#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
GNB1	2782	broad.mit.edu	37	1	1721961	1721961	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:1721961G>C	ENST00000378609.4	-	9	903	c.572C>G	c.(571-573)tCt>tGt	p.S191C		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	191					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		AGGAGCAAGAGAAAGGCTCAT	0.577																																							uc001aif.2		NA																	0					0						c.(571-573)TCT>TGT		guanine nucleotide-binding protein, beta-1							151.0	109.0	123.0					1																	1721961		2203	4300	6503	SO:0001583	missense	2782				cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity	g.chr1:1721961G>C	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.572C>G	1.37:g.1721961G>C	ENSP00000367872:p.Ser191Cys		Somatic				GNB1_uc009vky.2_Missense_Mutation_p.S91C	p.S191C	NM_002074	NP_002065	WXS	Illumina HiSeq	Unspecified	P62873	GBB1_HUMAN		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)	9	904	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)	191			WD 4.		B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	SNP	ENST00000378609.4	37	c.572C>G	CCDS34.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.0|25.0	4.596294|4.596294	0.86953|0.86953	.|.	.|.	ENSG00000078369|ENSG00000078369	ENST00000424622|ENST00000378609;ENST00000455156;ENST00000378606	.|T	.|0.62105	.|0.05	5.43|5.43	4.5|4.5	0.54988|0.54988	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.051442	.|0.85682	.|D	.|0.000000	T|T	0.71617|0.71617	0.3361|0.3361	L|L	0.45285|0.45285	1.41|1.41	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.71870	.|0.975	T|T	0.73786|0.73786	-0.3873|-0.3873	5|10	.|0.59425	.|D	.|0.04	-14.5758|-14.5758	14.53|14.53	0.67917|0.67917	0.0:0.0:0.8524:0.1476|0.0:0.0:0.8524:0.1476	.|.	.|191	.|P62873	.|GBB1_HUMAN	V|C	49|191;91;191	.|ENSP00000367872:S191C	.|ENSP00000367869:S191C	L|S	-|-	1|2	0|0	GNB1|GNB1	1711821|1711821	1.000000|1.000000	0.71417|0.71417	0.766000|0.766000	0.31476|0.31476	0.996000|0.996000	0.88848|0.88848	9.565000|9.565000	0.98154|0.98154	1.257000|1.257000	0.44085|0.44085	0.655000|0.655000	0.94253|0.94253	CTC|TCT		0.577	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074		6	53	0	0	0	0.001984	0	6	53				
IL22RA1	58985	broad.mit.edu	37	1	24449853	24449853	+	Missense_Mutation	SNP	G	G	T	rs571030286		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:24449853G>T	ENST00000270800.1	-	6	769	c.731C>A	c.(730-732)gCa>gAa	p.A244E		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	244					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		GCAGAGTACTGCGACGAGGAA	0.612																																							uc001biq.1		NA																	0				skin(1)	1						c.(730-732)GCA>GAA		interleukin 22 receptor, alpha 1 precursor							69.0	61.0	64.0					1																	24449853		2203	4300	6503	SO:0001583	missense	58985					integral to membrane	interferon receptor activity	g.chr1:24449853G>T	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.731C>A	1.37:g.24449853G>T	ENSP00000270800:p.Ala244Glu		Somatic				IL22RA1_uc010oeg.1_Missense_Mutation_p.A176E|IL22RA1_uc009vrb.1_Missense_Mutation_p.A108E|IL22RA1_uc010oeh.1_Missense_Mutation_p.A244E	p.A244E	NM_021258	NP_067081	WXS	Illumina HiSeq	Unspecified	Q8N6P7	I22R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)	6	770	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	244			Helical; (Potential).		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	c.731C>A	CCDS247.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996967	0.54147	.	.	ENSG00000142677	ENST00000270800	T	0.10960	2.82	5.24	3.29	0.37713	.	0.184756	0.34932	N	0.003562	T	0.16214	0.0390	L	0.32530	0.975	0.09310	N	1	D;D	0.54047	0.964;0.964	P;P	0.55785	0.784;0.726	T	0.03374	-1.1043	10	0.54805	T	0.06	-12.8209	11.9566	0.52984	0.0:0.3121:0.6879:0.0	.	176;244	B4E2V9;Q8N6P7	.;I22R1_HUMAN	E	244	ENSP00000270800:A244E	ENSP00000270800:A244E	A	-	2	0	IL22RA1	24322440	0.254000	0.23992	0.002000	0.10522	0.814000	0.46013	2.038000	0.41184	0.533000	0.28675	0.563000	0.77884	GCA		0.612	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1			22	18	1	0	1.10923e-09	0.00278	1.18062e-09	22	18				
SLFNL1	200172	broad.mit.edu	37	1	41483474	41483474	+	Missense_Mutation	SNP	C	C	T	rs200423444		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:41483474C>T	ENST00000359345.1	-	2	3366	c.790G>A	c.(790-792)Gac>Aac	p.D264N	SLFNL1_ENST00000372613.2_Missense_Mutation_p.D264N|SLFNL1_ENST00000397197.2_Missense_Mutation_p.D264N|SLFNL1_ENST00000372611.1_Missense_Mutation_p.D205N|SLFNL1_ENST00000302946.8_Missense_Mutation_p.D264N|SLFNL1_ENST00000439569.2_Missense_Mutation_p.D264N	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	264							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				AGGCCGCTGTCCTCTACTCCC	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		18516	0.001		0.0	False		,,,				2504	0.0						uc001cgm.1		NA																	0				skin(1)	1						c.(790-792)GAC>AAC		schlafen-like 1							52.0	49.0	50.0					1																	41483474		2203	4299	6502	SO:0001583	missense	200172						ATP binding	g.chr1:41483474C>T	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.790G>A	1.37:g.41483474C>T	ENSP00000352299:p.Asp264Asn		Somatic				SLFNL1_uc009vwf.1_Missense_Mutation_p.D264N|SLFNL1_uc001cgn.1_Missense_Mutation_p.D205N|SLFNL1_uc009vwg.1_Missense_Mutation_p.D264N	p.D264N	NM_144990	NP_659427	WXS	Illumina HiSeq	Unspecified	Q499Z3	SLNL1_HUMAN			3	1010	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	264			ATP (Potential).		A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	ENST00000359345.1	37	c.790G>A	CCDS460.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.33	3.094143	0.56075	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	5.42	4.51	0.55191	.	0.099737	0.44688	N	0.000426	T	0.62527	0.2435	M	0.78916	2.43	0.39649	D	0.970449	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.992;0.998;0.996	T	0.66960	-0.5791	10	0.62326	D	0.03	-56.9129	9.9453	0.41604	0.0:0.9066:0.0:0.0934	.	264;205;264	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	N	264;264;205;264;264;264	ENSP00000304401:D264N;ENSP00000361696:D264N;ENSP00000361694:D205N;ENSP00000352299:D264N;ENSP00000398938:D264N;ENSP00000380381:D264N	ENSP00000304401:D264N	D	-	1	0	SLFNL1	41256061	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	3.718000	0.54919	1.287000	0.44583	0.561000	0.74099	GAC		0.662	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		14	57	0	0	0	0.003163	0	14	57				
SLFNL1	200172	broad.mit.edu	37	1	41483477	41483477	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:41483477C>A	ENST00000359345.1	-	2	3363	c.787G>T	c.(787-789)Gag>Tag	p.E263*	SLFNL1_ENST00000372613.2_Nonsense_Mutation_p.E263*|SLFNL1_ENST00000397197.2_Nonsense_Mutation_p.E263*|SLFNL1_ENST00000372611.1_Nonsense_Mutation_p.E204*|SLFNL1_ENST00000302946.8_Nonsense_Mutation_p.E263*|SLFNL1_ENST00000439569.2_Nonsense_Mutation_p.E263*	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	263							ATP binding (GO:0005524)	p.E263Q(1)		endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				CCGCTGTCCTCTACTCCCACG	0.672																																							uc001cgm.1		NA																	1	Substitution - Missense(1)		endometrium(1)	skin(1)	1						c.(787-789)GAG>TAG		schlafen-like 1							51.0	49.0	50.0					1																	41483477		2203	4299	6502	SO:0001587	stop_gained	200172						ATP binding	g.chr1:41483477C>A	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.787G>T	1.37:g.41483477C>A	ENSP00000352299:p.Glu263*		Somatic				SLFNL1_uc009vwf.1_Nonsense_Mutation_p.E263*|SLFNL1_uc001cgn.1_Nonsense_Mutation_p.E204*|SLFNL1_uc009vwg.1_Nonsense_Mutation_p.E263*	p.E263*	NM_144990	NP_659427	WXS	Illumina HiSeq	Unspecified	Q499Z3	SLNL1_HUMAN			3	1007	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	263			ATP (Potential).		A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Nonsense_Mutation	SNP	ENST00000359345.1	37	c.787G>T	CCDS460.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159792	0.78226	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	.	.	.	5.42	5.42	0.78866	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-43.0488	14.7245	0.69332	0.0:1.0:0.0:0.0	.	.	.	.	X	263;263;204;263;263;263	.	ENSP00000304401:E263X	E	-	1	0	SLFNL1	41256064	0.985000	0.35326	0.973000	0.42090	0.010000	0.07245	2.619000	0.46401	2.539000	0.85634	0.561000	0.74099	GAG		0.672	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		14	58	1	0	2.32078e-09	0.003163	2.45797e-09	14	58				
SLFNL1	200172	broad.mit.edu	37	1	41486212	41486212	+	Missense_Mutation	SNP	C	C	G	rs376892209		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:41486212C>G	ENST00000359345.1	-	1	2697	c.121G>C	c.(121-123)Gag>Cag	p.E41Q	SLFNL1_ENST00000372613.2_Missense_Mutation_p.E41Q|SLFNL1_ENST00000397197.2_Missense_Mutation_p.E41Q|SLFNL1_ENST00000372611.1_Missense_Mutation_p.E41Q|SLFNL1_ENST00000302946.8_Missense_Mutation_p.E41Q|SLFNL1_ENST00000439569.2_Missense_Mutation_p.E41Q	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	41							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				GGAGCCTCCTCGAGGTCAGAG	0.632																																							uc001cgm.1		NA																	0				skin(1)	1						c.(121-123)GAG>CAG		schlafen-like 1							52.0	55.0	54.0					1																	41486212		2203	4300	6503	SO:0001583	missense	200172						ATP binding	g.chr1:41486212C>G	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.121G>C	1.37:g.41486212C>G	ENSP00000352299:p.Glu41Gln		Somatic				SLFNL1_uc009vwf.1_Missense_Mutation_p.E41Q|SLFNL1_uc001cgn.1_Missense_Mutation_p.E41Q|SLFNL1_uc009vwg.1_Missense_Mutation_p.E41Q	p.E41Q	NM_144990	NP_659427	WXS	Illumina HiSeq	Unspecified	Q499Z3	SLNL1_HUMAN			2	341	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	41					A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	ENST00000359345.1	37	c.121G>C	CCDS460.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695339	0.48202	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14	5.79	-11.1	0.00147	.	1.103570	0.06826	N	0.793163	T	0.38558	0.1045	L	0.43152	1.355	0.09310	N	1	B;B;B	0.25105	0.041;0.118;0.011	B;B;B	0.23574	0.024;0.047;0.011	T	0.41142	-0.9525	10	0.59425	D	0.04	-8.1886	4.8168	0.13371	0.0856:0.116:0.3855:0.413	.	41;41;41	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	Q	41	ENSP00000304401:E41Q;ENSP00000361696:E41Q;ENSP00000361694:E41Q;ENSP00000352299:E41Q;ENSP00000398938:E41Q;ENSP00000380381:E41Q	ENSP00000304401:E41Q	E	-	1	0	SLFNL1	41258799	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.366000	0.02585	-1.311000	0.02309	-0.291000	0.09656	GAG		0.632	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		14	104	0	0	0	0.003163	0	14	104				
SLFNL1	200172	broad.mit.edu	37	1	41486281	41486281	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:41486281C>T	ENST00000359345.1	-	1	2628	c.52G>A	c.(52-54)Gag>Aag	p.E18K	SLFNL1_ENST00000372613.2_Missense_Mutation_p.E18K|SLFNL1_ENST00000397197.2_Missense_Mutation_p.E18K|SLFNL1_ENST00000372611.1_Missense_Mutation_p.E18K|SLFNL1_ENST00000302946.8_Missense_Mutation_p.E18K|SLFNL1_ENST00000439569.2_Missense_Mutation_p.E18K	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	18							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				CCCCAGGACTCCATGAAGGGC	0.607																																							uc001cgm.1		NA																	0				skin(1)	1						c.(52-54)GAG>AAG		schlafen-like 1							44.0	45.0	44.0					1																	41486281		2203	4300	6503	SO:0001583	missense	200172						ATP binding	g.chr1:41486281C>T	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.52G>A	1.37:g.41486281C>T	ENSP00000352299:p.Glu18Lys		Somatic				SLFNL1_uc009vwf.1_Missense_Mutation_p.E18K|SLFNL1_uc001cgn.1_Missense_Mutation_p.E18K|SLFNL1_uc009vwg.1_Missense_Mutation_p.E18K	p.E18K	NM_144990	NP_659427	WXS	Illumina HiSeq	Unspecified	Q499Z3	SLNL1_HUMAN			2	272	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	18					A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	ENST00000359345.1	37	c.52G>A	CCDS460.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992136	0.35131	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26;0.26	4.86	2.94	0.34122	.	0.681694	0.13352	N	0.394370	T	0.46678	0.1405	L	0.48642	1.525	0.09310	N	1	B;B;B	0.32829	0.386;0.206;0.267	B;B;B	0.28011	0.085;0.077;0.039	T	0.36040	-0.9764	10	0.52906	T	0.07	-6.0956	8.0779	0.30726	0.0:0.8099:0.0:0.1901	.	18;18;18	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	K	18	ENSP00000304401:E18K;ENSP00000361696:E18K;ENSP00000361694:E18K;ENSP00000352299:E18K;ENSP00000398938:E18K;ENSP00000380381:E18K	ENSP00000304401:E18K	E	-	1	0	SLFNL1	41258868	0.133000	0.22466	0.005000	0.12908	0.008000	0.06430	0.850000	0.27737	0.624000	0.30286	0.561000	0.74099	GAG		0.607	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		10	82	0	0	0	0.003163	0	10	82				
RBMXL1	494115	broad.mit.edu	37	1	89448792	89448792	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:89448792C>T	ENST00000321792.5	-	2	1145	c.718G>A	c.(718-720)Gat>Aat	p.D240N	RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.D240N|CCBL2_ENST00000260508.4_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	240					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										TAAGTATAATCTCGTGGTGGT	0.428																																							uc009wcx.2		NA																	0					0						c.(718-720)GAT>AAT		RNA binding motif protein, X-linked-like 1							180.0	158.0	166.0					1																	89448792		2203	4300	6503	SO:0001583	missense	494115						nucleotide binding|RNA binding	g.chr1:89448792C>T	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.718G>A	1.37:g.89448792C>T	ENSP00000318415:p.Asp240Asn		Somatic				CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.D240N	p.D240N	NM_001162536	NP_001156008	WXS	Illumina HiSeq	Unspecified	Q96E39	RBMXL_HUMAN			3	1434	-			240						Missense_Mutation	SNP	ENST00000321792.5	37	c.718G>A	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.012463	0.93346	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.79749	-1.3;-1.3	1.76	1.76	0.24704	.	0.000000	0.85682	D	0.000000	T	0.74726	0.3754	M	0.69823	2.125	0.41886	D	0.990343	P	0.45594	0.862	P	0.48627	0.584	T	0.76526	-0.2927	10	0.62326	D	0.03	.	9.1404	0.36899	0.0:1.0:0.0:0.0	.	240	Q96E39	RBMXL_HUMAN	N	240	ENSP00000318415:D240N;ENSP00000446099:D240N	ENSP00000318415:D240N	D	-	1	0	RBMXL1	89221380	1.000000	0.71417	0.834000	0.33040	0.776000	0.43924	4.924000	0.63418	0.982000	0.38575	0.306000	0.20318	GAT		0.428	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610		32	33	0	0	0	0.003755	0	32	33				
PLEKHO1	51177	broad.mit.edu	37	1	150131230	150131230	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:150131230G>C	ENST00000369124.4	+	6	1020	c.742G>C	c.(742-744)Gac>Cac	p.D248H	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.D214H|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.D65H|PLEKHO1_ENST00000479194.1_3'UTR	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	248	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGAAAAAACAGACAAAGGGGC	0.647																																							uc001ett.2		NA																	0				lung(1)	1						c.(742-744)GAC>CAC		pleckstrin homology domain containing, family O							36.0	43.0	41.0					1																	150131230		2203	4299	6502	SO:0001583	missense	51177					cytoplasm|nucleus|plasma membrane		g.chr1:150131230G>C	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.742G>C	1.37:g.150131230G>C	ENSP00000358120:p.Asp248His		Somatic				PLEKHO1_uc001etr.2_Missense_Mutation_p.D76H|PLEKHO1_uc001ets.2_Missense_Mutation_p.D65H|PLEKHO1_uc001etu.2_Missense_Mutation_p.D76H	p.D248H	NM_016274	NP_057358	WXS	Illumina HiSeq	Unspecified	Q53GL0	PKHO1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		6	1020	+	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		248			Interaction with ATM, CKIP, IFP35 and NMI.		Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	37	c.742G>C	CCDS945.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330030	0.41297	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T	0.51817	0.69;0.76	4.97	4.06	0.47325	.	0.803834	0.12027	N	0.506307	T	0.31263	0.0791	L	0.54323	1.7	0.47308	D	0.999387	B	0.29085	0.232	B	0.30782	0.12	T	0.30060	-0.9991	10	0.66056	D	0.02	-12.7207	12.2923	0.54825	0.081:0.0:0.919:0.0	.	248	Q53GL0	PKHO1_HUMAN	H	65;214;248;128	ENSP00000025469:D214H;ENSP00000358120:D248H	ENSP00000025469:D214H	D	+	1	0	PLEKHO1	148397854	0.854000	0.29725	0.941000	0.38009	0.701000	0.40568	2.440000	0.44855	1.318000	0.45170	0.655000	0.94253	GAC		0.647	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274		27	25	0	0	0	0.009535	0	27	25				
FLG	2312	broad.mit.edu	37	1	152282561	152282561	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:152282561C>G	ENST00000368799.1	-	3	4836	c.4801G>C	c.(4801-4803)Gag>Cag	p.E1601Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1601	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGTGTCCCTCACTGTCCCTG	0.592									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(4801-4803)GAG>CAG		filaggrin							142.0	152.0	148.0					1																	152282561		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152282561C>G	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4801G>C	1.37:g.152282561C>G	ENSP00000357789:p.Glu1601Gln		Somatic					p.E1601Q	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4837	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1601			Ser-rich.|Filaggrin 9.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.4801G>C	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	9.917	1.211129	0.22289	.	.	ENSG00000143631	ENST00000368799	T	0.08008	3.14	2.97	0.963	0.19649	.	.	.	.	.	T	0.01254	0.0041	N	0.11818	0.18	0.09310	N	1	P	0.43542	0.81	B	0.39503	0.301	T	0.45338	-0.9268	9	0.13470	T	0.59	.	9.1565	0.36996	0.0:0.5655:0.4345:0.0	.	1601	P20930	FILA_HUMAN	Q	1601	ENSP00000357789:E1601Q	ENSP00000357789:E1601Q	E	-	1	0	FLG	150549185	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-0.236000	0.09003	0.106000	0.17784	-0.334000	0.08254	GAG		0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		50	182	0	0	0	0.01441	0	50	182				
ASH1L	55870	broad.mit.edu	37	1	155385641	155385641	+	Missense_Mutation	SNP	A	A	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:155385641A>C	ENST00000368346.3	-	6	6541	c.5902T>G	c.(5902-5904)Ttg>Gtg	p.L1968V	snoU13_ENST00000458873.1_RNA|ASH1L_ENST00000392403.3_Missense_Mutation_p.L1968V			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1968					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ACAGGCTGCAAGGTACTTTCA	0.438																																							uc009wqq.2		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(5902-5904)TTG>GTG		absent, small, or homeotic 1-like							100.0	104.0	103.0					1																	155385641		2203	4300	6503	SO:0001583	missense	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155385641A>C	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5902T>G	1.37:g.155385641A>C	ENSP00000357330:p.Leu1968Val		Somatic				ASH1L_uc001fkt.2_Missense_Mutation_p.L1968V	p.L1968V	NM_018489	NP_060959	WXS	Illumina HiSeq	Unspecified	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		6	6382	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		1968					Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37	c.5902T>G		.	.	.	.	.	.	.	.	.	.	A	13.87	2.364936	0.41902	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88046	-2.33;-2.33	4.98	2.63	0.31362	.	0.397608	0.23537	N	0.047118	T	0.52125	0.1715	N	0.08118	0	0.80722	D	1	B;B	0.28636	0.139;0.218	B;B	0.24848	0.025;0.056	T	0.50541	-0.8816	10	0.25106	T	0.35	.	4.5238	0.11971	0.6581:0.0:0.3419:0.0	.	1968;1968	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	V	1968	ENSP00000357330:L1968V;ENSP00000376204:L1968V	ENSP00000357330:L1968V	L	-	1	2	ASH1L	153652265	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	0.656000	0.24948	0.940000	0.37473	0.477000	0.44152	TTG		0.438	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		15	73	0	0	0	0.004007	0	15	73				
RXFP4	339403	broad.mit.edu	37	1	155912577	155912577	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:155912577C>T	ENST00000368318.3	+	1	1098	c.1077C>T	c.(1075-1077)agC>agT	p.S359S		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	359						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)			endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCCGGGAGAGCCGCCCTTCTA	0.632																																							uc010pgs.1		NA																	0					0						c.(1075-1077)AGC>AGT		relaxin 3 receptor 2							18.0	21.0	20.0					1																	155912577		2189	4272	6461	SO:0001819	synonymous_variant	339403					integral to membrane|plasma membrane	angiotensin type II receptor activity	g.chr1:155912577C>T	AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.1077C>T	1.37:g.155912577C>T			Somatic					p.S359S	NM_181885	NP_871001	WXS	Illumina HiSeq	Unspecified	Q8TDU9	RL3R2_HUMAN			1	1098	+	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		359			Cytoplasmic (Potential).		B0M0L4|Q3MJB1|Q8NGZ8	Silent	SNP	ENST00000368318.3	37	c.1077C>T	CCDS1124.1																																																																																				0.632	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885		3	56	0	0	0	0.000602	0	3	56				
INTS7	25896	broad.mit.edu	37	1	212118198	212118198	+	Silent	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:212118198G>C	ENST00000366994.3	-	19	2633	c.2529C>G	c.(2527-2529)ctC>ctG	p.L843L	INTS7_ENST00000366992.3_Silent_p.L823L|INTS7_ENST00000366993.3_Silent_p.L829L|INTS7_ENST00000440600.2_Silent_p.L794L|INTS7_ENST00000469606.1_5'UTR	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	843					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		TTTTGCGGAAGAGTCCTGGTT	0.478																																							uc001hiw.1		NA																	0					0						c.(2527-2529)CTC>CTG		integrator complex subunit 7							180.0	170.0	173.0					1																	212118198		2203	4300	6503	SO:0001819	synonymous_variant	25896				snRNA processing	integrator complex	protein binding	g.chr1:212118198G>C	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.2529C>G	1.37:g.212118198G>C			Somatic				INTS7_uc009xdb.1_Silent_p.L823L|INTS7_uc001hix.1_Silent_p.L719L|INTS7_uc001hiy.1_Silent_p.L829L|INTS7_uc010pta.1_Silent_p.L794L	p.L843L	NM_015434	NP_056249	WXS	Illumina HiSeq	Unspecified	Q9NVH2	INT7_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)	19	2634	-			843					B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Silent	SNP	ENST00000366994.3	37	c.2529C>G	CCDS1501.1																																																																																				0.478	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434		4	96	0	0	0	0.000602	0	4	96				
ANKRD26	22852	broad.mit.edu	37	10	27328913	27328913	+	Nonsense_Mutation	SNP	G	G	A	rs189856879		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:27328913G>A	ENST00000376087.4	-	21	2521	c.2356C>T	c.(2356-2358)Cga>Tga	p.R786*	ANKRD26_ENST00000376070.3_Nonsense_Mutation_p.R343*|ANKRD26_ENST00000436985.2_Nonsense_Mutation_p.R802*	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	785					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CACAGTTCTCGTTCCCATTCA	0.299													G|||	1	0.000199681	0.0	0.0	5008	,	,		18186	0.001		0.0	False		,,,				2504	0.0						uc001ith.2		NA																	0				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(2353-2355)CGA>TGA		ankyrin repeat domain 26							183.0	165.0	170.0					10																	27328913		1835	4079	5914	SO:0001587	stop_gained	22852					centrosome		g.chr10:27328913G>A	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.2356C>T	10.37:g.27328913G>A	ENSP00000365255:p.Arg786*		Somatic				ANKRD26_uc001itg.2_Nonsense_Mutation_p.R472*|ANKRD26_uc009xku.1_Nonsense_Mutation_p.R786*	p.R785*	NM_014915	NP_055730	WXS	Illumina HiSeq	Unspecified	Q9UPS8	ANR26_HUMAN			21	2525	-			785			Potential.		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Nonsense_Mutation	SNP	ENST00000376087.4	37	c.2353C>T	CCDS41499.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	39	7.519355	0.98335	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	.	.	.	5.18	0.0857	0.14443	.	0.543780	0.14993	N	0.286596	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	8.599	0.33734	0.0:0.127:0.2783:0.5947	.	.	.	.	X	343;786;802	.	ENSP00000365238:R343X	R	-	1	2	ANKRD26	27368919	0.894000	0.30519	0.192000	0.23308	0.814000	0.46013	2.182000	0.42556	0.217000	0.20800	0.585000	0.79938	CGA		0.299	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			7	98	0	0	0	0.004482	0	7	98				
MASTL	84930	broad.mit.edu	37	10	27448608	27448608	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:27448608G>A	ENST00000375940.4	+	3	442	c.385G>A	c.(385-387)Gat>Aat	p.D129N	MASTL_ENST00000375946.4_Missense_Mutation_p.D129N|MASTL_ENST00000342386.6_Missense_Mutation_p.D129N			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	129	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGTTATTTTGATGAAGAGAT	0.338																																							uc001itm.2		NA																	0				stomach(1)|ovary(1)|lung(1)	3						c.(385-387)GAT>AAT		microtubule associated serine/threonine							75.0	82.0	80.0					10																	27448608		2203	4299	6502	SO:0001583	missense	84930				cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity	g.chr10:27448608G>A	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.385G>A	10.37:g.27448608G>A	ENSP00000365107:p.Asp129Asn		Somatic				MASTL_uc001itl.2_Missense_Mutation_p.D129N|MASTL_uc009xkw.1_Missense_Mutation_p.D129N|MASTL_uc009xkx.1_RNA	p.D129N	NM_032844	NP_116233	WXS	Illumina HiSeq	Unspecified	Q96GX5	GWL_HUMAN			3	1024	+			129			Protein kinase.		Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	37	c.385G>A	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	G	35	5.476395	0.96291	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.40225	1.04;1.04;1.04	5.7	5.7	0.88788	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.086058	0.85682	D	0.000000	T	0.56247	0.1972	L	0.31120	0.905	0.80722	D	1	P;D;D	0.89917	0.843;0.999;1.0	P;D;D	0.91635	0.88;0.993;0.999	T	0.57740	-0.7759	10	0.66056	D	0.02	-22.8981	19.8336	0.96646	0.0:0.0:1.0:0.0	.	129;129;129	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	N	129	ENSP00000365113:D129N;ENSP00000343446:D129N;ENSP00000365107:D129N	ENSP00000343446:D129N	D	+	1	0	MASTL	27488614	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.215000	0.95146	2.701000	0.92244	0.561000	0.74099	GAT		0.338	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844		25	74	0	0	0	0.003954	0	25	74				
PARD3	56288	broad.mit.edu	37	10	34663884	34663884	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:34663884G>A	ENST00000374789.3	-	11	1911	c.1586C>T	c.(1585-1587)tCg>tTg	p.S529L	PARD3_ENST00000374776.1_Missense_Mutation_p.S529L|PARD3_ENST00000346874.4_Missense_Mutation_p.S529L|PARD3_ENST00000545693.1_Missense_Mutation_p.S529L|PARD3_ENST00000340077.5_Missense_Mutation_p.S529L|PARD3_ENST00000374790.3_Missense_Mutation_p.S485L|PARD3_ENST00000545260.1_Missense_Mutation_p.S485L|PARD3_ENST00000374794.3_Missense_Mutation_p.S485L|PARD3_ENST00000544292.1_Missense_Mutation_p.S259L|PARD3_ENST00000374788.3_Missense_Mutation_p.S529L|PARD3_ENST00000350537.4_Missense_Mutation_p.S529L|PARD3_ENST00000374768.1_5'Flank|PARD3_ENST00000374773.1_Missense_Mutation_p.S529L	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	529	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				TCTCAACAGCGAAACAACTTC	0.433																																							uc010qej.1		NA																	0				ovary(1)	1						c.(1585-1587)TCG>TTG		partitioning-defective protein 3 homolog							128.0	125.0	126.0					10																	34663884		2203	4300	6503	SO:0001583	missense	56288				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chr10:34663884G>A	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1586C>T	10.37:g.34663884G>A	ENSP00000363921:p.Ser529Leu		Somatic				PARD3_uc010qek.1_Missense_Mutation_p.S529L|PARD3_uc010qel.1_Missense_Mutation_p.S529L|PARD3_uc010qem.1_Missense_Mutation_p.S529L|PARD3_uc010qen.1_Missense_Mutation_p.S529L|PARD3_uc010qeo.1_Missense_Mutation_p.S529L|PARD3_uc010qep.1_Missense_Mutation_p.S485L|PARD3_uc010qeq.1_Missense_Mutation_p.S485L|PARD3_uc001ixo.1_Missense_Mutation_p.S259L|PARD3_uc001ixp.1_Missense_Mutation_p.S394L|PARD3_uc001ixq.1_Missense_Mutation_p.S529L|PARD3_uc001ixr.1_Missense_Mutation_p.S529L|PARD3_uc001ixt.1_Missense_Mutation_p.S350L|PARD3_uc001ixu.1_Missense_Mutation_p.S485L|PARD3_uc001ixs.1_Missense_Mutation_p.S182L	p.S529L	NM_019619	NP_062565	WXS	Illumina HiSeq	Unspecified	Q8TEW0	PARD3_HUMAN			11	1586	-		Breast(68;0.0707)	529			PDZ 2.		F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	c.1586C>T	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.132728	0.77662	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	T;T;T;T;T;T;T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23	5.82	5.82	0.92795	PDZ/DHR/GLGF (4);	0.049775	0.85682	D	0.000000	T	0.32882	0.0844	L	0.51422	1.61	0.80722	D	1	D;B;D;B;B;D;B;B;B;B;D;P;B;B;B	0.71674	0.998;0.08;0.98;0.207;0.239;0.989;0.37;0.158;0.303;0.246;0.973;0.753;0.251;0.32;0.005	P;B;P;B;B;P;B;B;B;B;P;B;B;B;B	0.54759	0.76;0.012;0.638;0.024;0.024;0.56;0.024;0.029;0.029;0.041;0.599;0.085;0.056;0.034;0.002	T	0.01042	-1.1471	10	0.87932	D	0	.	20.088	0.97803	0.0:0.0:1.0:0.0	.	485;485;529;529;529;529;529;529;485;529;529;529;529;529;259	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	L	529;485;529;529;529;485;529;485;529;529;529;259	ENSP00000443147:S529L;ENSP00000440857:S485L;ENSP00000363921:S529L;ENSP00000363920:S529L;ENSP00000340591:S529L;ENSP00000363926:S485L;ENSP00000311986:S529L;ENSP00000363922:S485L;ENSP00000363908:S529L;ENSP00000341844:S529L;ENSP00000363905:S529L;ENSP00000444429:S259L	ENSP00000341844:S529L	S	-	2	0	PARD3	34703890	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.428000	0.97476	2.739000	0.93911	0.655000	0.94253	TCG		0.433	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619		39	73	0	0	0	0.007835	0	39	73				
FZD8	8325	broad.mit.edu	37	10	35928705	35928705	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:35928705G>A	ENST00000374694.1	-	1	1657	c.1653C>T	c.(1651-1653)ctC>ctT	p.L551L	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	551					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						GCTCGTAGAAGAGGCAGGCGA	0.697																																							uc001iyz.1		NA																	0					0						c.(1651-1653)CTC>CTT		frizzled 8 precursor							33.0	28.0	30.0					10																	35928705		2198	4287	6485	SO:0001819	synonymous_variant	8325				axonogenesis|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|T cell differentiation in thymus|vasculature development	cell projection|Golgi apparatus|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr10:35928705G>A	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.1653C>T	10.37:g.35928705G>A			Somatic					p.L551L	NM_031866	NP_114072	WXS	Illumina HiSeq	Unspecified	Q9H461	FZD8_HUMAN			1	1658	-			551			Helical; Name=6; (Potential).			Silent	SNP	ENST00000374694.1	37	c.1653C>T	CCDS7192.1																																																																																				0.697	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866		5	30	0	0	0	0.001168	0	5	30				
HERC4	26091	broad.mit.edu	37	10	69832647	69832647	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:69832647C>G	ENST00000395198.3	-	3	466	c.219G>C	c.(217-219)aaG>aaC	p.K73N	HERC4_ENST00000373700.4_Missense_Mutation_p.K73N|HERC4_ENST00000395187.2_Missense_Mutation_p.K73N|HERC4_ENST00000412272.2_Missense_Mutation_p.K73N|HERC4_ENST00000492996.2_Missense_Mutation_p.K73N	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	73					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TACCTGGTTTCTTTCTGGATT	0.308																																							uc001jng.3		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(217-219)AAG>AAC		hect domain and RLD 4 isoform a							83.0	83.0	83.0					10																	69832647		2203	4300	6503	SO:0001583	missense	26091				cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity	g.chr10:69832647C>G	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.219G>C	10.37:g.69832647C>G	ENSP00000378624:p.Lys73Asn		Somatic				HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_Missense_Mutation_p.K73N|HERC4_uc009xpr.2_Missense_Mutation_p.K73N|HERC4_uc001jni.3_5'UTR|HERC4_uc001jnj.2_Missense_Mutation_p.K73N|HERC4_uc001jnk.2_Missense_Mutation_p.K73N	p.K73N	NM_022079	NP_071362	WXS	Illumina HiSeq	Unspecified	Q5GLZ8	HERC4_HUMAN			3	530	-			73			RCC1 2.		Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	c.219G>C	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672588	0.29693	.	.	ENSG00000148634	ENST00000412272;ENST00000395198;ENST00000373700;ENST00000395187;ENST00000513996;ENST00000492996	D;D;D;T;T;T	0.84223	-1.82;-1.82;-1.82;-1.26;-1.3;1.51	4.78	3.86	0.44501	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.150909	0.52532	D	0.000069	T	0.81809	0.4901	L	0.31207	0.915	0.54753	D	0.999981	P;D;B;B;B	0.58970	0.763;0.984;0.011;0.023;0.026	P;P;B;B;B	0.57324	0.463;0.818;0.038;0.031;0.035	T	0.79055	-0.1960	9	.	.	.	.	5.1442	0.14975	0.0:0.7611:0.0:0.2389	.	73;73;73;73;73	Q5GLZ8-3;Q5GLZ8-4;A8K9U4;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	N	73	ENSP00000416504:K73N;ENSP00000378624:K73N;ENSP00000362804:K73N;ENSP00000378614:K73N;ENSP00000427191:K73N;ENSP00000422383:K73N	.	K	-	3	2	HERC4	69502653	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.209000	0.32357	2.191000	0.70037	0.655000	0.94253	AAG		0.308	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601		4	81	0	0	0	0.000602	0	4	81				
HK1	3098	broad.mit.edu	37	10	71158502	71158502	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:71158502G>C	ENST00000359426.6	+	17	2631	c.2527G>C	c.(2527-2529)Gat>Cat	p.D843H	HK1_ENST00000448642.2_Missense_Mutation_p.D878H|HK1_ENST00000404387.2_Missense_Mutation_p.D847H|HK1_ENST00000360289.2_Missense_Mutation_p.D831H|HK1_ENST00000298649.3_Missense_Mutation_p.D842H	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	843	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						TGCGGTTGTGGATAAGATCCG	0.582																																							uc001jpl.3		NA																	0				ovary(1)	1						c.(2527-2529)GAT>CAT		hexokinase 1 isoform HKI							98.0	89.0	92.0					10																	71158502		2203	4300	6503	SO:0001583	missense	3098				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	g.chr10:71158502G>C	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2527G>C	10.37:g.71158502G>C	ENSP00000352398:p.Asp843His		Somatic				HK1_uc001jpg.3_Missense_Mutation_p.D831H|HK1_uc001jph.3_Missense_Mutation_p.D847H|HK1_uc001jpi.3_Missense_Mutation_p.D847H|HK1_uc001jpj.3_Missense_Mutation_p.D878H|HK1_uc001jpk.3_Missense_Mutation_p.D842H	p.D843H	NM_000188	NP_000179	WXS	Illumina HiSeq	Unspecified	P19367	HXK1_HUMAN			17	2628	+			843			Catalytic.		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	c.2527G>C	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186626	0.78789	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01;-4.01	5.49	5.49	0.81192	Hexokinase, C-terminal (1);	0.091120	0.64402	D	0.000001	D	0.98033	0.9352	M	0.79475	2.455	0.80722	D	1	P;D;D;D;P	0.76494	0.795;0.999;0.997;0.996;0.647	P;D;D;D;B	0.75020	0.71;0.964;0.985;0.958;0.051	D	0.98718	1.0707	10	0.72032	D	0.01	-18.1086	18.9537	0.92649	0.0:0.0:1.0:0.0	.	843;842;878;847;831	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	H	831;878;847;842;843;843	ENSP00000353433:D831H;ENSP00000402103:D878H;ENSP00000384774:D847H;ENSP00000298649:D842H;ENSP00000352398:D843H	ENSP00000298649:D842H	D	+	1	0	HK1	70828508	1.000000	0.71417	0.994000	0.49952	0.792000	0.44763	8.062000	0.89475	2.567000	0.86603	0.563000	0.77884	GAT		0.582	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		6	89	0	0	0	0.004482	0	6	89				
HK1	3098	broad.mit.edu	37	10	71158543	71158543	+	Silent	SNP	G	G	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:71158543G>T	ENST00000359426.6	+	17	2672	c.2568G>T	c.(2566-2568)gtG>gtT	p.V856V	HK1_ENST00000448642.2_Silent_p.V891V|HK1_ENST00000404387.2_Silent_p.V860V|HK1_ENST00000360289.2_Silent_p.V844V|HK1_ENST00000298649.3_Silent_p.V855V	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	856	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GTCTGAATGTGACTGTGGGAG	0.607																																							uc001jpl.3		NA																	0				ovary(1)	1						c.(2566-2568)GTG>GTT		hexokinase 1 isoform HKI							103.0	93.0	96.0					10																	71158543		2203	4300	6503	SO:0001819	synonymous_variant	3098				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	g.chr10:71158543G>T	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2568G>T	10.37:g.71158543G>T			Somatic				HK1_uc001jpg.3_Silent_p.V844V|HK1_uc001jph.3_Silent_p.V860V|HK1_uc001jpi.3_Silent_p.V860V|HK1_uc001jpj.3_Silent_p.V891V|HK1_uc001jpk.3_Silent_p.V855V	p.V856V	NM_000188	NP_000179	WXS	Illumina HiSeq	Unspecified	P19367	HXK1_HUMAN			17	2669	+			856			Catalytic.		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	37	c.2568G>T	CCDS7292.1																																																																																				0.607	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		7	85	1	0	0.00307968	0.00308	0.00313806	7	85				
HIF1AN	55662	broad.mit.edu	37	10	102304755	102304755	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:102304755C>G	ENST00000299163.6	+	4	725	c.625C>G	c.(625-627)Cag>Gag	p.Q209E		NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	209	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		CTTTTTTGCTCAGATAAAAGG	0.448																																							uc001krj.3		NA																	0					0						c.(625-627)CAG>GAG		hypoxia-inducible factor 1, alpha subunit							107.0	99.0	101.0					10																	102304755		2203	4300	6503	SO:0001583	missense	55662				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|protein binding	g.chr10:102304755C>G	AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.625C>G	10.37:g.102304755C>G	ENSP00000299163:p.Gln209Glu		Somatic					p.Q209E	NM_017902	NP_060372	WXS	Illumina HiSeq	Unspecified	Q9NWT6	HIF1N_HUMAN		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)	4	700	+		Colorectal(252;0.234)	209			JmjC.|Interaction with HIF1A.|Interaction with VHL.		D3DR69|Q5W147|Q969Q7|Q9NPV5	Missense_Mutation	SNP	ENST00000299163.6	37	c.625C>G	CCDS7498.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823311	0.90873	.	.	ENSG00000166135	ENST00000533589;ENST00000299163;ENST00000442724	T;T	0.76578	-1.03;-1.03	5.82	5.82	0.92795	Cupin, JmjC-type (1);Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.90683	0.7077	M	0.92784	3.345	0.80722	D	1	D	0.69078	0.997	P	0.62649	0.905	D	0.92069	0.5663	10	0.72032	D	0.01	-6.6918	20.093	0.97828	0.0:1.0:0.0:0.0	.	209	Q9NWT6	HIF1N_HUMAN	E	102;209;242	ENSP00000433360:Q102E;ENSP00000299163:Q209E	ENSP00000299163:Q209E	Q	+	1	0	HIF1AN	102294745	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.818000	0.86416	2.756000	0.94617	0.561000	0.74099	CAG		0.448	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049865.5	NM_017902		15	64	0	0	0	0.006122	0	15	64				
TAF5	6877	broad.mit.edu	37	10	105145201	105145201	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:105145201C>G	ENST00000369839.3	+	8	1806	c.1783C>G	c.(1783-1785)Cca>Gca	p.P595A	TAF5_ENST00000351396.4_Intron	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	595					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		ACAATTTTCTCCATATGGATA	0.413																																							uc001kwv.2		NA																	0				ovary(2)	2						c.(1783-1785)CCA>GCA		TBP-associated factor 5							90.0	78.0	82.0					10																	105145201		2203	4300	6503	SO:0001583	missense	6877				histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr10:105145201C>G	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1783C>G	10.37:g.105145201C>G	ENSP00000358854:p.Pro595Ala		Somatic				TAF5_uc010qqq.1_Intron	p.P595A	NM_006951	NP_008882	WXS	Illumina HiSeq	Unspecified	Q15542	TAF5_HUMAN		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)	8	1806	+		Colorectal(252;0.0747)|Breast(234;0.128)	595			WD 3.		A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	c.1783C>G	CCDS7547.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.597949	0.87055	.	.	ENSG00000148835	ENST00000369839	T	0.70749	-0.51	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83317	0.5228	L	0.61218	1.895	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84197	0.0448	10	0.72032	D	0.01	-10.3106	19.5716	0.95423	0.0:1.0:0.0:0.0	.	595	Q15542	TAF5_HUMAN	A	595	ENSP00000358854:P595A	ENSP00000358854:P595A	P	+	1	0	TAF5	105135191	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.425000	0.80255	2.688000	0.91661	0.650000	0.86243	CCA		0.413	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1			10	39	0	0	0	0.010729	0	10	39				
