)	p.A418T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CCCTGGAGTCGCAGGTGTCCC	0.627			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																uc003tzw.2		NA		Dom	yes		7	7q11.23	2006	T	elastin	yes	Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome	L	PAX5		B-ALL		1	Substitution - Missense(1)	p.A418T(1)	pancreas(1)	ovary(3)|pancreas(2)	5						c.(1252-1254)GCA>TCA		elastin isoform a precursor	Rofecoxib(DB00533)						113.0	112.0	112.0					7																	73470702		2203	4300	6503	SO:0001583	missense	2006				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding	g.chr7:73470702G>T		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1252G>T	7.37:g.73470702G>T	ENSP00000252034:p.Ala418Ser		Somatic				RFC2_uc011kfa.1_Intron|ELN_uc011kfe.1_Missense_Mutation_p.A387S|ELN_uc003tzn.2_Missense_Mutation_p.A418S|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Missense_Mutation_p.A404S|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Missense_Mutation_p.A301S|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Missense_Mutation_p.A418S|ELN_uc003tzt.2_Missense_Mutation_p.A423S|ELN_uc003tzu.2_Missense_Mutation_p.A423S|ELN_uc003tzv.2_Missense_Mutation_p.A408S|ELN_uc003tzx.2_Missense_Mutation_p.A408S|ELN_uc011kff.1_Missense_Mutation_p.A418S|ELN_uc003tzy.2_Missense_Mutation_p.A413S	p.A418S	NM_000501	NP_001075224	WXS	Illumina HiSeq	Unspecified	P15502	ELN_HUMAN			20	1343	+		Lung NSC(55;0.159)	418			Ala-rich.		B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	c.1252G>T	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833809	0.32421	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T	0.32753	1.46;1.45;1.48;1.53;1.44;1.52;1.53;1.46;1.46;1.55;1.5;1.52;1.48	3.2	2.26	0.28386	.	.	.	.	.	T	0.16938	0.0407	.	.	.	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B	0.21520	0.029;0.029;0.057;0.029;0.029;0.057;0.057;0.029;0.029;0.057;0.012;0.029	B;B;B;B;B;B;B;B;B;B;B;B	0.26693	0.045;0.045;0.045;0.045;0.045;0.045;0.045;0.045;0.045;0.072;0.045;0.045	T	0.35076	-0.9803	8	0.11794	T	0.64	.	7.7632	0.28965	0.0:0.2609:0.7391:0.0	.	418;387;413;408;418;408;423;423;418;301;404;418	E7ENM0;E9PBM4;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.	S	418;418;418;413;418;408;404;408;423;423;387;301;418;418	ENSP00000389857:A418S;ENSP00000252034:A418S;ENSP00000351807:A418S;ENSP00000392575:A413S;ENSP00000369936:A418S;ENSP00000369949:A408S;ENSP00000369958:A404S;ENSP00000403162:A408S;ENSP00000349540:A423S;ENSP00000391129:A423S;ENSP00000369926:A301S;ENSP00000369950:A418S;ENSP00000313565:A418S	ENSP00000252034:A418S	A	+	1	0	ELN	73108638	0.007000	0.16637	0.001000	0.08648	0.009000	0.06853	0.408000	0.21065	0.513000	0.28278	0.555000	0.69702	GCA		0.627	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501		63	170	1	0	1.26778e-28	0.00361	1.62865e-28	63	170				
SLC25A40	55972	broad.mit.edu	37	7	87471013	87471013	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:87471013G>C	ENST00000341119.5	-	10	1104	c.758C>G	c.(757-759)aCt>aGt	p.T253S		NM_018843.3	NP_061331.2	Q8TBP6	S2540_HUMAN	solute carrier family 25, member 40	253					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	17	Esophageal squamous(14;0.00202)					AAATGGTAAAGTTGCAACAGC	0.239																																							uc003uje.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)	1						c.(757-759)ACT>AGT		mitochondrial carrier family protein							34.0	32.0	32.0					7																	87471013		2184	4254	6438	SO:0001583	missense	55972				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr7:87471013G>C	AF125531	CCDS5610.1	7q21.12	2013-05-22			ENSG00000075303	ENSG00000075303		"""Solute carriers"""	29680	protein-coding gene	gene with protein product		610821				16949250	Standard	NM_018843		Approved	MCFP	uc003uje.3	Q8TBP6	OTTHUMG00000131033	ENST00000341119.5:c.758C>G	7.37:g.87471013G>C	ENSP00000344831:p.Thr253Ser		Somatic					p.T253S	NM_018843	NP_061331	WXS	Illumina HiSeq	Unspecified	Q8TBP6	S2540_HUMAN			10	1109	-	Esophageal squamous(14;0.00202)		253			Helical; Name=5; (Potential).|Solcar 3.		A8K483|D6W5P6|Q53GB1|Q9UHR1	Missense_Mutation	SNP	ENST00000341119.5	37	c.758C>G	CCDS5610.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.835856	0.91117	.	.	ENSG00000075303	ENST00000341119	D	0.82344	-1.6	5.92	5.92	0.95590	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.91821	0.7412	M	0.82823	2.61	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	D	0.90501	0.4474	10	0.41790	T	0.15	.	19.925	0.97099	0.0:0.0:1.0:0.0	.	253	Q8TBP6	S2540_HUMAN	S	253	ENSP00000344831:T253S	ENSP00000344831:T253S	T	-	2	0	SLC25A40	87308949	1.000000	0.71417	0.990000	0.47175	0.985000	0.73830	9.431000	0.97494	2.810000	0.96702	0.585000	0.79938	ACT		0.239	SLC25A40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253677.5	NM_018843		8	33	0	0	0	0.000978	0	8	33				
CALCR	799	broad.mit.edu	37	7	93067425	93067425	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:93067425C>G	ENST00000394441.1	-	10	1192	c.877G>C	c.(877-879)Gtg>Ctg	p.V293L	CALCR_ENST00000360249.4_Missense_Mutation_p.V309L|CALCR_ENST00000359558.2_Missense_Mutation_p.V327L|CALCR_ENST00000426151.1_Missense_Mutation_p.V293L|CALCR_ENST00000421592.1_Missense_Mutation_p.V309L	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	327					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TGGGTTTCCACACTCAGCCAG	0.348																																							uc003umv.1		NA																	0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(979-981)GTG>CTG		calcitonin receptor isoform 2 precursor	Salmon Calcitonin(DB00017)						85.0	82.0	83.0					7																	93067425		2203	4300	6503	SO:0001583	missense	799				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding	g.chr7:93067425C>G	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.877G>C	7.37:g.93067425C>G	ENSP00000377959:p.Val293Leu		Somatic				CALCR_uc011kia.1_Missense_Mutation_p.V107L|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.V293L|CALCR_uc003umw.2_Missense_Mutation_p.V293L	p.V327L	NM_001742	NP_001733	WXS	Illumina HiSeq	Unspecified	P30988	CALCR_HUMAN	STAD - Stomach adenocarcinoma(171;0.000244)		12	1240	-	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		309			Extracellular (Potential).		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	c.979G>C	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	7.968	0.748432	0.15710	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	4.67	0.757	0.18427	.	.	.	.	.	T	0.29652	0.0740	L	0.46885	1.475	0.38339	D	0.944012	B;B	0.20671	0.047;0.001	B;B	0.24394	0.053;0.009	T	0.11542	-1.0583	9	0.32370	T	0.25	.	10.2476	0.43350	0.0:0.7223:0.0:0.2777	.	327;293	F5H605;A4D1G6	.;.	L	327;309;309;293;293	ENSP00000352561:V327L;ENSP00000353385:V309L;ENSP00000399552:V309L;ENSP00000377959:V293L;ENSP00000389295:V293L	ENSP00000352561:V327L	V	-	1	0	CALCR	92905361	0.997000	0.39634	0.771000	0.31576	0.331000	0.28603	1.103000	0.31062	0.033000	0.15463	-0.786000	0.03341	GTG		0.348	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742		14	60	0	0	0	0.010504	0	14	60				
LMTK2	22853	broad.mit.edu	37	7	97822874	97822874	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:97822874G>A	ENST00000297293.5	+	11	3390	c.3097G>A	c.(3097-3099)Gaa>Aaa	p.E1033K		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1033					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CAGTGGCTACGAAACAGAGAA	0.607																																							uc003upd.1		NA																	0				lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16						c.(3097-3099)GAA>AAA		lemur tyrosine kinase 2 precursor							63.0	70.0	68.0					7																	97822874		2203	4300	6503	SO:0001583	missense	22853				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr7:97822874G>A	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.3097G>A	7.37:g.97822874G>A	ENSP00000297293:p.Glu1033Lys		Somatic					p.E1033K	NM_014916	NP_055731	WXS	Illumina HiSeq	Unspecified	Q8IWU2	LMTK2_HUMAN			11	3390	+	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)		1033					A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	c.3097G>A	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	36	5.646274	0.96704	.	.	ENSG00000164715	ENST00000297293	D	0.83673	-1.75	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.91078	0.7192	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91619	0.5309	10	0.72032	D	0.01	.	18.4759	0.90792	0.0:0.0:1.0:0.0	.	1033	Q8IWU2	LMTK2_HUMAN	K	1033	ENSP00000297293:E1033K	ENSP00000297293:E1033K	E	+	1	0	LMTK2	97660810	1.000000	0.71417	0.971000	0.41717	0.939000	0.58152	9.414000	0.97362	2.679000	0.91253	0.650000	0.86243	GAA		0.607	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		25	84	0	0	0	0.007291	0	25	84				
SRRT	51593	broad.mit.edu	37	7	100485997	100485997	+	Missense_Mutation	SNP	C	C	T	rs139519950		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:100485997C>T	ENST00000347433.4	+	19	2706	c.2548C>T	c.(2548-2550)Cgc>Tgc	p.R850C	SRRT_ENST00000388793.4_Missense_Mutation_p.R849C|SRRT_ENST00000457580.2_Missense_Mutation_p.R846C|SRRT_ENST00000432932.1_Missense_Mutation_p.R845C			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	850					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TGGGAAACCTCGCAACAGGTG	0.602																																							uc003uwy.2		NA																	0				ovary(2)	2						c.(2548-2550)CGC>TGC		arsenate resistance protein 2 isoform a		C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	58.0	58.0	58.0		2545,2536,2533,2548	3.7	1.0	7	dbSNP_134	58	0,8600		0,0,4300	no	missense,missense,missense,missense	SRRT	NM_001128852.1,NM_001128853.1,NM_001128854.1,NM_015908.5	180,180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	849/876,846/873,845/872,850/877	100485997	1,13005	2203	4300	6503	SO:0001583	missense	51593				cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding	g.chr7:100485997C>T		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2548C>T	7.37:g.100485997C>T	ENSP00000314491:p.Arg850Cys		Somatic				SRRT_uc010lhl.1_Missense_Mutation_p.R849C|SRRT_uc003uxa.2_Missense_Mutation_p.R845C|SRRT_uc003uwz.2_Missense_Mutation_p.R846C|uc010lhm.1_5'Flank	p.R850C	NM_015908	NP_056992	WXS	Illumina HiSeq	Unspecified	Q9BXP5	SRRT_HUMAN			20	2816	+			850					A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	c.2548C>T	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159440	0.78226	2.27E-4	0.0	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000448764	.	.	.	4.59	3.68	0.42216	Arsenite-resistance protein 2 (1);	0.060216	0.64402	D	0.000005	T	0.67097	0.2857	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	P;D;D;D	0.69654	0.796;0.965;0.965;0.941	T	0.66344	-0.5947	9	0.45353	T	0.12	.	10.8848	0.46960	0.0:0.9036:0.0:0.0964	.	849;845;846;850	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	C	846;849;845;850;473	.	ENSP00000314491:R850C	R	+	1	0	SRRT	100323933	1.000000	0.71417	0.975000	0.42487	0.946000	0.59487	5.134000	0.64770	2.386000	0.81285	0.484000	0.47621	CGC		0.602	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908		3	33	0	0	0	0.004672	0	3	33				
PRKRIP1	79706	broad.mit.edu	37	7	102047917	102047917	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:102047917G>A	ENST00000496391.1	+	9	1739	c.429G>A	c.(427-429)aaG>aaA	p.K143K	PRKRIP1_ENST00000482465.1_3'UTR|PRKRIP1_ENST00000462601.1_Silent_p.K86K|PRKRIP1_ENST00000397912.3_Silent_p.K143K|MIR548O_ENST00000408583.1_RNA|PRKRIP1_ENST00000354783.4_Intron			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	143	Required for RNA-binding. {ECO:0000250}.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|lung(4)|ovary(1)	6						TGGCAAAGAAGATGAAACTTG	0.348																																							uc003uzh.2		NA																	0				ovary(1)	1						c.(427-429)AAG>AAA		PRKR interacting protein 1 (IL11 inducible)							97.0	97.0	97.0					7																	102047917		2203	4300	6503	SO:0001819	synonymous_variant	79706					nucleolus		g.chr7:102047917G>A	AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	ENST00000496391.1:c.429G>A	7.37:g.102047917G>A			Somatic				PRKRIP1_uc003uzf.2_Silent_p.K92K|PRKRIP1_uc003uzg.2_Silent_p.K92K|PRKRIP1_uc011kkq.1_Silent_p.K86K|PRKRIP1_uc011kkr.1_Intron|MIR548O_hsa-mir-548o|MI0006402_5'Flank	p.K143K	NM_024653	NP_078929	WXS	Illumina HiSeq	Unspecified	Q9H875	PKRI1_HUMAN			5	484	+			143			Potential.|Required for RNA-binding (By similarity).		B4DGM2|Q8NDM6|Q96CF8	Silent	SNP	ENST00000496391.1	37	c.429G>A	CCDS34714.1																																																																																				0.348	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349489.1	NM_024653		12	48	0	0	0	0.00245	0	12	48				
RELN	5649	broad.mit.edu	37	7	103368615	103368615	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:103368615G>A	ENST00000428762.1	-	7	855	c.696C>T	c.(694-696)ggC>ggT	p.G232G	RELN_ENST00000424685.2_Silent_p.G232G|RELN_ENST00000343529.5_Silent_p.G232G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	232					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCATAATCGCGCCACACTGTT	0.448																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(694-696)GGC>GGT		reelin isoform a							147.0	118.0	127.0					7																	103368615		2203	4300	6503	SO:0001819	synonymous_variant	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103368615G>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.696C>T	7.37:g.103368615G>A			Somatic				RELN_uc010liz.2_Silent_p.G232G	p.G232G	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	7	856	-			232					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	c.696C>T	CCDS47680.1																																																																																				0.448	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		50	67	0	0	0	0.00361	0	50	67				
DOCK4	9732	broad.mit.edu	37	7	111379217	111379217	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:111379217G>A	ENST00000437633.1	-	48	5434	c.5178C>T	c.(5176-5178)atC>atT	p.I1726I	DOCK4_ENST00000494651.2_Silent_p.I609I|DOCK4_ENST00000428084.1_Silent_p.I1735I	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1726	Ser-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GTGTTGGATAGATGGCACTGC	0.463																																							uc003vfx.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(5176-5178)ATC>ATT		dedicator of cytokinesis 4							197.0	193.0	194.0					7																	111379217		1957	4149	6106	SO:0001819	synonymous_variant	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111379217G>A		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5178C>T	7.37:g.111379217G>A			Somatic				DOCK4_uc011kml.1_Silent_p.I607I|DOCK4_uc011kmm.1_Silent_p.I633I|DOCK4_uc003vfw.2_Silent_p.I1176I|DOCK4_uc003vfy.2_Silent_p.I1771I|DOCK4_uc003vfv.2_Silent_p.I39I	p.I1726I	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			48	5447	-		Acute lymphoblastic leukemia(1;0.0441)	1726			Ser-rich.		O14584|O94824|Q8NB45	Silent	SNP	ENST00000437633.1	37	c.5178C>T	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241900	0.22796	.	.	ENSG00000128512	ENST00000423057;ENST00000445943	.	.	.	5.95	2.58	0.30949	.	.	.	.	.	T	0.46678	0.1405	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26258	-1.0108	4	.	.	.	.	3.9166	0.09225	0.4716:0.0:0.3645:0.1639	.	.	.	.	F	1187;1759	.	.	S	-	2	0	DOCK4	111166453	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	1.031000	0.30165	0.164000	0.19529	0.655000	0.94253	TCT		0.463	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705		26	81	0	0	0	0.002445	0	26	81				
PPP1R3A	5506	broad.mit.edu	37	7	113518041	113518041	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:113518041G>T	ENST00000284601.3	-	4	3174	c.3106C>A	c.(3106-3108)Caa>Aaa	p.Q1036K		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1036					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.Q1036*(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TATAGTGATTGCCCAGAGCTT	0.398																																							uc010ljy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(3106-3108)CAA>AAA		protein phosphatase 1, regulatory (inhibitor)							201.0	196.0	198.0					7																	113518041		2203	4299	6502	SO:0001583	missense	5506				glycogen metabolic process	integral to membrane		g.chr7:113518041G>T	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3106C>A	7.37:g.113518041G>T	ENSP00000284601:p.Gln1036Lys		Somatic					p.Q1036K	NM_002711	NP_002702	WXS	Illumina HiSeq	Unspecified	Q16821	PPR3A_HUMAN			4	3137	-			1036					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	c.3106C>A	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	0.062	-1.222362	0.01530	.	.	ENSG00000154415	ENST00000284601	T	0.15952	2.38	5.49	4.61	0.57282	.	0.239625	0.29653	N	0.011560	T	0.14657	0.0354	L	0.52364	1.645	0.09310	N	1	B	0.23128	0.08	B	0.13407	0.009	T	0.26155	-1.0111	10	0.10636	T	0.68	-0.8981	11.7266	0.51712	0.0:0.0:0.6602:0.3398	.	1036	Q16821	PPR3A_HUMAN	K	1036	ENSP00000284601:Q1036K	ENSP00000284601:Q1036K	Q	-	1	0	PPP1R3A	113305277	0.665000	0.27466	0.433000	0.26760	0.072000	0.16883	1.836000	0.39191	1.302000	0.44855	0.650000	0.86243	CAA		0.398	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		63	180	1	0	1.93348e-29	0.00361	2.49786e-29	63	180				
AASS	10157	broad.mit.edu	37	7	121726159	121726159	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:121726159C>G	ENST00000393376.1	-	18	2186	c.2091G>C	c.(2089-2091)ttG>ttC	p.L697F	AASS_ENST00000417368.2_Missense_Mutation_p.L697F|AASS_ENST00000473553.1_5'UTR			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	697	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						GATAGCCTTCCAAATTTAATC	0.428																																							uc003vka.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(2089-2091)TTG>TTC		aminoadipate-semialdehyde synthase precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						90.0	87.0	88.0					7																	121726159		2203	4300	6503	SO:0001583	missense	10157				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity	g.chr7:121726159C>G	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2091G>C	7.37:g.121726159C>G	ENSP00000377040:p.Leu697Phe		Somatic				AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.L697F|AASS_uc011knw.1_Missense_Mutation_p.L185F	p.L697F	NM_005763	NP_005754	WXS	Illumina HiSeq	Unspecified	Q9UDR5	AASS_HUMAN			18	2187	-			697			Saccharopine dehydrogenase.		O95462	Missense_Mutation	SNP	ENST00000393376.1	37	c.2091G>C	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.615188	0.66672	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	T;T	0.45276	0.9;0.9	6.08	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.48259	0.1490	L	0.37507	1.11	0.80722	D	1	D	0.55172	0.97	D	0.64237	0.923	T	0.35599	-0.9782	10	0.20046	T	0.44	-11.556	11.0375	0.47811	0.0:0.8573:0.0:0.1427	.	697	Q9UDR5	AASS_HUMAN	F	697	ENSP00000377040:L697F;ENSP00000403768:L697F	ENSP00000351834:L697F	L	-	3	2	AASS	121513395	1.000000	0.71417	0.995000	0.50966	0.801000	0.45260	1.908000	0.39907	1.575000	0.49775	0.655000	0.94253	TTG		0.428	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763		20	53	0	0	0	0.008871	0	20	53				
GPR37	2861	broad.mit.edu	37	7	124404368	124404368	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:124404368C>G	ENST00000303921.2	-	1	1313	c.663G>C	c.(661-663)caG>caC	p.Q221H		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	221					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGGATCCATTCTGGGCCAGCG	0.637																																							uc003vli.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(661-663)CAG>CAC		G protein-coupled receptor 37 precursor							37.0	41.0	39.0					7																	124404368		2203	4300	6503	SO:0001583	missense	2861					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity	g.chr7:124404368C>G		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.663G>C	7.37:g.124404368C>G	ENSP00000306449:p.Gln221His		Somatic					p.Q221H	NM_005302	NP_005293	WXS	Illumina HiSeq	Unspecified	O15354	GPR37_HUMAN			1	1314	-			221			Extracellular (Potential).		A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	c.663G>C	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350454	0.61183	.	.	ENSG00000170775	ENST00000303921	T	0.71341	-0.56	5.49	3.53	0.40419	.	0.201709	0.41396	D	0.000900	T	0.58366	0.2117	L	0.36672	1.1	0.29355	N	0.865081	D	0.59357	0.985	P	0.47044	0.535	T	0.52895	-0.8514	10	0.15066	T	0.55	-17.8186	6.2504	0.20842	0.0:0.7737:0.0:0.2263	.	221	O15354	GPR37_HUMAN	H	221	ENSP00000306449:Q221H	ENSP00000306449:Q221H	Q	-	3	2	GPR37	124191604	0.986000	0.35501	1.000000	0.80357	0.867000	0.49689	1.025000	0.30090	1.538000	0.49270	0.638000	0.83543	CAG		0.637	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302		23	53	0	0	0	0.003954	0	23	53				
