#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
RHCE	6006	broad.mit.edu	37	1	25718526	25718526	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:25718526T>C	ENST00000294413.7	-	4	651	c.593A>G	c.(592-594)aAt>aGt	p.N198S	RHCE_ENST00000413854.1_Missense_Mutation_p.N198S|RHCE_ENST00000425135.1_Missense_Mutation_p.N198S|RHCE_ENST00000340849.4_Intron|RHCE_ENST00000243186.6_Missense_Mutation_p.N198S|RHCE_ENST00000374352.2_Missense_Mutation_p.N182S|RHCE_ENST00000455194.1_Intron|RHCE_ENST00000349438.4_Missense_Mutation_p.N198S|RHCE_ENST00000349320.3_Missense_Mutation_p.N182S|RHCE_ENST00000346452.4_Intron	NM_020485.4	NP_065231	P18577	RHCE_HUMAN	Rh blood group, CcEe antigens	198			N -> K (in dbSNP:rs1053354).			integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			endometrium(8)|large_intestine(6)|lung(3)	17		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCTGATCATTATCCTCCGT	0.527																																							uc001bkf.2		NA																	0					0						c.(592-594)AAT>AGT		Rhesus blood group, CcEe antigens isoform 1							287.0	228.0	248.0					1																	25718526		2203	4300	6503	SO:0001583	missense	6006					integral to plasma membrane		g.chr1:25718526T>C	BC075081	CCDS30634.1, CCDS30635.1, CCDS30636.1, CCDS30637.1	1p36.11	2014-09-17	2006-02-23		ENSG00000188672	ENSG00000188672		"""CD molecules"", ""Blood group antigens"""	10008	protein-coding gene	gene with protein product		111700	"""Rhesus blood group, CcEe antigens"""	RH		8220426	Standard	NM_138618		Approved	CD240CE	uc001bkf.3	P18577	OTTHUMG00000007650	ENST00000294413.7:c.593A>G	1.37:g.25718526T>C	ENSP00000294413:p.Asn198Ser		Somatic				RHCE_uc001bkg.2_Missense_Mutation_p.N198S|RHCE_uc001bkh.2_Intron|RHCE_uc001bki.2_Intron|RHCE_uc001bkj.2_Missense_Mutation_p.N182S	p.N198S	NM_020485	NP_065231	WXS	Illumina HiSeq	Unspecified	P18577	RHCE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)	4	679	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	198					A7DW68|B7UDF3|B7UDF4|B7UDF5|B7UDF6|B7UDF7|B7UDF8|B7UDF9|B7UDG0|B7UDG1|B7UDG2|B7UDG3|Q02163|Q02164|Q02165|Q16160|Q2MJW0|Q2VC86|Q3LTM6|Q6AZX5|Q6J2U3|Q7RU06|Q8IZT2|Q8IZT3|Q8IZT4|Q8IZT5|Q9UD13|Q9UD14|Q9UD15|Q9UD16|Q9UD73|Q9UD74|Q9UEC2|Q9UEC3|Q9UPN0	Missense_Mutation	SNP	ENST00000294413.7	37	c.593A>G	CCDS30635.1	.	.	.	.	.	.	.	.	.	.	t	10.63	1.404308	0.25378	.	.	ENSG00000188672	ENST00000413854;ENST00000374352;ENST00000243186;ENST00000425135;ENST00000349320;ENST00000294413;ENST00000447203;ENST00000349438	T;T;T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95;1.95;1.95	3.99	3.99	0.46301	Ammonium transporter AmtB-like (3);	0.108839	0.64402	D	0.000009	T	0.20820	0.0501	L	0.46157	1.445	0.09310	N	1	B;B;B	0.13594	0.004;0.008;0.005	B;B;B	0.28638	0.027;0.045;0.092	T	0.19353	-1.0308	10	0.72032	D	0.01	-2.1444	9.464	0.38802	0.0:0.0:0.0:1.0	.	182;198;198	Q5VSJ9;Q5VSJ8;P18577	.;.;RHCE_HUMAN	S	198;182;198;198;182;198;198;198	ENSP00000415417:N198S;ENSP00000363472:N182S;ENSP00000243186:N198S;ENSP00000392809:N198S;ENSP00000311185:N182S;ENSP00000294413:N198S;ENSP00000334570:N198S	ENSP00000243186:N198S	N	-	2	0	RHCE	25591113	0.302000	0.24454	0.003000	0.11579	0.002000	0.02628	3.824000	0.55723	1.784000	0.52394	0.459000	0.35465	AAT		0.527	RHCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020312.2	NM_020485		5	102	0	0	0	0.014758	0	5	102				
SMG5	23381	broad.mit.edu	37	1	156247793	156247793	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:156247793A>G	ENST00000361813.5	-	3	364	c.220T>C	c.(220-222)Tat>Cat	p.Y74H	SMG5_ENST00000368267.5_Missense_Mutation_p.Y74H	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	74					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TTTCTCCCATAGTCCACTGGG	0.502																																							uc001foc.3		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(220-222)TAT>CAT		SMG5 homolog nonsense mediated mRNA decay							137.0	129.0	131.0					1																	156247793		2203	4300	6503	SO:0001583	missense	23381				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding	g.chr1:156247793A>G	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.220T>C	1.37:g.156247793A>G	ENSP00000355261:p.Tyr74His		Somatic					p.Y74H	NM_015327	NP_056142	WXS	Illumina HiSeq	Unspecified	Q9UPR3	SMG5_HUMAN			3	369	-	Hepatocellular(266;0.158)		74					D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	c.220T>C	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.898760	0.91962	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.19669	2.13;2.13	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.31295	0.0792	M	0.72894	2.215	0.58432	D	0.999999	P	0.51933	0.949	P	0.58130	0.833	T	0.03993	-1.0986	10	0.54805	T	0.06	-26.0873	14.5252	0.67884	1.0:0.0:0.0:0.0	.	74	Q9UPR3	SMG5_HUMAN	H	74	ENSP00000355261:Y74H;ENSP00000357250:Y74H	ENSP00000355261:Y74H	Y	-	1	0	SMG5	154514417	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.875000	0.92372	2.291000	0.77112	0.533000	0.62120	TAT		0.502	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327		6	67	0	0	0	0.021553	0	6	67				
SPTA1	6708	broad.mit.edu	37	1	158631122	158631122	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:158631122G>A	ENST00000368147.4	-	18	2722	c.2542C>T	c.(2542-2544)Cgc>Tgc	p.R848C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	848					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTTGAATGCGTGGTTCATGG	0.438																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2542-2544)CGC>TGC		spectrin, alpha, erythrocytic 1							251.0	245.0	247.0					1																	158631122		1939	4150	6089	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158631122G>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2542C>T	1.37:g.158631122G>A	ENSP00000357129:p.Arg848Cys		Somatic					p.R848C	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			18	2741	-	all_hematologic(112;0.0378)		848			Spectrin 9.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2542C>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908453	0.52333	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.55588	0.51;0.51	4.81	2.87	0.33458	.	.	.	.	.	T	0.62319	0.2418	M	0.85630	2.765	0.52501	D	0.999952	D	0.89917	1.0	D	0.70016	0.967	T	0.66724	-0.5851	9	0.87932	D	0	.	8.5192	0.33264	0.0821:0.0:0.7548:0.1631	.	848	P02549	SPTA1_HUMAN	C	848	ENSP00000357130:R848C;ENSP00000357129:R848C	ENSP00000357129:R848C	R	-	1	0	SPTA1	156897746	0.998000	0.40836	0.995000	0.50966	0.160000	0.22226	4.273000	0.58914	0.566000	0.29273	0.650000	0.86243	CGC		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		9	89	0	0	0	0.047766	0	9	89				
SLC26A9	115019	broad.mit.edu	37	1	205904909	205904909	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:205904909C>T	ENST00000367135.3	-	2	153	c.40G>A	c.(40-42)Gca>Aca	p.A14T	SLC26A9_ENST00000340781.4_Missense_Mutation_p.A14T|SLC26A9_ENST00000367134.2_Missense_Mutation_p.A14T|RP4-681L3.2_ENST00000421166.1_RNA	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	14					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.A14T(2)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGGGAGTATGCGGCTCTGTCT	0.557																																							uc001hdq.2		NA																	2	Substitution - Missense(2)		urinary_tract(2)	ovary(1)|skin(1)	2						c.(40-42)GCA>ACA		solute carrier family 26, member 9 isoform a							170.0	150.0	157.0					1																	205904909		2203	4300	6503	SO:0001583	missense	115019					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity	g.chr1:205904909C>T	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.40G>A	1.37:g.205904909C>T	ENSP00000356103:p.Ala14Thr		Somatic				SLC26A9_uc001hdp.2_Missense_Mutation_p.A14T	p.A14T	NM_052934	NP_443166	WXS	Illumina HiSeq	Unspecified	Q7LBE3	S26A9_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0458)		2	154	-	Breast(84;0.201)		14					A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	c.40G>A	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087152	0.55968	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92858	-3.12;-3.07;-3.12	5.21	4.29	0.51040	.	0.063706	0.64402	D	0.000012	D	0.83170	0.5196	L	0.31294	0.92	0.47905	D	0.999543	P;P	0.42248	0.774;0.774	B;B	0.24155	0.051;0.051	D	0.85496	0.1188	10	0.52906	T	0.07	.	12.8362	0.57775	0.0:0.9203:0.0:0.0797	.	14;14	Q7LBE3;B1AVM8	S26A9_HUMAN;.	T	14	ENSP00000341682:A14T;ENSP00000356103:A14T;ENSP00000356102:A14T	ENSP00000341682:A14T	A	-	1	0	SLC26A9	204171532	0.973000	0.33851	0.968000	0.41197	0.989000	0.77384	2.424000	0.44714	2.448000	0.82819	0.655000	0.94253	GCA		0.557	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934		5	72	0	0	0	0.021553	0	5	72				