PLEKHS1	79949	broad.mit.edu	37	10	115536935	115536935	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:115536935G>C	ENST00000369310.3	+	11	1646	c.1084G>C	c.(1084-1086)Gat>Cat	p.D362H	PLEKHS1_ENST00000369309.1_Missense_Mutation_p.D196H|PLEKHS1_ENST00000369312.4_Missense_Mutation_p.D280H|PLEKHS1_ENST00000361048.1_Intron|PLEKHS1_ENST00000354462.3_Missense_Mutation_p.D112H	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	376																	TTGCCACGGAGATCATCTTCT	0.547																																							uc001lat.1		NA																	0				central_nervous_system(1)	1						c.(1084-1086)GAT>CAT		hypothetical protein LOC79949							52.0	47.0	48.0					10																	115536935		876	1991	2867	SO:0001583	missense	79949							g.chr10:115536935G>C	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.1084G>C	10.37:g.115536935G>C	ENSP00000358316:p.Asp362His		Somatic				C10orf81_uc001lar.1_Intron|C10orf81_uc009xyc.1_Missense_Mutation_p.D280H|C10orf81_uc001las.1_Missense_Mutation_p.D280H|C10orf81_uc001lau.1_Missense_Mutation_p.D196H	p.D362H	NM_024889	NP_079165	WXS	Illumina HiSeq	Unspecified	Q5SXH7	CJ081_HUMAN		Epithelial(162;0.0181)|all cancers(201;0.0204)	11	1646	+		Colorectal(252;0.175)	376					A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	c.1084G>C	CCDS53580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.363632|4.363632	0.82353|0.82353	.|.	.|.	ENSG00000148735|ENSG00000148735	ENST00000369312;ENST00000369310;ENST00000369309;ENST00000354462|ENST00000448805	T;T;T;T|.	0.34072|.	1.38;1.38;1.38;1.38|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73369|0.73369	0.3578|0.3578	M|M	0.68952|0.68952	2.095|2.095	0.44048|0.44048	D|D	0.996781|0.996781	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.71248|0.71248	-0.4649|-0.4649	10|5	0.87932|.	D|.	0|.	-34.7179|-34.7179	15.9221|15.9221	0.79583|0.79583	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	376;362;362|.	Q5SXH7;Q5SXH7-5;Q5SXH7-2|.	CJ081_HUMAN;.;.|.	H|T	280;362;196;112|92	ENSP00000358318:D280H;ENSP00000358316:D362H;ENSP00000358315:D196H;ENSP00000346451:D112H|.	ENSP00000346451:D112H|.	D|R	+|+	1|2	0|0	C10orf81|C10orf81	115526925|115526925	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.353000|5.353000	0.66034|0.66034	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	GAT|AGA		0.547	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889		5	29	0	0	0	0.000602	0	5	29				
EBF3	253738	broad.mit.edu	37	10	131676071	131676071	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:131676071C>A	ENST00000355311.5	-	7	669	c.597G>T	c.(595-597)ttG>ttT	p.L199F	EBF3_ENST00000368648.3_Missense_Mutation_p.L199F			Q9H4W6	COE3_HUMAN	early B-cell factor 3	199	Interaction with DNA. {ECO:0000250}.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CTGCATTCTTCAAACAGTTCT	0.358																																							uc001lki.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(595-597)TTG>TTT		early B-cell factor 3							111.0	98.0	103.0					10																	131676071		2203	4300	6503	SO:0001583	missense	253738				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding	g.chr10:131676071C>A		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.597G>T	10.37:g.131676071C>A	ENSP00000347463:p.Leu199Phe		Somatic					p.L199F	NM_001005463	NP_001005463	WXS	Illumina HiSeq	Unspecified	Q9H4W6	COE3_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00513)	7	656	-		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)	199			Interaction with DNA (By similarity).		A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37	c.597G>T		.	.	.	.	.	.	.	.	.	.	C	31	5.098184	0.94197	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.59502	0.26;0.36	5.1	5.1	0.69264	.	0.153823	0.44097	D	0.000483	T	0.78972	0.4368	M	0.85945	2.785	0.80722	D	1	D	0.61697	0.99	D	0.68483	0.958	T	0.83033	-0.0161	10	0.87932	D	0	-11.0453	18.5288	0.90983	0.0:1.0:0.0:0.0	.	199	Q9H4W6-2	.	F	199	ENSP00000347463:L199F;ENSP00000357637:L199F	ENSP00000347463:L199F	L	-	3	2	EBF3	131566061	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.814000	0.86154	2.362000	0.80069	0.563000	0.77884	TTG		0.358	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463		15	34	1	0	3.99206e-14	0.007413	4.29146e-14	15	34				
DPYSL4	10570	broad.mit.edu	37	10	134017270	134017270	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr10:134017270C>T	ENST00000338492.4	+	13	1630	c.1466C>T	c.(1465-1467)gCg>gTg	p.A489V	DPYSL4_ENST00000368629.1_Missense_Mutation_p.A329V|DPYSL4_ENST00000368627.1_Missense_Mutation_p.A329V	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	489					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CGGCAGCTGGCGGAGATCCAC	0.716																																							uc009ybb.2		NA																	0				central_nervous_system(2)	2						c.(1465-1467)GCG>GTG		dihydropyrimidinase-like 4							28.0	32.0	30.0					10																	134017270		2200	4297	6497	SO:0001583	missense	10570				axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	g.chr10:134017270C>T	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.1466C>T	10.37:g.134017270C>T	ENSP00000339850:p.Ala489Val		Somatic					p.A489V	NM_006426	NP_006417	WXS	Illumina HiSeq	Unspecified	O14531	DPYL4_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)	13	1620	+		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)	489					B2RMQ1|D3DRG5|O00240|Q5T0Q7	Missense_Mutation	SNP	ENST00000338492.4	37	c.1466C>T	CCDS7665.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269129	0.23221	.	.	ENSG00000151640	ENST00000338492;ENST00000368629;ENST00000368627	D;D;D	0.89681	-2.0;-2.55;-2.55	3.78	3.78	0.43462	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.85509	0.5713	L	0.59436	1.845	0.48696	D	0.999697	B	0.22080	0.064	B	0.06405	0.002	T	0.82028	-0.0660	10	0.18276	T	0.48	-27.2533	15.8649	0.79057	0.0:1.0:0.0:0.0	.	489	O14531	DPYL4_HUMAN	V	489;329;329	ENSP00000339850:A489V;ENSP00000357618:A329V;ENSP00000357616:A329V	ENSP00000339850:A489V	A	+	2	0	DPYSL4	133867260	0.998000	0.40836	0.946000	0.38457	0.060000	0.15804	5.502000	0.66956	1.941000	0.56285	0.460000	0.39030	GCG		0.716	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2			21	29	0	0	0	0.004656	0	21	29				
PHLDA2	7262	broad.mit.edu	37	11	2950336	2950336	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:2950336C>T	ENST00000314222.4	-	1	349	c.259G>A	c.(259-261)Gag>Aag	p.E87K		NM_003311.3	NP_003302.1	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain, family A, member 2	87	PH.				apoptotic process (GO:0006915)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|regulation of gene expression (GO:0010468)|regulation of glycogen metabolic process (GO:0070873)	cytoplasm (GO:0005737)|membrane (GO:0016020)				central_nervous_system(1)	1		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGCAGCTCTCGCCCGCGCAG	0.657																																							uc001lxa.1		NA																	0					0						c.(259-261)GAG>AAG		pleckstrin homology-like domain family A member							35.0	37.0	36.0					11																	2950336		2200	4299	6499	SO:0001583	missense	7262				apoptosis	cytoplasm|membrane		g.chr11:2950336C>T	AF035444	CCDS7741.1	11p15.4	2013-01-10	2003-09-26	2003-10-01	ENSG00000181649	ENSG00000181649		"""Pleckstrin homology (PH) domain containing"""	12385	protein-coding gene	gene with protein product		602131	"""tumor suppressing subtransferable candidate 3"""	TSSC3		9328465, 9403053	Standard	NM_003311		Approved	IPL, BWR1C, HLDA2	uc001lxa.1	Q53GA4	OTTHUMG00000010926	ENST00000314222.4:c.259G>A	11.37:g.2950336C>T	ENSP00000319231:p.Glu87Lys		Somatic					p.E87K	NM_003311	NP_003302	WXS	Illumina HiSeq	Unspecified	Q53GA4	PHLA2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	315	-		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)	87			PH.		O00496	Missense_Mutation	SNP	ENST00000314222.4	37	c.259G>A	CCDS7741.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369314	0.82463	.	.	ENSG00000181649	ENST00000314222	T	0.77229	-1.08	3.65	2.63	0.31362	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.458834	0.20488	U	0.091343	T	0.65595	0.2706	L	0.46157	1.445	0.32453	N	0.545207	P	0.44090	0.826	B	0.35510	0.204	T	0.74746	-0.3561	10	0.59425	D	0.04	-23.6023	8.842	0.35148	0.1636:0.6766:0.1598:0.0	.	87	Q53GA4	PHLA2_HUMAN	K	87	ENSP00000319231:E87K	ENSP00000319231:E87K	E	-	1	0	PHLDA2	2906912	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.019000	0.41001	1.747000	0.51819	0.313000	0.20887	GAG		0.657	PHLDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030116.1	NM_003311		11	29	0	0	0	0.013537	0	11	29				
OR51L1	119682	broad.mit.edu	37	11	5020308	5020308	+	Silent	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:5020308C>G	ENST00000321543.1	+	1	96	c.96C>G	c.(94-96)ctC>ctG	p.L32L		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTCCATCCTCTTCTGTCTTG	0.423																																							uc010qyu.1		NA																	0				skin(1)	1						c.(94-96)CTC>CTG		olfactory receptor, family 51, subfamily L,							246.0	223.0	231.0					11																	5020308		2201	4298	6499	SO:0001819	synonymous_variant	119682				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5020308C>G	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.96C>G	11.37:g.5020308C>G			Somatic					p.L32L	NM_001004755	NP_001004755	WXS	Illumina HiSeq	Unspecified	Q8NGJ5	O51L1_HUMAN		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	96	+		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	32			Helical; Name=1; (Potential).		Q6IFE5	Silent	SNP	ENST00000321543.1	37	c.96C>G	CCDS31369.1																																																																																				0.423	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755		9	184	0	0	0	0.013537	0	9	184				
FOLH1	2346	broad.mit.edu	37	11	49168488	49168488	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:49168488G>C	ENST00000256999.2	-	19	2333	c.2073C>G	c.(2071-2073)atC>atG	p.I691M	FOLH1_ENST00000356696.3_Missense_Mutation_p.I660M|FOLH1_ENST00000533034.1_Missense_Mutation_p.I645M|FOLH1_ENST00000343844.4_Missense_Mutation_p.I383M|FOLH1_ENST00000340334.7_Missense_Mutation_p.I676M	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	691					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TTGGAGCATAGATGACATGCC	0.423																																							uc001ngy.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(2071-2073)ATC>ATG		folate hydrolase 1 isoform 1	Capromab(DB00089)|L-Glutamic Acid(DB00142)						96.0	94.0	95.0					11																	49168488		2201	4295	6496	SO:0001583	missense	2346				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:49168488G>C	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.2073C>G	11.37:g.49168488G>C	ENSP00000256999:p.Ile691Met		Somatic				FOLH1_uc001ngx.2_Missense_Mutation_p.S91C|FOLH1_uc001ngz.2_Missense_Mutation_p.I660M|FOLH1_uc009yly.2_Missense_Mutation_p.I676M|FOLH1_uc009ylz.2_Missense_Mutation_p.I645M|FOLH1_uc009yma.2_Missense_Mutation_p.I383M	p.I691M	NM_004476	NP_004467	WXS	Illumina HiSeq	Unspecified	Q04609	FOLH1_HUMAN			19	2334	-			691			Extracellular (Probable).		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	c.2073C>G	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437708	0.43224	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034	T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0	3.26	3.26	0.37387	Transferrin receptor-like, dimerisation domain (3);	0.000000	0.56097	D	0.000024	T	0.81702	0.4878	M	0.92555	3.32	0.54753	D	0.999983	D;D;D;D	0.76494	0.999;0.999;0.999;0.996	D;D;D;D	0.73708	0.979;0.98;0.981;0.98	D	0.86081	0.1544	10	0.87932	D	0	.	12.3155	0.54953	0.0:0.0:1.0:0.0	.	645;676;660;691	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	M	691;660;676;383;645	ENSP00000256999:I691M;ENSP00000349129:I660M;ENSP00000344131:I676M;ENSP00000344086:I383M;ENSP00000431463:I645M	ENSP00000256999:I691M	I	-	3	3	FOLH1	49125064	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.902000	0.28459	1.818000	0.53035	0.609000	0.83330	ATC		0.423	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476		23	85	0	0	0	0.011902	0	23	85				
OR4C15	81309	broad.mit.edu	37	11	55321913	55321913	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:55321913C>T	ENST00000314644.2	+	1	131	c.131C>T	c.(130-132)cCt>cTt	p.P44L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TACATGATCCCTGTTGGAGCT	0.378										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(130-132)CCT>CTT		olfactory receptor, family 4, subfamily C,							160.0	162.0	161.0					11																	55321913		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55321913C>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.131C>T	11.37:g.55321913C>T	ENSP00000324958:p.Pro44Leu	HNSCC(20;0.049)	Somatic					p.P44L	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	131	+			Error:Variant_position_missing_in_Q8NGM1_after_alignment					Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.131C>T	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.721332	0.30503	.	.	ENSG00000181939	ENST00000314644	T	0.00001	9.91	4.53	-5.32	0.02722	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.01165	-1.1431	6	0.40728	T	0.16	.	2.5899	0.04839	0.1367:0.2053:0.1274:0.5306	.	.	.	.	L	44	ENSP00000324958:P44L	ENSP00000324958:P44L	P	+	2	0	OR4C15	55078489	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-2.419000	0.01033	-0.936000	0.03723	0.385000	0.25706	CCT		0.378	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		4	137	0	0	0	0.000602	0	4	137				
OR8H3	390152	broad.mit.edu	37	11	55890191	55890191	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:55890191C>G	ENST00000313472.3	+	1	343	c.343C>G	c.(343-345)Ctc>Gtc	p.L115V		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					ATGTTATCTTCTCTCCTCAAT	0.473																																							uc001nii.1		NA																	0				ovary(2)	2						c.(343-345)CTC>GTC		olfactory receptor, family 8, subfamily H,							265.0	253.0	257.0					11																	55890191		2201	4296	6497	SO:0001583	missense	390152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55890191C>G	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.343C>G	11.37:g.55890191C>G	ENSP00000323928:p.Leu115Val		Somatic					p.L115V	NM_001005201	NP_001005201	WXS	Illumina HiSeq	Unspecified	Q8N146	OR8H3_HUMAN			1	343	+	Esophageal squamous(21;0.00693)		115			Helical; Name=3; (Potential).		Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	c.343C>G	CCDS31519.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108594	0.37242	.	.	ENSG00000181761	ENST00000313472	T	0.02197	4.4	3.44	1.4	0.22301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000446	T	0.16685	0.0401	H	0.97682	4.055	0.23653	N	0.997199	D	0.71674	0.998	D	0.66602	0.945	T	0.07908	-1.0748	10	0.87932	D	0	.	9.0855	0.36579	0.0:0.8083:0.0:0.1917	.	115	Q8N146	OR8H3_HUMAN	V	115	ENSP00000323928:L115V	ENSP00000323928:L115V	L	+	1	0	OR8H3	55646767	0.009000	0.17119	0.087000	0.20705	0.599000	0.36880	0.152000	0.16302	0.511000	0.28236	0.173000	0.16961	CTC		0.473	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		48	230	0	0	0	0.01441	0	48	230				
OR9G4	283189	broad.mit.edu	37	11	56510847	56510847	+	Silent	SNP	A	A	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:56510847A>G	ENST00000302957.3	-	1	440	c.441T>C	c.(439-441)taT>taC	p.Y147Y		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						TGGTACCTGAATAAAGCAATG	0.488																																							uc010rjo.1		NA																	0				ovary(2)|skin(1)	3						c.(439-441)TAT>TAC		olfactory receptor, family 9, subfamily G,							112.0	116.0	114.0					11																	56510847		2201	4296	6497	SO:0001819	synonymous_variant	283189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56510847A>G	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.441T>C	11.37:g.56510847A>G			Somatic					p.Y147Y	NM_001005284	NP_001005284	WXS	Illumina HiSeq	Unspecified	Q8NGQ1	OR9G4_HUMAN			1	441	-			147			Cytoplasmic (Potential).		Q6IF62|Q96RA9	Silent	SNP	ENST00000302957.3	37	c.441T>C	CCDS31537.1																																																																																				0.488	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284		7	158	0	0	0	0.00308	0	7	158				
C11orf84	144097	broad.mit.edu	37	11	63585793	63585793	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:63585793C>G	ENST00000294244.4	+	3	862	c.563C>G	c.(562-564)cCt>cGt	p.P188R		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	188	Pro-rich.									endometrium(3)|kidney(1)|lung(3)|skin(1)	8						CCATCCCTCCCTAAAAGGAGC	0.632																																							uc001nxt.2		NA																	0					0						c.(562-564)CCT>CGT		hypothetical protein LOC144097							59.0	68.0	65.0					11																	63585793		2201	4298	6499	SO:0001583	missense	144097							g.chr11:63585793C>G	BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.563C>G	11.37:g.63585793C>G	ENSP00000294244:p.Pro188Arg		Somatic					p.P188R	NM_138471	NP_612480	WXS	Illumina HiSeq	Unspecified	Q9BUA3	CK084_HUMAN			3	799	+			188			Pro-rich.		Q68CV7|Q6PHS2|Q96IH0	Missense_Mutation	SNP	ENST00000294244.4	37	c.563C>G	CCDS31594.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544479	0.65198	.	.	ENSG00000168005	ENST00000294244	T	0.47528	0.84	5.02	5.02	0.67125	.	0.481846	0.20130	N	0.098604	T	0.61236	0.2331	L	0.51422	1.61	0.09310	N	0.999999	D	0.71674	0.998	D	0.66979	0.948	T	0.54853	-0.8231	10	0.87932	D	0	-16.2936	13.7005	0.62606	0.0:1.0:0.0:0.0	.	188	Q9BUA3	CK084_HUMAN	R	188	ENSP00000294244:P188R	ENSP00000294244:P188R	P	+	2	0	C11orf84	63342369	0.004000	0.15560	0.623000	0.29173	0.772000	0.43724	0.818000	0.27295	2.610000	0.88304	0.561000	0.74099	CCT		0.632	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396084.1	NM_138471		4	87	0	0	0	0.001168	0	4	87				
PYGM	5837	broad.mit.edu	37	11	64521147	64521147	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:64521147G>A	ENST00000164139.3	-	11	1645	c.1247C>T	c.(1246-1248)gCg>gTg	p.A416V	PYGM_ENST00000462303.1_5'Flank|PYGM_ENST00000377432.3_Missense_Mutation_p.A328V	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	416					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GAATGCGGCCGCCACCCGCTG	0.692																																							uc001oax.3		NA																	0				ovary(2)	2						c.(1246-1248)GCG>GTG		muscle glycogen phosphorylase isoform 1	Pyridoxal Phosphate(DB00114)						15.0	15.0	15.0					11																	64521147		2189	4281	6470	SO:0001583	missense	5837				glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding	g.chr11:64521147G>A		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1247C>T	11.37:g.64521147G>A	ENSP00000164139:p.Ala416Val		Somatic				PYGM_uc001oay.3_Missense_Mutation_p.A328V	p.A416V	NM_005609	NP_005600	WXS	Illumina HiSeq	Unspecified	P11217	PYGM_HUMAN			11	2064	-			416					A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	c.1247C>T	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332352	0.41297	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.93604	-3.11;-3.25	4.88	4.88	0.63580	.	0.000000	0.56097	D	0.000029	D	0.90854	0.7127	L	0.54908	1.71	0.49051	D	0.999746	B;B	0.16802	0.019;0.01	B;B	0.12837	0.008;0.005	D	0.87203	0.2242	10	0.29301	T	0.29	-16.4036	15.5631	0.76266	0.0:0.0:1.0:0.0	.	328;416	A6NDY6;P11217	.;PYGM_HUMAN	V	328;416;397	ENSP00000366650:A328V;ENSP00000164139:A416V	ENSP00000164139:A416V	A	-	2	0	PYGM	64277723	0.687000	0.27671	0.968000	0.41197	0.255000	0.26057	3.586000	0.53950	2.529000	0.85273	0.511000	0.50034	GCG		0.692	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609		7	20	0	0	0	0.006214	0	7	20				
CAPN1	823	broad.mit.edu	37	11	64974124	64974124	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:64974124C>T	ENST00000527323.1	+	12	1784	c.1544C>T	c.(1543-1545)tCa>tTa	p.S515L	CAPN1_ENST00000524773.1_Missense_Mutation_p.S515L|CAPN1_ENST00000533820.1_Missense_Mutation_p.S515L|CAPN1_ENST00000533129.1_Missense_Mutation_p.S515L|CAPN1_ENST00000279247.6_Missense_Mutation_p.S515L			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	515	Domain III.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		CGCTTCTTCTCAGAGAAGAGT	0.647																																							uc009yqd.1		NA																	0				ovary(1)	1						c.(1543-1545)TCA>TTA		calpain 1, large subunit							27.0	32.0	30.0					11																	64974124		2072	4204	6276	SO:0001583	missense	823				positive regulation of cell proliferation|proteolysis	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|protein binding	g.chr11:64974124C>T	X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.1544C>T	11.37:g.64974124C>T	ENSP00000431984:p.Ser515Leu		Somatic				CAPN1_uc001odf.1_Missense_Mutation_p.S515L|CAPN1_uc001odg.1_Missense_Mutation_p.S515L|CAPN1_uc010roa.1_Missense_Mutation_p.S256L	p.S515L	NM_005186	NP_005177	WXS	Illumina HiSeq	Unspecified	P07384	CAN1_HUMAN		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)	13	1655	+		Lung NSC(402;0.094)|Melanoma(852;0.16)	515			Domain III.		Q2TTR0|Q6DHV4	Missense_Mutation	SNP	ENST00000527323.1	37	c.1544C>T	CCDS44644.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471059	0.84533	.	.	ENSG00000014216	ENST00000533820;ENST00000533129;ENST00000524773;ENST00000279247;ENST00000259755;ENST00000527323	D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5	5.06	5.06	0.68205	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.268407	0.37715	N	0.001972	D	0.95313	0.8479	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.96198	0.9143	10	0.87932	D	0	.	15.9138	0.79496	0.0:1.0:0.0:0.0	.	515	P07384	CAN1_HUMAN	L	515;515;515;515;461;515	ENSP00000435272:S515L;ENSP00000431686:S515L;ENSP00000434176:S515L;ENSP00000279247:S515L;ENSP00000431984:S515L	ENSP00000259755:S461L	S	+	2	0	CAPN1	64730700	0.999000	0.42202	0.996000	0.52242	0.462000	0.32619	7.731000	0.84895	2.341000	0.79615	0.462000	0.41574	TCA		0.647	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1			8	48	0	0	0	0.008291	0	8	48				
CCDC87	55231	broad.mit.edu	37	11	66360198	66360198	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:66360198C>T	ENST00000333861.3	-	1	356	c.289G>A	c.(289-291)Gag>Aag	p.E97K	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	97					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCGGGCGGCTCCCGCCAGCTG	0.632											OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oiq.3		NA																	0				ovary(1)|skin(1)	2						c.(289-291)GAG>AAG		coiled-coil domain containing 87							38.0	42.0	41.0					11																	66360198		2200	4295	6495	SO:0001583	missense	55231							g.chr11:66360198C>T	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.289G>A	11.37:g.66360198C>T	ENSP00000328487:p.Glu97Lys		Somatic	OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1091	CCS_uc001oir.2_5'Flank	p.E97K	NM_018219	NP_060689	WXS	Illumina HiSeq	Unspecified	Q9NVE4	CCD87_HUMAN			1	357	-			97					Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	37	c.289G>A	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439057	0.83885	.	.	ENSG00000182791	ENST00000333861	T	0.33438	1.41	5.39	4.41	0.53225	.	0.576513	0.14740	N	0.301220	T	0.38081	0.1027	M	0.68317	2.08	0.37096	D	0.89965	P	0.52842	0.956	P	0.50825	0.651	T	0.18461	-1.0336	10	0.26408	T	0.33	.	8.1564	0.31171	0.0:0.8916:0.0:0.1084	.	97	Q9NVE4	CCD87_HUMAN	K	97	ENSP00000328487:E97K	ENSP00000328487:E97K	E	-	1	0	CCDC87	66116774	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	2.408000	0.44574	2.808000	0.96608	0.655000	0.94253	GAG		0.632	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219		7	62	0	0	0	0.001855	0	7	62				
LRP5	4041	broad.mit.edu	37	11	68181430	68181430	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:68181430G>A	ENST00000294304.7	+	12	2883	c.2777G>A	c.(2776-2778)tGc>tAc	p.C926Y		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	926	EGF-like 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGCCACCGCTGCGGCTGCGCC	0.647																																							uc001ont.2		NA																	0				lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						c.(2776-2778)TGC>TAC		low density lipoprotein receptor-related protein							28.0	28.0	28.0					11																	68181430		2199	4290	6489	SO:0001583	missense	4041				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity	g.chr11:68181430G>A	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2777G>A	11.37:g.68181430G>A	ENSP00000294304:p.Cys926Tyr		Somatic				LRP5_uc009ysg.2_Missense_Mutation_p.C336Y	p.C926Y	NM_002335	NP_002326	WXS	Illumina HiSeq	Unspecified	O75197	LRP5_HUMAN			12	2852	+			926			EGF-like 3.|Extracellular (Potential).		Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	c.2777G>A	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541403	0.85917	.	.	ENSG00000162337	ENST00000294304	D	0.99966	-10.09	5.02	5.02	0.67125	Epidermal growth factor-like (1);	0.000000	0.53938	U	0.000051	D	0.99981	0.9994	H	0.97611	4.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.98098	1.0413	10	0.87932	D	0	.	18.5313	0.90993	0.0:0.0:1.0:0.0	.	926;926	Q9UES7;O75197	.;LRP5_HUMAN	Y	926	ENSP00000294304:C926Y	ENSP00000294304:C926Y	C	+	2	0	LRP5	67938006	1.000000	0.71417	0.958000	0.39756	0.817000	0.46193	9.000000	0.93564	2.601000	0.87937	0.561000	0.74099	TGC		0.647	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		9	36	0	0	0	0.004482	0	9	36				
C2CD3	26005	broad.mit.edu	37	11	73803494	73803494	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:73803494C>T	ENST00000334126.7	-	19	3710	c.3484G>A	c.(3484-3486)Gag>Aag	p.E1162K	C2CD3_ENST00000313663.7_Missense_Mutation_p.E1162K			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1162					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TTCCTGTTCTCAATCCTGGGG	0.388																																							uc001ouu.2		NA																	0				ovary(4)|pancreas(2)|skin(1)	7						c.(3484-3486)GAG>AAG		C2 calcium-dependent domain containing 3							135.0	128.0	130.0					11																	73803494		2200	4293	6493	SO:0001583	missense	26005					centrosome		g.chr11:73803494C>T	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.3484G>A	11.37:g.73803494C>T	ENSP00000334379:p.Glu1162Lys		Somatic					p.E1162K	NM_015531	NP_056346	WXS	Illumina HiSeq	Unspecified	Q4AC94	C2CD3_HUMAN			19	3711	-	Breast(11;4.16e-06)		1162					C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37	c.3484G>A		.	.	.	.	.	.	.	.	.	.	C	16.76	3.213532	0.58452	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.12465	2.68;2.7	5.4	5.4	0.78164	.	0.303615	0.36268	N	0.002689	T	0.17577	0.0422	L	0.54323	1.7	0.34361	D	0.690934	B	0.34329	0.449	B	0.34536	0.185	T	0.14868	-1.0457	10	0.49607	T	0.09	-14.739	16.9392	0.86211	0.0:1.0:0.0:0.0	.	1162	Q4AC94-1	.	K	1162	ENSP00000334379:E1162K;ENSP00000323339:E1162K	ENSP00000323339:E1162K	E	-	1	0	C2CD3	73481142	1.000000	0.71417	0.928000	0.36995	0.833000	0.47200	6.502000	0.73695	2.538000	0.85594	0.442000	0.29010	GAG		0.388	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		34	101	0	0	0	0.009718	0	34	101				
INTS4	92105	broad.mit.edu	37	11	77618802	77618802	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:77618802G>C	ENST00000534064.1	-	16	2011	c.1977C>G	c.(1975-1977)ttC>ttG	p.F659L	AAMDC_ENST00000532481.1_Intron|INTS4_ENST00000535943.1_Missense_Mutation_p.F34L	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	659					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			AGGTGGCAGAGAAATCAGCTA	0.408																																							uc001oys.2		NA																	0				ovary(2)	2						c.(1975-1977)TTC>TTG		integrator complex subunit 4							136.0	134.0	135.0					11																	77618802		2200	4292	6492	SO:0001583	missense	92105				snRNA processing	integrator complex	protein binding	g.chr11:77618802G>C	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1977C>G	11.37:g.77618802G>C	ENSP00000434466:p.Phe659Leu		Somatic				C11orf67_uc001oyp.2_Intron|INTS4_uc001oyt.2_RNA	p.F659L	NM_033547	NP_291025	WXS	Illumina HiSeq	Unspecified	Q96HW7	INT4_HUMAN	Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)		16	2005	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		659					Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	c.1977C>G	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.501978	0.26949	.	.	ENSG00000149262	ENST00000534064;ENST00000535943	.	.	.	4.74	2.78	0.32641	.	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	L	0.59436	1.845	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.58808	-0.7571	9	0.22109	T	0.4	-5.5743	9.6552	0.39921	0.1803:0.0:0.8197:0.0	.	659	Q96HW7	INT4_HUMAN	L	659;34	.	ENSP00000434466:F659L	F	-	3	2	INTS4	77296450	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.727000	0.47311	0.652000	0.30806	0.655000	0.94253	TTC		0.408	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547		4	125	0	0	0	0.000602	0	4	125				
ALG8	79053	broad.mit.edu	37	11	77823813	77823813	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:77823813G>A	ENST00000299626.5	-	8	852	c.781C>T	c.(781-783)Cag>Tag	p.Q261*	ALG8_ENST00000376156.3_Nonsense_Mutation_p.Q261*|ALG8_ENST00000532552.2_Intron	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	261					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)			NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			TGAGGCAGCTGATTCTGTTGA	0.393																																							uc001oza.1		NA																	0				ovary(2)|pancreas(1)	3						c.(781-783)CAG>TAG		dolichyl pyrophosphate Glc1Man9GlcNAc2							57.0	57.0	57.0					11																	77823813		2200	4292	6492	SO:0001587	stop_gained	79053				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity|dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr11:77823813G>A	AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.781C>T	11.37:g.77823813G>A	ENSP00000299626:p.Gln261*		Somatic				ALG8_uc001oyz.1_Nonsense_Mutation_p.Q261*|ALG8_uc009yux.1_Nonsense_Mutation_p.Q159*	p.Q261*	NM_024079	NP_076984	WXS	Illumina HiSeq	Unspecified	Q9BVK2	ALG8_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)		8	846	-	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		261					A6NDW6|O60860	Nonsense_Mutation	SNP	ENST00000299626.5	37	c.781C>T	CCDS8258.1	.	.	.	.	.	.	.	.	.	.	G	34	5.327470	0.95733	.	.	ENSG00000159063	ENST00000299626;ENST00000376156;ENST00000532440;ENST00000525755;ENST00000530454	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-7.6834	19.8002	0.96504	0.0:0.0:1.0:0.0	.	.	.	.	X	261;261;79;210;262	.	ENSP00000299626:Q261X	Q	-	1	0	ALG8	77501461	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.094000	0.94168	2.674000	0.91012	0.655000	0.94253	CAG		0.393	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390637.1	NM_024079		5	31	0	0	0	0.001984	0	5	31				
CASP1	834	broad.mit.edu	37	11	104897032	104897032	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:104897032C>T	ENST00000533400.1	-	9	1203	c.1168G>A	c.(1168-1170)Gaa>Aaa	p.E390K	CASP1_ENST00000436863.3_Missense_Mutation_p.E390K|CASP1_ENST00000594519.1_Missense_Mutation_p.E249K|CASP1_ENST00000527979.1_Missense_Mutation_p.E353K|CASP1_ENST00000531166.1_Missense_Mutation_p.E74K|CASP1_ENST00000525825.1_Missense_Mutation_p.E369K|CASP1_ENST00000353247.5_Missense_Mutation_p.E74K|CASP1_ENST00000415981.2_Missense_Mutation_p.E74K|CASP1_ENST00000534497.1_Missense_Mutation_p.E249K|CASP1_ENST00000393136.4_Missense_Mutation_p.E369K|CASP1_ENST00000526568.1_Missense_Mutation_p.E297K|CASP1_ENST00000593315.1_Missense_Mutation_p.E369K|CASP1_ENST00000446369.1_Missense_Mutation_p.E249K|CASP1_ENST00000598974.1_Missense_Mutation_p.E390K	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	390					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	GTCACTCTTTCAGTGGTGGGC	0.423																																					NSCLC(41;1246 1743 4934)	NSCLC(41;1246 1743 4934)	uc010rve.1		NA																	0				ovary(2)	2						c.(1168-1170)GAA>AAA		caspase 1 isoform alpha precursor	Minocycline(DB01017)|Penicillamine(DB00859)						93.0	91.0	92.0					11																	104897032		2202	4299	6501	SO:0001583	missense	834				cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding	g.chr11:104897032C>T	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.1168G>A	11.37:g.104897032C>T	ENSP00000433138:p.Glu390Lys		Somatic				CASP1_uc001pig.2_Missense_Mutation_p.E297K|CASP1_uc001pik.2_Missense_Mutation_p.E353K|CASP1_uc010rvf.1_Missense_Mutation_p.E297K|CASP1_uc010rvg.1_Missense_Mutation_p.E369K|CASP1_uc010rvh.1_Missense_Mutation_p.E249K|CASP1_uc010rvi.1_Missense_Mutation_p.E74K|CASP1_uc001pim.3_Missense_Mutation_p.E390K|CASP1_uc009yxi.2_Missense_Mutation_p.E369K|CASP1_uc010rvj.1_Missense_Mutation_p.E390K	p.E390K	NM_033292	NP_150634	WXS	Illumina HiSeq	Unspecified	P29466	CASP1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	9	1185	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	390					B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	37	c.1168G>A	CCDS8330.1	.	.	.	.	.	.	.	.	.	.	.	18.10	3.549389	0.65311	.	.	ENSG00000137752	ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000415981;ENST00000446369;ENST00000353247;ENST00000393136;ENST00000525825;ENST00000531166;ENST00000534497	T;T;T;T;T;T;T;T;T;T;T	0.44482	2.01;2.01;2.01;2.01;2.01;0.92;2.01;2.01;2.01;2.01;0.92	4.2	4.2	0.49525	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.161086	0.53938	D	0.000051	T	0.65302	0.2678	M	0.81179	2.53	0.53688	D	0.99997	D;P;D;D;D;D	0.89917	0.972;0.925;1.0;1.0;1.0;1.0	P;P;D;D;D;D	0.97110	0.737;0.616;0.999;1.0;0.998;0.999	T	0.69844	-0.5035	10	0.56958	D	0.05	.	14.4387	0.67301	0.0:1.0:0.0:0.0	.	74;249;369;390;353;297	P29466-5;P29466-4;P29466-2;P29466;G3V169;P29466-3	.;.;.;CASP1_HUMAN;.;.	K	297;353;390;390;74;249;74;369;369;74;249	ENSP00000434250:E297K;ENSP00000432340:E353K;ENSP00000433138:E390K;ENSP00000410076:E390K;ENSP00000408446:E74K;ENSP00000403260:E249K;ENSP00000344132:E74K;ENSP00000376844:E369K;ENSP00000434779:E369K;ENSP00000434303:E74K;ENSP00000436875:E249K	ENSP00000344132:E74K	E	-	1	0	CASP1	104402242	1.000000	0.71417	0.864000	0.33941	0.111000	0.19643	5.967000	0.70403	2.322000	0.78497	0.460000	0.39030	GAA		0.423	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292		12	75	0	0	0	0.00245	0	12	75				
ROBO3	64221	broad.mit.edu	37	11	124744063	124744063	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:124744063C>T	ENST00000397801.1	+	12	2074	c.1882C>T	c.(1882-1884)Ctg>Ttg	p.L628L	ROBO3_ENST00000538940.1_Silent_p.L606L	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	628	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTACCTGTTTCTGGTTCGAGC	0.602																																							uc001qbc.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1882-1884)CTG>TTG		roundabout, axon guidance receptor, homolog 3							90.0	94.0	93.0					11																	124744063		2096	4222	6318	SO:0001819	synonymous_variant	64221				axon midline choice point recognition	integral to membrane	receptor activity	g.chr11:124744063C>T	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1882C>T	11.37:g.124744063C>T			Somatic				ROBO3_uc010saq.1_5'Flank|ROBO3_uc001qbd.2_5'Flank|ROBO3_uc010sar.1_5'Flank|ROBO3_uc001qbe.2_5'Flank	p.L628L	NM_022370	NP_071765	WXS	Illumina HiSeq	Unspecified	Q96MS0	ROBO3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)	12	2074	+	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)	628			Fibronectin type-III 1.|Extracellular (Potential).			Silent	SNP	ENST00000397801.1	37	c.1882C>T	CCDS44755.1																																																																																				0.602	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663		5	150	0	0	0	0.000602	0	5	150				
APLP2	334	broad.mit.edu	37	11	129999975	129999975	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr11:129999975G>C	ENST00000263574.5	+	11	1570	c.1498G>C	c.(1498-1500)Gag>Cag	p.E500Q	APLP2_ENST00000338167.5_Missense_Mutation_p.E500Q|APLP2_ENST00000539648.1_Missense_Mutation_p.E288Q|APLP2_ENST00000278756.7_Missense_Mutation_p.E510Q|APLP2_ENST00000345598.5_Missense_Mutation_p.E271Q|APLP2_ENST00000543137.1_Missense_Mutation_p.E407Q|APLP2_ENST00000528499.1_Missense_Mutation_p.E444Q	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	500					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TGTCCGTGCTGAGAACAAAGA	0.468																																							uc010sby.1		NA																	0				ovary(3)	3						c.(1498-1500)GAG>CAG		amyloid beta (A4) precursor-like protein 2							167.0	147.0	154.0					11																	129999975		2201	4297	6498	SO:0001583	missense	334				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity	g.chr11:129999975G>C	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.1498G>C	11.37:g.129999975G>C	ENSP00000263574:p.Glu500Gln		Somatic				APLP2_uc001qfp.2_Missense_Mutation_p.E500Q|APLP2_uc001qfq.2_Missense_Mutation_p.E444Q|APLP2_uc010sbz.1_Missense_Mutation_p.E288Q|APLP2_uc001qfr.2_Missense_Mutation_p.E266Q|APLP2_uc001qfs.2_Missense_Mutation_p.E271Q|APLP2_uc001qfv.2_Missense_Mutation_p.E391Q	p.E500Q	NM_001642	NP_001633	WXS	Illumina HiSeq	Unspecified	Q06481	APLP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)	11	1655	+	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	500			Extracellular (Potential).		B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	37	c.1498G>C	CCDS8486.1	.	.	.	.	.	.	.	.	.	.	G	31	5.071552	0.93950	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.33	5.33	0.75918	Amyloidogenic glycoprotein, E2 domain (2);	0.000000	0.85682	D	0.000000	T	0.73225	0.3560	M	0.86028	2.79	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;1.0;0.995;1.0;1.0;0.997;0.999	D;D;D;D;D;D;D	0.85130	0.921;0.997;0.966;0.996;0.989;0.966;0.978	T	0.78061	-0.2351	10	0.87932	D	0	-31.9767	18.0139	0.89232	0.0:0.0:1.0:0.0	.	288;500;444;271;438;444;500	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	Q	444;288;500;271;500;510;407	ENSP00000435914:E444Q;ENSP00000443728:E288Q;ENSP00000263574:E500Q;ENSP00000263575:E271Q;ENSP00000345444:E500Q;ENSP00000278756:E510Q;ENSP00000444122:E407Q	ENSP00000263574:E500Q	E	+	1	0	APLP2	129505185	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	9.476000	0.97823	2.506000	0.84524	0.655000	0.94253	GAG		0.468	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	NM_001642		21	138	0	0	0	0.00278	0	21	138				
H3F3C	440093	broad.mit.edu	37	12	31944812	31944812	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr12:31944812C>T	ENST00000340398.3	-	1	363	c.289G>A	c.(289-291)Gaa>Aaa	p.E97K		NM_001013699.2	NP_001013721.2	Q6NXT2	H3C_HUMAN	H3 histone, family 3C	97					positive regulation of cell growth (GO:0030307)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	nucleosomal DNA binding (GO:0031492)	p.E97K(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	18						AGGTACGCTTCGCTAGCCTCC	0.572										HNSCC(67;0.2)																													uc001rkr.2		NA																	1	Substitution - Missense(1)		skin(1)		0						c.(289-291)GAA>AAA		histone H3-like							133.0	124.0	127.0					12																	31944812		2203	4300	6503	SO:0001583	missense	440093				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr12:31944812C>T	BC066906	CCDS31769.1	12p11.21	2012-02-15			ENSG00000188375	ENSG00000188375		"""Histones / Replication-independent"""	33164	protein-coding gene	gene with protein product						21274551	Standard	NM_001013699		Approved	H3.5	uc001rkr.3	Q6NXT2	OTTHUMG00000157811	ENST00000340398.3:c.289G>A	12.37:g.31944812C>T	ENSP00000339835:p.Glu97Lys	HNSCC(67;0.2)	Somatic					p.E97K	NM_001013699	NP_001013721	WXS	Illumina HiSeq	Unspecified	Q6NXT2	H3C_HUMAN			1	364	-			97					E9P281	Missense_Mutation	SNP	ENST00000340398.3	37	c.289G>A	CCDS31769.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851242	0.51270	.	.	ENSG00000188375	ENST00000340398	T	0.77489	-1.1	1.53	0.471	0.16752	Histone-fold (2);Histone core (1);	0.348640	0.19915	N	0.103202	D	0.88005	0.6321	H	0.95816	3.725	0.33460	D	0.584802	D	0.53885	0.963	P	0.60682	0.878	D	0.87830	0.2644	10	0.87932	D	0	.	7.193	0.25837	0.0:0.7174:0.2826:0.0	.	97	Q6NXT2	H3C_HUMAN	K	97	ENSP00000339835:E97K	ENSP00000339835:E97K	E	-	1	0	H3F3C	31836079	1.000000	0.71417	0.015000	0.15790	0.098000	0.18820	5.193000	0.65120	-0.017000	0.14103	0.413000	0.27773	GAA		0.572	H3F3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349653.1	NM_001013699		8	100	0	0	0	0.006214	0	8	100				
SARNP	84324	broad.mit.edu	37	12	56188646	56188646	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr12:56188646C>T	ENST00000336133.3	-	6	376	c.322G>A	c.(322-324)Gaa>Aaa	p.E108K	SARNP_ENST00000444631.2_Missense_Mutation_p.E48K|SARNP_ENST00000552080.1_Missense_Mutation_p.E108K|RP11-762I7.5_ENST00000546837.1_Silent_p.*420*	NM_033082.3	NP_149073.1	P82979	SARNP_HUMAN	SAP domain containing ribonucleoprotein	108					mRNA export from nucleus (GO:0006406)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	6						TTGAATCGTTCAGCCCTCTTC	0.418																																							uc001shu.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(2371-2373)GAA>AAA		dopamine receptor interacting protein							56.0	53.0	54.0					12																	56188646		2203	4300	6503	SO:0001583	missense	85406				protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding	g.chr12:56188646C>T	AJ409089	CCDS8892.1	12q13.2	2009-07-09				ENSG00000205323			24432	protein-coding gene	gene with protein product	"""hepatocellular carcinoma 1"", ""cytokine induced protein 29 kDa"""	610049				11356193, 11922608	Standard	NM_033082		Approved	THO1, Hcc-1, CIP29		P82979	OTTHUMG00000170441	ENST00000336133.3:c.322G>A	12.37:g.56188646C>T	ENSP00000337632:p.Glu108Lys		Somatic				SARNP_uc009zoa.2_RNA|SARNP_uc001shs.3_RNA|SARNP_uc001sht.2_Missense_Mutation_p.E108K|SARNP_uc001shv.3_Missense_Mutation_p.E108K	p.E791K	NM_032364	NP_115740	WXS	Illumina HiSeq	Unspecified	Q6Y2X3	DJC14_HUMAN			11	2427	-			Error:Variant_position_missing_in_Q6Y2X3_after_alignment					A8K393|Q9P066	Missense_Mutation	SNP	ENST00000336133.3	37	c.2371G>A	CCDS8892.1	.	.	.	.	.	.	.	.	.	.	C	31	5.104959	0.94245	.	.	ENSG00000205323	ENST00000444631;ENST00000336133;ENST00000552080	.	.	.	5.67	5.67	0.87782	.	0.045370	0.85682	D	0.000000	T	0.59636	0.2208	L	0.45698	1.435	0.80722	D	1	D;P	0.55385	0.971;0.884	P;B	0.50934	0.654;0.358	T	0.52682	-0.8543	9	0.24483	T	0.36	-8.0642	15.6341	0.76937	0.0:1.0:0.0:0.0	.	108;108	F8VZQ9;P82979	.;SARNP_HUMAN	K	48;108;108	.	ENSP00000337632:E108K	E	-	1	0	SARNP	54474913	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.521000	0.60532	2.847000	0.97988	0.655000	0.94253	GAA		0.418	SARNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409159.2	NM_033082		7	18	0	0	0	0.008291	0	7	18				