SND1	27044	broad.mit.edu	37	7	127342491	127342491	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:127342491A>G	ENST00000354725.3	+	6	786	c.592A>G	c.(592-594)Atc>Gtc	p.I198V		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	198	TNase-like 2. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						TCACACAGCTATCATCGAGCA	0.488																																							uc003vmi.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(592-594)ATC>GTC		staphylococcal nuclease domain containing 1							148.0	127.0	134.0					7																	127342491		2203	4300	6503	SO:0001583	missense	27044				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity	g.chr7:127342491A>G		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.592A>G	7.37:g.127342491A>G	ENSP00000346762:p.Ile198Val		Somatic					p.I198V	NM_014390	NP_055205	WXS	Illumina HiSeq	Unspecified	Q7KZF4	SND1_HUMAN			6	818	+			198			TNase-like 2.		Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	c.592A>G	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	A	11.24	1.580022	0.28180	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.29397	1.57	5.86	5.86	0.93980	Staphylococcal nuclease (SNase-like) (3);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.16854	0.0405	N	0.11106	0.095	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.11324	-1.0592	10	0.09338	T	0.73	-23.5307	14.5065	0.67755	1.0:0.0:0.0:0.0	.	198	Q7KZF4	SND1_HUMAN	V	198;188	ENSP00000346762:I198V	ENSP00000346762:I198V	I	+	1	0	SND1	127129727	1.000000	0.71417	0.999000	0.59377	0.767000	0.43475	9.131000	0.94446	2.367000	0.80283	0.528000	0.53228	ATC		0.488	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390		50	138	0	0	0	0.00361	0	50	138				
FLNC	2318	broad.mit.edu	37	7	128497331	128497331	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:128497331C>A	ENST00000325888.8	+	46	7982	c.7721C>A	c.(7720-7722)gCc>gAc	p.A2574D	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.A2541D	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2574	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TACCTCATTGCCATCAAGTAC	0.617																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(7720-7722)GCC>GAC		gamma filamin isoform a							41.0	45.0	43.0					7																	128497331		2078	4206	6284	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128497331C>A	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7721C>A	7.37:g.128497331C>A	ENSP00000327145:p.Ala2574Asp		Somatic				FLNC_uc003voa.3_Missense_Mutation_p.A2541D	p.A2574D	NM_001458	NP_001449	WXS	Illumina HiSeq	Unspecified	Q14315	FLNC_HUMAN			46	7930	+			2574			Interaction with INPPL1.|Filamin 23.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.7721C>A	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	c	19.62	3.861971	0.71949	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84660	-1.88;-1.88	5.28	5.28	0.74379	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.121926	0.56097	D	0.000035	T	0.78457	0.4286	N	0.25286	0.73	0.42174	D	0.99165	B;P	0.40083	0.427;0.702	B;B	0.39971	0.197;0.315	T	0.80462	-0.1372	10	0.46703	T	0.11	.	15.5202	0.75859	0.0:0.852:0.148:0.0	.	2541;2574	Q14315-2;Q14315	.;FLNC_HUMAN	D	2574;2541	ENSP00000327145:A2574D;ENSP00000344002:A2541D	ENSP00000327145:A2574D	A	+	2	0	FLNC	128284567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.719000	0.47244	2.476000	0.83614	0.555000	0.69702	GCC		0.617	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			32	47	1	0	4.4194e-11	0.002836	5.04444e-11	32	47				
KIAA1549	57670	broad.mit.edu	37	7	138579145	138579146	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:138579145_138579146GC>AA	ENST00000422774.1	-	10	4022_4023	c.3974_3975GC>TT	c.(3973-3975)cGC>cTT	p.R1325L	KIAA1549_ENST00000242365.4_Missense_Mutation_p.R1275L|KIAA1549_ENST00000440172.1_Missense_Mutation_p.R1325L			Q9HCM3	K1549_HUMAN	KIAA1549	1325						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GCTTGTCTGTGCGGCATAGTTT	0.52			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	NSCLC(119;1534 1718 44213 46230 50068)	uc011kql.1		NA		Dom	yes		7	7q34	57670	O	KIAA1549			O	BRAF		pilocytic astrocytoma	KIAA1549/BRAF(229)	0				central_nervous_system(229)|pancreas(1)	230						c.(3973-3975)CGC>CTT		hypothetical protein LOC57670 isoform 1																																				SO:0001583	missense	57670					integral to membrane		g.chr7:138579145_138579146GC>AA		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3974_3975delinsAA	7.37:g.138579145_138579146delinsAA	ENSP00000416040:p.Arg1325Leu		Somatic				KIAA1549_uc011kqi.1_Missense_Mutation_p.R109L|KIAA1549_uc003vuk.3_Missense_Mutation_p.R1275L|KIAA1549_uc011kqj.1_Missense_Mutation_p.R1325L|KIAA1549_uc011kqk.1_Missense_Mutation_p.R109L	p.R1325L	NM_020910	NP_065961	WXS	Illumina HiSeq	Unspecified	Q9HCM3	K1549_HUMAN			10	4023_4024	-			1325					B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	DNP	ENST00000422774.1	37	c.3974_3975GC>TT	CCDS56513.1																																																																																				0.520	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			46	169	0	0	0	0.004672	0	46	169				
OR2F2	135948	broad.mit.edu	37	7	143632716	143632716	+	Nonsense_Mutation	SNP	C	C	T	rs185106716		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:143632716C>T	ENST00000408955.2	+	1	458	c.391C>T	c.(391-393)Cga>Tga	p.R131*		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					TGACCGCCTGCGATACTCGGC	0.552																																							uc011ktv.1		NA																	0				ovary(3)|skin(1)	4						c.(391-393)CGA>TGA		olfactory receptor, family 2, subfamily F,		C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	118.0	107.0	111.0		391	0.4	0.9	7		111	0,8600		0,0,4300	no	stop-gained	OR2F2	NM_001004685.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		131/318	143632716	1,13005	2203	4300	6503	SO:0001587	stop_gained	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143632716C>T		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.391C>T	7.37:g.143632716C>T	ENSP00000386222:p.Arg131*		Somatic					p.R131*	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	391	+	Melanoma(164;0.0903)		131			Cytoplasmic (Potential).		A4D2G0|Q6IFP8	Nonsense_Mutation	SNP	ENST00000408955.2	37	c.391C>T	CCDS43666.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	26.2	4.716204	0.89205	2.27E-4	0.0	ENSG00000221910	ENST00000408955	.	.	.	3.68	0.383	0.16239	.	0.000000	0.44688	D	0.000429	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-9.8208	10.9245	0.47184	0.6138:0.3862:0.0:0.0	.	.	.	.	X	131	.	ENSP00000386222:R131X	R	+	1	2	OR2F2	143263649	0.002000	0.14202	0.857000	0.33713	0.925000	0.55904	0.067000	0.14510	-0.061000	0.13110	0.491000	0.48974	CGA		0.552	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			36	107	0	0	0	0.004878	0	36	107				
SSPO	23145	broad.mit.edu	37	7	149495214	149495214	+	RNA	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:149495214G>T	ENST00000378016.2	+	0	6961							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCCCCGACAGGTGTGTGCACA	0.652																																							uc010lpk.2		NA																	0					0						c.e48+1		SCO-spondin precursor							55.0	65.0	62.0					7																	149495214		1997	4163	6160			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149495214G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149495214G>T			Somatic					p.E2321_splice	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		48	6961	+	Melanoma(164;0.165)|Ovarian(565;0.177)							Q76B61	Splice_Site	SNP	ENST00000378016.2	37	c.6961_splice																																																																																					0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				69	94	1	0	1.78623e-52	0.00361	2.37472e-52	69	94				
SMARCD3	6604	broad.mit.edu	37	7	150939586	150939586	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:150939586T>G	ENST00000262188.8	-	5	970	c.560A>C	c.(559-561)gAg>gCg	p.E187A	SMARCD3_ENST00000356800.2_Missense_Mutation_p.E174A|SMARCD3_ENST00000392811.2_Missense_Mutation_p.E174A|SMARCD3_ENST00000477169.1_5'UTR|RP4-548D19.3_ENST00000607902.1_RNA	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	187					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGCTTCCCCTCCACCCGTAG	0.577																																							uc003wjs.2		NA																	0				ovary(1)|lung(1)	2						c.(559-561)GAG>GCG		SWI/SNF related, matrix associated, actin							76.0	82.0	80.0					7																	150939586		2203	4300	6503	SO:0001583	missense	6604				cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding	g.chr7:150939586T>G	U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.560A>C	7.37:g.150939586T>G	ENSP00000262188:p.Glu187Ala		Somatic				SMARCD3_uc003wjt.2_Missense_Mutation_p.E174A|SMARCD3_uc003wju.2_Missense_Mutation_p.E174A|SMARCD3_uc011kvh.1_Missense_Mutation_p.E187A|SMARCD3_uc010lqa.1_Missense_Mutation_p.E187A	p.E187A	NM_001003801	NP_001003801	WXS	Illumina HiSeq	Unspecified	Q6STE5	SMRD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	5	661	-			187					D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Missense_Mutation	SNP	ENST00000262188.8	37	c.560A>C	CCDS34780.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973767	0.74246	.	.	ENSG00000082014	ENST00000262188;ENST00000392811;ENST00000356800;ENST00000347683	T;T;T	0.57273	0.41;0.41;0.41	4.58	4.58	0.56647	.	0.049237	0.85682	D	0.000000	T	0.75766	0.3894	M	0.91872	3.25	0.80722	D	1	D;D;D;D	0.89917	0.993;0.997;0.974;1.0	D;D;D;D	0.83275	0.971;0.996;0.953;0.994	T	0.78907	-0.2019	10	0.40728	T	0.16	-25.0416	11.9746	0.53083	0.0:0.0:0.0:1.0	.	187;187;174;187	B7Z4U8;B7ZA58;Q6STE5-2;Q6STE5	.;.;.;SMRD3_HUMAN	A	187;174;174;139	ENSP00000262188:E187A;ENSP00000376558:E174A;ENSP00000349254:E174A	ENSP00000262188:E187A	E	-	2	0	SMARCD3	150570519	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.864000	0.87037	1.915000	0.55452	0.460000	0.39030	GAG		0.577	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348825.1	NM_001003801		67	54	0	0	0	0.00361	0	67	54				
KMT2C	58508	broad.mit.edu	37	7	151932917	151932917	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:151932917A>G	ENST00000262189.6	-	16	2972	c.2754T>C	c.(2752-2754)gcT>gcC	p.A918A	KMT2C_ENST00000355193.2_Silent_p.A918A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	918					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GTAATACAACAGCTCCGATTC	0.468																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2752-2754)GCT>GCC		myeloid/lymphoid or mixed-lineage leukemia 3							78.0	71.0	73.0					7																	151932917		2202	4284	6486	SO:0001819	synonymous_variant	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151932917A>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2754T>C	7.37:g.151932917A>G			Somatic				MLL3_uc003wkz.2_5'UTR	p.A918A	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	16	2973	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	918					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	c.2754T>C	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	10.76	1.440168	0.25900	.	.	ENSG00000055609	ENST00000418673	.	.	.	5.0	-0.234	0.13074	.	.	.	.	.	T	0.43656	0.1257	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23762	-1.0179	4	.	.	.	.	3.5453	0.07826	0.5107:0.0:0.1706:0.3187	.	.	.	.	R	74	.	.	C	-	1	0	MLL3	151563850	0.960000	0.32886	0.998000	0.56505	0.993000	0.82548	0.312000	0.19397	0.011000	0.14865	0.477000	0.44152	TGT		0.468	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			31	214	0	0	0	0.009718	0	31	214				
KMT2C	58508	broad.mit.edu	37	7	151945009	151945009	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:151945009G>T	ENST00000262189.6	-	14	2728	c.2510C>A	c.(2509-2511)cCt>cAt	p.P837H	KMT2C_ENST00000355193.2_Missense_Mutation_p.P837H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	837					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGGTCTACCAGGAGAAAATTT	0.373																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2509-2511)CCT>CAT		myeloid/lymphoid or mixed-lineage leukemia 3							148.0	133.0	138.0					7																	151945009		2203	4298	6501	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151945009G>T	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2510C>A	7.37:g.151945009G>T	ENSP00000262189:p.Pro837His		Somatic					p.P837H	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	14	2729	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	837					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.2510C>A	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678991	0.68042	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.94613	-3.42;-3.47	5.67	5.67	0.87782	.	0.000000	0.46145	D	0.000303	D	0.95774	0.8625	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96176	0.9127	10	0.66056	D	0.02	.	19.7692	0.96356	0.0:0.0:1.0:0.0	.	837	Q8NEZ4	MLL3_HUMAN	H	837	ENSP00000262189:P837H;ENSP00000347325:P837H	ENSP00000262189:P837H	P	-	2	0	MLL3	151575942	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.471000	0.97696	2.658000	0.90341	0.650000	0.86243	CCT		0.373	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			15	207	1	0	1.55795e-14	0.001882	1.83634e-14	15	207				
KMT2C	58508	broad.mit.edu	37	7	151962220	151962220	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:151962220C>G	ENST00000262189.6	-	8	1305	c.1087G>C	c.(1087-1089)Ggt>Cgt	p.G363R	KMT2C_ENST00000355193.2_Missense_Mutation_p.G363R	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	363					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TAGTGCTGACCACAAGTAGTA	0.448																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(1087-1089)GGT>CGT		myeloid/lymphoid or mixed-lineage leukemia 3							332.0	299.0	310.0					7																	151962220		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151962220C>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1087G>C	7.37:g.151962220C>G	ENSP00000262189:p.Gly363Arg		Somatic					p.G363R	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	8	1306	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	363			PHD-type 1.|RING-type.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.1087G>C	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286050	0.40394	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98876	-5.2;-5.2	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.42548	U	0.000694	D	0.99058	0.9677	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99835	1.1057	10	0.87932	D	0	.	17.9157	0.88950	0.0:1.0:0.0:0.0	.	363	Q8NEZ4	MLL3_HUMAN	R	363	ENSP00000262189:G363R;ENSP00000347325:G363R	ENSP00000262189:G363R	G	-	1	0	MLL3	151593153	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	7.776000	0.85560	2.271000	0.75665	0.557000	0.71058	GGT		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			16	516	0	0	0	0.001882	0	16	516				
MNX1	3110	broad.mit.edu	37	7	156799175	156799175	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:156799175G>C	ENST00000252971.6	-	2	1150	c.850C>G	c.(850-852)Cag>Gag	p.Q284E	MNX1_ENST00000469500.1_Intron|MNX1-AS2_ENST00000429228.1_RNA|MNX1_ENST00000543409.1_Missense_Mutation_p.Q72E	NM_005515.3	NP_005506.3	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1	284					anatomical structure morphogenesis (GO:0009653)|diaphragm development (GO:0060539)|dorsal/ventral neural tube patterning (GO:0021904)|endocrine pancreas development (GO:0031018)|humoral immune response (GO:0006959)|motor neuron axon guidance (GO:0008045)|nerve development (GO:0021675)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCGCGCACCTGGGTCTCGGTG	0.662																																							uc003wnd.1		NA																	0					0						c.(850-852)CAG>GAG		motor neuron and pancreas homeobox 1 isoform 1							33.0	34.0	33.0					7																	156799175		2200	4298	6498	SO:0001583	missense	3110	Currarino_syndrome			humoral immune response|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:156799175G>C	AF107457	CCDS34788.1, CCDS55187.1	7q36	2012-03-09	2007-08-09	2007-08-09	ENSG00000130675	ENSG00000130675		"""Homeoboxes / ANTP class : HOXL subclass"""	4979	protein-coding gene	gene with protein product		142994	"""homeo box HB9"", ""homeobox HB9"""	HLXB9		9843207	Standard	NM_001165255		Approved	HB9, HOXHB9, SCRA1	uc003wmz.4	P50219	OTTHUMG00000157181	ENST00000252971.6:c.850C>G	7.37:g.156799175G>C	ENSP00000252971:p.Gln284Glu		Somatic				MNX1_uc003wmz.2_Intron|MNX1_uc003wna.2_Intron|MNX1_uc010lqq.1_Missense_Mutation_p.Q77E|MNX1_uc003wnc.1_Missense_Mutation_p.Q72E|MNX1_uc010lqr.1_Intron	p.Q284E	NM_005515	NP_005506	WXS	Illumina HiSeq	Unspecified	P50219	MNX1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	2	1153	-	Ovarian(565;0.218)	all_hematologic(28;0.0592)	284			Homeobox.		F5H401|Q9Y648	Missense_Mutation	SNP	ENST00000252971.6	37	c.850C>G	CCDS34788.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736280	0.89482	.	.	ENSG00000130675	ENST00000252971;ENST00000543409;ENST00000542972;ENST00000428439	D;D;D	0.96967	-4.19;-4.19;-4.19	3.96	3.96	0.45880	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.38381	U	0.001709	D	0.98479	0.9493	M	0.93062	3.375	0.54753	D	0.99998	D;D;D	0.89917	1.0;0.999;0.995	D;D;D	0.83275	0.992;0.996;0.968	D	0.99835	1.1057	10	0.87932	D	0	-23.6938	16.4168	0.83744	0.0:0.0:1.0:0.0	.	120;284;72	Q9UDY3;P50219;F5H401	.;MNX1_HUMAN;.	E	284;72;114;72	ENSP00000252971:Q284E;ENSP00000438552:Q72E;ENSP00000401158:Q72E	ENSP00000252971:Q284E	Q	-	1	0	MNX1	156491936	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	7.436000	0.80404	1.922000	0.55676	0.555000	0.69702	CAG		0.662	MNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347796.3			13	21	0	0	0	0.00499	0	13	21				
VIPR2	7434	broad.mit.edu	37	7	158829540	158829540	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr7:158829540G>T	ENST00000262178.2	-	7	836	c.651C>A	c.(649-651)ttC>ttA	p.F217L	VIPR2_ENST00000377633.3_Missense_Mutation_p.F201L|VIPR2_ENST00000402066.1_Missense_Mutation_p.F358L	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	217					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		GCAGCCAGAAGAAGTTGGCCA	0.587																																					Pancreas(154;1876 1931 2329 17914 20079)	Pancreas(154;1876 1931 2329 17914 20079)	uc003woh.2		NA																	0				lung(1)|central_nervous_system(1)	2						c.(649-651)TTC>TTA		vasoactive intestinal peptide receptor 2							88.0	74.0	79.0					7																	158829540		2203	4300	6503	SO:0001583	missense	7434				cell-cell signaling	integral to plasma membrane		g.chr7:158829540G>T	CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.651C>A	7.37:g.158829540G>T	ENSP00000262178:p.Phe217Leu		Somatic				VIPR2_uc010lqx.2_RNA|VIPR2_uc010lqy.2_RNA	p.F217L	NM_003382	NP_003373	WXS	Illumina HiSeq	Unspecified	P41587	VIPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)	7	837	-	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	217			Helical; Name=3; (Potential).		Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	ENST00000262178.2	37	c.651C>A	CCDS5950.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955733	0.73902	.	.	ENSG00000106018	ENST00000262178;ENST00000377633;ENST00000402066	T;T;T	0.62639	0.01;0.01;0.01	4.58	3.58	0.41010	GPCR, family 2-like (1);	0.000000	0.56097	D	0.000037	T	0.81088	0.4750	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80174	-0.1492	9	.	.	.	.	5.1458	0.14983	0.3276:0.0:0.6724:0.0	.	217	P41587	VIPR2_HUMAN	L	217;201;358	ENSP00000262178:F217L;ENSP00000366860:F201L;ENSP00000384497:F358L	.	F	-	3	2	VIPR2	158522301	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	2.709000	0.47160	0.816000	0.34421	0.561000	0.74099	TTC		0.587	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382		22	65	1	0	7.33532e-06	0.003954	7.78952e-06	22	65				
DEFB4A	1673	broad.mit.edu	37	8	7752238	7752238	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:7752238A>G	ENST00000302247.2	+	1	88	c.4A>G	c.(4-6)Agg>Ggg	p.R2G		NM_004942.2	NP_004933.1	O15263	DFB4A_HUMAN	defensin, beta 4A	2					chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				lung(1)	1						ATCAGCCATGAGGGTCTTGTA	0.527																																					Ovarian(105;1718 2131 4132 11552)	Ovarian(105;1718 2131 4132 11552)	uc003wsd.2		NA																	0					0						c.(4-6)AGG>GGG		defensin, beta 4 precursor							148.0	128.0	135.0					8																	7752238		2199	4297	6496	SO:0001583	missense	1673				chemotaxis|defense response to bacterium|G-protein coupled receptor protein signaling pathway|immune response	extracellular region		g.chr8:7752238A>G	AJ000152	CCDS5971.1	8p23.1	2014-01-30	2010-03-01	2010-03-01	ENSG00000171711	ENSG00000171711		"""Defensins, beta"", ""Endogenous ligands"""	2767	protein-coding gene	gene with protein product		602215	"""defensin, beta 2"", ""defensin, beta 4"""	DEFB102, DEFB2, DEFB4		9202117	Standard	NM_004942		Approved	SAP1, HBD-2, DEFB-2	uc003wsd.3	O15263	OTTHUMG00000129314	ENST00000302247.2:c.4A>G	8.37:g.7752238A>G	ENSP00000303532:p.Arg2Gly		Somatic					p.R2G	NM_004942	NP_004933	WXS	Illumina HiSeq	Unspecified	O15263	DFB4A_HUMAN			1	40	+			2					Q52LC0	Missense_Mutation	SNP	ENST00000302247.2	37	c.4A>G	CCDS5971.1	.	.	.	.	.	.	.	.	.	.	A	8.956	0.969426	0.18659	.	.	ENSG00000171711	ENST00000302247	.	.	.	1.72	1.72	0.24424	.	.	.	.	.	T	0.27419	0.0673	.	.	.	0.09310	N	1	B	0.28760	0.221	B	0.18561	0.022	T	0.21518	-1.0243	7	0.72032	D	0.01	.	5.4797	0.16717	1.0:0.0:0.0:0.0	.	2	O15263	DFB4A_HUMAN	G	2	.	ENSP00000303532:R2G	R	+	1	2	DEFB4A	7789648	0.909000	0.30893	0.021000	0.16686	0.044000	0.14063	2.846000	0.48262	1.029000	0.39812	0.334000	0.21626	AGG		0.527	DEFB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251446.1	NM_004942		7	112	0	0	0	0.008291	0	7	112				