OGDHL	55753	broad.mit.edu	37	10	50964886	50964886	+	Missense_Mutation	SNP	C	C	T	rs145127820	byFrequency	TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr10:50964886C>T	ENST00000374103.4	-	3	396	c.311G>A	c.(310-312)cGg>cAg	p.R104Q	OGDHL_ENST00000432695.1_Intron|OGDHL_ENST00000419399.1_Intron	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	104					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GGTCTTGGTCCGACTTGAGAC	0.612													c|||	4	0.000798722	0.0	0.0	5008	,	,		20627	0.004		0.0	False		,,,				2504	0.0						uc001jie.2		NA																	0				pancreas(1)	1						c.(310-312)CGG>CAG		oxoglutarate dehydrogenase-like isoform a							91.0	87.0	88.0					10																	50964886		2203	4300	6503	SO:0001583	missense	55753				glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr10:50964886C>T	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.311G>A	10.37:g.50964886C>T	ENSP00000363216:p.Arg104Gln		Somatic				OGDHL_uc009xog.2_Missense_Mutation_p.R131Q|OGDHL_uc010qgt.1_Intron|OGDHL_uc010qgu.1_Intron|OGDHL_uc009xoh.2_5'UTR	p.R104Q	NM_018245	NP_060715	WXS	Illumina HiSeq	Unspecified	Q9ULD0	OGDHL_HUMAN			3	453	-			104					A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	c.311G>A	CCDS7234.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	5.561	0.288428	0.10513	.	.	ENSG00000197444	ENST00000374103	T	0.40756	1.02	5.56	1.06	0.20224	.	0.864760	0.10167	N	0.707582	T	0.16342	0.0393	N	0.02708	-0.52	0.42755	D	0.99378	B	0.02656	0.0	B	0.01281	0.0	T	0.19910	-1.0291	10	0.09843	T	0.71	.	7.5943	0.28039	0.0:0.6166:0.1239:0.2596	.	104	Q9ULD0	OGDHL_HUMAN	Q	104	ENSP00000363216:R104Q	ENSP00000363216:R104Q	R	-	2	0	OGDHL	50634892	0.000000	0.05858	0.109000	0.21407	0.200000	0.23975	-0.098000	0.11024	0.301000	0.22738	-0.185000	0.12909	CGG		0.612	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245		8	57	0	0	0	0.058154	0	8	57				
UNC5B	219699	broad.mit.edu	37	10	73047465	73047465	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr10:73047465G>A	ENST00000335350.6	+	6	1260	c.844G>A	c.(844-846)Ggg>Agg	p.G282R	UNC5B_ENST00000373192.4_Missense_Mutation_p.G282R	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	282	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						ACTCAACGGAGGGGCCTTCTG	0.667																																							uc001jro.2		NA																	0				ovary(2)|lung(1)	3						c.(844-846)GGG>AGG		unc-5 homolog B precursor							68.0	65.0	66.0					10																	73047465		2203	4300	6503	SO:0001583	missense	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73047465G>A	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.844G>A	10.37:g.73047465G>A	ENSP00000334329:p.Gly282Arg		Somatic				UNC5B_uc001jrp.2_Missense_Mutation_p.G282R	p.G282R	NM_170744	NP_734465	WXS	Illumina HiSeq	Unspecified	Q8IZJ1	UNC5B_HUMAN			6	1289	+			282			TSP type-1 1.|Extracellular (Potential).		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	c.844G>A	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	g	32	5.107629	0.94292	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.23950	1.88;1.88	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.63850	0.2546	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76992	-0.2753	10	0.87932	D	0	-16.1415	17.6865	0.88257	0.0:0.0:1.0:0.0	.	282;282	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	R	282	ENSP00000334329:G282R;ENSP00000362288:G282R	ENSP00000334329:G282R	G	+	1	0	UNC5B	72717471	1.000000	0.71417	0.994000	0.49952	0.960000	0.62799	9.856000	0.99531	2.160000	0.67779	0.537000	0.68136	GGG		0.667	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		5	66	0	0	0	0.014758	0	5	66				
LCOR	84458	broad.mit.edu	37	10	98711952	98711952	+	Splice_Site	SNP	G	G	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr10:98711952G>C	ENST00000371097.4	+	7	877	c.331G>C	c.(331-333)Ggg>Cgg	p.G111R	LCOR_ENST00000371103.3_Splice_Site_p.G111R|LCOR_ENST00000540664.1_Splice_Site_p.G111R|LCOR_ENST00000356016.3_Splice_Site_p.G111R|LCOR_ENST00000498444.1_3'UTR			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	111					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		TCAAGGGAACGGGTAAGGGAG	0.438																																							uc009xvg.1		NA																	0				skin(2)	2						c.(331-333)GGT>CGT		hypothetical protein LOC26148							75.0	76.0	76.0					10																	98711952		2203	4300	6503	SO:0001630	splice_region_variant	26148							g.chr10:98711952G>C		CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.332+1G>C	10.37:g.98711952G>C			Somatic				LCOR_uc001kmr.2_Missense_Mutation_p.G111R|LCOR_uc001kms.1_Missense_Mutation_p.G111R|LCOR_uc001kmt.1_Missense_Mutation_p.G111R|LCOR_uc001kmu.1_Missense_Mutation_p.G111R	p.G111R	NM_015652	NP_056467	WXS	Illumina HiSeq	Unspecified	Q8N655	CJ012_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	7	852	+		Colorectal(252;0.172)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	ENST00000371097.4	37	c.331G>C	CCDS7451.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.899153	0.52227	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.97	5.97	0.96955	.	0.173314	0.49305	D	0.000156	T	0.37999	0.1024	N	0.19112	0.55	0.50313	D	0.999868	P;P	0.39391	0.542;0.671	B;B	0.25140	0.052;0.058	T	0.42515	-0.9447	9	0.72032	D	0.01	-2.6881	20.4324	0.99085	0.0:0.0:1.0:0.0	.	111;111	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	R	111	.	ENSP00000348298:G111R	G	+	1	0	LCOR	98701942	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.969000	0.70422	2.833000	0.97629	0.585000	0.79938	GGG		0.438	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2		Missense_Mutation	6	66	0	0	0	0.02938	0	6	66				
OR4C13	283092	broad.mit.edu	37	11	49974551	49974551	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:49974551C>T	ENST00000555099.1	+	1	609	c.577C>T	c.(577-579)Cta>Tta	p.L193L		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TACCCACACTCTAGGACTCTT	0.438																																							uc010rhz.1		NA																	0				skin(3)|ovary(1)	4						c.(577-579)CTA>TTA		olfactory receptor, family 4, subfamily C,							212.0	188.0	196.0					11																	49974551		2201	4296	6497	SO:0001819	synonymous_variant	283092				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:49974551C>T	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.577C>T	11.37:g.49974551C>T			Somatic					p.L193L	NM_001001955	NP_001001955	WXS	Illumina HiSeq	Unspecified	Q8NGP0	OR4CD_HUMAN			1	577	+			193			Extracellular (Potential).		A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	37	c.577C>T	CCDS31495.1																																																																																				0.438	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955		16	98	0	0	0	0.024245	0	16	98				
MTA2	9219	broad.mit.edu	37	11	62362837	62362837	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:62362837A>G	ENST00000278823.2	-	14	1771	c.1382T>C	c.(1381-1383)cTg>cCg	p.L461P	MTA2_ENST00000527204.1_Missense_Mutation_p.L288P|MTA2_ENST00000524902.1_Missense_Mutation_p.L288P	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	461					ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						AAGACGGGTCAGCTTTGTGGT	0.537																																							uc001ntq.1		NA																	0				ovary(1)|skin(1)	2						c.(1381-1383)CTG>CCG		metastasis-associated protein 2							162.0	143.0	150.0					11																	62362837		2202	4299	6501	SO:0001583	missense	9219				chromatin assembly or disassembly	NuRD complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr11:62362837A>G	AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.1382T>C	11.37:g.62362837A>G	ENSP00000278823:p.Leu461Pro		Somatic				MTA2_uc010rlx.1_Missense_Mutation_p.L288P	p.L461P	NM_004739	NP_004730	WXS	Illumina HiSeq	Unspecified	O94776	MTA2_HUMAN			14	1763	-			461					Q68DB1|Q9UQB5	Missense_Mutation	SNP	ENST00000278823.2	37	c.1382T>C	CCDS8022.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049186	0.75846	.	.	ENSG00000149480	ENST00000278823;ENST00000524902;ENST00000527204	T;T;T	0.54279	1.18;0.58;0.58	5.34	5.34	0.76211	.	0.150248	0.43747	D	0.000523	T	0.71813	0.3384	M	0.78049	2.395	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.75800	-0.3190	10	0.72032	D	0.01	-13.2809	13.2657	0.60133	1.0:0.0:0.0:0.0	.	461	O94776	MTA2_HUMAN	P	461;288;288	ENSP00000278823:L461P;ENSP00000431346:L288P;ENSP00000431797:L288P	ENSP00000278823:L461P	L	-	2	0	MTA2	62119413	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.006000	0.93592	2.020000	0.59435	0.533000	0.62120	CTG		0.537	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739		12	99	0	0	0	0.080935	0	12	99				
PYGM	5837	broad.mit.edu	37	11	64521112	64521112	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:64521112G>A	ENST00000164139.3	-	11	1680	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C	PYGM_ENST00000377432.3_Missense_Mutation_p.R340C|PYGM_ENST00000462303.1_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	428					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGCGACATGCGCCGCAGCCGG	0.687																																							uc001oax.3		NA																	0				ovary(2)	2	GRCh37	CM063084	PYGM	M		c.(1282-1284)CGC>TGC		muscle glycogen phosphorylase isoform 1	Pyridoxal Phosphate(DB00114)						28.0	22.0	24.0					11																	64521112		2196	4293	6489	SO:0001583	missense	5837				glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding	g.chr11:64521112G>A		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1282C>T	11.37:g.64521112G>A	ENSP00000164139:p.Arg428Cys		Somatic				PYGM_uc001oay.3_Missense_Mutation_p.R340C	p.R428C	NM_005609	NP_005600	WXS	Illumina HiSeq	Unspecified	P11217	PYGM_HUMAN			11	2099	-			428					A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	c.1282C>T	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049898	0.75846	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.94184	-3.24;-3.37	4.88	4.88	0.63580	.	0.097532	0.46442	D	0.000286	D	0.97266	0.9106	H	0.96398	3.815	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.66084	0.941;0.868	D	0.97504	1.0062	10	0.72032	D	0.01	-20.315	10.5878	0.45292	0.0:0.0:0.8079:0.1921	.	340;428	A6NDY6;P11217	.;PYGM_HUMAN	C	340;428;409	ENSP00000366650:R340C;ENSP00000164139:R428C	ENSP00000164139:R428C	R	-	1	0	PYGM	64277688	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	2.852000	0.48310	2.529000	0.85273	0.511000	0.50034	CGC		0.687	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609		4	14	0	0	0	0.014758	0	4	14				