DGKA	1606	broad.mit.edu	37	12	56346586	56346586	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr12:56346586C>A	ENST00000331886.5	+	21	2266	c.1812C>A	c.(1810-1812)agC>agA	p.S604R	DGKA_ENST00000394147.1_Missense_Mutation_p.S604R|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Missense_Mutation_p.S604R	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	604					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	ACATCCCTAGCATGCATGGTG	0.552																																							uc001sij.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1810-1812)AGC>AGA		diacylglycerol kinase, alpha 80kDa	Vitamin E(DB00163)						159.0	140.0	146.0					12																	56346586		2203	4300	6503	SO:0001583	missense	1606				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity	g.chr12:56346586C>A	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1812C>A	12.37:g.56346586C>A	ENSP00000328405:p.Ser604Arg		Somatic				DGKA_uc009zod.1_Missense_Mutation_p.S523R|DGKA_uc001sik.2_Missense_Mutation_p.S604R|DGKA_uc001sil.2_Missense_Mutation_p.S604R|DGKA_uc001sim.2_Missense_Mutation_p.S604R|DGKA_uc001sin.2_Missense_Mutation_p.S604R|DGKA_uc009zof.2_Missense_Mutation_p.S250R|DGKA_uc001sio.2_Missense_Mutation_p.S346R	p.S604R	NM_001345	NP_001336	WXS	Illumina HiSeq	Unspecified	P23743	DGKA_HUMAN			21	2076	+			604					O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	c.1812C>A	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793152	0.50102	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	4.67	1.39	0.22231	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.57344	0.2047	M	0.83603	2.65	0.50813	D	0.999892	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	T	0.56159	-0.8025	10	0.87932	D	0	.	8.2075	0.31465	0.0:0.6887:0.0:0.3113	.	523;604	G3V4E1;P23743	.;DGKA_HUMAN	R	604;523;604;604	ENSP00000328405:S604R;ENSP00000451743:S523R;ENSP00000377703:S604R;ENSP00000450359:S604R	ENSP00000328405:S604R	S	+	3	2	DGKA	54632853	1.000000	0.71417	0.500000	0.27589	0.873000	0.50193	4.562000	0.60816	0.040000	0.15660	0.313000	0.20887	AGC		0.552	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1			100	83	1	0	4.85316e-53	0.01441	5.2966e-53	100	83				
NAB2	4665	broad.mit.edu	37	12	57485446	57485446	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr12:57485446T>C	ENST00000300131.3	+	2	1000	c.622T>C	c.(622-624)Ttc>Ctc	p.F208L	NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000342556.6_Missense_Mutation_p.F208L|NAB2_ENST00000357680.4_Missense_Mutation_p.F208L	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	208					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.F208L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTCGCCCCCCTTCTCCCCCCC	0.716																																							uc001smz.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(622-624)TTC>CTC		NGFI-A binding protein 2							12.0	17.0	15.0					12																	57485446		2196	4277	6473	SO:0001583	missense	4665				cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity	g.chr12:57485446T>C	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.622T>C	12.37:g.57485446T>C	ENSP00000300131:p.Phe208Leu		Somatic					p.F208L	NM_005967	NP_005958	WXS	Illumina HiSeq	Unspecified	Q15742	NAB2_HUMAN			2	1000	+			208					B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	c.622T>C	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473597	0.26423	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.15	4.15	0.48705	NAB co-repressor, domain (1);	0.441905	0.22768	N	0.055868	T	0.21801	0.0525	N	0.11427	0.14	0.33270	D	0.560932	P	0.43826	0.818	B	0.41466	0.358	T	0.14392	-1.0474	9	0.10902	T	0.67	-12.462	9.5058	0.39046	0.0:0.0:0.0:1.0	.	208	Q15742	NAB2_HUMAN	L	208	.	ENSP00000300131:F208L	F	+	1	0	NAB2	55771713	0.994000	0.37717	0.852000	0.33557	0.975000	0.68041	0.652000	0.24888	1.732000	0.51606	0.379000	0.24179	TTC		0.716	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967		5	10	0	0	0	0.001984	0	5	10				
ZFC3H1	196441	broad.mit.edu	37	12	72017964	72017964	+	Nonsense_Mutation	SNP	G	G	A	rs557426044		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr12:72017964G>A	ENST00000378743.3	-	23	4784	c.4426C>T	c.(4426-4428)Cag>Tag	p.Q1476*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1476					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCTAAAAGCTGAAAGGACAAA	0.408																																							uc001swo.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(4426-4428)CAG>TAG		proline/serine-rich coiled-coil 2							198.0	194.0	195.0					12																	72017964		1831	4082	5913	SO:0001587	stop_gained	196441				RNA processing	intracellular	metal ion binding	g.chr12:72017964G>A	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4426C>T	12.37:g.72017964G>A	ENSP00000368017:p.Gln1476*		Somatic					p.Q1476*	NM_144982	NP_659419	WXS	Illumina HiSeq	Unspecified	O60293	ZC3H1_HUMAN			23	4785	-			1476					Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	37	c.4426C>T	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	44	10.649932	0.99444	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.39	5.39	0.77823	.	0.064896	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	14.4406	0.67314	0.073:0.0:0.927:0.0	.	.	.	.	X	1476	.	ENSP00000368017:Q1476X	Q	-	1	0	ZFC3H1	70304231	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	5.685000	0.68204	2.520000	0.84964	0.655000	0.94253	CAG		0.408	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		13	161	0	0	0	0.00245	0	13	161				
PIWIL1	9271	broad.mit.edu	37	12	130827556	130827556	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr12:130827556C>T	ENST00000245255.3	+	3	372	c.100C>T	c.(100-102)Cag>Tag	p.Q34*		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	34					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TGGTTATATTCAGCCTAGGCC	0.478																																							uc001uik.2		NA																	0				ovary(2)	2						c.(100-102)CAG>TAG		piwi-like 1							61.0	60.0	61.0					12																	130827556		2203	4300	6503	SO:0001587	stop_gained	9271				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding	g.chr12:130827556C>T	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.100C>T	12.37:g.130827556C>T	ENSP00000245255:p.Gln34*		Somatic				PIWIL1_uc001uij.1_Nonsense_Mutation_p.Q34*	p.Q34*	NM_004764	NP_004755	WXS	Illumina HiSeq	Unspecified	Q96J94	PIWL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	3	190	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		34					A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Nonsense_Mutation	SNP	ENST00000245255.3	37	c.100C>T	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311551	0.81358	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539400;ENST00000539995;ENST00000535956;ENST00000542723	.	.	.	5.03	4.08	0.47627	.	1.046440	0.07443	N	0.897753	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-2.5701	14.0891	0.64977	0.1503:0.8497:0.0:0.0	.	.	.	.	X	34	.	ENSP00000245255:Q34X	Q	+	1	0	PIWIL1	129393509	0.007000	0.16637	0.004000	0.12327	0.235000	0.25334	2.288000	0.43514	2.480000	0.83734	0.591000	0.81541	CAG		0.478	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			17	42	0	0	0	0.012319	0	17	42				
KBTBD6	89890	broad.mit.edu	37	13	41704658	41704658	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr13:41704658C>G	ENST00000379485.1	-	1	2224	c.1990G>C	c.(1990-1992)Gat>Cat	p.D664H	KBTBD6_ENST00000499385.2_Missense_Mutation_p.D598H	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	664										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		AAATCATCATCAGAAAGAGAA	0.418																																							uc001uxu.1		NA																	0				ovary(1)|skin(1)	2						c.(1990-1992)GAT>CAT		kelch repeat and BTB (POZ) domain-containing 6							82.0	80.0	81.0					13																	41704658		2203	4300	6503	SO:0001583	missense	89890						protein binding	g.chr13:41704658C>G	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1990G>C	13.37:g.41704658C>G	ENSP00000368799:p.Asp664His		Somatic				KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Missense_Mutation_p.D598H|uc001uxv.1_5'Flank	p.D664H	NM_152903	NP_690867	WXS	Illumina HiSeq	Unspecified	Q86V97	KBTB6_HUMAN		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)	1	2279	-		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	664			Kelch 6.		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	c.1990G>C	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	c	28.8	4.955276	0.92726	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.79454	-1.17;-1.27	3.79	2.94	0.34122	.	0.084915	0.45126	D	0.000394	T	0.75265	0.3826	N	0.19112	0.55	0.36294	D	0.856608	D;D	0.67145	0.996;0.981	D;P	0.63192	0.912;0.819	T	0.79674	-0.1705	10	0.87932	D	0	.	9.0917	0.36614	0.0:0.8883:0.0:0.1117	.	598;664	F5GZN7;Q86V97	.;KBTB6_HUMAN	H	664;598	ENSP00000368799:D664H;ENSP00000444326:D598H	ENSP00000368799:D664H	D	-	1	0	KBTBD6	40602658	1.000000	0.71417	0.996000	0.52242	0.823000	0.46562	2.896000	0.48656	0.947000	0.37659	0.455000	0.32223	GAT		0.418	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903		14	22	0	0	0	0.00499	0	14	22				
RNASE1	6035	broad.mit.edu	37	14	21269841	21269841	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr14:21269841C>T	ENST00000397967.4	-	2	893	c.387G>A	c.(385-387)ccG>ccA	p.P129P	RNASE1_ENST00000412779.2_Silent_p.P129P|RNASE1_ENST00000555698.1_Silent_p.P89P|RNASE1_ENST00000397970.4_Silent_p.P129P|RNASE1_ENST00000340900.3_Silent_p.P129P	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	129					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	GTCTCTCCTTCGGGCTGGTCC	0.562																																							uc001vyf.2		NA																	0					0						c.(385-387)CCG>CCA		pancreatic ribonuclease precursor							162.0	142.0	149.0					14																	21269841		2203	4300	6503	SO:0001819	synonymous_variant	6035					extracellular region	nucleic acid binding|pancreatic ribonuclease activity|protein binding	g.chr14:21269841C>T	BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.387G>A	14.37:g.21269841C>T			Somatic				RNASE1_uc001vyg.2_Silent_p.P129P|RNASE1_uc001vyh.2_Silent_p.P129P|RNASE1_uc001vyi.2_Silent_p.P129P	p.P129P	NM_198232	NP_937875	WXS	Illumina HiSeq	Unspecified	P07998	RNAS1_HUMAN	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	2	563	-	all_cancers(95;0.00671)	all_lung(585;0.235)	129					B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Silent	SNP	ENST00000397967.4	37	c.387G>A	CCDS9559.1																																																																																				0.562	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3			29	63	0	0	0	0.012213	0	29	63				
FAM179B	23116	broad.mit.edu	37	14	45431675	45431675	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr14:45431675C>T	ENST00000361577.3	+	1	265	c.51C>T	c.(49-51)ctC>ctT	p.L17L	KLHL28_ENST00000355081.2_5'Flank|FAM179B_ENST00000361462.2_Silent_p.L17L|FAM179B_ENST00000382233.2_Silent_p.L17L|KLHL28_ENST00000553817.1_5'Flank|KLHL28_ENST00000396128.4_5'Flank	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	17										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						TTCCAGTCCTCTCTACCTATC	0.582																																							uc001wvv.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(49-51)CTC>CTT		hypothetical protein LOC23116							23.0	25.0	24.0					14																	45431675		2203	4300	6503	SO:0001819	synonymous_variant	23116						binding	g.chr14:45431675C>T	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.51C>T	14.37:g.45431675C>T			Somatic				FAM179B_uc001wvw.2_Silent_p.L17L|FAM179B_uc010anc.2_RNA|KLHL28_uc001wvq.2_5'Flank|KLHL28_uc001wvr.2_5'Flank|FAM179B_uc010anb.1_Silent_p.L17L|FAM179B_uc001wvu.2_Silent_p.L17L	p.L17L	NM_015091	NP_055906	WXS	Illumina HiSeq	Unspecified	Q9Y4F4	F179B_HUMAN			1	260	+			17					Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	c.51C>T	CCDS9681.1																																																																																				0.582	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		7	17	0	0	0	0.001984	0	7	17				
ADCK1	57143	broad.mit.edu	37	14	78399726	78399726	+	Missense_Mutation	SNP	C	C	G	rs141850399		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr14:78399726C>G	ENST00000238561.5	+	11	1663	c.1564C>G	c.(1564-1566)Cca>Gca	p.P522A	ADCK1_ENST00000556560.1_3'UTR|ADCK1_ENST00000341211.5_Missense_Mutation_p.P454A	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	529						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GTTCCCTGCTCCACTCTGAGT	0.557																																							uc001xui.2		NA																	0				stomach(2)|ovary(1)	3						c.(1564-1566)CCA>GCA		aarF domain containing kinase 1 isoform a		C	ALA/PRO,ALA/PRO	1,4405	2.1+/-5.4	0,1,2202	133.0	121.0	125.0		1360,1564	0.9	0.0	14	dbSNP_134	125	0,8600		0,0,4300	no	missense,missense	ADCK1	NM_001142545.1,NM_020421.3	27,27	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	454/456,522/524	78399726	1,13005	2203	4300	6503	SO:0001583	missense	57143					extracellular region	ATP binding|protein serine/threonine kinase activity	g.chr14:78399726C>G	AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1564C>G	14.37:g.78399726C>G	ENSP00000238561:p.Pro522Ala		Somatic				ADCK1_uc001xuj.2_Missense_Mutation_p.P454A|ADCK1_uc001xul.2_Missense_Mutation_p.P229A	p.P522A	NM_020421	NP_065154	WXS	Illumina HiSeq	Unspecified	Q86TW2	ADCK1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)	11	1663	+			529					B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	ENST00000238561.5	37	c.1564C>G	CCDS9869.1	.	.	.	.	.	.	.	.	.	.	C	3.558	-0.090218	0.07053	2.27E-4	0.0	ENSG00000063761	ENST00000238561;ENST00000341211	T;T	0.66280	-0.2;1.2	5.05	0.925	0.19424	.	0.589703	0.17459	N	0.173516	T	0.47414	0.1444	L	0.51422	1.61	0.09310	N	1	B;B;B	0.20368	0.044;0.009;0.015	B;B;B	0.15870	0.014;0.006;0.013	T	0.43540	-0.9385	10	0.56958	D	0.05	-47.5804	1.2328	0.01946	0.1503:0.3674:0.1302:0.3521	.	529;454;522	Q86TW2;Q9UIE6;Q86TW2-2	ADCK1_HUMAN;.;.	A	522;454	ENSP00000238561:P522A;ENSP00000339663:P454A	ENSP00000238561:P522A	P	+	1	0	ADCK1	77469479	0.005000	0.15991	0.000000	0.03702	0.078000	0.17371	0.239000	0.18023	-0.013000	0.14199	-0.150000	0.13652	CCA		0.557	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1	NM_020421		4	120	0	0	0	0.001168	0	4	120				
TCL1A	8115	broad.mit.edu	37	14	96178093	96178093	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr14:96178093C>T	ENST00000402399.1	-	3	473	c.344G>A	c.(343-345)tGa>tAa	p.*115*	TCL1A_ENST00000555202.1_Silent_p.*115*|TCL1A_ENST00000554012.1_Silent_p.*115*|TCL1A_ENST00000556450.1_Silent_p.*115*|RP11-164H13.1_ENST00000547644.2_RNA|RP11-164H13.1_ENST00000553445.1_RNA	NM_021966.2	NP_068801.1	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	0					multicellular organismal development (GO:0007275)|stem cell maintenance (GO:0019827)	cell cortex (GO:0005938)|endoplasmic reticulum (GO:0005783)|pronucleus (GO:0045120)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		CACCATACATCAGTCATCTGG	0.557			T	TRA@	T-CLL																																Ovarian(96;1068 2019 35393 39316)	Ovarian(96;1068 2019 35393 39316)	uc001yfc.3		NA		Dom	yes		14	14q32.1	8115	T	T-cell leukemia/lymphoma 1A			L	TRA@		T-CLL		0				lung(1)	1						c.(343-345)TGA>TAA		T-cell leukemia/lymphoma 1A							121.0	86.0	98.0					14																	96178093		2203	4300	6503	SO:0001819	synonymous_variant	8115				multicellular organismal development	endoplasmic reticulum|microsome		g.chr14:96178093C>T	X82240	CCDS9941.1	14q32.1	2008-07-03				ENSG00000100721			11648	protein-coding gene	gene with protein product		186960				2783489, 7809072	Standard	NM_021966		Approved	TCL1	uc001yfb.4	P56279		ENST00000402399.1:c.344G>A	14.37:g.96178093C>T			Somatic				TCL1A_uc001yfb.3_Silent_p.*115*	p.*115*	NM_001098725	NP_001092195	WXS	Illumina HiSeq	Unspecified	P56279	TCL1A_HUMAN		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)	3	474	-		all_cancers(154;0.103)	115					Q6IBK7	Silent	SNP	ENST00000402399.1	37	c.344G>A	CCDS9941.1																																																																																				0.557	TCL1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413246.1			9	13	0	0	0	0.006214	0	9	13				
TMEM87A	25963	broad.mit.edu	37	15	42510006	42510006	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:42510006C>T	ENST00000389834.4	-	19	1885	c.1621G>A	c.(1621-1623)Gat>Aat	p.D541N	TMEM87A_ENST00000448392.1_Missense_Mutation_p.D480N|RP11-546B15.1_ENST00000563846.1_RNA	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	541						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		CCAACCTCATCTGAATCCAGA	0.343																																							uc010udd.1		NA																	0				ovary(1)	1						c.(1621-1623)GAT>AAT		transmembrane protein 87A isoform 1							72.0	72.0	72.0					15																	42510006		2203	4298	6501	SO:0001583	missense	25963					integral to membrane		g.chr15:42510006C>T	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.1621G>A	15.37:g.42510006C>T	ENSP00000374484:p.Asp541Asn		Somatic					p.D541N	NM_015497	NP_056312	WXS	Illumina HiSeq	Unspecified	Q8NBN3	TM87A_HUMAN		GBM - Glioblastoma multiforme(94;1.03e-06)	19	1780	-		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	541					Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	ENST00000389834.4	37	c.1621G>A	CCDS32205.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645325	0.87859	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305	.	.	.	4.77	4.77	0.60923	.	0.058714	0.64402	D	0.000002	T	0.80110	0.4563	M	0.79805	2.47	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	T	0.83156	-0.0101	9	0.87932	D	0	-15.3375	18.3519	0.90340	0.0:1.0:0.0:0.0	.	541	Q8NBN3	TM87A_HUMAN	N	541;480;517	.	ENSP00000374484:D541N	D	-	1	0	TMEM87A	40297298	1.000000	0.71417	1.000000	0.80357	0.590000	0.36582	6.974000	0.76122	2.638000	0.89438	0.462000	0.41574	GAT		0.343	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	NM_015497		36	54	0	0	0	0.011902	0	36	54				
UBR1	197131	broad.mit.edu	37	15	43328728	43328728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:43328728G>A	ENST00000290650.4	-	18	2164	c.2086C>T	c.(2086-2088)Cag>Tag	p.Q696*	UBR1_ENST00000382177.2_Nonsense_Mutation_p.Q696*	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	696					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATAGGTACCTGAAGCATGATG	0.269																																							uc001zqq.2		NA																	0				lung(1)	1						c.(2086-2088)CAG>TAG		ubiquitin protein ligase E3 component n-recognin							85.0	91.0	89.0					15																	43328728		2199	4285	6484	SO:0001587	stop_gained	197131				cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding	g.chr15:43328728G>A		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.2086C>T	15.37:g.43328728G>A	ENSP00000290650:p.Gln696*		Somatic				UBR1_uc010udk.1_Nonsense_Mutation_p.Q696*	p.Q696*	NM_174916	NP_777576	WXS	Illumina HiSeq	Unspecified	Q8IWV7	UBR1_HUMAN		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)	18	2152	-		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)	696					O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Nonsense_Mutation	SNP	ENST00000290650.4	37	c.2086C>T	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182991	0.78677	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	.	.	.	4.58	3.66	0.41972	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.2769	11.6388	0.51220	0.0863:0.0:0.9137:0.0	.	.	.	.	X	696	.	ENSP00000290650:Q696X	Q	-	1	0	UBR1	41116020	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.880000	0.92407	1.144000	0.42321	0.591000	0.81541	CAG		0.269	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916		36	74	0	0	0	0.007835	0	36	74				
GNB5	10681	broad.mit.edu	37	15	52433340	52433340	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:52433340C>T	ENST00000261837.7	-	7	689	c.624G>A	c.(622-624)atG>atA	p.M208I	GNB5_ENST00000559348.1_5'Flank|GNB5_ENST00000396335.4_Intron|CTD-2184D3.7_ENST00000560613.1_RNA|GNB5_ENST00000358784.7_Missense_Mutation_p.M166I|CTD-2184D3.7_ENST00000557898.1_RNA	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	208					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		TATTTACCTGCATGTCAGAGT	0.507																																							uc002abt.1		NA																	0				lung(1)	1						c.(622-624)ATG>ATA		guanine nucleotide-binding protein, beta-5							111.0	100.0	104.0					15																	52433340		2195	4293	6488	SO:0001583	missense	10681					heterotrimeric G-protein complex	GTPase activity|signal transducer activity	g.chr15:52433340C>T	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.624G>A	15.37:g.52433340C>T	ENSP00000261837:p.Met208Ile		Somatic				GNB5_uc002abr.1_Missense_Mutation_p.M166I|GNB5_uc002abs.1_Intron	p.M208I	NM_016194	NP_057278	WXS	Illumina HiSeq	Unspecified	O14775	GBB5_HUMAN		all cancers(107;0.0163)	7	689	-			208			WD 3.		B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	37	c.624G>A	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.348038	0.61183	.	.	ENSG00000069966	ENST00000261837;ENST00000396335	T	0.59906	0.23	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64472	0.2601	L	0.28192	0.835	0.80722	D	1	P	0.51933	0.949	D	0.63488	0.915	T	0.62572	-0.6826	10	0.37606	T	0.19	-40.1048	18.8498	0.92224	0.0:1.0:0.0:0.0	.	208	O14775	GBB5_HUMAN	I	208;166	ENSP00000261837:M208I	ENSP00000261837:M208I	M	-	3	0	GNB5	50220632	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.483000	0.81158	2.681000	0.91329	0.561000	0.74099	ATG		0.507	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1			15	64	0	0	0	0.00278	0	15	64				
CSNK1G1	53944	broad.mit.edu	37	15	64506298	64506298	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:64506298G>A	ENST00000303052.7	-	6	893	c.470C>T	c.(469-471)tCa>tTa	p.S157L	CSNK1G1_ENST00000607537.1_Missense_Mutation_p.S157L|CTD-2116N17.1_ENST00000606793.1_Missense_Mutation_p.S139L|CSNK1G1_ENST00000303032.6_Missense_Mutation_p.S157L	NM_022048.3	NP_071331.2	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	13						GAGGTTCTTTGAGTGCACGTA	0.373																																							uc002anf.2		NA																	0					0						c.(469-471)TCA>TTA		casein kinase 1, gamma 1							181.0	167.0	172.0					15																	64506298		2203	4300	6503	SO:0001583	missense	53944				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr15:64506298G>A	AB042562	CCDS10192.2	15q22.1-q22.31	2013-01-17			ENSG00000169118	ENSG00000169118			2454	protein-coding gene	gene with protein product		606274				11124537	Standard	NM_022048		Approved	CK1gamma1	uc002anf.3	Q9HCP0	OTTHUMG00000133019	ENST00000303052.7:c.470C>T	15.37:g.64506298G>A	ENSP00000305777:p.Ser157Leu		Somatic				CSNK1G1_uc002ane.2_RNA|CSNK1G1_uc002ang.1_Missense_Mutation_p.S157L|CSNK1G1_uc002anh.1_Missense_Mutation_p.S157L|CSNK1G1_uc002anj.2_Missense_Mutation_p.S139L	p.S157L	NM_022048	NP_071331	WXS	Illumina HiSeq	Unspecified	Q9HCP0	KC1G1_HUMAN			6	950	-			157			Protein kinase.		Q5JPH1|Q96AE9|Q9HCP1	Missense_Mutation	SNP	ENST00000303052.7	37	c.470C>T	CCDS10192.2	.	.	.	.	.	.	.	.	.	.	G	34	5.363545	0.95877	.	.	ENSG00000169118	ENST00000303052;ENST00000447727;ENST00000303032	T;T	0.24538	1.85;1.85	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.120909	0.64402	D	0.000017	T	0.54382	0.1855	M	0.75884	2.315	0.80722	D	1	D;P;P;P	0.69078	0.997;0.739;0.78;0.78	D;B;P;P	0.76575	0.988;0.414;0.55;0.55	T	0.55335	-0.8157	10	0.87932	D	0	.	19.6381	0.95746	0.0:0.0:1.0:0.0	.	15;157;157;157	Q9H5M4;Q9HCP0-2;Q8IXA3;Q9HCP0	.;.;.;KC1G1_HUMAN	L	157;113;157	ENSP00000305777:S157L;ENSP00000307753:S157L	ENSP00000307753:S157L	S	-	2	0	CSNK1G1	62293351	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.813000	0.99286	2.803000	0.96430	0.585000	0.79938	TCA		0.373	CSNK1G1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256605.1	NM_022048		31	118	0	0	0	0.007835	0	31	118				
LMAN1L	79748	broad.mit.edu	37	15	75115958	75115958	+	Missense_Mutation	SNP	G	G	A	rs551657514		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:75115958G>A	ENST00000309664.5	+	12	1397	c.1258G>A	c.(1258-1260)Gag>Aag	p.E420K	CPLX3_ENST00000395018.4_5'Flank|RP11-414J4.2_ENST00000564823.1_RNA|LMAN1L_ENST00000379709.3_Missense_Mutation_p.E408K	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	420						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGTGGGCATTGAGCATCATTT	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		19271	0.001		0.0	False		,,,				2504	0.0						uc002ayt.1		NA																	0					0						c.(1258-1260)GAG>AAG		lectin, mannose-binding, 1 like precursor							69.0	65.0	66.0					15																	75115958		2197	4295	6492	SO:0001583	missense	79748					ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding	g.chr15:75115958G>A	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.1258G>A	15.37:g.75115958G>A	ENSP00000310431:p.Glu420Lys		Somatic				LMAN1L_uc010bke.1_Missense_Mutation_p.E408K|CPLX3_uc002ayu.1_5'Flank	p.E420K	NM_021819	NP_068591	WXS	Illumina HiSeq	Unspecified	Q9HAT1	LMA1L_HUMAN			12	1260	+			420			Lumenal (Potential).		Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	37	c.1258G>A	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023185	0.35701	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.37235	1.26;1.21	5.02	-0.659	0.11424	.	1.192850	0.06079	N	0.661527	T	0.15305	0.0369	N	0.04880	-0.145	0.25629	N	0.986329	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.25676	-1.0125	10	0.02654	T	1	.	8.1522	0.31148	0.6671:0.0:0.3329:0.0	.	408;420	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	K	420;408	ENSP00000310431:E420K;ENSP00000369031:E408K	ENSP00000310431:E420K	E	+	1	0	LMAN1L	72903011	0.326000	0.24669	0.956000	0.39512	0.799000	0.45148	-0.326000	0.07965	-0.317000	0.08677	0.561000	0.74099	GAG		0.597	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4			17	62	0	0	0	0.007413	0	17	62				
GOLGA6C	653641	broad.mit.edu	37	15	75562495	75562495	+	Silent	SNP	G	G	T	rs138154232	byFrequency	TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:75562495G>T	ENST00000300576.5	+	18	2037	c.2037G>T	c.(2035-2037)ccG>ccT	p.P679P	RN7SL489P_ENST00000486185.2_RNA	NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	679						Golgi apparatus (GO:0005794)				ovary(1)	1						ACAACCCCCCGGTACAGCAGA	0.602													N|||	184	0.0367412	0.1339	0.0086	5008	,	,		17187	0.0		0.001	False		,,,				2504	0.0						uc002azs.1		NA																	0				ovary(1)	1						c.(1999-2001)CCG>CCT		golgi autoantigen, golgin subfamily a, 6D							52.0	65.0	61.0					15																	75562495		652	1575	2227	SO:0001819	synonymous_variant	653641							g.chr15:75562495G>T		CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.2037G>T	15.37:g.75562495G>T			Somatic				uc002azu.1_5'Flank|uc010ulz.1_5'Flank	p.P667P	NM_001145224	NP_001138696	WXS	Illumina HiSeq	Unspecified	A6NDK9	GOG6C_HUMAN			18	2078	+			679						Silent	SNP	ENST00000300576.5	37	c.2001G>T	CCDS58388.1																																																																																				0.602	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419797.1	NM_001164404		5	71	1	0	5.9392e-07	0.001168	6.22892e-07	5	71				
IREB2	3658	broad.mit.edu	37	15	78777160	78777160	+	Missense_Mutation	SNP	C	C	T	rs149176868		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:78777160C>T	ENST00000258886.8	+	12	1620	c.1471C>T	c.(1471-1473)Cat>Tat	p.H491Y	RP11-650L12.1_ENST00000560094.1_RNA	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	491					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TGTCTCCATTCATTATGAAGG	0.353																																					NSCLC(200;764 2208 35157 49871 50830)	NSCLC(200;764 2208 35157 49871 50830)	uc002bdr.2		NA																	0					0						c.(1471-1473)CAT>TAT		iron-responsive element binding protein 2							116.0	101.0	106.0					15																	78777160		2196	4293	6489	SO:0001583	missense	3658						4 iron, 4 sulfur cluster binding|metal ion binding|protein binding	g.chr15:78777160C>T	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.1471C>T	15.37:g.78777160C>T	ENSP00000258886:p.His491Tyr		Somatic				IREB2_uc010unb.1_Missense_Mutation_p.H241Y	p.H491Y	NM_004136	NP_004127	WXS	Illumina HiSeq	Unspecified	P48200	IREB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (272;0.232)	12	1633	+			491					A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	37	c.1471C>T	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365500	0.41902	.	.	ENSG00000136381	ENST00000258886	T	0.41065	1.01	6.02	4.06	0.47325	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.695549	0.16266	N	0.222012	T	0.35711	0.0941	L	0.27053	0.805	0.80722	D	1	B	0.22146	0.065	B	0.25405	0.06	T	0.10590	-1.0623	10	0.56958	D	0.05	.	16.9754	0.86311	0.0:0.5056:0.4944:0.0	.	491	P48200	IREB2_HUMAN	Y	491	ENSP00000258886:H491Y	ENSP00000258886:H491Y	H	+	1	0	IREB2	76564215	0.648000	0.27313	0.039000	0.18376	0.962000	0.63368	0.607000	0.24209	0.800000	0.34041	0.650000	0.86243	CAT		0.353	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136		4	63	0	0	0	0.009096	0	4	63				
FSD2	123722	broad.mit.edu	37	15	83455853	83455853	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:83455853C>T	ENST00000334574.8	-	2	471	c.290G>A	c.(289-291)aGa>aAa	p.R97K	FSD2_ENST00000541889.1_Missense_Mutation_p.R97K			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	97										breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						AACCCCTGTTCTGGGTATGTT	0.468																																							uc002bjd.2		NA																	0				central_nervous_system(1)	1						c.(289-291)AGA>AAA		fibronectin type III and SPRY domain containing							106.0	108.0	107.0					15																	83455853		1917	4142	6059	SO:0001583	missense	123722							g.chr15:83455853C>T	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.290G>A	15.37:g.83455853C>T	ENSP00000335651:p.Arg97Lys		Somatic				FSD2_uc010uol.1_Missense_Mutation_p.R97K|FSD2_uc010uom.1_Missense_Mutation_p.R97K	p.R97K	NM_001007122	NP_001007123	WXS	Illumina HiSeq	Unspecified	A1L4K1	FSD2_HUMAN			2	457	-			97					B3KVG1|B7ZM02	Missense_Mutation	SNP	ENST00000334574.8	37	c.290G>A	CCDS45332.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807876	0.31961	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.43688	0.94;0.94	4.63	3.71	0.42584	.	0.565699	0.15623	N	0.252763	T	0.30448	0.0765	L	0.54323	1.7	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.11329	0.004;0.006	T	0.38520	-0.9657	10	0.02654	T	1	-1.1243	6.5682	0.22523	0.0:0.6813:0.1507:0.1681	.	97;97	B7ZM02;A1L4K1	.;FSD2_HUMAN	K	97	ENSP00000335651:R97K;ENSP00000444078:R97K	ENSP00000335651:R97K	R	-	2	0	FSD2	81252907	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.027000	0.12371	1.174000	0.42811	0.655000	0.94253	AGA		0.468	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122		30	112	0	0	0	0.010818	0	30	112				
KIF7	374654	broad.mit.edu	37	15	90173628	90173628	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr15:90173628G>A	ENST00000394412.3	-	16	3284	c.3208C>T	c.(3208-3210)Ctt>Ttt	p.L1070F	KIF7_ENST00000558928.1_5'Flank	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1070					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GAGGCCCGAAGCACCCGCTGG	0.592																																							uc002bof.2		NA																	0				ovary(2)|lung(1)	3						c.(3208-3210)CTT>TTT		kinesin family member 7							60.0	55.0	57.0					15																	90173628		2200	4299	6499	SO:0001583	missense	374654				microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding	g.chr15:90173628G>A	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3208C>T	15.37:g.90173628G>A	ENSP00000377934:p.Leu1070Phe		Somatic				KIF7_uc010upw.1_Missense_Mutation_p.L556F|C15orf42_uc010upv.1_RNA	p.L1070F	NM_198525	NP_940927	WXS	Illumina HiSeq	Unspecified	Q2M1P5	KIF7_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.128)		16	3285	-	Lung NSC(78;0.0237)|all_lung(78;0.0478)		1070					Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	37	c.3208C>T	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452080	0.84209	.	.	ENSG00000166813	ENST00000394412	T	0.73575	-0.76	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000001	D	0.83751	0.5322	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.84349	0.0531	10	0.54805	T	0.06	.	9.5492	0.39299	0.1569:0.0:0.8431:0.0	.	556;1070	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	F	1070	ENSP00000377934:L1070F	ENSP00000377934:L1070F	L	-	1	0	KIF7	87974632	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.673000	0.68109	2.422000	0.82143	0.462000	0.41574	CTT		0.592	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525		3	33	0	0	0	0.004672	0	3	33				
PKD1	5310	broad.mit.edu	37	16	2161870	2161870	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr16:2161870C>T	ENST00000262304.4	-	15	3506	c.3298G>A	c.(3298-3300)Gag>Aag	p.E1100K	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.E1100K	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1100	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGGAGGTACTCACCTGTGGGG	0.706																																							uc002cos.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(3298-3300)GAG>AAG		polycystin 1 isoform 1 precursor							23.0	24.0	24.0					16																	2161870		2185	4294	6479	SO:0001583	missense	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2161870C>T	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3298G>A	16.37:g.2161870C>T	ENSP00000262304:p.Glu1100Lys		Somatic				PKD1_uc002cot.1_Missense_Mutation_p.E1100K	p.E1100K	NM_001009944	NP_001009944	WXS	Illumina HiSeq	Unspecified	P98161	PKD1_HUMAN			15	3507	-			1100			PKD 5.|Extracellular (Potential).		Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	c.3298G>A	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	c	14.64	2.594622	0.46214	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.61859	0.07;0.07	5.66	5.66	0.87406	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (4);	0.377447	0.28560	N	0.014919	T	0.68842	0.3045	M	0.62723	1.935	0.31445	N	0.671548	P;P	0.44429	0.835;0.775	P;P	0.52066	0.493;0.689	T	0.69075	-0.5241	10	0.34782	T	0.22	.	19.7717	0.96369	0.0:1.0:0.0:0.0	.	1100;1100	P98161-3;P98161	.;PKD1_HUMAN	K	1100;1100;815	ENSP00000262304:E1100K;ENSP00000399501:E1100K	ENSP00000262304:E1100K	E	-	1	0	PKD1	2101871	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	5.251000	0.65438	2.671000	0.90904	0.645000	0.84053	GAG		0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			7	29	0	0	0	0.006214	0	7	29				
ITGAM	3684	broad.mit.edu	37	16	31309257	31309257	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr16:31309257C>G	ENST00000287497.8	+	14	1764	c.1689C>G	c.(1687-1689)atC>atG	p.I563M	ITGAM_ENST00000544665.3_Missense_Mutation_p.I564M			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	563					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GATCTGGCATCAGCCCCTCCC	0.557																																							uc002ebq.2		NA																	0				kidney(1)	1						c.(1687-1689)ATC>ATG		integrin alpha M isoform 2 precursor							50.0	53.0	52.0					16																	31309257		2194	4299	6493	SO:0001583	missense	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31309257C>G	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1689C>G	16.37:g.31309257C>G	ENSP00000287497:p.Ile563Met		Somatic				ITGAM_uc002ebr.2_Missense_Mutation_p.I564M|ITGAM_uc010cam.1_Intron|ITGAM_uc010can.2_Intron	p.I563M	NM_000632	NP_000623	WXS	Illumina HiSeq	Unspecified	P11215	ITAM_HUMAN			14	1787	+			563			FG-GAP 6.|Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	c.1689C>G	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	C	3.154	-0.173514	0.06421	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.55930	0.49;0.49	4.0	0.919	0.19392	.	.	.	.	.	T	0.58004	0.2092	M	0.89601	3.045	0.28810	N	0.898291	P;P	0.39717	0.684;0.684	B;B	0.40864	0.235;0.342	T	0.55805	-0.8083	9	0.51188	T	0.08	.	6.3304	0.21266	0.0:0.6743:0.0:0.3257	.	563;563	Q4VAK1;P11215	.;ITAM_HUMAN	M	564;563	ENSP00000441691:I564M;ENSP00000287497:I563M	ENSP00000287497:I563M	I	+	3	3	ITGAM	31216758	0.016000	0.18221	0.030000	0.17652	0.086000	0.17979	0.079000	0.14782	0.113000	0.18004	0.655000	0.94253	ATC		0.557	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		10	39	0	0	0	0.006214	0	10	39				
MARVELD3	91862	broad.mit.edu	37	16	71674454	71674454	+	Missense_Mutation	SNP	C	C	T	rs140602857		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr16:71674454C>T	ENST00000299952.4	+	3	800	c.757C>T	c.(757-759)Cgg>Tgg	p.R253W	PHLPP2_ENST00000540628.1_3'UTR|MARVELD3_ENST00000561682.1_Intron|MARVELD3_ENST00000565261.1_3'UTR	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	256	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				AGAGCAGGTTCGGCAGCTGGA	0.577																																							uc002fau.2		NA																	0				skin(1)	1						c.(757-759)CGG>TGG		MARVEL domain containing 3 isoform 1							94.0	79.0	84.0					16																	71674454		2198	4300	6498	SO:0001583	missense	91862					integral to membrane		g.chr16:71674454C>T	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.757C>T	16.37:g.71674454C>T	ENSP00000299952:p.Arg253Trp		Somatic				PHLPP2_uc002fav.2_RNA|MARVELD3_uc010cge.2_3'UTR	p.R253W	NM_001017967	NP_001017967	WXS	Illumina HiSeq	Unspecified	Q96A59	MALD3_HUMAN			3	820	+		Ovarian(137;0.125)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000299952.4	37	c.757C>T	CCDS32478.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458110	0.84317	.	.	ENSG00000140832	ENST00000299952	D	0.87412	-2.25	5.79	5.79	0.91817	.	0.108147	0.64402	D	0.000005	D	0.93706	0.7989	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.94050	0.7317	9	0.87932	D	0	-30.1813	17.535	0.87827	0.0:1.0:0.0:0.0	.	253	Q96A59-2	.	W	253	ENSP00000299952:R253W	ENSP00000299952:R253W	R	+	1	2	MARVELD3	70231955	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	2.938000	0.48987	2.739000	0.93911	0.655000	0.94253	CGG		0.577	MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268990.1	NM_052858		23	90	0	0	0	0.005443	0	23	90				
TCF25	22980	broad.mit.edu	37	16	89964965	89964965	+	Splice_Site	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr16:89964965G>C	ENST00000263346.8	+	10	1079	c.1023G>C	c.(1021-1023)agG>agC	p.R341S	TCF25_ENST00000263347.7_Splice_Site_p.R106S	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	341					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		TTGGATCTAGGAGCTTCTACC	0.577																																							uc002fpb.2		NA																	0					0						c.(1021-1023)AGG>AGC		NULP1							86.0	100.0	95.0					16																	89964965		2198	4300	6498	SO:0001630	splice_region_variant	22980				heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr16:89964965G>C	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1023-1G>C	16.37:g.89964965G>C			Somatic				TCF25_uc002fpc.2_Missense_Mutation_p.R106S	p.R341S	NM_014972	NP_055787	WXS	Illumina HiSeq	Unspecified	Q9BQ70	TCF25_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0288)	10	1105	+		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)	341					Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	37	c.1023G>C	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006880	0.74932	.	.	ENSG00000141002	ENST00000263346;ENST00000263347	T;T	0.73152	-0.72;-0.72	5.63	3.66	0.41972	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.84392	0.5462	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.85667	0.1292	9	.	.	.	.	9.2499	0.37549	0.2041:0.0:0.7959:0.0	.	106;341	Q9H384;Q9BQ70	.;TCF25_HUMAN	S	341;106	ENSP00000263346:R341S;ENSP00000263347:R106S	.	R	+	3	2	TCF25	88492466	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	5.381000	0.66208	2.654000	0.90174	0.561000	0.74099	AGG		0.577	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	Missense_Mutation	48	145	0	0	0	0.01441	0	48	145				
SRR	63826	broad.mit.edu	37	17	2224685	2224685	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:2224685G>C	ENST00000344595.5	+	5	803	c.485G>C	c.(484-486)gGa>gCa	p.G162A	SRR_ENST00000576848.1_Intron	NM_021947.1	NP_068766.1	Q9GZT4	SRR_HUMAN	serine racemase	162					aging (GO:0007568)|brain development (GO:0007420)|D-serine biosynthetic process (GO:0070179)|D-serine metabolic process (GO:0070178)|L-serine metabolic process (GO:0006563)|protein homotetramerization (GO:0051289)|pyruvate biosynthetic process (GO:0042866)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|serine family amino acid metabolic process (GO:0009069)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|D-serine ammonia-lyase activity (GO:0008721)|glycine binding (GO:0016594)|L-serine ammonia-lyase activity (GO:0003941)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|serine racemase activity (GO:0030378)|threonine racemase activity (GO:0018114)			NS(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)	GTGATAGCTGGACAAGGGACA	0.413																																							uc002fue.1		NA																	0					0						c.(484-486)GGA>GCA		serine racemase	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)						100.0	105.0	103.0					17																	2224685		2203	4300	6503	SO:0001583	missense	63826				D-serine biosynthetic process|L-serine metabolic process|protein homotetramerization|pyruvate biosynthetic process|response to lipopolysaccharide	cytoplasm|neuronal cell body|soluble fraction	ATP binding|calcium ion binding|D-serine ammonia-lyase activity|glycine binding|L-serine ammonia-lyase activity|magnesium ion binding|PDZ domain binding|protein homodimerization activity|pyridoxal phosphate binding|serine racemase activity|threonine racemase activity	g.chr17:2224685G>C	AF169974	CCDS11017.1	17p13	2007-01-18			ENSG00000167720	ENSG00000167720			14398	protein-coding gene	gene with protein product		606477				17067558, 15953485, 15193426	Standard	NM_021947		Approved	ILV1, ISO1	uc002fue.1	Q9GZT4	OTTHUMG00000090583	ENST00000344595.5:c.485G>C	17.37:g.2224685G>C	ENSP00000339435:p.Gly162Ala		Somatic				SRR_uc002fui.1_Missense_Mutation_p.G13A	p.G162A	NM_021947	NP_068766	WXS	Illumina HiSeq	Unspecified	Q9GZT4	SRR_HUMAN		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	5	553	+		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)	162					D3DTI5|Q6IA55	Missense_Mutation	SNP	ENST00000344595.5	37	c.485G>C	CCDS11017.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546721	0.86022	.	.	ENSG00000167720	ENST00000344595	D	0.98649	-5.05	5.86	5.86	0.93980	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.99456	0.9807	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98565	1.0643	10	0.87932	D	0	-0.1439	19.1813	0.93625	0.0:0.0:1.0:0.0	.	162	Q9GZT4	SRR_HUMAN	A	162	ENSP00000339435:G162A	ENSP00000339435:G162A	G	+	2	0	SRR	2171435	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.269000	0.72558	2.771000	0.95319	0.563000	0.77884	GGA		0.413	SRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207129.2	NM_021947		27	70	0	0	0	0.00632	0	27	70				