PCM1	5108	broad.mit.edu	37	8	17796323	17796323	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:17796323G>A	ENST00000519253.1	+	5	668	c.417G>A	c.(415-417)aaG>aaA	p.K139K	PCM1_ENST00000524226.1_Silent_p.K139K|PCM1_ENST00000518537.1_Silent_p.K139K|PCM1_ENST00000325083.8_Silent_p.K139K			Q15154	PCM1_HUMAN	pericentriolar material 1	139					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AAAACCGAAAGCCCTTCAACT	0.393			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																		uc003wyi.3		NA		Dom	yes		8	8p22-p21.3	5108	T	pericentriolar material 1  (PTC4)			"""E, L"""	RET|JAK2		papillary thyroid|CML|MPD	PCM1/JAK2(30)	0				haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36						c.(415-417)AAG>AAA		pericentriolar material 1							78.0	75.0	76.0					8																	17796323		1852	4093	5945	SO:0001819	synonymous_variant	5108				centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding	g.chr8:17796323G>A		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.417G>A	8.37:g.17796323G>A			Somatic				PCM1_uc011kyh.1_Silent_p.K139K|PCM1_uc003wyj.3_Silent_p.K139K|PCM1_uc003wyg.2_Silent_p.K139K|PCM1_uc003wyh.2_Silent_p.K139K|PCM1_uc010lta.1_Silent_p.K139K	p.K139K	NM_006197	NP_006188	WXS	Illumina HiSeq	Unspecified	Q15154	PCM1_HUMAN		Colorectal(111;0.0789)	5	839	+			139					Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Silent	SNP	ENST00000519253.1	37	c.417G>A																																																																																					0.393	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197		11	21	0	0	0	0.00245	0	11	21				
UNC5D	137970	broad.mit.edu	37	8	35606111	35606111	+	Missense_Mutation	SNP	C	C	G	rs369520847		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:35606111C>G	ENST00000404895.2	+	12	2161	c.1833C>G	c.(1831-1833)atC>atG	p.I611M	UNC5D_ENST00000287272.2_Missense_Mutation_p.I542M|UNC5D_ENST00000449677.1_Missense_Mutation_p.I187M|UNC5D_ENST00000420357.1_Missense_Mutation_p.I544M|UNC5D_ENST00000416672.1_Missense_Mutation_p.I616M|UNC5D_ENST00000453357.2_Missense_Mutation_p.I606M	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	611	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CAGACATGATCGTCACCACTC	0.493																																							uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(1831-1833)ATC>ATG		unc-5 homolog D precursor							185.0	154.0	165.0					8																	35606111		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35606111C>G	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1833C>G	8.37:g.35606111C>G	ENSP00000385143:p.Ile611Met		Somatic				UNC5D_uc003xjs.1_Missense_Mutation_p.I606M|UNC5D_uc003xju.1_Missense_Mutation_p.I187M	p.I611M	NM_080872	NP_543148	WXS	Illumina HiSeq	Unspecified	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	12	2161	+			611			ZU5.|Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.1833C>G	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527653	0.44969	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	6.07	-9.63	0.00544	ZU5 (2);	0.679800	0.16208	N	0.224593	T	0.13114	0.0318	N	0.03608	-0.345	0.09310	N	0.999998	B;B;B	0.29037	0.069;0.231;0.129	B;B;B	0.31869	0.086;0.084;0.137	T	0.15694	-1.0428	10	0.51188	T	0.08	-2.4728	4.5906	0.12304	0.1221:0.1969:0.4419:0.2391	.	187;606;611	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	M	611;544;542;616;606;187	ENSP00000385143:I611M;ENSP00000392739:I544M;ENSP00000287272:I542M;ENSP00000412652:I616M;ENSP00000394303:I606M;ENSP00000397211:I187M	ENSP00000287272:I542M	I	+	3	3	UNC5D	35725653	0.000000	0.05858	0.584000	0.28653	0.998000	0.95712	-4.402000	0.00240	-1.013000	0.03383	0.655000	0.94253	ATC		0.493	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			38	45	0	0	0	0.007835	0	38	45				
GPR124	25960	broad.mit.edu	37	8	37688280	37688280	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:37688280G>A	ENST00000412232.2	+	7	784	c.771G>A	c.(769-771)gtG>gtA	p.V257V	GPR124_ENST00000315215.7_Silent_p.V257V	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	257	Ig-like.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TACGCCAAGTGGTGTTCCAGG	0.657																																							uc003xkj.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(769-771)GTG>GTA		G protein-coupled receptor 124 precursor							82.0	52.0	62.0					8																	37688280		2201	4299	6500	SO:0001819	synonymous_variant	25960				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr8:37688280G>A	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.771G>A	8.37:g.37688280G>A			Somatic				GPR124_uc010lvy.2_Silent_p.V257V	p.V257V	NM_032777	NP_116166	WXS	Illumina HiSeq	Unspecified	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		7	1134	+			257			Extracellular (Potential).|Ig-like.		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	c.771G>A	CCDS6097.2																																																																																				0.657	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			8	20	0	0	0	0.004482	0	8	20				
GPR124	25960	broad.mit.edu	37	8	37691560	37691560	+	Missense_Mutation	SNP	G	G	A	rs372027558		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:37691560G>A	ENST00000412232.2	+	11	1535	c.1522G>A	c.(1522-1524)Gag>Aag	p.E508K	GPR124_ENST00000315215.7_Missense_Mutation_p.E508K	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	508					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GGCCCAGCGCGAGGACAAGGC	0.662																																							uc003xkj.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(1522-1524)GAG>AAG		G protein-coupled receptor 124 precursor		G	LYS/GLU	0,4406		0,0,2203	35.0	42.0	39.0		1522	4.6	1.0	8		39	1,8595		0,1,4297	no	missense	GPR124	NM_032777.9	56	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	508/1339	37691560	1,13001	2203	4298	6501	SO:0001583	missense	25960				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr8:37691560G>A	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1522G>A	8.37:g.37691560G>A	ENSP00000406367:p.Glu508Lys		Somatic				GPR124_uc010lvy.2_Missense_Mutation_p.E508K	p.E508K	NM_032777	NP_116166	WXS	Illumina HiSeq	Unspecified	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		11	1885	+			508			Extracellular (Potential).		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	c.1522G>A	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	35	5.447939	0.96205	0.0	1.16E-4	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.49720	0.77;0.77	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.65678	0.2714	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.98;0.996	T	0.63817	-0.6551	10	0.30854	T	0.27	-11.4601	17.4576	0.87611	0.0:0.0:1.0:0.0	.	508;508	Q96PE1-2;Q96PE1	.;GP124_HUMAN	K	501;508;508	ENSP00000323508:E508K;ENSP00000406367:E508K	ENSP00000323508:E508K	E	+	1	0	GPR124	37810718	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.755000	0.98912	2.113000	0.64589	0.462000	0.41574	GAG		0.662	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			46	98	0	0	0	0.002522	0	46	98				
IKBKB	3551	broad.mit.edu	37	8	42166509	42166509	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:42166509C>T	ENST00000520810.1	+	8	844	c.658C>T	c.(658-660)Cgg>Tgg	p.R220W	IKBKB_ENST00000379708.3_Intron|IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.R218W|IKBKB_ENST00000416505.2_Missense_Mutation_p.R161W|IKBKB_ENST00000519735.1_Missense_Mutation_p.R220W	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CACGGGCTTCCGGCCCTTCCT	0.627																																							uc003xow.1		NA																	0				breast(3)|ovary(2)|lung(1)|skin(1)	7						c.(658-660)CGG>TGG		inhibitor of nuclear factor kappa B kinase beta	Arsenic trioxide(DB01169)|Auranofin(DB00995)						122.0	112.0	115.0					8																	42166509		2203	4300	6503	SO:0001583	missense	3551				anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity	g.chr8:42166509C>T	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.658C>T	8.37:g.42166509C>T	ENSP00000430684:p.Arg220Trp		Somatic				IKBKB_uc003xov.2_Missense_Mutation_p.R220W|IKBKB_uc010lxh.1_Missense_Mutation_p.R115W|IKBKB_uc011lco.1_RNA|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_5'UTR|IKBKB_uc011lcp.1_RNA|IKBKB_uc011lcq.1_Missense_Mutation_p.R218W|IKBKB_uc010lxi.1_RNA|IKBKB_uc011lcr.1_Missense_Mutation_p.R161W	p.R220W	NM_001556	NP_001547	WXS	Illumina HiSeq	Unspecified	O14920	IKKB_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		8	835	+	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	220			Protein kinase.		B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	c.658C>T	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566922	0.86439	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000519735;ENST00000520835	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.92	1.79	0.24919	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70439	0.3224	M	0.92412	3.305	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.984;0.999;1.0;0.997;1.0	T	0.79014	-0.1976	10	0.66056	D	0.02	.	14.8085	0.69977	0.4695:0.5305:0.0:0.0	.	161;218;171;220;220	B4E0U4;O14920-2;Q59GL9;O14920;Q32ND9	.;.;.;IKKB_HUMAN;.	W	220;161;220;218	ENSP00000430684:R220W;ENSP00000404920:R161W;ENSP00000430483:R220W;ENSP00000430868:R218W	ENSP00000404920:R161W	R	+	1	2	IKBKB	42285666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.493000	0.45320	0.533000	0.28675	0.563000	0.77884	CGG		0.627	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1			53	145	0	0	0	0.00361	0	53	145				
CHD7	55636	broad.mit.edu	37	8	61734601	61734601	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:61734601G>A	ENST00000423902.2	+	11	3333	c.2854G>A	c.(2854-2856)Gat>Aat	p.D952N	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000525508.1_Missense_Mutation_p.D952N	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	952					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TCCTGCTGATGATTGGAAGAA	0.388																																							uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(2854-2856)GAT>AAT		chromodomain helicase DNA binding protein 7							63.0	61.0	62.0					8																	61734601		1827	4083	5910	SO:0001583	missense	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61734601G>A	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.2854G>A	8.37:g.61734601G>A	ENSP00000392028:p.Asp952Asn		Somatic				CHD7_uc003xuf.2_Missense_Mutation_p.D65N	p.D952N	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		11	3331	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	952					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	c.2854G>A	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837041	0.50951	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000525508	D;D	0.93547	-3.24;-3.24	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.90143	0.6920	L	0.36672	1.1	0.58432	D	0.999992	B;B	0.21309	0.054;0.013	B;B	0.24394	0.052;0.053	D	0.85455	0.1163	10	0.17369	T	0.5	-16.5471	19.7999	0.96502	0.0:0.0:1.0:0.0	.	952;952	Q9P2D1-2;Q9P2D1	.;CHD7_HUMAN	N	952	ENSP00000392028:D952N;ENSP00000436027:D952N	ENSP00000307304:D952N	D	+	1	0	CHD7	61897155	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	4.724000	0.61972	2.751000	0.94390	0.650000	0.86243	GAT		0.388	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		12	42	0	0	0	0.001855	0	12	42				
CLVS1	157807	broad.mit.edu	37	8	62412051	62412051	+	Missense_Mutation	SNP	G	G	A	rs35623706	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:62412051G>A	ENST00000519846.1	+	7	1487	c.1015G>A	c.(1015-1017)Gag>Aag	p.E339K	CLVS1_ENST00000325897.4_Missense_Mutation_p.E339K|CLVS1_ENST00000518858.1_3'UTR|CLVS1_ENST00000518592.1_Missense_Mutation_p.E60K			Q8IUQ0	CLVS1_HUMAN	clavesin 1	339					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						CCTGAAACATGAGGAGAAGGG	0.498																																							uc003xuh.2		NA																	0				skin(4)|ovary(1)	5						c.(1015-1017)GAG>AAG		retinaldehyde binding protein 1-like 1							129.0	111.0	117.0					8																	62412051		2203	4300	6503	SO:0001583	missense	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62412051G>A	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.1015G>A	8.37:g.62412051G>A	ENSP00000428402:p.Glu339Lys		Somatic				CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Silent_p.*260*	p.E339K	NM_173519	NP_775790	WXS	Illumina HiSeq	Unspecified	Q8IUQ0	CLVS1_HUMAN			6	1339	+			339					B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	ENST00000519846.1	37	c.1015G>A	CCDS6176.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720970	0.30503	.	.	ENSG00000177182	ENST00000519846;ENST00000518592;ENST00000325897	T;T	0.79141	-1.24;-1.24	5.67	5.67	0.87782	.	0.123447	0.53938	D	0.000044	T	0.66015	0.2747	N	0.19112	0.55	0.51233	D	0.999918	B	0.27068	0.167	B	0.19148	0.024	T	0.60372	-0.7276	10	0.21014	T	0.42	-13.9372	20.1271	0.97986	0.0:0.0:1.0:0.0	.	339	Q8IUQ0	CLVS1_HUMAN	K	339;60;339	ENSP00000428402:E339K;ENSP00000325506:E339K	ENSP00000325506:E339K	E	+	1	0	CLVS1	62574605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.905000	0.63286	2.834000	0.97654	0.650000	0.86243	GAG		0.498	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		19	67	0	0	0	0.002299	0	19	67				
CYP7B1	9420	broad.mit.edu	37	8	65509386	65509386	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:65509386C>T	ENST00000310193.3	-	6	1507	c.1334G>A	c.(1333-1335)gGa>gAa	p.G445E	CYP7B1_ENST00000523954.1_Intron	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	445					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTTGCTGGTTCCAGTTCCAAA	0.323																																							uc003xvj.2		NA																	0				ovary(3)	3						c.(1333-1335)GGA>GAA		cytochrome P450, family 7, subfamily B,							63.0	64.0	63.0					8																	65509386		2203	4299	6502	SO:0001583	missense	9420				bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity	g.chr8:65509386C>T	AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.1334G>A	8.37:g.65509386C>T	ENSP00000310721:p.Gly445Glu		Somatic					p.G445E	NM_004820	NP_004811	WXS	Illumina HiSeq	Unspecified	O75881	CP7B1_HUMAN			6	1538	-		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)	445					B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	37	c.1334G>A	CCDS6180.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458957	0.84317	.	.	ENSG00000172817	ENST00000310193	D	0.98849	-5.18	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98652	1.0680	10	0.56958	D	0.05	-24.4743	19.5081	0.95127	0.0:1.0:0.0:0.0	.	445	O75881	CP7B1_HUMAN	E	445	ENSP00000310721:G445E	ENSP00000310721:G445E	G	-	2	0	CYP7B1	65671940	1.000000	0.71417	0.389000	0.26208	0.679000	0.39708	7.818000	0.86416	2.601000	0.87937	0.563000	0.77884	GGA		0.323	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1			15	33	0	0	0	0.00499	0	15	33				
TRPA1	8989	broad.mit.edu	37	8	72936057	72936057	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:72936057C>T	ENST00000262209.4	-	26	3348	c.3141G>A	c.(3139-3141)caG>caA	p.Q1047Q	RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000524152.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	1047					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ACCGGTATTTCTGCTTTAATA	0.259																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(3139-3141)CAG>CAA		ankyrin-like protein 1	Menthol(DB00825)						64.0	72.0	69.0					8																	72936057		2198	4295	6493	SO:0001819	synonymous_variant	8989					integral to plasma membrane		g.chr8:72936057C>T	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.3141G>A	8.37:g.72936057C>T			Somatic				uc011lff.1_Intron|uc003xyy.2_Intron	p.Q1047Q	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		26	3316	-			1047			Cytoplasmic (Potential).		A6NIN6	Silent	SNP	ENST00000262209.4	37	c.3141G>A	CCDS34908.1																																																																																				0.259	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		26	51	0	0	0	0.004656	0	26	51				
ZFHX4	79776	broad.mit.edu	37	8	77617343	77617343	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:77617343A>C	ENST00000521891.2	+	2	1468	c.1020A>C	c.(1018-1020)aaA>aaC	p.K340N	ZFHX4_ENST00000455469.2_Missense_Mutation_p.K340N|ZFHX4_ENST00000050961.6_Missense_Mutation_p.K340N|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.K340N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.K340N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACCAAAAAAATCCACTTCTG	0.433										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(1018-1020)AAA>AAC		zinc finger homeodomain 4							114.0	109.0	110.0					8																	77617343		1820	4088	5908	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77617343A>C		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1020A>C	8.37:g.77617343A>C	ENSP00000430497:p.Lys340Asn	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yat.1_Missense_Mutation_p.K340N|ZFHX4_uc003yau.1_Missense_Mutation_p.K340N|ZFHX4_uc003yaw.1_Missense_Mutation_p.K340N	p.K340N	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	1407	+			340					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.1020A>C	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	9.329	1.060108	0.19987	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49139	0.79;0.84;0.81;0.8	5.53	4.38	0.52667	.	0.000000	0.47455	U	0.000231	T	0.39200	0.1069	N	0.08118	0	0.54753	D	0.999988	P;D;D;B	0.55605	0.953;0.972;0.972;0.017	P;P;P;B	0.56398	0.631;0.691;0.797;0.008	T	0.18650	-1.0330	10	0.22706	T	0.39	.	11.5339	0.50626	0.9304:0.0:0.0696:0.0	.	340;340;340;340	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	N	340	ENSP00000430497:K340N;ENSP00000399605:K340N;ENSP00000050961:K340N;ENSP00000430848:K340N	ENSP00000050961:K340N	K	+	3	2	ZFHX4	77779898	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.511000	0.67024	1.109000	0.41680	0.533000	0.62120	AAA		0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		23	57	0	0	0	0.003954	0	23	57				
LRRCC1	85444	broad.mit.edu	37	8	86039068	86039068	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:86039068G>A	ENST00000360375.3	+	9	1566	c.1417G>A	c.(1417-1419)Gat>Aat	p.D473N	LRRCC1_ENST00000414626.2_Missense_Mutation_p.D453N	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	473					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						ACTTACCACAGATAGGTAAAA	0.338																																							uc003ycw.2		NA																	0					0						c.(1417-1419)GAT>AAT		sodium channel associated protein 2 isoform a							64.0	61.0	62.0					8																	86039068		1842	4081	5923	SO:0001583	missense	85444				cell division|mitosis	centriole|nucleus		g.chr8:86039068G>A	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1417G>A	8.37:g.86039068G>A	ENSP00000353538:p.Asp473Asn		Somatic				LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.D174N|LRRCC1_uc003ycx.2_Missense_Mutation_p.D380N|LRRCC1_uc003ycy.2_Missense_Mutation_p.D453N	p.D473N	NM_033402	NP_208325	WXS	Illumina HiSeq	Unspecified	Q9C099	LRCC1_HUMAN			9	1571	+			473			Potential.		B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	c.1417G>A	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	G	32	5.109773	0.94292	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.33865	1.39;1.39	5.56	5.56	0.83823	.	0.205821	0.24200	N	0.040628	T	0.58581	0.2132	M	0.66939	2.045	0.58432	D	0.999999	D;D;D;D	0.76494	0.992;0.999;0.992;0.982	P;D;P;P	0.71656	0.891;0.974;0.891;0.817	T	0.50398	-0.8833	10	0.25751	T	0.34	-17.2128	19.1212	0.93364	0.0:0.0:1.0:0.0	.	380;453;380;473	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	N	473;453	ENSP00000353538:D473N;ENSP00000394695:D453N	ENSP00000353538:D473N	D	+	1	0	LRRCC1	86226320	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	5.820000	0.69250	2.632000	0.89209	0.655000	0.94253	GAT		0.338	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402		20	44	0	0	0	0.010504	0	20	44				