TSGA10IP	254187	broad.mit.edu	37	11	65714930	65714930	+	RNA	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:65714930G>A	ENST00000532620.1	+	0	865				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						ATCGGCGTCCGACAAGCAGGT	0.662																																							uc001ogk.1		NA																	0					0						c.(634-636)GAC>AAC		testis specific, 10 interacting protein							27.0	33.0	31.0					11																	65714930		1943	4133	6076			254187							g.chr11:65714930G>A	AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65714930G>A			Somatic				TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_Intron	p.D212N	NM_152762	NP_689975	WXS	Illumina HiSeq	Unspecified	Q3SY00	T10IP_HUMAN			5	666	+			212					Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	ENST00000532620.1	37	c.634G>A																																																																																					0.662	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2	NM_152762		5	31	0	0	0	0.021553	0	5	31				
TESPA1	9840	broad.mit.edu	37	12	55368298	55368298	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr12:55368298A>G	ENST00000449076.1	-	2	181	c.49T>C	c.(49-51)Tgg>Cgg	p.W17R	TESPA1_ENST00000524959.1_5'Flank|TESPA1_ENST00000532804.1_5'Flank|TESPA1_ENST00000524622.1_5'Flank|TESPA1_ENST00000316577.8_Missense_Mutation_p.W17R|TESPA1_ENST00000531122.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	17					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											TGACGGAGCCAGGCCCGCCGT	0.632																																							uc001sgn.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(49-51)TGG>CGG		hypothetical protein LOC9840							16.0	18.0	18.0					12																	55368298		1910	4114	6024	SO:0001583	missense	9840							g.chr12:55368298A>G	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.49T>C	12.37:g.55368298A>G	ENSP00000400892:p.Trp17Arg		Somatic				KIAA0748_uc001sgl.3_5'Flank|KIAA0748_uc001sgm.3_5'Flank|KIAA0748_uc010spb.1_5'Flank|KIAA0748_uc010spc.1_5'Flank|KIAA0748_uc010spd.1_Missense_Mutation_p.W17R|KIAA0748_uc001sgo.3_RNA	p.W17R	NM_001098815	NP_001092285	WXS	Illumina HiSeq	Unspecified	A2RU30	K0748_HUMAN			2	159	-			17					B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	ENST00000449076.1	37	c.49T>C	CCDS44913.1	.	.	.	.	.	.	.	.	.	.	A	15.55	2.866355	0.51588	.	.	ENSG00000135426	ENST00000449076;ENST00000316577;ENST00000524668;ENST00000533607	T;T	0.76060	-0.99;-0.99	5.24	5.24	0.73138	.	.	.	.	.	T	0.82254	0.4997	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83859	0.0267	9	0.87932	D	0	.	11.85	0.52405	1.0:0.0:0.0:0.0	.	17	A2RU30	K0748_HUMAN	R	17	ENSP00000400892:W17R;ENSP00000312679:W17R	ENSP00000312679:W17R	W	-	1	0	KIAA0748	53654565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.355000	0.52262	2.114000	0.64651	0.533000	0.62120	TGG		0.632	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815		4	9	0	0	0	0.009096	0	4	9				
NAV3	89795	broad.mit.edu	37	12	78513568	78513568	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr12:78513568G>T	ENST00000397909.2	+	15	3765	c.3592G>T	c.(3592-3594)Gac>Tac	p.D1198Y	NAV3_ENST00000228327.6_Missense_Mutation_p.D1198Y|NAV3_ENST00000266692.7_Missense_Mutation_p.D1198Y|NAV3_ENST00000536525.2_Missense_Mutation_p.D1198Y			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1198	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAACCAAACAGACAAGGAAAA	0.527										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(3592-3594)GAC>TAC		neuron navigator 3							83.0	87.0	86.0					12																	78513568		1921	4130	6051	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78513568G>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3592G>T	12.37:g.78513568G>T	ENSP00000381007:p.Asp1198Tyr	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.D1198Y|NAV3_uc010sub.1_Missense_Mutation_p.D698Y|NAV3_uc009zsf.2_Missense_Mutation_p.D206Y	p.D1198Y	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			15	3765	+			1198			Ser-rich.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.3592G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.450367|4.450367	0.84101|0.84101	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.61627|.	0.45;0.49;0.46;0.09|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.41823|.	U|.	0.000803|.	T|T	0.78259|0.78259	0.4255|0.4255	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.999;0.999;0.999|.	T|T	0.77670|0.77670	-0.2501|-0.2501	10|5	0.87932|.	D|.	0|.	-20.5068|-20.5068	19.5083|19.5083	0.95130|0.95130	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1198;1198;1198;1198|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	Y|I	1198|269	ENSP00000446132:D1198Y;ENSP00000381007:D1198Y;ENSP00000228327:D1198Y;ENSP00000266692:D1198Y|.	ENSP00000228327:D1198Y|.	D|R	+|+	1|2	0|0	NAV3|NAV3	77037699|77037699	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.993000|0.993000	0.82548|0.82548	9.526000|9.526000	0.98042|0.98042	2.600000|2.600000	0.87896|0.87896	0.655000|0.655000	0.94253|0.94253	GAC|AGA		0.527	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		6	58	1	0	0.00116845	0.021553	0.00154323	6	58				
HECTD4	283450	broad.mit.edu	37	12	112600844	112600844	+	Splice_Site	SNP	A	A	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr12:112600844A>C	ENST00000430131.2	-	74	13000		c.e74+1		HECTD4_ENST00000550722.1_Splice_Site|HECTD4_ENST00000377560.5_Splice_Site|HECTD4_ENST00000549141.1_5'Flank			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4						glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGAGGGCGGTACCTGCTGTGC	0.617																																							uc009zwc.2		NA																	0				ovary(1)|lung(1)	2						c.e68+1		chromosome 12 open reading frame 51							63.0	68.0	66.0					12																	112600844		1997	4149	6146	SO:0001630	splice_region_variant	283450							g.chr12:112600844A>C	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11854+1T>G	12.37:g.112600844A>C			Somatic					p.G3952_splice	NM_001109662	NP_001103132	WXS	Illumina HiSeq	Unspecified					68	11872	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Splice_Site	SNP	ENST00000430131.2	37	c.11854_splice		.	.	.	.	.	.	.	.	.	.	A	18.03	3.532537	0.64972	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	.	.	.	5.68	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2456	0.54568	0.8726:0.0:0.0:0.1273	.	.	.	.	.	-1	.	.	.	-	.	.	C12orf51	111085227	1.000000	0.71417	0.997000	0.53966	0.917000	0.54804	7.044000	0.76578	0.982000	0.38575	0.459000	0.35465	.		0.617	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	Intron	5	87	0	0	0	0.021553	0	5	87				
RHOT2	89941	broad.mit.edu	37	16	721945	721945	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:721945G>C	ENST00000315082.4	+	13	1154	c.1040G>C	c.(1039-1041)cGc>cCc	p.R347P		NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2	347					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				GAGCTCCCACGCACAGTCCGC	0.697																																							uc002cip.2		NA																	0				pancreas(1)	1						c.(1039-1041)CGC>CCC		ras homolog gene family, member T2							50.0	61.0	57.0					16																	721945		2200	4296	6496	SO:0001583	missense	89941				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding	g.chr16:721945G>C	BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.1040G>C	16.37:g.721945G>C	ENSP00000321971:p.Arg347Pro		Somatic				RHOT2_uc002ciq.2_Missense_Mutation_p.R240P|RHOT2_uc010bqy.2_Missense_Mutation_p.R126P	p.R347P	NM_138769	NP_620124	WXS	Illumina HiSeq	Unspecified	Q8IXI1	MIRO2_HUMAN			13	1107	+		Hepatocellular(780;0.0218)	347			Mitochondrial intermembrane (Potential).		A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	Missense_Mutation	SNP	ENST00000315082.4	37	c.1040G>C	CCDS10417.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022006	0.35701	.	.	ENSG00000140983	ENST00000315082	T	0.08458	3.09	5.31	-5.75	0.02384	EF hand associated, type-1 (1);	1.721060	0.02411	N	0.081628	T	0.08088	0.0202	L	0.27053	0.805	0.09310	N	1	B	0.31680	0.335	B	0.39094	0.29	T	0.34900	-0.9810	10	0.35671	T	0.21	-8.2106	8.8365	0.35115	0.5475:0.0:0.3539:0.0985	.	347	Q8IXI1	MIRO2_HUMAN	P	347	ENSP00000321971:R347P	ENSP00000321971:R347P	R	+	2	0	RHOT2	661946	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.948000	0.03897	-0.924000	0.03780	0.456000	0.33151	CGC		0.697	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241617.1	NM_138769		8	84	0	0	0	0.038147	0	8	84				
