#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MORN1	79906	broad.mit.edu	37	1	2288985	2288985	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:2288985C>T	ENST00000378531.3	-	10	1095	c.922G>A	c.(922-924)Ggg>Agg	p.G308R	MORN1_ENST00000606372.1_5'UTR|MORN1_ENST00000378529.3_Missense_Mutation_p.G308R	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	308										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		GCTCTGGGCCCCGGCACCCCA	0.652																																							uc001ajb.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(922-924)GGG>AGG		MORN repeat containing 1							46.0	53.0	51.0					1																	2288985		2203	4300	6503	SO:0001583	missense	79906							g.chr1:2288985C>T	AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.922G>A	1.37:g.2288985C>T	ENSP00000367792:p.Gly308Arg		Somatic				MORN1_uc009vld.2_Missense_Mutation_p.G284R|MORN1_uc001ajd.1_Missense_Mutation_p.G308R	p.G308R	NM_024848	NP_079124	WXS	Illumina HiSeq	Unspecified	Q5T089	MORN1_HUMAN		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)	10	943	-	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	308					A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	ENST00000378531.3	37	c.922G>A	CCDS40.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.613459	0.28712	.	.	ENSG00000116151	ENST00000378531;ENST00000378529	T;T	0.52983	0.92;0.64	3.2	3.2	0.36748	.	0.837651	0.09871	N	0.744978	T	0.32882	0.0844	L	0.29908	0.895	0.30252	N	0.793971	P;P	0.43701	0.815;0.651	B;B	0.37304	0.246;0.084	T	0.08785	-1.0705	10	0.22706	T	0.39	.	10.1636	0.42866	0.0:1.0:0.0:0.0	.	308;308	Q5T089-2;Q5T089	.;MORN1_HUMAN	R	308	ENSP00000367792:G308R;ENSP00000367790:G308R	ENSP00000367790:G308R	G	-	1	0	MORN1	2278845	0.011000	0.17503	0.034000	0.17996	0.001000	0.01503	2.044000	0.41241	2.089000	0.63090	0.563000	0.77884	GGG		0.652	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004055.1	NM_024848		32	97	0	0	0	0.002836	0	32	97				
MEGF6	1953	broad.mit.edu	37	1	3427376	3427376	+	Missense_Mutation	SNP	C	C	A	rs201247174		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:3427376C>A	ENST00000356575.4	-	10	1431	c.1205G>T	c.(1204-1206)cGg>cTg	p.R402L	MEGF6_ENST00000294599.4_Missense_Mutation_p.R297L	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	402	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GGCACTGAGCCGGTAGCCGGC	0.672																																					Ovarian(73;978 3658)	Ovarian(73;978 3658)	uc001akl.2		NA																	0				large_intestine(1)	1						c.(1204-1206)CGG>CTG		EGF-like-domain, multiple 3 precursor							28.0	37.0	34.0					1																	3427376		2133	4233	6366	SO:0001583	missense	1953					extracellular region	calcium ion binding	g.chr1:3427376C>A	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1205G>T	1.37:g.3427376C>A	ENSP00000348982:p.Arg402Leu		Somatic				MEGF6_uc001akk.2_Missense_Mutation_p.R297L	p.R402L	NM_001409	NP_001400	WXS	Illumina HiSeq	Unspecified	O75095	MEGF6_HUMAN		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)	10	1432	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	402			EGF-like 7.		Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	c.1205G>T	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041135	0.55003	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	D;D	0.86956	-2.19;-2.19	4.51	1.56	0.23342	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.200893	0.40554	N	0.001067	D	0.87474	0.6186	L	0.42686	1.345	0.30788	N	0.741263	D;D	0.76494	0.999;0.999	D;D	0.77004	0.955;0.989	T	0.81531	-0.0890	10	0.19147	T	0.46	-11.358	7.611	0.28131	0.0:0.6535:0.0:0.3465	.	402;297	O75095;O75095-2	MEGF6_HUMAN;.	L	297;402	ENSP00000294599:R297L;ENSP00000348982:R402L	ENSP00000294599:R297L	R	-	2	0	MEGF6	3417236	0.261000	0.24063	0.872000	0.34217	0.735000	0.41995	1.538000	0.36094	0.030000	0.15379	0.462000	0.41574	CGG		0.672	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409		23	48	1	0	1.66031e-10	0.003954	2.44718e-10	23	48				
CEP104	9731	broad.mit.edu	37	1	3740027	3740027	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:3740027C>A	ENST00000378230.3	-	19	2788	c.2464G>T	c.(2464-2466)Gaa>Taa	p.E822*		NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	822						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						GGCAGCTCTTCCTTGAAAACA	0.542																																							uc001aky.2		NA																	0					0						c.(2464-2466)GAA>TAA		glycine-, glutamate-,							195.0	169.0	178.0					1																	3740027		2203	4300	6503	SO:0001587	stop_gained	9731					centriole	binding	g.chr1:3740027C>A	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.2464G>T	1.37:g.3740027C>A	ENSP00000367476:p.Glu822*		Somatic				KIAA0562_uc010nzm.1_RNA	p.E822*	NM_014704	NP_055519	WXS	Illumina HiSeq	Unspecified	O60308	CE104_HUMAN		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)	19	2823	-	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)	822					Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Nonsense_Mutation	SNP	ENST00000378230.3	37	c.2464G>T	CCDS30571.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.971150|4.971150	0.92919|0.92919	.|.	.|.	ENSG00000116198|ENSG00000116198	ENST00000378230|ENST00000438539	.|.	.|.	.|.	5.68|5.68	4.72|4.72	0.59763|0.59763	.|.	0.061993|.	0.64402|.	D|.	0.000005|.	.|T	.|0.70842	.|0.3270	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69258	.|-0.5192	.|4	0.11182|.	T|.	0.66|.	.|.	15.2383|15.2383	0.73450|0.73450	0.0:0.8593:0.1407:0.0|0.0:0.8593:0.1407:0.0	.|.	.|.	.|.	.|.	X|S	822|118	.|.	ENSP00000367476:E822X|.	E|R	-|-	1|3	0|2	CEP104|CEP104	3729887|3729887	0.999000|0.999000	0.42202|0.42202	0.955000|0.955000	0.39395|0.39395	0.976000|0.976000	0.68499|0.68499	4.198000|4.198000	0.58419|0.58419	2.670000|2.670000	0.90874|0.90874	0.655000|0.655000	0.94253|0.94253	GAA|AGG		0.542	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704		32	95	1	0	4.74835e-14	0.010818	7.65149e-14	32	95				
MTOR	2475	broad.mit.edu	37	1	11182094	11182094	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:11182094C>T	ENST00000361445.4	-	48	6828	c.6752G>A	c.(6751-6753)cGg>cAg	p.R2251Q	MTOR_ENST00000376838.1_Missense_Mutation_p.R456Q	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2251	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCTGTAGTCCCGGATGAGGGC	0.577																																							uc001asd.2		NA																	0				central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						c.(6751-6753)CGG>CAG		FK506 binding protein 12-rapamycin associated							140.0	124.0	129.0					1																	11182094		2203	4300	6503	SO:0001583	missense	2475				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	g.chr1:11182094C>T	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6752G>A	1.37:g.11182094C>T	ENSP00000354558:p.Arg2251Gln		Somatic				MTOR_uc001asc.2_Missense_Mutation_p.R456Q	p.R2251Q	NM_004958	NP_004949	WXS	Illumina HiSeq	Unspecified	P42345	MTOR_HUMAN			48	6873	-			2251			PI3K/PI4K.		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	c.6752G>A	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	36	5.856805	0.97030	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.76839	-1.05;-1.05	5.36	5.36	0.76844	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.88102	0.2820	10	0.87932	D	0	-17.367	19.1089	0.93309	0.0:1.0:0.0:0.0	.	2251	P42345	MTOR_HUMAN	Q	2251;456	ENSP00000354558:R2251Q;ENSP00000366034:R456Q	ENSP00000354558:R2251Q	R	-	2	0	MTOR	11104681	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.407000	0.80029	2.508000	0.84585	0.650000	0.86243	CGG		0.577	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		14	79	0	0	0	0.003163	0	14	79				
AADACL4	343066	broad.mit.edu	37	1	12711243	12711243	+	Silent	SNP	C	C	A	rs140616597	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:12711243C>A	ENST00000376221.1	+	2	270	c.270C>A	c.(268-270)acC>acA	p.T90T		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	90						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		TTGTGGTGACCGACCTGCGTT	0.502																																							uc001auf.2		NA																	0					0						c.(268-270)ACC>ACA		arylacetamide deacetylase-like 4							95.0	93.0	94.0					1																	12711243		2203	4300	6503	SO:0001819	synonymous_variant	343066					integral to membrane	carboxylesterase activity	g.chr1:12711243C>A		CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.270C>A	1.37:g.12711243C>A			Somatic					p.T90T	NM_001013630	NP_001013652	WXS	Illumina HiSeq	Unspecified	Q5VUY2	ADCL4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)	2	270	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	90			Lumenal (Potential).			Silent	SNP	ENST00000376221.1	37	c.270C>A	CCDS30590.1																																																																																				0.502	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005328.1	NM_001013630		27	42	1	0	2.79863e-10	0.004656	4.09588e-10	27	42				
PRDM2	7799	broad.mit.edu	37	1	14107117	14107117	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:14107117G>T	ENST00000235372.7	+	8	3683	c.2827G>T	c.(2827-2829)Gat>Tat	p.D943Y	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.D742Y|PRDM2_ENST00000311066.5_Missense_Mutation_p.D943Y|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.D742Y	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	943	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GTCCACACCTGATGTTTGTCC	0.582																																							uc001avi.2		NA																	0				ovary(1)	1						c.(2827-2829)GAT>TAT		retinoblastoma protein-binding zinc finger							168.0	151.0	157.0					1																	14107117		2203	4300	6503	SO:0001583	missense	7799					Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:14107117G>T	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.2827G>T	1.37:g.14107117G>T	ENSP00000235372:p.Asp943Tyr		Somatic				PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.D943Y|PRDM2_uc001avj.2_Intron|PRDM2_uc001avk.2_Missense_Mutation_p.D742Y|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	p.D943Y	NM_012231	NP_036363	WXS	Illumina HiSeq	Unspecified	Q13029	PRDM2_HUMAN	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)	8	3683	+	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	943			Pro-rich.		B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	c.2827G>T	CCDS150.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356394	0.41700	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01560	4.89;4.77;4.78;4.78	5.91	4.92	0.64577	.	0.703041	0.13774	N	0.363713	T	0.01870	0.0059	L	0.34521	1.04	0.09310	N	1	P;P;P	0.44946	0.845;0.761;0.846	B;B;B	0.37198	0.174;0.123;0.243	T	0.51834	-0.8655	10	0.56958	D	0.05	.	10.4073	0.44272	0.0:0.2092:0.6564:0.1344	.	801;943;943	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	Y	943;943;943;742;742	ENSP00000235372:D943Y;ENSP00000312352:D943Y;ENSP00000411103:D742Y;ENSP00000341621:D742Y	ENSP00000235372:D943Y	D	+	1	0	PRDM2	13979704	0.048000	0.20356	0.067000	0.19924	0.321000	0.28281	1.563000	0.36364	2.801000	0.96364	0.655000	0.94253	GAT		0.582	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231		60	154	1	0	1.83847e-13	0.00361	2.93966e-13	60	154				
ALDH4A1	8659	broad.mit.edu	37	1	19209835	19209835	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:19209835C>A	ENST00000375341.3	-	6	798	c.541G>T	c.(541-543)Gag>Tag	p.E181*	ALDH4A1_ENST00000538309.1_Nonsense_Mutation_p.E121*|ALDH4A1_ENST00000290597.5_Nonsense_Mutation_p.E181*|ALDH4A1_ENST00000538839.1_Nonsense_Mutation_p.E181*|MIR4695_ENST00000577305.1_RNA|RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000454547.1_5'UTR	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	181					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGCTGCCCCTCCAGCTCCACC	0.637																																							uc001bbb.2		NA																	0					0						c.(541-543)GAG>TAG		aldehyde dehydrogenase 4A1 isoform a precursor	NADH(DB00157)						53.0	44.0	47.0					1																	19209835		2203	4300	6503	SO:0001587	stop_gained	8659				proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity	g.chr1:19209835C>A	U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.541G>T	1.37:g.19209835C>A	ENSP00000364490:p.Glu181*		Somatic				ALDH4A1_uc010ocu.1_Nonsense_Mutation_p.E121*|ALDH4A1_uc001bbc.2_Nonsense_Mutation_p.E181*	p.E181*	NM_170726	NP_733844	WXS	Illumina HiSeq	Unspecified	P30038	AL4A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	6	817	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	181					A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Nonsense_Mutation	SNP	ENST00000375341.3	37	c.541G>T	CCDS188.1	.	.	.	.	.	.	.	.	.	.	C	38	6.682759	0.97759	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309;ENST00000375335;ENST00000454547;ENST00000375334;ENST00000432718	.	.	.	5.31	5.31	0.75309	.	0.550322	0.21253	N	0.077606	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-32.7178	7.7367	0.28819	0.0:0.7476:0.1657:0.0867	.	.	.	.	X	181;181;181;121;165;79;121;165	.	ENSP00000290597:E181X	E	-	1	0	ALDH4A1	19082422	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	1.459000	0.35234	2.489000	0.83994	0.491000	0.48974	GAG		0.637	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006954.1			21	30	1	0	6.33239e-15	0.010504	1.042e-14	21	30				