KIAA1429	25962	broad.mit.edu	37	8	95541319	95541319	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:95541319C>T	ENST00000297591.5	-	7	934	c.859G>A	c.(859-861)Gaa>Aaa	p.E287K	KIAA1429_ENST00000437199.1_Missense_Mutation_p.E287K|KIAA1429_ENST00000421249.2_Missense_Mutation_p.E287K	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	287	Glu-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			tcatcctcttcaccttcttcc	0.418																																							uc003ygo.1		NA																	0				ovary(1)|skin(1)	2						c.(859-861)GAA>AAA		hypothetical protein LOC25962 isoform 1							420.0	344.0	370.0					8																	95541319		2203	4300	6503	SO:0001583	missense	25962				mRNA processing|RNA splicing	nucleus		g.chr8:95541319C>T	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.859G>A	8.37:g.95541319C>T	ENSP00000297591:p.Glu287Lys		Somatic				KIAA1429_uc003ygp.2_Missense_Mutation_p.E287K|KIAA1429_uc010maz.1_5'Flank	p.E287K	NM_015496	NP_056311	WXS	Illumina HiSeq	Unspecified	Q69YN4	VIR_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00185)		7	872	-	Breast(36;3.29e-05)		287			Glu-rich.		Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	c.859G>A	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371475	0.61624	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.44482	0.93;0.93;0.92	5.23	5.23	0.72850	.	0.543782	0.19830	N	0.105113	T	0.30696	0.0773	N	0.19112	0.55	0.46849	D	0.999222	P;P	0.36535	0.557;0.557	B;B	0.30646	0.118;0.118	T	0.15896	-1.0421	10	0.46703	T	0.11	-17.3624	19.1649	0.93553	0.0:1.0:0.0:0.0	.	287;287	Q69YN4-4;Q69YN4	.;VIR_HUMAN	K	287	ENSP00000297591:E287K;ENSP00000395600:E287K;ENSP00000398390:E287K	ENSP00000297591:E287K	E	-	1	0	KIAA1429	95610495	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.680000	0.68168	2.595000	0.87683	0.591000	0.81541	GAA		0.418	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496		9	29	0	0	0	0.008291	0	9	29				
INTS8	55656	broad.mit.edu	37	8	95884155	95884155	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:95884155G>C	ENST00000523731.1	+	21	2591	c.2458G>C	c.(2458-2460)Gag>Cag	p.E820Q	INTS8_ENST00000447247.1_Missense_Mutation_p.E820Q	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	820					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					CACAGTGAAAGAGCTAGTTCG	0.348																																							uc003yhb.2		NA																	0					0						c.(2458-2460)GAG>CAG		integrator complex subunit 8							117.0	109.0	112.0					8																	95884155		2203	4300	6503	SO:0001583	missense	55656				snRNA processing	integrator complex	protein binding	g.chr8:95884155G>C	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2458G>C	8.37:g.95884155G>C	ENSP00000430338:p.Glu820Gln		Somatic				INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Missense_Mutation_p.E647Q	p.E820Q	NM_017864	NP_060334	WXS	Illumina HiSeq	Unspecified	Q75QN2	INT8_HUMAN			21	2584	+	Breast(36;1.05e-06)		820					B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	37	c.2458G>C	CCDS34925.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.1|20.1	3.936620|3.936620	0.73442|0.73442	.|.	.|.	ENSG00000164941|ENSG00000164941	ENST00000523731;ENST00000447247|ENST00000520526	T;T|T	0.39406|0.34472	1.08;1.08|1.36	5.57|5.57	5.57|5.57	0.84162|0.84162	Tetratricopeptide-like helical (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.47619|0.47619	0.1455|0.1455	L|L	0.41824|0.41824	1.3|1.3	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	D|.	0.78314|.	0.991|.	T|T	0.20273|0.20273	-1.0280|-1.0280	10|7	0.21014|0.42905	T|T	0.42|0.14	-24.4912|-24.4912	19.918|19.918	0.97070|0.97070	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	820|.	Q75QN2|.	INT8_HUMAN|.	Q|N	820|641	ENSP00000430338:E820Q;ENSP00000398203:E820Q|ENSP00000430180:K641N	ENSP00000398203:E820Q|ENSP00000430180:K641N	E|K	+|+	1|3	0|2	INTS8|INTS8	95953331|95953331	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.992000|0.992000	0.81027|0.81027	9.399000|9.399000	0.97285|0.97285	2.785000|2.785000	0.95823|0.95823	0.591000|0.591000	0.81541|0.81541	GAG|AAG		0.348	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864		22	44	0	0	0	0.002299	0	22	44				
RSPO2	340419	broad.mit.edu	37	8	109001460	109001460	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:109001460G>A	ENST00000276659.5	-	3	727	c.107C>T	c.(106-108)tCa>tTa	p.S36L	RSPO2_ENST00000378439.2_Intron|RSPO2_ENST00000517781.1_Intron|RSPO2_ENST00000517939.1_5'UTR	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	36					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			AATGGGATTTGATACATAACT	0.353																																							uc003yms.2		NA																	0				skin(3)|ovary(2)|pancreas(1)|lung(1)	7						c.(106-108)TCA>TTA		R-spondin family, member 2 precursor							71.0	64.0	66.0					8																	109001460		2203	4300	6503	SO:0001583	missense	340419				Wnt receptor signaling pathway	extracellular region	heparin binding	g.chr8:109001460G>A	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.107C>T	8.37:g.109001460G>A	ENSP00000276659:p.Ser36Leu		Somatic				RSPO2_uc003ymq.2_5'UTR|RSPO2_uc003ymr.2_Intron	p.S36L	NM_178565	NP_848660	WXS	Illumina HiSeq	Unspecified	Q6UXX9	RSPO2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)		3	765	-			36					B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	c.107C>T	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210087	0.58343	.	.	ENSG00000147655	ENST00000276659;ENST00000521956;ENST00000520026;ENST00000522333	T;T;D;T	0.87412	-1.13;-1.13;-2.25;-1.13	5.05	5.05	0.67936	Growth factor, receptor (1);	0.358182	0.28016	N	0.016932	T	0.82070	0.4957	N	0.25789	0.76	0.80722	D	1	B	0.19200	0.034	B	0.17098	0.017	T	0.78076	-0.2345	10	0.59425	D	0.04	-0.7404	18.7722	0.91896	0.0:0.0:1.0:0.0	.	36	Q6UXX9	RSPO2_HUMAN	L	36;36;8;36	ENSP00000276659:S36L;ENSP00000430010:S36L;ENSP00000429159:S8L;ENSP00000430973:S36L	ENSP00000276659:S36L	S	-	2	0	RSPO2	109070636	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.116000	0.71571	2.511000	0.84671	0.563000	0.77884	TCA		0.353	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565		20	48	0	0	0	0.001882	0	20	48				
PKHD1L1	93035	broad.mit.edu	37	8	110397764	110397764	+	Splice_Site	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:110397764A>T	ENST00000378402.5	+	6	579		c.e6-1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTTTGTTTTCAGGTACACTAA	0.338										HNSCC(38;0.096)																													uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.e6-2		fibrocystin L precursor							47.0	46.0	46.0					8																	110397764		1799	4056	5855	SO:0001630	splice_region_variant	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110397764A>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.476-1A>T	8.37:g.110397764A>T		HNSCC(38;0.096)	Somatic					p.G159_splice	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		6	580	+								Q567P2|Q9UF27	Splice_Site	SNP	ENST00000378402.5	37	c.476_splice	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138922	0.77775	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.699	0.62597	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKHD1L1	110466940	1.000000	0.71417	0.939000	0.37840	0.961000	0.63080	6.635000	0.74295	2.129000	0.65627	0.454000	0.30748	.		0.338	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	Intron	4	16	0	0	0	0.000602	0	4	16				
ASAP1	50807	broad.mit.edu	37	8	131073214	131073214	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:131073214G>C	ENST00000518721.1	-	28	3030	c.2803C>G	c.(2803-2805)Cca>Gca	p.P935A	ASAP1_ENST00000357668.1_Missense_Mutation_p.P935A	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	935	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TCTCCAGGTGGTGGCTTTTGT	0.547																																							uc003yta.1		NA																	0				ovary(4)	4						c.(2803-2805)CCA>GCA		development and differentiation enhancing factor							96.0	112.0	107.0					8																	131073214		2203	4300	6503	SO:0001583	missense	50807				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr8:131073214G>C	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2803C>G	8.37:g.131073214G>C	ENSP00000429900:p.Pro935Ala		Somatic				ASAP1_uc003ysz.1_Missense_Mutation_p.P746A|ASAP1_uc011liw.1_Missense_Mutation_p.P928A	p.P935A	NM_018482	NP_060952	WXS	Illumina HiSeq	Unspecified	Q9ULH1	ASAP1_HUMAN			27	2831	-			935			Pro-rich.		B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	c.2803C>G	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.28|16.28	3.079541|3.079541	0.55753|0.55753	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721|ENST00000524124;ENST00000519483	T;T|.	0.06528|.	3.29;3.29|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	1.066500|.	0.07198|.	N|.	0.856886|.	T|T	0.60907|0.60907	0.2305|0.2305	L|L	0.38175|0.38175	1.15|1.15	0.46521|0.46521	D|D	0.999087|0.999087	B;B;B|.	0.26195|.	0.089;0.089;0.144|.	B;B;B|.	0.26094|.	0.049;0.049;0.066|.	T|T	0.55611|0.55611	-0.8114|-0.8114	10|5	0.31617|.	T|.	0.26|.	.|.	18.2478|18.2478	0.89992|0.89992	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	935;935;938|.	B2RNV3;Q9ULH1;Q9ULH1-2|.	.;ASAP1_HUMAN;.|.	A|S	938;935;935|755;291	ENSP00000350297:P935A;ENSP00000429900:P935A|.	ENSP00000344591:P938A|.	P|T	-|-	1|2	0|0	ASAP1|ASAP1	131142396|131142396	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	7.540000|7.540000	0.82074|0.82074	2.543000|2.543000	0.85770|0.85770	0.655000|0.655000	0.94253|0.94253	CCA|ACC		0.547	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		51	132	0	0	0	0.00361	0	51	132				
OC90	729330	broad.mit.edu	37	8	133053885	133053885	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:133053885G>A	ENST00000443356.2	-	5	317	c.231C>T	c.(229-231)atC>atT	p.I77I	OC90_ENST00000262283.5_Silent_p.I273I|OC90_ENST00000603859.1_Silent_p.I77I|OC90_ENST00000254627.3_Silent_p.I77I			Q02509	OC90_HUMAN	otoconin 90	77	Phospholipase A2-like 1.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			TGACAAACTGGATCAGCACAG	0.567																																							uc003ytg.2		NA																	0				ovary(2)|skin(1)	3						c.(181-183)ATC>ATT		otoconin 90							42.0	42.0	42.0					8																	133053885		2003	4186	6189	SO:0001819	synonymous_variant	729330				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity	g.chr8:133053885G>A	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.231C>T	8.37:g.133053885G>A			Somatic				OC90_uc011lix.1_Silent_p.I77I	p.I61I	NM_001080399	NP_001073868	WXS	Illumina HiSeq	Unspecified	Q02509	OC90_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)		3	183	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		77			Phospholipase A2-like 1.		B4DNG8	Silent	SNP	ENST00000443356.2	37	c.183C>T																																																																																					0.567	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399		14	37	0	0	0	0.001855	0	14	37				
COL22A1	169044	broad.mit.edu	37	8	139736904	139736904	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:139736904G>T	ENST00000303045.6	-	25	2647	c.2201C>A	c.(2200-2202)cCt>cAt	p.P734H	COL22A1_ENST00000341807.4_5'Flank|COL22A1_ENST00000435777.1_Missense_Mutation_p.P734H	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	734	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GATCTCTCCAGGCAAACCCTG	0.592										HNSCC(7;0.00092)																													uc003yvd.2		NA																	0				ovary(11)|pancreas(1)|skin(1)	13						c.(2200-2202)CCT>CAT		collagen, type XXII, alpha 1							75.0	60.0	65.0					8																	139736904		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139736904G>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2201C>A	8.37:g.139736904G>T	ENSP00000303153:p.Pro734His	HNSCC(7;0.00092)	Somatic				COL22A1_uc011ljo.1_Missense_Mutation_p.P34H	p.P734H	NM_152888	NP_690848	WXS	Illumina HiSeq	Unspecified	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		25	2648	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		734			Collagen-like 5.|Pro-rich.|Gly-rich.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.2201C>A	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849172	0.32699	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.96967	-4.19;-4.19	4.72	4.72	0.59763	.	0.320704	0.21975	U	0.066393	D	0.98340	0.9449	M	0.91663	3.23	0.50632	D	0.999883	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98931	1.0787	10	0.72032	D	0.01	.	13.9041	0.63823	0.0:0.0:1.0:0.0	.	734;734	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	H	734;734;447	ENSP00000303153:P734H;ENSP00000387655:P734H	ENSP00000303153:P734H	P	-	2	0	COL22A1	139806086	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.608000	0.61141	2.542000	0.85734	0.655000	0.94253	CCT		0.592	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		27	40	1	0	2.68265e-12	0.002836	3.08886e-12	27	40				
COL22A1	169044	broad.mit.edu	37	8	139839014	139839014	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:139839014G>A	ENST00000303045.6	-	6	1302	c.856C>T	c.(856-858)Ccc>Tcc	p.P286S	COL22A1_ENST00000435777.1_Missense_Mutation_p.P286S	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	286	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AAACCTTGGGGGAACACATCC	0.522										HNSCC(7;0.00092)																													uc003yvd.2		NA																	0				ovary(11)|pancreas(1)|skin(1)	13						c.(856-858)CCC>TCC		collagen, type XXII, alpha 1							84.0	70.0	75.0					8																	139839014		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139839014G>A	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.856C>T	8.37:g.139839014G>A	ENSP00000303153:p.Pro286Ser	HNSCC(7;0.00092)	Somatic					p.P286S	NM_152888	NP_690848	WXS	Illumina HiSeq	Unspecified	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		6	1303	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		286			TSP N-terminal.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.856C>T	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	18.99	3.740012	0.69304	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	T;T	0.30981	1.51;1.51	5.21	3.38	0.38709	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.130493	0.34700	N	0.003753	T	0.33556	0.0867	M	0.81614	2.55	0.53688	D	0.99997	B	0.09022	0.002	B	0.08055	0.003	T	0.10042	-1.0647	9	.	.	.	.	9.6272	0.39757	0.0748:0.0:0.7842:0.141	.	286	Q8NFW1	COMA1_HUMAN	S	286	ENSP00000303153:P286S;ENSP00000387655:P286S	.	P	-	1	0	COL22A1	139908196	1.000000	0.71417	0.422000	0.26621	0.890000	0.51754	4.538000	0.60650	0.571000	0.29365	0.644000	0.83932	CCC		0.522	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		11	30	0	0	0	0.008291	0	11	30				
KCNK9	51305	broad.mit.edu	37	8	140630669	140630669	+	Silent	SNP	G	G	A	rs140285421	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:140630669G>A	ENST00000520439.1	-	2	1020	c.957C>T	c.(955-957)agC>agT	p.S319S	KCNK9_ENST00000303015.1_Silent_p.S319S|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	319					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.S319S(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CAAGCTTGGCGCTGAAGGAGT	0.577																																							uc003yvf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)	3						c.(955-957)AGC>AGT		potassium channel, subfamily K, member 9		G		1,4405	2.1+/-5.4	0,1,2202	76.0	77.0	77.0		957	0.6	0.4	8	dbSNP_134	77	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	KCNK9	NM_016601.2		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		319/375	140630669	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	51305					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity	g.chr8:140630669G>A	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.957C>T	8.37:g.140630669G>A			Somatic				KCNK9_uc003yvg.1_Silent_p.S319S|KCNK9_uc003yve.1_RNA	p.S319S	NM_016601	NP_057685	WXS	Illumina HiSeq	Unspecified	Q9NPC2	KCNK9_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0855)		2	1021	-	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	319			Cytoplasmic (Potential).		Q2M290|Q540F2	Silent	SNP	ENST00000520439.1	37	c.957C>T	CCDS6377.1																																																																																				0.577	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601		31	67	0	0	0	0.003755	0	31	67				
DENND3	22898	broad.mit.edu	37	8	142178212	142178212	+	Silent	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:142178212G>A	ENST00000262585.2	+	13	1901	c.1623G>A	c.(1621-1623)ctG>ctA	p.L541L	DENND3_ENST00000424248.1_Silent_p.L489L|DENND3_ENST00000519811.1_Silent_p.L621L	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	541					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TCTCCATGCTGAGCGAGGCCA	0.557																																							uc003yvy.2		NA																	0				ovary(1)	1						c.(1621-1623)CTG>CTA		DENN/MADD domain containing 3							134.0	118.0	123.0					8																	142178212		2203	4300	6503	SO:0001819	synonymous_variant	22898							g.chr8:142178212G>A	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1623G>A	8.37:g.142178212G>A			Somatic				DENND3_uc010mep.2_Silent_p.L502L|DENND3_uc003yvz.1_Silent_p.L225L	p.L541L	NM_014957	NP_055772	WXS	Illumina HiSeq	Unspecified	A2RUS2	DEND3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.105)		13	1901	+	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		541					B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	c.1623G>A	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	G	0.839	-0.742513	0.03088	.	.	ENSG00000105339	ENST00000518668	.	.	.	5.56	3.73	0.42828	.	.	.	.	.	T	0.59404	0.2191	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56661	-0.7942	4	.	.	.	-14.2627	9.3693	0.38244	0.0822:0.4635:0.4543:0.0	.	.	.	.	K	546	.	.	E	+	1	0	DENND3	142247394	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	1.561000	0.36342	1.318000	0.45170	0.462000	0.41574	GAG		0.557	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957		46	110	0	0	0	0.00361	0	46	110				
DMRT3	58524	broad.mit.edu	37	9	977286	977286	+	Silent	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:977286A>G	ENST00000190165.2	+	1	323	c.285A>G	c.(283-285)ccA>ccG	p.P95P		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	95					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		GCGCTCTGCCAGGgcccccgc	0.781																																							uc003zgw.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(283-285)CCA>CCG		doublesex and mab-3 related transcription factor							8.0	8.0	8.0					9																	977286		2151	4214	6365	SO:0001819	synonymous_variant	58524				cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	g.chr9:977286A>G	AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.285A>G	9.37:g.977286A>G			Somatic					p.P95P	NM_021240	NP_067063	WXS	Illumina HiSeq	Unspecified	Q9NQL9	DMRT3_HUMAN		Lung(218;0.0196)	1	323	+		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)	95					Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Silent	SNP	ENST00000190165.2	37	c.285A>G	CCDS6443.1																																																																																				0.781	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051490.1	NM_021240		7	21	0	0	0	0.00308	0	7	21				
RCL1	10171	broad.mit.edu	37	9	4833225	4833225	+	Silent	SNP	G	G	A	rs189577327		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:4833225G>A	ENST00000381750.4	+	4	679	c.456G>A	c.(454-456)ctG>ctA	p.L152L		NM_005772.3	NP_005763.3	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1	152					ribosome biogenesis (GO:0042254)|RNA processing (GO:0006396)	nucleolus (GO:0005730)	catalytic activity (GO:0003824)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		CATTTGAACTGAAGGTAAGAA	0.373																																							uc003zis.2		NA																	0					0						c.(454-456)CTG>CTA		RNA terminal phosphate cyclase-like 1							166.0	157.0	160.0					9																	4833225		2203	4300	6503	SO:0001819	synonymous_variant	10171				ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity	g.chr9:4833225G>A	AJ276894	CCDS6456.1, CCDS69565.1, CCDS75810.1	9p24.1-p23	2008-02-05			ENSG00000120158	ENSG00000120158			17687	protein-coding gene	gene with protein product		611405					Standard	NM_001286701		Approved	RPCL1, RNAC	uc003zis.2	Q9Y2P8	OTTHUMG00000019474	ENST00000381750.4:c.456G>A	9.37:g.4833225G>A			Somatic				RCL1_uc003zit.2_5'UTR|RCL1_uc010mhk.1_5'UTR	p.L152L	NM_005772	NP_005763	WXS	Illumina HiSeq	Unspecified	Q9Y2P8	RCL1_HUMAN		GBM - Glioblastoma multiforme(50;0.0244)	4	714	+	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)	152					D3DRI2|Q5VYW9|Q5VZU1|Q9H9D0|Q9NY00|Q9P044	Silent	SNP	ENST00000381750.4	37	c.456G>A	CCDS6456.1																																																																																				0.373	RCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051587.1	NM_005772		17	84	0	0	0	0.002299	0	17	84				