ALOX15B	247	broad.mit.edu	37	17	7950584	7950584	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:7950584C>G	ENST00000380183.4	+	11	1605	c.1466C>G	c.(1465-1467)tCt>tGt	p.S489C	ALOX15B_ENST00000572022.1_Intron|ALOX15B_ENST00000380173.2_Missense_Mutation_p.S460C|ALOX15B_ENST00000573359.1_Intron	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	489	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						AGCTTTGTCTCTGAAATCATC	0.532																																							uc002gju.2		NA																	0				ovary(1)	1						c.(1465-1467)TCT>TGT		arachidonate 15-lipoxygenase, second type							118.0	119.0	119.0					17																	7950584		2203	4300	6503	SO:0001583	missense	247				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity	g.chr17:7950584C>G	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1466C>G	17.37:g.7950584C>G	ENSP00000369530:p.Ser489Cys		Somatic				ALOX15B_uc002gjv.2_Missense_Mutation_p.S460C|ALOX15B_uc002gjw.2_Intron|ALOX15B_uc010vun.1_Intron|ALOX15B_uc010cnp.2_Missense_Mutation_p.S295C	p.S489C	NM_001141	NP_001132	WXS	Illumina HiSeq	Unspecified	O15296	LX15B_HUMAN			11	1582	+			489			Lipoxygenase.		D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	c.1466C>G	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972164	0.74246	.	.	ENSG00000179593	ENST00000380173;ENST00000380183	D;D	0.90676	-2.71;-2.71	3.84	3.84	0.44239	Lipoxygenase, C-terminal (3);	0.403945	0.27744	N	0.018022	D	0.95671	0.8592	M	0.89095	3.005	0.40222	D	0.977748	D;D	0.89917	1.0;1.0	D;D	0.77557	0.973;0.99	D	0.96859	0.9631	10	0.87932	D	0	-32.1445	15.0651	0.71986	0.0:1.0:0.0:0.0	.	460;489	O15296-4;O15296	.;LX15B_HUMAN	C	460;489	ENSP00000369520:S460C;ENSP00000369530:S489C	ENSP00000369520:S460C	S	+	2	0	ALOX15B	7891309	0.000000	0.05858	0.978000	0.43139	0.751000	0.42716	1.119000	0.31258	2.148000	0.66965	0.655000	0.94253	TCT		0.532	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2			76	68	0	0	0	0.01441	0	76	68				
ZNF286B	729288	broad.mit.edu	37	17	18565946	18565946	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:18565946C>G	ENST00000545289.1	-	5	1123	c.873G>C	c.(871-873)caG>caC	p.Q291H	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						TATGAGTTCTCTGGTGTTTAG	0.403																																							uc010vyd.1		NA																	0					0						c.(871-873)CAG>CAC		zinc finger protein 286B							28.0	28.0	28.0					17																	18565946		692	1591	2283	SO:0001583	missense	729288				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:18565946C>G		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.873G>C	17.37:g.18565946C>G	ENSP00000461413:p.Gln291His		Somatic					p.Q291H	NM_001145045	NP_001138517	WXS	Illumina HiSeq	Unspecified	P0CG31	Z286B_HUMAN			5	1124	-			291			C2H2-type 2.			Missense_Mutation	SNP	ENST00000545289.1	37	c.873G>C	CCDS58523.1																																																																																				0.403	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047		9	48	0	0	0	0.010729	0	9	48				
KRT37	8688	broad.mit.edu	37	17	39579083	39579083	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:39579083G>A	ENST00000225550.3	-	3	678	c.679C>T	c.(679-681)Cag>Tag	p.Q227*	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	227	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				GACTCCTGCTGGGCCTCCAGG	0.667																																							uc002hwp.1		NA																	0				skin(1)	1						c.(679-681)CAG>TAG		keratin 37							62.0	54.0	57.0					17																	39579083		2203	4300	6503	SO:0001587	stop_gained	8688					intermediate filament	structural molecule activity	g.chr17:39579083G>A	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.679C>T	17.37:g.39579083G>A	ENSP00000225550:p.Gln227*		Somatic				uc002hwo.1_Intron	p.Q227*	NM_003770	NP_003761	WXS	Illumina HiSeq	Unspecified	O76014	KRT37_HUMAN			3	726	-		Breast(137;0.000496)	227			Rod.|Coil 1B.			Nonsense_Mutation	SNP	ENST00000225550.3	37	c.679C>T	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	32	5.128865	0.94473	.	.	ENSG00000108417	ENST00000225550	.	.	.	4.86	4.86	0.63082	.	0.000000	0.44285	D	0.000478	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.9589	0.86267	0.0:0.0:1.0:0.0	.	.	.	.	X	227	.	ENSP00000225550:Q227X	Q	-	1	0	KRT37	36832609	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.882000	0.56160	2.253000	0.74438	0.655000	0.94253	CAG		0.667	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		10	36	0	0	0	0.00245	0	10	36				
CNTD1	124817	broad.mit.edu	37	17	40957871	40957872	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:40957871_40957872GG>CT	ENST00000588408.1	+	4	825_826	c.549_550GG>CT	c.(547-552)ctGGca>ctCTca	p.A184S	CNTD1_ENST00000588527.1_Missense_Mutation_p.A101S|CNTD1_ENST00000315066.5_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	184										central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCACTCCCCTGGCATATGTGGA	0.455																																							uc002ibm.3		NA																	0				central_nervous_system(1)	1						c.(547-552)CTGGCA>CTCTCA		cyclin N-terminal domain containing 1																																				SO:0001583	missense	124817							g.chr17:40957871_40957872GG>CT	AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		Exception_encountered	17.37:g.40957871_40957872delinsCT	ENSP00000465204:p.Ala184Ser		Somatic				CNTD1_uc010wha.1_Missense_Mutation_p.A101S	p.A184S	NM_173478	NP_775749	WXS	Illumina HiSeq	Unspecified	Q8N815	CNTD1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0749)	4	781_782	+		Breast(137;0.00104)	184					Q658Q6|Q8NEP1	Missense_Mutation	DNP	ENST00000588408.1	37	c.549_550GG>CT	CCDS11440.1																																																																																				0.455	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452398.1	NM_173478		13	43	0	0	0	0.004672	0	13	43				
PPP1R9B	84687	broad.mit.edu	37	17	48217463	48217463	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:48217463C>T	ENST00000316878.6	-	7	1857	c.1855G>A	c.(1855-1857)Gag>Aag	p.E619K	PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	619	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						CCTACCTCCTCGTCATCCTCC	0.597											OREG0024556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002iqh.3		NA																	0					0						c.(1861-1863)GAG>AAG		protein phosphatase 1, regulatory subunit 9B							69.0	79.0	76.0					17																	48217463		2153	4227	6380	SO:0001583	missense	84687				cell cycle arrest|cell differentiation|cell migration|filopodium assembly|negative regulation of cell growth|nervous system development|regulation of cell growth by extracellular stimulus|regulation of cell proliferation|regulation of exit from mitosis|RNA splicing	adherens junction|cytoskeleton|dendritic spine|filopodium|lamellipodium|nucleoplasm|protein phosphatase type 1 complex|ruffle membrane|synapse	actin binding|protein phosphatase 1 binding|protein phosphatase inhibitor activity	g.chr17:48217463C>T	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.1855G>A	17.37:g.48217463C>T	ENSP00000475417:p.Glu619Lys		Somatic	OREG0024556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	952		p.E621K	NM_032595	NP_115984	WXS	Illumina HiSeq	Unspecified	Q96SB3	NEB2_HUMAN			7	1864	-			619			Interacts with TGN38 (By similarity).		Q8TCR9	Missense_Mutation	SNP	ENST00000316878.6	37	c.1861G>A																																																																																					0.597	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032595		7	17	0	0	0	0.00308	0	7	17				
KIF2B	84643	broad.mit.edu	37	17	51902371	51902371	+	Silent	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:51902371G>C	ENST00000268919.4	+	1	2133	c.1977G>C	c.(1975-1977)ctG>ctC	p.L659L		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	659					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAAAGAAACTGAAATTATTAC	0.458																																							uc002iua.2		NA																	0				ovary(5)|skin(3)	8						c.(1975-1977)CTG>CTC		kinesin family member 2B							80.0	79.0	79.0					17																	51902371		2203	4300	6503	SO:0001819	synonymous_variant	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51902371G>C	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1977G>C	17.37:g.51902371G>C			Somatic				uc010wna.1_RNA	p.L659L	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	2133	+			659			Potential.		Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	c.1977G>C	CCDS32685.1																																																																																				0.458	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		11	42	0	0	0	0.001855	0	11	42				
BPTF	2186	broad.mit.edu	37	17	65850861	65850861	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:65850861G>A	ENST00000321892.4	+	2	1480	c.1419G>A	c.(1417-1419)ttG>ttA	p.L473L	BPTF_ENST00000335221.5_Silent_p.L473L|BPTF_ENST00000424123.3_Silent_p.L334L|BPTF_ENST00000306378.6_Silent_p.L473L			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	473					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACTGGTTCTTGAACCGAAGAC	0.353																																							uc002jgf.2		NA																	0				ovary(2)|skin(2)	4						c.(1417-1419)TTG>TTA		bromodomain PHD finger transcription factor							58.0	53.0	55.0					17																	65850861		2203	4300	6503	SO:0001819	synonymous_variant	2186				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding	g.chr17:65850861G>A	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.1419G>A	17.37:g.65850861G>A			Somatic				BPTF_uc002jge.2_Silent_p.L473L|BPTF_uc010wqm.1_Silent_p.L473L	p.L473L	NM_182641	NP_872579	WXS	Illumina HiSeq	Unspecified	Q12830	BPTF_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)		2	1480	+	all_cancers(12;6e-11)		473					Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37	c.1419G>A																																																																																					0.353	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459		8	47	0	0	0	0.004482	0	8	47				
KIAA0195	9772	broad.mit.edu	37	17	73490824	73490824	+	Missense_Mutation	SNP	G	G	T	rs370945470		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:73490824G>T	ENST00000314256.7	+	19	2918	c.2524G>T	c.(2524-2526)Gat>Tat	p.D842Y	KIAA0195_ENST00000375248.5_Missense_Mutation_p.D852Y|AC100787.1_ENST00000579379.1_RNA|KIAA0195_ENST00000579208.1_Missense_Mutation_p.D493Y	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	842						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCGCCTCATTGATGGGCTTGT	0.577																																							uc002jnz.3		NA																	0				ovary(1)	1						c.(2524-2526)GAT>TAT		hypothetical protein LOC9772							100.0	82.0	88.0					17																	73490824		2203	4300	6503	SO:0001583	missense	9772				ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism	g.chr17:73490824G>T		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2524G>T	17.37:g.73490824G>T	ENSP00000313885:p.Asp842Tyr		Somatic				KIAA0195_uc010wsa.1_Missense_Mutation_p.D852Y|KIAA0195_uc010wsb.1_Missense_Mutation_p.D482Y|KIAA0195_uc002job.3_5'Flank	p.D842Y	NM_014738	NP_055553	WXS	Illumina HiSeq	Unspecified	Q12767	K0195_HUMAN	all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)		19	2799	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		842					O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	c.2524G>T	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900437	0.33535	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.46063	0.88;0.88	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.57755	0.2075	L	0.44542	1.39	0.80722	D	1	D;D;D	0.71674	0.986;0.998;0.997	P;D;P	0.63192	0.754;0.912;0.819	T	0.57499	-0.7801	10	0.72032	D	0.01	-28.5417	20.0349	0.97554	0.0:0.0:1.0:0.0	.	852;852;842	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	Y	842;852	ENSP00000313885:D842Y;ENSP00000364397:D852Y	ENSP00000313885:D842Y	D	+	1	0	KIAA0195	71002419	1.000000	0.71417	0.987000	0.45799	0.274000	0.26718	9.759000	0.98931	2.735000	0.93741	0.591000	0.81541	GAT		0.577	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		15	112	1	0	3.32936e-07	0.006122	3.50888e-07	15	112				
GALK1	2584	broad.mit.edu	37	17	73754172	73754172	+	Missense_Mutation	SNP	G	G	C	rs111033608		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:73754172G>C	ENST00000588479.1	-	8	1718	c.1144C>G	c.(1144-1146)Caa>Gaa	p.Q382E	GALK1_ENST00000225614.2_Missense_Mutation_p.Q382E|GALK1_ENST00000437911.1_Missense_Mutation_p.Q412E			P51570	GALK1_HUMAN	galactokinase 1	382					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCGGCTGCTTGAGAGAGGTAG	0.692																																							uc010wsi.1		NA																	0					0	GRCh37	CM001700	GALK1	M	rs111033608	c.(1144-1146)CAA>GAA		galactokinase 1							38.0	37.0	37.0					17																	73754172		2198	4298	6496	SO:0001583	missense	2584				galactose catabolic process	cytosol	ATP binding|galactokinase activity|galactose binding	g.chr17:73754172G>C		CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.1144C>G	17.37:g.73754172G>C	ENSP00000465930:p.Gln382Glu		Somatic				GALK1_uc002jpk.2_Missense_Mutation_p.Q382E	p.Q382E	NM_000154	NP_000145	WXS	Illumina HiSeq	Unspecified	P51570	GALK1_HUMAN	all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		8	1207	-	all_cancers(13;1.5e-07)		382					B2RC07|B4E1G6	Missense_Mutation	SNP	ENST00000588479.1	37	c.1144C>G	CCDS11728.1	.	.	.	.	.	.	.	.	.	.	G	8.200	0.797859	0.16327	.	.	ENSG00000108479	ENST00000225614;ENST00000437911	D;D	0.84516	-1.86;-1.86	4.31	3.27	0.37495	.	.	.	.	.	T	0.68375	0.2994	N	0.10782	0.045	0.27052	N	0.963762	B	0.02656	0.0	B	0.01281	0.0	T	0.53365	-0.8449	9	0.12430	T	0.62	.	9.1814	0.37143	0.0:0.0:0.6572:0.3428	.	382	P51570	GALK1_HUMAN	E	382;412	ENSP00000225614:Q382E;ENSP00000406305:Q412E	ENSP00000225614:Q382E	Q	-	1	0	GALK1	71265767	1.000000	0.71417	0.984000	0.44739	0.666000	0.39218	2.117000	0.41939	2.244000	0.73946	0.563000	0.77884	CAA		0.692	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448430.1			19	54	0	0	0	0.010504	0	19	54				
DSG3	1830	broad.mit.edu	37	18	29041325	29041325	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr18:29041325G>A	ENST00000257189.4	+	8	1032	c.949G>A	c.(949-951)Gaa>Aaa	p.E317K		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	317	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AAATTGGTTTGAAATACAAAC	0.348																																							uc002kws.2		NA																	0				skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9						c.(949-951)GAA>AAA		desmoglein 3 preproprotein							76.0	76.0	76.0					18																	29041325		2203	4299	6502	SO:0001583	missense	1830				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding	g.chr18:29041325G>A	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.949G>A	18.37:g.29041325G>A	ENSP00000257189:p.Glu317Lys		Somatic					p.E317K	NM_001944	NP_001935	WXS	Illumina HiSeq	Unspecified	P32926	DSG3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		8	1058	+			317			Cadherin 3.|Extracellular (Potential).		A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	c.949G>A	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378201	0.42105	.	.	ENSG00000134757	ENST00000257189	T	0.51574	0.7	5.55	5.55	0.83447	Cadherin (4);Cadherin-like (1);	0.126603	0.34725	N	0.003727	T	0.45034	0.1322	L	0.43646	1.37	0.35520	D	0.801368	P	0.38250	0.624	B	0.43445	0.42	T	0.43572	-0.9383	10	0.10111	T	0.7	.	16.0833	0.81020	0.0:0.1341:0.8659:0.0	.	317	P32926	DSG3_HUMAN	K	317	ENSP00000257189:E317K	ENSP00000257189:E317K	E	+	1	0	DSG3	27295323	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	0.906000	0.28517	2.768000	0.95171	0.655000	0.94253	GAA		0.348	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		22	75	0	0	0	0.008361	0	22	75				
GALNT1	2589	broad.mit.edu	37	18	33243677	33243677	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr18:33243677G>A	ENST00000269195.5	+	2	328	c.225G>A	c.(223-225)atG>atA	p.M75I	GALNT1_ENST00000537549.1_Missense_Mutation_p.M15I|GALNT1_ENST00000591081.1_Missense_Mutation_p.M75I	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	75					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						AAGAAAAGATGAAAGAGATGT	0.378																																							uc010dmu.2		NA																	0				ovary(2)	2						c.(223-225)ATG>ATA		polypeptide N-acetylgalactosaminyltransferase 1							117.0	111.0	113.0					18																	33243677		2203	4300	6503	SO:0001583	missense	2589				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr18:33243677G>A		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.225G>A	18.37:g.33243677G>A	ENSP00000269195:p.Met75Ile		Somatic				GALNT1_uc002kyz.3_Missense_Mutation_p.M15I|GALNT1_uc002kza.2_Missense_Mutation_p.M75I|GALNT1_uc002kzb.2_Missense_Mutation_p.M75I	p.M75I	NM_020474	NP_065207	WXS	Illumina HiSeq	Unspecified	Q10472	GALT1_HUMAN			3	278	+			75			Lumenal (Potential).		Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	c.225G>A	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339749	0.60963	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.53857	0.65;0.6	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	L	0.42632	1.34	0.80722	D	1	B	0.33135	0.399	B	0.35039	0.194	T	0.36311	-0.9753	10	0.21540	T	0.41	.	16.3514	0.83213	0.0:0.0:1.0:0.0	.	75	Q10472	GALT1_HUMAN	I	75;75;15	ENSP00000269195:M75I;ENSP00000440910:M15I	ENSP00000269195:M75I	M	+	3	0	GALNT1	31497675	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.469000	0.83416	0.655000	0.94253	ATG		0.378	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474		24	50	0	0	0	0.00278	0	24	50				
IER3IP1	51124	broad.mit.edu	37	18	44683867	44683867	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr18:44683867C>A	ENST00000256433.3	-	2	229	c.133G>T	c.(133-135)Gag>Tag	p.E45*	IER3IP1_ENST00000588705.1_Nonsense_Mutation_p.E45*	NM_016097.4	NP_057181.1			immediate early response 3 interacting protein 1											large_intestine(1)	1						ATTCCCGGCTCTTCTCCAAAT	0.393																																							uc002lcu.2		NA																	0					0						c.(133-135)GAG>TAG		immediate early response 3 interacting protein							169.0	152.0	158.0					18																	44683867		2203	4300	6503	SO:0001587	stop_gained	51124					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane		g.chr18:44683867C>A	AF371963	CCDS11933.1	18q12	2006-06-23			ENSG00000134049	ENSG00000134049			18550	protein-coding gene	gene with protein product		609382				15276200	Standard	NM_016097		Approved		uc002lcu.3	Q9Y5U9	OTTHUMG00000132650	ENST00000256433.3:c.133G>T	18.37:g.44683867C>A	ENSP00000256433:p.Glu45*		Somatic					p.E45*	NM_016097	NP_057181	WXS	Illumina HiSeq	Unspecified	Q9Y5U9	IR3IP_HUMAN			2	230	-			45						Nonsense_Mutation	SNP	ENST00000256433.3	37	c.133G>T	CCDS11933.1	.	.	.	.	.	.	.	.	.	.	C	34	5.303769	0.95601	.	.	ENSG00000134049	ENST00000256433	.	.	.	5.77	5.77	0.91146	.	0.111398	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	18.8244	0.92111	0.0:1.0:0.0:0.0	.	.	.	.	X	45	.	ENSP00000256433:E45X	E	-	1	0	IER3IP1	42937865	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.973000	0.76116	2.733000	0.93635	0.650000	0.86243	GAG		0.393	IER3IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255901.1	NM_016097		32	112	1	0	3.70713e-34	0.01441	4.02542e-34	32	112				
ALPK2	115701	broad.mit.edu	37	18	56205245	56205245	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr18:56205245C>G	ENST00000361673.3	-	5	2387	c.2174G>C	c.(2173-2175)aGa>aCa	p.R725T	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	725						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GTTGCCATCTCTGTCTTGTTT	0.458																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(2173-2175)AGA>ACA		heart alpha-kinase							194.0	170.0	178.0					18																	56205245		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56205245C>G	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2174G>C	18.37:g.56205245C>G	ENSP00000354991:p.Arg725Thr		Somatic				ALPK2_uc002lhk.1_Missense_Mutation_p.R56T	p.R725T	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			5	2388	-			725					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.2174G>C	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861734	0.51482	.	.	ENSG00000198796	ENST00000361673	T	0.48836	0.8	5.67	1.21	0.21127	.	1.536640	0.03337	N	0.194186	T	0.45034	0.1322	L	0.50333	1.59	0.09310	N	1	B;B	0.33807	0.426;0.325	B;B	0.35278	0.199;0.032	T	0.38950	-0.9637	10	0.62326	D	0.03	-2.9243	6.3757	0.21505	0.0:0.6661:0.1655:0.1684	.	725;725	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	T	725	ENSP00000354991:R725T	ENSP00000354991:R725T	R	-	2	0	ALPK2	54356225	0.002000	0.14202	0.001000	0.08648	0.595000	0.36748	1.229000	0.32600	0.282000	0.22254	0.655000	0.94253	AGA		0.458	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		39	167	0	0	0	0.01441	0	39	167				
ACSBG2	81616	broad.mit.edu	37	19	6183092	6183092	+	Silent	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:6183092C>G	ENST00000586696.1	+	10	1407	c.1131C>G	c.(1129-1131)ctC>ctG	p.L377L	ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000252669.5_Silent_p.L377L|ACSBG2_ENST00000588304.1_Silent_p.L327L|ACSBG2_ENST00000591403.1_Silent_p.L377L|ACSBG2_ENST00000588485.1_Silent_p.L190L			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	377					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTAAGACTCTCGTGTTCAGCA	0.498																																							uc002mef.1		NA																	0				ovary(1)	1						c.(1129-1131)CTC>CTG		bubblegum-related acyl-CoA synthetase 2							113.0	105.0	108.0					19																	6183092		2203	4300	6503	SO:0001819	synonymous_variant	81616				cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity	g.chr19:6183092C>G		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1131C>G	19.37:g.6183092C>G			Somatic				ACSBG2_uc002mee.1_Silent_p.L190L|ACSBG2_uc002meg.1_Silent_p.L377L|ACSBG2_uc002meh.1_Silent_p.L377L|ACSBG2_uc002mei.1_Silent_p.L327L|ACSBG2_uc010xiz.1_Silent_p.L377L	p.L377L	NM_030924	NP_112186	WXS	Illumina HiSeq	Unspecified	Q5FVE4	ACBG2_HUMAN			10	1358	+			377					B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Silent	SNP	ENST00000586696.1	37	c.1131C>G	CCDS12159.1																																																																																				0.498	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924		25	93	0	0	0	0.013726	0	25	93				
FBN3	84467	broad.mit.edu	37	19	8201290	8201290	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:8201290C>T	ENST00000600128.1	-	11	1741	c.1327G>A	c.(1327-1329)Gtg>Atg	p.V443M	FBN3_ENST00000601739.1_Missense_Mutation_p.V443M|FBN3_ENST00000270509.2_Missense_Mutation_p.V443M			Q75N90	FBN3_HUMAN	fibrillin 3	443	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TCGCCGCGCACGTCCTGGGTG	0.647																																							uc002mjf.2		NA																	0				ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						c.(1327-1329)GTG>ATG		fibrillin 3 precursor							78.0	71.0	74.0					19																	8201290		2203	4300	6503	SO:0001583	missense	84467					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr19:8201290C>T		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1327G>A	19.37:g.8201290C>T	ENSP00000470498:p.Val443Met		Somatic					p.V443M	NM_032447	NP_115823	WXS	Illumina HiSeq	Unspecified	Q75N90	FBN3_HUMAN			10	1348	-			443			EGF-like 3.		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	c.1327G>A	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	c	3.017	-0.202544	0.06219	.	.	ENSG00000142449	ENST00000270509	T	0.30448	1.53	4.4	3.37	0.38596	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.270128	0.29579	U	0.011755	T	0.18882	0.0453	L	0.28192	0.835	0.20873	N	0.999839	P	0.39520	0.676	B	0.35413	0.202	T	0.08411	-1.0723	10	0.46703	T	0.11	.	8.775	0.34756	0.0:0.8251:0.0:0.1749	.	443	Q75N90	FBN3_HUMAN	M	443	ENSP00000270509:V443M	ENSP00000270509:V443M	V	-	1	0	FBN3	8107290	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	0.851000	0.27751	0.845000	0.35118	-0.379000	0.06801	GTG		0.647	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447		4	71	0	0	0	0.009096	0	4	71				
ZNF561	93134	broad.mit.edu	37	19	9721178	9721178	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:9721178G>A	ENST00000302851.3	-	6	1522	c.1159C>T	c.(1159-1161)Cac>Tac	p.H387Y	ZNF561_ENST00000495503.1_5'Flank|ZNF561_ENST00000354661.4_Missense_Mutation_p.H251Y|ZNF561_ENST00000424629.1_Missense_Mutation_p.H318Y|ZNF561_ENST00000326044.5_3'UTR	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						TCTCCTGTGTGAATTCTTGTA	0.403																																							uc002mlu.2		NA																	0				ovary(1)	1						c.(1159-1161)CAC>TAC		zinc finger protein 561							114.0	108.0	110.0					19																	9721178		2203	4300	6503	SO:0001583	missense	93134				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9721178G>A	AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.1159C>T	19.37:g.9721178G>A	ENSP00000303915:p.His387Tyr		Somatic				ZNF561_uc010dwu.2_Missense_Mutation_p.H318Y|ZNF561_uc010xkr.1_Missense_Mutation_p.H251Y	p.H387Y	NM_152289	NP_689502	WXS	Illumina HiSeq	Unspecified	Q8N587	ZN561_HUMAN			6	1364	-			387			C2H2-type 9.		B4E2Q8|Q6PJS0	Missense_Mutation	SNP	ENST00000302851.3	37	c.1159C>T	CCDS12216.2	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361726	0.61403	.	.	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000354661	T;T;T	0.67523	-0.27;-0.27;-0.27	1.1	1.1	0.20463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.80899	0.4712	M	0.90145	3.09	0.34859	D	0.742403	D	0.54601	0.967	D	0.66351	0.943	D	0.84352	0.0533	9	0.72032	D	0.01	.	8.1044	0.30877	0.0:0.0:1.0:0.0	.	387	Q8N587	ZN561_HUMAN	Y	318;387;251	ENSP00000393074:H318Y;ENSP00000303915:H387Y;ENSP00000346687:H251Y	ENSP00000303915:H387Y	H	-	1	0	ZNF561	9582178	1.000000	0.71417	0.057000	0.19452	0.386000	0.30323	7.236000	0.78154	0.905000	0.36596	0.298000	0.19748	CAC		0.403	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347272.2	NM_152289		16	82	0	0	0	0.00499	0	16	82				
COL5A3	50509	broad.mit.edu	37	19	10087239	10087239	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:10087239G>A	ENST00000264828.3	-	45	3422	c.3337C>T	c.(3337-3339)Ccc>Tcc	p.P1113S		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1113	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTCACCGGGGGACCTGGGTGT	0.532																																							uc002mmq.1		NA																	0				ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(3337-3339)CCC>TCC		collagen, type V, alpha 3 preproprotein							25.0	27.0	26.0					19																	10087239		2202	4300	6502	SO:0001583	missense	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10087239G>A	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3337C>T	19.37:g.10087239G>A	ENSP00000264828:p.Pro1113Ser		Somatic					p.P1113S	NM_015719	NP_056534	WXS	Illumina HiSeq	Unspecified	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		45	3423	-			1113			Triple-helical region.		Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	c.3337C>T	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	7.116	0.576933	0.13686	.	.	ENSG00000080573	ENST00000264828	D	0.96587	-4.06	4.5	-5.68	0.02436	.	0.870470	0.09803	N	0.753873	D	0.91233	0.7237	L	0.42529	1.33	0.09310	N	1	B	0.29341	0.242	B	0.35312	0.2	T	0.82669	-0.0343	10	0.07644	T	0.81	.	7.1353	0.25525	0.2211:0.2549:0.524:0.0	.	1113	P25940	CO5A3_HUMAN	S	1113	ENSP00000264828:P1113S	ENSP00000264828:P1113S	P	-	1	0	COL5A3	9948239	0.000000	0.05858	0.228000	0.23943	0.526000	0.34562	-0.224000	0.09164	-1.017000	0.03367	0.313000	0.20887	CCC		0.532	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		3	9	0	0	0	0.009096	0	3	9				
RDH8	50700	broad.mit.edu	37	19	10127876	10127876	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:10127876G>C	ENST00000171214.1	+	2	496	c.247G>C	c.(247-249)Gaa>Caa	p.E83Q	RDH8_ENST00000591589.1_Missense_Mutation_p.E103Q	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	83					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	TATCCAGGGAGAAGTGGACGT	0.602																																							uc002mmr.2		NA																	0				ovary(3)|pancreas(1)	4						c.(247-249)GAA>CAA		retinol dehydrogenase 8 (all-trans)	Vitamin A(DB00162)						77.0	68.0	71.0					19																	10127876		2203	4300	6503	SO:0001583	missense	50700				estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity	g.chr19:10127876G>C	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.247G>C	19.37:g.10127876G>C	ENSP00000171214:p.Glu83Gln		Somatic					p.E83Q	NM_015725	NP_056540	WXS	Illumina HiSeq	Unspecified	Q9NYR8	RDH8_HUMAN	Epithelial(33;4.24e-05)		2	496	+			83					Q9H838	Missense_Mutation	SNP	ENST00000171214.1	37	c.247G>C		.	.	.	.	.	.	.	.	.	.	G	12.15	1.851023	0.32699	.	.	ENSG00000080511	ENST00000171214	D	0.87571	-2.27	4.77	-0.317	0.12736	NAD(P)-binding domain (1);	0.478898	0.22952	N	0.053642	T	0.65923	0.2738	N	0.05199	-0.095	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.54866	-0.8229	10	0.44086	T	0.13	.	1.5305	0.02534	0.1786:0.3542:0.2983:0.1689	.	83	Q9NYR8	RDH8_HUMAN	Q	83	ENSP00000171214:E83Q	ENSP00000171214:E83Q	E	+	1	0	RDH8	9988876	0.082000	0.21442	0.992000	0.48379	0.975000	0.68041	0.577000	0.23758	0.956000	0.37904	0.655000	0.94253	GAA		0.602	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				14	28	0	0	0	0.007413	0	14	28				
DHPS	1725	broad.mit.edu	37	19	12786738	12786738	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:12786738C>T	ENST00000210060.7	-	9	1159	c.1024G>A	c.(1024-1026)Gac>Aac	p.D342N	DHPS_ENST00000594424.1_Missense_Mutation_p.D300N|DHPS_ENST00000351660.5_Missense_Mutation_p.D295N	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	342					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						AGGGAGGCGTCAGCATAGACC	0.607											OREG0025272	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002muh.1		NA																	0				central_nervous_system(1)	1						c.(1024-1026)GAC>AAC		deoxyhypusine synthase isoform a	Sulfadoxine(DB01299)						50.0	47.0	48.0					19																	12786738		2203	4300	6503	SO:0001583	missense	1725				peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|post-translational protein modification|spermidine catabolic process to deoxyhypusine, using deoxyhypusine synthase|translation	cytosol	deoxyhypusine synthase activity|protein binding	g.chr19:12786738C>T	U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.1024G>A	19.37:g.12786738C>T	ENSP00000210060:p.Asp342Asn		Somatic	OREG0025272	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	682	DHPS_uc002muf.1_Missense_Mutation_p.D219N|DHPS_uc002mug.1_Missense_Mutation_p.D300N|DHPS_uc002mui.1_Missense_Mutation_p.D295N|DHPS_uc002muj.1_Missense_Mutation_p.D286N|DHPS_uc002muk.1_RNA	p.D342N	NM_001930	NP_001921	WXS	Illumina HiSeq	Unspecified	P49366	DHYS_HUMAN			9	1121	-			342	D->A: Strongly reduced NAD binding. Strongly reduced activity.		NAD.		A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Missense_Mutation	SNP	ENST00000210060.7	37	c.1024G>A	CCDS12276.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045961	0.75846	.	.	ENSG00000095059	ENST00000210060;ENST00000351660	T;T	0.61158	0.13;0.13	5.59	4.55	0.56014	.	0.049190	0.85682	D	0.000000	T	0.80670	0.4667	H	0.94462	3.54	0.58432	D	0.999996	D;D	0.65815	0.989;0.995	D;D	0.69142	0.962;0.959	D	0.85283	0.1063	10	0.87932	D	0	-27.7098	12.7518	0.57312	0.0:0.918:0.0:0.0819	.	295;342	P49366-2;P49366	.;DHYS_HUMAN	N	342;295	ENSP00000210060:D342N;ENSP00000221303:D295N	ENSP00000210060:D342N	D	-	1	0	DHPS	12647738	1.000000	0.71417	0.990000	0.47175	0.365000	0.29674	5.229000	0.65316	2.644000	0.89710	0.561000	0.74099	GAC		0.607	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462708.1	NM_001930		12	43	0	0	0	0.010729	0	12	43				
CACNA1A	773	broad.mit.edu	37	19	13395961	13395961	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:13395961C>T	ENST00000360228.5	-	21	3612	c.3613G>A	c.(3613-3615)Gag>Aag	p.E1205K	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E1206K	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1206	Poly-Glu.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	tcgtcttcctcctcctccttc	0.542																																							uc010dze.2		NA																	0				large_intestine(2)	2						c.(3616-3618)GAG>AAG		calcium channel, alpha 1A subunit isoform 3	Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)						92.0	100.0	97.0					19																	13395961		1918	4124	6042	SO:0001583	missense	773				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding	g.chr19:13395961C>T	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3613G>A	19.37:g.13395961C>T	ENSP00000353362:p.Glu1205Lys		Somatic				CACNA1A_uc010dzc.2_Missense_Mutation_p.E731K|CACNA1A_uc002mwy.3_Missense_Mutation_p.E1205K|CACNA1A_uc010xne.1_Missense_Mutation_p.E734K	p.E1206K	NM_001127221	NP_001120693	WXS	Illumina HiSeq	Unspecified	O00555	CAC1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		21	3852	-			1206			Cytoplasmic (Potential).|Poly-Glu.		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	c.3616G>A	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883810	0.51908	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.38887	1.11	4.92	4.92	0.64577	.	.	.	.	.	T	0.40694	0.1127	L	0.46819	1.47	0.52099	D	0.999947	B;P;B	0.39352	0.245;0.669;0.421	B;B;B	0.38880	0.085;0.284;0.073	T	0.38757	-0.9646	9	0.49607	T	0.09	.	16.8848	0.86073	0.0:1.0:0.0:0.0	.	1206;1209;1205	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	K	1205;1209;1206;1206	ENSP00000353362:E1205K	ENSP00000317661:E1206K	E	-	1	0	CACNA1A	13256961	1.000000	0.71417	0.993000	0.49108	0.861000	0.49209	4.644000	0.61397	2.283000	0.76528	0.561000	0.74099	GAG		0.542	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068		14	52	0	0	0	0.003163	0	14	52				
HAPLN4	404037	broad.mit.edu	37	19	19371821	19371821	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:19371821G>T	ENST00000291481.7	-	3	348	c.285C>A	c.(283-285)ttC>ttA	p.F95L	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	95	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	AGACGTCGGTGAAGGCCAGCG	0.692																																							uc002nmb.2		NA																	0				pancreas(1)	1						c.(283-285)TTC>TTA		hyaluronan and proteoglycan link protein 4							52.0	53.0	53.0					19																	19371821		2203	4299	6502	SO:0001583	missense	404037				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding	g.chr19:19371821G>T	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.285C>A	19.37:g.19371821G>T	ENSP00000291481:p.Phe95Leu		Somatic				HAPLN4_uc002nmc.2_Missense_Mutation_p.F95L	p.F95L	NM_023002	NP_075378	WXS	Illumina HiSeq	Unspecified	Q86UW8	HPLN4_HUMAN	Epithelial(12;0.00575)		3	340	-			95			Ig-like C2-type.		A5PKW5|Q96PW2	Missense_Mutation	SNP	ENST00000291481.7	37	c.285C>A	CCDS12398.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.522933	0.27211	.	.	ENSG00000187664	ENST00000291481	T	0.20598	2.06	4.52	2.17	0.27698	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.12646	0.0307	N	0.17474	0.49	0.37068	D	0.898404	B	0.27594	0.182	B	0.30401	0.115	T	0.13335	-1.0513	10	0.51188	T	0.08	-15.4483	8.1349	0.31048	0.2037:0.0:0.7963:0.0	.	95	Q86UW8	HPLN4_HUMAN	L	95	ENSP00000291481:F95L	ENSP00000291481:F95L	F	-	3	2	HAPLN4	19232821	0.977000	0.34250	0.989000	0.46669	0.992000	0.81027	1.820000	0.39032	0.349000	0.23975	0.561000	0.74099	TTC		0.692	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002		15	57	1	0	5.03518e-11	0.007413	5.38589e-11	15	57				
ZNF607	84775	broad.mit.edu	37	19	38198843	38198843	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:38198843C>T	ENST00000355202.4	-	4	802	c.207G>A	c.(205-207)gtG>gtA	p.V69V	CTD-2528L19.4_ENST00000586606.2_Silent_p.V69V|ZNF607_ENST00000395835.3_Silent_p.V68V	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			TTTCTTCCCTCACAATCATCC	0.438																																							uc002ohc.1		NA																	0					0						c.(205-207)GTG>GTA		zinc finger protein 607							277.0	219.0	239.0					19																	38198843		2203	4300	6503	SO:0001819	synonymous_variant	84775				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38198843C>T	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.207G>A	19.37:g.38198843C>T			Somatic				ZNF607_uc002ohb.1_Silent_p.V68V	p.V69V	NM_032689	NP_116078	WXS	Illumina HiSeq	Unspecified	Q96SK3	ZN607_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)		4	803	-			69			KRAB.		F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Silent	SNP	ENST00000355202.4	37	c.207G>A	CCDS33006.1																																																																																				0.438	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689		15	58	0	0	0	0.006122	0	15	58				
SIPA1L3	23094	broad.mit.edu	37	19	38610393	38610393	+	Silent	SNP	C	C	T	rs370172497		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:38610393C>T	ENST00000222345.6	+	9	3248	c.2739C>T	c.(2737-2739)tgC>tgT	p.C913C		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	913					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACTGCTACTGCGGGGATGTCA	0.532																																							uc002ohk.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2737-2739)TGC>TGT		signal-induced proliferation-associated 1 like		C		1,4403	2.1+/-5.4	0,1,2201	100.0	111.0	107.0		2739	-6.9	0.9	19		107	0,8600		0,0,4300	no	coding-synonymous	SIPA1L3	NM_015073.1		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		913/1782	38610393	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	23094				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr19:38610393C>T	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.2739C>T	19.37:g.38610393C>T			Somatic					p.C913C	NM_015073	NP_055888	WXS	Illumina HiSeq	Unspecified	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		9	3248	+			913					Q2TV87	Silent	SNP	ENST00000222345.6	37	c.2739C>T	CCDS33007.1																																																																																				0.532	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278		5	141	0	0	0	0.000602	0	5	141				
CNTD2	79935	broad.mit.edu	37	19	40730538	40730538	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:40730538G>C	ENST00000430325.2	-	3	418	c.370C>G	c.(370-372)Ctg>Gtg	p.L124V	CNTD2_ENST00000433940.1_Missense_Mutation_p.L94V|CNTD2_ENST00000513948.1_Missense_Mutation_p.L18V	NM_024877.3	NP_079153.2	Q9H8S5	CNTD2_HUMAN	cyclin N-terminal domain containing 2	124	Cyclin N-terminal.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					lung(1)|prostate(1)	2						TCACCAGCCAGACCCAGGTAC	0.637																																							uc010xvi.1		NA																	0					0						c.(370-372)CTG>GTG		cyclin N-terminal domain containing 2 isoform 2							82.0	66.0	72.0					19																	40730538		2203	4300	6503	SO:0001583	missense	79935				regulation of cyclin-dependent protein kinase activity		protein kinase binding	g.chr19:40730538G>C	AK023327	CCDS12551.1, CCDS12551.2	19q13.2	2014-07-03				ENSG00000105219			25805	protein-coding gene	gene with protein product	"""cyclin P"""					11237006	Standard	NM_024877		Approved	FLJ13265, CCNP	uc010xvi.2	Q9H8S5		ENST00000430325.2:c.370C>G	19.37:g.40730538G>C	ENSP00000396755:p.Leu124Val		Somatic				CNTD2_uc002ond.2_RNA	p.L124V	NM_024877	NP_079153	WXS	Illumina HiSeq	Unspecified	Q9H8S5	CNTD2_HUMAN			3	419	-			124					B4DX65	Missense_Mutation	SNP	ENST00000430325.2	37	c.370C>G	CCDS12551.2	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755587	0.31046	.	.	ENSG00000105219	ENST00000430325;ENST00000513948;ENST00000433940	T;T;T	0.12465	2.68;2.68;2.68	4.9	2.74	0.32292	.	0.083328	0.48767	D	0.000178	T	0.22742	0.0549	M	0.69463	2.115	0.24807	N	0.992661	P	0.41131	0.739	P	0.47134	0.539	T	0.05007	-1.0912	10	0.87932	D	0	-19.4062	11.5957	0.50972	0.1648:0.0:0.8352:0.0	.	124	B4DX65	.	V	124;18;94	ENSP00000396755:L124V;ENSP00000425529:L18V;ENSP00000408707:L94V	ENSP00000221818:L94V	L	-	1	2	CNTD2	45422378	0.996000	0.38824	0.932000	0.37286	0.044000	0.14063	0.970000	0.29383	0.265000	0.21872	-1.134000	0.01955	CTG		0.637	CNTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360785.1	NM_024877		11	36	0	0	0	0.00245	0	11	36				
RTN2	6253	broad.mit.edu	37	19	45998252	45998252	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:45998252C>T	ENST00000245923.4	-	3	326	c.91G>A	c.(91-93)Gac>Aac	p.D31N	PPM1N_ENST00000396737.2_5'Flank|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000456399.2_5'Flank|RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000589384.1_5'UTR|RTN2_ENST00000590526.1_5'UTR|RTN2_ENST00000344680.4_Missense_Mutation_p.D31N	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	31					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		AAATCAGAGTCGTCGTTCCCT	0.622																																							uc002pcb.2		NA																	0				ovary(3)	3						c.(91-93)GAC>AAC		reticulon 2 isoform A							72.0	69.0	70.0					19																	45998252		2203	4300	6503	SO:0001583	missense	6253					integral to endoplasmic reticulum membrane	signal transducer activity	g.chr19:45998252C>T	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.91G>A	19.37:g.45998252C>T	ENSP00000245923:p.Asp31Asn		Somatic				RTN2_uc002pcc.2_Missense_Mutation_p.D31N|RTN2_uc002pcd.2_RNA	p.D31N	NM_005619	NP_005610	WXS	Illumina HiSeq	Unspecified	O75298	RTN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)	3	319	-		Ovarian(192;0.051)|all_neural(266;0.112)	31					O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	c.91G>A	CCDS12665.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578956	0.65878	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.58652	0.36;0.32	5.44	4.38	0.52667	.	0.115539	0.38548	N	0.001643	T	0.46151	0.1378	L	0.32530	0.975	0.80722	D	1	P;P	0.50943	0.935;0.94	B;B	0.41619	0.361;0.267	T	0.45071	-0.9286	10	0.45353	T	0.12	-17.3579	12.1124	0.53846	0.0:0.8271:0.1729:0.0	.	31;31	O75298-2;O75298	.;RTN2_HUMAN	N	31	ENSP00000345127:D31N;ENSP00000245923:D31N	ENSP00000245923:D31N	D	-	1	0	RTN2	50690092	1.000000	0.71417	0.994000	0.49952	0.367000	0.29736	4.069000	0.57541	1.261000	0.44149	0.462000	0.41574	GAC		0.622	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		18	55	0	0	0	0.010504	0	18	55				