EMC1	23065	broad.mit.edu	37	1	19549300	19549300	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:19549300C>T	ENST00000477853.1	-	20	2447	c.2405G>A	c.(2404-2406)cGc>cAc	p.R802H	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Missense_Mutation_p.R801H|EMC1_ENST00000480380.1_5'Flank|EMC1_ENST00000375208.3_Missense_Mutation_p.R780H	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	802						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											AAACTCGTTGCGCCGAGCCTT	0.592																																						GBM(4;72 124 25802 30195)	uc001bbo.2		NA																	0				ovary(1)	1						c.(2404-2406)CGC>CAC		hypothetical protein LOC23065 precursor							115.0	98.0	104.0					1																	19549300		2203	4300	6503	SO:0001583	missense	23065					integral to membrane	protein binding	g.chr1:19549300C>T		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2405G>A	1.37:g.19549300C>T	ENSP00000420608:p.Arg802His		Somatic				KIAA0090_uc001bbn.2_5'Flank|KIAA0090_uc001bbp.2_Missense_Mutation_p.R801H|KIAA0090_uc001bbq.2_Missense_Mutation_p.R801H|KIAA0090_uc001bbr.2_Missense_Mutation_p.R780H	p.R802H	NM_015047	NP_055862	WXS	Illumina HiSeq	Unspecified	Q8N766	K0090_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)	20	2448	-		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)	802			DUF1620.|Extracellular (Potential).		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	37	c.2405G>A	CCDS190.1	.	.	.	.	.	.	.	.	.	.	C	32	5.118619	0.94385	.	.	ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208;ENST00000486405	T;T;T	0.29917	1.55;1.55;1.55	5.84	5.84	0.93424	Domain of unknown function DUF1620 (1);	0.000000	0.85682	D	0.000000	T	0.62344	0.2420	M	0.86178	2.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.64563	-0.6378	10	0.54805	T	0.06	-18.1195	18.707	0.91643	0.0:1.0:0.0:0.0	.	780;801;801;802	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.;.;.;K0090_HUMAN	H	802;801;780;47	ENSP00000420608:R802H;ENSP00000364345:R801H;ENSP00000364354:R780H	ENSP00000364345:R801H	R	-	2	0	KIAA0090	19421887	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.298000	0.78815	2.769000	0.95229	0.561000	0.74099	CGC		0.592	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047		4	38	0	0	0	0.009096	0	4	38				
NIPAL3	57185	broad.mit.edu	37	1	24768625	24768626	+	Silent	DNP	CC	CC	TT			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:24768625_24768626CC>TT	ENST00000374399.4	+	4	611_612	c.243_244CC>TT	c.(241-246)ttCCtg>ttTTtg	p.81_82FL>FL	NIPAL3_ENST00000358028.4_Silent_p.81_82FL>FL|NIPAL3_ENST00000428131.1_Silent_p.81_82FL>FL|NIPAL3_ENST00000339255.2_Silent_p.81_82FL>FL|NIPAL3_ENST00000003912.3_5'UTR	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	81						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						TGGGCCTGTTCCTGATGCTTCT	0.574																																							uc001bjh.2		NA																	0					0						c.(241-246)TTCCTG>TTTTTG		NIPA-like domain containing 3																																				SO:0001819	synonymous_variant	57185					integral to membrane		g.chr1:24768625_24768626CC>TT	BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	Exception_encountered	1.37:g.24768625_24768626delinsTT			Somatic				NIPAL3_uc010oek.1_Silent_p.81_82FL>FL|NIPAL3_uc001bjg.2_Silent_p.81_82FL>FL|NIPAL3_uc009vrc.2_5'UTR	p.81_82FL>FL	NM_020448	NP_065181	WXS	Illumina HiSeq	Unspecified	Q6P499	NPAL3_HUMAN			4	650_651	+			81_82			Helical; (Potential).		A2A298|Q6MZT9|Q9BVE6	Silent	DNP	ENST00000374399.4	37	c.243_244CC>TT	CCDS30631.1																																																																																				0.574	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276996.1	NM_020448		31	80	0	0	0	0.004672	0	31	80				
CATSPER4	378807	broad.mit.edu	37	1	26517187	26517187	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:26517187G>T	ENST00000456354.2	+	1	136	c.69G>T	c.(67-69)ggG>ggT	p.G23G		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	23					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGGGGCGGGACTCAGGAGG	0.597																																							uc010oez.1		NA																	0				ovary(1)	1						c.(67-69)GGG>GGT		cation channel, sperm associated 4							37.0	44.0	42.0					1																	26517187		2203	4300	6503	SO:0001819	synonymous_variant	378807				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity	g.chr1:26517187G>T	BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.69G>T	1.37:g.26517187G>T			Somatic				CATSPER4_uc010oey.1_5'UTR|CATSPER4_uc009vsf.2_RNA	p.G23G	NM_198137	NP_937770	WXS	Illumina HiSeq	Unspecified	Q7RTX7	CTSR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)	1	69	+		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)	23			Cytoplasmic (Potential).		A1A4W6|Q5VY71	Silent	SNP	ENST00000456354.2	37	c.69G>T	CCDS30645.1																																																																																				0.597	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137		11	33	1	0	2.27111e-07	0.001368	2.96771e-07	11	33				
GJB4	127534	broad.mit.edu	37	1	35227283	35227283	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:35227283C>A	ENST00000339480.1	+	2	798	c.428C>A	c.(427-429)gCt>gAt	p.A143D	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	143					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GCCGTGGATGCTGGCTTCCTC	0.607																																							uc001bxv.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(427-429)GCT>GAT		gap junction protein, beta 4							75.0	58.0	64.0					1																	35227283		2203	4300	6503	SO:0001583	missense	127534				cell communication	connexon complex|integral to membrane	gap junction channel activity	g.chr1:35227283C>A		CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.428C>A	1.37:g.35227283C>A	ENSP00000345868:p.Ala143Asp		Somatic				GJB4_uc001bxw.3_Missense_Mutation_p.A143D	p.A143D	NM_153212	NP_694944	WXS	Illumina HiSeq	Unspecified	Q9NTQ9	CXB4_HUMAN			2	798	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)	143			Helical; (Potential).		B3KQ82	Missense_Mutation	SNP	ENST00000339480.1	37	c.428C>A	CCDS383.1	.	.	.	.	.	.	.	.	.	.	C	8.463	0.855758	0.17106	.	.	ENSG00000189433	ENST00000339480	D	0.96011	-3.88	5.73	2.82	0.32997	Gap junction protein, cysteine-rich domain (1);	0.646961	0.15409	N	0.263896	D	0.93729	0.7996	M	0.80183	2.485	0.09310	N	1	P	0.39443	0.674	B	0.37550	0.253	D	0.88835	0.3308	10	0.87932	D	0	.	5.6247	0.17477	0.0:0.6034:0.1541:0.2425	.	143	Q9NTQ9	CXB4_HUMAN	D	143	ENSP00000345868:A143D	ENSP00000345868:A143D	A	+	2	0	GJB4	34999870	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	-0.642000	0.05427	0.763000	0.33175	0.655000	0.94253	GCT		0.607	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011560.1	NM_153212		17	44	1	0	2.48551e-13	0.00499	3.94384e-13	17	44				
RAD54L	8438	broad.mit.edu	37	1	46726526	46726526	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:46726526G>C	ENST00000371975.4	+	7	1279	c.605G>C	c.(604-606)cGc>cCc	p.R202P	RAD54L_ENST00000442598.1_Missense_Mutation_p.R202P|RAD54L_ENST00000473251.1_3'UTR	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	202	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.		R -> C (in dbSNP:rs28363218). {ECO:0000269|Ref.2}.		chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		ACACTTTTACGCCAGAGTCCA	0.547								Direct reversal of damage;Homologous recombination																															uc009vye.2		NA																	0				ovary(2)|skin(1)	3						c.(604-606)CGC>CCC	Direct_reversal_of_damage|Homologous_recombination	RAD54-like protein							110.0	98.0	102.0					1																	46726526		2203	4300	6503	SO:0001583	missense	8438				meiosis	nucleus	ATP binding|DNA binding|helicase activity	g.chr1:46726526G>C	X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.605G>C	1.37:g.46726526G>C	ENSP00000361043:p.Arg202Pro		Somatic				RAD54L_uc001cpl.2_Missense_Mutation_p.R202P|RAD54L_uc001cpm.1_Missense_Mutation_p.R22P	p.R202P	NM_001142548	NP_001136020	WXS	Illumina HiSeq	Unspecified	Q92698	RAD54_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)	8	719	+	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)	202			Helicase ATP-binding.		Q5TE31|Q6IUY3	Missense_Mutation	SNP	ENST00000371975.4	37	c.605G>C	CCDS532.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356813	0.82243	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	D;D	0.92911	-3.13;-3.13	5.25	5.25	0.73442	DEAD-like helicase (2);SNF2-related (1);	0.051335	0.64402	D	0.000001	D	0.96423	0.8833	M	0.85373	2.75	0.80722	D	1	D;D	0.71674	0.957;0.998	P;D	0.71414	0.754;0.973	D	0.96555	0.9411	10	0.62326	D	0.03	-12.951	19.2311	0.93841	0.0:0.0:1.0:0.0	.	22;202	G3V1N0;Q92698	.;RAD54_HUMAN	P	202;202;22	ENSP00000396113:R202P;ENSP00000361043:R202P	ENSP00000361043:R202P	R	+	2	0	RAD54L	46499113	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.695000	0.68279	2.625000	0.88918	0.561000	0.74099	CGC		0.547	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021272.1	NM_003579		9	37	0	0	0	0.004482	0	9	37				
LRRC7	57554	broad.mit.edu	37	1	70504765	70504765	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:70504765A>G	ENST00000035383.5	+	19	3174	c.3144A>G	c.(3142-3144)atA>atG	p.I1048M	LRRC7_ENST00000310961.5_Missense_Mutation_p.I1053M|LRRC7_ENST00000415775.2_Missense_Mutation_p.I332M	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1048						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AAAAGAGGATACCACCCCCTT	0.448																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(3142-3144)ATA>ATG		leucine rich repeat containing 7							65.0	70.0	68.0					1																	70504765		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70504765A>G		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3144A>G	1.37:g.70504765A>G	ENSP00000035383:p.Ile1048Met		Somatic				LRRC7_uc009wbg.2_Missense_Mutation_p.I332M|LRRC7_uc001deq.2_Missense_Mutation_p.I289M	p.I1048M	NM_020794	NP_065845	WXS	Illumina HiSeq	Unspecified	Q96NW7	LRRC7_HUMAN			19	3174	+			1048					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.3144A>G	CCDS645.1	.	.	.	.	.	.	.	.	.	.	A	1.166	-0.642331	0.03531	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.38240	1.15;1.23;2.33	5.41	-5.71	0.02413	.	0.447143	0.24321	N	0.039556	T	0.05640	0.0148	N	0.22421	0.69	0.19575	N	0.999964	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.15870	0.014;0.003;0.001	T	0.21621	-1.0240	10	0.36615	T	0.2	.	3.6045	0.08037	0.2968:0.3879:0.2261:0.0892	.	332;1048;1048	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	M	1053;1048;332;871	ENSP00000309245:I1053M;ENSP00000035383:I1048M;ENSP00000394867:I332M	ENSP00000035383:I1048M	I	+	3	3	LRRC7	70277353	0.026000	0.19158	0.870000	0.34147	0.020000	0.10135	-0.600000	0.05693	-0.953000	0.03645	-0.371000	0.07208	ATA		0.448	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		8	31	0	0	0	0.008291	0	8	31				
ST6GALNAC5	81849	broad.mit.edu	37	1	77510025	77510025	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:77510025G>T	ENST00000477717.1	+	3	633	c.398G>T	c.(397-399)cGt>cTt	p.R133L		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	133					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						GGCTATGGGCGTGACGTGGGC	0.622																																							uc001dhi.2		NA																	0				pancreas(1)|skin(1)	2						c.(397-399)CGT>CTT		sialyltransferase 7E							72.0	64.0	67.0					1																	77510025		2203	4300	6503	SO:0001583	missense	81849				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:77510025G>T		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.398G>T	1.37:g.77510025G>T	ENSP00000417583:p.Arg133Leu		Somatic				ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	p.R133L	NM_030965	NP_112227	WXS	Illumina HiSeq	Unspecified	Q9BVH7	SIA7E_HUMAN			3	573	+			133			Lumenal (Potential).		B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	c.398G>T	CCDS673.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654010	0.29425	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.30981	1.51	5.63	0.668	0.17912	.	0.395101	0.30820	N	0.008815	T	0.11367	0.0277	M	0.81682	2.555	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.30707	-0.9969	10	0.28530	T	0.3	-19.2892	2.2109	0.03947	0.4494:0.1189:0.3033:0.1283	.	133	Q9BVH7	SIA7E_HUMAN	L	133;43	ENSP00000417583:R133L	ENSP00000436263:R133L	R	+	2	0	ST6GALNAC5	77282613	0.000000	0.05858	0.476000	0.27291	0.978000	0.69477	-0.527000	0.06200	-0.129000	0.11620	0.591000	0.81541	CGT		0.622	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965		26	59	1	0	3.73808e-20	0.005443	6.75897e-20	26	59				
PRKACB	5567	broad.mit.edu	37	1	84679969	84679969	+	Missense_Mutation	SNP	C	C	T	rs143624941	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:84679969C>T	ENST00000370689.2	+	9	1163	c.899C>T	c.(898-900)aCg>aTg	p.T300M	PRKACB_ENST00000370685.3_Missense_Mutation_p.T347M|PRKACB_ENST00000394838.2_Missense_Mutation_p.T307M|PRKACB_ENST00000370682.3_Missense_Mutation_p.T304M|PRKACB_ENST00000394839.2_Missense_Mutation_p.T270M	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	300	AGC-kinase C-terminal.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TGGTTTGCCACGACAGATTGG	0.363													C|||	2	0.000399361	0.0	0.0	5008	,	,		16056	0.0		0.0	False		,,,				2504	0.002						uc001djj.2		NA																	0				lung(2)|ovary(1)	3						c.(898-900)ACG>ATG		cAMP-dependent protein kinase catalytic subunit		C	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	85.0	86.0	85.0		920,863,911,917,809,860,899,1040	5.4	1.0	1	dbSNP_134	85	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense,missense,missense,missense,missense	PRKACB	NM_001242857.1,NM_001242858.1,NM_001242859.1,NM_001242860.1,NM_001242861.1,NM_001242862.1,NM_002731.2,NM_182948.2	81,81,81,81,81,81,81,81	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign,benign,benign,benign,benign,benign	307/359,288/340,304/356,306/358,270/322,287/339,300/352,347/399	84679969	3,13003	2203	4300	6503	SO:0001583	missense	5567				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding	g.chr1:84679969C>T	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.899C>T	1.37:g.84679969C>T	ENSP00000359723:p.Thr300Met		Somatic				PRKACB_uc001djl.2_Missense_Mutation_p.T347M|PRKACB_uc010ort.1_Missense_Mutation_p.T307M|PRKACB_uc001djn.2_Missense_Mutation_p.T304M|PRKACB_uc010oru.1_Missense_Mutation_p.T288M|PRKACB_uc001djp.2_Missense_Mutation_p.T306M|PRKACB_uc001djq.2_Missense_Mutation_p.T270M|PRKACB_uc010orv.1_Missense_Mutation_p.T287M	p.T300M	NM_002731	NP_002722	WXS	Illumina HiSeq	Unspecified	P22694	KAPCB_HUMAN		all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)	9	1163	+			300			AGC-kinase C-terminal.		B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Missense_Mutation	SNP	ENST00000370689.2	37	c.899C>T	CCDS691.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239464	0.58995	0.0	3.49E-4	ENSG00000142875	ENST00000370689;ENST00000370685;ENST00000394838;ENST00000370682;ENST00000370679;ENST00000394839;ENST00000370681	T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1	5.39	5.39	0.77823	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.142140	0.64402	D	0.000007	T	0.12646	0.0307	M	0.81682	2.555	0.54753	D	0.999988	B;P;P;P;P;P;P;B	0.43826	0.417;0.463;0.56;0.818;0.687;0.617;0.463;0.417	B;B;B;B;B;B;B;B	0.44278	0.156;0.282;0.146;0.368;0.282;0.445;0.345;0.156	T	0.01545	-1.1328	10	0.56958	D	0.05	-15.5163	19.1532	0.93499	0.0:1.0:0.0:0.0	.	300;288;307;270;306;304;347;300	B2RB89;P22694-3;B4DKB0;B1APG4;P22694-6;P22694-7;P22694-2;P22694	.;.;.;.;.;.;.;KAPCB_HUMAN	M	300;347;307;304;306;270;262	ENSP00000359723:T300M;ENSP00000359719:T347M;ENSP00000378314:T307M;ENSP00000359716:T304M;ENSP00000378315:T270M	ENSP00000359713:T306M	T	+	2	0	PRKACB	84452557	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.986000	0.70563	2.522000	0.85027	0.650000	0.86243	ACG		0.363	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948		4	24	0	0	0	0.000602	0	4	24				