ZNF200	7752	broad.mit.edu	37	16	3274335	3274335	+	Silent	SNP	T	T	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:3274335T>G	ENST00000431561.3	-	5	1357	c.745A>C	c.(745-747)Agg>Cgg	p.R249R	ZNF200_ENST00000575948.1_Silent_p.R248R|ZNF200_ENST00000396871.4_Silent_p.R248R|ZNF200_ENST00000414144.2_Silent_p.R249R|ZNF200_ENST00000396870.4_Silent_p.R248R|AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000396868.3_Silent_p.R248R	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						TACCATCTCCTTGTCCTCCGA	0.418																																							uc002cuj.2		NA																	0					0						c.(745-747)AGG>CGG		zinc finger protein 200 isoform 1							124.0	115.0	118.0					16																	3274335		2197	4300	6497	SO:0001819	synonymous_variant	7752				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr16:3274335T>G	AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.745A>C	16.37:g.3274335T>G			Somatic				ZNF200_uc002cum.3_Silent_p.R248R|ZNF200_uc010bti.2_Silent_p.R248R|ZNF200_uc002cuk.2_Silent_p.R249R|ZNF200_uc002cui.2_Silent_p.R248R|ZNF200_uc002cul.3_Silent_p.R248R	p.R249R	NM_003454	NP_003445	WXS	Illumina HiSeq	Unspecified	P98182	ZN200_HUMAN			5	1377	-			249					D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Silent	SNP	ENST00000431561.3	37	c.745A>C	CCDS10497.1																																																																																				0.418	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1			7	65	0	0	0	0.02938	0	7	65				
ADCY9	115	broad.mit.edu	37	16	4165247	4165247	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:4165247C>T	ENST00000294016.3	-	2	735	c.197G>A	c.(196-198)cGa>cAa	p.R66Q		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	66					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GCCGCCCACTCGCCGGGGGAC	0.667																																							uc002cvx.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)	6						c.(196-198)CGA>CAA		adenylate cyclase 9							36.0	33.0	34.0					16																	4165247		2197	4300	6497	SO:0001583	missense	115				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	g.chr16:4165247C>T	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.197G>A	16.37:g.4165247C>T	ENSP00000294016:p.Arg66Gln		Somatic					p.R66Q	NM_001116	NP_001107	WXS	Illumina HiSeq	Unspecified	O60503	ADCY9_HUMAN			2	736	-			66			Cytoplasmic (Potential).		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	c.197G>A	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	C	9.587	1.125188	0.20959	.	.	ENSG00000162104	ENST00000294016	T	0.27557	1.66	5.04	2.89	0.33648	.	0.292228	0.27210	N	0.020417	T	0.15739	0.0379	N	0.22421	0.69	0.09310	N	1	B	0.23650	0.089	B	0.09377	0.004	T	0.11036	-1.0604	10	0.30854	T	0.27	.	4.4972	0.11842	0.148:0.4828:0.2878:0.0813	.	66	O60503	ADCY9_HUMAN	Q	66	ENSP00000294016:R66Q	ENSP00000294016:R66Q	R	-	2	0	ADCY9	4105248	0.103000	0.21917	0.517000	0.27799	0.887000	0.51463	3.118000	0.50414	1.094000	0.41399	0.456000	0.33151	CGA		0.667	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			5	26	0	0	0	0.014758	0	5	26				
SLC12A3	6559	broad.mit.edu	37	16	56904081	56904081	+	Silent	SNP	C	C	T	rs369387970		TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:56904081C>T	ENST00000563236.1	+	5	700	c.675C>T	c.(673-675)ttC>ttT	p.F225F	SLC12A3_ENST00000566786.1_Silent_p.F224F|SLC12A3_ENST00000438926.2_Silent_p.F225F|SLC12A3_ENST00000262502.5_Silent_p.F224F			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	225					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTTTCGCTTTCGCCAATGCCG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		19036	0.0		0.0	False		,,,				2504	0.001						uc010ccm.2		NA																	0				ovary(2)|breast(1)	3						c.(673-675)TTC>TTT		solute carrier family 12, member 3 isoform 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	C	,,	0,4396		0,0,2198	66.0	65.0	65.0		675,672,675	-10.8	0.0	16		65	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC12A3	NM_000339.2,NM_001126107.1,NM_001126108.1	,,	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	,,	225/1031,224/1030,225/1022	56904081	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	6559				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity	g.chr16:56904081C>T		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.675C>T	16.37:g.56904081C>T			Somatic				SLC12A3_uc002ekd.3_Silent_p.F225F|SLC12A3_uc010ccn.2_Silent_p.F224F	p.F225F	NM_001126108	NP_001119580	WXS	Illumina HiSeq	Unspecified	P55017	S12A3_HUMAN			5	704	+			225			Helical; (Potential).		A8MSJ2|C9JNN9	Silent	SNP	ENST00000563236.1	37	c.675C>T	CCDS58464.1																																																																																				0.647	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1			6	87	0	0	0	0.02938	0	6	87				
SUPT6H	6830	broad.mit.edu	37	17	27003436	27003436	+	Silent	SNP	T	T	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr17:27003436T>G	ENST00000314616.6	+	7	1168	c.885T>G	c.(883-885)ccT>ccG	p.P295P	SUPT6H_ENST00000347486.4_Silent_p.P295P	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	295	Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CTGACCTGCCTGAGAGGTTCC	0.463																																							uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(883-885)CCT>CCG		suppressor of Ty 6 homolog							57.0	57.0	57.0					17																	27003436		2203	4299	6502	SO:0001819	synonymous_variant	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27003436T>G	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.885T>G	17.37:g.27003436T>G			Somatic				SUPT6H_uc010crt.2_Silent_p.P295P	p.P295P	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			7	975	+	Lung NSC(42;0.00431)		295					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	c.885T>G	CCDS32596.1																																																																																				0.463	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		5	71	0	0	0	0.021553	0	5	71				
RAB11FIP4	84440	broad.mit.edu	37	17	29848989	29848989	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr17:29848989T>A	ENST00000325874.8	+	6	1044	c.815T>A	c.(814-816)gTt>gAt	p.V272D	RAB11FIP4_ENST00000394744.2_Missense_Mutation_p.V170D	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	272	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				TTGCTAGATGTTTACTGCTCT	0.522																																							uc002hgn.1		NA																	0				skin(1)	1						c.(814-816)GTT>GAT		RAB11 family interacting protein 4 (class II)							119.0	113.0	115.0					17																	29848989		2203	4300	6503	SO:0001583	missense	84440				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding	g.chr17:29848989T>A	AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.815T>A	17.37:g.29848989T>A	ENSP00000312837:p.Val272Asp		Somatic				RAB11FIP4_uc002hgo.2_Missense_Mutation_p.V170D	p.V272D	NM_032932	NP_116321	WXS	Illumina HiSeq	Unspecified	Q86YS3	RFIP4_HUMAN			6	1044	+		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)	272			Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.		Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	ENST00000325874.8	37	c.815T>A	CCDS11267.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.880122	0.72294	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.67050	0.2852	L	0.51422	1.61	0.80722	D	1	D;D	0.64830	0.991;0.994	P;P	0.62560	0.904;0.832	T	0.66308	-0.5956	8	.	.	.	-28.0258	12.6792	0.56912	0.0:0.0:0.0:1.0	.	170;272	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	D	272	.	.	V	+	2	0	RAB11FIP4	26873109	1.000000	0.71417	0.684000	0.30055	0.302000	0.27658	7.366000	0.79548	2.235000	0.73313	0.533000	0.62120	GTT		0.522	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932		9	62	0	0	0	0.047766	0	9	62				
EPB41L3	23136	broad.mit.edu	37	18	5433980	5433980	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr18:5433980T>C	ENST00000341928.2	-	7	1086	c.746A>G	c.(745-747)tAc>tGc	p.Y249C	EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000544123.1_Missense_Mutation_p.Y249C|EPB41L3_ENST00000342933.3_Missense_Mutation_p.Y249C|EPB41L3_ENST00000400111.3_Missense_Mutation_p.Y249C|EPB41L3_ENST00000540638.2_Missense_Mutation_p.Y249C	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	249	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CTCACTAATGTAATCGCTCCC	0.517																																							uc002kmt.1		NA																	0				ovary(5)	5						c.(745-747)TAC>TGC		erythrocyte membrane protein band 4.1-like 3							270.0	238.0	249.0					18																	5433980		2203	4300	6503	SO:0001583	missense	23136				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity	g.chr18:5433980T>C	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.746A>G	18.37:g.5433980T>C	ENSP00000343158:p.Tyr249Cys		Somatic				EPB41L3_uc010wzh.1_Missense_Mutation_p.Y249C|EPB41L3_uc002kmu.1_Missense_Mutation_p.Y249C|EPB41L3_uc010dkq.1_Missense_Mutation_p.Y140C|EPB41L3_uc010dks.1_Missense_Mutation_p.Y271C|EPB41L3_uc002kmv.1_Missense_Mutation_p.Y140C	p.Y249C	NM_012307	NP_036439	WXS	Illumina HiSeq	Unspecified	Q9Y2J2	E41L3_HUMAN			7	832	-			249			FERM.		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	c.746A>G	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.293641	0.80914	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	6.16	6.16	0.99307	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.051501	0.85682	D	0.000000	D	0.90287	0.6962	H	0.95004	3.61	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.982;0.999;0.998;0.998	D	0.92705	0.6178	10	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	249;249;140;249;249	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	C	249;140;249;140;249;249	ENSP00000343158:Y249C;ENSP00000441174:Y249C;ENSP00000341138:Y249C;ENSP00000382981:Y249C	ENSP00000343158:Y249C	Y	-	2	0	EPB41L3	5423980	1.000000	0.71417	0.997000	0.53966	0.808000	0.45660	8.040000	0.89188	2.367000	0.80283	0.528000	0.53228	TAC		0.517	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307		13	119	0	0	0	0.028581	0	13	119				