LIN7B	64130	broad.mit.edu	37	19	49618206	49618206	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:49618206C>G	ENST00000221459.2	+	2	182	c.138C>G	c.(136-138)ttC>ttG	p.F46L	LIN7B_ENST00000391864.3_Missense_Mutation_p.F46L	NM_022165.2	NP_071448.1	Q9HAP6	LIN7B_HUMAN	lin-7 homolog B (C. elegans)	46	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				exocytosis (GO:0006887)|neurotransmitter secretion (GO:0007269)|protein transport (GO:0015031)	neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			central_nervous_system(1)|endometrium(1)|prostate(1)	3		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;5e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000191)|GBM - Glioblastoma multiforme(486;0.00449)|Epithelial(262;0.01)		AGAGCCGCTTCTGCTCCGCTA	0.721																																							uc002pmp.2		NA																	0					0						c.(136-138)TTC>TTG		lin-7 homolog B							5.0	5.0	5.0					19																	49618206		1888	3779	5667	SO:0001583	missense	64130				exocytosis|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein domain specific binding	g.chr19:49618206C>G	AF311862	CCDS12757.1	19q13.3	2008-07-17			ENSG00000104863	ENSG00000104863			17788	protein-coding gene	gene with protein product		612331				10341223	Standard	XR_243950		Approved	MALS-2, LIN-7B, VELI2	uc002pmp.3	Q9HAP6	OTTHUMG00000134288	ENST00000221459.2:c.138C>G	19.37:g.49618206C>G	ENSP00000221459:p.Phe46Leu		Somatic					p.F46L	NM_022165	NP_071448	WXS	Illumina HiSeq	Unspecified	Q9HAP6	LIN7B_HUMAN		all cancers(93;5e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000191)|GBM - Glioblastoma multiforme(486;0.00449)|Epithelial(262;0.01)	2	182	+		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	46			L27.			Missense_Mutation	SNP	ENST00000221459.2	37	c.138C>G	CCDS12757.1	.	.	.	.	.	.	.	.	.	.	c	22.7	4.325951	0.81580	.	.	ENSG00000104863	ENST00000391864;ENST00000221459	T	0.25414	1.8	3.29	2.25	0.28309	L27, C-terminal (1);L27 (2);	0.000000	0.64402	D	0.000004	T	0.46946	0.1419	M	0.76838	2.35	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.38993	-0.9635	10	0.39692	T	0.17	-27.6637	9.9132	0.41419	0.0:0.894:0.0:0.106	.	46	Q9HAP6	LIN7B_HUMAN	L	46	ENSP00000221459:F46L	ENSP00000221459:F46L	F	+	3	2	LIN7B	54310018	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.809000	0.47971	0.742000	0.32697	-0.372000	0.07161	TTC		0.721	LIN7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258980.1	NM_022165		4	8	0	0	0	0.001984	0	4	8				
TMC4	147798	broad.mit.edu	37	19	54664081	54664081	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:54664081G>A	ENST00000376591.4	-	15	2232	c.2101C>T	c.(2101-2103)Cgc>Tgc	p.R701C	TMC4_ENST00000301187.4_Missense_Mutation_p.R695C|TMC4_ENST00000416963.1_Missense_Mutation_p.R283C|LENG1_ENST00000222224.3_5'Flank	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	701					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCCACAGCGCGCCGTGCCAGG	0.612																																							uc010erf.2		NA																	0				pancreas(1)	1						c.(2101-2103)CGC>TGC		transmembrane channel-like 4 isoform 1							79.0	88.0	85.0					19																	54664081		2203	4300	6503	SO:0001583	missense	147798					integral to membrane		g.chr19:54664081G>A	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.2101C>T	19.37:g.54664081G>A	ENSP00000365776:p.Arg701Cys		Somatic				LENG1_uc002qdm.2_5'Flank|TMC4_uc002qdn.2_Missense_Mutation_p.R415C|TMC4_uc002qdo.2_Missense_Mutation_p.R695C	p.R701C	NM_001145303	NP_001138775	WXS	Illumina HiSeq	Unspecified	Q7Z404	TMC4_HUMAN			15	2233	-	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		701			Cytoplasmic (Potential).		Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	ENST00000376591.4	37	c.2101C>T	CCDS46174.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394390	0.83011	.	.	ENSG00000167608	ENST00000301187;ENST00000416963;ENST00000376591	T;T;T	0.75704	-0.96;-0.85;-0.96	5.37	3.05	0.35203	.	0.315686	0.28349	N	0.015663	D	0.84334	0.5449	M	0.77820	2.39	0.46631	D	0.999135	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.939;0.997;0.969	D	0.85824	0.1387	10	0.87932	D	0	-15.51	11.2616	0.49087	0.0:0.0:0.6738:0.3262	.	701;695;283	Q7Z404;Q7Z404-1;Q7Z404-3	TMC4_HUMAN;.;.	C	695;283;701	ENSP00000301187:R695C;ENSP00000405023:R283C;ENSP00000365776:R701C	ENSP00000301187:R695C	R	-	1	0	TMC4	59355893	0.865000	0.29922	0.995000	0.50966	0.989000	0.77384	1.549000	0.36212	1.379000	0.46325	0.650000	0.86243	CGC		0.612	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2			26	74	0	0	0	0.00632	0	26	74				
ZNF583	147949	broad.mit.edu	37	19	56935705	56935705	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:56935705C>T	ENST00000333201.9	+	5	1888	c.1678C>T	c.(1678-1680)Cag>Tag	p.Q560*	ZNF583_ENST00000291598.7_Nonsense_Mutation_p.Q560*|ZNF583_ENST00000585612.1_Intron	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	560					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q560K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		cacatcaaatcagttgccaag	0.423																																							uc010ygl.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)	1						c.(1678-1680)CAG>TAG		zinc finger protein 583							66.0	63.0	64.0					19																	56935705		2203	4300	6503	SO:0001587	stop_gained	147949				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:56935705C>T	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1678C>T	19.37:g.56935705C>T	ENSP00000388502:p.Gln560*		Somatic				ZNF583_uc002qnc.2_Nonsense_Mutation_p.Q560*|ZNF583_uc010ygm.1_Nonsense_Mutation_p.Q560*	p.Q560*	NM_001159860	NP_001153332	WXS	Illumina HiSeq	Unspecified	Q96ND8	ZN583_HUMAN		GBM - Glioblastoma multiforme(193;0.0564)	5	1843	+		Colorectal(82;0.000256)|Ovarian(87;0.243)	560					O14850|Q2NKK3	Nonsense_Mutation	SNP	ENST00000333201.9	37	c.1678C>T	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	C	37	6.622533	0.97714	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	.	.	.	4.64	3.61	0.41365	.	0.582086	0.14406	N	0.321546	.	.	.	.	.	.	0.39955	D	0.974596	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0192	0.30400	0.0:0.8918:0.0:0.1082	.	.	.	.	X	560	.	.	Q	+	1	0	ZNF583	61627517	0.000000	0.05858	0.952000	0.39060	0.980000	0.70556	0.106000	0.15354	2.574000	0.86865	0.650000	0.86243	CAG		0.423	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478		7	12	0	0	0	0.001984	0	7	12				
ZNF544	27300	broad.mit.edu	37	19	58773458	58773458	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:58773458C>T	ENST00000596652.1	+	6	1720	c.1486C>T	c.(1486-1488)Cag>Tag	p.Q496*	ZNF544_ENST00000415203.2_Nonsense_Mutation_p.Q468*|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000596929.1_Intron|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000269829.4_Nonsense_Mutation_p.Q496*|ZNF544_ENST00000600220.1_Nonsense_Mutation_p.Q468*|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000600044.1_Nonsense_Mutation_p.Q468*|ZNF544_ENST00000599953.1_Nonsense_Mutation_p.Q354*|ZNF544_ENST00000595981.1_Intron			Q6NX49	ZN544_HUMAN	zinc finger protein 544	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		CAAATGTACTCAGTGTGGGAA	0.448																																							uc010euo.2		NA																	0				pancreas(1)	1						c.(1486-1488)CAG>TAG		zinc finger protein 544							78.0	81.0	80.0					19																	58773458		2203	4300	6503	SO:0001587	stop_gained	27300				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58773458C>T	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.1486C>T	19.37:g.58773458C>T	ENSP00000469635:p.Gln496*		Somatic				ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Nonsense_Mutation_p.Q468*|ZNF544_uc010yhy.1_Nonsense_Mutation_p.Q468*|ZNF544_uc002qrt.3_Nonsense_Mutation_p.Q354*|ZNF544_uc002qru.3_Nonsense_Mutation_p.Q354*|uc002qrx.1_Intron	p.Q496*	NM_014480	NP_055295	WXS	Illumina HiSeq	Unspecified	Q6NX49	ZN544_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)	7	1960	+		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)	496			C2H2-type 6.		A8K6J1|Q9UEX4	Nonsense_Mutation	SNP	ENST00000596652.1	37	c.1486C>T	CCDS12973.1	.	.	.	.	.	.	.	.	.	.	C	37	6.003774	0.97189	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	.	.	.	2.35	-0.291	0.12843	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	3.0977	0.06315	0.4562:0.3901:0.0:0.1537	.	.	.	.	X	496;468	.	ENSP00000269829:Q496X	Q	+	1	0	ZNF544	63465270	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-4.041000	0.00307	-0.109000	0.12044	0.514000	0.50259	CAG		0.448	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480		33	66	0	0	0	0.00623	0	33	66				
ROCK2	9475	broad.mit.edu	37	2	11367475	11367475	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:11367475G>A	ENST00000315872.6	-	6	1221	c.773C>T	c.(772-774)tCa>tTa	p.S258L	ROCK2_ENST00000401753.1_Missense_Mutation_p.S15L	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	258	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		AACCTCAGGTGATATATAATC	0.423																																							uc002rbd.1		NA																	0				stomach(2)|skin(2)	4						c.(772-774)TCA>TTA		Rho-associated, coiled-coil containing protein							231.0	231.0	231.0					2																	11367475		1907	4141	6048	SO:0001583	missense	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11367475G>A	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.773C>T	2.37:g.11367475G>A	ENSP00000317985:p.Ser258Leu		Somatic					p.S258L	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	6	1222	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		258			Protein kinase.		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	c.773C>T	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	G	34	5.297012	0.95574	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000431087	T;T;T	0.28666	1.6;1.6;1.6	5.04	5.04	0.67666	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66077	-0.6013	10	0.87932	D	0	.	18.7544	0.91826	0.0:0.0:1.0:0.0	.	258	O75116	ROCK2_HUMAN	L	258;15;85	ENSP00000317985:S258L;ENSP00000385509:S15L;ENSP00000395957:S85L	ENSP00000261535:S258L	S	-	2	0	ROCK2	11284926	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.869000	0.99810	2.501000	0.84356	0.585000	0.79938	TCA		0.423	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3			38	222	0	0	0	0.01441	0	38	222				
PUM2	23369	broad.mit.edu	37	2	20508167	20508167	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:20508167C>G	ENST00000361078.2	-	5	719	c.697G>C	c.(697-699)Gaa>Caa	p.E233Q	PUM2_ENST00000420234.1_5'Flank|PUM2_ENST00000403432.1_Missense_Mutation_p.E233Q|PUM2_ENST00000536417.1_Missense_Mutation_p.E177Q|PUM2_ENST00000319801.5_Missense_Mutation_p.E233Q|PUM2_ENST00000338086.5_Missense_Mutation_p.E233Q			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	233	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTAAGGATTCCAGACCAACT	0.433																																							uc002rds.1		NA																	0				ovary(1)	1						c.(697-699)GAA>CAA		pumilio homolog 2							86.0	84.0	85.0					2																	20508167		2203	4300	6503	SO:0001583	missense	23369				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding	g.chr2:20508167C>G	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.697G>C	2.37:g.20508167C>G	ENSP00000354370:p.Glu233Gln		Somatic				PUM2_uc002rdt.1_Missense_Mutation_p.E233Q|PUM2_uc002rdr.2_Missense_Mutation_p.E172Q|PUM2_uc010yjy.1_Missense_Mutation_p.E233Q|PUM2_uc002rdu.1_Missense_Mutation_p.E233Q|PUM2_uc010yjz.1_Missense_Mutation_p.E172Q	p.E233Q	NM_015317	NP_056132	WXS	Illumina HiSeq	Unspecified	Q8TB72	PUM2_HUMAN			5	720	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		233			Interaction with SNAPIN.		B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37	c.697G>C		.	.	.	.	.	.	.	.	.	.	C	24.6	4.549094	0.86127	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T;T	0.26067	1.97;2.19;2.19;1.76;1.97;1.96	6.03	6.03	0.97812	.	0.137318	0.64402	D	0.000003	T	0.34861	0.0912	L	0.50333	1.59	0.58432	D	0.999996	B;B;B	0.32693	0.05;0.048;0.38	B;B;B	0.39660	0.121;0.071;0.306	T	0.02294	-1.1181	10	0.42905	T	0.14	-10.1857	20.6243	0.99512	0.0:1.0:0.0:0.0	.	177;233;233	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	Q	233;233;233;124;233;177;233	ENSP00000338173:E233Q;ENSP00000354370:E233Q;ENSP00000326746:E233Q;ENSP00000409905:E124Q;ENSP00000385992:E233Q;ENSP00000440093:E177Q	ENSP00000326746:E233Q	E	-	1	0	PUM2	20371648	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.815000	0.86186	2.886000	0.99085	0.644000	0.83932	GAA		0.433	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317		23	102	0	0	0	0.007291	0	23	102				
KIF3C	3797	broad.mit.edu	37	2	26178520	26178520	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:26178520G>A	ENST00000264712.3	-	3	2239	c.1660C>T	c.(1660-1662)Cgg>Tgg	p.R554W	KIF3C_ENST00000405914.1_Missense_Mutation_p.R554W	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	554					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCATCTCCCGCTCACGACGT	0.602																																							uc002rgu.2		NA																	0				ovary(3)|skin(1)	4						c.(1660-1662)CGG>TGG		kinesin family member 3C							152.0	120.0	131.0					2																	26178520		2203	4300	6503	SO:0001583	missense	3797				blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:26178520G>A		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1660C>T	2.37:g.26178520G>A	ENSP00000264712:p.Arg554Trp		Somatic				KIF3C_uc010eyj.1_RNA|KIF3C_uc010ykr.1_Missense_Mutation_p.R554W	p.R554W	NM_002254	NP_002245	WXS	Illumina HiSeq	Unspecified	O14782	KIF3C_HUMAN			3	2317	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		554			Potential.		O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	37	c.1660C>T	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070368	0.76301	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.74421	-0.84;-0.84	5.24	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.86435	0.5932	M	0.86953	2.85	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.958	D	0.88252	0.2917	10	0.72032	D	0.01	.	12.7821	0.57483	0.0:0.0:0.8348:0.1652	.	554;554	B7ZM25;O14782	.;KIF3C_HUMAN	W	554;360;554	ENSP00000264712:R554W;ENSP00000385030:R554W	ENSP00000264712:R554W	R	-	1	2	KIF3C	26032024	1.000000	0.71417	0.973000	0.42090	0.957000	0.61999	2.313000	0.43735	1.183000	0.42943	0.561000	0.74099	CGG		0.602	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			39	40	0	0	0	0.01441	0	39	40				
SOS1	6654	broad.mit.edu	37	2	39224544	39224544	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:39224544C>G	ENST00000426016.1	-	19	2900	c.2814G>C	c.(2812-2814)ttG>ttC	p.L938F	SOS1_ENST00000395038.2_Missense_Mutation_p.L938F|SOS1_ENST00000402219.2_Missense_Mutation_p.L938F			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	938	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CTTCTGTTTTCAAGATATTAG	0.333									Noonan syndrome																														uc002rrk.3		NA																	0				ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10						c.(2812-2814)TTG>TTC		son of sevenless homolog 1							101.0	96.0	97.0					2																	39224544		2203	4299	6502	SO:0001583	missense	6654	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr2:39224544C>G	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.2814G>C	2.37:g.39224544C>G	ENSP00000387784:p.Leu938Phe		Somatic				SOS1_uc002rrj.3_Missense_Mutation_p.L552F	p.L938F	NM_005633	NP_005624	WXS	Illumina HiSeq	Unspecified	Q07889	SOS1_HUMAN			18	2855	-		all_hematologic(82;0.21)	938			Ras-GEF.		A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	c.2814G>C	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084998	0.55861	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	T;T;T	0.30714	1.52;1.52;1.52	5.54	3.68	0.42216	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine-nucleotide exchange factor, conserved site (1);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000001	T	0.50086	0.1595	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.42982	-0.9419	10	0.46703	T	0.11	.	8.7831	0.34802	0.0:0.6883:0.0:0.3117	.	938	Q07889	SOS1_HUMAN	F	938;938;670;938;938	ENSP00000387784:L938F;ENSP00000384675:L938F;ENSP00000378479:L938F	ENSP00000263879:L938F	L	-	3	2	SOS1	39078048	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.074000	0.30703	0.641000	0.30601	0.462000	0.41574	TTG		0.333	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		14	50	0	0	0	0.006122	0	14	50				
NRXN1	9378	broad.mit.edu	37	2	50724737	50724737	+	Missense_Mutation	SNP	G	G	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:50724737G>T	ENST00000406316.2	-	14	4089	c.2613C>A	c.(2611-2613)agC>agA	p.S871R	NRXN1_ENST00000406859.3_Missense_Mutation_p.S871R|NRXN1_ENST00000405472.3_Missense_Mutation_p.S863R|NRXN1_ENST00000402717.3_Missense_Mutation_p.S863R|NRXN1_ENST00000404971.1_Missense_Mutation_p.S911R|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401710.1_5'Flank|NRXN1_ENST00000401669.2_Missense_Mutation_p.S871R	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	871	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TAAATGTCAAGCTCTGCAGGT	0.433																																							uc010fbq.2		NA																	0				ovary(2)	2						c.(2731-2733)AGC>AGA		neurexin 1 isoform alpha2 precursor							99.0	89.0	92.0					2																	50724737		1954	4156	6110	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50724737G>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2613C>A	2.37:g.50724737G>T	ENSP00000384311:p.Ser871Arg		Somatic				NRXN1_uc002rxb.3_Missense_Mutation_p.S543R|NRXN1_uc002rxe.3_Missense_Mutation_p.S871R|NRXN1_uc002rxc.1_RNA	p.S911R	NM_001135659	NP_001129131	WXS	Illumina HiSeq	Unspecified	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		14	4210	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.2733C>A	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953233	0.73902	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.97	3.95	0.45737	.	0.079507	0.85682	D	0.000000	D	0.83179	0.5198	M	0.65498	2.005	0.28532	N	0.912558	D;D;D	0.76494	0.972;0.999;0.978	P;D;P	0.67103	0.829;0.949;0.893	T	0.75074	-0.3446	10	0.21014	T	0.42	.	10.252	0.43375	0.2422:0.0:0.7578:0.0	.	911;871;863	Q9ULB1-3;F8WB18;A7E294	.;.;.	R	911;871;863;871;912;863;871	ENSP00000385142:S911R;ENSP00000384311:S871R;ENSP00000434015:S863R;ENSP00000385017:S871R;ENSP00000385434:S863R;ENSP00000385681:S871R	ENSP00000385017:S871R	S	-	3	2	NRXN1	50578241	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.749000	0.55150	0.673000	0.31224	0.561000	0.74099	AGC		0.433	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			7	39	1	0	5.18039e-06	0.00308	5.3806e-06	7	39				
ZNF638	27332	broad.mit.edu	37	2	71650506	71650506	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:71650506C>G	ENST00000409544.1	+	22	4492	c.3862C>G	c.(3862-3864)Ccc>Gcc	p.P1288A	ZNF638_ENST00000264447.4_Missense_Mutation_p.P1288A|ZNF638_ENST00000355812.3_Intron|ZNF638_ENST00000409407.1_Missense_Mutation_p.P228A	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1288	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ACCAGGAATTCCCACTGGGGA	0.368																																							uc002shx.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(3862-3864)CCC>GCC		zinc finger protein 638							50.0	53.0	52.0					2																	71650506		2203	4298	6501	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71650506C>G	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.3862C>G	2.37:g.71650506C>G	ENSP00000386433:p.Pro1288Ala		Somatic				ZNF638_uc010yqw.1_Missense_Mutation_p.P867A|ZNF638_uc002shy.2_Missense_Mutation_p.P1288A|ZNF638_uc002shz.2_Missense_Mutation_p.P1288A|ZNF638_uc002sia.2_Missense_Mutation_p.P1288A|ZNF638_uc002sib.1_Intron|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Missense_Mutation_p.P385A|ZNF638_uc002sid.2_Intron	p.P1288A	NM_014497	NP_055312	WXS	Illumina HiSeq	Unspecified	Q14966	ZN638_HUMAN			22	4181	+			1288			Glu-rich.		B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.3862C>G	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	C	0.222	-1.027946	0.02045	.	.	ENSG00000075292	ENST00000394137;ENST00000264447;ENST00000409544;ENST00000409407;ENST00000462695	T;T;T	0.27890	1.64;1.64;2.05	5.49	1.61	0.23674	.	0.854715	0.10194	N	0.704313	T	0.13884	0.0336	N	0.08118	0	0.21184	N	0.999763	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.34576	-0.9823	10	0.19590	T	0.45	6.4042	6.1577	0.20346	0.0:0.0821:0.3087:0.6092	.	1288;1288;1288	A8K583;Q14966-3;Q14966	.;.;ZN638_HUMAN	A	867;1288;1288;228;228	ENSP00000264447:P1288A;ENSP00000386433:P1288A;ENSP00000386813:P228A	ENSP00000264447:P1288A	P	+	1	0	ZNF638	71504014	0.006000	0.16342	0.004000	0.12327	0.016000	0.09150	1.048000	0.30379	0.083000	0.17047	-0.414000	0.06135	CCC		0.368	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		8	52	0	0	0	0.004482	0	8	52				
NPHP1	4867	broad.mit.edu	37	2	110905540	110905540	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:110905540G>C	ENST00000393272.3	-	13	1484	c.1387C>G	c.(1387-1389)Cca>Gca	p.P463A	NPHP1_ENST00000417665.1_Missense_Mutation_p.P407A|NPHP1_ENST00000316534.4_Missense_Mutation_p.P464A|NPHP1_ENST00000445609.2_Missense_Mutation_p.P408A|NPHP1_ENST00000355301.4_Missense_Mutation_p.P345A	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	463					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						CCAAGATCTGGAGATGCAGAA	0.318																																							uc002tfn.3		NA																	0				ovary(2)	2						c.(1387-1389)CCA>GCA		nephrocystin 1 isoform 2							83.0	92.0	89.0					2																	110905540		2203	4300	6503	SO:0001583	missense	4867				actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity	g.chr2:110905540G>C	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1387C>G	2.37:g.110905540G>C	ENSP00000376953:p.Pro463Ala		Somatic				NPHP1_uc002tfm.3_Missense_Mutation_p.P408A|NPHP1_uc002tfl.3_Missense_Mutation_p.P464A|NPHP1_uc002tfo.3_Missense_Mutation_p.P345A|NPHP1_uc010ywx.1_Missense_Mutation_p.P407A|NPHP1_uc010fjv.1_Missense_Mutation_p.P407A	p.P463A	NM_207181	NP_997064	WXS	Illumina HiSeq	Unspecified	O15259	NPHP1_HUMAN			13	1481	-			463					O14837	Missense_Mutation	SNP	ENST00000393272.3	37	c.1387C>G	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641057	0.67244	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.61158	0.13;0.14;0.13;0.15;0.15	5.63	4.75	0.60458	.	0.119152	0.56097	D	0.000025	T	0.64068	0.2565	L	0.60455	1.87	0.80722	D	1	D;P;P;D;D;P	0.57571	0.966;0.786;0.919;0.97;0.98;0.919	P;B;P;P;P;P	0.54664	0.577;0.374;0.578;0.577;0.758;0.578	T	0.64533	-0.6385	10	0.49607	T	0.09	-7.946	11.5778	0.50873	0.0852:0.0:0.9148:0.0	.	407;407;345;463;408;464	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	A	464;408;463;345;407	ENSP00000313169:P464A;ENSP00000389879:P408A;ENSP00000376953:P463A;ENSP00000347452:P345A;ENSP00000402176:P407A	ENSP00000313169:P464A	P	-	1	0	NPHP1	110262829	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.809000	0.55606	2.665000	0.90641	0.655000	0.94253	CCA		0.318	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272		23	94	0	0	0	0.005443	0	23	94				
PRPF40A	55660	broad.mit.edu	37	2	153530178	153530178	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:153530178C>G	ENST00000410080.1	-	11	1615	c.1074G>C	c.(1072-1074)aaG>aaC	p.K358N		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	385					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						TGTATGTTTTCTTTGCTGGTT	0.299																																							uc002tyi.2		NA																	0					0						c.(1153-1155)AAG>AAC		formin binding protein 3							103.0	95.0	98.0					2																	153530178		1800	4066	5866	SO:0001583	missense	55660				mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding	g.chr2:153530178C>G	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.1074G>C	2.37:g.153530178C>G	ENSP00000386458:p.Lys358Asn		Somatic				PRPF40A_uc002tyh.3_Missense_Mutation_p.K358N|PRPF40A_uc010zcd.1_Missense_Mutation_p.K305N|PRPF40A_uc002tyj.2_Missense_Mutation_p.K254N	p.K385N	NM_017892	NP_060362	WXS	Illumina HiSeq	Unspecified	O75400	PR40A_HUMAN			11	1168	-			385					O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	ENST00000410080.1	37	c.1155G>C	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403506	0.62288	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961;ENST00000545856	T;T	0.29917	1.55;1.55	5.44	1.81	0.25067	FF domain (2);	0.000000	0.85682	D	0.000000	T	0.37404	0.1002	L	0.32530	0.975	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	D;D	0.76071	0.987;0.915	T	0.03202	-1.1061	10	0.28530	T	0.3	-22.8589	8.8519	0.35206	0.0:0.2197:0.0:0.7803	.	385;358	O75400;E9PFS0	PR40A_HUMAN;.	N	358;367;254;305;385	ENSP00000386458:K358N;ENSP00000444656:K385N	ENSP00000348770:K367N	K	-	3	2	PRPF40A	153238424	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.687000	0.37680	0.136000	0.18733	-0.302000	0.09304	AAG		0.299	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575		3	36	0	0	0	0.000602	0	3	36				
TTC21B	79809	broad.mit.edu	37	2	166767949	166767949	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:166767949C>T	ENST00000243344.7	-	18	2486	c.2349G>A	c.(2347-2349)ctG>ctA	p.L783L		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	783					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						GTCCAGTTTTCAGAGCAGCTT	0.358																																							uc002udk.2		NA																	0				ovary(2)|pancreas(2)|breast(1)	5						c.(2347-2349)CTG>CTA		tetratricopeptide repeat domain 21B							116.0	117.0	116.0					2																	166767949		2203	4300	6503	SO:0001819	synonymous_variant	79809					cilium axoneme|cytoplasm|cytoskeleton	binding	g.chr2:166767949C>T	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.2349G>A	2.37:g.166767949C>T			Somatic					p.L783L	NM_024753	NP_079029	WXS	Illumina HiSeq	Unspecified	Q7Z4L5	TT21B_HUMAN			18	2482	-			783			TPR 10.		A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Silent	SNP	ENST00000243344.7	37	c.2349G>A	CCDS33315.1																																																																																				0.358	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753		17	61	0	0	0	0.010504	0	17	61				
ZNF804A	91752	broad.mit.edu	37	2	185802465	185802465	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:185802465C>T	ENST00000302277.6	+	4	2936	c.2342C>T	c.(2341-2343)tCa>tTa	p.S781L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	781							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TCTTATTCTTCAGATGAAAGT	0.373																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(2341-2343)TCA>TTA		zinc finger protein 804A							49.0	52.0	51.0					2																	185802465		2201	4299	6500	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185802465C>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2342C>T	2.37:g.185802465C>T	ENSP00000303252:p.Ser781Leu		Somatic					p.S781L	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	2936	+			781					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.2342C>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195954	0.78902	.	.	ENSG00000170396	ENST00000302277	T	0.11277	2.79	5.81	5.81	0.92471	.	0.000000	0.47093	D	0.000255	T	0.31638	0.0803	L	0.55481	1.735	0.41445	D	0.987943	D	0.89917	1.0	D	0.85130	0.997	T	0.00514	-1.1695	10	0.87932	D	0	-14.7073	19.0503	0.93041	0.0:1.0:0.0:0.0	.	781	Q7Z570	Z804A_HUMAN	L	781	ENSP00000303252:S781L	ENSP00000303252:S781L	S	+	2	0	ZNF804A	185510710	0.998000	0.40836	0.986000	0.45419	0.946000	0.59487	5.359000	0.66074	2.750000	0.94351	0.655000	0.94253	TCA		0.373	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		12	36	0	0	0	0.001855	0	12	36				
ABCA12	26154	broad.mit.edu	37	2	215880343	215880343	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:215880343G>A	ENST00000272895.7	-	15	2046	c.1827C>T	c.(1825-1827)atC>atT	p.I609I	ABCA12_ENST00000389661.4_Silent_p.I291I	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	609					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGGGAGTGGTGATATTAGTAT	0.423																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(1825-1827)ATC>ATT		ATP-binding cassette, sub-family A, member 12							102.0	98.0	100.0					2																	215880343		2203	4300	6503	SO:0001819	synonymous_variant	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215880343G>A	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1827C>T	2.37:g.215880343G>A			Somatic				ABCA12_uc002vev.2_Silent_p.I291I|ABCA12_uc010zjn.1_5'UTR	p.I609I	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	15	2047	-		Renal(323;0.127)	609					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	c.1827C>T	CCDS33372.1																																																																																				0.423	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		20	24	0	0	0	0.00278	0	20	24				
HDLBP	3069	broad.mit.edu	37	2	242206264	242206264	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr2:242206264C>G	ENST00000391975.1	-	3	248	c.21G>C	c.(19-21)ttG>ttC	p.L7F	HDLBP_ENST00000310931.4_Missense_Mutation_p.L7F|HDLBP_ENST00000391976.2_Missense_Mutation_p.L7F|HDLBP_ENST00000427183.2_Missense_Mutation_p.L43F	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	7					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TCTCTTGGGTCAAAACTGCAA	0.443																																							uc002waz.2		NA																	0				breast(3)|skin(1)	4						c.(19-21)TTG>TTC		high density lipoprotein binding protein							178.0	163.0	168.0					2																	242206264		2203	4300	6503	SO:0001583	missense	3069				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding	g.chr2:242206264C>G		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.21G>C	2.37:g.242206264C>G	ENSP00000375836:p.Leu7Phe		Somatic				HDLBP_uc002wba.2_Missense_Mutation_p.L7F|HDLBP_uc002wbb.2_Missense_Mutation_p.L28F|HDLBP_uc010fzn.1_5'UTR	p.L7F	NM_203346	NP_976221	WXS	Illumina HiSeq	Unspecified	Q00341	VIGLN_HUMAN		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)	3	249	-		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	7					B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	c.21G>C	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126597	0.77549	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000422933;ENST00000428482;ENST00000442714;ENST00000452065;ENST00000444092;ENST00000430918;ENST00000441124;ENST00000426343;ENST00000413241;ENST00000423693;ENST00000425989;ENST00000420451;ENST00000422080;ENST00000458564;ENST00000427007;ENST00000449504;ENST00000417540	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.65178	1.79;1.79;1.79;1.55;0.77;0.18;0.06;0.17;0.22;0.22;0.21;0.22;0.06;0.06;0.01;-0.14	5.51	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	M	0.70595	2.14	0.38802	D	0.955224	P;D	0.89917	0.457;1.0	B;D	0.91635	0.135;0.999	T	0.77930	-0.2403	10	0.62326	D	0.03	-8.6103	9.1858	0.37170	0.145:0.7816:0.0:0.0734	.	43;7	E7EM71;Q00341	.;VIGLN_HUMAN	F	7;7;7;43;7;7;7;7;7;7;7;7;7;7;7;7;7;7;7;7;7	ENSP00000375836:L7F;ENSP00000375837:L7F;ENSP00000312042:L7F;ENSP00000399139:L43F;ENSP00000403807:L7F;ENSP00000405109:L7F;ENSP00000413891:L7F;ENSP00000387782:L7F;ENSP00000416559:L7F;ENSP00000403913:L7F;ENSP00000396964:L7F;ENSP00000394205:L7F;ENSP00000390290:L7F;ENSP00000413805:L7F;ENSP00000390942:L7F;ENSP00000403693:L7F	ENSP00000312042:L7F	L	-	3	2	HDLBP	241854937	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.541000	0.45735	1.333000	0.45449	0.655000	0.94253	TTG		0.443	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346		4	107	0	0	0	0.001984	0	4	107				
UBOX5	22888	broad.mit.edu	37	20	3102754	3102754	+	Silent	SNP	G	G	T	rs371115884		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr20:3102754G>T	ENST00000217173.2	-	3	1002	c.531C>A	c.(529-531)atC>atA	p.I177I	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Silent_p.I177I	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						TCACATGGGTGATACAGATCC	0.582																																							uc002whw.2		NA																	0				ovary(1)|skin(1)	2						c.(529-531)ATC>ATA		U-box domain containing 5 isoform a							68.0	61.0	63.0					20																	3102754		2203	4300	6503	SO:0001819	synonymous_variant	22888					nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding	g.chr20:3102754G>T	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.531C>A	20.37:g.3102754G>T			Somatic				uc002whv.1_Intron|UBOX5_uc002whx.2_Silent_p.I177I|UBOX5_uc002why.1_Silent_p.I177I	p.I177I	NM_014948	NP_055763	WXS	Illumina HiSeq	Unspecified	O94941	RNF37_HUMAN			3	701	-			177						Silent	SNP	ENST00000217173.2	37	c.531C>A	CCDS13046.1																																																																																				0.582	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948		22	76	1	0	9.86323e-18	0.003954	1.06563e-17	22	76				
PLCB1	23236	broad.mit.edu	37	20	8721083	8721083	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr20:8721083G>C	ENST00000338037.6	+	22	2428	c.2401G>C	c.(2401-2403)Gac>Cac	p.D801H	PLCB1_ENST00000378641.3_Missense_Mutation_p.D801H|PLCB1_ENST00000378637.2_Missense_Mutation_p.D801H|PLCB1_ENST00000494924.1_3'UTR	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	801					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CTATGTGCCAGACACATATGC	0.408																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2401-2403)GAC>CAC		phosphoinositide-specific phospholipase C beta 1							109.0	100.0	103.0					20																	8721083		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8721083G>C	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2401G>C	20.37:g.8721083G>C	ENSP00000338185:p.Asp801His		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.D700H|PLCB1_uc002wna.2_Missense_Mutation_p.D801H|PLCB1_uc002wnc.1_Missense_Mutation_p.D700H|PLCB1_uc002wnd.1_Missense_Mutation_p.D378H	p.D801H	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			22	2404	+			801					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.2401G>C	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310029	0.60414	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719;ENST00000338061;ENST00000439627	T;T;T;T	0.25085	1.83;1.82;1.83;2.0	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	M	0.83774	2.66	0.58432	D	0.999998	P;D	0.76494	0.86;0.999	B;D	0.68039	0.085;0.955	T	0.60047	-0.7339	10	0.59425	D	0.04	.	19.356	0.94414	0.0:0.0:1.0:0.0	.	801;801	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	H	801;801;801;721;721;147;120	ENSP00000367908:D801H;ENSP00000338185:D801H;ENSP00000367904:D801H;ENSP00000391162:D120H	ENSP00000338185:D801H	D	+	1	0	PLCB1	8669083	1.000000	0.71417	0.964000	0.40570	0.935000	0.57460	7.887000	0.87295	2.582000	0.87167	0.585000	0.79938	GAC		0.408	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			16	60	0	0	0	0.004007	0	16	60				
REM1	28954	broad.mit.edu	37	20	30065669	30065669	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr20:30065669G>C	ENST00000201979.2	+	3	672	c.379G>C	c.(379-381)Gac>Cac	p.D127H	DEFB124_ENST00000481595.1_5'Flank	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	127					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GGATGGAGAAGACACCACACT	0.557																																							uc002wwa.2		NA																	0				lung(2)|pancreas(2)	4						c.(379-381)GAC>CAC		RAS-like GTP-binding protein REM							98.0	75.0	83.0					20																	30065669		2203	4300	6503	SO:0001583	missense	28954				small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity	g.chr20:30065669G>C	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.379G>C	20.37:g.30065669G>C	ENSP00000201979:p.Asp127His		Somatic					p.D127H	NM_014012	NP_054731	WXS	Illumina HiSeq	Unspecified	O75628	REM1_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		3	663	+	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		127					E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	ENST00000201979.2	37	c.379G>C	CCDS13181.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802776	0.70682	.	.	ENSG00000088320	ENST00000201979	T	0.76968	-1.06	4.5	4.5	0.54988	Small GTP-binding protein domain (1);	0.122077	0.53938	D	0.000042	T	0.80502	0.4635	N	0.25332	0.735	0.53005	D	0.999966	D	0.65815	0.995	D	0.64877	0.93	D	0.83484	0.0066	10	0.72032	D	0.01	.	16.3764	0.83401	0.0:0.0:1.0:0.0	.	127	O75628	REM1_HUMAN	H	127	ENSP00000201979:D127H	ENSP00000201979:D127H	D	+	1	0	REM1	29529330	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.166000	0.77553	2.329000	0.79093	0.563000	0.77884	GAC		0.557	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012		9	27	0	0	0	0.010729	0	9	27				
IGSF5	150084	broad.mit.edu	37	21	41142889	41142889	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr21:41142889G>C	ENST00000380588.4	+	4	568	c.465G>C	c.(463-465)gaG>gaC	p.E155D	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	155	Ig-like V-type 2.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				TAGTCGCTGAGAATGAACCTT	0.463																																							uc002yyo.2		NA																	0					0						c.(463-465)GAG>GAC		immunoglobulin superfamily 5 like							69.0	64.0	66.0					21																	41142889		2203	4300	6503	SO:0001583	missense	150084					integral to membrane|tight junction		g.chr21:41142889G>C		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.465G>C	21.37:g.41142889G>C	ENSP00000369962:p.Glu155Asp		Somatic					p.E155D	NM_001080444	NP_001073913	WXS	Illumina HiSeq	Unspecified	Q9NSI5	IGSF5_HUMAN			4	568	+		Prostate(19;5.35e-06)	155			Ig-like V-type 2.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000380588.4	37	c.465G>C	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692130	0.30052	.	.	ENSG00000183067	ENST00000380588	T	0.11821	2.74	5.17	1.32	0.21799	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.463064	0.25335	N	0.031415	T	0.16214	0.0390	L	0.52573	1.65	0.20489	N	0.999893	D	0.52996	0.957	P	0.50896	0.653	T	0.08411	-1.0723	10	0.39692	T	0.17	-16.1621	6.0787	0.19928	0.2189:0.2494:0.5316:0.0	.	155	Q9NSI5	IGSF5_HUMAN	D	155	ENSP00000369962:E155D	ENSP00000369962:E155D	E	+	3	2	IGSF5	40064759	0.241000	0.23857	0.045000	0.18777	0.008000	0.06430	0.456000	0.21859	0.121000	0.18284	0.650000	0.86243	GAG		0.463	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1			12	50	0	0	0	0.00245	0	12	50				
PWP2	5822	broad.mit.edu	37	21	45540973	45540973	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr21:45540973G>A	ENST00000291576.7	+	13	1753	c.1626G>A	c.(1624-1626)ctG>ctA	p.L542L		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	542					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		CGCTGGCCCTGACCTCTGATG	0.607																																							uc002zeb.2		NA																	0				pancreas(1)	1						c.(1624-1626)CTG>CTA		PWP2 periodic tryptophan protein homolog							59.0	51.0	54.0					21																	45540973		2203	4300	6503	SO:0001819	synonymous_variant	5822					cytoplasm|nucleolus	signal transducer activity	g.chr21:45540973G>A		CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1626G>A	21.37:g.45540973G>A			Somatic					p.L542L	NM_005049	NP_005040	WXS	Illumina HiSeq	Unspecified	Q15269	PWP2_HUMAN		STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)	13	1716	+			542			WD 12.		B2RAG8|Q96A77	Silent	SNP	ENST00000291576.7	37	c.1626G>A	CCDS33579.1																																																																																				0.607	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049		12	26	0	0	0	0.013537	0	12	26				
CLTCL1	8218	broad.mit.edu	37	22	19222139	19222139	+	Missense_Mutation	SNP	G	G	A	rs560664885		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr22:19222139G>A	ENST00000263200.10	-	7	1132	c.1060C>T	c.(1060-1062)Cgt>Tgt	p.R354C	CLTCL1_ENST00000353891.5_Missense_Mutation_p.R354C|CLTCL1_ENST00000427926.1_Missense_Mutation_p.R354C	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	354	Globular terminal domain.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					AGGTTACTACGAACGGCCAAA	0.483			T	?	ALCL								G|||	1	0.000199681	0.0	0.0	5008	,	,		21951	0.0		0.0	False		,,,				2504	0.001						uc002zpb.2		NA		Dom	yes		22	22q11.21	8218	T	"""clathrin, heavy polypeptide-like 1"""			L	?		ALCL		0				ovary(4)|central_nervous_system(1)	5						c.(1060-1062)CGT>TGT		clathrin, heavy polypeptide-like 1 isoform 1							106.0	105.0	106.0					22																	19222139		1941	4136	6077	SO:0001583	missense	8218				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity	g.chr22:19222139G>A		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.1060C>T	22.37:g.19222139G>A	ENSP00000445677:p.Arg354Cys		Somatic				CLTCL1_uc011agv.1_Missense_Mutation_p.R354C|CLTCL1_uc011agw.1_Missense_Mutation_p.R354C	p.R354C	NM_007098	NP_009029	WXS	Illumina HiSeq	Unspecified	P53675	CLH2_HUMAN			7	1135	-	Colorectal(54;0.0993)		354			Globular terminal domain.		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	c.1060C>T	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.239547	0.39598	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.51325	0.71;0.71;0.71	3.3	2.27	0.28462	Clathrin, heavy chain, linker, core motif (1);Armadillo-type fold (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.64402	D	0.000003	T	0.55878	0.1948	M	0.90870	3.155	0.80722	D	1	B;B	0.27068	0.167;0.022	B;B	0.31191	0.125;0.046	T	0.61028	-0.7145	10	0.59425	D	0.04	-7.9411	10.6885	0.45856	0.0968:0.0:0.9032:0.0	.	354;354	P53675-2;P53675	.;CLH2_HUMAN	C	354	ENSP00000439662:R354C;ENSP00000445677:R354C;ENSP00000441158:R354C	ENSP00000445677:R354C	R	-	1	0	CLTCL1	17602139	1.000000	0.71417	0.937000	0.37676	0.573000	0.36030	4.288000	0.59007	0.731000	0.32448	0.467000	0.42956	CGT		0.483	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098		10	114	0	0	0	0.008291	0	10	114				