WDR63	126820	broad.mit.edu	37	1	85547055	85547055	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:85547055G>T	ENST00000294664.6	+	4	422	c.242G>T	c.(241-243)aGa>aTa	p.R81I	WDR63_ENST00000326813.8_Missense_Mutation_p.R81I|WDR63_ENST00000370596.1_Missense_Mutation_p.R81I	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	81										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		CTGCGCAACAGAGCTGCAGTA	0.378																																							uc001dkt.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5						c.(241-243)AGA>ATA		WD repeat domain 63							99.0	100.0	99.0					1																	85547055		2203	4300	6503	SO:0001583	missense	126820							g.chr1:85547055G>T		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.242G>T	1.37:g.85547055G>T	ENSP00000294664:p.Arg81Ile		Somatic				WDR63_uc009wcl.2_Missense_Mutation_p.R81I	p.R81I	NM_145172	NP_660155	WXS	Illumina HiSeq	Unspecified	Q8IWG1	WDR63_HUMAN		all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)	4	433	+			81					A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	ENST00000294664.6	37	c.242G>T	CCDS702.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294475	0.81025	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664;ENST00000528899	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71856	-0.4466	10	0.66056	D	0.02	-2.1517	20.1484	0.98083	0.0:0.0:1.0:0.0	.	81;81	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	I	81;81;81;68	ENSP00000359628:R81I;ENSP00000317463:R81I;ENSP00000294664:R81I;ENSP00000435102:R68I	ENSP00000294664:R81I	R	+	2	0	WDR63	85319643	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	9.163000	0.94750	2.770000	0.95276	0.650000	0.86243	AGA		0.378	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172		9	36	1	0	1.12685e-05	0.004482	1.36628e-05	9	36				
GLMN	11146	broad.mit.edu	37	1	92733549	92733549	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:92733549T>A	ENST00000370360.3	-	11	1100	c.1019A>T	c.(1018-1020)gAg>gTg	p.E340V	GLMN_ENST00000534881.1_Missense_Mutation_p.E340V	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	340					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TAAACTATTCTCCAGCAGCTC	0.294									Multiple Glomus Tumors (of the Skin), Familial																														uc001dor.2		NA																	0				skin(1)	1						c.(1018-1020)GAG>GTG		glomulin							67.0	79.0	75.0					1																	92733549		2198	4290	6488	SO:0001583	missense	11146	Multiple_Glomus_Tumors_(of_the_Skin)_Familial	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding	g.chr1:92733549T>A	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.1019A>T	1.37:g.92733549T>A	ENSP00000359385:p.Glu340Val		Somatic				GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.E340V	p.E340V	NM_053274	NP_444504	WXS	Illumina HiSeq	Unspecified	Q92990	GLMN_HUMAN		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)	11	1134	-		all_lung(203;0.00827)|Lung NSC(277;0.0295)	340					Q5VVC3|Q9BVE8	Missense_Mutation	SNP	ENST00000370360.3	37	c.1019A>T	CCDS738.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.874453	0.72180	.	.	ENSG00000174842	ENST00000370360;ENST00000534881	T;T	0.40756	1.02;1.02	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.36991	0.0987	L	0.54323	1.7	0.80722	D	1	P;B	0.36837	0.571;0.324	P;B	0.44921	0.464;0.38	T	0.38714	-0.9648	10	0.66056	D	0.02	-14.503	14.7192	0.69294	0.0:0.0:0.0:1.0	.	340;340	B4DJ85;Q92990	.;GLMN_HUMAN	V	340	ENSP00000359385:E340V;ENSP00000440156:E340V	ENSP00000359385:E340V	E	-	2	0	GLMN	92506137	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.646000	0.54396	2.131000	0.65755	0.533000	0.62120	GAG		0.294	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028358.1	NM_007070		15	67	0	0	0	0.00245	0	15	67				
LPPR4	9890	broad.mit.edu	37	1	99771914	99771914	+	Missense_Mutation	SNP	C	C	A	rs201251961		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:99771914C>A	ENST00000370185.3	+	7	2137	c.1640C>A	c.(1639-1641)tCc>tAc	p.S547Y	LPPR4_ENST00000370184.1_Missense_Mutation_p.S389Y|LPPR4_ENST00000457765.1_Missense_Mutation_p.S489Y	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		547					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		ATAAGCACCTCCCCCAAAAGC	0.537																																							uc001dse.2		NA																	0				ovary(3)	3						c.(1639-1641)TCC>TAC		plasticity related gene 1							84.0	90.0	88.0					1																	99771914		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99771914C>A																												ENST00000370185.3:c.1640C>A	1.37:g.99771914C>A	ENSP00000359204:p.Ser547Tyr		Somatic				LPPR4_uc010oue.1_Missense_Mutation_p.S489Y	p.S547Y	NM_014839	NP_055654	WXS	Illumina HiSeq	Unspecified	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1746	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	547					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.1640C>A	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453423	0.63290	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.29397	2.13;2.06;1.57	5.62	4.7	0.59300	.	0.483382	0.23863	N	0.043838	T	0.39436	0.1078	L	0.58810	1.83	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.70935	0.77;0.971	T	0.21895	-1.0232	9	.	.	.	-21.4944	14.4306	0.67246	0.0:0.9289:0.0:0.0711	.	489;547	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	Y	547;489;547;389	ENSP00000359204:S547Y;ENSP00000394913:S489Y;ENSP00000359203:S389Y	.	S	+	2	0	RP4-788L13.1	99544502	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.747000	0.74872	1.362000	0.46000	0.591000	0.81541	TCC		0.537	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			42	104	1	0	1.57019e-19	0.007835	2.79845e-19	42	104				
COL11A1	1301	broad.mit.edu	37	1	103449739	103449739	+	Silent	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:103449739A>T	ENST00000370096.3	-	31	2823	c.2511T>A	c.(2509-2511)ctT>ctA	p.L837L	COL11A1_ENST00000358392.2_Silent_p.L849L|COL11A1_ENST00000353414.4_Silent_p.L798L|COL11A1_ENST00000512756.1_Silent_p.L721L	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	837	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTGGAACTCCAAGTTTTCCCT	0.254																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(2509-2511)CTT>CTA		alpha 1 type XI collagen isoform A							63.0	63.0	63.0					1																	103449739		2203	4296	6499	SO:0001819	synonymous_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103449739A>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2511T>A	1.37:g.103449739A>T			Somatic				COL11A1_uc001duk.2_Nonsense_Mutation_p.L28*|COL11A1_uc001dum.2_Silent_p.L849L|COL11A1_uc001dun.2_Silent_p.L798L|COL11A1_uc009weh.2_Silent_p.L721L	p.L837L	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	31	2829	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	837			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	c.2511T>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	A	9.237	1.037335	0.19669	.	.	ENSG00000060718	ENST00000370090	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.224	0.73336	1.0:0.0:0.0:0.0	.	.	.	.	X	52	.	ENSP00000359108:L52X	L	-	2	0	COL11A1	103222327	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.629000	0.37071	2.171000	0.68590	0.528000	0.53228	TTG		0.254	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		7	8	0	0	0	0.001984	0	7	8				
VANGL1	81839	broad.mit.edu	37	1	116206606	116206606	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:116206606G>C	ENST00000355485.2	+	4	800	c.529G>C	c.(529-531)Gct>Cct	p.A177P	VANGL1_ENST00000310260.3_Missense_Mutation_p.A177P|VANGL1_ENST00000369509.1_Missense_Mutation_p.A177P|VANGL1_ENST00000369510.4_Missense_Mutation_p.A175P	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	177					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.F171fs*93(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CAAGCGGAGAGCTGACATGCC	0.488																																							uc001efv.1		NA																	1	Deletion - Frameshift(1)		kidney(1)	central_nervous_system(1)	1						c.(529-531)GCT>CCT		vang-like 1							194.0	202.0	199.0					1																	116206606		2203	4300	6503	SO:0001583	missense	81839				multicellular organismal development	integral to membrane	protein binding	g.chr1:116206606G>C	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.529G>C	1.37:g.116206606G>C	ENSP00000347672:p.Ala177Pro		Somatic				VANGL1_uc009wgy.1_Missense_Mutation_p.A175P|VANGL1_uc001efw.1_Missense_Mutation_p.A177P	p.A177P	NM_138959	NP_620409	WXS	Illumina HiSeq	Unspecified	Q8TAA9	VANG1_HUMAN		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)	4	800	+	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)	177			Cytoplasmic (Potential).		Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	ENST00000355485.2	37	c.529G>C	CCDS883.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150289	0.78001	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.92312	0.7561	M	0.85630	2.765	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.66847	0.912;0.947	D	0.92821	0.6272	10	0.72032	D	0.01	-10.1484	19.4118	0.94677	0.0:0.0:1.0:0.0	.	175;177	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	P	177;175;177;177	ENSP00000347672:A177P;ENSP00000358523:A175P;ENSP00000310800:A177P;ENSP00000358522:A177P	ENSP00000310800:A177P	A	+	1	0	VANGL1	116008129	1.000000	0.71417	0.589000	0.28718	0.520000	0.34377	7.531000	0.81973	2.662000	0.90505	0.650000	0.86243	GCT		0.488	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1			22	129	0	0	0	0.00278	0	22	129				
MTMR11	10903	broad.mit.edu	37	1	149907245	149907245	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:149907245G>C	ENST00000439741.2	-	4	522	c.272C>G	c.(271-273)cCc>cGc	p.P91R	MTMR11_ENST00000361405.6_Missense_Mutation_p.P91R|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000406732.3_Missense_Mutation_p.P63R|MTMR11_ENST00000369140.3_Missense_Mutation_p.P19R	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	91							phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			ACTGTTCAAGGGAGTGTCCTA	0.532																																							uc001etl.3		NA																	0				central_nervous_system(1)	1						c.(271-273)CCC>CGC		myotubularin related protein 11 isoform a							97.0	80.0	86.0					1																	149907245		2203	4300	6503	SO:0001583	missense	10903						phosphatase activity	g.chr1:149907245G>C	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.272C>G	1.37:g.149907245G>C	ENSP00000391668:p.Pro91Arg		Somatic				MTMR11_uc001etm.1_Missense_Mutation_p.P19R|MTMR11_uc010pbm.1_Missense_Mutation_p.P63R|MTMR11_uc010pbn.1_5'Flank|MTMR11_uc010pbo.1_RNA	p.P91R	NM_001145862	NP_001139334	WXS	Illumina HiSeq	Unspecified	A4FU01	MTMRB_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		4	523	-	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		91					B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	ENST00000439741.2	37	c.272C>G	CCDS53360.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295048	0.23564	.	.	ENSG00000014914	ENST00000369140;ENST00000439741;ENST00000361405;ENST00000406732	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.11	4.13	0.48395	.	0.234695	0.35466	N	0.003188	T	0.75398	0.3844	L	0.41236	1.265	0.39475	D	0.967791	D;D;P	0.53151	0.958;0.958;0.93	P;P;P	0.54312	0.563;0.748;0.564	T	0.74987	-0.3476	9	.	.	.	.	7.6703	0.28455	0.1146:0.0:0.8854:0.0	.	63;19;91	A4FU01-6;A4FU01-4;A4FU01	.;.;MTMRB_HUMAN	R	19;91;91;63	ENSP00000358136:P19R;ENSP00000391668:P91R;ENSP00000354941:P91R;ENSP00000383948:P63R	.	P	-	2	0	MTMR11	148173869	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	1.986000	0.40677	2.654000	0.90174	0.650000	0.86243	CCC		0.532	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873		26	28	0	0	0	0.00632	0	26	28				
LCE2D	353141	broad.mit.edu	37	1	152636902	152636902	+	Silent	SNP	G	G	T	rs562405396		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:152636902G>T	ENST00000368784.1	+	2	376	c.321G>T	c.(319-321)ggG>ggT	p.G107G		NM_178430.2	NP_848517.1	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	107	Cys-rich.				keratinization (GO:0031424)					large_intestine(1)|lung(7)|prostate(2)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACAGCTCTGGGGGCTGCTGCT	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		16277	0.0		0.0	False		,,,				2504	0.001						uc001fag.2		NA																	0					0						c.(319-321)GGG>GGT		late cornified envelope 2D							38.0	46.0	43.0					1																	152636902		2155	4253	6408	SO:0001819	synonymous_variant	353141				keratinization			g.chr1:152636902G>T	BI670513	CCDS1018.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000187223	ENSG00000187223		"""Late cornified envelopes"""	16518	protein-coding gene	gene with protein product		612612	"""small proline rich-like (epidermal differentiation complex) 1A"""	SPRL1A		11698679	Standard	NM_178430		Approved	LEP12	uc001fag.4	Q5TA82	OTTHUMG00000014400	ENST00000368784.1:c.321G>T	1.37:g.152636902G>T			Somatic					p.G107G	NM_178430	NP_848517	WXS	Illumina HiSeq	Unspecified	Q5TA82	LCE2D_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	376	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		107			Cys-rich.		A1L4M8	Silent	SNP	ENST00000368784.1	37	c.321G>T	CCDS1018.1																																																																																				0.592	LCE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040058.1	NM_178430		24	145	1	0	2.21704e-12	0.00278	3.42183e-12	24	145				