ROCK1	6093	broad.mit.edu	37	18	18650556	18650556	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr18:18650556C>A	ENST00000399799.2	-	2	1052	c.112G>T	c.(112-114)Gta>Tta	p.V38L		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	38					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					AAATCATATACCAAAGCATCC	0.294																																							uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(112-114)GTA>TTA		Rho-associated, coiled-coil containing protein							49.0	47.0	48.0					18																	18650556		2203	4289	6492	SO:0001583	missense	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18650556C>A		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.112G>T	18.37:g.18650556C>A	ENSP00000382697:p.Val38Leu		Somatic					p.V38L	NM_005406	NP_005397	WXS	Illumina HiSeq	Unspecified	Q13464	ROCK1_HUMAN			2	1053	-	Melanoma(1;0.165)		38					B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	c.112G>T	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848585	0.91277	.	.	ENSG00000067900	ENST00000399799	T	0.67171	-0.25	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	M	0.80616	2.505	0.80722	D	1	P	0.39883	0.693	P	0.44561	0.453	T	0.77313	-0.2634	10	0.49607	T	0.09	.	17.8763	0.88826	0.0:1.0:0.0:0.0	.	38	Q13464	ROCK1_HUMAN	L	38	ENSP00000382697:V38L	ENSP00000382697:V38L	V	-	1	0	ROCK1	16904554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.250000	0.65432	2.510000	0.84645	0.561000	0.74099	GTA		0.294	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		4	19	1	0	0.000602214	0.014758	0.000810673	4	19				
DIRAS1	148252	broad.mit.edu	37	19	2717373	2717373	+	Silent	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:2717373G>A	ENST00000323469.4	-	2	615	c.432C>T	c.(430-432)tgC>tgT	p.C144C	DIRAS1_ENST00000585334.1_Silent_p.C144C	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	144					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCATGAAAGCGCACTTCCACT	0.622																																							uc002lwf.3		NA																	0				ovary(1)	1						c.(430-432)TGC>TGT		DIRAS family, GTP-binding RAS-like 1							105.0	92.0	97.0					19																	2717373		2203	4300	6503	SO:0001819	synonymous_variant	148252				small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity	g.chr19:2717373G>A	BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.432C>T	19.37:g.2717373G>A			Somatic					p.C144C	NM_145173	NP_660156	WXS	Illumina HiSeq	Unspecified	O95057	DIRA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	590	-			144						Silent	SNP	ENST00000323469.4	37	c.432C>T	CCDS12092.1																																																																																				0.622	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451350.1			13	90	0	0	0	0.105934	0	13	90				
MUC16	94025	broad.mit.edu	37	19	9008336	9008336	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:9008336C>T	ENST00000397910.4	-	41	39419	c.39216G>A	c.(39214-39216)aaG>aaA	p.K13072K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13074	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCCCCATCCTTCTCAGACC	0.557																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(39214-39216)AAG>AAA		mucin 16							95.0	86.0	89.0					19																	9008336		1921	4144	6065	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9008336C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39216G>A	19.37:g.9008336C>T			Somatic				MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	p.K13072K	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			41	39420	-			13074			Extracellular (Potential).|SEA 7.		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.39216G>A	CCDS54212.1																																																																																				0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		12	123	0	0	0	0.080935	0	12	123				
RYR1	6261	broad.mit.edu	37	19	38933075	38933075	+	Silent	SNP	G	G	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:38933075G>C	ENST00000359596.3	+	3	252	c.252G>C	c.(250-252)acG>acC	p.T84T	RYR1_ENST00000360985.3_Silent_p.T84T|RYR1_ENST00000355481.4_Silent_p.T84T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	84					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGGCTAACACGGTGGAGGCTG	0.667																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(250-252)ACG>ACC		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						50.0	43.0	45.0					19																	38933075		2203	4300	6503	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38933075G>C	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.252G>C	19.37:g.38933075G>C			Somatic				RYR1_uc002oiu.2_Silent_p.T84T	p.T84T	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		3	382	+	all_cancers(60;7.91e-06)		84			Cytoplasmic.		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.252G>C	CCDS33011.1																																																																																				0.667	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			4	54	0	0	0	0.009096	0	4	54				
RYR1	6261	broad.mit.edu	37	19	38976776	38976776	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:38976776C>T	ENST00000359596.3	+	34	5481	c.5481C>T	c.(5479-5481)cgC>cgT	p.R1827R	RYR1_ENST00000360985.3_Silent_p.R1827R|RYR1_ENST00000355481.4_Silent_p.R1827R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1827	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R1827R(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGCACGCTCGCGACCCCGTCG	0.682																																							uc002oit.2		NA																	1	Substitution - coding silent(1)	p.R1827H(1)	large_intestine(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(5479-5481)CGC>CGT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						84.0	83.0	83.0					19																	38976776		2191	4287	6478	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38976776C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5481C>T	19.37:g.38976776C>T			Somatic				RYR1_uc002oiu.2_Silent_p.R1827R	p.R1827R	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		34	5611	+	all_cancers(60;7.91e-06)		1827			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.5481C>T	CCDS33011.1																																																																																				0.682	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			24	154	0	0	0	0.069288	0	24	154				
PLA2G4C	8605	broad.mit.edu	37	19	48558162	48558162	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:48558162G>A	ENST00000599921.1	-	15	1759	c.1402C>T	c.(1402-1404)Ccc>Tcc	p.P468S	PLA2G4C_ENST00000354276.3_Missense_Mutation_p.P468S|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.P478S|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000413144.2_Missense_Mutation_p.P468S			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	468	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)	p.P468T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		TTGAACAGGGGAAAATGCATC	0.517																																							uc002phx.2		NA																	1	Substitution - Missense(1)		central_nervous_system(1)	ovary(1)|skin(1)	2						c.(1402-1404)CCC>TCC		phospholipase A2, group IVC isoform 1 precursor							112.0	104.0	107.0					19																	48558162		2203	4300	6503	SO:0001583	missense	8605				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding	g.chr19:48558162G>A	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1402C>T	19.37:g.48558162G>A	ENSP00000469473:p.Pro468Ser		Somatic				PLA2G4C_uc002phv.2_RNA|PLA2G4C_uc002phw.2_Missense_Mutation_p.P403S|PLA2G4C_uc010elr.2_Missense_Mutation_p.P468S|PLA2G4C_uc010xzd.1_Missense_Mutation_p.P478S	p.P468S	NM_003706	NP_003697	WXS	Illumina HiSeq	Unspecified	Q9UP65	PA24C_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)	15	1800	-		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)	468			PLA2c.		B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	c.1402C>T	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235052	0.79800	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.18657	2.2;2.2	3.19	0.759	0.18438	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.081323	0.49916	U	0.000127	T	0.39226	0.1070	M	0.77616	2.38	0.25071	N	0.990995	D;D	0.76494	0.999;0.992	D;P	0.72625	0.978;0.782	T	0.14282	-1.0478	10	0.66056	D	0.02	-8.1773	5.8785	0.18842	0.0:0.2128:0.5685:0.2187	.	478;468	B4DI40;Q9UP65	.;PA24C_HUMAN	S	468	ENSP00000346228:P468S;ENSP00000400036:P468S	ENSP00000346228:P468S	P	-	1	0	PLA2G4C	53249974	0.991000	0.36638	0.865000	0.33974	0.925000	0.55904	1.099000	0.31013	-0.009000	0.14296	0.411000	0.27672	CCC		0.517	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1			10	83	0	0	0	0.069234	0	10	83				