RANBP6	26953	broad.mit.edu	37	9	6012838	6012838	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:6012838C>G	ENST00000259569.5	-	1	2780	c.2770G>C	c.(2770-2772)Gat>Cat	p.D924H	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	924					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GGGTTGTTATCTCGCATATTT	0.428																																							uc003zjr.2		NA																	0				ovary(3)	3						c.(2770-2772)GAT>CAT		RAN binding protein 6							68.0	62.0	64.0					9																	6012838		2203	4300	6503	SO:0001583	missense	26953				protein transport	cytoplasm|nucleus	binding	g.chr9:6012838C>G	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2770G>C	9.37:g.6012838C>G	ENSP00000259569:p.Asp924His		Somatic				RANBP6_uc011lmf.1_Missense_Mutation_p.D572H|RANBP6_uc003zjs.2_Missense_Mutation_p.D512H	p.D924H	NM_012416	NP_036548	WXS	Illumina HiSeq	Unspecified	O60518	RNBP6_HUMAN		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)	1	2781	-		Acute lymphoblastic leukemia(23;0.158)	924			HEAT 6.		Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	c.2770G>C	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446436	0.63178	.	.	ENSG00000137040	ENST00000259569	T	0.74737	-0.87	4.56	4.56	0.56223	Armadillo-like helical (1);Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	D	0.84534	0.5493	M	0.79258	2.445	0.80722	D	1	D;D;D	0.65815	0.995;0.985;0.985	P;P;D	0.68765	0.893;0.906;0.96	D	0.85394	0.1127	10	0.62326	D	0.03	-10.0492	13.1425	0.59442	0.0:1.0:0.0:0.0	.	91;512;924	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	H	924	ENSP00000259569:D924H	ENSP00000259569:D924H	D	-	1	0	RANBP6	6002838	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	3.303000	0.51858	2.820000	0.97059	0.650000	0.86243	GAT		0.428	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		12	44	0	0	0	0.001855	0	12	44				
ELAVL2	1993	broad.mit.edu	37	9	23731084	23731084	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:23731084G>T	ENST00000397312.2	-	3	543	c.269C>A	c.(268-270)cCc>cAc	p.P90H	ELAVL2_ENST00000223951.6_Missense_Mutation_p.P90H|ELAVL2_ENST00000544538.1_Missense_Mutation_p.P90H|ELAVL2_ENST00000380110.4_Missense_Mutation_p.P119H|ELAVL2_ENST00000380117.1_Missense_Mutation_p.P90H	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	90	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TGCATCCTTGGGGTCAATGTA	0.373																																							uc003zpu.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(268-270)CCC>CAC		ELAV (embryonic lethal, abnormal vision,							141.0	119.0	127.0					9																	23731084		2203	4299	6502	SO:0001583	missense	1993				regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding	g.chr9:23731084G>T	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.269C>A	9.37:g.23731084G>T	ENSP00000380479:p.Pro90His		Somatic				ELAVL2_uc003zps.2_Missense_Mutation_p.P90H|ELAVL2_uc003zpt.2_Missense_Mutation_p.P90H|ELAVL2_uc003zpv.2_Missense_Mutation_p.P90H|ELAVL2_uc003zpw.2_Missense_Mutation_p.P90H	p.P90H	NM_004432	NP_004423	WXS	Illumina HiSeq	Unspecified	Q12926	ELAV2_HUMAN		GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)	3	544	-			90			RRM 1.		D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	37	c.269C>A	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835641	0.71373	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000440102	T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39	5.87	5.87	0.94306	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.29491	0.0735	L	0.33093	0.98	0.80722	D	1	P;D	0.63046	0.899;0.992	P;P	0.58520	0.712;0.84	T	0.00130	-1.2014	10	0.37606	T	0.19	.	20.1777	0.98189	0.0:0.0:1.0:0.0	.	90;90	Q12926;Q12926-2	ELAV2_HUMAN;.	H	90;90;90;90;90;118;90	ENSP00000223951:P90H;ENSP00000380479:P90H;ENSP00000440998:P90H;ENSP00000369460:P90H;ENSP00000412602:P90H	ENSP00000223951:P90H	P	-	2	0	ELAVL2	23721084	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.398000	0.79919	2.941000	0.99782	0.655000	0.94253	CCC		0.373	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432		15	62	1	0	1.56452e-12	0.007413	1.80989e-12	15	62				
UBAP1	51271	broad.mit.edu	37	9	34241369	34241369	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:34241369C>G	ENST00000297661.4	+	4	581	c.346C>G	c.(346-348)Cct>Gct	p.P116A	UBAP1_ENST00000359544.2_Missense_Mutation_p.P116A|UBAP1_ENST00000545103.1_Missense_Mutation_p.P180A|UBAP1_ENST00000540348.1_Missense_Mutation_p.P116A|UBAP1_ENST00000536252.1_Missense_Mutation_p.P116A|UBAP1_ENST00000379186.4_Missense_Mutation_p.P116A|UBAP1_ENST00000543944.1_Missense_Mutation_p.P152A	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	116					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)			endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			AATGCCACCTCCTATTAACCC	0.512																																					NSCLC(109;1074 1634 14978 20375 39620)	NSCLC(109;1074 1634 14978 20375 39620)	uc003ztx.2		NA																	0					0						c.(346-348)CCT>GCT		ubiquitin associated protein 1							147.0	137.0	141.0					9																	34241369		2203	4300	6503	SO:0001583	missense	51271					cytoplasm		g.chr9:34241369C>G	AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.346C>G	9.37:g.34241369C>G	ENSP00000297661:p.Pro116Ala		Somatic				UBAP1_uc010mka.1_Missense_Mutation_p.P152A|UBAP1_uc003zty.2_Missense_Mutation_p.P116A|UBAP1_uc011loi.1_Missense_Mutation_p.P152A|UBAP1_uc011loj.1_Missense_Mutation_p.P180A|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Missense_Mutation_p.P116A	p.P116A	NM_016525	NP_057609	WXS	Illumina HiSeq	Unspecified	Q9NZ09	UBAP1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00272)		4	581	+			116					B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Missense_Mutation	SNP	ENST00000297661.4	37	c.346C>G	CCDS6550.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871562	0.33069	.	.	ENSG00000165006	ENST00000545103;ENST00000543944;ENST00000536252;ENST00000540348;ENST00000297661;ENST00000379186;ENST00000359544	T;T;T;T;T;T;T	0.46063	0.88;0.93;0.95;0.95;0.95;0.96;0.95	6.03	6.03	0.97812	.	0.048221	0.85682	D	0.000000	T	0.36552	0.0971	N	0.16903	0.455	0.52099	D	0.999941	P;P;P;P	0.46784	0.884;0.884;0.884;0.884	B;B;P;B	0.46253	0.292;0.292;0.509;0.292	T	0.03695	-1.1012	10	0.18276	T	0.48	-24.4094	20.5568	0.99304	0.0:1.0:0.0:0.0	.	180;152;180;116	F5GXE2;F5H0J8;B7Z8N9;Q9NZ09	.;.;.;UBAP1_HUMAN	A	180;152;116;116;116;116;116	ENSP00000441024:P180A;ENSP00000439806:P152A;ENSP00000440456:P116A;ENSP00000439976:P116A;ENSP00000297661:P116A;ENSP00000368484:P116A;ENSP00000352541:P116A	ENSP00000297661:P116A	P	+	1	0	UBAP1	34231369	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.027000	0.64109	2.861000	0.98227	0.655000	0.94253	CCT		0.512	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001084.1			33	88	0	0	0	0.005524	0	33	88				
UBAP1	51271	broad.mit.edu	37	9	34242063	34242063	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:34242063C>G	ENST00000297661.4	+	4	1275	c.1040C>G	c.(1039-1041)tCt>tGt	p.S347C	UBAP1_ENST00000359544.2_Missense_Mutation_p.S347C|UBAP1_ENST00000545103.1_Missense_Mutation_p.S411C|UBAP1_ENST00000540348.1_Missense_Mutation_p.S347C|UBAP1_ENST00000536252.1_Missense_Mutation_p.S347C|UBAP1_ENST00000379186.4_Missense_Mutation_p.S347C|UBAP1_ENST00000543944.1_Missense_Mutation_p.S383C	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	347					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)			endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			TCTGTTTTGTCTGTGTGCACA	0.498																																					NSCLC(109;1074 1634 14978 20375 39620)	NSCLC(109;1074 1634 14978 20375 39620)	uc003ztx.2		NA																	0					0						c.(1039-1041)TCT>TGT		ubiquitin associated protein 1							97.0	99.0	99.0					9																	34242063		2203	4300	6503	SO:0001583	missense	51271					cytoplasm		g.chr9:34242063C>G	AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.1040C>G	9.37:g.34242063C>G	ENSP00000297661:p.Ser347Cys		Somatic				UBAP1_uc010mka.1_Missense_Mutation_p.S383C|UBAP1_uc003zty.2_Missense_Mutation_p.S347C|UBAP1_uc011loi.1_Missense_Mutation_p.S383C|UBAP1_uc011loj.1_Missense_Mutation_p.S411C|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Missense_Mutation_p.S347C	p.S347C	NM_016525	NP_057609	WXS	Illumina HiSeq	Unspecified	Q9NZ09	UBAP1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00272)		4	1275	+			347					B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Missense_Mutation	SNP	ENST00000297661.4	37	c.1040C>G	CCDS6550.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007494	0.54361	.	.	ENSG00000165006	ENST00000545103;ENST00000543944;ENST00000536252;ENST00000540348;ENST00000297661;ENST00000379186;ENST00000359544	T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69	6.01	6.01	0.97437	.	0.526689	0.20781	N	0.085787	T	0.58821	0.2149	L	0.44542	1.39	0.40882	D	0.984006	D;D;D;D	0.76494	0.999;0.989;0.999;0.99	P;P;D;P	0.63192	0.794;0.818;0.912;0.723	T	0.56854	-0.7910	10	0.49607	T	0.09	-11.5279	14.6389	0.68708	0.0:0.9311:0.0:0.0689	.	411;383;411;347	F5GXE2;F5H0J8;B7Z8N9;Q9NZ09	.;.;.;UBAP1_HUMAN	C	411;383;347;347;347;347;347	ENSP00000441024:S411C;ENSP00000439806:S383C;ENSP00000440456:S347C;ENSP00000439976:S347C;ENSP00000297661:S347C;ENSP00000368484:S347C;ENSP00000352541:S347C	ENSP00000297661:S347C	S	+	2	0	UBAP1	34232063	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.813000	0.48002	2.852000	0.98041	0.643000	0.83706	TCT		0.498	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001084.1			46	137	0	0	0	0.00361	0	46	137				
TRPM3	80036	broad.mit.edu	37	9	73477941	73477941	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:73477941G>T	ENST00000377111.2	-	3	588	c.345C>A	c.(343-345)ctC>ctA	p.L115L	TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000423814.3_Silent_p.L117L|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000377110.3_Silent_p.L115L|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000357533.2_Silent_p.L117L|TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000377105.1_5'UTR|TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000377097.3_5'UTR	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	115					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CATTTCGGGAGAGGCGACTTT	0.507																																							uc004aid.2		NA																	0				ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(343-345)CTC>CTA		transient receptor potential cation channel,							147.0	156.0	153.0					9																	73477941		2203	4300	6503	SO:0001819	synonymous_variant	80036					integral to membrane	calcium channel activity	g.chr9:73477941G>T	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.345C>A	9.37:g.73477941G>T			Somatic				TRPM3_uc004ahw.2_5'UTR|TRPM3_uc004ahx.2_5'UTR|TRPM3_uc004ahy.2_5'UTR|TRPM3_uc004ahz.2_5'UTR|TRPM3_uc004aia.2_5'UTR|TRPM3_uc004aib.2_5'UTR|TRPM3_uc004aic.2_Silent_p.L115L|TRPM3_uc010mor.2_Silent_p.L115L|TRPM3_uc004aie.2_5'UTR|TRPM3_uc004aif.2_5'UTR|TRPM3_uc004aig.2_5'UTR|TRPM3_uc004aii.2_Silent_p.L117L	p.L115L	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			3	589	-			115			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37	c.345C>A		.	.	.	.	.	.	.	.	.	.	G	9.714	1.157906	0.21454	.	.	ENSG00000083067	ENST00000377097	.	.	.	5.95	3.12	0.35913	.	.	.	.	.	T	0.54679	0.1873	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45381	-0.9265	4	.	.	.	-11.465	6.3429	0.21332	0.2286:0.1337:0.6377:0.0	.	.	.	.	Y	5	.	.	S	-	2	0	TRPM3	72667761	0.981000	0.34729	1.000000	0.80357	0.998000	0.95712	0.148000	0.16224	0.405000	0.25532	0.655000	0.94253	TCT		0.507	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		31	76	1	0	1.02151e-06	0.002836	1.09664e-06	31	76				
GCNT1	2650	broad.mit.edu	37	9	79117682	79117682	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:79117682G>T	ENST00000376730.4	+	4	868	c.385G>T	c.(385-387)Gtt>Ttt	p.V129F	GCNT1_ENST00000444201.2_Missense_Mutation_p.V129F|GCNT1_ENST00000442371.1_Missense_Mutation_p.V129F|GCNT1_ENST00000536223.1_Missense_Mutation_p.V129F	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	Q02742	GCNT1_HUMAN	glucosaminyl (N-acetyl) transferase 1, core 2	129	Catalytic. {ECO:0000250}.				cell adhesion molecule production (GO:0060352)|cellular protein metabolic process (GO:0044267)|glycoprotein biosynthetic process (GO:0009101)|kidney morphogenesis (GO:0060993)|leukocyte tethering or rolling (GO:0050901)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to insulin (GO:0032868)|tissue morphogenesis (GO:0048729)	extracellular space (GO:0005615)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(11)|prostate(2)|urinary_tract(1)	30						TTCTATAGTGGTTCATCACAA	0.408																																							uc010mpf.2		NA																	0					0						c.(385-387)GTT>TTT		beta-1,3-galactosyl-O-glycosyl-glycoprotein							79.0	83.0	82.0					9																	79117682		2203	4300	6503	SO:0001583	missense	2650				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity	g.chr9:79117682G>T	L41415	CCDS6653.1	9q13	2013-02-25	2010-03-16		ENSG00000187210	ENSG00000187210	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4203	protein-coding gene	gene with protein product	"""core 2 beta1,6 N-acetylglucosaminyltransferase-I"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N--acetylglucosaminyltransferase"""	600391	"""glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""	NACGT2		8449405, 9915862	Standard	NM_001490		Approved	C2GNT, NAGCT2	uc004akf.4	Q02742	OTTHUMG00000020044	ENST00000376730.4:c.385G>T	9.37:g.79117682G>T	ENSP00000365920:p.Val129Phe		Somatic				GCNT1_uc010mpg.2_Missense_Mutation_p.V129F|GCNT1_uc010mph.2_Missense_Mutation_p.V129F|GCNT1_uc004akf.3_Missense_Mutation_p.V129F|GCNT1_uc010mpi.2_Missense_Mutation_p.V129F|GCNT1_uc004akh.3_Missense_Mutation_p.V129F	p.V129F	NM_001490	NP_001481	WXS	Illumina HiSeq	Unspecified	Q02742	GCNT1_HUMAN			3	726	+			129			Lumenal (Potential).|Catalytic (By similarity).		Q6DJZ4	Missense_Mutation	SNP	ENST00000376730.4	37	c.385G>T	CCDS6653.1	.	.	.	.	.	.	.	.	.	.	g	18.42	3.619710	0.66787	.	.	ENSG00000187210	ENST00000536223;ENST00000442371;ENST00000444201;ENST00000376730	T;T;T;T	0.15139	2.45;2.45;2.45;2.45	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.51346	0.1669	M	0.87617	2.895	0.42428	D	0.992661	D	0.89917	1.0	D	0.83275	0.996	T	0.52434	-0.8576	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	129	Q02742	GCNT1_HUMAN	F	129	ENSP00000440883:V129F;ENSP00000415454:V129F;ENSP00000390703:V129F;ENSP00000365920:V129F	.	V	+	1	0	GCNT1	78307502	0.927000	0.31430	0.997000	0.53966	0.988000	0.76386	2.079000	0.41577	2.885000	0.99019	0.655000	0.94253	GTT		0.408	GCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052725.1	NM_001097634		55	64	1	0	2.69953e-25	0.00361	3.41675e-25	55	64				
GKAP1	80318	broad.mit.edu	37	9	86368180	86368180	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:86368180T>G	ENST00000376371.2	-	9	1233	c.833A>C	c.(832-834)cAa>cCa	p.Q278P	GKAP1_ENST00000376365.3_Missense_Mutation_p.Q227P	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	278					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						AACCTCCCATTGAGTGATTAC	0.299																																							uc004amy.2		NA																	0					0						c.(832-834)CAA>CCA		G kinase anchoring protein 1 isoform a							160.0	158.0	158.0					9																	86368180		2203	4297	6500	SO:0001583	missense	80318				signal transduction	Golgi apparatus		g.chr9:86368180T>G	BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.833A>C	9.37:g.86368180T>G	ENSP00000365550:p.Gln278Pro		Somatic				GKAP1_uc004amz.2_Missense_Mutation_p.Q227P	p.Q278P	NM_025211	NP_079487	WXS	Illumina HiSeq	Unspecified	Q5VSY0	GKAP1_HUMAN			9	1329	-			278			Potential.		Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Missense_Mutation	SNP	ENST00000376371.2	37	c.833A>C	CCDS35049.1	.	.	.	.	.	.	.	.	.	.	T	19.91	3.913869	0.72983	.	.	ENSG00000165113	ENST00000376371;ENST00000376365	.	.	.	5.78	5.78	0.91487	.	0.100934	0.64402	D	0.000001	T	0.79240	0.4412	M	0.76838	2.35	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.91635	0.994;0.999	T	0.81621	-0.0850	9	0.66056	D	0.02	-15.6167	14.343	0.66641	0.0:0.0:0.0:1.0	.	227;278	Q5VSY0-2;Q5VSY0	.;GKAP1_HUMAN	P	278;227	.	ENSP00000365544:Q227P	Q	-	2	0	GKAP1	85558000	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	5.067000	0.64357	2.208000	0.71279	0.455000	0.32223	CAA		0.299	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052839.2	NM_025211		23	92	0	0	0	0.00333	0	23	92				
SPTLC1	10558	broad.mit.edu	37	9	94874764	94874764	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:94874764T>G	ENST00000262554.2	-	2	143	c.138A>C	c.(136-138)ttA>ttC	p.L46F	SPTLC1_ENST00000337841.4_Missense_Mutation_p.L46F|SPTLC1_ENST00000482632.1_5'UTR	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	46					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	ATCGTTCTTGTAATTTGTAAG	0.348																																							uc004arl.1		NA																	0				ovary(1)|breast(1)	2						c.(136-138)TTA>TTC		serine palmitoyltransferase subunit 1 isoform a	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)						98.0	100.0	100.0					9																	94874764		2203	4299	6502	SO:0001583	missense	10558					integral to membrane|SPOTS complex	protein binding|pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups	g.chr9:94874764T>G	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.138A>C	9.37:g.94874764T>G	ENSP00000262554:p.Leu46Phe		Somatic				SPTLC1_uc011ltv.1_Missense_Mutation_p.L46F|SPTLC1_uc004arm.1_Missense_Mutation_p.L46F|SPTLC1_uc004arn.1_Missense_Mutation_p.L46F	p.L46F	NM_006415	NP_006406	WXS	Illumina HiSeq	Unspecified	O15269	SPTC1_HUMAN			2	176	-			46			Cytoplasmic (Potential).		A8K681|Q5VWB4|Q96IX6	Missense_Mutation	SNP	ENST00000262554.2	37	c.138A>C	CCDS6692.1	.	.	.	.	.	.	.	.	.	.	T	6.679	0.493915	0.12702	.	.	ENSG00000090054	ENST00000262554;ENST00000337841	T;T	0.68903	-0.36;-0.36	4.55	1.03	0.20045	Pyridoxal phosphate-dependent transferase, major domain (1);	0.069243	0.56097	D	0.000026	T	0.45418	0.1341	L	0.34521	1.04	0.58432	D	0.999996	B;B;B;B	0.33755	0.016;0.424;0.046;0.016	B;B;B;B	0.27796	0.023;0.083;0.01;0.014	T	0.29852	-0.9998	10	0.54805	T	0.06	-13.5958	3.5987	0.08016	0.1812:0.3785:0.0:0.4403	.	46;46;41;46	Q6NUL7;Q96IX6;Q59EQ4;O15269	.;.;.;SPTC1_HUMAN	F	46	ENSP00000262554:L46F;ENSP00000337635:L46F	ENSP00000262554:L46F	L	-	3	2	SPTLC1	93914585	0.183000	0.23186	1.000000	0.80357	0.998000	0.95712	-0.749000	0.04813	0.364000	0.24374	0.528000	0.53228	TTA		0.348	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415		18	96	0	0	0	0.002299	0	18	96				
ECM2	1842	broad.mit.edu	37	9	95258649	95258649	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:95258649G>A	ENST00000344604.5	-	10	2197	c.2048C>T	c.(2047-2049)tCa>tTa	p.S683L	CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	683					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						TCTTATGCATGAAAATGTGTA	0.299																																							uc004ash.2		NA																	0				ovary(1)|skin(1)	2						c.(2047-2049)TCA>TTA		extracellular matrix protein 2 precursor							97.0	97.0	97.0					9																	95258649		2202	4299	6501	SO:0001583	missense	1842				cell-matrix adhesion		integrin binding	g.chr9:95258649G>A	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.2048C>T	9.37:g.95258649G>A	ENSP00000344758:p.Ser683Leu		Somatic				CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Intron|ECM2_uc011lty.1_Missense_Mutation_p.S683L|ECM2_uc004asg.2_Missense_Mutation_p.S661L|ECM2_uc010mqz.1_Missense_Mutation_p.S105L	p.S683L	NM_001393	NP_001384	WXS	Illumina HiSeq	Unspecified	O94769	ECM2_HUMAN			10	2113	-			683			LRR 13.		B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	ENST00000344604.5	37	c.2048C>T	CCDS6698.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622769	0.87460	.	.	ENSG00000106823	ENST00000344604	T	0.52754	0.65	5.44	4.54	0.55810	.	0.000000	0.64402	D	0.000003	T	0.58991	0.2161	M	0.64997	1.995	0.80722	D	1	D;P	0.67145	0.996;0.936	P;P	0.59221	0.854;0.573	T	0.62011	-0.6944	10	0.62326	D	0.03	.	10.6634	0.45714	0.1463:0.0:0.8537:0.0	.	683;661	O94769;B4DK93	ECM2_HUMAN;.	L	683	ENSP00000344758:S683L	ENSP00000344758:S683L	S	-	2	0	ECM2	94298470	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.001000	0.76297	1.448000	0.47680	0.655000	0.94253	TCA		0.299	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393		7	184	0	0	0	0.00308	0	7	184				
GABBR2	9568	broad.mit.edu	37	9	101304157	101304157	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:101304157C>T	ENST00000259455.2	-	3	1087	c.628G>A	c.(628-630)Gag>Aag	p.E210K	GABBR2_ENST00000477471.1_5'UTR	NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	210					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GAGCGTACCTCAGAGAACCTC	0.547																																							uc004ays.2		NA																	0				ovary(2)|skin(2)	4						c.(628-630)GAG>AAG		G protein-coupled receptor 51 precursor	Baclofen(DB00181)						149.0	105.0	120.0					9																	101304157		2203	4300	6503	SO:0001583	missense	9568				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr9:101304157C>T	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.628G>A	9.37:g.101304157C>T	ENSP00000259455:p.Glu210Lys		Somatic					p.E210K	NM_005458	NP_005449	WXS	Illumina HiSeq	Unspecified	O75899	GABR2_HUMAN			3	784	-		Acute lymphoblastic leukemia(62;0.0527)	210			Extracellular (Potential).		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	ENST00000259455.2	37	c.628G>A	CCDS6736.1	.	.	.	.	.	.	.	.	.	.	C	32	5.110183	0.94292	.	.	ENSG00000136928	ENST00000259455	D	0.83163	-1.69	5.09	5.09	0.68999	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.86564	0.5963	L	0.38531	1.155	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.85187	0.1007	10	0.34782	T	0.22	-20.202	16.3412	0.83082	0.0:1.0:0.0:0.0	.	210	O75899	GABR2_HUMAN	K	210	ENSP00000259455:E210K	ENSP00000259455:E210K	E	-	1	0	GABBR2	100343978	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	7.661000	0.83786	2.538000	0.85594	0.655000	0.94253	GAG		0.547	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1			15	41	0	0	0	0.00499	0	15	41				