TDRD10	126668	broad.mit.edu	37	1	154519884	154519884	+	Splice_Site	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:154519884G>C	ENST00000368480.3	+	12	1037		c.e12-1		TDRD10_ENST00000368482.4_Splice_Site|TDRD10_ENST00000479937.1_Splice_Site			Q5VZ19	TDR10_HUMAN	tudor domain containing 10								nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTGTTTTGCAGACATTTTGAG	0.512																																							uc009wow.2		NA																	0				ovary(1)	1						c.e12-1		tudor domain containing 10 isoform a							186.0	138.0	154.0					1																	154519884		2203	4300	6503	SO:0001630	splice_region_variant	126668						nucleotide binding|RNA binding	g.chr1:154519884G>C	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.953-1G>C	1.37:g.154519884G>C			Somatic				TDRD10_uc001ffd.2_Splice_Site_p.D318_splice|TDRD10_uc001ffe.2_Splice_Site_p.D239_splice	p.D318_splice	NM_001098475	NP_001091945	WXS	Illumina HiSeq	Unspecified	Q5VZ19	TDR10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		12	1791	+	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)							A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Splice_Site	SNP	ENST00000368480.3	37	c.953_splice	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.450358	0.63290	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	.	.	.	4.93	2.91	0.33838	.	.	.	.	.	.	.	.	.	.	.	0.22156	N	0.999322	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0846	0.19960	0.2304:0.0:0.7696:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDRD10	152786508	0.993000	0.37304	0.007000	0.13788	0.961000	0.63080	3.974000	0.56852	1.316000	0.45131	0.655000	0.94253	.		0.512	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	Intron	10	79	0	0	0	0.008291	0	10	79				
INSRR	3645	broad.mit.edu	37	1	156811916	156811916	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:156811916C>A	ENST00000368195.3	-	19	3781	c.3385G>T	c.(3385-3387)Gtc>Ttc	p.V1129F	NTRK1_ENST00000392302.2_Missense_Mutation_p.T18K	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1129	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCGATCTTGACGGTGAAGTCC	0.587																																							uc010pht.1		NA																	0				lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(3385-3387)GTC>TTC		insulin receptor-related receptor precursor							105.0	91.0	96.0					1																	156811916		2203	4300	6503	SO:0001583	missense	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156811916C>A	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3385G>T	1.37:g.156811916C>A	ENSP00000357178:p.Val1129Phe		Somatic				NTRK1_uc001fqf.1_Missense_Mutation_p.T18K|NTRK1_uc009wsi.1_5'UTR	p.V1129F	NM_014215	NP_055030	WXS	Illumina HiSeq	Unspecified	P14616	INSRR_HUMAN			19	3639	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1129			Cytoplasmic (Potential).|Protein kinase.		O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	c.3385G>T	CCDS1160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.532960|4.532960	0.85812|0.85812	.|.	.|.	ENSG00000198400|ENSG00000027644	ENST00000392302|ENST00000368195	T|D	0.75477|0.86562	-0.94|-2.14	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.41823	.|D	.|0.000815	D|D	0.95166|0.95166	0.8433|0.8433	H|H	0.95365|0.95365	3.66|3.66	0.80722|0.80722	D|D	1|1	D|D	0.89917|0.89917	1.0|1.0	D|D	0.91635|0.97110	0.999|1.0	D|D	0.96308|0.96308	0.9226|0.9226	9|10	0.16420|0.87932	T|D	0.52|0	.|.	16.6498|16.6498	0.85186|0.85186	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	18|1129	A6NF12|P14616	.|INSRR_HUMAN	K|F	18|1129	ENSP00000376120:T18K|ENSP00000357178:V1129F	ENSP00000376120:T18K|ENSP00000357178:V1129F	T|V	+|-	2|1	0|0	NTRK1|INSRR	155078540|155078540	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.987000|0.987000	0.75469|0.75469	7.651000|7.651000	0.83577|0.83577	2.523000|2.523000	0.85059|0.85059	0.561000|0.561000	0.74099|0.74099	ACG|GTC		0.587	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		8	55	1	0	3.09899e-07	0.004482	3.99083e-07	8	55				
PEAR1	375033	broad.mit.edu	37	1	156876502	156876502	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:156876502C>A	ENST00000338302.3	+	7	699	c.474C>A	c.(472-474)ccC>ccA	p.P158P	PEAR1_ENST00000292357.7_Silent_p.P158P			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	158					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGTGTGATCCCAAGAGTGGGG	0.627																																							uc001fqj.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(472-474)CCC>CCA		platelet endothelial aggregation receptor 1							134.0	115.0	122.0					1																	156876502		2203	4300	6503	SO:0001819	synonymous_variant	375033					integral to membrane		g.chr1:156876502C>A	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.474C>A	1.37:g.156876502C>A			Somatic				PEAR1_uc009wsl.1_Silent_p.P20P|PEAR1_uc001fqk.1_5'UTR	p.P158P	NM_001080471	NP_001073940	WXS	Illumina HiSeq	Unspecified	Q5VY43	PEAR1_HUMAN			6	590	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		158					Q8TEK2	Silent	SNP	ENST00000338302.3	37	c.474C>A	CCDS30892.1																																																																																				0.627	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		68	69	1	0	2.92363e-43	0.00361	5.57822e-43	68	69				
PYHIN1	149628	broad.mit.edu	37	1	158913591	158913591	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:158913591T>C	ENST00000368140.1	+	6	1259	c.1014T>C	c.(1012-1014)aaT>aaC	p.N338N	PYHIN1_ENST00000368138.3_Silent_p.N329N|PYHIN1_ENST00000392252.3_Silent_p.N329N|PYHIN1_ENST00000392254.2_Silent_p.N338N|PYHIN1_ENST00000485134.1_3'UTR	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	338	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AAATTGTAAATAGGAAGACGA	0.343																																							uc001ftb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1012-1014)AAT>AAC		pyrin and HIN domain family, member 1 alpha 1							60.0	61.0	61.0					1																	158913591		2203	4300	6503	SO:0001819	synonymous_variant	149628				cell cycle	nuclear speck		g.chr1:158913591T>C	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1014T>C	1.37:g.158913591T>C			Somatic				PYHIN1_uc001ftc.2_Silent_p.N329N|PYHIN1_uc001ftd.2_Silent_p.N338N|PYHIN1_uc001fte.2_Silent_p.N329N	p.N338N	NM_152501	NP_689714	WXS	Illumina HiSeq	Unspecified	Q6K0P9	IFIX_HUMAN			6	1259	+	all_hematologic(112;0.0378)		338			HIN-200.		Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Silent	SNP	ENST00000368140.1	37	c.1014T>C	CCDS1178.1																																																																																				0.343	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		11	23	0	0	0	0.010729	0	11	23				
SLAMF9	89886	broad.mit.edu	37	1	159923135	159923135	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:159923135T>C	ENST00000368093.3	-	2	471	c.355A>G	c.(355-357)Atc>Gtc	p.I119V	SLAMF9_ENST00000368092.3_Missense_Mutation_p.I119V|SLAMF9_ENST00000466773.1_Intron	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	119						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATGGTAGAGATCTGGGATGTT	0.498																																							uc001fus.2		NA																	0				ovary(1)	1						c.(355-357)ATC>GTC		SLAM family member 9 isoform 1							181.0	164.0	170.0					1																	159923135		2203	4300	6503	SO:0001583	missense	89886					integral to membrane		g.chr1:159923135T>C	AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.355A>G	1.37:g.159923135T>C	ENSP00000357072:p.Ile119Val		Somatic				SLAMF9_uc009wtd.2_Missense_Mutation_p.I119V|SLAMF9_uc001fut.2_Intron	p.I119V	NM_033438	NP_254273	WXS	Illumina HiSeq	Unspecified	Q96A28	SLAF9_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		2	472	-	all_hematologic(112;0.093)		119			Extracellular (Potential).		Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	ENST00000368093.3	37	c.355A>G	CCDS1191.1	.	.	.	.	.	.	.	.	.	.	T	0.061	-1.224512	0.01530	.	.	ENSG00000162723	ENST00000368093;ENST00000368092	T;T	0.27890	3.48;1.64	5.28	-10.6	0.00265	Immunoglobulin subtype (1);	2.668540	0.01167	N	0.006791	T	0.03011	0.0089	N	0.12961	0.28	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.10450	0.0;0.005	T	0.14282	-1.0478	9	.	.	.	-5.9482	1.8387	0.03145	0.2943:0.2625:0.3212:0.122	.	119;119	Q96A28-2;Q96A28	.;SLAF9_HUMAN	V	119	ENSP00000357072:I119V;ENSP00000357071:I119V	.	I	-	1	0	SLAMF9	158189759	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.042000	0.01414	-3.385000	0.00174	-0.250000	0.11733	ATC		0.498	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060630.1	NM_033438		61	63	0	0	0	0.00361	0	61	63				
SLAMF1	6504	broad.mit.edu	37	1	160616670	160616670	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:160616670G>C	ENST00000302035.6	-	1	415	c.66C>G	c.(64-66)agC>agG	p.S22R	SLAMF1_ENST00000538290.1_Missense_Mutation_p.S22R|SLAMF1_ENST00000355199.3_Missense_Mutation_p.S22R|SLAMF1_ENST00000235739.5_Missense_Mutation_p.S22R	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	22					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CTGTTCCGTAGCTTGCCCCAA	0.557																																							uc001fwl.3		NA																	0				ovary(1)|breast(1)	2						c.(64-66)AGC>AGG		signaling lymphocytic activation molecule family							70.0	61.0	64.0					1																	160616670		2203	4300	6503	SO:0001583	missense	6504				interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity	g.chr1:160616670G>C	U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.66C>G	1.37:g.160616670G>C	ENSP00000306190:p.Ser22Arg		Somatic				SLAMF1_uc010pjk.1_RNA|SLAMF1_uc010pjl.1_RNA|SLAMF1_uc010pjm.1_RNA|SLAMF1_uc001fwm.2_Missense_Mutation_p.S22R	p.S22R	NM_003037	NP_003028	WXS	Illumina HiSeq	Unspecified	Q13291	SLAF1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0175)		1	412	-	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		22			Extracellular (Potential).		Q5W172|Q9HBE8	Missense_Mutation	SNP	ENST00000302035.6	37	c.66C>G	CCDS1207.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764257	0.31228	.	.	ENSG00000117090	ENST00000302035;ENST00000235739;ENST00000392208;ENST00000538290;ENST00000355199	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	3.57	3.57	0.40892	Signaling lymphocytic activation molecule, N-terminal (2);	0.485095	0.14458	U	0.318384	T	0.52322	0.1727	L	0.52011	1.625	0.35597	D	0.80753	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.43621	-0.9380	10	0.21540	T	0.41	0.0016	10.9936	0.47563	0.0:0.0:1.0:0.0	.	22;22	B4E2E4;Q13291	.;SLAF1_HUMAN	R	22	ENSP00000306190:S22R;ENSP00000235739:S22R;ENSP00000438406:S22R;ENSP00000347333:S22R	ENSP00000235739:S22R	S	-	3	2	SLAMF1	158883294	0.945000	0.32115	0.754000	0.31244	0.009000	0.06853	1.547000	0.36190	2.298000	0.77334	0.563000	0.77884	AGC		0.557	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060454.1			6	42	0	0	0	0.001168	0	6	42				
PVRL4	81607	broad.mit.edu	37	1	161049471	161049471	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:161049471G>A	ENST00000368012.3	-	2	650	c.348C>T	c.(346-348)aaC>aaT	p.N116N		NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	116	Ig-like V-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CCTGCACTGCGTTGCGCAGGA	0.701																																					NSCLC(76;1160 1387 14476 16172 29359)	NSCLC(76;1160 1387 14476 16172 29359)	uc001fxo.2		NA																	0				ovary(2)	2						c.(346-348)AAC>AAT		poliovirus receptor-related 4 precursor							18.0	19.0	19.0					1																	161049471		2190	4278	6468	SO:0001819	synonymous_variant	81607				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane		g.chr1:161049471G>A	AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.348C>T	1.37:g.161049471G>A			Somatic					p.N116N	NM_030916	NP_112178	WXS	Illumina HiSeq	Unspecified	Q96NY8	PVRL4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00165)		2	647	-	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		116			Ig-like V-type 1.|Extracellular (Potential).		B4DQW3|Q96K15	Silent	SNP	ENST00000368012.3	37	c.348C>T	CCDS1216.1																																																																																				0.701	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916		7	51	0	0	0	0.001984	0	7	51				
SLC9C2	284525	broad.mit.edu	37	1	173569280	173569280	+	Silent	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:173569280T>A	ENST00000367714.3	-	3	626	c.204A>T	c.(202-204)ggA>ggT	p.G68G	SLC9C2_ENST00000536496.1_Intron|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	68					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AGGCCATGTGTCCTATCACGA	0.343																																							uc001giz.2		NA																	0				ovary(2)	2						c.(202-204)GGA>GGT		solute carrier family 9, member 11							90.0	83.0	85.0					1																	173569280		2203	4300	6503	SO:0001819	synonymous_variant	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173569280T>A	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.204A>T	1.37:g.173569280T>A			Somatic				SLC9A11_uc010pmq.1_Intron	p.G68G	NM_178527	NP_848622	WXS	Illumina HiSeq	Unspecified	Q5TAH2	S9A11_HUMAN			3	627	-			68			Helical; (Potential).		Q86UF3	Silent	SNP	ENST00000367714.3	37	c.204A>T	CCDS1308.1																																																																																				0.343	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		30	30	0	0	0	0.004289	0	30	30				