CSNK1E	1454	broad.mit.edu	37	22	38690475	38690475	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr22:38690475C>T	ENST00000396832.1	-	8	1211	c.951G>A	c.(949-951)atG>atA	p.M317I	CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000359867.3_Missense_Mutation_p.M317I|CSNK1E_ENST00000400206.2_Missense_Mutation_p.M317I|CSNK1E_ENST00000403904.1_Missense_Mutation_p.M317I	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	317					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GTAGCTGCCCCATCCTCTCCT	0.706																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	uc003avj.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(949-951)ATG>ATA		casein kinase 1 epsilon							13.0	10.0	11.0					22																	38690475		2193	4284	6477	SO:0001583	missense	1454				DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr22:38690475C>T		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.951G>A	22.37:g.38690475C>T	ENSP00000380044:p.Met317Ile		Somatic				CSNK1E_uc003avk.2_Missense_Mutation_p.M317I|CSNK1E_uc003avl.1_RNA|CSNK1E_uc003avm.1_Missense_Mutation_p.M317I|CSNK1E_uc003avn.1_Missense_Mutation_p.M1I|CSNK1E_uc003avo.2_Missense_Mutation_p.M317I	p.M317I	NM_152221	NP_689407	WXS	Illumina HiSeq	Unspecified	P49674	KC1E_HUMAN			8	1212	-	Melanoma(58;0.045)		317						Missense_Mutation	SNP	ENST00000396832.1	37	c.951G>A	CCDS13970.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	8.982|8.982|8.982	0.975490|0.975490|0.975490	0.18736|0.18736|0.18736	.|.|.	.|.|.	ENSG00000213923|ENSG00000213923|ENSG00000213923	ENST00000431632|ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904|ENST00000366216	.|T;T;T;T|.	.|0.54279|.	.|0.58;0.58;0.58;0.58|.	5.56|5.56|5.56	5.56|5.56|5.56	0.83823|0.83823|0.83823	.|.|.	.|0.381154|.	.|0.36167|.	.|N|.	.|0.002745|.	T|T|.	0.56016|0.56016|.	0.1957|0.1957|.	N|N|N	0.22421|0.22421|0.22421	0.69|0.69|0.69	0.38709|0.38709|0.38709	D|D|D	0.953163|0.953163|0.953163	.|B|.	.|0.02656|.	.|0.0|.	.|B|.	.|0.01281|.	.|0.0|.	T|T|.	0.53486|0.53486|.	-0.8432|-0.8432|.	5|10|.	.|0.33141|.	.|T|.	.|0.24|.	.|.|.	19.5338|19.5338|19.5338	0.95240|0.95240|0.95240	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|317|.	.|P49674|.	.|KC1E_HUMAN|.	R|I|X	45|317|20	.|ENSP00000352929:M317I;ENSP00000380044:M317I;ENSP00000383067:M317I;ENSP00000384074:M317I|.	.|ENSP00000352929:M317I|.	G|M|W	-|-|-	1|3|2	0|0|0	CSNK1E|CSNK1E|CSNK1E	37020421|37020421|37020421	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.176000|0.176000|0.176000	0.22953|0.22953|0.22953	2.083000|2.083000|2.083000	0.41615|0.41615|0.41615	2.600000|2.600000|2.600000	0.87896|0.87896|0.87896	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GGG|ATG|TGG		0.706	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894		3	18	0	0	0	0.004672	0	3	18				
TBC1D22A	25771	broad.mit.edu	37	22	47290698	47290698	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr22:47290698C>T	ENST00000337137.4	+	7	1022	c.856C>T	c.(856-858)Cgc>Tgc	p.R286C	TBC1D22A_ENST00000406733.1_Missense_Mutation_p.R239C|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.R208C|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.R239C|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.R227C	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	286	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		AGACATCCCTCGCATGAGCCC	0.507																																							uc003bib.2		NA																	0				ovary(1)	1						c.(856-858)CGC>TGC		TBC1 domain family, member 22A							214.0	158.0	177.0					22																	47290698		2203	4300	6503	SO:0001583	missense	25771					intracellular	protein homodimerization activity|Rab GTPase activator activity	g.chr22:47290698C>T	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.856C>T	22.37:g.47290698C>T	ENSP00000336724:p.Arg286Cys		Somatic				TBC1D22A_uc010haf.2_Missense_Mutation_p.R256C|TBC1D22A_uc003bic.2_Missense_Mutation_p.R227C|TBC1D22A_uc003bie.2_Missense_Mutation_p.R208C|TBC1D22A_uc003bid.2_RNA|TBC1D22A_uc010hag.2_RNA|TBC1D22A_uc003bif.2_Missense_Mutation_p.R239C	p.R286C	NM_014346	NP_055161	WXS	Illumina HiSeq	Unspecified	Q8WUA7	TB22A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)	7	991	+		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)	286			Rab-GAP TBC.		B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	37	c.856C>T	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.087550	0.76642	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.06	5.06	0.68205	Rab-GAP/TBC domain (4);	0.056069	0.64402	D	0.000001	T	0.71022	0.3291	H	0.98068	4.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.83095	-0.0131	10	0.87932	D	0	.	15.9266	0.79621	0.0:1.0:0.0:0.0	.	286;208;227;286	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	C	286;239;227;208;239	ENSP00000336724:R286C;ENSP00000370383:R239C;ENSP00000384036:R227C;ENSP00000347932:R208C;ENSP00000385634:R239C	ENSP00000336724:R286C	R	+	1	0	TBC1D22A	45669362	1.000000	0.71417	0.989000	0.46669	0.976000	0.68499	4.600000	0.61083	2.355000	0.79922	0.655000	0.94253	CGC		0.507	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346		35	110	0	0	0	0.011902	0	35	110				
MYRIP	25924	broad.mit.edu	37	3	40251560	40251560	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:40251560G>C	ENST00000302541.6	+	11	2223	c.1881G>C	c.(1879-1881)caG>caC	p.Q627H	MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000444716.1_Missense_Mutation_p.Q627H|RN7SL411P_ENST00000585204.1_RNA|MYRIP_ENST00000396217.3_Missense_Mutation_p.Q538H|MYRIP_ENST00000539167.1_Missense_Mutation_p.Q440H|MYRIP_ENST00000425621.1_Missense_Mutation_p.Q627H	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	627	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		ACAACAGCCAGAGTGTCCAGG	0.507																																							uc003cka.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1879-1881)CAG>CAC		myosin VIIA and Rab interacting protein							39.0	38.0	39.0					3																	40251560		2203	4300	6503	SO:0001583	missense	25924				intracellular protein transport		actin binding|zinc ion binding	g.chr3:40251560G>C	AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.1881G>C	3.37:g.40251560G>C	ENSP00000301972:p.Gln627His		Somatic				MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Missense_Mutation_p.Q627H|MYRIP_uc010hhw.2_Missense_Mutation_p.Q538H|MYRIP_uc011ayz.1_Missense_Mutation_p.Q440H|uc003ckb.2_Intron	p.Q627H	NM_015460	NP_056275	WXS	Illumina HiSeq	Unspecified	Q8NFW9	MYRIP_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)	11	2016	+			627			Actin-binding.		B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	37	c.1881G>C	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157206	0.38119	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.52	2.59	0.31030	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.586686	0.17405	N	0.175384	T	0.35335	0.0928	L	0.50333	1.59	0.09310	N	0.999991	D;P;B	0.55800	0.973;0.925;0.064	P;P;B	0.57548	0.823;0.667;0.055	T	0.09840	-1.0656	9	.	.	.	.	8.984	0.35983	0.0:0.302:0.5413:0.1568	.	538;627;627	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	H	627;627;627;538;440	ENSP00000398665:Q627H;ENSP00000301972:Q627H;ENSP00000389323:Q627H;ENSP00000379519:Q538H;ENSP00000438297:Q440H	.	Q	+	3	2	MYRIP	40226564	0.995000	0.38212	0.569000	0.28460	0.993000	0.82548	1.409000	0.34680	0.230000	0.21059	0.655000	0.94253	CAG		0.507	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460		17	14	0	0	0	0.006122	0	17	14				
LAMB2	3913	broad.mit.edu	37	3	49163465	49163465	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:49163465G>A	ENST00000418109.1	-	18	2443	c.2279C>T	c.(2278-2280)tCt>tTt	p.S760F	LAMB2_ENST00000305544.4_Missense_Mutation_p.S760F|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	760	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTCAGAGGGAGAAGTCTTGCT	0.597																																							uc003cwe.2		NA																	0				ovary(3)	3						c.(2278-2280)TCT>TTT		laminin, beta 2 precursor							94.0	86.0	89.0					3																	49163465		2203	4300	6503	SO:0001583	missense	3913				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	g.chr3:49163465G>A		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2279C>T	3.37:g.49163465G>A	ENSP00000388325:p.Ser760Phe		Somatic				LAMB2_uc003cwf.1_Missense_Mutation_p.S760F	p.S760F	NM_002292	NP_002283	WXS	Illumina HiSeq	Unspecified	P55268	LAMB2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	17	2578	-			760			Laminin IV type B.		Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	c.2279C>T	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	6.522	0.464626	0.12402	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.35789	1.29;1.29	5.66	0.439	0.16567	Laminin IV (1);	0.734127	0.13756	N	0.364950	T	0.24774	0.0601	L	0.34521	1.04	0.09310	N	1	B	0.27559	0.181	B	0.17098	0.017	T	0.12116	-1.0560	10	0.59425	D	0.04	.	9.5307	0.39191	0.1742:0.1204:0.7055:0.0	.	760	P55268	LAMB2_HUMAN	F	760	ENSP00000388325:S760F;ENSP00000307156:S760F	ENSP00000307156:S760F	S	-	2	0	LAMB2	49138469	0.152000	0.22762	0.001000	0.08648	0.005000	0.04900	0.208000	0.17415	-0.211000	0.10124	-0.145000	0.13849	TCT		0.597	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		33	20	0	0	0	0.003755	0	33	20				
NPRL2	10641	broad.mit.edu	37	3	50386409	50386409	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:50386409C>G	ENST00000232501.3	-	5	919	c.481G>C	c.(481-483)Gag>Cag	p.E161Q	CYB561D2_ENST00000232508.5_5'Flank|CYB561D2_ENST00000424512.1_5'Flank|CYB561D2_ENST00000418577.1_5'Flank|CYB561D2_ENST00000425346.1_5'Flank|NPRL2_ENST00000493465.1_5'Flank|ZMYND10_ENST00000231749.3_5'Flank|XXcos-LUCA11.5_ENST00000606589.1_5'Flank	NM_006545.4	NP_006536.3	Q8WTW4	NPRL2_HUMAN	nitrogen permease regulator-like 2 (S. cerevisiae)	161					negative regulation of kinase activity (GO:0033673)|protein phosphorylation (GO:0006468)		GTPase activator activity (GO:0005096)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	11						GGCCGCTGCTCAATCACCTTC	0.532																																							uc003daj.1		NA																	0				lung(1)	1						c.(481-483)GAG>CAG		tumor suppressor candidate 4							103.0	104.0	103.0					3																	50386409		2203	4300	6503	SO:0001583	missense	10641				negative regulation of kinase activity		protein binding|protein kinase activity	g.chr3:50386409C>G	AF040708	CCDS2826.1	3p21.3	2010-03-30	2010-03-30	2010-03-30	ENSG00000114388	ENSG00000114388			24969	protein-coding gene	gene with protein product		607072	"""tumor suppressor candidate 4"""	TUSC4		11085536	Standard	NM_006545		Approved	NPR2L, NPR2	uc003daj.1	Q8WTW4	OTTHUMG00000156864	ENST00000232501.3:c.481G>C	3.37:g.50386409C>G	ENSP00000232501:p.Glu161Gln		Somatic				NPRL2_uc003dai.1_Missense_Mutation_p.E41Q|CYB561D2_uc003dak.2_5'Flank|CYB561D2_uc003dal.2_5'Flank|CYB561D2_uc003dam.2_5'Flank	p.E161Q	NM_006545	NP_006536	WXS	Illumina HiSeq	Unspecified	Q8WTW4	NPRL2_HUMAN			5	884	-			161					A8K831|Q6FGS2|Q9Y249|Q9Y497	Missense_Mutation	SNP	ENST00000232501.3	37	c.481G>C	CCDS2826.1	.	.	.	.	.	.	.	.	.	.	C	9.532	1.111152	0.20714	.	.	ENSG00000114388	ENST00000232501	.	.	.	5.58	5.58	0.84498	.	0.189568	0.53938	D	0.000042	T	0.57051	0.2027	L	0.41236	1.265	0.43050	D	0.994659	B	0.15141	0.012	B	0.14578	0.011	T	0.50583	-0.8811	9	0.34782	T	0.22	-8.3215	19.5689	0.95404	0.0:1.0:0.0:0.0	.	161	Q8WTW4	NPRL2_HUMAN	Q	161	.	ENSP00000232501:E161Q	E	-	1	0	NPRL2	50361413	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.881000	0.63114	2.626000	0.88956	0.655000	0.94253	GAG		0.532	NPRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346299.1	NM_006545		49	65	0	0	0	0.01441	0	49	65				
PDZRN3	23024	broad.mit.edu	37	3	73438989	73438989	+	Missense_Mutation	SNP	C	C	T	rs187848097	byFrequency	TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:73438989C>T	ENST00000263666.4	-	7	1508	c.1394G>A	c.(1393-1395)cGa>cAa	p.R465Q	PDZRN3_ENST00000479530.1_Missense_Mutation_p.R182Q|PDZRN3_ENST00000466780.1_Missense_Mutation_p.R122Q|PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000535920.1_Missense_Mutation_p.R187Q|PDZRN3_ENST00000462146.2_Missense_Mutation_p.R122Q	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	465	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GTCTCCTTCTCGGATGCGCCC	0.478													C|||	2	0.000399361	0.0015	0.0	5008	,	,		23292	0.0		0.0	False		,,,				2504	0.0						uc003dpl.1		NA																	0				pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(1393-1395)CGA>CAA		PDZ domain containing ring finger 3							175.0	132.0	147.0					3																	73438989		2203	4300	6503	SO:0001583	missense	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73438989C>T	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1394G>A	3.37:g.73438989C>T	ENSP00000263666:p.Arg465Gln		Somatic				PDZRN3_uc011bgh.1_Missense_Mutation_p.R122Q|PDZRN3_uc010hoe.1_Missense_Mutation_p.R163Q|PDZRN3_uc011bgf.1_Missense_Mutation_p.R182Q|PDZRN3_uc011bgg.1_Missense_Mutation_p.R185Q	p.R465Q	NM_015009	NP_055824	WXS	Illumina HiSeq	Unspecified	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	7	1490	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	465			PDZ 2.		A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	c.1394G>A	CCDS33789.1	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	C|C	36|36	5.654841|5.654841	0.96724|0.96724	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000494559|ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	.|T;T;T;T;T;T	.|0.26067	.|1.76;1.76;1.76;1.76;1.76;1.76	5.43|5.43	5.43|5.43	0.79202|0.79202	.|PDZ/DHR/GLGF (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.43612|0.43612	0.1255|0.1255	L|L	0.38692|0.38692	1.165|1.165	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.89917	.|0.991;1.0;0.917;0.999	.|P;D;P;D	.|0.81914	.|0.796;0.993;0.456;0.995	T|T	0.24119|0.24119	-1.0169|-1.0169	5|10	.|0.52906	.|T	.|0.07	.|.	18.8532|18.8532	0.92241|0.92241	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|187;182;182;465	.|F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.|.;.;.;PZRN3_HUMAN	K|Q	62|465;187;122;122;182;465;163	.|ENSP00000263666:R465Q;ENSP00000442026:R187Q;ENSP00000418168:R122Q;ENSP00000418484:R122Q;ENSP00000418624:R182Q;ENSP00000419250:R163Q	.|ENSP00000263666:R465Q	E|R	-|-	1|2	0|0	PDZRN3|PDZRN3	73521679|73521679	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	7.638000|7.638000	0.83328|0.83328	2.547000|2.547000	0.85894|0.85894	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.478	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		4	98	0	0	0	0.009096	0	4	98				
PVRL3	25945	broad.mit.edu	37	3	110837719	110837719	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:110837719G>C	ENST00000485303.1	+	3	994	c.719G>C	c.(718-720)aGa>aCa	p.R240T	PVRL3_ENST00000493615.1_Missense_Mutation_p.R217T|PVRL3_ENST00000319792.3_Missense_Mutation_p.R240T	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	240	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						AGATTTGCTAGAGGAAGGCGA	0.383																																							uc003dxt.1		NA																	0				upper_aerodigestive_tract(2)	2						c.(718-720)AGA>ACA		poliovirus receptor-related 3 precursor							83.0	79.0	81.0					3																	110837719		2203	4300	6503	SO:0001583	missense	25945				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity	g.chr3:110837719G>C	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.719G>C	3.37:g.110837719G>C	ENSP00000418070:p.Arg240Thr		Somatic				PVRL3_uc003dxu.1_Missense_Mutation_p.R217T	p.R240T	NM_015480	NP_056295	WXS	Illumina HiSeq	Unspecified	Q9NQS3	PVRL3_HUMAN			3	719	+			240			Extracellular (Potential).|Ig-like C2-type 1.		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	c.719G>C	CCDS2957.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452167	0.43531	.	.	ENSG00000177707	ENST00000485303;ENST00000319792;ENST00000493615	T;T;T	0.76316	-1.01;-1.01;-1.01	5.6	4.73	0.59995	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.053136	0.85682	D	0.000000	T	0.78622	0.4312	L	0.44542	1.39	0.37948	D	0.932544	D;D	0.59357	0.964;0.985	P;P	0.54759	0.677;0.76	T	0.79718	-0.1686	9	.	.	.	.	12.3271	0.55018	0.0818:0.0:0.9182:0.0	.	217;240	E9PFR0;Q9NQS3	.;PVRL3_HUMAN	T	240;240;217	ENSP00000418070:R240T;ENSP00000321514:R240T;ENSP00000420579:R217T	.	R	+	2	0	PVRL3	112320409	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.529000	0.67135	1.384000	0.46424	0.650000	0.86243	AGA		0.383	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480		45	45	0	0	0	0.01441	0	45	45				
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		899	Substitution - Missense(899)	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1633-1635)GAG>AAG		phosphoinositide-3-kinase, catalytic, alpha							61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936091G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E545K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1790	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		545		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1633G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			24	29	0	0	0	0.007291	0	24	29				
N4BP2	55728	broad.mit.edu	37	4	40121580	40121580	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:40121580G>C	ENST00000261435.6	+	9	2265	c.1849G>C	c.(1849-1851)Gaa>Caa	p.E617Q		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	617					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						TATTATCTCTGAAAAAGAAGA	0.308																																							uc003guy.3		NA																	0				lung(3)|breast(2)|kidney(2)|ovary(1)	8						c.(1849-1851)GAA>CAA		Nedd4 binding protein 2							36.0	41.0	39.0					4																	40121580		2159	4246	6405	SO:0001583	missense	55728					cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	g.chr4:40121580G>C	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.1849G>C	4.37:g.40121580G>C	ENSP00000261435:p.Glu617Gln		Somatic				N4BP2_uc010ifq.2_Missense_Mutation_p.E537Q|N4BP2_uc010ifr.2_Missense_Mutation_p.E537Q	p.E617Q	NM_018177	NP_060647	WXS	Illumina HiSeq	Unspecified	Q86UW6	N4BP2_HUMAN			9	2187	+			617					A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	c.1849G>C	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.882|3.882	-0.025759|-0.025759	0.07589|0.07589	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000261435;ENST00000381804|ENST00000513269	T|.	0.18338|.	2.22|.	5.93|5.93	3.18|3.18	0.36537|0.36537	.|.	0.391819|.	0.26499|.	N|.	0.024032|.	T|.	0.39835|.	0.1093|.	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	1|1	P;P|.	0.37276|.	0.589;0.454|.	B;B|.	0.33339|.	0.162;0.078|.	T|.	0.25779|.	-1.0122|.	10|.	0.19590|.	T|.	0.45|.	-2.2761|-2.2761	6.1475|6.1475	0.20293|0.20293	0.2565:0.0:0.6185:0.125|0.2565:0.0:0.6185:0.125	.|.	617;617|.	Q86UW6-2;Q86UW6|.	.;N4BP2_HUMAN|.	Q|S	617;537|263	ENSP00000261435:E617Q|.	ENSP00000261435:E617Q|.	E|X	+|+	1|2	0|2	N4BP2|N4BP2	39797975|39797975	0.096000|0.096000	0.21769|0.21769	0.945000|0.945000	0.38365|0.38365	0.286000|0.286000	0.27126|0.27126	1.781000|1.781000	0.38644|0.38644	0.827000|0.827000	0.34685|0.34685	0.555000|0.555000	0.69702|0.69702	GAA|TGA		0.308	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177		10	72	0	0	0	0.010729	0	10	72				
N4BP2	55728	broad.mit.edu	37	4	40122548	40122548	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:40122548G>C	ENST00000261435.6	+	9	3233	c.2817G>C	c.(2815-2817)aaG>aaC	p.K939N		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	939					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AAAAACTAAAGACATTGGGTA	0.418																																							uc003guy.3		NA																	0				lung(3)|breast(2)|kidney(2)|ovary(1)	8						c.(2815-2817)AAG>AAC		Nedd4 binding protein 2							68.0	65.0	66.0					4																	40122548		2203	4300	6503	SO:0001583	missense	55728					cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	g.chr4:40122548G>C	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2817G>C	4.37:g.40122548G>C	ENSP00000261435:p.Lys939Asn		Somatic				N4BP2_uc010ifq.2_Missense_Mutation_p.K859N|N4BP2_uc010ifr.2_Missense_Mutation_p.K859N	p.K939N	NM_018177	NP_060647	WXS	Illumina HiSeq	Unspecified	Q86UW6	N4BP2_HUMAN			9	3155	+			939					A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	c.2817G>C	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.786|5.786	0.329395|0.329395	0.10956|0.10956	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.20200	.|2.09	5.49|5.49	1.73|1.73	0.24493|0.24493	.|.	.|1.011480	.|0.07899	.|N	.|0.972334	T|T	0.37433|0.37433	0.1003|0.1003	M|M	0.61703|0.61703	1.905|1.905	0.09310|0.09310	N|N	1|1	.|D;P	.|0.76494	.|0.999;0.806	.|D;B	.|0.66351	.|0.943;0.231	T|T	0.13098|0.13098	-1.0522|-1.0522	5|10	.|0.45353	.|T	.|0.12	-6.8334|-6.8334	5.0113|5.0113	0.14313|0.14313	0.5442:0.1507:0.3051:0.0|0.5442:0.1507:0.3051:0.0	.|.	.|939;939	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	H|N	586|939;859	.|ENSP00000261435:K939N	.|ENSP00000261435:K939N	D|K	+|+	1|3	0|2	N4BP2|N4BP2	39798943|39798943	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.011000|0.011000	0.07611|0.07611	0.307000|0.307000	0.19296|0.19296	0.127000|0.127000	0.18452|0.18452	-0.367000|-0.367000	0.07326|0.07326	GAC|AAG		0.418	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177		12	46	0	0	0	0.003163	0	12	46				
BMP2K	55589	broad.mit.edu	37	4	79808376	79808376	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:79808376C>G	ENST00000335016.5	+	15	2166	c.2000C>G	c.(1999-2001)tCt>tGt	p.S667C	PAQR3_ENST00000295462.3_3'UTR	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	667					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						GACTCACTTTCTGCTCCACAT	0.358																																							uc003hlk.2		NA																	0				lung(1)	1						c.(1999-2001)TCT>TGT		BMP-2 inducible kinase isoform a							126.0	117.0	120.0					4																	79808376		1915	4120	6035	SO:0001583	missense	55589					nucleus	ATP binding|protein serine/threonine kinase activity	g.chr4:79808376C>G	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2000C>G	4.37:g.79808376C>G	ENSP00000334836:p.Ser667Cys		Somatic				PAQR3_uc003hlm.2_RNA|PAQR3_uc003hln.2_RNA	p.S667C	NM_198892	NP_942595	WXS	Illumina HiSeq	Unspecified	Q9NSY1	BMP2K_HUMAN			15	2166	+			667					O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	c.2000C>G	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.00|19.00	3.741136|3.741136	0.69304|0.69304	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000502613|ENST00000335016	.|T	.|0.21932	.|1.98	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.336817	.|0.27782	.|N	.|0.017870	T|T	0.31606|0.31606	0.0802|0.0802	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|D	.|0.60575	.|0.988	.|P	.|0.50231	.|0.635	T|T	0.00888|0.00888	-1.1526|-1.1526	5|10	.|0.56958	.|D	.|0.05	-9.9689|-9.9689	20.0498|20.0498	0.97621|0.97621	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|667	.|Q9NSY1	.|BMP2K_HUMAN	L|C	359|667	.|ENSP00000334836:S667C	.|ENSP00000334836:S667C	F|S	+|+	3|2	2|0	BMP2K|BMP2K	80027400|80027400	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	4.490000|4.490000	0.60319|0.60319	2.753000|2.753000	0.94483|0.94483	0.557000|0.557000	0.71058|0.71058	TTC|TCT		0.358	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593		4	26	0	0	0	0.000602	0	4	26				
KIAA1109	84162	broad.mit.edu	37	4	123192815	123192815	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:123192815C>G	ENST00000264501.4	+	47	8509	c.8136C>G	c.(8134-8136)ttC>ttG	p.F2712L	KIAA1109_ENST00000455637.1_Missense_Mutation_p.F2712L|KIAA1109_ENST00000388738.3_Missense_Mutation_p.F2712L			Q2LD37	K1109_HUMAN	KIAA1109	2712					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGCTTAACTTCTATTCACTTA	0.348																																							uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(8134-8136)TTC>TTG		fragile site-associated protein							57.0	54.0	55.0					4																	123192815		1859	4092	5951	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123192815C>G	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.8136C>G	4.37:g.123192815C>G	ENSP00000264501:p.Phe2712Leu		Somatic				KIAA1109_uc003iel.1_Missense_Mutation_p.F647L|KIAA1109_uc003iek.2_Missense_Mutation_p.F1331L	p.F2712L	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			45	8181	+			2712					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.8136C>G	CCDS43267.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	7.799|7.799|7.799	0.713153|0.713153|0.713153	0.15306|0.15306|0.15306	.|.|.	.|.|.	ENSG00000138688|ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000419325|ENST00000446180	T;T;T|.|.	0.12147|.|.	3.34;3.34;2.71|.|.	5.78|5.78|5.78	3.11|3.11|3.11	0.35812|0.35812|0.35812	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.31949|0.31949|0.31949	0.0813|0.0813|0.0813	N|N|N	0.05441|0.05441|0.05441	-0.05|-0.05|-0.05	0.39610|0.39610|0.39610	D|D|D	0.969864|0.969864|0.969864	D;D;D|.|.	0.58268|.|.	0.974;0.974;0.982|.|.	D;D;D|.|.	0.70487|.|.	0.969;0.969;0.952|.|.	T|T|T	0.08289|0.08289|0.08289	-1.0729|-1.0729|-1.0729	10|5|5	0.02654|.|.	T|.|.	1|.|.	.|.|.	8.899|8.899|8.899	0.35484|0.35484|0.35484	0.0:0.6521:0.0:0.3479|0.0:0.6521:0.0:0.3479|0.0:0.6521:0.0:0.3479	.|.|.	2712;2711;2712|.|.	Q2LD37-6;Q2LD37-2;Q2LD37|.|.	.;.;K1109_HUMAN|.|.	L|V|C	2712|670|1285	ENSP00000264501:F2712L;ENSP00000373390:F2712L;ENSP00000389925:F2712L|.|.	ENSP00000264501:F2712L|.|.	F|L|S	+|+|+	3|1|2	2|2|0	KIAA1109|KIAA1109|KIAA1109	123412265|123412265|123412265	0.990000|0.990000|0.990000	0.36364|0.36364|0.36364	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.990000|0.990000|0.990000	0.78478|0.78478|0.78478	0.359000|0.359000|0.359000	0.20233|0.20233|0.20233	0.801000|0.801000|0.801000	0.34066|0.34066|0.34066	-0.229000|-0.229000|-0.229000	0.12294|0.12294|0.12294	TTC|CTA|TCT		0.348	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		6	50	0	0	0	0.001984	0	6	50				
FAT4	79633	broad.mit.edu	37	4	126238505	126238505	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:126238505C>G	ENST00000394329.3	+	1	952	c.939C>G	c.(937-939)ttC>ttG	p.F313L		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	313	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCCTGGACTTCGAAGCTCGGC	0.647											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(937-939)TTC>TTG		FAT tumor suppressor homolog 4 precursor							27.0	33.0	31.0					4																	126238505		2019	4166	6185	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126238505C>G	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.939C>G	4.37:g.126238505C>G	ENSP00000377862:p.Phe313Leu		Somatic	OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1548		p.F313L	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			1	939	+			313			Cadherin 3.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.939C>G	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	0.932	-0.712307	0.03206	.	.	ENSG00000196159	ENST00000394329	T	0.51325	0.71	4.96	3.15	0.36227	Cadherin (4);Cadherin-like (1);	0.239455	0.21249	U	0.077661	T	0.39358	0.1075	L	0.49778	1.585	0.80722	D	1	B	0.24043	0.096	B	0.31869	0.137	T	0.07233	-1.0783	10	0.11485	T	0.65	.	8.4367	0.32791	0.0:0.6011:0.0:0.3989	.	313	Q6V0I7	FAT4_HUMAN	L	313	ENSP00000377862:F313L	ENSP00000377862:F313L	F	+	3	2	FAT4	126457955	0.995000	0.38212	0.998000	0.56505	0.353000	0.29299	0.359000	0.20233	0.431000	0.26258	0.655000	0.94253	TTC		0.647	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		9	45	0	0	0	0.008291	0	9	45				
PCDH10	57575	broad.mit.edu	37	4	134073363	134073363	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:134073363G>A	ENST00000264360.5	+	1	2894	c.2068G>A	c.(2068-2070)Ggg>Agg	p.G690R		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	690	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		gggcgggggcgggagcggagg	0.706																																							uc003iha.2		NA																	0				ovary(2)	2						c.(2068-2070)GGG>AGG		protocadherin 10 isoform 1 precursor							34.0	41.0	38.0					4																	134073363		2195	4293	6488	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134073363G>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2068G>A	4.37:g.134073363G>A	ENSP00000264360:p.Gly690Arg		Somatic				PCDH10_uc003igz.2_Missense_Mutation_p.G690R	p.G690R	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2894	+			690			Cadherin 6.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.2068G>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842201	0.51057	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.51574	0.7	4.48	4.48	0.54585	.	0.000000	0.44285	D	0.000474	T	0.26702	0.0653	N	0.08118	0	0.41349	D	0.987354	P;P	0.50443	0.935;0.935	B;B	0.39771	0.232;0.309	T	0.09530	-1.0670	10	0.16896	T	0.51	.	16.1033	0.81203	0.0:0.0:1.0:0.0	.	690;690	Q9P2E7;Q96SF0	PCD10_HUMAN;.	R	690	ENSP00000264360:G690R	ENSP00000264360:G690R	G	+	1	0	PCDH10	134292813	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.153000	0.50685	2.322000	0.78497	0.561000	0.74099	GGG		0.706	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		22	35	0	0	0	0.00333	0	22	35				
TLR2	7097	broad.mit.edu	37	4	154625613	154625613	+	Silent	SNP	A	A	G	rs376583514		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr4:154625613A>G	ENST00000260010.6	+	1	2962	c.1554A>G	c.(1552-1554)caA>caG	p.Q518Q		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	518					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	CTAAGGAGCAACTTGACTCAT	0.428																																							uc003inq.2		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(1552-1554)CAA>CAG		toll-like receptor 2 precursor							57.0	60.0	59.0					4																	154625613		2203	4300	6503	SO:0001819	synonymous_variant	7097				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding	g.chr4:154625613A>G	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.1554A>G	4.37:g.154625613A>G			Somatic				TLR2_uc003inr.2_Silent_p.Q518Q|TLR2_uc003ins.2_Silent_p.Q518Q	p.Q518Q	NM_003264	NP_003255	WXS	Illumina HiSeq	Unspecified	O60603	TLR2_HUMAN			3	1773	+	all_hematologic(180;0.093)	Renal(120;0.117)	518			LRR 14.|Extracellular (Potential).		B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Silent	SNP	ENST00000260010.6	37	c.1554A>G	CCDS3784.1																																																																																				0.428	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1			45	39	0	0	0	0.010771	0	45	39				
UGT3A2	167127	broad.mit.edu	37	5	36049273	36049273	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:36049273G>A	ENST00000282507.3	-	4	662	c.561C>T	c.(559-561)ttC>ttT	p.F187F	UGT3A2_ENST00000513300.1_Silent_p.F153F|UGT3A2_ENST00000545528.1_Intron|UGT3A2_ENST00000504954.1_Intron	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	187					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCAAGGAACGGAATACTGGAA	0.463																																							uc003jjz.1		NA																	0				ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6						c.(559-561)TTC>TTT		UDP glycosyltransferase 3 family, polypeptide A2							94.0	91.0	92.0					5																	36049273		2203	4300	6503	SO:0001819	synonymous_variant	167127					integral to membrane	glucuronosyltransferase activity	g.chr5:36049273G>A		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.561C>T	5.37:g.36049273G>A			Somatic				UGT3A2_uc011cos.1_Silent_p.F153F|UGT3A2_uc011cot.1_Intron	p.F187F	NM_174914	NP_777574	WXS	Illumina HiSeq	Unspecified	Q3SY77	UD3A2_HUMAN	Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		4	654	-	all_lung(31;0.000179)		187			Extracellular (Potential).		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Silent	SNP	ENST00000282507.3	37	c.561C>T	CCDS3914.1																																																																																				0.463	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914		25	71	0	0	0	0.003954	0	25	71				
SERINC5	256987	broad.mit.edu	37	5	79454754	79454754	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:79454754G>C	ENST00000507668.2	-	8	1041	c.891C>G	c.(889-891)atC>atG	p.I297M	SERINC5_ENST00000512972.2_Missense_Mutation_p.I297M|SERINC5_ENST00000512721.1_Missense_Mutation_p.I297M|SERINC5_ENST00000509193.1_Missense_Mutation_p.I295M	NM_001174071.1|NM_178276.5	NP_001167542.1|NP_840060.1	Q86VE9	SERC5_HUMAN	serine incorporator 5	297					myelination (GO:0042552)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(3)|kidney(1)|lung(3)|ovary(1)	8		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)		CAGGCACACAGATTGTAACAT	0.403																																							uc003kgj.2		NA																	0				ovary(1)	1						c.(889-891)ATC>ATG		developmentally regulated protein TPO1							123.0	119.0	120.0					5																	79454754		1891	4123	6014	SO:0001583	missense	256987				phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity	endoplasmic reticulum membrane|integral to membrane		g.chr5:79454754G>C	AF498273	CCDS54874.1	5q14.1	2014-01-28	2005-10-14	2005-10-14		ENSG00000164300			18825	protein-coding gene	gene with protein product		614551	"""chromosome 5 open reading frame 12"""	C5orf12		12688535	Standard	NM_178276		Approved	TPO1	uc011ctj.2	Q86VE9		ENST00000507668.2:c.891C>G	5.37:g.79454754G>C	ENSP00000426237:p.Ile297Met		Somatic				SERINC5_uc003kgk.2_Missense_Mutation_p.I295M|SERINC5_uc003kgl.2_RNA|SERINC5_uc003kgm.2_Missense_Mutation_p.I297M|SERINC5_uc011ctj.1_Missense_Mutation_p.I297M	p.I297M	NM_178276	NP_840060	WXS	Illumina HiSeq	Unspecified	Q86VE9	SERC5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)	8	1020	-		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)	297			Cytoplasmic (Potential).		B4DMH7|Q495A4|Q495A6	Missense_Mutation	SNP	ENST00000507668.2	37	c.891C>G	CCDS54873.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185232	0.57909	.	.	ENSG00000164300	ENST00000507668;ENST00000329637;ENST00000509193;ENST00000512972;ENST00000512721	T;T;T;T	0.19394	2.21;2.15;2.23;2.49	5.88	3.05	0.35203	.	0.046380	0.85682	D	0.000000	T	0.31482	0.0798	L	0.61036	1.89	0.42578	D	0.993203	P;B;P;P	0.51653	0.947;0.321;0.947;0.947	P;B;P;P	0.56751	0.744;0.281;0.805;0.744	T	0.03795	-1.1003	10	0.30854	T	0.27	.	7.2249	0.26010	0.135:0.0:0.6205:0.2445	.	297;297;295;297	B4DMH7;Q86VE9-2;D6RHG7;Q86VE9	.;.;.;SERC5_HUMAN	M	297;296;295;297;297	ENSP00000426237:I297M;ENSP00000426134:I295M;ENSP00000421665:I297M;ENSP00000420863:I297M	ENSP00000327542:I296M	I	-	3	3	SERINC5	79490510	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	0.723000	0.25939	0.776000	0.33473	0.591000	0.81541	ATC		0.403	SERINC5-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_178276		5	95	0	0	0	0.00308	0	5	95				
DDX46	9879	broad.mit.edu	37	5	134147433	134147433	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:134147433C>T	ENST00000354283.4	+	18	2469	c.2334C>T	c.(2332-2334)ttC>ttT	p.F778F	DDX46_ENST00000452510.2_Silent_p.F778F			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	778					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.F778F(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTAAGGGATTCAAGTTTGATG	0.353																																					Colon(13;391 453 4901 21675 24897)	Colon(13;391 453 4901 21675 24897)	uc003kzw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2332-2334)TTC>TTT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 46							112.0	117.0	115.0					5																	134147433		2203	4300	6503	SO:0001819	synonymous_variant	9879				mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr5:134147433C>T		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2334C>T	5.37:g.134147433C>T			Somatic				DDX46_uc003kzv.1_RNA	p.F778F	NM_014829	NP_055644	WXS	Illumina HiSeq	Unspecified	Q7L014	DDX46_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		18	2502	+			778					O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	37	c.2334C>T	CCDS34240.1																																																																																				0.353	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829		15	58	0	0	0	0.006122	0	15	58				
PCDHA7	56141	broad.mit.edu	37	5	140214417	140214417	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:140214417C>G	ENST00000525929.1	+	1	449	c.449C>G	c.(448-450)tCt>tGt	p.S150C	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.S150C|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	150	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCTTGACTCTCGGTTTCCA	0.552																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(448-450)TCT>TGT		protocadherin alpha 7 isoform 1 precursor							51.0	50.0	50.0					5																	140214417		2203	4292	6495	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140214417C>G	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.449C>G	5.37:g.140214417C>G	ENSP00000436426:p.Ser150Cys		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.S150C	p.S150C	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	449	+			150			Extracellular (Potential).|Cadherin 2.		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.449C>G	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.865133	0.32977	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.54071	0.59;0.59	4.17	3.3	0.37823	Cadherin (3);Cadherin-like (1);	0.000000	0.29444	U	0.012122	T	0.77512	0.4141	H	0.96833	3.89	0.26229	N	0.979049	B;P	0.41159	0.233;0.74	B;P	0.55087	0.184;0.768	T	0.73043	-0.4107	10	0.72032	D	0.01	.	12.1403	0.53994	0.0:0.915:0.0:0.085	.	150;150	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	C	150	ENSP00000436426:S150C;ENSP00000367365:S150C	ENSP00000367365:S150C	S	+	2	0	PCDHA7	140194601	0.004000	0.15560	0.988000	0.46212	0.659000	0.38960	1.491000	0.35583	0.865000	0.35603	0.455000	0.32223	TCT		0.552	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		3	33	0	0	0	0.00308	0	3	33				
PCDHA9	9752	broad.mit.edu	37	5	140228529	140228529	+	Missense_Mutation	SNP	C	C	G	rs267600395		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:140228529C>G	ENST00000532602.1	+	1	1482	c.449C>G	c.(448-450)tCt>tGt	p.S150C	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.S150C|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	150	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCTTGACTCTCGGTTTCCA	0.542																																					Melanoma(55;1800 1972 14909)	Melanoma(55;1800 1972 14909)	uc003lhu.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(448-450)TCT>TGT		protocadherin alpha 9 isoform 1 precursor							64.0	60.0	61.0					5																	140228529		2203	4298	6501	SO:0001583	missense	9752				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140228529C>G	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.449C>G	5.37:g.140228529C>G	ENSP00000436042:p.Ser150Cys		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.S150C	p.S150C	NM_031857	NP_114063	WXS	Illumina HiSeq	Unspecified	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1173	+			150			Extracellular (Potential).|Cadherin 2.		O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	c.449C>G	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372262	0.61624	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.54071	0.59;0.59	4.13	3.26	0.37387	Cadherin (3);Cadherin-like (1);	0.000000	0.29444	U	0.012122	T	0.77922	0.4203	H	0.96861	3.895	0.26165	N	0.97995	B;D	0.76494	0.276;0.999	B;P	0.61800	0.215;0.894	T	0.74188	-0.3746	10	0.87932	D	0	.	12.1631	0.54115	0.0:0.9153:0.0:0.0847	.	150;150	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	C	150	ENSP00000436042:S150C;ENSP00000367362:S150C	ENSP00000367362:S150C	S	+	2	0	PCDHA9	140208713	0.001000	0.12720	0.906000	0.35671	0.914000	0.54420	1.426000	0.34870	1.057000	0.40506	0.591000	0.81541	TCT		0.542	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		7	63	0	0	0	0.00499	0	7	63				
DPYSL3	1809	broad.mit.edu	37	5	146777387	146777387	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:146777387C>T	ENST00000398514.3	-	12	1674	c.1303G>A	c.(1303-1305)Gaa>Aaa	p.E435K	DPYSL3_ENST00000343218.5_Missense_Mutation_p.E549K|DPYSL3_ENST00000534907.1_Missense_Mutation_p.E61K	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	435					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCATCCCTTCAAAGATGTTG	0.567																																							uc003lon.1		NA																	0				ovary(1)	1						c.(1303-1305)GAA>AAA		dihydropyrimidinase-like 3							39.0	43.0	42.0					5																	146777387		2038	4222	6260	SO:0001583	missense	1809				axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity	g.chr5:146777387C>T	D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1303G>A	5.37:g.146777387C>T	ENSP00000381526:p.Glu435Lys		Somatic				DPYSL3_uc003loo.2_Missense_Mutation_p.E549K	p.E435K	NM_001387	NP_001378	WXS	Illumina HiSeq	Unspecified	Q14195	DPYL3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		12	1413	-			435					B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	c.1303G>A	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	C	37	5.991356	0.97179	.	.	ENSG00000113657	ENST00000398514;ENST00000343218;ENST00000534907	T;T;T	0.81163	-1.46;-1.46;-1.46	6.04	6.04	0.98038	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.92414	0.7592	M	0.93550	3.43	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.63957	0.92;0.834	D	0.93320	0.6692	10	0.87932	D	0	-18.8419	20.5948	0.99439	0.0:1.0:0.0:0.0	.	549;435	B3SXQ8;Q14195	.;DPYL3_HUMAN	K	435;549;61	ENSP00000381526:E435K;ENSP00000343690:E549K;ENSP00000441819:E61K	ENSP00000343690:E549K	E	-	1	0	DPYSL3	146757580	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.797000	0.85911	2.873000	0.98535	0.563000	0.77884	GAA		0.567	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387		9	30	0	0	0	0.008291	0	9	30				