TNC	3371	broad.mit.edu	37	9	117848184	117848184	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:117848184C>T	ENST00000350763.4	-	3	2237	c.1826G>A	c.(1825-1827)tGc>tAc	p.C609Y	TNC_ENST00000340094.3_Missense_Mutation_p.C609Y|TNC_ENST00000346706.3_Missense_Mutation_p.C609Y|TNC_ENST00000423613.2_Missense_Mutation_p.C609Y|TNC_ENST00000341037.4_Missense_Mutation_p.C609Y|TNC_ENST00000535648.1_Missense_Mutation_p.C609Y|TNC_ENST00000537320.1_Missense_Mutation_p.C609Y|TNC_ENST00000542877.1_Missense_Mutation_p.C609Y|TNC_ENST00000345230.3_Missense_Mutation_p.C609Y	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	609	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GTTGCAGATGCAGCGGCCCGA	0.597																																							uc004bjj.3		NA																	0				central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						c.(1825-1827)TGC>TAC		tenascin C precursor							52.0	46.0	48.0					9																	117848184		2203	4300	6503	SO:0001583	missense	3371				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding	g.chr9:117848184C>T		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1826G>A	9.37:g.117848184C>T	ENSP00000265131:p.Cys609Tyr		Somatic				TNC_uc010mvf.2_Missense_Mutation_p.C609Y	p.C609Y	NM_002160	NP_002151	WXS	Illumina HiSeq	Unspecified	P24821	TENA_HUMAN			3	2188	-			609			EGF-like 15.		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	c.1826G>A	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.988037	0.53934	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.89	5.89	0.94794	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);	0.082063	0.85682	D	0.000000	T	0.68641	0.3023	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80908	-0.1172	10	0.87932	D	0	.	14.4027	0.67060	0.0:0.9295:0.0:0.0705	.	609;609	E9PC84;P24821	.;TENA_HUMAN	Y	609	ENSP00000344400:C609Y;ENSP00000438152:C609Y;ENSP00000344555:C609Y;ENSP00000345861:C609Y;ENSP00000265131:C609Y;ENSP00000339553:C609Y;ENSP00000411406:C609Y;ENSP00000443478:C609Y;ENSP00000442242:C609Y	ENSP00000344400:C609Y	C	-	2	0	TNC	116888005	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	7.818000	0.86416	2.787000	0.95880	0.563000	0.77884	TGC		0.597	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160		50	14	0	0	0	0.00361	0	50	14				
CACFD1	11094	broad.mit.edu	37	9	136330483	136330483	+	Silent	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:136330483C>T	ENST00000316948.4	+	3	314	c.234C>T	c.(232-234)ttC>ttT	p.F78F	CACFD1_ENST00000489519.1_3'UTR|CACFD1_ENST00000540581.1_Silent_p.F78F|CACFD1_ENST00000291722.7_Intron|CACFD1_ENST00000542192.1_Intron	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	78					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)										AGGCGCCCTTCTGCTGCCAGT	0.602																																							uc011mdg.1		NA																	0					0						c.(232-234)TTC>TTT		hypothetical protein LOC11094 isoform a							138.0	125.0	129.0					9																	136330483		2203	4300	6503	SO:0001819	synonymous_variant	11094					integral to membrane		g.chr9:136330483C>T		CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.234C>T	9.37:g.136330483C>T			Somatic				C9orf7_uc004cec.2_Intron|C9orf7_uc011mdh.1_Silent_p.F78F|C9orf7_uc011mdi.1_Intron|C9orf7_uc010nan.2_RNA	p.F78F	NM_017586	NP_060056	WXS	Illumina HiSeq	Unspecified	Q9UGQ2	FLOWR_HUMAN		GBM - Glioblastoma multiforme(294;5.7e-39)|all cancers(34;1.83e-23)|OV - Ovarian serous cystadenocarcinoma(145;8.94e-08)|Epithelial(140;1.01e-06)	3	336	+			78			Helical; (Potential).		B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Silent	SNP	ENST00000316948.4	37	c.234C>T	CCDS6974.1																																																																																				0.602	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054915.1	NM_017586		297	73	0	0	0	0.00361	0	297	73				
OLFM1	10439	broad.mit.edu	37	9	138011958	138011958	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:138011958G>A	ENST00000371793.3	+	6	1643	c.1392G>A	c.(1390-1392)tgG>tgA	p.W464*	OLFM1_ENST00000252854.4_Nonsense_Mutation_p.W446*|OLFM1_ENST00000371796.3_Nonsense_Mutation_p.W437*	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	464	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		TGTATGCCTGGAACAACGGCC	0.562																																							uc010nar.2		NA																	0				ovary(1)|skin(1)	2						c.(1390-1392)TGG>TGA		olfactomedin related ER localized protein							123.0	109.0	114.0					9																	138011958		2203	4300	6503	SO:0001587	stop_gained	10439				nervous system development	endoplasmic reticulum lumen	protein binding	g.chr9:138011958G>A	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1392G>A	9.37:g.138011958G>A	ENSP00000360858:p.Trp464*		Somatic				OLFM1_uc004cfl.3_Nonsense_Mutation_p.W446*|OLFM1_uc004cfn.3_Nonsense_Mutation_p.W215*	p.W464*	NM_014279	NP_055094	WXS	Illumina HiSeq	Unspecified	Q99784	NOE1_HUMAN		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)	6	1708	+		Myeloproliferative disorder(178;0.0333)	464			Olfactomedin-like.		Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Nonsense_Mutation	SNP	ENST00000371793.3	37	c.1392G>A		.	.	.	.	.	.	.	.	.	.	G	37	6.206303	0.97376	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	.	.	.	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.166	0.89727	0.0:0.0:1.0:0.0	.	.	.	.	X	446;437;464	.	ENSP00000252854:W446X	W	+	3	0	OLFM1	137151779	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.535000	0.98064	2.296000	0.77279	0.561000	0.74099	TGG		0.562	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279		34	154	0	0	0	0.005524	0	34	154				
SOHLH1	402381	broad.mit.edu	37	9	138588565	138588565	+	Missense_Mutation	SNP	G	G	C	rs200147898	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr9:138588565G>C	ENST00000298466.5	-	5	614	c.554C>G	c.(553-555)gCg>gGg	p.A185G	SOHLH1_ENST00000425225.1_Missense_Mutation_p.A185G	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	185					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CCTGGAGGACGCAAGGATGTG	0.657																																							uc004cgl.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(553-555)GCG>GGG		spermatogenesis and oogenesis specific basic							56.0	55.0	56.0					9																	138588565		2203	4300	6503	SO:0001583	missense	402381				cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr9:138588565G>C	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.554C>G	9.37:g.138588565G>C	ENSP00000298466:p.Ala185Gly		Somatic				SOHLH1_uc010nbe.2_Missense_Mutation_p.A185G	p.A185G	NM_001012415	NP_001012415	WXS	Illumina HiSeq	Unspecified	Q5JUK2	SOLH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)	5	615	-		Myeloproliferative disorder(178;0.0511)	185					C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	ENST00000298466.5	37	c.554C>G	CCDS35174.1	.	.	.	.	.	.	.	.	.	.	G	5.531	0.282870	0.10458	.	.	ENSG00000165643	ENST00000298466;ENST00000425225	T;T	0.37752	1.18;1.22	1.95	-3.9	0.04181	.	.	.	.	.	T	0.20577	0.0495	L	0.29908	0.895	0.09310	N	1	B;B	0.19200	0.023;0.034	B;B	0.22880	0.042;0.026	T	0.19031	-1.0318	9	0.28530	T	0.3	.	4.2143	0.10526	0.5048:0.0:0.3341:0.1611	.	185;185	Q5JUK2-2;Q5JUK2	.;SOLH1_HUMAN	G	185	ENSP00000298466:A185G;ENSP00000404438:A185G	ENSP00000298466:A185G	A	-	2	0	SOHLH1	137728386	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.529000	0.02223	-1.788000	0.01266	-0.981000	0.02577	GCG		0.657	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415		99	24	0	0	0	0.00361	0	99	24				
XG	7499	broad.mit.edu	37	X	2712605	2712605	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:2712605G>A	ENST00000381174.5	+	6	508	c.283G>A	c.(283-285)Gga>Aga	p.G95R	XG_ENST00000426774.1_Missense_Mutation_p.G96R|XG_ENST00000419513.2_Missense_Mutation_p.G95R			P55808	XG_HUMAN	Xg blood group	95						integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CCGTGATGACGGACGCTACCC	0.612																																							uc011mhg.1		NA																	0				ovary(1)	1						c.(283-285)GGA>AGA		XG glycoprotein isoform 1 precursor							54.0	44.0	47.0					X																	2712605		2203	4298	6501	SO:0001583	missense	7499					integral to membrane|plasma membrane		g.chrX:2712605G>A	AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.283G>A	X.37:g.2712605G>A	ENSP00000370566:p.Gly95Arg		Somatic				XG_uc004cqp.2_Missense_Mutation_p.G95R	p.G95R	NM_175569	NP_780778	WXS	Illumina HiSeq	Unspecified	P55808	XG_HUMAN			6	506	+		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	95			Extracellular (Potential).		E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	c.283G>A	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	g	10.17	1.277952	0.23307	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	2.06	2.06	0.26882	.	0.479254	0.13562	U	0.378750	T	0.44767	0.1309	M	0.72894	2.215	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.09640	-1.0665	10	0.51188	T	0.08	.	7.0989	0.25325	0.0:0.0:1.0:0.0	.	95;95	P55808;P55808-3	XG_HUMAN;.	R	95;95;96;73	ENSP00000370566:G95R;ENSP00000411004:G95R;ENSP00000398503:G96R;ENSP00000430005:G73R	ENSP00000370566:G95R	G	+	1	0	XG	2722605	0.041000	0.20044	0.110000	0.21437	0.011000	0.07611	0.774000	0.26675	1.359000	0.45940	0.591000	0.81541	GGA		0.612	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569		7	8	0	0	0	0.006214	0	7	8				
RAI2	10742	broad.mit.edu	37	X	17820121	17820121	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:17820121G>C	ENST00000545871.1	-	3	470	c.10C>G	c.(10-12)Ctg>Gtg	p.L4V	RAI2_ENST00000360011.1_Missense_Mutation_p.L4V|RAI2_ENST00000451717.1_Missense_Mutation_p.L4V|RAI2_ENST00000331511.1_Missense_Mutation_p.L4V|RAI2_ENST00000415486.3_Missense_Mutation_p.L4V	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	4					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					TGGGACTGCAGGTCGTCCATC	0.488																																							uc004cyf.2		NA																	0				ovary(1)|breast(1)	2						c.(10-12)CTG>GTG		retinoic acid induced 2							112.0	104.0	106.0					X																	17820121		2203	4300	6503	SO:0001583	missense	10742				embryo development			g.chrX:17820121G>C	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.10C>G	X.37:g.17820121G>C	ENSP00000444210:p.Leu4Val		Somatic				RAI2_uc004cyg.2_Missense_Mutation_p.L4V|RAI2_uc010nfa.2_Missense_Mutation_p.L4V|RAI2_uc004cyh.3_Missense_Mutation_p.L4V|RAI2_uc011miy.1_Missense_Mutation_p.L4V	p.L4V	NM_021785	NP_068557	WXS	Illumina HiSeq	Unspecified	Q9Y5P3	RAI2_HUMAN			3	580	-	Hepatocellular(33;0.183)		4					B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	c.10C>G	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	G	6.908	0.537026	0.13188	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.36520	1.34;1.34;1.34;1.34;1.25	5.6	3.51	0.40186	.	0.444437	0.19771	N	0.106430	T	0.43366	0.1244	N	0.24115	0.695	0.25490	N	0.987657	D;D	0.67145	0.996;0.996	D;D	0.80764	0.994;0.994	T	0.22836	-1.0205	10	0.87932	D	0	-15.7094	10.9338	0.47233	0.1785:0.0:0.8215:0.0	.	4;4	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	V	4	ENSP00000333456:L4V;ENSP00000353106:L4V;ENSP00000444210:L4V;ENSP00000401323:L4V;ENSP00000392578:L4V	ENSP00000333456:L4V	L	-	1	2	RAI2	17730042	0.999000	0.42202	0.772000	0.31596	0.505000	0.33919	2.420000	0.44679	1.150000	0.42419	0.529000	0.55759	CTG		0.488	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785		79	38	0	0	0	0.00361	0	79	38				
EIF1AX	1964	broad.mit.edu	37	X	20153879	20153879	+	Missense_Mutation	SNP	T	T	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:20153879T>G	ENST00000379607.5	-	3	384	c.181A>C	c.(181-183)Atc>Ctc	p.I61L	EIF1AX_ENST00000379593.1_Missense_Mutation_p.I33L|snoU2-30_ENST00000365012.1_RNA|snoU2_19_ENST00000364722.1_RNA	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	61	S1-like.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						TTTCCTCTGATGTGACATAAC	0.378																																							uc004czt.2		NA																	0				ovary(1)	1						c.(181-183)ATC>CTC		X-linked eukaryotic translation initiation							155.0	137.0	143.0					X																	20153879		2203	4300	6503	SO:0001583	missense	1964					cytosol	translation initiation factor activity	g.chrX:20153879T>G	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.181A>C	X.37:g.20153879T>G	ENSP00000368927:p.Ile61Leu		Somatic					p.I61L	NM_001412	NP_001403	WXS	Illumina HiSeq	Unspecified	P47813	IF1AX_HUMAN			3	389	-			61			S1-like.		B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	ENST00000379607.5	37	c.181A>C	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.736268	0.89482	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.52057	0.68;0.68	5.47	5.47	0.80525	Translation initiation factor 1A (eIF-1A), conserved site (1);Nucleic acid-binding, OB-fold-like (1);RNA-binding domain, S1, IF1 type (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.78972	0.4368	M	0.92026	3.265	0.80722	D	1	B	0.28605	0.217	P	0.62491	0.903	T	0.80070	-0.1536	9	0.62326	D	0.03	-11.3375	14.6214	0.68588	0.0:0.0:0.0:1.0	.	61	P47813	IF1AX_HUMAN	L	61;33	ENSP00000368927:I61L;ENSP00000368912:I33L	ENSP00000368912:I33L	I	-	1	0	EIF1AX	20063800	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.646000	0.83445	1.833000	0.53350	0.486000	0.48141	ATC		0.378	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1			45	25	0	0	0	0.00361	0	45	25				
CNKSR2	22866	broad.mit.edu	37	X	21627461	21627461	+	Silent	SNP	G	G	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:21627461G>T	ENST00000379510.3	+	20	2454	c.2418G>T	c.(2416-2418)cgG>cgT	p.R806R	CNKSR2_ENST00000543067.1_Silent_p.R757R|CNKSR2_ENST00000425654.2_Silent_p.R776R|CNKSR2_ENST00000279451.4_Silent_p.R806R	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	806					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AGCACAGGCGGCAGTCTACCC	0.547																																							uc004czx.1		NA																	0				large_intestine(1)|lung(1)	2						c.(2416-2418)CGG>CGT		connector enhancer of kinase suppressor of Ras							63.0	59.0	61.0					X																	21627461		2203	4300	6503	SO:0001819	synonymous_variant	22866				regulation of signal transduction	cytoplasm|membrane	protein binding	g.chrX:21627461G>T	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2418G>T	X.37:g.21627461G>T			Somatic				CNKSR2_uc004czw.2_Silent_p.R806R|CNKSR2_uc011mjn.1_Silent_p.R757R|CNKSR2_uc011mjo.1_Silent_p.R776R|CNKSR2_uc004czy.2_Silent_p.R398R	p.R806R	NM_014927	NP_055742	WXS	Illumina HiSeq	Unspecified	Q8WXI2	CNKR2_HUMAN			20	2454	+			806					B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	ENST00000379510.3	37	c.2418G>T	CCDS14198.1																																																																																				0.547	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927		32	16	1	0	8.16721e-17	0.002096	9.84658e-17	32	16				
POLA1	5422	broad.mit.edu	37	X	24766437	24766437	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:24766437C>G	ENST00000379059.3	+	25	2698	c.2683C>G	c.(2683-2685)Caa>Gaa	p.Q895E	POLA1_ENST00000379068.3_Missense_Mutation_p.Q901E	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	895					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GGATGGAGAACAAGAACAGAT	0.393																																							uc004dbl.2		NA																	0				ovary(2)|skin(1)	3						c.(2683-2685)CAA>GAA		DNA-directed DNA polymerase alpha 1	Clofarabine(DB00631)|Fludarabine(DB01073)						87.0	74.0	78.0					X																	24766437		2203	4300	6503	SO:0001583	missense	5422				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding	g.chrX:24766437C>G		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2683C>G	X.37:g.24766437C>G	ENSP00000368349:p.Gln895Glu		Somatic					p.Q895E	NM_016937	NP_058633	WXS	Illumina HiSeq	Unspecified	P09884	DPOLA_HUMAN			25	2706	+			895					Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	c.2683C>G	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	C	0.211	-1.036714	0.02013	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.15834	2.39;2.39	4.96	4.07	0.47477	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.403835	0.24630	N	0.036887	T	0.04815	0.0130	N	0.00754	-1.215	0.42057	D	0.991144	B	0.02656	0.0	B	0.06405	0.002	T	0.30119	-0.9989	10	0.02654	T	1	-4.849	13.5408	0.61672	0.0:0.6315:0.3685:0.0	.	895	P09884	DPOLA_HUMAN	E	901;895	ENSP00000368358:Q901E;ENSP00000368349:Q895E	ENSP00000368349:Q895E	Q	+	1	0	POLA1	24676358	0.930000	0.31532	1.000000	0.80357	0.864000	0.49448	0.812000	0.27211	1.177000	0.42855	0.600000	0.82982	CAA		0.393	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937		12	5	0	0	0	0.00245	0	12	5				
CDK16	5127	broad.mit.edu	37	X	47086599	47086599	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:47086599G>A	ENST00000357227.4	+	13	1685	c.1261G>A	c.(1261-1263)Gac>Aac	p.D421N	CDK16_ENST00000518022.1_Missense_Mutation_p.D421N|CDK16_ENST00000457458.2_Missense_Mutation_p.D427N|CDK16_ENST00000276052.6_Missense_Mutation_p.D495N	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	421	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)	p.D421N(1)|p.D495N(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						CGACGGGGCCGACCTCCTCAC	0.582																																							uc004dho.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(1261-1263)GAC>AAC		PCTAIRE protein kinase 1 isoform 1							49.0	45.0	47.0					X																	47086599		2203	4300	6503	SO:0001583	missense	5127						ATP binding|cyclin-dependent protein kinase activity|protein binding	g.chrX:47086599G>A		CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.1261G>A	X.37:g.47086599G>A	ENSP00000349762:p.Asp421Asn		Somatic				CDK16_uc011mli.1_Missense_Mutation_p.D427N|CDK16_uc011mlk.1_Missense_Mutation_p.D428N|CDK16_uc011mll.1_Missense_Mutation_p.D495N	p.D421N	NM_006201	NP_006192	WXS	Illumina HiSeq	Unspecified	Q00536	CDK16_HUMAN			13	1657	+			421			Protein kinase.		A8K280|B7Z7C8|J3KN74|J3KQP7	Missense_Mutation	SNP	ENST00000357227.4	37	c.1261G>A	CCDS14276.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.03|12.03	1.816493|1.816493	0.32145|0.32145	.|.	.|.	ENSG00000102225|ENSG00000102225	ENST00000457458;ENST00000357227;ENST00000540877;ENST00000540311;ENST00000518022;ENST00000276052;ENST00000523344|ENST00000520141;ENST00000462827	T;T;T;T;T|.	0.53206|.	0.63;0.63;0.63;0.63;0.63|.	5.49|5.49	4.63|4.63	0.57726|0.57726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.102198|.	0.64402|.	D|.	0.000004|.	T|T	0.62514|0.62514	0.2434|0.2434	M|M	0.64080|0.64080	1.96|1.96	0.49582|0.49582	D|D	0.999804|0.999804	B;B;B|.	0.32731|.	0.026;0.382;0.014|.	B;B;B|.	0.28849|.	0.017;0.095;0.011|.	T|T	0.60747|0.60747	-0.7202|-0.7202	10|5	0.48119|.	T|.	0.1|.	-18.4372|-18.4372	8.9259|8.9259	0.35641|0.35641	0.178:0.0:0.822:0.0|0.178:0.0:0.822:0.0	.|.	495;526;421|.	B7Z7C8;B7Z8T0;Q00536|.	.;.;CDK16_HUMAN|.	N|Q	427;421;526;373;421;495;185|7	ENSP00000405798:D427N;ENSP00000349762:D421N;ENSP00000429751:D421N;ENSP00000276052:D495N;ENSP00000428349:D185N|.	ENSP00000276052:D495N|.	D|R	+|+	1|2	0|0	CDK16|CDK16	46971543|46971543	0.995000|0.995000	0.38212|0.38212	0.994000|0.994000	0.49952|0.49952	0.702000|0.702000	0.40608|0.40608	3.192000|3.192000	0.50989|0.50989	1.199000|1.199000	0.43173|0.43173	0.529000|0.529000	0.55759|0.55759	GAC|CGA		0.582	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056406.2	NM_006201		9	7	0	0	0	0.001855	0	9	7				
ZNF157	7712	broad.mit.edu	37	X	47271817	47271817	+	Silent	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:47271817C>G	ENST00000377073.3	+	4	431	c.345C>G	c.(343-345)ctC>ctG	p.L115L		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	115					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						ATAATGCCCTCAGGCATGATA	0.393																																							uc004dhr.1		NA																	0					0						c.(343-345)CTC>CTG		zinc finger protein 157							119.0	101.0	107.0					X																	47271817		2203	4300	6503	SO:0001819	synonymous_variant	7712				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47271817C>G	U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.345C>G	X.37:g.47271817C>G			Somatic					p.L115L	NM_003446	NP_003437	WXS	Illumina HiSeq	Unspecified	P51786	ZN157_HUMAN			4	414	+			115					Q96LE9	Silent	SNP	ENST00000377073.3	37	c.345C>G	CCDS14278.1																																																																																				0.393	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056415.1	NM_003446		34	20	0	0	0	0.004878	0	34	20				