CACNA1E	777	broad.mit.edu	37	1	181479632	181479632	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:181479632C>A	ENST00000367573.2	+	2	286	c.286C>A	c.(286-288)Ctg>Atg	p.L96M	CACNA1E_ENST00000357570.5_Missense_Mutation_p.L47M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.L47M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.L96M|CACNA1E_ENST00000360108.3_Missense_Mutation_p.L96M|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Missense_Mutation_p.L96M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	96					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GTACATGATCCTGGCCACCAT	0.537																																							uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(286-288)CTG>ATG		calcium channel, voltage-dependent, R type,							131.0	127.0	128.0					1																	181479632		2116	4230	6346	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181479632C>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.286C>A	1.37:g.181479632C>A	ENSP00000356545:p.Leu96Met		Somatic				CACNA1E_uc009wxr.2_Missense_Mutation_p.L3M|CACNA1E_uc009wxs.2_Missense_Mutation_p.L3M	p.L96M	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			2	451	+			96			I.|Helical; Name=S1 of repeat I.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.286C>A	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390622	0.62066	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	T;T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	5.42	0.115	0.14643	.	0.110599	0.45361	D	0.000370	D	0.82356	0.5019	M	0.75150	2.29	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.79603	-0.1735	10	0.48119	T	0.1	.	10.148	0.42776	0.0:0.7002:0.0:0.2998	.	96;96	Q15878-2;Q15878-3	.;.	M	96;96;96;47;47;96;96	ENSP00000432038:L96M;ENSP00000356542:L96M;ENSP00000434814:L96M;ENSP00000350183:L47M;ENSP00000351101:L47M;ENSP00000353222:L96M;ENSP00000356545:L96M	ENSP00000350183:L47M	L	+	1	2	CACNA1E	179746255	0.995000	0.38212	0.978000	0.43139	0.981000	0.71138	0.894000	0.28350	-0.028000	0.13850	0.561000	0.74099	CTG		0.537	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		5	37	1	0	0.000602214	0.000602	0.000670085	5	37				
NCF2	4688	broad.mit.edu	37	1	183536055	183536055	+	Splice_Site	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:183536055C>A	ENST00000367535.3	-	9	1175	c.924G>T	c.(922-924)caG>caT	p.Q308H	NCF2_ENST00000418089.1_Splice_Site_p.Q227H|NCF2_ENST00000367536.1_Splice_Site_p.Q308H|NCF2_ENST00000469280.1_5'Flank|NCF2_ENST00000413720.1_Splice_Site_p.Q263H	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	308					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	ATCACATTACCTGGGGCTGCT	0.542																																							uc001gqj.3		NA																	0				ovary(3)	3						c.(922-924)CAG>CAT		neutrophil cytosolic factor 2							92.0	79.0	83.0					1																	183536055		2203	4300	6503	SO:0001630	splice_region_variant	4688				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding	g.chr1:183536055C>A	BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.924+1G>T	1.37:g.183536055C>A			Somatic				NCF2_uc010pod.1_Missense_Mutation_p.Q263H|NCF2_uc010poe.1_Missense_Mutation_p.Q227H|NCF2_uc001gqk.3_Missense_Mutation_p.Q308H	p.Q308H	NM_000433	NP_000424	WXS	Illumina HiSeq	Unspecified	P19878	NCF2_HUMAN			9	1199	-			308					B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	ENST00000367535.3	37	c.924G>T	CCDS1356.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798682	0.70567	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535;ENST00000419402	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	4.98	4.98	0.66077	Src homology-3 domain (1);	0.485925	0.23000	N	0.053087	T	0.56381	0.1981	M	0.77820	2.39	0.32743	N	0.507417	D;D;D	0.71674	0.998;0.997;0.988	D;P;P	0.74023	0.982;0.813;0.825	T	0.67795	-0.5578	9	.	.	.	-48.7149	15.4312	0.75102	0.0:1.0:0.0:0.0	.	227;263;308	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	H	308;380;263;227;308;47	ENSP00000356506:Q308H;ENSP00000399294:Q263H;ENSP00000407217:Q227H;ENSP00000356505:Q308H;ENSP00000406198:Q47H	.	Q	-	3	2	NCF2	181802678	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.458000	0.53014	2.320000	0.78422	0.655000	0.94253	CAG		0.542	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085483.1	NM_000433	Missense_Mutation	32	45	1	0	3.62531e-18	0.004289	6.28117e-18	32	45				
TPR	7175	broad.mit.edu	37	1	186324788	186324788	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:186324788C>A	ENST00000367478.4	-	16	2297	c.2001G>T	c.(1999-2001)gaG>gaT	p.E667D	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	667					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CAGCCTTAGCCTCTATAGCCT	0.413			T	NTRK1	papillary thyroid																																		uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		0				ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(1999-2001)GAG>GAT		nuclear pore complex-associated protein TPR							132.0	127.0	129.0					1																	186324788		1915	4130	6045	SO:0001583	missense	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186324788C>A	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2001G>T	1.37:g.186324788C>A	ENSP00000356448:p.Glu667Asp		Somatic					p.E667D	NM_003292	NP_003283	WXS	Illumina HiSeq	Unspecified	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	16	2298	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	667			Potential.		Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	c.2001G>T	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647668	0.67358	.	.	ENSG00000047410	ENST00000367478	T	0.17213	2.29	5.22	0.376	0.16193	.	0.050974	0.85682	D	0.000000	T	0.14056	0.0340	L	0.43757	1.38	0.44754	D	0.997754	P	0.52170	0.951	P	0.46718	0.525	T	0.18178	-1.0345	10	0.22109	T	0.4	.	5.759	0.18188	0.1243:0.3693:0.0:0.5064	.	667	P12270	TPR_HUMAN	D	667	ENSP00000356448:E667D	ENSP00000356448:E667D	E	-	3	2	TPR	184591411	0.739000	0.28196	0.989000	0.46669	0.835000	0.47333	-0.226000	0.09139	-0.112000	0.11979	-0.469000	0.05056	GAG		0.413	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		15	88	1	0	1.3612e-06	0.003163	1.72438e-06	15	88				
F13B	2165	broad.mit.edu	37	1	197026449	197026449	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:197026449C>T	ENST00000367412.1	-	6	995	c.952G>A	c.(952-954)Gat>Aat	p.D318N		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	318	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						CATTTTCCATCTTCACAACGT	0.358																																							uc001gtt.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(952-954)GAT>AAT		coagulation factor XIII B subunit precursor							194.0	182.0	186.0					1																	197026449		2203	4300	6503	SO:0001583	missense	2165				blood coagulation	extracellular region		g.chr1:197026449C>T	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.952G>A	1.37:g.197026449C>T	ENSP00000356382:p.Asp318Asn		Somatic					p.D318N	NM_001994	NP_001985	WXS	Illumina HiSeq	Unspecified	P05160	F13B_HUMAN			6	996	-			318			Sushi 5.		A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	37	c.952G>A	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	C	0.186	-1.057873	0.01965	.	.	ENSG00000143278	ENST00000367412	T	0.63913	-0.07	5.64	1.84	0.25277	Complement control module (2);Sushi/SCR/CCP (3);	0.229565	0.22329	N	0.061481	T	0.21761	0.0524	N	0.00841	-1.15	0.09310	N	0.999994	B	0.02656	0.0	B	0.09377	0.004	T	0.35101	-0.9802	10	0.02654	T	1	.	6.0913	0.19995	0.0:0.1779:0.2374:0.5847	.	318	P05160	F13B_HUMAN	N	318	ENSP00000356382:D318N	ENSP00000356382:D318N	D	-	1	0	F13B	195293072	0.995000	0.38212	0.997000	0.53966	0.349000	0.29174	0.649000	0.24843	0.406000	0.25560	-0.247000	0.11927	GAT		0.358	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		12	92	0	0	0	0.010729	0	12	92				
NFASC	23114	broad.mit.edu	37	1	204985633	204985633	+	Missense_Mutation	SNP	C	C	T	rs376304938		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:204985633C>T	ENST00000401399.1	+	29	3888	c.3689C>T	c.(3688-3690)aCg>aTg	p.T1230M	NFASC_ENST00000404907.1_Missense_Mutation_p.T1164M|NFASC_ENST00000360049.4_Missense_Mutation_p.T1159M|NFASC_ENST00000367169.4_Missense_Mutation_p.T1061M|NFASC_ENST00000513543.1_Missense_Mutation_p.T1159M|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000338515.6_Missense_Mutation_p.T1247M|NFASC_ENST00000404076.1_Missense_Mutation_p.T1147M|NFASC_ENST00000339876.6_Missense_Mutation_p.T1230M|NFASC_ENST00000367172.4_Missense_Mutation_p.T1337M|NFASC_ENST00000338586.6_Missense_Mutation_p.T1214M|NFASC_ENST00000367171.4_Missense_Mutation_p.T1322M|NFASC_ENST00000539706.1_Missense_Mutation_p.T1164M|NFASC_ENST00000367170.4_Missense_Mutation_p.T1258M			O94856	NFASC_HUMAN	neurofascin	1337					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCAGAGGCCACGTCACCTGTC	0.562																																							uc001hbj.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(3688-3690)ACG>ATG		neurofascin isoform 1 precursor		C	MET/THR,MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	171.0	149.0	156.0		3689,3536,3491,3476	5.3	1.0	1		156	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	NFASC	NM_001005388.2,NM_001160331.1,NM_001160332.1,NM_015090.3	81,81,81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1230/1241,1179/1190,1164/1175,1159/1170	204985633	1,13005	2203	4300	6503	SO:0001583	missense	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204985633C>T	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3689C>T	1.37:g.204985633C>T	ENSP00000385637:p.Thr1230Met		Somatic				NFASC_uc010pra.1_Missense_Mutation_p.T1164M|NFASC_uc001hbi.2_Missense_Mutation_p.T1159M|NFASC_uc010prb.1_Missense_Mutation_p.T1179M|NFASC_uc010prc.1_Missense_Mutation_p.T730M|NFASC_uc001hbl.1_Missense_Mutation_p.T306M|NFASC_uc001hbm.1_Missense_Mutation_p.T253M|NFASC_uc009xbh.1_Missense_Mutation_p.R85C|NFASC_uc001hbo.1_Missense_Mutation_p.R106C	p.T1230M	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		30	4017	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		1337			Cytoplasmic (Potential).		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	c.3689C>T	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.799290|4.799290	0.90538|0.90538	0.0|0.0	1.16E-4|1.16E-4	ENSG00000163531|ENSG00000163531	ENST00000367173;ENST00000425360|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000447819	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.79653	.|-0.39;-0.45;-0.29;-0.32;-0.43;-0.36;-0.19;-0.2;-0.26;-0.28;-0.43;-0.19;-0.2;-0.19;-1.29	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|0.000000	.|0.52532	.|D	.|0.000073	D|D	0.88887|0.88887	0.6559|0.6559	M|M	0.68593|0.68593	2.085|2.085	0.32822|0.32822	D|D	0.502928|0.502928	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;0.998;0.999;1.0;0.999	.|D;D;D;D;D;D;D	.|0.74348	.|0.962;0.975;0.949;0.954;0.949;0.983;0.921	D|D	0.91230|0.91230	0.5013|0.5013	5|10	.|0.66056	.|D	.|0.02	.|.	18.6493|18.6493	0.91425|0.91425	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1337;1179;1164;1214;1056;1230;1159	.|O94856;O94856-11;O94856-8;F8W8X7;O94856-4;O94856-9;O94856-3	.|NFASC_HUMAN;.;.;.;.;.;.	C|M	1031;288|1337;1322;1258;1247;1230;1214;1179;1164;1159;1061;1147;1230;1164;1159;1155;208	.|ENSP00000356140:T1337M;ENSP00000356139:T1322M;ENSP00000356138:T1258M;ENSP00000342128:T1247M;ENSP00000344786:T1230M;ENSP00000343509:T1214M;ENSP00000438614:T1164M;ENSP00000353154:T1159M;ENSP00000356137:T1061M;ENSP00000385676:T1147M;ENSP00000385637:T1230M;ENSP00000384061:T1164M;ENSP00000425908:T1159M;ENSP00000415031:T1155M;ENSP00000416891:T208M	.|ENSP00000295776:T1179M	R|T	+|+	1|2	0|0	NFASC|NFASC	203252256|203252256	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.994000|0.994000	0.84299|0.84299	7.792000|7.792000	0.85828|0.85828	2.484000|2.484000	0.83849|0.83849	0.563000|0.563000	0.77884|0.77884	CGT|ACG		0.562	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		35	47	0	0	0	0.003755	0	35	47				
TRAF5	7188	broad.mit.edu	37	1	211534059	211534059	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:211534059T>C	ENST00000261464.5	+	6	613	c.559T>C	c.(559-561)Ttg>Ctg	p.L187L	TRAF5_ENST00000367004.3_Silent_p.L187L|TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000336184.2_Silent_p.L187L	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	187					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TGAGGAAAACTTGTGTCCTGA	0.368																																							uc001hih.2		NA																	0				lung(2)|breast(2)|ovary(1)	5						c.(559-561)TTG>CTG		TNF receptor-associated factor 5							115.0	104.0	108.0					1																	211534059		2203	4300	6503	SO:0001819	synonymous_variant	7188				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:211534059T>C	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.559T>C	1.37:g.211534059T>C			Somatic				TRAF5_uc001hii.2_Silent_p.L187L|TRAF5_uc010psx.1_Silent_p.L198L|TRAF5_uc010psy.1_Intron|TRAF5_uc001hij.2_Silent_p.L187L	p.L187L	NM_004619	NP_004610	WXS	Illumina HiSeq	Unspecified	O00463	TRAF5_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)	6	619	+			187			TRAF-type 2.		B4DIS9|B4E0A2|Q6FHY1	Silent	SNP	ENST00000261464.5	37	c.559T>C	CCDS1497.1																																																																																				0.368	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619		7	43	0	0	0	0.00308	0	7	43				