GRIA1	2890	broad.mit.edu	37	5	153144112	153144112	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:153144112G>C	ENST00000285900.5	+	12	2285	c.1942G>C	c.(1942-1944)Gag>Cag	p.E648Q	GRIA1_ENST00000518142.1_Missense_Mutation_p.E568Q|GRIA1_ENST00000340592.5_Missense_Mutation_p.E648Q|GRIA1_ENST00000518783.1_Missense_Mutation_p.E658Q|GRIA1_ENST00000448073.4_Missense_Mutation_p.E658Q|GRIA1_ENST00000521843.2_Missense_Mutation_p.E579Q	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	648					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GTCTCCCATTGAGAGTGCAGA	0.532																																							uc003lva.3		NA																	0				ovary(4)|skin(2)	6						c.(1942-1944)GAG>CAG		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						125.0	104.0	111.0					5																	153144112		2203	4300	6503	SO:0001583	missense	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:153144112G>C		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1942G>C	5.37:g.153144112G>C	ENSP00000285900:p.Glu648Gln		Somatic				GRIA1_uc003luy.3_Missense_Mutation_p.E648Q|GRIA1_uc003luz.3_Missense_Mutation_p.E553Q|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.E568Q|GRIA1_uc011dcx.1_Missense_Mutation_p.E579Q|GRIA1_uc011dcy.1_Missense_Mutation_p.E658Q|GRIA1_uc011dcz.1_Missense_Mutation_p.E658Q	p.E648Q	NM_001114183	NP_001107655	WXS	Illumina HiSeq	Unspecified	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		12	2307	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	648			Extracellular (Potential).		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	c.1942G>C	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914535	0.92178	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.26	5.26	0.73747	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.47488	0.1448	N	0.19112	0.55	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.613;1.0;0.988	D;D;P;D;D	0.91635	0.999;0.999;0.455;0.998;0.934	T	0.53711	-0.8400	10	0.87932	D	0	.	17.8377	0.88704	0.0:0.0:1.0:0.0	.	658;658;568;648;648	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	Q	648;648;568;602;648;581;579;658;658	ENSP00000285900:E648Q;ENSP00000427920:E568Q;ENSP00000339343:E648Q;ENSP00000427864:E581Q;ENSP00000442108:E579Q;ENSP00000428994:E658Q;ENSP00000415569:E658Q	ENSP00000285900:E648Q	E	+	1	0	GRIA1	153124305	1.000000	0.71417	0.979000	0.43373	0.995000	0.86356	9.640000	0.98453	2.443000	0.82685	0.555000	0.69702	GAG		0.532	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			3	54	0	0	0	0.004672	0	3	54				
CDHR2	54825	broad.mit.edu	37	5	176002508	176002508	+	Splice_Site	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr5:176002508G>A	ENST00000510636.1	+	10	1044	c.770G>A	c.(769-771)gGa>gAa	p.G257E	CDHR2_ENST00000506348.1_Splice_Site_p.G257E|CDHR2_ENST00000261944.5_Splice_Site_p.G257E	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	257	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CCATTCCAGGGAACCTCGGTG	0.632																																							uc003mem.1		NA																	0				ovary(2)	2						c.(769-771)GGA>GAA		protocadherin LKC precursor							109.0	116.0	114.0					5																	176002508		2203	4300	6503	SO:0001630	splice_region_variant	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176002508G>A	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.769-1G>A	5.37:g.176002508G>A			Somatic				CDHR2_uc003men.1_Missense_Mutation_p.G257E	p.G257E	NM_017675	NP_060145	WXS	Illumina HiSeq	Unspecified	Q9BYE9	CDHR2_HUMAN			10	836	+			257			Extracellular (Potential).|Cadherin 3.		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	c.770G>A	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454667	0.26161	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.69435	-0.4;-0.4;-0.4	4.32	3.45	0.39498	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.81475	0.4830	M	0.90369	3.11	0.53005	D	0.999963	D	0.65815	0.995	P	0.60949	0.881	D	0.84499	0.0615	9	0.72032	D	0.01	-5.279	11.6935	0.51529	0.0871:0.0:0.9129:0.0	.	257	Q9BYE9	CDHR2_HUMAN	E	257	ENSP00000424565:G257E;ENSP00000261944:G257E;ENSP00000421078:G257E	ENSP00000261944:G257E	G	+	2	0	CDHR2	175935114	1.000000	0.71417	0.734000	0.30879	0.105000	0.19272	3.036000	0.49767	1.038000	0.40049	0.478000	0.44815	GGA		0.632	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	Missense_Mutation	6	146	0	0	0	0.001168	0	6	146				
HIST1H3B	8358	broad.mit.edu	37	6	26032138	26032138	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:26032138C>G	ENST00000244661.2	-	1	150	c.151G>C	c.(151-153)Gag>Cag	p.E51Q		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	51					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.E51Q(1)		breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						CGGCGGATCTCGCGCAGAGCC	0.627																																							uc003nfs.1		NA																	1	Substitution - Missense(1)	p.E51Q(1)	ovary(1)	ovary(2)	2						c.(151-153)GAG>CAG		histone cluster 1, H3b							56.0	67.0	63.0					6																	26032138		2203	4300	6503	SO:0001583	missense	8358				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26032138C>G	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.151G>C	6.37:g.26032138C>G	ENSP00000244661:p.Glu51Gln		Somatic					p.E51Q	NM_003537	NP_003528	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	151	-			51					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	c.151G>C	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	c	20.3	3.959673	0.74016	.	.	ENSG00000124693	ENST00000244661	T	0.56941	0.43	5.19	5.19	0.71726	.	.	.	.	.	T	0.65502	0.2697	.	.	.	0.45330	D	0.998322	.	.	.	.	.	.	T	0.69610	-0.5099	6	0.87932	D	0	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	.	.	.	Q	51	ENSP00000244661:E51Q	ENSP00000244661:E51Q	E	-	1	0	HIST1H3B	26140117	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	7.588000	0.82629	2.577000	0.86979	0.561000	0.74099	GAG		0.627	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537		19	134	0	0	0	0.00278	0	19	134				
HIST1H2BC	8347	broad.mit.edu	37	6	26124097	26124097	+	Silent	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:26124097C>T	ENST00000314332.5	-	1	41	c.36G>A	c.(34-36)aaG>aaA	p.K12K	HIST1H2BC_ENST00000396984.1_Silent_p.K12K|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	12					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						TGGAGCCCTTCTTCGGGGCGG	0.512																																							uc003ngk.3		NA																	0				ovary(1)	1						c.(34-36)AAG>AAA		histone cluster 1, H2bc							105.0	101.0	102.0					6																	26124097		2203	4300	6503	SO:0001819	synonymous_variant	8347				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26124097C>T	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.36G>A	6.37:g.26124097C>T			Somatic				HIST1H2BC_uc003ngl.2_Silent_p.K12K|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	p.K12K	NM_003526	NP_003517	WXS	Illumina HiSeq	Unspecified	P62807	H2B1C_HUMAN			1	58	-			12					P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000314332.5	37	c.36G>A	CCDS4584.1																																																																																				0.512	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526		23	115	0	0	0	0.005443	0	23	115				
HIST1H2AJ	8331	broad.mit.edu	37	6	27782485	27782485	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:27782485G>A	ENST00000333151.3	-	1	122	c.34C>T	c.(34-36)Cgc>Tgc	p.R12C	HIST1H2BM_ENST00000359465.4_5'Flank	NM_021066.2	NP_066544.1	Q99878	H2A1J_HUMAN	histone cluster 1, H2aj	12						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	11						GCCTTGGCGCGAGCTTTGCCT	0.542																																							uc003njn.1		NA																	0					0						c.(34-36)CGC>TGC		histone cluster 1, H2aj							41.0	51.0	48.0					6																	27782485		2202	4300	6502	SO:0001583	missense	8331				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27782485G>A	Z83736	CCDS4628.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000182611	ENSG00000276368		"""Histones / Replication-dependent"""	4727	protein-coding gene	gene with protein product		602791	"""H2A histone family, member E"", ""histone 1, H2aj"""	H2AFE		9439656, 12408966	Standard	NM_021066		Approved	H2A/E	uc003njn.1	Q99878	OTTHUMG00000014486	ENST00000333151.3:c.34C>T	6.37:g.27782485G>A	ENSP00000328484:p.Arg12Cys		Somatic				HIST1H2BM_uc003njo.2_5'Flank	p.R12C	NM_021066	NP_066544	WXS	Illumina HiSeq	Unspecified	Q99878	H2A1J_HUMAN			1	34	-			12					A2RUU6|Q5JXQ5	Missense_Mutation	SNP	ENST00000333151.3	37	c.34C>T	CCDS4628.1	.	.	.	.	.	.	.	.	.	.	.	12.27	1.888574	0.33348	.	.	ENSG00000182611	ENST00000333151	D	0.85339	-1.97	4.06	4.06	0.47325	Histone-fold (2);Histone H2A (1);	0.000000	0.33161	U	0.005220	D	0.90086	0.6903	M	0.91510	3.215	0.44104	D	0.996875	D	0.69078	0.997	P	0.52217	0.693	D	0.92386	0.5917	10	0.87932	D	0	.	16.4632	0.84070	0.0:0.0:1.0:0.0	.	12	Q99878	H2A1J_HUMAN	C	12	ENSP00000328484:R12C	ENSP00000328484:R12C	R	-	1	0	HIST1H2AJ	27890464	0.358000	0.24947	0.997000	0.53966	0.881000	0.50899	0.606000	0.24194	2.531000	0.85337	0.655000	0.94253	CGC		0.542	HIST1H2AJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040154.1	NM_021066		8	66	0	0	0	0.004482	0	8	66				
PGBD1	84547	broad.mit.edu	37	6	28251760	28251760	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:28251760G>A	ENST00000405948.2	+	2	590	c.170G>A	c.(169-171)gGa>gAa	p.G57E	PGBD1_ENST00000259883.3_Missense_Mutation_p.G57E	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	57	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.					membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						GAGGCTCACGGACCCCAGGAA	0.587																																							uc003nky.2		NA																	0				ovary(4)	4						c.(169-171)GGA>GAA		piggyBac transposable element derived 1							72.0	71.0	71.0					6																	28251760		2203	4300	6503	SO:0001583	missense	84547				viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity	g.chr6:28251760G>A	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.170G>A	6.37:g.28251760G>A	ENSP00000385213:p.Gly57Glu		Somatic				PGBD1_uc003nkz.2_Missense_Mutation_p.G57E	p.G57E	NM_032507	NP_115896	WXS	Illumina HiSeq	Unspecified	Q96JS3	PGBD1_HUMAN			2	540	+			57			SCAN box.		Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	c.170G>A	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387192	0.61956	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.05996	3.36;3.36	4.16	4.16	0.48862	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.26521	0.0648	M	0.92880	3.355	0.38128	D	0.938051	D	0.89917	1.0	D	0.97110	1.0	T	0.31447	-0.9943	9	0.87932	D	0	1.0174	16.4115	0.83713	0.0:0.0:1.0:0.0	.	57	Q96JS3	PGBD1_HUMAN	E	57	ENSP00000385213:G57E;ENSP00000259883:G57E	ENSP00000259883:G57E	G	+	2	0	PGBD1	28359739	1.000000	0.71417	0.935000	0.37517	0.288000	0.27193	1.834000	0.39171	2.586000	0.87340	0.655000	0.94253	GGA		0.587	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			23	56	0	0	0	0.00333	0	23	56				
PSORS1C1	170679	broad.mit.edu	37	6	31084746	31084746	+	Intron	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:31084746G>A	ENST00000259881.9	+	1	61				PSORS1C1_ENST00000467107.1_3'UTR|CDSN_ENST00000376288.2_Missense_Mutation_p.R216C	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						CTACAGGGACGCTGGTTGGAG	0.607																																							uc003nsm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(646-648)CGT>TGT		corneodesmosin precursor							80.0	86.0	84.0					6																	31084746		2203	4300	6503	SO:0001627	intron_variant	1041				cell-cell adhesion|keratinocyte differentiation|skin morphogenesis	cornified envelope|desmosome|extracellular region	protein homodimerization activity	g.chr6:31084746G>A	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+2078G>A	6.37:g.31084746G>A			Somatic				PSORS1C1_uc003nsl.1_Intron|PSORS1C1_uc010jsj.1_Intron	p.R216C	NM_001264	NP_001255	WXS	Illumina HiSeq	Unspecified	Q15517	CDSN_HUMAN			2	673	-			216			Ser-rich.		B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	37	c.646C>T	CCDS34390.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947838	0.34377	.	.	ENSG00000204539	ENST00000376288	T	0.06768	3.26	4.35	2.44	0.29823	.	0.432263	0.19395	N	0.115311	T	0.04048	0.0113	L	0.32530	0.975	0.09310	N	1	D	0.67145	0.996	P	0.50754	0.649	T	0.29305	-1.0016	10	0.72032	D	0.01	-0.655	7.4883	0.27447	0.0:0.181:0.6322:0.1868	.	216	Q15517	CDSN_HUMAN	C	216	ENSP00000365465:R216C	ENSP00000365465:R216C	R	-	1	0	CDSN	31192725	0.010000	0.17322	0.018000	0.16275	0.058000	0.15608	1.922000	0.40045	0.812000	0.34326	0.448000	0.29417	CGT		0.607	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068		26	126	0	0	0	0.008361	0	26	126				
TNXB	7148	broad.mit.edu	37	6	32023733	32023733	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:32023733C>T	ENST00000375244.3	-	24	8563	c.8362G>A	c.(8362-8364)Gag>Aag	p.E2788K	TNXB_ENST00000375247.2_Missense_Mutation_p.E2788K			P22105	TENX_HUMAN	tenascin XB	2846					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						ACGGTGACCTCGCTCTCCTCG	0.687																																							uc003nzl.2		NA																	0					0						c.(8362-8364)GAG>AAG		tenascin XB isoform 1 precursor							57.0	63.0	61.0					6																	32023733		1245	2535	3780	SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32023733C>T	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8362G>A	6.37:g.32023733C>T	ENSP00000364393:p.Glu2788Lys		Somatic					p.E2788K	NM_019105	NP_061978	WXS	Illumina HiSeq	Unspecified	P22105	TENX_HUMAN			24	8564	-			2846			Fibronectin type-III 20.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37	c.8362G>A		.	.	.	.	.	.	.	.	.	.	C	10.63	1.403844	0.25291	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57595	0.39;0.39	5.04	4.18	0.49190	.	.	.	.	.	T	0.21631	0.0521	L	0.43923	1.385	0.24648	N	0.993537	B	0.24426	0.103	B	0.25140	0.058	T	0.18808	-1.0325	9	0.11794	T	0.64	.	10.9241	0.47182	0.0:0.9097:0.0:0.0903	.	2788	P22105-3	.	K	2788	ENSP00000364393:E2788K;ENSP00000364396:E2788K	ENSP00000364393:E2788K	E	-	1	0	TNXB	32131711	0.000000	0.05858	0.351000	0.25721	0.253000	0.25986	0.156000	0.16382	1.106000	0.41623	-0.448000	0.05591	GAG		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		22	69	0	0	0	0.014323	0	22	69				
SCUBE3	222663	broad.mit.edu	37	6	35210967	35210967	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:35210967G>A	ENST00000274938.7	+	15	1863	c.1863G>A	c.(1861-1863)ccG>ccA	p.P621P	SCUBE3_ENST00000394681.1_Silent_p.P637P	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						GAGCAGAGCCGATGGAGTCCT	0.627																																							uc003okf.1		NA																	0				skin(1)	1						c.(1861-1863)CCG>CCA		signal peptide, CUB domain, EGF-like 3							41.0	50.0	47.0					6																	35210967		2203	4300	6503	SO:0001819	synonymous_variant	222663				protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding	g.chr6:35210967G>A	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.1863G>A	6.37:g.35210967G>A			Somatic				SCUBE3_uc003okg.1_Silent_p.P620P|SCUBE3_uc003okh.1_Silent_p.P508P	p.P621P	NM_152753	NP_689966	WXS	Illumina HiSeq	Unspecified	Q8IX30	SCUB3_HUMAN			15	1869	+			621						Silent	SNP	ENST00000274938.7	37	c.1863G>A	CCDS4800.1																																																																																				0.627	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753		23	78	0	0	0	0.005443	0	23	78				
TEAD3	7005	broad.mit.edu	37	6	35444128	35444128	+	Missense_Mutation	SNP	C	C	T	rs369194515		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:35444128C>T	ENST00000402886.3	-	7	650	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	TEAD3_ENST00000338863.7_Missense_Mutation_p.R226Q			Q99594	TEAD3_HUMAN	TEA domain family member 3	226	Pro-rich.				female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						CTCCAGGAGCCGCAGCCGGGA	0.632																																							uc003oku.3		NA																	0				ovary(1)	1						c.(676-678)CGG>CAG		TEA domain family member 3							36.0	46.0	42.0					6																	35444128		2019	4179	6198	SO:0001583	missense	7005				female pregnancy|hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:35444128C>T	X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.497G>A	6.37:g.35444128C>T	ENSP00000384577:p.Arg166Gln		Somatic				TEAD3_uc003okt.2_Missense_Mutation_p.R115Q|TEAD3_uc010jvx.2_Missense_Mutation_p.R166Q	p.R226Q	NM_003214	NP_003205	WXS	Illumina HiSeq	Unspecified	Q99594	TEAD3_HUMAN			9	913	-			226			Transcriptional activation (Potential).		O95910|Q5BJG7|Q8N6Y4	Missense_Mutation	SNP	ENST00000402886.3	37	c.677G>A		.	.	.	.	.	.	.	.	.	.	C	21.9	4.223250	0.79464	.	.	ENSG00000007866	ENST00000338863;ENST00000402886;ENST00000373905;ENST00000433586	T;T;T	0.30182	1.54;1.54;1.54	4.94	4.06	0.47325	.	0.000000	0.85682	D	0.000000	T	0.46054	0.1373	M	0.83118	2.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;P;D	0.81914	0.995;0.858;0.988	T	0.48854	-0.8998	10	0.33141	T	0.24	-28.7943	13.6995	0.62599	0.1554:0.8446:0.0:0.0	.	166;242;226	B5MCM0;Q7Z6V0;Q99594	.;.;TEAD3_HUMAN	Q	226;166;242;137	ENSP00000345772:R226Q;ENSP00000384577:R166Q;ENSP00000416400:R137Q	ENSP00000345772:R226Q	R	-	2	0	TEAD3	35552106	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.582000	0.82546	1.274000	0.44362	0.561000	0.74099	CGG		0.632	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316961.2			17	49	0	0	0	0.007413	0	17	49				
SAYSD1	55776	broad.mit.edu	37	6	39082745	39082745	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:39082745G>C	ENST00000229903.4	-	1	220	c.121C>G	c.(121-123)Cta>Gta	p.L41V	SAYSD1_ENST00000481599.1_5'UTR	NM_018322.1	NP_060792.1	Q9NPB0	SMDC1_HUMAN	SAYSVFN motif domain containing 1	41	Ala-rich.					cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)											GCTGCCTTTAGAGTCGCTGCT	0.667																																							uc003ook.1		NA																	0					0						c.(121-123)CTA>GTA		hypothetical protein LOC55776							32.0	36.0	35.0					6																	39082745		2202	4299	6501	SO:0001583	missense	55776					integral to membrane		g.chr6:39082745G>C	BC022007	CCDS4840.1	6p21.1	2011-12-13	2011-12-13	2011-12-13	ENSG00000112167	ENSG00000112167			21025	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 64"""	C6orf64			Standard	XM_005249222		Approved	FLJ11101	uc003ook.1	Q9NPB0	OTTHUMG00000014641	ENST00000229903.4:c.121C>G	6.37:g.39082745G>C	ENSP00000229903:p.Leu41Val		Somatic				C6orf64_uc011dty.1_RNA|C6orf64_uc003oom.1_RNA	p.L41V	NM_018322	NP_060792	WXS	Illumina HiSeq	Unspecified	Q9NPB0	CF064_HUMAN			1	121	-			41			Ala-rich.		Q9H0D8	Missense_Mutation	SNP	ENST00000229903.4	37	c.121C>G	CCDS4840.1	.	.	.	.	.	.	.	.	.	.	G	5.893	0.348892	0.11126	.	.	ENSG00000112167	ENST00000229903	.	.	.	4.33	1.43	0.22495	.	0.589151	0.14076	N	0.343089	T	0.05273	0.0140	L	0.34521	1.04	0.09310	N	1	B	0.19817	0.039	B	0.15052	0.012	T	0.39702	-0.9601	9	0.05525	T	0.97	-0.1706	1.6964	0.02863	0.1887:0.1614:0.4842:0.1657	.	41	Q9NPB0	CF064_HUMAN	V	41	.	ENSP00000229903:L41V	L	-	1	2	C6orf64	39190723	0.985000	0.35326	0.194000	0.23346	0.708000	0.40852	0.345000	0.19979	0.173000	0.19788	-0.136000	0.14681	CTA		0.667	SAYSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040448.1	NM_018322		12	52	0	0	0	0.00245	0	12	52				
AARS2	57505	broad.mit.edu	37	6	44278827	44278827	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:44278827C>T	ENST00000244571.4	-	4	655	c.653G>A	c.(652-654)tGt>tAt	p.C218Y	RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACAGGGCCCACAAGGGCCAGT	0.572																																							uc010jza.1		NA																	0				ovary(1)	1						c.(652-654)TGT>TAT		alanyl-tRNA synthetase 2, mitochondrial	L-Alanine(DB00160)						77.0	80.0	79.0					6																	44278827		2203	4300	6503	SO:0001583	missense	57505				alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding	g.chr6:44278827C>T	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.653G>A	6.37:g.44278827C>T	ENSP00000244571:p.Cys218Tyr		Somatic				SPATS1_uc003oxg.2_Intron	p.C218Y	NM_020745	NP_065796	WXS	Illumina HiSeq	Unspecified	Q5JTZ9	SYAM_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		4	656	-	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		218						Missense_Mutation	SNP	ENST00000244571.4	37	c.653G>A	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366083	0.82463	.	.	ENSG00000124608	ENST00000244571	T	0.74632	-0.86	5.08	5.08	0.68730	Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.050523	0.85682	D	0.000000	D	0.90511	0.7027	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93287	0.6665	10	0.87932	D	0	-9.2808	18.6562	0.91455	0.0:1.0:0.0:0.0	.	218	Q5JTZ9	SYAM_HUMAN	Y	218	ENSP00000244571:C218Y	ENSP00000244571:C218Y	C	-	2	0	AARS2	44386805	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.651000	0.83577	2.644000	0.89710	0.655000	0.94253	TGT		0.572	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745		4	128	0	0	0	0.001168	0	4	128				
MUT	4594	broad.mit.edu	37	6	49421348	49421348	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:49421348G>C	ENST00000274813.3	-	5	1160	c.1033C>G	c.(1033-1035)Ctt>Gtt	p.L345V		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	345					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTAGAAGAAGAGATTTTGAG	0.318																																							uc003ozg.3		NA																	0					0						c.(1033-1035)CTT>GTT		methylmalonyl Coenzyme A mutase precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						93.0	95.0	94.0					6																	49421348		2203	4300	6503	SO:0001583	missense	4594				fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity	g.chr6:49421348G>C		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1033C>G	6.37:g.49421348G>C	ENSP00000274813:p.Leu345Val		Somatic					p.L345V	NM_000255	NP_000246	WXS	Illumina HiSeq	Unspecified	P22033	MUTA_HUMAN			5	1288	-	Lung NSC(77;0.0376)		345					A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	37	c.1033C>G	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656462	0.67586	.	.	ENSG00000146085	ENST00000274813	D	0.98362	-4.89	5.84	5.84	0.93424	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.98909	0.9630	M	0.88512	2.96	0.80722	D	1	B	0.23806	0.091	P	0.48063	0.565	D	0.97749	1.0213	10	0.59425	D	0.04	-14.6572	19.1433	0.93455	0.0:0.0:1.0:0.0	.	345	P22033	MUTA_HUMAN	V	345	ENSP00000274813:L345V	ENSP00000274813:L345V	L	-	1	0	MUT	49529307	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.476000	0.97823	2.760000	0.94817	0.655000	0.94253	CTT		0.318	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1			10	186	0	0	0	0.001855	0	10	186				
FIG4	9896	broad.mit.edu	37	6	110113848	110113848	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:110113848G>A	ENST00000230124.3	+	21	2564	c.2440G>A	c.(2440-2442)Gat>Aat	p.D814N	FIG4_ENST00000441478.2_Missense_Mutation_p.D537N	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	814					cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		CTCAGAAGAAGATTTCTCCAT	0.313																																							uc003ptt.2		NA																	0				ovary(1)	1						c.(2440-2442)GAT>AAT		Sac domain-containing inositol phosphatase 3							65.0	65.0	65.0					6																	110113848		2203	4299	6502	SO:0001583	missense	9896				cell death	endosome membrane	protein binding	g.chr6:110113848G>A	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.2440G>A	6.37:g.110113848G>A	ENSP00000230124:p.Asp814Asn		Somatic				FIG4_uc011eau.1_Missense_Mutation_p.D537N	p.D814N	NM_014845	NP_055660	WXS	Illumina HiSeq	Unspecified	Q92562	FIG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)	21	2655	+		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)	814					Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	c.2440G>A	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720584	0.48728	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.59364	1.76;0.27	5.07	5.07	0.68467	.	0.116799	0.56097	D	0.000028	T	0.59335	0.2186	L	0.34521	1.04	0.58432	D	0.999996	D;D	0.67145	0.996;0.968	D;P	0.79784	0.993;0.606	T	0.57213	-0.7850	10	0.33141	T	0.24	-23.6806	18.4622	0.90743	0.0:0.0:1.0:0.0	.	537;814	F5H8L9;Q92562	.;FIG4_HUMAN	N	537;814	ENSP00000399443:D537N;ENSP00000230124:D814N	ENSP00000230124:D814N	D	+	1	0	FIG4	110220541	1.000000	0.71417	0.995000	0.50966	0.534000	0.34807	6.367000	0.73099	2.379000	0.81126	0.313000	0.20887	GAT		0.313	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845		15	27	0	0	0	0.010504	0	15	27				
KIF25	3834	broad.mit.edu	37	6	168430272	168430272	+	Missense_Mutation	SNP	T	T	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr6:168430272T>A	ENST00000443060.2	+	3	398	c.7T>A	c.(7-9)Tgg>Agg	p.W3R	KIF25_ENST00000351261.3_Missense_Mutation_p.W3R|KIF25_ENST00000354419.2_Missense_Mutation_p.W3R			Q9UIL4	KIF25_HUMAN	kinesin family member 25	3					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.W3R(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CCAGATGACATGGACCTCAGG	0.612																																							uc003qwk.1		NA																	1	Substitution - Missense(1)	p.W3C(1)	skin(1)	ovary(1)|pancreas(1)	2						c.(7-9)TGG>AGG		kinesin family member 25 isoform 1							127.0	120.0	122.0					6																	168430272		2203	4300	6503	SO:0001583	missense	3834				microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr6:168430272T>A	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.7T>A	6.37:g.168430272T>A	ENSP00000388878:p.Trp3Arg		Somatic				KIF25_uc010kkt.1_RNA|KIF25_uc003qwl.1_Missense_Mutation_p.W3R	p.W3R	NM_030615	NP_085118	WXS	Illumina HiSeq	Unspecified	Q9UIL4	KIF25_HUMAN		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)	2	269	+		Breast(66;1.07e-05)|Ovarian(120;0.0728)	3			Kinesin-motor.		O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	c.7T>A	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	t	0.006	-2.097855	0.00360	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.72725	-0.68;-0.68;0.12	0.785	0.785	0.18584	.	0.000000	0.46758	U	0.000269	T	0.19604	0.0471	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21552	-1.0242	9	.	.	.	.	3.8317	0.08877	0.0:0.0:0.0:1.0	.	3;3	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	R	3	ENSP00000388878:W3R;ENSP00000346401:W3R;ENSP00000252688:W3R	.	W	+	1	0	KIF25	168173121	0.001000	0.12720	0.011000	0.14972	0.015000	0.08874	-0.031000	0.12287	0.590000	0.29694	0.334000	0.21626	TGG		0.612	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1			4	92	0	0	0	0.009096	0	4	92				
EIF3B	8662	broad.mit.edu	37	7	2409156	2409156	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:2409156G>A	ENST00000360876.4	+	10	1509	c.1453G>A	c.(1453-1455)Gaa>Aaa	p.E485K	EIF3B_ENST00000397011.2_Missense_Mutation_p.E485K	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CTGGGTGCCTGAAGACAAAGA	0.473																																							uc003slx.2		NA																	0					0						c.(1453-1455)GAA>AAA		eukaryotic translation initiation factor 3,							197.0	204.0	201.0					7																	2409156		2203	4300	6503	SO:0001583	missense	8662				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity	g.chr7:2409156G>A	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1453G>A	7.37:g.2409156G>A	ENSP00000354125:p.Glu485Lys		Somatic				EIF3B_uc003sly.2_Missense_Mutation_p.E485K|EIF3B_uc003sma.2_Missense_Mutation_p.E213K	p.E485K	NM_003751	NP_003742	WXS	Illumina HiSeq	Unspecified	P55884	EIF3B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)	10	1536	+		Ovarian(82;0.0253)	485						Missense_Mutation	SNP	ENST00000360876.4	37	c.1453G>A	CCDS5332.1	.	.	.	.	.	.	.	.	.	.	G	32	5.137091	0.94517	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.05649	3.41;3.41	5.53	4.65	0.58169	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	M	0.90705	3.14	0.80722	D	1	P	0.51653	0.947	P	0.53518	0.728	T	0.17167	-1.0378	10	0.87932	D	0	-38.6802	14.6421	0.68732	0.0699:0.0:0.9301:0.0	.	485	P55884	EIF3B_HUMAN	K	485;485;485;409	ENSP00000354125:E485K;ENSP00000380206:E485K	ENSP00000316638:E485K	E	+	1	0	EIF3B	2375682	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	9.559000	0.98135	1.488000	0.48433	-0.136000	0.14681	GAA		0.473	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1			40	181	0	0	0	0.011902	0	40	181				
GLCCI1	113263	broad.mit.edu	37	7	8110737	8110737	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:8110737G>A	ENST00000223145.5	+	6	1710	c.1153G>A	c.(1153-1155)Gat>Aat	p.D385N		NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	385						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		CTCAACAGAAGATTTGCTCTA	0.473																																							uc003srk.2		NA																	0					0						c.(1153-1155)GAT>AAT		glucocorticoid induced transcript 1							115.0	109.0	111.0					7																	8110737		2203	4300	6503	SO:0001583	missense	113263							g.chr7:8110737G>A	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.1153G>A	7.37:g.8110737G>A	ENSP00000223145:p.Asp385Asn		Somatic					p.D385N	NM_138426	NP_612435	WXS	Illumina HiSeq	Unspecified	Q86VQ1	GLCI1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)	6	1712	+		Ovarian(82;0.0608)	385					A4D103|Q96FD0	Missense_Mutation	SNP	ENST00000223145.5	37	c.1153G>A	CCDS34601.1	.	.	.	.	.	.	.	.	.	.	G	33	5.238371	0.95240	.	.	ENSG00000106415	ENST00000223145	.	.	.	4.9	4.9	0.64082	.	0.047372	0.85682	D	0.000000	T	0.75466	0.3853	L	0.55481	1.735	0.58432	D	0.999999	D	0.76494	0.999	D	0.69479	0.964	T	0.76892	-0.2791	9	0.62326	D	0.03	-18.3546	18.6477	0.91416	0.0:0.0:1.0:0.0	.	385	Q86VQ1	GLCI1_HUMAN	N	385	.	ENSP00000223145:D385N	D	+	1	0	GLCCI1	8077262	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.574000	0.90763	2.705000	0.92388	0.650000	0.86243	GAT		0.473	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426		26	117	0	0	0	0.013726	0	26	117				
FAM188B	84182	broad.mit.edu	37	7	30831131	30831131	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:30831131G>C	ENST00000265299.6	+	5	1091	c.1014G>C	c.(1012-1014)atG>atC	p.M338I	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	338										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATTCCAGGATGACCCAGGAGA	0.587																																							uc003tbt.2		NA																	0					0						c.(1012-1014)ATG>ATC		hypothetical protein LOC84182							42.0	53.0	49.0					7																	30831131		2049	4195	6244	SO:0001583	missense	84182							g.chr7:30831131G>C	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1014G>C	7.37:g.30831131G>C	ENSP00000265299:p.Met338Ile		Somatic				FAM188B_uc010kwe.2_Missense_Mutation_p.M309I	p.M338I	NM_032222	NP_115598	WXS	Illumina HiSeq	Unspecified	Q4G0A6	F188B_HUMAN			5	1091	+			338					Q71AZ7|Q9H6D2	Missense_Mutation	SNP	ENST00000265299.6	37	c.1014G>C	CCDS43565.1	.	.	.	.	.	.	.	.	.	.	G	7.764	0.706001	0.15172	.	.	ENSG00000106125	ENST00000265299	T	0.02737	4.18	4.59	-1.27	0.09347	.	0.900897	0.09720	N	0.764514	T	0.03095	0.0091	L	0.58101	1.795	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.47923	-0.9079	10	0.87932	D	0	-15.4751	0.3752	0.00386	0.2202:0.1649:0.279:0.3359	.	338	Q4G0A6	F188B_HUMAN	I	338	ENSP00000265299:M338I	ENSP00000265299:M338I	M	+	3	0	FAM188B	30797656	0.000000	0.05858	0.197000	0.23402	0.675000	0.39556	-0.714000	0.05002	-0.036000	0.13669	0.563000	0.77884	ATG		0.587	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	NM_032222		13	36	0	0	0	0.003163	0	13	36				
Unknown	0	broad.mit.edu	37	7	63680216	63680216	+	IGR	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:63680216C>T								GUSBP6 (69117 upstream) : ZNF679 (8635 downstream)																							TAAGAGAATTCACACTGGAGA	0.443																																							uc011kdn.1		NA																	0					0						c.(787-789)CAC>TAC		zinc finger protein 735							18.0	19.0	18.0					7																	63680216		692	1591	2283	SO:0001628	intergenic_variant	730291				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63680216C>T																													7.37:g.63680216C>T			Somatic					p.H263Y	NM_001159524	NP_001152996	WXS	Illumina HiSeq	Unspecified	P0CB33	ZN735_HUMAN			4	787	+			263			C2H2-type 4.			Missense_Mutation	SNP		37	c.787C>T																																																																																				0	0.443									5	30	0	0	0	0.000602	0	5	30				
GTF2I	2969	broad.mit.edu	37	7	74173158	74173158	+	Missense_Mutation	SNP	C	C	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:74173158C>A	ENST00000324896.4	+	34	3376	c.2987C>A	c.(2986-2988)cCc>cAc	p.P996H	GTF2I_ENST00000353920.4_Missense_Mutation_p.P976H|GTF2I_ENST00000416070.1_Missense_Mutation_p.P955H|GTF2I_ENST00000346152.4_Missense_Mutation_p.P975H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	996					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						GAACCAGACCCCACGTGGTAG	0.468																																							uc003uau.2		NA																	0					0						c.(2986-2988)CCC>CAC		general transcription factor IIi isoform 1							22.0	19.0	20.0					7																	74173158		1805	3570	5375	SO:0001583	missense	2969				negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr7:74173158C>A	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.2987C>A	7.37:g.74173158C>A	ENSP00000322542:p.Pro996His		Somatic				GTF2I_uc003uav.2_Missense_Mutation_p.P975H|GTF2I_uc003uaw.2_Missense_Mutation_p.P976H|GTF2I_uc003uay.2_Missense_Mutation_p.P974H|GTF2I_uc003uax.2_Missense_Mutation_p.P955H|GTF2I_uc003uba.2_Missense_Mutation_p.P187H	p.P996H	NM_032999	NP_127492	WXS	Illumina HiSeq	Unspecified	P78347	GTF2I_HUMAN			34	3357	+			996					O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	ENST00000324896.4	37	c.2987C>A	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640307	0.67244	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.42131	1.02;0.98;0.99;0.99	3.75	3.75	0.43078	.	0.000000	0.64402	D	0.000014	T	0.51092	0.1654	L	0.27053	0.805	0.80722	D	1	D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.806	D;D;D;D;B	0.87578	0.996;0.998;0.996;0.998;0.329	T	0.58086	-0.7698	10	0.87932	D	0	-1.5713	15.1324	0.72536	0.0:1.0:0.0:0.0	.	974;955;976;975;996	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	996;991;976;975;955	ENSP00000322542:P996H;ENSP00000322671:P976H;ENSP00000322599:P975H;ENSP00000387651:P955H	ENSP00000322542:P996H	P	+	2	0	GTF2I	73811094	0.932000	0.31603	1.000000	0.80357	0.995000	0.86356	2.170000	0.42443	2.125000	0.65367	0.449000	0.29647	CCC		0.468	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1	NM_032999		3	75	1	0	7.48243e-07	0.006214	7.80933e-07	3	75				
COL1A2	1278	broad.mit.edu	37	7	94029590	94029590	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:94029590G>A	ENST00000297268.6	+	5	686	c.215G>A	c.(214-216)gGt>gAt	p.G72D		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	72					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGCCCCCCTGGTCTCGGTGGG	0.488										HNSCC(75;0.22)																													uc003ung.1		NA																COL1A2/PLAG1(3)	0				soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9						c.(214-216)GGT>GAT		alpha 2 type I collagen precursor	Collagenase(DB00048)						73.0	70.0	71.0					7																	94029590		2203	4300	6503	SO:0001583	missense	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94029590G>A	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.215G>A	7.37:g.94029590G>A	ENSP00000297268:p.Gly72Asp	HNSCC(75;0.22)	Somatic				COL1A2_uc011kib.1_Missense_Mutation_p.G72D	p.G72D	NM_000089	NP_000080	WXS	Illumina HiSeq	Unspecified	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		5	686	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		72					P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	c.215G>A	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537294	0.65085	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99353	-5.77	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.99560	0.9842	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98383	1.0559	10	0.66056	D	0.02	.	19.8519	0.96744	0.0:0.0:1.0:0.0	.	72;72	B4DTF5;P08123	.;CO1A2_HUMAN	D	72;73	ENSP00000297268:G72D	ENSP00000297268:G72D	G	+	2	0	COL1A2	93867526	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	9.420000	0.97426	2.861000	0.98227	0.655000	0.94253	GGT		0.488	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		4	85	0	0	0	0.000602	0	4	85				
PPP1R3A	5506	broad.mit.edu	37	7	113518581	113518581	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:113518581G>A	ENST00000284601.3	-	4	2634	c.2566C>T	c.(2566-2568)Caa>Taa	p.Q856*		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	856					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GTTGCTTTTTGATATTCTGTA	0.373																																							uc010ljy.1		NA																	0				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(2566-2568)CAA>TAA		protein phosphatase 1, regulatory (inhibitor)							170.0	161.0	164.0					7																	113518581		2203	4300	6503	SO:0001587	stop_gained	5506				glycogen metabolic process	integral to membrane		g.chr7:113518581G>A	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2566C>T	7.37:g.113518581G>A	ENSP00000284601:p.Gln856*		Somatic					p.Q856*	NM_002711	NP_002702	WXS	Illumina HiSeq	Unspecified	Q16821	PPR3A_HUMAN			4	2597	-			856					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Nonsense_Mutation	SNP	ENST00000284601.3	37	c.2566C>T	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465148	0.43839	.	.	ENSG00000154415	ENST00000284601	.	.	.	5.92	-0.808	0.10868	.	1.122620	0.06567	N	0.747808	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-0.5018	8.5295	0.33326	0.0695:0.5694:0.1931:0.168	.	.	.	.	X	856	.	ENSP00000284601:Q856X	Q	-	1	0	PPP1R3A	113305817	0.003000	0.15002	0.001000	0.08648	0.008000	0.06430	-0.192000	0.09587	0.063000	0.16370	0.650000	0.86243	CAA		0.373	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		25	116	0	0	0	0.00632	0	25	116				
MDFIC	29969	broad.mit.edu	37	7	114655893	114655893	+	Silent	SNP	T	T	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:114655893T>C	ENST00000393486.1	+	5	1235	c.645T>C	c.(643-645)ccT>ccC	p.P215P	MDFIC_ENST00000257724.3_Silent_p.P324P	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						GTAACTGCCCTTGTGATATGG	0.463																																							uc003vhf.2		NA																	0				ovary(1)	1						c.(970-972)CCT>CCC		MyoD family inhibitor domain containing protein							315.0	280.0	292.0					7																	114655893		2203	4300	6503	SO:0001819	synonymous_variant	29969				activation of JUN kinase activity|interspecies interaction between organisms|negative regulation of protein import into nucleus|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|regulation of Wnt receptor signaling pathway|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleolus|nucleus	cyclin binding|Tat protein binding	g.chr7:114655893T>C	AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.645T>C	7.37:g.114655893T>C			Somatic					p.P324P	NM_199072	NP_951038	WXS	Illumina HiSeq	Unspecified	Q9P1T7	MDFIC_HUMAN			5	1235	+			215			Cys-rich.			Silent	SNP	ENST00000393486.1	37	c.972T>C	CCDS55155.1																																																																																				0.463	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059968.4	NM_199072		4	265	0	0	0	0.001168	0	4	265				
LOC407835	407835	broad.mit.edu	37	7	128767312	128767312	+	RNA	SNP	G	G	A	rs542293177	byFrequency	TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:128767312G>A	ENST00000471777.1	+	0	0																											CGGTGCAGTCGGTCATCTGGA	0.642																																							uc003voo.2		NA																	0					0						c.(739-741)TCG>TCA		SubName: Full=cDNA FLJ35806 fis, clone TESTI2005987, highly similar to Dual specificity mitogen-activated protein kinase kinase 2 (EC 2.7.12.2); SubName: Full=Mitogen-activated protein kinase kinase 2, isoform CRA_d;																																						407835							g.chr7:128767312G>A																													7.37:g.128767312G>A			Somatic					p.S247S	NR_002144		WXS	Illumina HiSeq	Unspecified					1	988	+									Silent	SNP	ENST00000471777.1	37	c.741G>A																																																																																					0.642	RP11-286H14.4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000350981.1			2	3	0	0	0	0.009096	0	2	3				
SSMEM1	136263	broad.mit.edu	37	7	129847761	129847761	+	Missense_Mutation	SNP	T	T	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:129847761T>C	ENST00000297819.3	+	1	62	c.11T>C	c.(10-12)cTt>cCt	p.L4P	TMEM209_ENST00000462753.1_5'Flank|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000473456.1_5'Flank|TMEM209_ENST00000397622.2_5'Flank|TMEM209_ENST00000336804.8_5'Flank	NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	4						integral component of membrane (GO:0016021)											ATGGGAGACCTTTTTTCCTTA	0.413																																							uc003vpp.2		NA																	0					0						c.(10-12)CTT>CCT		hypothetical protein LOC136263							174.0	165.0	168.0					7																	129847761		2203	4300	6503	SO:0001583	missense	136263					integral to membrane		g.chr7:129847761T>C	AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.11T>C	7.37:g.129847761T>C	ENSP00000297819:p.Leu4Pro		Somatic				TMEM209_uc003vpn.2_5'Flank|TMEM209_uc010lmc.1_5'Flank|TMEM209_uc003vpo.2_5'Flank	p.L4P	NM_145268	NP_660311	WXS	Illumina HiSeq	Unspecified	Q8WWF3	CG045_HUMAN			1	58	+	Melanoma(18;0.0435)		4						Missense_Mutation	SNP	ENST00000297819.3	37	c.11T>C	CCDS5816.1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.233478	0.58886	.	.	ENSG00000165120	ENST00000297819	T	0.54279	0.58	5.54	4.23	0.50019	.	0.216312	0.32769	N	0.005669	T	0.29914	0.0748	N	0.12746	0.255	0.58432	D	0.999999	B	0.33448	0.412	B	0.31869	0.137	T	0.17289	-1.0374	10	0.54805	T	0.06	-14.6723	5.7126	0.17943	0.0:0.1451:0.0:0.8549	.	4	Q8WWF3	CG045_HUMAN	P	4	ENSP00000297819:L4P	ENSP00000297819:L4P	L	+	2	0	C7orf45	129634997	0.999000	0.42202	0.974000	0.42286	0.981000	0.71138	2.540000	0.45727	2.243000	0.73865	0.533000	0.62120	CTT		0.413	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1	NM_145268		3	107	0	0	0	0.001168	0	3	107				