XAGE3	170626	broad.mit.edu	37	X	52896082	52896082	+	Splice_Site	SNP	A	A	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:52896082A>T	ENST00000346279.3	-	2	152		c.e2+1		XAGE3_ENST00000375491.3_Splice_Site	NM_133179.2	NP_573440.1	Q8WTP9	XAGE3_HUMAN	X antigen family, member 3											kidney(1)|large_intestine(1)|lung(2)	4						TAAGGCACTCACCAGCATAGG	0.398																																							uc004dre.2		NA																	0					0						c.e2+1		XAGE-3 protein							153.0	121.0	132.0					X																	52896082		2203	4300	6503	SO:0001630	splice_region_variant	170626							g.chrX:52896082A>T	BG354572	CCDS14347.1	Xp11.22	2010-09-27	2004-06-07	2005-01-27	ENSG00000171402	ENSG00000171402			14618	protein-coding gene	gene with protein product	"""cancer/testis antigen family 12, member 3a"", ""cancer/testis antigen family 12, member 3b"""	300740	"""placenta-specific 6; G antigen, family D, 4"""	PLAC6, GAGED4			Standard	NM_133179		Approved	XAGE-3, pp9012, CT12.3a, CT12.3b	uc004dre.3	Q8WTP9	OTTHUMG00000021587	ENST00000346279.3:c.81+1T>A	X.37:g.52896082A>T			Somatic				XAGE3_uc004drf.2_Splice_Site_p.L27_splice	p.L27_splice	NM_130776	NP_570132	WXS	Illumina HiSeq	Unspecified	Q8WTP9	GAGD4_HUMAN			2	141	-								Q5JS82|Q8WYS9	Splice_Site	SNP	ENST00000346279.3	37	c.81_splice	CCDS14347.1	.	.	.	.	.	.	.	.	.	.	.	3.481	-0.105942	0.06924	.	.	ENSG00000171402	ENST00000375491;ENST00000346279	.	.	.	1.29	1.29	0.21616	.	.	.	.	.	.	.	.	.	.	.	0.24162	N	0.99566	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3645	0.11218	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	XAGE3	52912807	0.077000	0.21312	0.125000	0.21846	0.019000	0.09904	1.029000	0.30140	0.766000	0.33244	0.345000	0.21793	.		0.398	XAGE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056686.1	NM_133179	Intron	27	16	0	0	0	0.00632	0	27	16				
ZC3H12B	340554	broad.mit.edu	37	X	64709193	64709193	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:64709193G>A	ENST00000338957.4	+	1	579	c.512G>A	c.(511-513)aGa>aAa	p.R171K	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.R160K	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	171							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCCAGCTCCAGAGAGATTGCA	0.438																																							uc010nko.2		NA																	0				lung(1)|kidney(1)|pancreas(1)	3						c.(478-480)AGA>AAA		zinc finger CCCH-type containing 12B							70.0	67.0	68.0					X																	64709193		1921	4114	6035	SO:0001583	missense	340554						endonuclease activity|nucleic acid binding|zinc ion binding	g.chrX:64709193G>A	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.512G>A	X.37:g.64709193G>A	ENSP00000340839:p.Arg171Lys		Somatic					p.R160K	NM_001010888	NP_001010888	WXS	Illumina HiSeq	Unspecified	Q5HYM0	ZC12B_HUMAN			1	488	+			160					B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	c.479G>A	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	G	1.102	-0.660947	0.03454	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.20881	2.04;2.04	5.15	1.41	0.22369	.	0.302605	0.38164	N	0.001782	T	0.06005	0.0156	N	0.03608	-0.345	0.23174	N	0.998172	B	0.02656	0.0	B	0.01281	0.0	T	0.38950	-0.9637	10	0.05959	T	0.93	-4.6425	4.5548	0.12131	0.4299:0.1562:0.4139:0.0	.	160	Q5HYM0	ZC12B_HUMAN	K	171;160;107	ENSP00000340839:R171K;ENSP00000408077:R160K	ENSP00000218172:R107K	R	+	2	0	ZC3H12B	64625918	1.000000	0.71417	0.068000	0.19968	0.881000	0.50899	4.718000	0.61930	-0.033000	0.13736	-0.518000	0.04402	AGA		0.438	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334		33	9	0	0	0	0.004289	0	33	9				
OTUD6A	139562	broad.mit.edu	37	X	69282948	69282948	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:69282948C>A	ENST00000338352.2	+	1	608	c.574C>A	c.(574-576)Ccc>Acc	p.P192T		NM_207320.1	NP_997203.1	Q7L8S5	OTU6A_HUMAN	OTU deubiquitinase 6A	192	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)		ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(3)|urinary_tract(1)	23						CTTCAGCAACCCCGAGACCAG	0.612																																							uc004dxu.1		NA																	0				lung(1)|skin(1)	2						c.(574-576)CCC>ACC		OTU domain containing 6A							66.0	57.0	60.0					X																	69282948		2203	4300	6503	SO:0001583	missense	139562							g.chrX:69282948C>A	AK098697	CCDS14395.1	Xq13.1	2014-02-24	2014-02-24			ENSG00000189401		"""OTU domain containing"""	32312	protein-coding gene	gene with protein product		300714	"""OTU domain containing 6A"""			23827681	Standard	NM_207320		Approved	FLJ25831, HSHIN6, DUBA2	uc004dxu.1	Q7L8S5		ENST00000338352.2:c.574C>A	X.37:g.69282948C>A	ENSP00000339389:p.Pro192Thr		Somatic					p.P192T	NM_207320	NP_997203	WXS	Illumina HiSeq	Unspecified	Q7L8S5	OTU6A_HUMAN			1	608	+			192			OTU.		B2RPB7	Missense_Mutation	SNP	ENST00000338352.2	37	c.574C>A	CCDS14395.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073231	0.36566	.	.	ENSG00000189401	ENST00000338352	T	0.44482	0.92	4.15	-0.699	0.11277	Ovarian tumour, otubain (2);	0.315064	0.34777	N	0.003687	T	0.33962	0.0881	L	0.47716	1.5	0.09310	N	0.99999	B	0.33528	0.416	B	0.42386	0.386	T	0.25572	-1.0128	10	0.23302	T	0.38	.	4.9424	0.13973	0.0:0.352:0.1575:0.4905	.	192	Q7L8S5	OTU6A_HUMAN	T	192	ENSP00000339389:P192T	ENSP00000339389:P192T	P	+	1	0	OTUD6A	69199673	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	0.092000	0.15066	-0.308000	0.08792	-0.853000	0.03031	CCC		0.612	OTUD6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358763.1	NM_207320		20	9	1	0	6.44725e-10	0.002299	7.25052e-10	20	9				
CDX4	1046	broad.mit.edu	37	X	72667226	72667226	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:72667226C>A	ENST00000373514.2	+	1	137	c.137C>A	c.(136-138)gCg>gAg	p.A46E		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	46					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					AATTTCGCTGCGGCACCGGCT	0.647																																							uc011mqk.1		NA																	0					0						c.(136-138)GCG>GAG		caudal type homeobox 4							41.0	37.0	38.0					X																	72667226		2203	4300	6503	SO:0001583	missense	1046					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:72667226C>A	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.137C>A	X.37:g.72667226C>A	ENSP00000362613:p.Ala46Glu		Somatic					p.A46E	NM_005193	NP_005184	WXS	Illumina HiSeq	Unspecified	O14627	CDX4_HUMAN			1	137	+	Renal(35;0.156)		46					A1A513|Q5JS20	Missense_Mutation	SNP	ENST00000373514.2	37	c.137C>A	CCDS14424.1	.	.	.	.	.	.	.	.	.	.	.	5.190	0.220661	0.09863	.	.	ENSG00000131264	ENST00000373514	T	0.48201	0.82	2.57	1.69	0.24217	Caudal-like activation domain (1);	0.315565	0.30630	N	0.009220	T	0.48169	0.1485	M	0.65498	2.005	0.23834	N	0.996713	B	0.32245	0.361	B	0.39339	0.297	T	0.44667	-0.9313	10	0.49607	T	0.09	-4.2406	9.9804	0.41811	0.0:0.8693:0.0:0.1307	.	46	O14627	CDX4_HUMAN	E	46	ENSP00000362613:A46E	ENSP00000362613:A46E	A	+	2	0	CDX4	72583951	0.988000	0.35896	0.003000	0.11579	0.005000	0.04900	4.335000	0.59298	0.078000	0.16900	-1.701000	0.00721	GCG		0.647	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193		11	5	1	0	0.00244969	0.00245	0.00252705	11	5				
PBDC1	51260	broad.mit.edu	37	X	75396725	75396725	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:75396725C>G	ENST00000373358.3	+	5	510	c.307C>G	c.(307-309)Cca>Gca	p.P103A	PBDC1_ENST00000373357.3_Intron	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	103																	GAAGTGGAGGCCATTCTGCTT	0.438																																							uc004ecl.1		NA																	0					0						c.(307-309)CCA>GCA		hypothetical protein LOC51260							198.0	158.0	171.0					X																	75396725		2203	4300	6503	SO:0001583	missense	51260							g.chrX:75396725C>G	BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.307C>G	X.37:g.75396725C>G	ENSP00000362456:p.Pro103Ala		Somatic					p.P103A	NM_016500	NP_057584	WXS	Illumina HiSeq	Unspecified	Q9BVG4	CX026_HUMAN			5	510	+			103						Missense_Mutation	SNP	ENST00000373358.3	37	c.307C>G	CCDS14432.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.982099	0.53827	.	.	ENSG00000102390	ENST00000373358	.	.	.	4.94	4.94	0.65067	Yst0336-like domain (1);	0.104933	0.64402	D	0.000003	T	0.60625	0.2283	L	0.45352	1.415	0.80722	D	1	D	0.53885	0.963	P	0.52957	0.714	T	0.59354	-0.7470	9	0.38643	T	0.18	-3.244	14.6924	0.69096	0.0:1.0:0.0:0.0	.	103	Q9BVG4	CX026_HUMAN	A	103	.	ENSP00000362456:P103A	P	+	1	0	CXorf26	75313128	0.990000	0.36364	0.988000	0.46212	0.971000	0.66376	3.015000	0.49599	2.440000	0.82611	0.529000	0.55759	CCA		0.438	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500		32	12	0	0	0	0.005524	0	32	12				
ATRX	546	broad.mit.edu	37	X	76972666	76972666	+	Silent	SNP	T	T	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:76972666T>A	ENST00000373344.5	-	2	289	c.75A>T	c.(73-75)tcA>tcT	p.S25S	ATRX_ENST00000395603.3_Silent_p.S25S|ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000373341.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	25					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATTCTTCTGATGAGTGTGCAA	0.343			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(73-75)TCA>TCT		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						172.0	159.0	163.0					X																	76972666		2203	4296	6499	SO:0001819	synonymous_variant	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76972666T>A	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.75A>T	X.37:g.76972666T>A			Somatic				ATRX_uc004ecq.3_Silent_p.S25S|ATRX_uc004eco.3_5'UTR|ATRX_uc004ecr.2_Silent_p.S25S|ATRX_uc010nlx.1_Silent_p.S25S|ATRX_uc010nly.1_Intron	p.S25S	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			2	307	-			25					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	37	c.75A>T	CCDS14434.1																																																																																				0.343	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		49	24	0	0	0	0.00361	0	49	24				
ZNF711	7552	broad.mit.edu	37	X	84526329	84526329	+	Missense_Mutation	SNP	A	A	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:84526329A>G	ENST00000373165.3	+	9	2087	c.1781A>G	c.(1780-1782)cAt>cGt	p.H594R	ZNF711_ENST00000276123.3_Missense_Mutation_p.H594R|ZNF711_ENST00000360700.4_Missense_Mutation_p.H640R|ZNF711_ENST00000395402.1_Missense_Mutation_p.H602R|ZNF711_ENST00000542798.1_Missense_Mutation_p.H436R	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	594					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						CAGTGTCCTCATTGTGACCAT	0.433																																							uc004eeo.2		NA																	0				ovary(3)|skin(1)	4						c.(1780-1782)CAT>CGT		zinc finger protein 711							82.0	64.0	70.0					X																	84526329		2203	4300	6503	SO:0001583	missense	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84526329A>G	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1781A>G	X.37:g.84526329A>G	ENSP00000362260:p.His594Arg		Somatic				ZNF711_uc004eep.2_Missense_Mutation_p.H594R|ZNF711_uc004eeq.2_Missense_Mutation_p.H640R|ZNF711_uc011mqy.1_Missense_Mutation_p.H193R	p.H594R	NM_021998	NP_068838	WXS	Illumina HiSeq	Unspecified	Q9Y462	ZN711_HUMAN			9	2128	+			594			C2H2-type 7.		B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	c.1781A>G	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	A	17.06	3.292164	0.59976	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45	5.3	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.45126	D	0.000391	T	0.38692	0.1050	M	0.64080	1.96	0.58432	D	0.999999	D;P	0.58970	0.984;0.948	D;P	0.69479	0.964;0.748	T	0.19516	-1.0303	10	0.87932	D	0	-12.114	14.3815	0.66914	1.0:0.0:0.0:0.0	.	640;594	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	R	602;594;594;640;436	ENSP00000378798:H602R;ENSP00000362260:H594R;ENSP00000276123:H594R;ENSP00000353922:H640R;ENSP00000442071:H436R	ENSP00000276123:H594R	H	+	2	0	ZNF711	84412985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	1.775000	0.52247	0.417000	0.27973	CAT		0.433	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		6	2	0	0	0	0.001984	0	6	2				
AGTR2	186	broad.mit.edu	37	X	115304135	115304135	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:115304135C>T	ENST00000371906.4	+	3	792	c.602C>T	c.(601-603)cCt>cTt	p.P201L		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	201					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	GCTTTCCCACCTGAGAAATAT	0.378																																							uc004eqh.3		NA																	0				ovary(2)|lung(1)	3						c.(601-603)CCT>CTT		angiotensin II receptor, type 2							120.0	107.0	111.0					X																	115304135		2203	4300	6503	SO:0001583	missense	186				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity	g.chrX:115304135C>T	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.602C>T	X.37:g.115304135C>T	ENSP00000360973:p.Pro201Leu		Somatic					p.P201L	NM_000686	NP_000677	WXS	Illumina HiSeq	Unspecified	P50052	AGTR2_HUMAN			3	809	+			201			Extracellular (Potential).		B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	c.602C>T	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	C	9.673	1.147165	0.21288	.	.	ENSG00000180772	ENST00000371906	T	0.36520	1.25	4.78	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.320971	0.31415	N	0.007693	T	0.22475	0.0542	L	0.33137	0.985	0.43714	D	0.996188	B	0.18461	0.028	B	0.26094	0.066	T	0.07693	-1.0759	10	0.23302	T	0.38	-8.6632	2.7154	0.05186	0.1895:0.5265:0.1807:0.1034	.	201	P50052	AGTR2_HUMAN	L	201	ENSP00000360973:P201L	ENSP00000360973:P201L	P	+	2	0	AGTR2	115218163	0.017000	0.18338	0.994000	0.49952	0.933000	0.57130	2.762000	0.47597	0.432000	0.26286	0.506000	0.49869	CCT		0.378	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686		30	23	0	0	0	0.003755	0	30	23				
AMELY	266	broad.mit.edu	37	Y	6736332	6736332	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrY:6736332G>A	ENST00000383036.1	-	5	360	c.361C>T	c.(361-363)Cag>Tag	p.Q121*	AMELY_ENST00000383037.4_Nonsense_Mutation_p.Q121*|AMELY_ENST00000215479.5_Nonsense_Mutation_p.Q107*			Q99218	AMELY_HUMAN	amelogenin, Y-linked	121	Gln-rich.				biomineral tissue development (GO:0031214)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	structural constituent of tooth enamel (GO:0030345)			NS(1)|lung(5)	6						ATGGATTGCTGGCCAGGAACA	0.632																																							uc004fra.1		NA																	0					0						c.(361-363)CAG>TAG		amelogenin, Y-linked precursor																																				SO:0001587	stop_gained	266				biomineral tissue development	proteinaceous extracellular matrix	structural constituent of tooth enamel	g.chrY:6736332G>A	M86933	CCDS14778.1	Yp11.2	2004-12-07	2003-09-12		ENSG00000099721	ENSG00000099721			462	protein-coding gene	gene with protein product		410000	"""amelogenin (Y chromosome)"""	AMGL		2004775	Standard	NM_001143		Approved		uc004fqz.3	Q99218	OTTHUMG00000035297	ENST00000383036.1:c.361C>T	Y.37:g.6736332G>A	ENSP00000372505:p.Gln121*		Somatic				AMELY_uc004fqz.2_Nonsense_Mutation_p.Q107*	p.Q121*	NM_001143	NP_001134	WXS	Illumina HiSeq	Unspecified	Q99218	AMELY_HUMAN			5	373	-			121			Gln-rich.		Q6RWT1	Nonsense_Mutation	SNP	ENST00000383036.1	37	c.361C>T	CCDS14778.1	.	.	.	.	.	.	.	.	.	.	.	4.357	0.065679	0.08388	.	.	ENSG00000099721	ENST00000383036;ENST00000383037	.	.	.	1.35	1.35	0.21983	.	0.244366	0.28977	N	0.013535	.	.	.	.	.	.	0.58432	A	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	0.005	.	.	.	.	.	.	.	X	121	.	.	Q	-	1	0	AMELY	6796332	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	4.405000	0.59741	1.063000	0.40649	0.184000	0.17185	CAG		0.632	AMELY-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000100214.1	NM_001143		53	20	0	0	0	0.00361	0	53	20				
TMCO2	127391	broad.mit.edu	37	1	40713748	40713749	+	Frame_Shift_Ins	INS	-	-	T			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:40713748_40713749insT	ENST00000372766.3	+	1	176_177	c.83_84insT	c.(82-87)agttttfs	p.SF28fs	TMCO2_ENST00000468258.1_Intron	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	28						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			ATACAAGCAAGTTTTTTGGGAG	0.406																																							uc001cfe.2		NA																	0				ovary(1)	1						c.(82-84)AGTfs		transmembrane and coiled-coil domains 2																																				SO:0001589	frameshift_variant	127391					integral to membrane		g.chr1:40713748_40713749insT	AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.89dupT	1.37:g.40713754_40713754dupT	ENSP00000361852:p.Ser28fs		Somatic					p.S28fs	NM_001008740	NP_001008740	WXS	Illumina HiSeq	Unspecified	Q7Z6W1	TMCO2_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)		1	176_177	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	28						Frame_Shift_Ins	INS	ENST00000372766.3	37	c.83_84insT	CCDS30684.1																																																																																				0.406	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015769.1	NM_001008740		54	233	NA	NA	NA	NA	NA	54	233	---	---	---	---
ASPM	259266	broad.mit.edu	37	1	197057405	197057405	+	Frame_Shift_Del	DEL	T	T	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:197057405delT	ENST00000367409.4	-	26	10398	c.10142delA	c.(10141-10143)aagfs	p.K3381fs	ASPM_ENST00000294732.7_Frame_Shift_Del_p.K1796fs|ASPM_ENST00000367408.1_Frame_Shift_Del_p.K1046fs	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3381					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATTTGTTGTCTTCAGTAAAAT	0.338																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(10141-10143)AAGfs		asp (abnormal spindle)-like, microcephaly							71.0	75.0	74.0					1																	197057405		2201	4299	6500	SO:0001589	frameshift_variant	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197057405delT	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.10142delA	1.37:g.197057405delT	ENSP00000356379:p.Lys3381fs		Somatic				ASPM_uc001gtv.2_Frame_Shift_Del_p.K1796fs|ASPM_uc001gtw.3_Frame_Shift_Del_p.K1229fs	p.K3381fs	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			26	10399	-			3381					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Frame_Shift_Del	DEL	ENST00000367409.4	37	c.10142delA	CCDS1389.1																																																																																				0.338	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		94	79	NA	NA	NA	NA	NA	94	79	---	---	---	---
MIR205HG	642587	broad.mit.edu	37	1	209603810	209603810	+	lincRNA	DEL	C	C	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr1:209603810delC	ENST00000384891.1	+	0	0					NR_029622.1				MIR205 host gene (non-protein coding)																		AGGGTACGGACCCCACATGAG	0.522																																							uc009xcn.2		NA																	0					0						c.(151-153)ACCfs		hypothetical protein LOC642587							129.0	126.0	127.0					1																	209603810		1915	4136	6051			642587							g.chr1:209603810delC			1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209603810delC			Somatic				LOC642587_uc010psk.1_5'Flank|MIR205_hsa-mir-205|MI0000285_5'Flank	p.T51fs	NM_001104548	NP_001098018	WXS	Illumina HiSeq	Unspecified				OV - Ovarian serous cystadenocarcinoma(81;0.0422)	3	535	+									Frame_Shift_Del	DEL	ENST00000384891.1	37	c.152delC																																																																																					0.522	MIR205HG-202	KNOWN	basic	miRNA	lincRNA				75	133	NA	NA	NA	NA	NA	75	133	---	---	---	---
CUEDC2	79004	broad.mit.edu	37	10	104184914	104184915	+	Frame_Shift_Ins	INS	-	-	G			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr10:104184914_104184915insG	ENST00000369937.4	-	2	176_177	c.31_32insC	c.(31-33)ctcfs	p.L11fs	CUEDC2_ENST00000465409.1_5'Flank	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2	11						cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AAAGGCAAGGAGGGCTGCACTG	0.639																																							uc001kvn.2		NA																	0					0						c.(31-33)CTCfs		CUE domain containing 2																																				SO:0001589	frameshift_variant	79004					cytoplasm|nucleus	protein binding	g.chr10:104184914_104184915insG	BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.32dupC	10.37:g.104184917_104184917dupG	ENSP00000358953:p.Leu11fs		Somatic				CUEDC2_uc001kvm.2_5'Flank	p.L11fs	NM_024040	NP_076945	WXS	Illumina HiSeq	Unspecified	Q9H467	CUED2_HUMAN		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	2	182_183	-		Colorectal(252;0.122)	11					D3DR88|Q9BWG8	Frame_Shift_Ins	INS	ENST00000369937.4	37	c.31_32insC	CCDS41566.1																																																																																				0.639	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050060.1	NM_024040		33	77	NA	NA	NA	NA	NA	33	77	---	---	---	---