TMEM206	55248	broad.mit.edu	37	1	212553283	212553283	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:212553283C>T	ENST00000261455.4	-	5	729	c.592G>A	c.(592-594)Gcc>Acc	p.A198T	TMEM206_ENST00000535273.1_Missense_Mutation_p.A259T	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	198						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TAATCAATGGCGCTGAAGTCC	0.502																																							uc001hjc.3		NA																	0				breast(1)	1						c.(592-594)GCC>ACC		transmembrane protein 206							97.0	102.0	101.0					1																	212553283		2203	4300	6503	SO:0001583	missense	55248					integral to membrane		g.chr1:212553283C>T	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.592G>A	1.37:g.212553283C>T	ENSP00000261455:p.Ala198Thr		Somatic				TMEM206_uc010pte.1_Missense_Mutation_p.A259T	p.A198T	NM_018252	NP_060722	WXS	Illumina HiSeq	Unspecified	Q9H813	TM206_HUMAN		all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)	5	760	-			198			Extracellular (Potential).		B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	37	c.592G>A	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	C	30	5.053230	0.93793	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.57	5.57	0.84162	.	0.045929	0.85682	N	0.000000	T	0.72819	0.3508	L	0.34521	1.04	0.80722	D	1	D;P	0.89917	1.0;0.954	D;B	0.87578	0.998;0.418	T	0.74985	-0.3477	9	0.72032	D	0.01	-7.2029	19.5995	0.95554	0.0:1.0:0.0:0.0	.	259;198	B7Z4D6;Q9H813	.;TM206_HUMAN	T	198;259	.	ENSP00000261455:A198T	A	-	1	0	TMEM206	210619906	1.000000	0.71417	0.992000	0.48379	0.947000	0.59692	7.304000	0.78882	2.635000	0.89317	0.650000	0.86243	GCC		0.502	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252		9	96	0	0	0	0.006214	0	9	96				
PTPN14	5784	broad.mit.edu	37	1	214575100	214575100	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:214575100T>C	ENST00000366956.5	-	7	791	c.597A>G	c.(595-597)gcA>gcG	p.A199A	PTPN14_ENST00000543945.1_Intron	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	199	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GTTCAGCTTCTGCTGGCAGGA	0.443																																					Colon(92;557 1424 24372 34121 40073)	Colon(92;557 1424 24372 34121 40073)	uc001hkk.1		NA																	0				breast(2)|ovary(1)|kidney(1)|skin(1)	5						c.(595-597)GCA>GCG		protein tyrosine phosphatase, non-receptor type							134.0	136.0	135.0					1																	214575100		2203	4300	6503	SO:0001819	synonymous_variant	5784				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding	g.chr1:214575100T>C	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.597A>G	1.37:g.214575100T>C			Somatic				PTPN14_uc010pty.1_Silent_p.A100A	p.A199A	NM_005401	NP_005392	WXS	Illumina HiSeq	Unspecified	Q15678	PTN14_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)	7	868	-			199			FERM.		Q5VSI0	Silent	SNP	ENST00000366956.5	37	c.597A>G	CCDS1514.1																																																																																				0.443	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401		65	60	0	0	0	0.00361	0	65	60				
USH2A	7399	broad.mit.edu	37	1	216420066	216420067	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:216420066_216420067GG>TT	ENST00000307340.3	-	13	3055_3056	c.2669_2670CC>AA	c.(2668-2670)aCC>aAA	p.T890K	USH2A_ENST00000366943.2_Missense_Mutation_p.T890K|USH2A_ENST00000366942.3_Missense_Mutation_p.T890K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	890	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AATTGTCAATGGTCAAATTGTA	0.475										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(2668-2670)ACC>AAA		usherin isoform B																																				SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216420066_216420067GG>TT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2669_2670delinsTT	1.37:g.216420066_216420067delinsTT	ENSP00000305941:p.Thr890Lys	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.T890K	p.T890K	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	13	3056_3057	-			890			Laminin EGF-like 7.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	DNP	ENST00000307340.3	37	c.2669_2670CC>AA	CCDS31025.1																																																																																				0.475	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		22	200	0	0	0	0.004672	0	22	200				
FBXO28	23219	broad.mit.edu	37	1	224318265	224318265	+	Missense_Mutation	SNP	T	T	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:224318265T>G	ENST00000366862.5	+	2	402	c.359T>G	c.(358-360)gTt>gGt	p.V120G	FBXO28_ENST00000424254.2_Missense_Mutation_p.V120G	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	120										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		CAGAAACAAGTTAAAGCACAA	0.393																																							uc001hoh.2		NA																	0				ovary(2)|kidney(2)|lung(1)	5						c.(358-360)GTT>GGT		F-box protein 28 isoform a							143.0	129.0	134.0					1																	224318265		2203	4300	6503	SO:0001583	missense	23219							g.chr1:224318265T>G	AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.359T>G	1.37:g.224318265T>G	ENSP00000355827:p.Val120Gly		Somatic				FBXO28_uc009xef.2_Missense_Mutation_p.V120G|FBXO28_uc010pvc.1_5'UTR	p.V120G	NM_015176	NP_055991	WXS	Illumina HiSeq	Unspecified	Q9NVF7	FBX28_HUMAN		GBM - Glioblastoma multiforme(131;0.0363)	2	400	+	Breast(184;0.206)		120					E9PEM8|O75070	Missense_Mutation	SNP	ENST00000366862.5	37	c.359T>G	CCDS1539.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284511	0.80803	.	.	ENSG00000143756	ENST00000366862;ENST00000424254	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.74473	0.3721	L	0.55990	1.75	0.80722	D	1	D;D	0.76494	0.999;0.967	D;D	0.78314	0.991;0.927	T	0.77040	-0.2735	9	0.87932	D	0	-13.8276	13.5268	0.61599	0.0:0.0:0.0:1.0	.	120;120	E9PEM8;Q9NVF7	.;FBX28_HUMAN	G	120	.	ENSP00000355827:V120G	V	+	2	0	FBXO28	222384888	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.495000	0.81514	2.140000	0.66376	0.533000	0.62120	GTT		0.393	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176		23	24	0	0	0	0.012319	0	23	24				
NID1	4811	broad.mit.edu	37	1	236175324	236175324	+	Silent	SNP	T	T	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:236175324T>G	ENST00000264187.6	-	12	2506	c.2424A>C	c.(2422-2424)ccA>ccC	p.P808P	NID1_ENST00000366595.3_Intron	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	808	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GACATCGGCTTGGCTGGCATT	0.507																																							uc001hxo.2		NA																	0				large_intestine(1)|pancreas(1)	2						c.(2422-2424)CCA>CCC		nidogen 1 precursor	Becaplermin(DB00102)|Urokinase(DB00013)						107.0	88.0	94.0					1																	236175324		2203	4300	6503	SO:0001819	synonymous_variant	4811				cell-matrix adhesion	basement membrane	calcium ion binding	g.chr1:236175324T>G	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2424A>C	1.37:g.236175324T>G			Somatic				NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_5'UTR	p.P808P	NM_002508	NP_002499	WXS	Illumina HiSeq	Unspecified	P14543	NID1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		12	2526	-	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	808			EGF-like 5; calcium-binding (Potential).		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	c.2424A>C	CCDS1608.1																																																																																				0.507	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508		4	66	0	0	0	0.001168	0	4	66				
ACTN2	88	broad.mit.edu	37	1	236881227	236881227	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:236881227T>A	ENST00000366578.4	+	2	362	c.196T>A	c.(196-198)Ttc>Atc	p.F66I	ACTN2_ENST00000542672.1_Missense_Mutation_p.F66I|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	66	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CGAGGAAGACTTCAGGAATGG	0.463																																							uc001hyf.2		NA																	0				ovary(4)|skin(1)	5						c.(196-198)TTC>ATC		actinin, alpha 2							176.0	153.0	161.0					1																	236881227		2203	4300	6503	SO:0001583	missense	88				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding	g.chr1:236881227T>A	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.196T>A	1.37:g.236881227T>A	ENSP00000355537:p.Phe66Ile		Somatic				ACTN2_uc001hyg.2_5'UTR|ACTN2_uc009xgi.1_Missense_Mutation_p.F66I	p.F66I	NM_001103	NP_001094	WXS	Illumina HiSeq	Unspecified	P35609	ACTN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00168)		2	400	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	66			CH 1.|Actin-binding.		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	c.196T>A	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.829378	0.90955	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	T;T	0.59224	0.28;0.28	5.61	5.61	0.85477	Calponin homology domain (5);	0.043639	0.85682	D	0.000000	T	0.66963	0.2843	L	0.48935	1.535	0.80722	D	1	P;B	0.48089	0.905;0.078	P;B	0.58013	0.831;0.166	T	0.69870	-0.5028	10	0.87932	D	0	.	14.7935	0.69860	0.0:0.0:0.0:1.0	.	66;66	B2RCS5;P35609	.;ACTN2_HUMAN	I	66	ENSP00000443495:F66I;ENSP00000355537:F66I	ENSP00000355537:F66I	F	+	1	0	ACTN2	234947850	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.088000	0.71371	2.145000	0.66743	0.528000	0.53228	TTC		0.463	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		24	27	0	0	0	0.00333	0	24	27				
RYR2	6262	broad.mit.edu	37	1	237729937	237729937	+	Silent	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:237729937A>T	ENST00000366574.2	+	28	3602	c.3285A>T	c.(3283-3285)gcA>gcT	p.A1095A	RYR2_ENST00000542537.1_Silent_p.A1079A|RYR2_ENST00000360064.6_Silent_p.A1093A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1095	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGACCTATGCAGTGAAGGCCG	0.557																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(3283-3285)GCA>GCT		cardiac muscle ryanodine receptor							122.0	121.0	122.0					1																	237729937		1944	4140	6084	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237729937A>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3285A>T	1.37:g.237729937A>T			Somatic					p.A1095A	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		28	3405	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1095			Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.3285A>T	CCDS55691.1																																																																																				0.557	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		77	79	0	0	0	0.00361	0	77	79				
RYR2	6262	broad.mit.edu	37	1	237813181	237813181	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:237813181C>T	ENST00000366574.2	+	50	7834	c.7517C>T	c.(7516-7518)gCt>gTt	p.A2506V	RYR2_ENST00000542537.1_Missense_Mutation_p.A2490V|RYR2_ENST00000360064.6_Missense_Mutation_p.A2504V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2506	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTCAGGCAGCTTTGAGTGCT	0.458																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(7516-7518)GCT>GTT		cardiac muscle ryanodine receptor							111.0	106.0	108.0					1																	237813181		1959	4133	6092	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237813181C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7517C>T	1.37:g.237813181C>T	ENSP00000355533:p.Ala2506Val		Somatic					p.A2506V	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		50	7637	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2506			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.7517C>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398621	0.42512	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96491	-4.03;-4.03;-4.03	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000013	D	0.93048	0.7787	N	0.11000	0.08	0.80722	D	1	D	0.59357	0.985	P	0.48400	0.576	D	0.92200	0.5767	10	0.25751	T	0.34	-11.7489	19.7098	0.96094	0.0:1.0:0.0:0.0	.	2506	Q92736	RYR2_HUMAN	V	2506;2504;2490	ENSP00000355533:A2506V;ENSP00000353174:A2504V;ENSP00000443798:A2490V	ENSP00000353174:A2504V	A	+	2	0	RYR2	235879804	0.998000	0.40836	1.000000	0.80357	0.796000	0.44982	3.934000	0.56553	2.713000	0.92767	0.655000	0.94253	GCT		0.458	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		24	120	0	0	0	0.00333	0	24	120				
RYR2	6262	broad.mit.edu	37	1	237947313	237947313	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:237947313C>A	ENST00000366574.2	+	90	12618	c.12301C>A	c.(12301-12303)Ctt>Att	p.L4101I	RYR2_ENST00000542537.1_Missense_Mutation_p.L4085I|RYR2_ENST00000360064.6_Missense_Mutation_p.L4107I|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4101					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGTCGCCGTCCTTCTGACAAA	0.517																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12301-12303)CTT>ATT		cardiac muscle ryanodine receptor							49.0	49.0	49.0					1																	237947313		1998	4198	6196	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947313C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12301C>A	1.37:g.237947313C>A	ENSP00000355533:p.Leu4101Ile		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.L516I	p.L4101I	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12421	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4101					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12301C>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848973	0.71603	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.98968	-5.28;-5.28;-5.28	5.62	5.62	0.85841	.	0.000000	0.52532	D	0.000072	D	0.99086	0.9686	M	0.75615	2.305	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.83275	0.99;0.996	D	0.99880	1.1112	10	0.87932	D	0	.	19.6415	0.95760	0.0:1.0:0.0:0.0	.	1075;4101	B4DGV4;Q92736	.;RYR2_HUMAN	I	4101;4107;4085;1075	ENSP00000355533:L4101I;ENSP00000353174:L4107I;ENSP00000443798:L4085I	ENSP00000353174:L4107I	L	+	1	0	RYR2	236013936	0.993000	0.37304	0.103000	0.21229	0.684000	0.39900	2.062000	0.41413	2.651000	0.90000	0.561000	0.74099	CTT		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		19	22	1	0	2.94398e-08	0.007413	3.98945e-08	19	22				