PLXNA4	91584	broad.mit.edu	37	7	131817925	131817925	+	Silent	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr7:131817925G>A	ENST00000359827.3	-	31	6434	c.5472C>T	c.(5470-5472)atC>atT	p.I1824I	PLXNA4_ENST00000321063.4_Silent_p.I1824I			Q9HCM2	PLXA4_HUMAN	plexin A4	1824					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CTTGGTCGCTGATGGCTGGCA	0.507																																							uc003vra.3		NA																	0				ovary(1)	1						c.(5470-5472)ATC>ATT		plexin A4 isoform 1							141.0	142.0	142.0					7																	131817925		2198	4300	6498	SO:0001819	synonymous_variant	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131817925G>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5472C>T	7.37:g.131817925G>A			Somatic				PLXNA4_uc003vqz.3_Silent_p.I109I	p.I1824I	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			31	5701	-			1824			Cytoplasmic (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	c.5472C>T	CCDS43646.1																																																																																				0.507	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		30	124	0	0	0	0.006999	0	30	124				
PRKDC	5591	broad.mit.edu	37	8	48719862	48719862	+	Missense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:48719862C>T	ENST00000314191.2	-	70	9636	c.9580G>A	c.(9580-9582)Gag>Aag	p.E3194K	PRKDC_ENST00000338368.3_Missense_Mutation_p.E3194K|PRKDC_ENST00000523565.1_5'UTR|Y_RNA_ENST00000384719.1_RNA	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3195	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GTAAGCTTCTCCTCTATTTTG	0.418								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	Esophageal Squamous(79;1091 1253 12329 31680 40677)	uc003xqi.2		NA																	0				lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34						c.(9583-9585)GAG>AAG	NHEJ	protein kinase, DNA-activated, catalytic							144.0	137.0	139.0					8																	48719862		1867	4113	5980	SO:0001583	missense	5591				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding	g.chr8:48719862C>T		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9580G>A	8.37:g.48719862C>T	ENSP00000313420:p.Glu3194Lys		Somatic				PRKDC_uc003xqj.2_Missense_Mutation_p.E3195K|PRKDC_uc011ldh.1_Intron	p.E3195K	NM_006904	NP_008835	WXS	Illumina HiSeq	Unspecified	P78527	PRKDC_HUMAN			70	9640	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	3195			KIP-binding.|FAT.		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37	c.9583G>A		.	.	.	.	.	.	.	.	.	.	C	16.61	3.172385	0.57584	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02631	4.29;4.22	5.88	5.88	0.94601	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.330334	0.30492	N	0.009514	T	0.06735	0.0172	M	0.62723	1.935	0.38437	D	0.946593	B;B	0.20261	0.043;0.043	B;B	0.23150	0.044;0.044	T	0.20773	-1.0265	10	0.51188	T	0.08	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	3194;3195	E7EUY0;P78527	.;PRKDC_HUMAN	K	3194	ENSP00000313420:E3194K;ENSP00000345182:E3194K	ENSP00000313420:E3194K	E	-	1	0	PRKDC	48882415	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.232000	0.58645	2.774000	0.95407	0.655000	0.94253	GAG		0.418	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		53	97	0	0	0	0.01441	0	53	97				
PCMTD1	115294	broad.mit.edu	37	8	52733136	52733136	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:52733136C>G	ENST00000360540.5	-	7	1255	c.849G>C	c.(847-849)caG>caC	p.Q283H	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Missense_Mutation_p.Q283H|PCMTD1_ENST00000544451.1_Missense_Mutation_p.Q207H	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	283						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TGTTAATTCTCTGTTTAACTC	0.408																																							uc003xqx.3		NA																	0					0						c.(847-849)CAG>CAC		protein-L-isoaspartate (D-aspartate)							180.0	181.0	180.0					8																	52733136		2203	4300	6503	SO:0001583	missense	115294					cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity	g.chr8:52733136C>G		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.849G>C	8.37:g.52733136C>G	ENSP00000353739:p.Gln283His		Somatic				PCMTD1_uc011ldm.1_Missense_Mutation_p.Q153H|PCMTD1_uc003xqw.3_Missense_Mutation_p.Q283H|PCMTD1_uc011ldn.1_Missense_Mutation_p.Q95H|PCMTD1_uc010lya.2_Missense_Mutation_p.Q207H	p.Q283H	NM_052937	NP_443169	WXS	Illumina HiSeq	Unspecified	Q96MG8	PCMD1_HUMAN			6	1190	-		Lung NSC(129;0.0795)|all_lung(136;0.144)	283					Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	c.849G>C	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753250	0.49362	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.44083	0.93;0.93;0.93	5.97	2.92	0.33932	.	0.473545	0.23999	N	0.042499	T	0.37376	0.1001	N	0.22421	0.69	0.33998	D	0.649912	B;D;B	0.53151	0.412;0.958;0.0	B;P;B	0.54312	0.188;0.748;0.001	T	0.50857	-0.8778	10	0.54805	T	0.06	-50.4488	7.159	0.25652	0.0:0.5441:0.282:0.1739	.	153;207;283	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	H	283;207;283	ENSP00000353739:Q283H;ENSP00000444026:Q207H;ENSP00000428099:Q283H	ENSP00000353739:Q283H	Q	-	3	2	PCMTD1	52895689	0.978000	0.34361	1.000000	0.80357	0.966000	0.64601	-0.011000	0.12721	1.463000	0.47967	0.655000	0.94253	CAG		0.408	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937		6	246	0	0	0	0.006214	0	6	246				
ERICH5	203111	broad.mit.edu	37	8	99102182	99102182	+	Nonsense_Mutation	SNP	C	C	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:99102182C>T	ENST00000318528.3	+	2	1296	c.937C>T	c.(937-939)Cga>Tga	p.R313*	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		313	Glu-rich.									kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			GCATCCAGCACGAAATGTAGA	0.443																																							uc003yih.1		NA																	0					0						c.(937-939)CGA>TGA		hypothetical protein LOC203111							118.0	104.0	109.0					8																	99102182		2203	4300	6503	SO:0001587	stop_gained	203111							g.chr8:99102182C>T																												ENST00000318528.3:c.937C>T	8.37:g.99102182C>T	ENSP00000315614:p.Arg313*		Somatic					p.R313*	NM_173549	NP_775820	WXS	Illumina HiSeq	Unspecified	Q6P6B1	CH047_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.214)		2	1085	+	Breast(36;2.31e-06)		313			Glu-rich.		G3V1K4|Q8N1L8	Nonsense_Mutation	SNP	ENST00000318528.3	37	c.937C>T	CCDS34929.1	.	.	.	.	.	.	.	.	.	.	C	35	5.574901	0.96553	.	.	ENSG00000177459	ENST00000318528	.	.	.	4.8	3.0	0.34707	.	0.411835	0.20879	N	0.084039	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-1.6124	6.0305	0.19677	0.1033:0.2072:0.6894:0.0	.	.	.	.	X	313	.	ENSP00000315614:R313X	R	+	1	2	C8orf47	99171358	0.048000	0.20356	0.020000	0.16555	0.016000	0.09150	1.749000	0.38319	1.392000	0.46585	-0.165000	0.13383	CGA		0.443	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380465.1			29	146	0	0	0	0.004289	0	29	146				
RIMS2	9699	broad.mit.edu	37	8	105261043	105261043	+	Splice_Site	SNP	T	T	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:105261043T>A	ENST00000436393.2	+	25	3884		c.e25+2		RIMS2_ENST00000507740.1_Splice_Site|RIMS2_ENST00000262231.10_Splice_Site|RIMS2_ENST00000406091.3_Splice_Site|RIMS2_ENST00000339750.2_Splice_Site			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CTGCAATGGGTAAGAATTTCT	0.438										HNSCC(12;0.0054)																													uc003yls.2		NA																	0				ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.e25+2		regulating synaptic membrane exocytosis 2							73.0	73.0	73.0					8																	105261043		2121	4269	6390	SO:0001630	splice_region_variant	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:105261043T>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3643+2T>A	8.37:g.105261043T>A		HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Splice_Site_p.G1197_splice|RIMS2_uc003ylw.2_Splice_Site_p.G1204_splice|RIMS2_uc003ylq.2_Splice_Site_p.G1011_splice|RIMS2_uc003ylr.2_Splice_Site_p.G1036_splice	p.G1215_splice	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		25	3884	+								B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Splice_Site	SNP	ENST00000436393.2	37	c.3643_splice		.	.	.	.	.	.	.	.	.	.	T	20.8	4.057067	0.76074	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6122	0.76733	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIMS2	105330219	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	7.997000	0.88414	2.152000	0.67230	0.528000	0.53228	.		0.438	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	Intron	5	101	0	0	0	0.001168	0	5	101				
LRP12	29967	broad.mit.edu	37	8	105511743	105511743	+	Nonsense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:105511743G>A	ENST00000276654.5	-	4	385	c.277C>T	c.(277-279)Cag>Tag	p.Q93*	LRP12_ENST00000424843.2_Nonsense_Mutation_p.Q74*	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	93	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCAAAATCCTGAAAACTGAAA	0.299																																							uc003yma.2		NA																	0					0						c.(277-279)CAG>TAG		low density lipoprotein-related protein 12							58.0	60.0	60.0					8																	105511743		2203	4300	6503	SO:0001587	stop_gained	29967				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding	g.chr8:105511743G>A	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.277C>T	8.37:g.105511743G>A	ENSP00000276654:p.Gln93*		Somatic				LRP12_uc003ymb.2_Nonsense_Mutation_p.Q74*	p.Q93*	NM_013437	NP_038465	WXS	Illumina HiSeq	Unspecified	Q9Y561	LRP12_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)		4	372	-			93			Extracellular (Potential).|CUB 1.		A8K137|B4DRQ2	Nonsense_Mutation	SNP	ENST00000276654.5	37	c.277C>T	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	G	37	6.623895	0.97714	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523830	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-12.5053	20.089	0.97809	0.0:0.0:1.0:0.0	.	.	.	.	X	74;93;93	.	ENSP00000276654:Q93X	Q	-	1	0	LRP12	105580919	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.978000	0.56881	2.752000	0.94435	0.557000	0.71058	CAG		0.299	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437		6	55	0	0	0	0.001984	0	6	55				
DENND3	22898	broad.mit.edu	37	8	142178249	142178249	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:142178249C>G	ENST00000262585.2	+	13	1938	c.1660C>G	c.(1660-1662)Ctg>Gtg	p.L554V	DENND3_ENST00000424248.1_Missense_Mutation_p.L502V|DENND3_ENST00000519811.1_Missense_Mutation_p.L634V	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	554					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CGATAACTCTCTGCTCCTGGC	0.542																																							uc003yvy.2		NA																	0				ovary(1)	1						c.(1660-1662)CTG>GTG		DENN/MADD domain containing 3							126.0	114.0	118.0					8																	142178249		2203	4300	6503	SO:0001583	missense	22898							g.chr8:142178249C>G	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1660C>G	8.37:g.142178249C>G	ENSP00000262585:p.Leu554Val		Somatic				DENND3_uc010mep.2_Missense_Mutation_p.L515V|DENND3_uc003yvz.1_Missense_Mutation_p.L238V	p.L554V	NM_014957	NP_055772	WXS	Illumina HiSeq	Unspecified	A2RUS2	DEND3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.105)		13	1938	+	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		554					B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	c.1660C>G	CCDS34947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.284|0.284	-0.984713|-0.984713	0.02180|0.02180	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811|ENST00000518668	T;T;T|T	0.13420|0.21543	3.01;2.59;3.01|2.0	5.56|5.56	4.69|4.69	0.59074|0.59074	.|.	0.311263|.	0.34268|.	N|.	0.004111|.	T|T	0.07999|0.07999	0.0200|0.0200	N|N	0.00926|0.00926	-1.1|-1.1	0.20403|0.20403	N|N	0.999904|0.999904	B;B;B|.	0.06786|.	0.001;0.001;0.001|.	B;B;B|.	0.08055|.	0.001;0.003;0.001|.	T|T	0.15665|0.15665	-1.0429|-1.0429	10|7	0.02654|0.87932	T|D	1|0	-13.2799|-13.2799	8.4539|8.4539	0.32888|0.32888	0.093:0.2483:0.6587:0.0|0.093:0.2483:0.6587:0.0	.|.	634;502;554|.	E9PF32;A2RUS2-2;A2RUS2|.	.;.;DEND3_HUMAN|.	V|C	554;502;634|558	ENSP00000262585:L554V;ENSP00000410594:L502V;ENSP00000428714:L634V|ENSP00000428276:S558C	ENSP00000262585:L554V|ENSP00000428276:S558C	L|S	+|+	1|2	2|0	DENND3|DENND3	142247431|142247431	0.459000|0.459000	0.25768|0.25768	0.680000|0.680000	0.29994|0.29994	0.542000|0.542000	0.35054|0.35054	3.562000|3.562000	0.53777|0.53777	1.362000|1.362000	0.46000|0.46000	0.462000|0.462000	0.41574|0.41574	CTG|TCT		0.542	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957		93	168	0	0	0	0.01441	0	93	168				
CYP11B1	1584	broad.mit.edu	37	8	143957662	143957662	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr8:143957662C>G	ENST00000292427.4	-	5	981	c.949G>C	c.(949-951)Gac>Cac	p.D317H	CYP11B1_ENST00000377675.3_Missense_Mutation_p.D388H|CYP11B1_ENST00000517471.1_Missense_Mutation_p.D317H	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	317					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CTGACCGTGTCCACGCTCCCT	0.617									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	0				ovary(3)	3						c.(949-951)GAC>CAC		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						112.0	97.0	102.0					8																	143957662		2203	4300	6503	SO:0001583	missense	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143957662C>G	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.949G>C	8.37:g.143957662C>G	ENSP00000292427:p.Asp317His		Somatic				CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'UTR|CYP11B1_uc003yxj.2_Missense_Mutation_p.D317H|CYP11B1_uc010mey.2_Missense_Mutation_p.D388H	p.D317H	NM_000497	NP_000488	WXS	Illumina HiSeq	Unspecified	P15538	C11B1_HUMAN			5	956	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		317					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	c.949G>C	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	14.98	2.696904	0.48202	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.73363	-0.74;2.27;-0.74	4.1	4.1	0.47936	.	0.123831	0.35870	N	0.002927	D	0.86201	0.5876	M	0.83312	2.635	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.995	D	0.88252	0.2917	10	0.62326	D	0.03	.	14.1608	0.65446	0.0:1.0:0.0:0.0	.	388;317;317	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	H	317;317;388	ENSP00000292427:D317H;ENSP00000428043:D317H;ENSP00000366903:D388H	ENSP00000292427:D317H	D	-	1	0	CYP11B1	143954664	0.995000	0.38212	0.869000	0.34112	0.031000	0.12232	3.178000	0.50879	1.977000	0.57605	0.650000	0.86243	GAC		0.617	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			29	79	0	0	0	0.003755	0	29	79				
PTCH1	5727	broad.mit.edu	37	9	98244475	98244475	+	Silent	SNP	A	A	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr9:98244475A>G	ENST00000331920.6	-	4	894	c.595T>C	c.(595-597)Ttg>Ctg	p.L199L	PTCH1_ENST00000430669.2_Silent_p.L133L|PTCH1_ENST00000375274.2_Silent_p.L198L|PTCH1_ENST00000437951.1_Silent_p.L133L|PTCH1_ENST00000429896.2_Silent_p.L48L|PTCH1_ENST00000421141.1_Silent_p.L48L|PTCH1_ENST00000548379.1_5'UTR|PTCH1_ENST00000468211.2_Silent_p.L133L|PTCH1_ENST00000418258.1_Silent_p.L48L	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	199					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AAATGTTCCAATTTCCACTGC	0.323																																							uc004avk.3		NA																	0				skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379						c.(595-597)TTG>CTG		patched isoform L							80.0	78.0	78.0					9																	98244475		2203	4300	6503	SO:0001819	synonymous_variant	5727	Basal_Cell_Nevus_syndrome			embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	g.chr9:98244475A>G	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.595T>C	9.37:g.98244475A>G			Somatic				PTCH1_uc010mro.2_Silent_p.L48L|PTCH1_uc010mrp.2_Silent_p.L48L|PTCH1_uc010mrq.2_Silent_p.L48L|PTCH1_uc004avl.3_Silent_p.L48L|PTCH1_uc010mrr.2_Silent_p.L133L|PTCH1_uc004avm.3_Silent_p.L198L|PTCH1_uc010mrs.1_5'Flank|PTCH1_uc010mrt.1_RNA|PTCH1_uc010mru.1_Intron|PTCH1_uc004avo.2_Silent_p.L133L|PTCH1_uc010mrv.1_RNA	p.L199L	NM_000264	NP_000255	WXS	Illumina HiSeq	Unspecified	Q13635	PTC1_HUMAN			4	783	-		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)	199			Extracellular (Potential).		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	c.595T>C	CCDS6714.1																																																																																				0.323	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		10	17	0	0	0	0.008291	0	10	17				
C9orf156	51531	broad.mit.edu	37	9	100667199	100667199	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr9:100667199G>A	ENST00000375119.3	-	5	1218	c.1142C>T	c.(1141-1143)gCg>gTg	p.A381V		NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156	381					viral process (GO:0016032)		hydrolase activity (GO:0016787)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				CCGAGGATCCGCTGACAGCAC	0.473																																							uc004axv.1		NA																	0					0						c.(1141-1143)GCG>GTG		Nef associated protein 1							79.0	76.0	77.0					9																	100667199		2203	4300	6503	SO:0001583	missense	51531				interspecies interaction between organisms		hydrolase activity	g.chr9:100667199G>A	AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.1142C>T	9.37:g.100667199G>A	ENSP00000364260:p.Ala381Val		Somatic				C9orf156_uc004axw.1_Missense_Mutation_p.A278V|C9orf156_uc004axx.1_Missense_Mutation_p.A235V	p.A381V	NM_016481	NP_057565	WXS	Illumina HiSeq	Unspecified	Q9BU70	NAP1_HUMAN			5	1219	-		Acute lymphoblastic leukemia(62;0.158)	381					Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Missense_Mutation	SNP	ENST00000375119.3	37	c.1142C>T	CCDS6730.1	.	.	.	.	.	.	.	.	.	.	G	33	5.248647	0.95305	.	.	ENSG00000136932	ENST00000375119;ENST00000375118	T;T	0.42131	0.98;0.98	5.19	5.19	0.71726	Uncharacterised domain UPF0066, YaeB-like domain (1);	0.000000	0.85682	D	0.000000	T	0.67970	0.2950	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72453	-0.4289	10	0.66056	D	0.02	-15.159	16.5983	0.84802	0.0:0.0:1.0:0.0	.	235;381	Q5T114;Q9BU70	.;NAP1_HUMAN	V	381;235	ENSP00000364260:A381V;ENSP00000364259:A235V	ENSP00000364259:A235V	A	-	2	0	C9orf156	99707020	1.000000	0.71417	0.493000	0.27502	0.947000	0.59692	7.996000	0.88334	2.577000	0.86979	0.655000	0.94253	GCG		0.473	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055401.1	NM_016481		3	57	0	0	0	0.004672	0	3	57				
AKAP17A	8227	broad.mit.edu	37	X	1714321	1714321	+	Missense_Mutation	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:1714321G>C	ENST00000313871.3	+	3	1003	c.807G>C	c.(805-807)aaG>aaC	p.K269N	AKAP17A_ENST00000381261.3_Missense_Mutation_p.K269N	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	269					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						CCTCAATTAAGAAGCGGCAGC	0.517																																							uc004cqa.2		NA																	0					0						c.(805-807)AAG>AAC		DNA segment on chromosome X and Y (unique) 155							248.0	265.0	259.0					X																	1714321		2203	4296	6499	SO:0001583	missense	8227				B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding	g.chrX:1714321G>C	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.807G>C	X.37:g.1714321G>C	ENSP00000324827:p.Lys269Asn		Somatic				SFRS17A_uc010ncx.1_Missense_Mutation_p.K269N|SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_5'Flank	p.K269N	NM_005088	NP_005079	WXS	Illumina HiSeq	Unspecified	Q02040	AK17A_HUMAN			3	1003	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	269					Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	ENST00000313871.3	37	c.807G>C	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	g	9.749	1.166983	0.21621	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.45668	0.89;0.89	2.29	-2.79	0.05841	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	U	0.000000	T	0.40119	0.1104	.	.	.	0.09310	N	1	P;P	0.50943	0.85;0.94	P;P	0.53518	0.529;0.728	T	0.30592	-0.9973	9	0.42905	T	0.14	.	4.5518	0.12116	0.4099:0.1656:0.4245:0.0	.	269;269	Q02040-3;Q02040	.;AK17A_HUMAN	N	269	ENSP00000324827:K269N;ENSP00000370660:K269N	ENSP00000324827:K269N	K	+	3	2	AKAP17A	1674321	1.000000	0.71417	0.001000	0.08648	0.213000	0.24496	1.469000	0.35343	-0.416000	0.07473	0.100000	0.15512	AAG		0.517	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088		33	150	0	0	0	0.012213	0	33	150				
TLR7	51284	broad.mit.edu	37	X	12906731	12906731	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:12906731C>G	ENST00000380659.3	+	3	3243	c.3104C>G	c.(3103-3105)aCa>aGa	p.T1035R		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	1035	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GCCCTGGCCACAGACAATCAT	0.517																																							uc004cvc.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(3103-3105)ACA>AGA		toll-like receptor 7 precursor	Imiquimod(DB00724)						102.0	100.0	101.0					X																	12906731		2203	4300	6503	SO:0001583	missense	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12906731C>G	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.3104C>G	X.37:g.12906731C>G	ENSP00000370034:p.Thr1035Arg		Somatic					p.T1035R	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	3243	+			1035			TIR.|Cytoplasmic (Potential).		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	c.3104C>G	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	C	4.923	0.171502	0.09391	.	.	ENSG00000196664	ENST00000380659	T	0.02498	4.27	5.96	2.31	0.28768	Toll/interleukin-1 receptor homology (TIR) domain (2);	0.362257	0.26684	N	0.023040	T	0.05135	0.0137	L	0.58101	1.795	0.36720	D	0.881129	B	0.33748	0.423	B	0.40066	0.318	T	0.34725	-0.9817	10	0.42905	T	0.14	.	9.5881	0.39528	0.0:0.6209:0.0:0.3791	.	1035	Q9NYK1	TLR7_HUMAN	R	1035	ENSP00000370034:T1035R	ENSP00000370034:T1035R	T	+	2	0	TLR7	12816652	0.055000	0.20627	0.645000	0.29479	0.116000	0.19942	0.750000	0.26334	0.028000	0.15324	-0.191000	0.12829	ACA		0.517	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		16	193	0	0	0	0.008871	0	16	193				
ACE2	59272	broad.mit.edu	37	X	15605910	15605910	+	Missense_Mutation	SNP	G	G	C	rs377035576		TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:15605910G>C	ENST00000252519.3	-	6	870	c.768C>G	c.(766-768)atC>atG	p.I256M	ACE2_ENST00000427411.1_Missense_Mutation_p.I256M			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	256					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	CAATTGGACTGATATAGGAAG	0.388																																							uc004cxa.1		NA																	0				ovary(3)	3						c.(766-768)ATC>ATG		angiotensin I converting enzyme 2 precursor	Moexipril(DB00691)						155.0	137.0	143.0					X																	15605910		2203	4300	6503	SO:0001583	missense	59272				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding	g.chrX:15605910G>C	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.768C>G	X.37:g.15605910G>C	ENSP00000252519:p.Ile256Met		Somatic				ACE2_uc004cxb.2_Missense_Mutation_p.I256M	p.I256M	NM_021804	NP_068576	WXS	Illumina HiSeq	Unspecified	Q9BYF1	ACE2_HUMAN			6	936	-	Hepatocellular(33;0.183)		256			Extracellular (Potential).		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	37	c.768C>G	CCDS14169.1	.	.	.	.	.	.	.	.	.	.	g	6.081	0.383229	0.11524	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	T;T	0.41758	0.99;0.99	5.68	2.91	0.33838	.	0.213099	0.48286	N	0.000190	T	0.53012	0.1770	M	0.73319	2.225	0.25831	N	0.984166	B	0.32862	0.387	P	0.47102	0.537	T	0.53114	-0.8484	10	0.72032	D	0.01	-11.1438	10.1516	0.42796	0.1416:0.115:0.7435:0.0	.	256	Q9BYF1	ACE2_HUMAN	M	256	ENSP00000252519:I256M;ENSP00000389326:I256M	ENSP00000252519:I256M	I	-	3	3	ACE2	15515831	1.000000	0.71417	0.026000	0.17262	0.004000	0.04260	1.650000	0.37292	0.179000	0.19938	-1.029000	0.02412	ATC		0.388	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			10	201	0	0	0	0.004007	0	10	201				
PPEF1	5475	broad.mit.edu	37	X	18725777	18725777	+	Splice_Site	SNP	G	G	C			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:18725777G>C	ENST00000361511.4	+	4	372		c.e4-1		PPEF1_ENST00000349874.5_Splice_Site|PPEF1_ENST00000471570.1_Splice_Site|PPEF1_ENST00000543630.1_Splice_Site|PPEF1_ENST00000359763.6_Splice_Site|PPEF1_ENST00000544635.1_5'UTR	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1						detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					TTCCTCATTAGAATCTATGAC	0.458																																							uc004cyq.2		NA																	0					0						c.e4-1		protein phosphatase with EF hand calcium-binding																																				SO:0001630	splice_region_variant	5475				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity	g.chrX:18725777G>C	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.-122-1G>C	X.37:g.18725777G>C			Somatic				PPEF1_uc004cyp.2_Splice_Site|PPEF1_uc004cyr.2_Splice_Site|PPEF1_uc004cys.2_5'UTR|PPEF1_uc011mja.1_5'Flank		NM_006240	NP_006231	WXS	Illumina HiSeq	Unspecified	O14829	PPE1_HUMAN			4	360	+	Hepatocellular(33;0.183)							A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Splice_Site	SNP	ENST00000361511.4	37	c.-121_splice	CCDS14188.1																																																																																				0.458	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240	Intron	3	8	0	0	0	0.004672	0	3	8				
ASB12	142689	broad.mit.edu	37	X	63445233	63445233	+	Missense_Mutation	SNP	C	C	G			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:63445233C>G	ENST00000396130.2	-	1	270	c.271G>C	c.(271-273)Gac>Cac	p.D91H	ASB12_ENST00000362002.2_Missense_Mutation_p.D100H|MTMR8_ENST00000453546.1_Missense_Mutation_p.D475H			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	91					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						TCCAAGCTGTCAACATCAGCA	0.552																																							uc011mou.1		NA																	2	Whole gene deletion(2)		ovary(1)|large_intestine(1)	ovary(2)|breast(2)	4						c.(1423-1425)GAC>CAC		myotubularin related protein 8							96.0	57.0	70.0					X																	63445233		2203	4300	6503	SO:0001583	missense	55613					nuclear envelope	protein tyrosine phosphatase activity	g.chrX:63445233C>G	AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.271G>C	X.37:g.63445233C>G	ENSP00000379435:p.Asp91His		Somatic				ASB12_uc004dvp.1_Missense_Mutation_p.D91H|ASB12_uc004dvq.1_Missense_Mutation_p.D100H|ASB12_uc004dvr.1_Missense_Mutation_p.D100H	p.D475H	NM_017677	NP_060147	WXS	Illumina HiSeq	Unspecified	Q96EF0	MTMR8_HUMAN			10	1491	-			Error:Variant_position_missing_in_Q96EF0_after_alignment					J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	ENST00000396130.2	37	c.1423G>C		.	.	.	.	.	.	.	.	.	.	C	17.96	3.515677	0.64634	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.56444	0.46;0.46;0.46	4.0	4.0	0.46444	Ankyrin repeat-containing domain (4);	0.048090	0.85682	D	0.000000	T	0.66790	0.2825	L	0.56280	1.765	0.34226	D	0.675924	D;D	0.89917	1.0;0.998	D;D	0.79784	0.993;0.928	T	0.77910	-0.2411	10	0.87932	D	0	-36.9291	14.2368	0.65932	0.0:1.0:0.0:0.0	.	475;91	B4DQL0;Q8WXK4	.;ASB12_HUMAN	H	100;91;100;475	ENSP00000355195:D100H;ENSP00000379435:D91H;ENSP00000394003:D475H	ENSP00000354626:D100H	D	-	1	0	ASB12;MTMR8	63361958	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.846000	0.75399	1.986000	0.57962	0.468000	0.43344	GAC		0.552	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				3	20	0	0	0	0.009096	0	3	20				
ZMYM3	9203	broad.mit.edu	37	X	70465569	70465569	+	Nonsense_Mutation	SNP	C	C	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:70465569C>A	ENST00000353904.2	-	17	2996	c.2809G>T	c.(2809-2811)Gaa>Taa	p.E937*	ZMYM3_ENST00000314425.5_Nonsense_Mutation_p.E937*|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Nonsense_Mutation_p.E939*|ZMYM3_ENST00000373984.3_Nonsense_Mutation_p.E939*|ZMYM3_ENST00000373998.1_Nonsense_Mutation_p.E925*	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	937					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GCAATCATTTCTGCCATAGCC	0.527																																							uc004dzh.1		NA																	0				ovary(1)	1						c.(2809-2811)GAA>TAA		zinc finger protein 261							113.0	82.0	93.0					X																	70465569		2203	4300	6503	SO:0001587	stop_gained	9203				multicellular organismal development	nucleus	DNA binding|zinc ion binding	g.chrX:70465569C>A	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.2809G>T	X.37:g.70465569C>A	ENSP00000343909:p.Glu937*		Somatic				BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Nonsense_Mutation_p.E937*|ZMYM3_uc004dzj.1_Nonsense_Mutation_p.E925*	p.E937*	NM_201599	NP_963893	WXS	Illumina HiSeq	Unspecified	Q14202	ZMYM3_HUMAN			17	2896	-	Renal(35;0.156)		937					D3DVV3|O15089|Q96E26	Nonsense_Mutation	SNP	ENST00000353904.2	37	c.2809G>T	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	c	47	13.112832	0.99720	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.6537	18.5203	0.90950	0.0:1.0:0.0:0.0	.	.	.	.	X	937;925;937;939;939	.	ENSP00000322845:E937X	E	-	1	0	ZMYM3	70382294	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.147000	0.77382	2.571000	0.86741	0.597000	0.82753	GAA		0.527	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599		7	41	1	0	0.00307968	0.00308	0.00313806	7	41				
ACRC	93953	broad.mit.edu	37	X	70823512	70823512	+	Missense_Mutation	SNP	G	G	A			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:70823512G>A	ENST00000373695.1	+	7	922	c.385G>A	c.(385-387)Gac>Aac	p.D129N	ACRC_ENST00000373696.3_Missense_Mutation_p.D129N			Q96QF7	ACRC_HUMAN	acidic repeat containing	129	Asp/Ser-rich.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TGATGACAATGACGATGACAA	0.448																																							uc004eae.2		NA																	0				ovary(3)	3						c.(385-387)GAC>AAC		ACRC protein							186.0	166.0	173.0					X																	70823512		2203	4300	6503	SO:0001583	missense	93953					nucleus		g.chrX:70823512G>A	AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.385G>A	X.37:g.70823512G>A	ENSP00000362799:p.Asp129Asn		Somatic				BCYRN1_uc011mpt.1_Intron	p.D129N	NM_052957	NP_443189	WXS	Illumina HiSeq	Unspecified	Q96QF7	ACRC_HUMAN			8	886	+	Renal(35;0.156)		129			Asp/Ser-rich.		B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	c.385G>A	CCDS35326.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478084	0.26511	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.32515	1.45;1.45	1.96	-0.0306	0.13913	.	.	.	.	.	T	0.16085	0.0387	N	0.14661	0.345	0.09310	N	1	B	0.24576	0.106	B	0.25759	0.063	T	0.24905	-1.0147	9	0.87932	D	0	.	4.2151	0.10530	0.4216:0.0:0.5784:0.0	.	129	Q96QF7	ACRC_HUMAN	N	129	ENSP00000362800:D129N;ENSP00000362799:D129N	ENSP00000362799:D129N	D	+	1	0	ACRC	70740237	0.001000	0.12720	0.001000	0.08648	0.012000	0.07955	0.804000	0.27098	-0.096000	0.12329	0.468000	0.43344	GAC		0.448	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			54	181	0	0	0	0.01441	0	54	181				
TAF7L	54457	broad.mit.edu	37	X	100533109	100533109	+	Splice_Site	SNP	A	A	T			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chrX:100533109A>T	ENST00000372907.3	-	8	774	c.763T>A	c.(763-765)Tac>Aac	p.Y255N	TAF7L_ENST00000356784.1_Splice_Site_p.Y169N|TAF7L_ENST00000324762.6_Splice_Site_p.Y169N|TAF7L_ENST00000372905.2_Splice_Site_p.Y169N	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	255					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GATTCAATGTACTGAAGCAAA	0.433																																					Ovarian(104;431 1530 3210 15406 18594)	Ovarian(104;431 1530 3210 15406 18594)	uc004ehb.2		NA																	0				breast(1)	1						c.(763-765)TAC>AAC		TATA box binding protein-associated factor, RNA							93.0	81.0	85.0					X																	100533109		2203	4300	6503	SO:0001630	splice_region_variant	54457				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding	g.chrX:100533109A>T	AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.763-1T>A	X.37:g.100533109A>T			Somatic				TAF7L_uc004eha.2_Missense_Mutation_p.Y169N|TAF7L_uc004ehc.1_Missense_Mutation_p.Y169N	p.Y255N	NM_024885	NP_079161	WXS	Illumina HiSeq	Unspecified	Q5H9L4	TAF7L_HUMAN			8	775	-			255					Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	c.763T>A	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	A	7.600	0.672564	0.14776	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	T;T;T;T	0.25579	3.76;1.79;1.79;3.12	4.95	0.908	0.19326	TAFII55 protein, conserved region (1);Armadillo-like helical (1);	0.763743	0.11240	N	0.584706	T	0.23451	0.0567	L	0.58101	1.795	0.42414	D	0.992619	B;B	0.25390	0.125;0.023	B;B	0.25291	0.059;0.01	T	0.06972	-1.0797	10	0.62326	D	0.03	-0.1343	5.0377	0.14443	0.7043:0.0:0.1614:0.1344	.	255;169	Q5H9L4;Q5H9L4-3	TAF7L_HUMAN;.	N	255;169;169;169	ENSP00000361998:Y255N;ENSP00000361996:Y169N;ENSP00000320283:Y169N;ENSP00000349235:Y169N	ENSP00000320283:Y169N	Y	-	1	0	TAF7L	100419765	1.000000	0.71417	0.041000	0.18516	0.193000	0.23685	3.085000	0.50151	-0.132000	0.11557	-1.600000	0.00815	TAC		0.433	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		Missense_Mutation	5	78	0	0	0	0.001984	0	5	78				
MMEL1	79258	broad.mit.edu	37	1	2560819	2560821	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr1:2560819_2560821delCAG	ENST00000378412.3	-	2	264_266	c.103_105delCTG	c.(103-105)ctgdel	p.L35del	MMEL1_ENST00000511099.1_5'Flank|MMEL1_ENST00000288709.6_In_Frame_Del_p.L26del|MMEL1_ENST00000502556.1_In_Frame_Del_p.L35del			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	35						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CAGCGGTCACcagcagcagcagc	0.739																																							uc001ajy.2		NA																	0					0						c.(103-105)CTGdel		membrane metallo-endopeptidase-like 1				2,190,3148		0,0,2,18,154,1496						-0.2	0.9			12	5,359,6192		1,0,3,61,237,2976	no	codingComplex	MMEL1	NM_033467.3		1,0,5,79,391,4472	A1A1,A1A2,A1R,A2A2,A2R,RR		5.5522,5.7485,5.6184				7,549,9340				SO:0001651	inframe_deletion	79258				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity	g.chr1:2560819_2560821delCAG	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.103_105delCTG	1.37:g.2560828_2560830delCAG	ENSP00000367668:p.Leu35del		Somatic				MMEL1_uc009vlg.1_RNA	p.L35del	NM_033467	NP_258428	WXS	Illumina HiSeq	Unspecified	Q495T6	MMEL1_HUMAN		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)	2	317_319	-	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	35			Helical; Signal-anchor for type II membrane protein; (Potential).		B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	In_Frame_Del	DEL	ENST00000378412.3	37	c.103_105delCTG	CCDS30569.2																																																																																				0.739	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69833132	69833132	+	Frame_Shift_Del	DEL	A	A	-			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr16:69833132delA	ENST00000359154.2	+	4	375	c.274delA	c.(274-276)agafs	p.R92fs	WWP2_ENST00000448661.1_Frame_Shift_Del_p.R92fs|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000356003.2_Frame_Shift_Del_p.R92fs|WWP2_ENST00000569174.1_Frame_Shift_Del_p.R92fs	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	92	C2.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCATACCTTGAGAAATGAACT	0.453											OREG0023909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002exu.1		NA																	0				lung(3)|ovary(1)|breast(1)|skin(1)	6						c.(274-276)AGAfs		WW domain containing E3 ubiquitin protein ligase							87.0	86.0	86.0					16																	69833132		2198	4300	6498	SO:0001589	frameshift_variant	11060				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity	g.chr16:69833132delA	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.274delA	16.37:g.69833132delA	ENSP00000352069:p.Arg92fs		Somatic	OREG0023909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1117	WWP2_uc002ext.2_Frame_Shift_Del_p.R92fs|WWP2_uc002exv.1_Frame_Shift_Del_p.R92fs	p.R92fs	NM_007014	NP_008945	WXS	Illumina HiSeq	Unspecified	O00308	WWP2_HUMAN			5	363	+			92			C2.		A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Frame_Shift_Del	DEL	ENST00000359154.2	37	c.274delA	CCDS10885.1																																																																																				0.453	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014		40	71	NA	NA	NA	NA	NA	40	71	---	---	---	---
IFI35	3430	broad.mit.edu	37	17	41164281	41164281	+	Frame_Shift_Del	DEL	C	C	-			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr17:41164281delC	ENST00000415816.2	+	2	330	c.107delC	c.(106-108)tccfs	p.S36fs	IFI35_ENST00000438323.2_Frame_Shift_Del_p.S36fs|IFI35_ENST00000536969.1_3'UTR	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	36					cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		CTCGGGGACTCCCCCAAAGAC	0.597																																							uc010whj.1		NA																	0				ovary(1)	1						c.(106-108)TCCfs		interferon-induced protein 35							37.0	41.0	39.0					17																	41164281		2181	4282	6463	SO:0001589	frameshift_variant	3430				response to virus|type I interferon-mediated signaling pathway	nucleus	protein binding	g.chr17:41164281delC	BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.107delC	17.37:g.41164281delC	ENSP00000394579:p.Ser36fs		Somatic					p.S36fs	NM_005533	NP_005524	WXS	Illumina HiSeq	Unspecified	P80217	IN35_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.157)	2	303	+		Breast(137;0.00499)	36					C9JGX1|Q92984|Q99537|Q9BV98	Frame_Shift_Del	DEL	ENST00000415816.2	37	c.107delC																																																																																					0.597	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000395851.1	NM_005533		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
CNDP2	55748	broad.mit.edu	37	18	72167216	72167221	+	In_Frame_Del	DEL	CCCTCA	CCCTCA	-			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	CCCTCA	CCCTCA	-	-	CCCTCA	CCCTCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr18:72167216_72167221delCCCTCA	ENST00000324262.4	+	2	324_329	c.8_13delCCCTCA	c.(7-15)gccctcact>gct	p.LT4del	CNDP2_ENST00000579847.1_In_Frame_Del_p.LT4del|CNDP2_ENST00000324301.8_In_Frame_Del_p.LT4del	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	4					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		AAGATGGCGGCCCTCACTACCCTGTT	0.466																																							uc002llm.1		NA																	0				ovary(2)|skin(1)	3						c.(7-15)GCCCTCACT>GCT		CNDP dipeptidase 2																																				SO:0001651	inframe_deletion	55748					cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity	g.chr18:72167216_72167221delCCCTCA	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.8_13delCCCTCA	18.37:g.72167216_72167221delCCCTCA	ENSP00000325548:p.Leu4_Thr5del		Somatic				CNDP2_uc002lln.1_In_Frame_Del_p.LT4del|CNDP2_uc002llo.2_In_Frame_Del_p.LT4del	p.LT4del	NM_018235	NP_060705	WXS	Illumina HiSeq	Unspecified	Q96KP4	CNDP2_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.22)	2	170_175	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	4_5					B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	In_Frame_Del	DEL	ENST00000324262.4	37	c.8_13delCCCTCA	CCDS12006.1																																																																																				0.466	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235		12	62	NA	NA	NA	NA	NA	12	62	---	---	---	---
MEGF8	1954	broad.mit.edu	37	19	42880807	42880808	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr19:42880807_42880808delGC	ENST00000251268.6	+	42	8418_8419	c.8418_8419delGC	c.(8416-8421)ctgcggfs	p.R2807fs	MEGF8_ENST00000334370.4_Frame_Shift_Del_p.R2740fs|MEGF8_ENST00000378073.4_Frame_Shift_Del_p.R401fs	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2807	Gly-rich.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TCGTCACACTGCGGCACAGGCT	0.688																																							uc002otl.3		NA																	0				ovary(1)	1						c.(8215-8220)CTGCGGfs		multiple EGF-like-domains 8																																				SO:0001589	frameshift_variant	1954					integral to membrane	calcium ion binding|structural molecule activity	g.chr19:42880807_42880808delGC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.8418_8419delGC	19.37:g.42880807_42880808delGC	ENSP00000251268:p.Arg2807fs		Somatic				MEGF8_uc002otm.3_Frame_Shift_Del_p.L2347fs|MEGF8_uc002otn.3_Frame_Shift_Del_p.L400fs	p.L2739fs	NM_001410	NP_001401	WXS	Illumina HiSeq	Unspecified	Q7Z7M0	MEGF8_HUMAN			41	8852_8853	+		Prostate(69;0.00682)	2806_2807			Gly-rich.|Cytoplasmic (Potential).		A8KAY0|O75097	Frame_Shift_Del	DEL	ENST00000251268.6	37	c.8217_8218delGC																																																																																					0.688	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
BAP1	8314	broad.mit.edu	37	3	52437500	52437500	+	Frame_Shift_Del	DEL	C	C	-			TCGA-95-7948-01A-11D-2184-08	TCGA-95-7948-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ab3b50c5-0335-4685-acc2-eeadbf2a9c1b	984543c0-0d4b-4b68-997e-a8e3a755414d	g.chr3:52437500delC	ENST00000460680.1	-	13	2132	c.1661delG	c.(1660-1662)ggtfs	p.G554fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.G536fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GATGACAGGACCCAGATCACG	0.607			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	GBM(101;493 1458 7992 21037 25532)	uc003ddx.2		NA		Rec	yes		3	3p21.31-p21.2	8314	N|Mis|F|S|O	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)			E			uveal melanoma|breast|NSCLC		0				pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65						c.(1660-1662)GGTfs		BRCA1 associated protein-1							80.0	74.0	76.0					3																	52437500		2203	4300	6503	SO:0001589	frameshift_variant	8314				monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr3:52437500delC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1661delG	3.37:g.52437500delC	ENSP00000417132:p.Gly554fs		Somatic				BAP1_uc003ddw.2_RNA|BAP1_uc010hmg.2_RNA|BAP1_uc010hmh.2_Intron	p.G554fs	NM_004656	NP_004647	WXS	Illumina HiSeq	Unspecified	Q92560	BAP1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	13	1776	-			554					B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	c.1661delG	CCDS2853.1																																																																																				0.607	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			77	32	NA	NA	NA	NA	NA	77	32	---	---	---	---