AP2A1	160	broad.mit.edu	37	19	50306626	50306626	+	Silent	SNP	C	C	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:50306626C>G	ENST00000359032.5	+	19	2403	c.2403C>G	c.(2401-2403)ctC>ctG	p.L801L	AP2A1_ENST00000354293.5_Silent_p.L779L	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	801					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CGGGAGACCTCCAGACTCATA	0.607																																							uc002ppn.2		NA																	0				ovary(2)	2						c.(2401-2403)CTC>CTG		adaptor-related protein complex 2, alpha 1							78.0	83.0	81.0					19																	50306626		2000	4157	6157	SO:0001819	synonymous_variant	160				axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity	g.chr19:50306626C>G	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.2403C>G	19.37:g.50306626C>G			Somatic				AP2A1_uc010enj.1_RNA|AP2A1_uc002ppo.2_Silent_p.L779L|AP2A1_uc002ppp.1_3'UTR|AP2A1_uc010enk.2_5'Flank	p.L801L	NM_014203	NP_055018	WXS	Illumina HiSeq	Unspecified	O95782	AP2A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)	19	2614	+		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	801					Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	37	c.2403C>G	CCDS46148.1																																																																																				0.607	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1			6	24	0	0	0	0.038147	0	6	24				
NLRP13	126204	broad.mit.edu	37	19	56443372	56443372	+	Silent	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:56443372T>C	ENST00000342929.3	-	1	305	c.306A>G	c.(304-306)agA>agG	p.R102R	NLRP13_ENST00000588751.1_Silent_p.R102R	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	102	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TCATCTCGGCTCTAACTTTCT	0.517																																							uc010ygg.1		NA																	0				skin(4)|ovary(3)|pancreas(1)|lung(1)	9						c.(304-306)AGA>AGG		NACHT, leucine rich repeat and PYD containing							54.0	47.0	49.0					19																	56443372		2203	4300	6503	SO:0001819	synonymous_variant	126204						ATP binding	g.chr19:56443372T>C	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.306A>G	19.37:g.56443372T>C			Somatic					p.R102R	NM_176810	NP_789780	WXS	Illumina HiSeq	Unspecified	Q86W25	NAL13_HUMAN		GBM - Glioblastoma multiforme(193;0.0642)	1	331	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	102			DAPIN.		Q7RTR5	Silent	SNP	ENST00000342929.3	37	c.306A>G	CCDS33119.1																																																																																				0.517	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		8	33	0	0	0	0.047766	0	8	33				
ST6GAL2	84620	broad.mit.edu	37	2	107423242	107423242	+	Silent	SNP	G	G	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr2:107423242G>T	ENST00000409382.3	-	6	2092	c.1482C>A	c.(1480-1482)cgC>cgA	p.R494R	ST6GAL2_ENST00000361686.4_Silent_p.R494R	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	494					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CCATGTTCAGGCGCTGCACCA	0.622																																							uc002tdq.2		NA																	0				pancreas(6)|ovary(4)|skin(1)	11						c.(1480-1482)CGC>CGA		ST6 beta-galactosamide							95.0	82.0	86.0					2																	107423242		2203	4300	6503	SO:0001819	synonymous_variant	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107423242G>T	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1482C>A	2.37:g.107423242G>T			Somatic				ST6GAL2_uc002tdr.2_Silent_p.R494R	p.R494R	NM_001142351	NP_001135823	WXS	Illumina HiSeq	Unspecified	Q96JF0	SIAT2_HUMAN			6	1601	-			494			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	37	c.1482C>A	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428780	0.25726	.	.	ENSG00000144057	ENST00000361803	.	.	.	5.8	-2.25	0.06888	.	.	.	.	.	T	0.57257	0.2041	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55088	-0.8195	4	.	.	.	-40.0616	11.4393	0.50088	0.2195:0.6134:0.1671:0.0	.	.	.	.	T	60	.	.	P	-	1	0	ST6GAL2	106789674	0.786000	0.28738	0.982000	0.44146	0.932000	0.56968	-0.098000	0.11024	-0.377000	0.07930	-0.136000	0.14681	CCT		0.622	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		7	84	1	0	8.12818e-05	0.02938	0.000113795	7	84				
SCN3A	6328	broad.mit.edu	37	2	165984435	165984435	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr2:165984435C>T	ENST00000360093.3	-	18	3590	c.3099G>A	c.(3097-3099)aaG>aaA	p.K1033K	SCN3A_ENST00000409101.3_Silent_p.K984K|SCN3A_ENST00000283254.7_Silent_p.K1033K	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1033					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAACTTTTGGCTTTCTAAAAA	0.333																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(3097-3099)AAG>AAA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						86.0	90.0	89.0					2																	165984435		2203	4300	6503	SO:0001819	synonymous_variant	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165984435C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3099G>A	2.37:g.165984435C>T			Somatic				SCN3A_uc002ucy.2_Silent_p.K984K|SCN3A_uc002ucz.2_Silent_p.K984K|SCN3A_uc002uda.1_Silent_p.K853K|SCN3A_uc002udb.1_Silent_p.K853K	p.K1033K	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			18	3591	-			1033					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37	c.3099G>A																																																																																					0.333	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		4	60	0	0	0	0.009096	0	4	60				
TTN	7273	broad.mit.edu	37	2	179397281	179397281	+	Silent	SNP	A	A	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr2:179397281A>T	ENST00000591111.1	-	308	99362	c.99138T>A	c.(99136-99138)ctT>ctA	p.L33046L	TTN_ENST00000589042.1_Silent_p.L34687L|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN_ENST00000342992.6_Silent_p.L32119L|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.L25747L|TTN-AS1_ENST00000589391.1_RNA|TTN_ENST00000460472.2_Silent_p.L25622L|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.L25814L|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33046					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACCTAACTCAAGCTCTTCTT	0.473																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(96355-96357)CTT>CTA		titin isoform N2-A							118.0	114.0	115.0					2																	179397281		1897	4129	6026	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179397281A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.99138T>A	2.37:g.179397281A>T			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L25814L|TTN_uc010zfi.1_Silent_p.L25747L|TTN_uc010zfj.1_Silent_p.L25622L	p.L32119L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	96581	-			33046					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.96357T>A																																																																																					0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	91	0	0	0	0.058154	0	10	91				
SAMHD1	25939	broad.mit.edu	37	20	35533856	35533856	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr20:35533856C>T	ENST00000262878.4	-	12	1520	c.1321G>A	c.(1321-1323)Gca>Aca	p.A441T		NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	441					dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				ATCTCTCGTGCGTCTTTCAAT	0.318																																							uc002xgh.1		NA																	0					0						c.(1321-1323)GCA>ACA		SAM domain- and HD domain-containing protein 1							127.0	124.0	125.0					20																	35533856		2203	4300	6503	SO:0001583	missense	25939				defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity	g.chr20:35533856C>T	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.1321G>A	20.37:g.35533856C>T	ENSP00000262878:p.Ala441Thr		Somatic				SAMHD1_uc010gft.1_RNA	p.A441T	NM_015474	NP_056289	WXS	Illumina HiSeq	Unspecified	Q9Y3Z3	SAMH1_HUMAN			12	1451	-		Myeloproliferative disorder(115;0.00878)	441					B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	37	c.1321G>A	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275844	0.59649	.	.	ENSG00000101347	ENST00000262878	D	0.95656	-3.77	5.29	4.32	0.51571	.	0.048303	0.85682	D	0.000000	D	0.97980	0.9335	M	0.92219	3.285	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	D	0.99013	1.0815	10	0.87932	D	0	-13.3177	14.8521	0.70306	0.145:0.855:0.0:0.0	.	441	Q9Y3Z3	SAMH1_HUMAN	T	441	ENSP00000262878:A441T	ENSP00000262878:A441T	A	-	1	0	SAMHD1	34967270	0.998000	0.40836	0.021000	0.16686	0.172000	0.22775	4.382000	0.59594	1.426000	0.47256	0.462000	0.41574	GCA		0.318	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474		6	61	0	0	0	0.021553	0	6	61				