ZP4	57829	broad.mit.edu	37	1	238049109	238049109	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:238049109G>C	ENST00000366570.4	-	7	1075	c.917C>G	c.(916-918)cCc>cGc	p.P306R	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	306	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CTCAGGAAAGGGTGGTGGGAG	0.502																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(916-918)CCC>CGC		zona pellucida glycoprotein 4 preproprotein							153.0	148.0	149.0					1																	238049109		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238049109G>C	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.917C>G	1.37:g.238049109G>C	ENSP00000355529:p.Pro306Arg		Somatic				LOC100130331_uc010pyc.1_Intron	p.P306R	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		7	917	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	306			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.917C>G	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526175	0.44969	.	.	ENSG00000116996	ENST00000366570	D	0.82081	-1.57	4.55	4.55	0.56014	Zona pellucida sperm-binding protein (3);	0.060224	0.64402	D	0.000002	D	0.92270	0.7548	M	0.90309	3.105	0.50313	D	0.999865	D	0.89917	1.0	D	0.91635	0.999	D	0.93626	0.6952	10	0.62326	D	0.03	-25.3063	15.1812	0.72960	0.0:0.0:1.0:0.0	.	306	Q12836	ZP4_HUMAN	R	306	ENSP00000355529:P306R	ENSP00000355529:P306R	P	-	2	0	ZP4	236115732	1.000000	0.71417	0.444000	0.26895	0.208000	0.24298	3.576000	0.53878	2.242000	0.73789	0.650000	0.86243	CCC		0.502	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			42	38	0	0	0	0.006999	0	42	38				
WDR64	128025	broad.mit.edu	37	1	241912881	241912881	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:241912881C>A	ENST00000366552.2	+	13	1804	c.1597C>A	c.(1597-1599)Cag>Aag	p.Q533K	WDR64_ENST00000437684.2_Missense_Mutation_p.Q533K	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	533										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TGGCAGTGGGCAGGAGATGAA	0.493																																							uc001hzf.1		NA																	0				skin(1)	1						c.(757-759)CAG>AAG		WD repeat domain 64							127.0	129.0	128.0					1																	241912881		2203	4300	6503	SO:0001583	missense	128025							g.chr1:241912881C>A	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1597C>A	1.37:g.241912881C>A	ENSP00000355510:p.Gln533Lys		Somatic				WDR64_uc001hzg.1_5'UTR	p.Q253K	NM_144625	NP_653226	WXS	Illumina HiSeq	Unspecified	B1ANS9	WDR64_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0116)		8	910	+	Ovarian(103;0.103)	all_cancers(173;0.0121)	533			WD 7.		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37	c.757C>A		.	.	.	.	.	.	.	.	.	.	C	13.88	2.369391	0.42003	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.36520	2.31;1.25;5.18	6.06	5.14	0.70334	.	0.280145	0.31134	N	0.008197	T	0.29882	0.0747	L	0.41236	1.265	0.34796	D	0.736231	B	0.13145	0.007	B	0.15052	0.012	T	0.32375	-0.9909	10	0.18710	T	0.47	-9.3547	14.0741	0.64880	0.151:0.849:0.0:0.0	.	253	D1MPS4	.	K	533;533;304	ENSP00000355510:Q533K;ENSP00000402446:Q533K;ENSP00000406656:Q304K	ENSP00000355510:Q533K	Q	+	1	0	WDR64	239979504	0.989000	0.36119	0.985000	0.45067	0.987000	0.75469	3.012000	0.49575	1.558000	0.49541	0.655000	0.94253	CAG		0.493	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625		35	62	1	0	3.62531e-18	0.004289	6.28117e-18	35	62				
PLD5	200150	broad.mit.edu	37	1	242511458	242511458	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:242511458C>T	ENST00000536534.2	-	2	517	c.276G>A	c.(274-276)atG>atA	p.M92I	PLD5_ENST00000427495.1_Missense_Mutation_p.M30I|PLD5_ENST00000442594.2_5'UTR			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	92						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CATCCTCTCCCATGATGTCCA	0.458																																							uc001hzn.1		NA																	0				ovary(6)	6						c.(274-276)ATG>ATA		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							103.0	97.0	99.0					1																	242511458		2203	4298	6501	SO:0001583	missense	200150					integral to membrane	catalytic activity	g.chr1:242511458C>T	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.276G>A	1.37:g.242511458C>T	ENSP00000440896:p.Met92Ile		Somatic				PLD5_uc001hzl.3_Missense_Mutation_p.M30I|PLD5_uc001hzm.3_5'UTR|PLD5_uc001hzo.1_5'UTR	p.M92I			WXS	Illumina HiSeq	Unspecified	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		2	403	-	Melanoma(84;0.242)		92					A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	c.276G>A	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	10.83	1.462442	0.26248	.	.	ENSG00000180287	ENST00000427495;ENST00000536534;ENST00000459864	T;T;T	0.35605	1.3;1.3;1.3	5.24	4.31	0.51392	.	.	.	.	.	T	0.28699	0.0711	L	0.34521	1.04	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.11348	-1.0591	9	0.87932	D	0	.	11.7564	0.51878	0.0:0.912:0.0:0.088	.	92;30	Q8N7P1;Q8N7P1-4	PLD5_HUMAN;.	I	30;92;30	ENSP00000401285:M30I;ENSP00000440896:M92I;ENSP00000438191:M30I	ENSP00000314748:M30I	M	-	3	0	PLD5	240578081	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.413000	0.66399	2.609000	0.88269	0.655000	0.94253	ATG		0.458	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		47	67	0	0	0	0.00361	0	47	67				
OR2W3	343171	broad.mit.edu	37	1	248059128	248059128	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:248059128G>A	ENST00000360358.3	+	1	240	c.240G>A	c.(238-240)caG>caA	p.Q80Q	OR2W3_ENST00000537741.1_Silent_p.Q80Q	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCATCCCCCAGCTGCTCTACA	0.587																																							uc001idp.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(238-240)CAG>CAA		olfactory receptor, family 2, subfamily W,							169.0	134.0	146.0					1																	248059128		2203	4300	6503	SO:0001819	synonymous_variant	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059128G>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.240G>A	1.37:g.248059128G>A			Somatic				OR2W3_uc010pzb.1_Silent_p.Q80Q	p.Q80Q	NM_001001957	NP_001001957	WXS	Illumina HiSeq	Unspecified	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	509	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		80			Extracellular (Potential).		Q6IF06|Q8NG86	Silent	SNP	ENST00000360358.3	37	c.240G>A	CCDS31099.1																																																																																				0.587	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		29	174	0	0	0	0.00632	0	29	174				
OR2L13	284521	broad.mit.edu	37	1	248154045	248154045	+	Intron	SNP	C	C	T	rs115826103	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:248154045C>T	ENST00000366478.2	+	1	194					NM_175911.2	NP_787107.1	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TGTGCTCACACGGTATATGCA	0.463													.|||	12	0.00239617	0.0061	0.0	5008	,	,		23133	0.0		0.0	False		,,,				2504	0.0041						uc001idv.1		NA																	0					0						c.(232-234)ACG>ATG		RecName: Full=Olfactory receptor 2L5; AltName: Full=Olfactory receptor OR1-53;																																				SO:0001627	intron_variant	26247							g.chr1:248154045C>T	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000366478.2:c.-144+53359C>T	1.37:g.248154045C>T			Somatic				OR2L13_uc001ids.2_Intron	p.T78M	NR_002145		WXS	Illumina HiSeq	Unspecified					1	477	+								Q5VUR5	Missense_Mutation	SNP	ENST00000366478.2	37	c.233C>T	CCDS1637.1																																																																																				0.463	OR2L13-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_175911		49	67	0	0	0	0.00361	0	49	67				
OR2L2	26246	broad.mit.edu	37	1	248202247	248202247	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:248202247C>G	ENST00000366479.2	+	1	774	c.678C>G	c.(676-678)cgC>cgG	p.R226R	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTGTCTACCGCATGCACTCTG	0.483																																							uc001idw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(676-678)CGC>CGG		olfactory receptor, family 2, subfamily L,							246.0	217.0	227.0					1																	248202247		2203	4300	6503	SO:0001819	synonymous_variant	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248202247C>G	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.678C>G	1.37:g.248202247C>G			Somatic				OR2L13_uc001ids.2_Intron	p.R226R	NM_001004686	NP_001004686	WXS	Illumina HiSeq	Unspecified	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	774	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		226			Cytoplasmic (Potential).		Q2M3T5	Silent	SNP	ENST00000366479.2	37	c.678C>G	CCDS31103.1																																																																																				0.483	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		107	129	0	0	0	0.00361	0	107	129				
OR2M5	127059	broad.mit.edu	37	1	248308862	248308862	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:248308862C>G	ENST00000366476.1	+	1	413	c.413C>G	c.(412-414)cCc>cGc	p.P138R		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CTCATGAGACCCAAAATTTGT	0.458																																							uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(412-414)CCC>CGC		olfactory receptor, family 2, subfamily M,							265.0	265.0	265.0					1																	248308862		2203	4298	6501	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308862C>G		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.413C>G	1.37:g.248308862C>G	ENSP00000355432:p.Pro138Arg		Somatic					p.P138R	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	413	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		138			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.413C>G	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	c	0.004	-2.253159	0.00268	.	.	ENSG00000162727	ENST00000366476	T	0.00591	6.35	3.05	-6.11	0.02131	GPCR, rhodopsin-like superfamily (1);	1.753880	0.03901	U	0.280361	T	0.00300	0.0009	N	0.11698	0.16	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46331	-0.9199	10	0.02654	T	1	.	0.2635	0.00222	0.3811:0.1545:0.2033:0.2611	.	138	A3KFT3	OR2M5_HUMAN	R	138	ENSP00000355432:P138R	ENSP00000355432:P138R	P	+	2	0	OR2M5	246375485	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-3.863000	0.00347	-1.349000	0.02202	0.492000	0.49549	CCC		0.458	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		55	332	0	0	0	0.00361	0	55	332				
OR14C36	127066	broad.mit.edu	37	1	248512288	248512288	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:248512288A>T	ENST00000317861.1	+	1	212	c.212A>T	c.(211-213)tAc>tTc	p.Y71F		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						GATGCCTGCTACATTTCTGTT	0.488																																							uc010pzl.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(211-213)TAC>TTC		olfactory receptor, family 14, subfamily C,							213.0	180.0	191.0					1																	248512288		2203	4300	6503	SO:0001583	missense	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512288A>T	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.212A>T	1.37:g.248512288A>T	ENSP00000324534:p.Tyr71Phe		Somatic					p.Y71F	NM_001001918	NP_001001918	WXS	Illumina HiSeq	Unspecified	Q8NHC7	O14CZ_HUMAN			1	212	+			71			Helical; Name=2; (Potential).		Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	c.212A>T	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.416139	0.25552	.	.	ENSG00000177174	ENST00000317861	T	0.04360	3.64	4.05	1.44	0.22558	GPCR, rhodopsin-like superfamily (1);	0.185243	0.26286	U	0.025256	T	0.02970	0.0088	L	0.29908	0.895	0.09310	N	1	P	0.41848	0.763	B	0.40636	0.335	T	0.33701	-0.9858	10	0.16896	T	0.51	.	1.304	0.02085	0.3709:0.1433:0.0911:0.3947	.	71	Q8NHC7	O14CZ_HUMAN	F	71	ENSP00000324534:Y71F	ENSP00000324534:Y71F	Y	+	2	0	OR14C36	246578911	0.000000	0.05858	0.949000	0.38748	0.835000	0.47333	-1.841000	0.01683	0.606000	0.29965	0.324000	0.21423	TAC		0.488	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		31	146	0	0	0	0.009535	0	31	146				
OR14I1	401994	broad.mit.edu	37	1	248844746	248844746	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:248844746A>T	ENST00000342623.3	-	1	883	c.860T>A	c.(859-861)aTa>aAa	p.I287K		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						AAGACTATATATGATGGGATT	0.388																																							uc001ieu.1		NA																	0					0						c.(859-861)ATA>AAA		olfactory receptor, family 14, subfamily I,							83.0	81.0	82.0					1																	248844746		2203	4300	6503	SO:0001583	missense	401994				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248844746A>T		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.860T>A	1.37:g.248844746A>T	ENSP00000339726:p.Ile287Lys		Somatic					p.I287K	NM_001004734	NP_001004734	WXS	Illumina HiSeq	Unspecified	A6ND48	O14I1_HUMAN			1	860	-			287			Helical; Name=7; (Potential).			Missense_Mutation	SNP	ENST00000342623.3	37	c.860T>A	CCDS31125.1	.	.	.	.	.	.	.	.	.	.	.	17.76	3.468276	0.63625	.	.	ENSG00000189181	ENST00000342623	T	0.57752	0.38	3.36	3.36	0.38483	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000154	T	0.74898	0.3777	M	0.91406	3.205	0.51233	D	0.999915	D	0.89917	1.0	D	0.83275	0.996	T	0.78969	-0.1994	10	0.87932	D	0	.	9.716	0.40274	1.0:0.0:0.0:0.0	.	287	A6ND48	O14I1_HUMAN	K	287	ENSP00000339726:I287K	ENSP00000339726:I287K	I	-	2	0	OR14I1	246911369	0.999000	0.42202	0.121000	0.21740	0.800000	0.45204	6.448000	0.73469	1.367000	0.46095	0.443000	0.29094	ATA		0.388	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734		10	67	0	0	0	0.008291	0	10	67				
AKR1C4	1109	broad.mit.edu	37	10	5258743	5258743	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:5258743G>A	ENST00000380448.1	+	10	1169	c.916G>A	c.(916-918)Gtt>Att	p.V306I	AKR1C4_ENST00000263126.1_Missense_Mutation_p.V306I			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	306					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						TTATCGATATGTTGTCATGGA	0.348																																							uc001ihw.2		NA																	0				ovary(1)	1						c.(916-918)GTT>ATT		aldo-keto reductase family 1, member C4	NADH(DB00157)						135.0	134.0	135.0					10																	5258743		2203	4299	6502	SO:0001583	missense	1109				androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity	g.chr10:5258743G>A	M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.916G>A	10.37:g.5258743G>A	ENSP00000369814:p.Val306Ile		Somatic					p.V306I	NM_001818	NP_001809	WXS	Illumina HiSeq	Unspecified	P17516	AK1C4_HUMAN			8	949	+			306					Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	ENST00000380448.1	37	c.916G>A	CCDS7064.1	.	.	.	.	.	.	.	.	.	.	G	1.107	-0.659447	0.03454	.	.	ENSG00000198610	ENST00000380448;ENST00000263126	T;T	0.51071	0.72;0.72	3.42	-6.84	0.01687	NADP-dependent oxidoreductase domain (2);	4.364490	0.00939	N	0.002818	T	0.23249	0.0562	N	0.12853	0.265	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12268	-1.0554	10	0.15499	T	0.54	.	4.1655	0.10305	0.4162:0.0:0.2934:0.2904	.	306	P17516	AK1C4_HUMAN	I	306	ENSP00000369814:V306I;ENSP00000263126:V306I	ENSP00000263126:V306I	V	+	1	0	AKR1C4	5248743	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.618000	0.02049	-1.668000	0.01471	-1.872000	0.00552	GTT		0.348	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046543.2	NM_001818		3	12	0	0	0	0.004672	0	3	12				