RB1	5925	broad.mit.edu	37	13	48934258	48934259	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr13:48934258_48934259insA	ENST00000267163.4	+	7	851_852	c.713_714insA	c.(712-717)ccatatfs	p.Y239fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	239					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(6)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTCAAAGAACCATATAGTAAGT	0.356		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		21	Whole gene deletion(15)|Unknown(6)	p.?(5)	bone(11)|breast(5)|eye(1)|soft_tissue(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358						c.(712-714)CCAfs		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)																																			SO:0001589	frameshift_variant	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:48934258_48934259insA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.714dupA	13.37:g.48934259_48934259dupA	ENSP00000267163:p.Tyr239fs	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)	Somatic				RB1_uc010acs.1_RNA|RB1_uc010act.1_5'UTR	p.P238fs	NM_000321	NP_000312	WXS	Illumina HiSeq	Unspecified	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	7	879_880	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)	238					A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Ins	INS	ENST00000267163.4	37	c.713_714insA	CCDS31973.1																																																																																				0.356	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			12	37	NA	NA	NA	NA	NA	12	37	---	---	---	---
FAM179B	23116	broad.mit.edu	37	14	45481238	45481238	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr14:45481238delG	ENST00000361577.3	+	7	3412	c.3198delG	c.(3196-3198)aagfs	p.K1068fs	FAM179B_ENST00000361462.2_Frame_Shift_Del_p.K1068fs|FAM179B_ENST00000382233.2_Frame_Shift_Del_p.E989fs|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1068	Ser-rich.									endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTTCTGCAAAGAAAAAAATTT	0.284																																							uc001wvv.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(3196-3198)AAGfs		hypothetical protein LOC23116							54.0	57.0	56.0					14																	45481238		2201	4299	6500	SO:0001589	frameshift_variant	23116						binding	g.chr14:45481238delG	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3198delG	14.37:g.45481238delG	ENSP00000355045:p.Lys1068fs		Somatic				FAM179B_uc001wvw.2_Frame_Shift_Del_p.K1066fs|FAM179B_uc010anc.2_RNA	p.K1066fs	NM_015091	NP_055906	WXS	Illumina HiSeq	Unspecified	Q9Y4F4	F179B_HUMAN			7	3407	+			1066			Ser-rich.		Q68D66|Q6PG27	Frame_Shift_Del	DEL	ENST00000361577.3	37	c.3198delG	CCDS9681.1																																																																																				0.284	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		8	89	NA	NA	NA	NA	NA	8	89	---	---	---	---
CERS3	204219	broad.mit.edu	37	15	101031128	101031129	+	Frame_Shift_Ins	INS	-	-	C			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr15:101031128_101031129insC	ENST00000394113.1	-	6	871_872	c.181_182insG	c.(181-183)gctfs	p.A61fs	CERS3_ENST00000538112.2_Frame_Shift_Ins_p.A61fs|CERS3_ENST00000284382.4_Frame_Shift_Ins_p.A61fs|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	61					ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TAGAGGTGAAGCAACAAATCTA	0.322																																						NSCLC(135;1149 2482 10680 49908)	uc002bvz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(181-183)GCTfs		LAG1 longevity assurance homolog 3																																				SO:0001589	frameshift_variant	204219					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity	g.chr15:101031128_101031129insC		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.182dupG	15.37:g.101031129_101031129dupC	ENSP00000377672:p.Ala61fs		Somatic				LASS3_uc002bwa.2_Frame_Shift_Ins_p.A72fs|LASS3_uc002bwb.2_Frame_Shift_Ins_p.A61fs	p.A61fs	NM_178842	NP_849164	WXS	Illumina HiSeq	Unspecified	Q8IU89	CERS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)		5	683_684	-	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		61					Q8NE64|Q8NEN6	Frame_Shift_Ins	INS	ENST00000394113.1	37	c.181_182insG	CCDS10384.1																																																																																				0.322	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842		22	41	NA	NA	NA	NA	NA	22	41	---	---	---	---
CCT8L2	150160	broad.mit.edu	37	22	17072854	17072854	+	Frame_Shift_Del	DEL	C	C	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr22:17072854delC	ENST00000359963.3	-	1	846	c.587delG	c.(586-588)ggcfs	p.G196fs		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	196					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTTGAAGCTGCCGTCTAGTTC	0.612																																							uc002zlp.1		NA																	0				ovary(1)	1						c.(586-588)GGCfs		T-complex protein 1							67.0	65.0	65.0					22																	17072854		2203	4300	6503	SO:0001589	frameshift_variant	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072854delC	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.587delG	22.37:g.17072854delC	ENSP00000353048:p.Gly196fs		Somatic					p.G196fs	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	847	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	196					A4QPH3|Q9UJS3	Frame_Shift_Del	DEL	ENST00000359963.3	37	c.587delG	CCDS13738.1																																																																																				0.612	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			105	55	NA	NA	NA	NA	NA	105	55	---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118623578	118623579	+	Frame_Shift_Ins	INS	-	-	A			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:118623578_118623579insA	ENST00000393775.2	-	6	1075_1076	c.770_771insT	c.(769-771)tgcfs	p.C257fs	IGSF11_ENST00000489689.1_Frame_Shift_Ins_p.C233fs|IGSF11_ENST00000425327.2_Frame_Shift_Ins_p.C256fs|IGSF11_ENST00000354673.2_Frame_Shift_Ins_p.C256fs|IGSF11_ENST00000491903.1_Intron|IGSF11_ENST00000441144.2_Frame_Shift_Ins_p.C232fs	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	257					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C256fs*17(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTAGTGCAATGCAAAAAATGAT	0.342																																							uc003ebw.2		NA																	1	Insertion - Frameshift(1)		prostate(1)		0						c.(769-771)TGCfs		immunoglobulin superfamily, member 11 isoform b																																				SO:0001589	frameshift_variant	152404				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity	g.chr3:118623578_118623579insA	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.770_771insT	3.37:g.118623578_118623579insA	ENSP00000377370:p.Cys257fs		Somatic				IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Frame_Shift_Ins_p.C233fs|IGSF11_uc003eby.2_Frame_Shift_Ins_p.C256fs|IGSF11_uc003ebz.2_Frame_Shift_Ins_p.C232fs|IGSF11_uc010hqs.2_Frame_Shift_Ins_p.C256fs	p.C257fs	NM_001015887	NP_001015887	WXS	Illumina HiSeq	Unspecified	Q5DX21	IGS11_HUMAN			6	1017_1018	-			257			Helical; (Potential).		C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Frame_Shift_Ins	INS	ENST00000393775.2	37	c.770_771insT	CCDS46891.1																																																																																				0.342	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2			129	180	NA	NA	NA	NA	NA	129	180	---	---	---	---
MED12L	116931	broad.mit.edu	37	3	151148114	151148116	+	In_Frame_Del	DEL	CAG	CAG	-	rs147600909		TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr3:151148114_151148116delCAG	ENST00000474524.1	+	42	6369_6371	c.6331_6333delCAG	c.(6331-6333)cagdel	p.Q2115del	MED12L_ENST00000273432.4_In_Frame_Del_p.Q1779del	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2115	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q2111E(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCAGCAGACCCAGCAGCAGCAGC	0.527																																							uc003eyp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(6331-6333)CAGdel		mediator of RNA polymerase II transcription,																																				SO:0001651	inframe_deletion	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:151148114_151148116delCAG	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6331_6333delCAG	3.37:g.151148123_151148125delCAG	ENSP00000417235:p.Gln2115del		Somatic				MED12L_uc011bnz.1_In_Frame_Del_p.Q1779del	p.Q2115del	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		42	6369_6371	+			2115			Gln-rich.		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	In_Frame_Del	DEL	ENST00000474524.1	37	c.6331_6333delCAG	CCDS33876.1																																																																																				0.527	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		7	142	NA	NA	NA	NA	NA	7	142	---	---	---	---
BEND4	389206	broad.mit.edu	37	4	42122225	42122225	+	Frame_Shift_Del	DEL	C	C	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:42122225delC	ENST00000502486.1	-	5	1812	c.1233delG	c.(1231-1233)gggfs	p.G411fs	BEND4_ENST00000504360.1_Frame_Shift_Del_p.G407fs	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	411	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						GGAGCCGTCTCCCATCTTTCT	0.458																																							uc003gwn.2		NA																	0					0						c.(1231-1233)GGGfs		BEN domain containing 4 isoform a							118.0	119.0	118.0					4																	42122225		1929	4142	6071	SO:0001589	frameshift_variant	389206							g.chr4:42122225delC	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.1233delG	4.37:g.42122225delC	ENSP00000421169:p.Gly411fs		Somatic				BEND4_uc003gwm.2_Frame_Shift_Del_p.G411fs|BEND4_uc011byy.1_Frame_Shift_Del_p.G411fs	p.G411fs	NM_207406	NP_997289	WXS	Illumina HiSeq	Unspecified	Q6ZU67	BEND4_HUMAN			5	1813	-			411			BEN.		A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Frame_Shift_Del	DEL	ENST00000502486.1	37	c.1233delG	CCDS47048.1																																																																																				0.458	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406		25	41	NA	NA	NA	NA	NA	25	41	---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62897312	62897312	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr4:62897312delG	ENST00000514591.1	+	22	3700	c.3371delG	c.(3370-3372)tgtfs	p.C1124fs	LPHN3_ENST00000506700.1_Frame_Shift_Del_p.C1115fs|LPHN3_ENST00000512091.2_Frame_Shift_Del_p.C1124fs|LPHN3_ENST00000504896.1_Frame_Shift_Del_p.C1124fs|LPHN3_ENST00000506720.1_Frame_Shift_Del_p.C1192fs|LPHN3_ENST00000545650.1_Frame_Shift_Del_p.C1124fs|LPHN3_ENST00000514996.1_Frame_Shift_Del_p.C1115fs|LPHN3_ENST00000514157.1_Frame_Shift_Del_p.C1115fs|LPHN3_ENST00000507625.1_Frame_Shift_Del_p.C1183fs|LPHN3_ENST00000506746.1_Frame_Shift_Del_p.C1183fs|LPHN3_ENST00000509896.1_Frame_Shift_Del_p.C1192fs|LPHN3_ENST00000508946.1_Frame_Shift_Del_p.C1124fs|LPHN3_ENST00000511324.1_Frame_Shift_Del_p.C1183fs|LPHN3_ENST00000507164.1_Frame_Shift_Del_p.C1183fs|LPHN3_ENST00000508693.1_Frame_Shift_Del_p.C1192fs			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1102					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ATTTTCCATTGTGTCCTACAG	0.313																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(3370-3372)TGTfs		latrophilin 3 precursor							69.0	67.0	68.0					4																	62897312		1809	4072	5881	SO:0001589	frameshift_variant	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62897312delG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3371delG	4.37:g.62897312delG	ENSP00000422533:p.Cys1124fs		Somatic				LPHN3_uc003hcq.3_Frame_Shift_Del_p.C1124fs|LPHN3_uc003hct.2_Frame_Shift_Del_p.C508fs	p.C1124fs	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			20	3544	+			1102			Helical; Name=7; (Potential).		E9PE04|O94867|Q9NWK5	Frame_Shift_Del	DEL	ENST00000514591.1	37	c.3371delG	CCDS54768.1																																																																																				0.313	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			19	36	NA	NA	NA	NA	NA	19	36	---	---	---	---
SPRY4	81848	broad.mit.edu	37	5	141694361	141694363	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	TGC	TGC	-	-	TGC	TGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:141694361_141694363delTGC	ENST00000434127.2	-	2	554_556	c.311_313delGCA	c.(310-315)agcaca>aca	p.S104del	SPRY4_ENST00000344120.4_In_Frame_Del_p.S127del|SPRY4_ENST00000503582.1_5'Flank	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	104	Poly-Ser.				multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGAGGATGTGCTGCTGCTGCT	0.66									Testicular Cancer, Familial Clustering of																														uc003lml.2		NA																	0				ovary(1)|lung(1)	2						c.(310-315)AGCACA>ACA		sprouty homolog 4 isoform 2																																				SO:0001651	inframe_deletion	81848	Testicular_Cancer_Familial_Clustering_of	Familial Cancer Database		multicellular organismal development	cytoplasm|ruffle membrane	protein binding	g.chr5:141694361_141694363delTGC	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.311_313delGCA	5.37:g.141694370_141694372delTGC	ENSP00000399468:p.Ser104del		Somatic				SPRY4_uc010jgi.1_In_Frame_Del_p.S127del	p.S104del	NM_001127496	NP_001120968	WXS	Illumina HiSeq	Unspecified	Q9C004	SPY4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	570_572	-		all_hematologic(541;0.118)	104			Poly-Ser.		A4FVB2|A4FVB3|Q6QIX2|Q9C003	In_Frame_Del	DEL	ENST00000434127.2	37	c.311_313delGCA	CCDS47296.1																																																																																				0.660	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370652.1			7	190	NA	NA	NA	NA	NA	7	190	---	---	---	---
CCNJL	79616	broad.mit.edu	37	5	159686536	159686536	+	Frame_Shift_Del	DEL	G	G	-	rs200898721	byFrequency	TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr5:159686536delG	ENST00000393977.3	-	5	952	c.667delC	c.(667-669)cgcfs	p.R223fs	CCNJL_ENST00000541762.1_Frame_Shift_Del_p.R174fs|CCNJL_ENST00000377503.2_5'UTR|CCNJL_ENST00000257536.7_Frame_Shift_Del_p.R175fs|CCNJL_ENST00000519673.1_Frame_Shift_Del_p.R175fs	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	223						nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGGTCTTGCGGGGGCAGGTG	0.627																																							uc003lyb.1		NA																	0					0						c.(667-669)CGCfs		cyclin J-like							68.0	76.0	73.0					5																	159686536		2094	4215	6309	SO:0001589	frameshift_variant	79616					nucleus		g.chr5:159686536delG	BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.667delC	5.37:g.159686536delG	ENSP00000377547:p.Arg223fs		Somatic				CCNJL_uc011dee.1_Frame_Shift_Del_p.R175fs|CCNJL_uc003lyc.1_RNA|CCNJL_uc011def.1_Frame_Shift_Del_p.R175fs	p.R223fs	NM_024565	NP_078841	WXS	Illumina HiSeq	Unspecified	Q8IV13	CCNJL_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		5	919	-	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	223					Q6ZN43|Q9H7W8	Frame_Shift_Del	DEL	ENST00000393977.3	37	c.667delC	CCDS4350.2																																																																																				0.627	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252674.1	NM_024565		26	129	NA	NA	NA	NA	NA	26	129	---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157099403	157099405	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr6:157099403_157099405delCAG	ENST00000350026.5	+	1	341_343	c.340_342delCAG	c.(340-342)cagdel	p.Q131del	MIR4466_ENST00000606121.1_RNA|ARID1B_ENST00000346085.5_In_Frame_Del_p.Q131del|RP11-230C9.3_ENST00000604792.1_RNA|RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000367148.1_In_Frame_Del_p.Q131del|ARID1B_ENST00000275248.4_In_Frame_Del_p.Q73del	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	131	Gln-rich.|Poly-Gln.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AAACCAGTTCcagcagcagcagc	0.64																																							uc003qqn.2		NA																	0				ovary(1)|breast(1)	2						c.(166-168)CAGdel		AT rich interactive domain 1B (SWI1-like)			,	105,53,105,2485		24,0,5,52,7,0,39,21,58,1168					,	2.3	1.0			9	30,100,26,5174		8,0,0,14,16,0,68,8,10,2541	no	codingComplex,codingComplex	ARID1B	NM_020732.3,NM_017519.2	,	32,0,5,66,23,0,107,29,68,3709	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		2.9268,9.5706,5.1869	,	,		135,153,131,7659				SO:0001651	inframe_deletion	57492				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity	g.chr6:157099403_157099405delCAG	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.340_342delCAG	6.37:g.157099412_157099414delCAG	ENSP00000055163:p.Gln131del		Somatic				ARID1B_uc003qqo.2_In_Frame_Del_p.Q73del|ARID1B_uc003qqp.2_In_Frame_Del_p.Q73del	p.Q73del	NM_017519	NP_059989	WXS	Illumina HiSeq	Unspecified	Q8NFD5	ARI1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)	1	318_320	+		Breast(66;0.000162)|Ovarian(120;0.0265)	131			Gln-rich.		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	In_Frame_Del	DEL	ENST00000350026.5	37	c.166_168delCAG	CCDS5251.2																																																																																				0.640	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
DCAF4L2	138009	broad.mit.edu	37	8	88885347	88885347	+	Frame_Shift_Del	DEL	G	G	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chr8:88885347delG	ENST00000319675.3	-	1	949	c.853delC	c.(853-855)ctgfs	p.L285fs		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	285										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GATGACACCAGGAATTGGCCA	0.498																																							uc003ydz.2		NA																	0				ovary(1)	1						c.(853-855)CTGfs		WD repeat domain 21C							98.0	89.0	92.0					8																	88885347		2203	4300	6503	SO:0001589	frameshift_variant	138009							g.chr8:88885347delG	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.853delC	8.37:g.88885347delG	ENSP00000316496:p.Leu285fs		Somatic					p.L285fs	NM_152418	NP_689631	WXS	Illumina HiSeq	Unspecified	Q8NA75	DC4L2_HUMAN			1	950	-			285			WD 1.			Frame_Shift_Del	DEL	ENST00000319675.3	37	c.853delC	CCDS6245.1																																																																																				0.498	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		28	53	NA	NA	NA	NA	NA	28	53	---	---	---	---
IL3RA	3563	broad.mit.edu	37	X	1467367	1467376	+	Frame_Shift_Del	DEL	GTGAAGTGAC	GTGAAGTGAC	-			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	GTGAAGTGAC	GTGAAGTGAC	-	-	GTGAAGTGAC	GTGAAGTGAC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:1467367_1467376delGTGAAGTGAC	ENST00000331035.4	+	4	576_585	c.227_236delGTGAAGTGAC	c.(226-237)tgtgaagtgaccfs	p.CEVT76fs	IL3RA_ENST00000381469.2_Intron	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	76					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ATTTCCTTATGTGAAGTGACCAACTACACC	0.443																																							uc004cps.2		NA																	0				skin(2)|lung(1)	3						c.(226-237)TGTGAAGTGACCfs		interleukin 3 receptor, alpha precursor	Sargramostim(DB00020)																																			SO:0001589	frameshift_variant	3563					integral to membrane|plasma membrane	interleukin-3 receptor activity	g.chrX:1467367_1467376delGTGAAGTGAC	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.227_236delGTGAAGTGAC	X.37:g.1467367_1467376delGTGAAGTGAC	ENSP00000327890:p.Cys76fs		Somatic				IL3RA_uc011mhd.1_Intron	p.C76fs	NM_002183	NP_002174	WXS	Illumina HiSeq	Unspecified	P26951	IL3RA_HUMAN			4	576_585	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	76_79			Extracellular (Potential).		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Frame_Shift_Del	DEL	ENST00000331035.4	37	c.227_236delGTGAAGTGAC	CCDS14113.1																																																																																				0.443	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3			30	366	NA	NA	NA	NA	NA	30	366	---	---	---	---
MED12	9968	broad.mit.edu	37	X	70339996	70339997	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-95-7947-01A-11D-2184-08	TCGA-95-7947-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9a9ed047-e91a-46e2-a054-82f000bc35ea	81a2d022-e55f-49c7-856c-9258fd01c9e5	g.chrX:70339996_70339997insAG	ENST00000374080.3	+	4	561_562	c.529_530insAG	c.(529-531)aagfs	p.K177fs	MED12_ENST00000333646.6_Frame_Shift_Ins_p.K177fs|MED12_ENST00000374102.1_Frame_Shift_Ins_p.K177fs			Q93074	MED12_HUMAN	mediator complex subunit 12	177					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CAAGGTTAAGAAGAGACATGTT	0.49			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(529-531)AAGfs		mediator complex subunit 12																																				SO:0001589	frameshift_variant	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70339996_70339997insAG	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.532_533dupAG	X.37:g.70339999_70340000dupAG	ENSP00000363193:p.Lys177fs		Somatic				MED12_uc011mpq.1_Frame_Shift_Ins_p.K177fs|MED12_uc004dyz.2_Frame_Shift_Ins_p.K177fs|MED12_uc004dza.2_Frame_Shift_Ins_p.K24fs	p.K177fs	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			4	728_729	+	Renal(35;0.156)		177					O15410|O75557|Q9UHV6|Q9UND7	Frame_Shift_Ins	INS	ENST00000374080.3	37	c.529_530insAG	CCDS43970.1																																																																																				0.490	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		61	40	NA	NA	NA	NA	NA	61	40	---	---	---	---