KRTAP24-1	643803	broad.mit.edu	37	21	31655071	31655071	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr21:31655071G>T	ENST00000340345.4	-	1	205	c.180C>A	c.(178-180)taC>taA	p.Y60*		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	60						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						ATTCTTGGCAGTAATCCAGGA	0.512																																							uc002ynv.2		NA																	0					0						c.(178-180)TAC>TAA		keratin associated protein 24-1							90.0	91.0	91.0					21																	31655071		1966	4171	6137	SO:0001587	stop_gained	643803					keratin filament	structural molecule activity	g.chr21:31655071G>T	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.180C>A	21.37:g.31655071G>T	ENSP00000339238:p.Tyr60*		Somatic					p.Y60*	NM_001085455	NP_001078924	WXS	Illumina HiSeq	Unspecified	Q3LI83	KR241_HUMAN			1	206	-			60					Q1XDX0	Nonsense_Mutation	SNP	ENST00000340345.4	37	c.180C>A	CCDS42915.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500329	0.85176	.	.	ENSG00000188694	ENST00000340345	.	.	.	4.96	-0.172	0.13327	.	1.200940	0.06065	N	0.659072	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-2.0295	4.1707	0.10327	0.3532:0.0:0.4937:0.1531	.	.	.	.	X	60	.	ENSP00000339238:Y60X	Y	-	3	2	KRTAP24-1	30576942	0.961000	0.32948	0.944000	0.38274	0.967000	0.64934	0.021000	0.13489	-0.147000	0.11254	-0.218000	0.12543	TAC		0.512	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455		7	82	1	0	5.68852e-11	0.047766	8.29577e-11	7	82				
SEC14L3	266629	broad.mit.edu	37	22	30864641	30864641	+	Missense_Mutation	SNP	G	G	A	rs116683933		TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr22:30864641G>A	ENST00000215812.4	-	5	367	c.277C>T	c.(277-279)Cgt>Tgt	p.R93C	SEC14L3_ENST00000415957.2_Missense_Mutation_p.R34C|SEC14L3_ENST00000539629.1_Missense_Mutation_p.R34C|SEC14L3_ENST00000401751.1_Missense_Mutation_p.R34C|SEC14L3_ENST00000540910.1_Missense_Mutation_p.R16C|SEC14L3_ENST00000402286.1_Missense_Mutation_p.R16C|SEC14L3_ENST00000403066.1_Missense_Mutation_p.R34C	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	93	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	CAGCCATCACGGTCATAGCCA	0.547																																					Esophageal Squamous(108;290 1516 3584 23771 37333)	Esophageal Squamous(108;290 1516 3584 23771 37333)	uc003ahy.2		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(277-279)CGT>TGT		SEC14-like 3	Vitamin E(DB00163)						155.0	132.0	140.0					22																	30864641		2203	4300	6503	SO:0001583	missense	266629					integral to membrane|intracellular	lipid binding|transporter activity	g.chr22:30864641G>A	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.277C>T	22.37:g.30864641G>A	ENSP00000215812:p.Arg93Cys		Somatic				SEC14L3_uc003ahz.2_Missense_Mutation_p.R16C|SEC14L3_uc003aia.2_Missense_Mutation_p.R34C|SEC14L3_uc003aib.2_Missense_Mutation_p.R34C	p.R93C	NM_174975	NP_777635	WXS	Illumina HiSeq	Unspecified	Q9UDX4	S14L3_HUMAN			5	366	-			93			CRAL-TRIO.		E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	c.277C>T	CCDS13877.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395254	0.25205	.	.	ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910	T;T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	4.55	3.53	0.40419	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.194166	0.44902	D	0.000407	T	0.80276	0.4593	L	0.58510	1.815	0.80722	D	1	B;D	0.53619	0.371;0.961	B;P	0.52386	0.105;0.697	T	0.81433	-0.0935	10	0.62326	D	0.03	-1.317	12.5134	0.56017	0.0834:0.0:0.9166:0.0	.	16;93	E9PE57;Q9UDX4	.;S14L3_HUMAN	C	34;34;93;16;34;34;16	ENSP00000385941:R34C;ENSP00000401864:R34C;ENSP00000215812:R93C;ENSP00000385004:R16C;ENSP00000383896:R34C;ENSP00000444691:R34C;ENSP00000439752:R16C	ENSP00000215812:R93C	R	-	1	0	SEC14L3	29194641	1.000000	0.71417	0.686000	0.30086	0.315000	0.28087	4.511000	0.60462	1.033000	0.39918	-0.158000	0.13435	CGT		0.547	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975		6	105	0	0	0	0.02938	0	6	105				
CGGBP1	8545	broad.mit.edu	37	3	88105073	88105073	+	Silent	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr3:88105073A>G	ENST00000398392.2	-	1	1386	c.54T>C	c.(52-54)gcT>gcC	p.A18A	CGGBP1_ENST00000482016.1_Silent_p.A18A|CGGBP1_ENST00000474441.1_5'Flank|CGGBP1_ENST00000462901.1_Silent_p.A18A|CGGBP1_ENST00000309534.6_Silent_p.A18A			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1	18					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		TCACATACAAAGCAGTCTTAG	0.428																																							uc003dqs.2		NA																	0					0						c.(52-54)GCT>GCC		CGG triplet repeat binding protein 1							105.0	105.0	105.0					3																	88105073		1965	4155	6120	SO:0001819	synonymous_variant	8545				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding	g.chr3:88105073A>G	AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000398392.2:c.54T>C	3.37:g.88105073A>G			Somatic				CGGBP1_uc003dqt.2_Silent_p.A18A|CGGBP1_uc003dqu.2_Silent_p.A18A	p.A18A	NM_001008390	NP_001008391	WXS	Illumina HiSeq	Unspecified	Q9UFW8	CGBP1_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)	4	566	-		Lung NSC(201;0.0283)	18					D3DU38|O15183	Silent	SNP	ENST00000398392.2	37	c.54T>C	CCDS43111.1																																																																																				0.428	CGGBP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352955.1	NM_001008390		4	78	0	0	0	0.014758	0	4	78				
GDF9	2661	broad.mit.edu	37	5	132199850	132199850	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr5:132199850C>T	ENST00000378673.2	-	2	1242	c.376G>A	c.(376-378)Gct>Act	p.A126T	GDF9_ENST00000296875.2_Missense_Mutation_p.A126T|UQCRQ_ENST00000378667.1_5'Flank|GDF9_ENST00000464378.1_5'UTR|UQCRQ_ENST00000378670.3_5'Flank|UQCRQ_ENST00000378665.1_5'Flank			O60383	GDF9_HUMAN	growth differentiation factor 9	126					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTCCAGGAGCCTGCTTGTGC	0.468																																							uc003kxz.1		NA																	0				skin(1)	1						c.(376-378)GCT>ACT		growth differentiation factor 9 precursor							104.0	118.0	113.0					5																	132199850		2203	4300	6503	SO:0001583	missense	2661				female gamete generation|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr5:132199850C>T		CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.376G>A	5.37:g.132199850C>T	ENSP00000367942:p.Ala126Thr		Somatic				GDF9_uc011cxj.1_Missense_Mutation_p.A38T|UQCRQ_uc003kya.1_5'Flank	p.A126T	NM_005260	NP_005251	WXS	Illumina HiSeq	Unspecified	O60383	GDF9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	628	-		all_cancers(142;0.105)|Breast(839;0.198)	126					Q4VAW5	Missense_Mutation	SNP	ENST00000378673.2	37	c.376G>A	CCDS4162.1	.	.	.	.	.	.	.	.	.	.	C	11.00	1.508932	0.27036	.	.	ENSG00000164404	ENST00000378673;ENST00000296875	T;T	0.69806	-0.43;-0.43	5.61	-1.96	0.07525	.	0.594657	0.17947	N	0.156638	T	0.53981	0.1830	M	0.79123	2.44	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.39522	-0.9610	10	0.12103	T	0.63	.	2.1996	0.03919	0.1785:0.4346:0.137:0.2499	.	126	O60383	GDF9_HUMAN	T	126	ENSP00000367942:A126T;ENSP00000296875:A126T	ENSP00000296875:A126T	A	-	1	0	GDF9	132227749	0.000000	0.05858	0.024000	0.17045	0.989000	0.77384	-1.346000	0.02634	-0.269000	0.09298	0.655000	0.94253	GCT		0.468	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133060.2	NM_005260		11	83	0	0	0	0.09319	0	11	83				
HDAC9	9734	broad.mit.edu	37	7	18767353	18767353	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr7:18767353C>T	ENST00000432645.2	+	12	1873	c.1873C>T	c.(1873-1875)Cgc>Tgc	p.R625C	HDAC9_ENST00000441542.2_Missense_Mutation_p.R628C|HDAC9_ENST00000401921.1_Missense_Mutation_p.R584C|HDAC9_ENST00000406451.4_Missense_Mutation_p.R625C	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	625					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AGCAATGGACCGCCCCCTCCA	0.527																																							uc003suh.2		NA																	0				lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1873-1875)CGC>TGC		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						41.0	46.0	44.0					7																	18767353		1988	4143	6131	SO:0001583	missense	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18767353C>T	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1873C>T	7.37:g.18767353C>T	ENSP00000410337:p.Arg625Cys		Somatic				HDAC9_uc003sue.2_Missense_Mutation_p.R625C|HDAC9_uc011jyd.1_Missense_Mutation_p.R625C|HDAC9_uc003sui.2_Missense_Mutation_p.R628C|HDAC9_uc003suj.2_Missense_Mutation_p.R584C|HDAC9_uc003sua.1_Missense_Mutation_p.R603C|HDAC9_uc010kue.1_Missense_Mutation_p.R280C	p.R625C	NM_058176	NP_478056	WXS	Illumina HiSeq	Unspecified	Q9UKV0	HDAC9_HUMAN			12	1914	+	all_lung(11;0.187)		625					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	c.1873C>T	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.620803	0.28889	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.58797	0.32;0.31;0.31;0.32	4.87	1.44	0.22558	.	0.387462	0.22358	N	0.061105	T	0.37839	0.1018	N	0.16478	0.41	0.80722	D	1	B;B;B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.001;0.0;0.001	B;B;B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0;0.0;0.001	T	0.11767	-1.0574	10	0.51188	T	0.08	-24.6513	9.38	0.38306	0.0:0.7311:0.0:0.2689	.	625;537;584;628;625;625;603	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	C	625;584;625;628;537	ENSP00000384657:R625C;ENSP00000383912:R584C;ENSP00000410337:R625C;ENSP00000408617:R628C	ENSP00000339165:R537C	R	+	1	0	HDAC9	18733878	1.000000	0.71417	0.829000	0.32907	0.991000	0.79684	1.096000	0.30976	0.150000	0.19136	0.557000	0.71058	CGC		0.527	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			3	18	0	0	0	0.009096	0	3	18				
ERI1	90459	broad.mit.edu	37	8	8877863	8877863	+	Silent	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr8:8877863T>C	ENST00000523898.1	+	7	1375	c.696T>C	c.(694-696)tcT>tcC	p.S232S	ERI1_ENST00000250263.7_Silent_p.S232S|ERI1_ENST00000519292.1_Silent_p.S232S|ERI1_ENST00000520332.1_3'UTR			Q8IV48	ERI1_HUMAN	exoribonuclease 1	232	Exonuclease.				gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						TTTATAGTTCTTGGGATATGA	0.303																																							uc011kwu.1		NA																	0					0						c.(694-696)TCT>TCC		three prime histone mRNA exonuclease 1	Adenosine monophosphate(DB00131)						65.0	65.0	65.0					8																	8877863		2203	4296	6499	SO:0001819	synonymous_variant	90459				gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding	g.chr8:8877863T>C	BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	ENST00000523898.1:c.696T>C	8.37:g.8877863T>C			Somatic				ERI1_uc003wsk.2_Silent_p.S232S	p.S232S	NM_153332	NP_699163	WXS	Illumina HiSeq	Unspecified	Q8IV48	ERI1_HUMAN			6	956	+			232			Exonuclease.		A8K4U7|Q9NSX3	Silent	SNP	ENST00000523898.1	37	c.696T>C	CCDS5972.1																																																																																				0.303	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251471.2	NM_153332		2	14	0	0	0	0.004672	0	2	14				
TMEM67	91147	broad.mit.edu	37	8	94767313	94767313	+	Silent	SNP	C	C	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr8:94767313C>A	ENST00000453321.3	+	1	229	c.171C>A	c.(169-171)atC>atA	p.I57I	TMEM67_ENST00000409623.3_5'UTR	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	57					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ACTTTGATATCTCCGCCCTCT	0.552																																							uc011lgk.1		NA																	0				ovary(2)	2						c.(169-171)ATC>ATA		meckelin isoform 1							120.0	114.0	116.0					8																	94767313		2203	4300	6503	SO:0001819	synonymous_variant	91147				cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding	g.chr8:94767313C>A	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.171C>A	8.37:g.94767313C>A			Somatic				TMEM67_uc010mau.2_Silent_p.I57I|TMEM67_uc010mav.2_Silent_p.I57I|TMEM67_uc010mat.1_5'UTR|TMEM67_uc010maw.2_Silent_p.I57I|TMEM67_uc003yga.3_5'UTR	p.I57I	NM_153704	NP_714915	WXS	Illumina HiSeq	Unspecified	Q5HYA8	MKS3_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00896)		1	242	+	Breast(36;4.14e-07)		57					B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Silent	SNP	ENST00000453321.3	37	c.171C>A	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	C	3.119	-0.180906	0.06380	.	.	ENSG00000164953	ENST00000521517	.	.	.	5.35	1.44	0.22558	.	.	.	.	.	T	0.51787	0.1695	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39078	-0.9631	4	.	.	.	-14.2139	5.372	0.16144	0.1411:0.6218:0.0:0.2372	.	.	.	.	I	55	.	.	L	+	1	0	TMEM67	94836489	0.999000	0.42202	0.998000	0.56505	0.093000	0.18481	0.290000	0.18975	0.379000	0.24794	-0.225000	0.12378	CTC		0.552	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704		14	125	1	0	0.000219431	0.020292	0.00030118	14	125				
CHDC2	286464	broad.mit.edu	37	X	36117961	36117961	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chrX:36117961C>T	ENST00000313548.4	+	7	1003	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	273						integral component of membrane (GO:0016021)											CTGGAGTAAACGGGCATGGAC	0.333																																							uc004ddk.1		NA																	0				central_nervous_system(1)	1						c.(817-819)CGG>TGG		hypothetical protein LOC286464							101.0	111.0	108.0					X																	36117961		2202	4299	6501	SO:0001583	missense	286464					integral to membrane		g.chrX:36117961C>T	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.817C>T	X.37:g.36117961C>T	ENSP00000324767:p.Arg273Trp		Somatic					p.R273W	NM_173695	NP_775966	WXS	Illumina HiSeq	Unspecified	Q8N9S7	CX059_HUMAN			7	1003	+			273						Missense_Mutation	SNP	ENST00000313548.4	37	c.817C>T	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532042	0.45073	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.73	1.91	0.25777	.	0.000000	0.52532	D	0.000062	T	0.24661	0.0598	L	0.59436	1.845	0.23862	N	0.996633	P	0.47962	0.903	B	0.34722	0.188	T	0.33574	-0.9863	9	0.87932	D	0	-5.3905	3.2514	0.06815	0.1409:0.5656:0.1339:0.1596	.	273	Q8N9S7	CX059_HUMAN	W	273	.	ENSP00000324767:R273W	R	+	1	2	CXorf59	36027882	1.000000	0.71417	0.997000	0.53966	0.868000	0.49771	0.524000	0.22940	-0.049000	0.13379	0.506000	0.49869	CGG		0.333	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695		5	18	0	0	0	0.021553	0	5	18				
MED12	9968	broad.mit.edu	37	X	70343061	70343061	+	Silent	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chrX:70343061G>A	ENST00000374080.3	+	11	1634	c.1602G>A	c.(1600-1602)gcG>gcA	p.A534A	MED12_ENST00000374102.1_Silent_p.A534A|MED12_ENST00000333646.6_Silent_p.A534A			Q93074	MED12_HUMAN	mediator complex subunit 12	534					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGAGACAGGCGGAGATTGAGG	0.532			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(1600-1602)GCG>GCA		mediator complex subunit 12							85.0	76.0	79.0					X																	70343061		2069	4206	6275	SO:0001819	synonymous_variant	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70343061G>A	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.1602G>A	X.37:g.70343061G>A			Somatic				MED12_uc011mpq.1_Silent_p.A534A|MED12_uc004dyz.2_Silent_p.A534A|MED12_uc004dza.2_Silent_p.A381A	p.A534A	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			11	1801	+	Renal(35;0.156)		534					O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	c.1602G>A	CCDS43970.1																																																																																				0.532	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		5	21	0	0	0	0.021553	0	5	21				
SEC22A	26984	broad.mit.edu	37	3	122990411	122990412	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr3:122990411_122990412delTC	ENST00000309934.4	+	6	1662_1663	c.766_767delTC	c.(766-768)tctfs	p.S256fs	SEC22A_ENST00000492595.1_Frame_Shift_Del_p.S256fs|SEC22A_ENST00000481965.2_Frame_Shift_Del_p.L98fs	NM_012430.4	NP_036562.2	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A (S. cerevisiae)	256					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	10				GBM - Glioblastoma multiforme(114;0.0548)		GAATGTCAAATCTTTTTTGACT	0.371																																							uc003ege.2		NA																	0				ovary(1)	1						c.(766-768)TCTfs		SEC22 vesicle trafficking protein homolog A																																				SO:0001589	frameshift_variant	26984				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity	g.chr3:122990411_122990412delTC	AF100749	CCDS3021.1	3q21.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000121542	ENSG00000121542			20260	protein-coding gene	gene with protein product		612442	"""SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)"""	SEC22L2		9094723, 9501016	Standard	NM_012430		Approved		uc003ege.3	Q96IW7	OTTHUMG00000159495	ENST00000309934.4:c.766_767delTC	3.37:g.122990411_122990412delTC	ENSP00000310521:p.Ser256fs		Somatic				SEC22A_uc003egf.2_Frame_Shift_Del_p.S256fs	p.S256fs	NM_012430	NP_036562	WXS	Illumina HiSeq	Unspecified	Q96IW7	SC22A_HUMAN		GBM - Glioblastoma multiforme(114;0.0548)	7	845_846	+			256			Helical; (Potential).		B2RE26|Q9Y682	Frame_Shift_Del	DEL	ENST00000309934.4	37	c.766_767delTC	CCDS3021.1																																																																																				0.371	SEC22A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355770.2	NM_012430		9	72	NA	NA	NA	NA	NA	9	72	---	---	---	---
ZNF746	155061	broad.mit.edu	37	7	149174059	149174059	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr7:149174059delT	ENST00000340622.3	-	6	1072	c.792delA	c.(790-792)gcafs	p.A264fs	ZNF746_ENST00000458143.2_Frame_Shift_Del_p.A264fs			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	264					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CGTCCGAGCATGCTGAAGAGG	0.612																																							uc003wfw.2		NA																	0				ovary(2)|breast(1)	3						c.(790-792)GCAfs		zinc finger protein 746 isoform 2							162.0	137.0	146.0					7																	149174059		2203	4300	6503	SO:0001589	frameshift_variant	155061				negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr7:149174059delT	AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.792delA	7.37:g.149174059delT	ENSP00000345140:p.Ala264fs		Somatic				ZNF746_uc010lpi.2_Frame_Shift_Del_p.A264fs	p.A264fs	NM_152557	NP_689770	WXS	Illumina HiSeq	Unspecified	Q6NUN9	ZN746_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00358)		6	1063	-	Melanoma(164;0.165)		264					A8K6Z9|Q6ZRF9	Frame_Shift_Del	DEL	ENST00000340622.3	37	c.792delA	CCDS5897.1																																																																																				0.612	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557		16	115	NA	NA	NA	NA	NA	16	115	---	---	---	---