FAM208B	54906	broad.mit.edu	37	10	5791121	5791121	+	Missense_Mutation	SNP	G	G	C	rs199718858		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:5791121G>C	ENST00000328090.5	+	15	6362	c.5737G>C	c.(5737-5739)Gtc>Ctc	p.V1913L		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1913																	GCCGCCTTACGTCCAAATCCG	0.542																																							uc001iij.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(5737-5739)GTC>CTC		hypothetical protein LOC54906							40.0	41.0	41.0					10																	5791121		1992	4160	6152	SO:0001583	missense	54906							g.chr10:5791121G>C	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.5737G>C	10.37:g.5791121G>C	ENSP00000328426:p.Val1913Leu		Somatic				C10orf18_uc001iik.2_Missense_Mutation_p.V757L	p.V1913L	NM_017782	NP_060252	WXS	Illumina HiSeq	Unspecified	Q5VWN6	CJ018_HUMAN			15	6362	+			1913					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.5737G>C	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526031	0.44969	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.07567	3.18	5.82	-3.77	0.04346	.	0.924734	0.09145	N	0.842351	T	0.08223	0.0205	L	0.53249	1.67	0.09310	N	0.999999	P	0.42735	0.788	B	0.35655	0.207	T	0.19192	-1.0313	10	0.40728	T	0.16	.	12.6392	0.56700	0.6883:0.0:0.3117:0.0	.	1913	Q5VWN6	F208B_HUMAN	L	1913;1108	ENSP00000328426:V1913L	ENSP00000328426:V1913L	V	+	1	0	C10orf18	5831127	0.005000	0.15991	0.009000	0.14445	0.050000	0.14768	-0.173000	0.09854	-0.690000	0.05142	-0.253000	0.11424	GTC		0.542	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		12	30	0	0	0	0.010729	0	12	30				
PRKCQ	5588	broad.mit.edu	37	10	6553016	6553016	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:6553016C>T	ENST00000263125.5	-	3	358	c.259G>A	c.(259-261)Gtg>Atg	p.V87M	PRKCQ_ENST00000397176.2_Missense_Mutation_p.V87M|PRKCQ_ENST00000539722.1_De_novo_Start_OutOfFrame	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	87	C2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TAGAGCTCCACGGTGGTTTCA	0.483																																					Ovarian(50;572 1126 10530 25349 30594)	Ovarian(50;572 1126 10530 25349 30594)	uc001ijj.1		NA																	0				ovary(3)|lung(2)|large_intestine(1)	6						c.(259-261)GTG>ATG		protein kinase C, theta							237.0	207.0	217.0					10																	6553016		2203	4300	6503	SO:0001583	missense	5588				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr10:6553016C>T	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.259G>A	10.37:g.6553016C>T	ENSP00000263125:p.Val87Met		Somatic				PRKCQ_uc009xim.1_Missense_Mutation_p.V87M|PRKCQ_uc001iji.1_Missense_Mutation_p.V120M|PRKCQ_uc009xin.1_Missense_Mutation_p.V51M|PRKCQ_uc010qax.1_Translation_Start_Site	p.V87M	NM_006257	NP_006248	WXS	Illumina HiSeq	Unspecified	Q04759	KPCT_HUMAN			3	334	-			87			C2.		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	c.259G>A	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	C	9.120	1.008655	0.19199	.	.	ENSG00000065675	ENST00000263125;ENST00000397176	T;T	0.70869	-0.52;-0.46	5.63	1.67	0.24075	C2 calcium/lipid-binding domain, CaLB (1);	0.203730	0.41823	D	0.000812	T	0.63141	0.2486	L	0.55213	1.73	0.80722	D	1	B;P	0.43909	0.381;0.821	B;B	0.40375	0.327;0.317	T	0.61123	-0.7126	10	0.46703	T	0.11	.	10.614	0.45439	0.0:0.738:0.0:0.262	.	87;87	Q04759-2;Q04759	.;KPCT_HUMAN	M	87	ENSP00000263125:V87M;ENSP00000380361:V87M	ENSP00000263125:V87M	V	-	1	0	PRKCQ	6593022	0.976000	0.34144	0.017000	0.16124	0.042000	0.13812	2.480000	0.45206	0.323000	0.23307	0.655000	0.94253	GTG		0.483	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		21	104	0	0	0	0.00278	0	21	104				
ANKRD30A	91074	broad.mit.edu	37	10	37506637	37506637	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:37506637A>T	ENST00000602533.1	+	33	3029	c.2930A>T	c.(2929-2931)cAa>cTa	p.Q977L	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.Q1096L|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.Q977L			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1033					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACTTTAAACCAAGAAGAAGAG	0.289																																							uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(2929-2931)CAA>CTA		ankyrin repeat domain 30A							38.0	39.0	39.0					10																	37506637		1782	4047	5829	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37506637A>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2930A>T	10.37:g.37506637A>T	ENSP00000473551:p.Gln977Leu		Somatic					p.Q977L	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			33	3029	+			1033			Potential.		Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.2930A>T		.	.	.	.	.	.	.	.	.	.	a	11.18	1.561656	0.27915	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05580	3.42;3.42	2.63	2.63	0.31362	.	.	.	.	.	T	0.17023	0.0409	M	0.65677	2.01	0.28310	N	0.922738	P	0.51933	0.949	P	0.59171	0.853	T	0.02457	-1.1156	9	0.87932	D	0	.	8.4548	0.32893	1.0:0.0:0.0:0.0	.	1033	Q9BXX3	AN30A_HUMAN	L	977;1096	ENSP00000354432:Q977L;ENSP00000363792:Q1096L	ENSP00000354432:Q977L	Q	+	2	0	ANKRD30A	37546643	1.000000	0.71417	0.437000	0.26809	0.014000	0.08584	3.640000	0.54350	1.051000	0.40369	0.397000	0.26171	CAA		0.289	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		9	28	0	0	0	0.006214	0	9	28				
ANK3	288	broad.mit.edu	37	10	62149354	62149354	+	De_novo_Start_OutOfFrame	SNP	C	C	A	rs547467430		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:62149354C>A	ENST00000280772.2	-	0	134				ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)						axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AGGTGATATCCTCAGGCACCT	0.413																																							uc001jky.2		NA																	0				skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.(-59--55)GAGGA>GATGA		ankyrin 3 isoform 1																																						288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:62149354C>A	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.-58G>T	10.37:g.62149354C>A			Somatic				ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron		NM_020987	NP_066267	WXS	Illumina HiSeq	Unspecified	Q12955	ANK3_HUMAN			1	135	-								B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Translation_Start_Site	SNP	ENST00000280772.2	37	c.-57G>T	CCDS7258.1																																																																																				0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		7	36	1	0	0.00198382	0.001984	0.00216101	7	36				
CDH23	64072	broad.mit.edu	37	10	73558329	73558329	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:73558329T>A	ENST00000224721.6	+	49	7068	c.7063T>A	c.(7063-7065)Tcg>Acg	p.S2355T	CDH23_ENST00000398788.3_Missense_Mutation_p.S110T|CDH23_ENST00000475158.1_3'UTR	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2350	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GGAGGACTCCTCGGCAGGTAG	0.597																																							uc001jrx.3		NA																	0				central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(7048-7050)TCG>ACG		cadherin-like 23 isoform 1 precursor							19.0	21.0	20.0					10																	73558329		1930	4119	6049	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73558329T>A	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7063T>A	10.37:g.73558329T>A	ENSP00000224721:p.Ser2355Thr		Somatic				CDH23_uc001jsg.3_Missense_Mutation_p.S110T|CDH23_uc001jsh.3_Missense_Mutation_p.S110T|CDH23_uc001jsi.3_Missense_Mutation_p.S110T	p.S2350T	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			48	7425	+			2350			Cadherin 22.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.7048T>A		.	.	.	.	.	.	.	.	.	.	T	14.45	2.538983	0.45176	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.03441	3.93	5.59	5.59	0.84812	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000001	T	0.03220	0.0094	N	0.21545	0.675	0.39642	D	0.970337	P;B	0.36660	0.564;0.376	B;B	0.39094	0.269;0.29	T	0.57946	-0.7723	10	0.29301	T	0.29	.	6.9167	0.24363	0.1335:0.0722:0.0:0.7943	.	2350;2350	E9PEX1;Q9H251	.;CAD23_HUMAN	T	2355;2350;2353;110	ENSP00000381768:S110T	ENSP00000224721:S2355T	S	+	1	0	CDH23	73228335	0.853000	0.29707	0.994000	0.49952	0.241000	0.25554	1.674000	0.37544	2.137000	0.66172	0.533000	0.62120	TCG		0.597	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		9	22	0	0	0	0.004482	0	9	22				
DYDC1	143241	broad.mit.edu	37	10	82111703	82111703	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:82111703T>C	ENST00000372204.3	-	4	367	c.203A>G	c.(202-204)cAg>cGg	p.Q68R	DYDC2_ENST00000372197.1_Intron|DYDC1_ENST00000421924.2_Missense_Mutation_p.Q68R|DYDC2_ENST00000372198.1_Intron|DYDC1_ENST00000372202.1_Missense_Mutation_p.Q68R|DYDC2_ENST00000372199.1_Intron	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	68										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			CATCATTTCCTGCTCCATCAG	0.468																																							uc001kbx.2		NA																	0					0						c.(202-204)CAG>CGG		DPY30 domain containing 1							212.0	186.0	195.0					10																	82111703		2203	4300	6503	SO:0001583	missense	143241							g.chr10:82111703T>C	BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.203A>G	10.37:g.82111703T>C	ENSP00000361278:p.Gln68Arg		Somatic				DYDC1_uc001kby.1_Missense_Mutation_p.Q68R|DYDC1_uc009xsr.1_Missense_Mutation_p.Q68R|DYDC2_uc001kbz.1_Intron|DYDC2_uc001kca.1_Intron	p.Q68R	NM_138812	NP_620167	WXS	Illumina HiSeq	Unspecified	Q8WWB3	DYDC1_HUMAN	Colorectal(32;0.229)		4	368	-			68					A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	37	c.203A>G	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	T	9.764	1.170955	0.21621	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362;ENST00000453477	.	.	.	5.12	3.97	0.46021	.	0.601285	0.15616	N	0.253126	T	0.43743	0.1261	L	0.46157	1.445	0.80722	D	1	B;B	0.25441	0.126;0.126	B;B	0.18871	0.023;0.023	T	0.20840	-1.0263	9	0.11182	T	0.66	-13.2645	7.8905	0.29675	0.0:0.0978:0.0:0.9022	.	68;68	A8K927;Q8WWB3	.;DYDC1_HUMAN	R	68	.	ENSP00000361276:Q68R	Q	-	2	0	DYDC1	82101683	0.994000	0.37717	0.988000	0.46212	0.981000	0.71138	0.618000	0.24373	1.900000	0.55004	0.533000	0.62120	CAG		0.468	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812		31	96	0	0	0	0.005524	0	31	96				
NRG3	10718	broad.mit.edu	37	10	84733574	84733574	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:84733574G>C	ENST00000404547.1	+	7	1315	c.1315G>C	c.(1315-1317)Gca>Cca	p.A439P	NRG3_ENST00000372141.2_Missense_Mutation_p.A439P|NRG3_ENST00000556918.1_Missense_Mutation_p.A269P|NRG3_ENST00000537893.1_Missense_Mutation_p.A89P|NRG3_ENST00000545131.1_Missense_Mutation_p.A89P|NRG3_ENST00000404576.2_Missense_Mutation_p.A243P|NRG3_ENST00000372142.2_Missense_Mutation_p.A218P			P56975	NRG3_HUMAN	neuregulin 3	439					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TCCTGTGACTGCATTGGAGAA	0.483																																							uc001kco.2		NA																	0				lung(5)|breast(1)	6						c.(1315-1317)GCA>CCA		neuregulin 3 isoform 1							137.0	119.0	125.0					10																	84733574		2203	4300	6503	SO:0001583	missense	10718				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr10:84733574G>C	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1315G>C	10.37:g.84733574G>C	ENSP00000384796:p.Ala439Pro		Somatic				NRG3_uc010qlz.1_Missense_Mutation_p.A438P|NRG3_uc001kcp.2_Missense_Mutation_p.A218P|NRG3_uc001kcq.2_Missense_Mutation_p.A89P|NRG3_uc001kcr.2_Missense_Mutation_p.A89P	p.A439P	NM_001010848	NP_001010848	WXS	Illumina HiSeq	Unspecified	P56975	NRG3_HUMAN		GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)	7	1342	+			439			Cytoplasmic (Potential).		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	c.1315G>C	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.794515	0.70452	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.55413	1.39;1.38;0.52;0.52;0.52;0.52;0.52	6.06	3.98	0.46160	.	0.212683	0.32401	N	0.006150	T	0.52338	0.1728	L	0.43152	1.355	0.09310	N	0.999997	P;P;D;P	0.57571	0.874;0.744;0.98;0.874	P;B;P;P	0.53649	0.447;0.341;0.731;0.447	T	0.46665	-0.9175	10	0.66056	D	0.02	-23.7139	8.064	0.30651	0.0886:0.0:0.7486:0.1628	.	438;439;218;439	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	P	439;439;438;218;243;269;89;89	ENSP00000361214:A439P;ENSP00000384796:A439P;ENSP00000361215:A218P;ENSP00000385804:A243P;ENSP00000451376:A269P;ENSP00000441201:A89P;ENSP00000440377:A89P	ENSP00000361214:A439P	A	+	1	0	NRG3	84723554	0.535000	0.26370	0.981000	0.43875	0.998000	0.95712	2.509000	0.45459	2.880000	0.98712	0.650000	0.86243	GCA		0.483	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086		24	51	0	0	0	0.003954	0	24	51				
GRID1	2894	broad.mit.edu	37	10	87628790	87628790	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:87628790C>A	ENST00000327946.7	-	6	1013	c.928G>T	c.(928-930)Gaa>Taa	p.E310*		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	310					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AGGTAGCCTTCCTGGGGGTCG	0.577										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(928-930)GAA>TAA		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						167.0	122.0	137.0					10																	87628790		2203	4300	6503	SO:0001587	stop_gained	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87628790C>A	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.928G>T	10.37:g.87628790C>A	ENSP00000330148:p.Glu310*	Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_RNA	p.E310*	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			6	1029	-			310			Extracellular (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Nonsense_Mutation	SNP	ENST00000327946.7	37	c.928G>T	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	38	7.285810	0.98186	.	.	ENSG00000182771	ENST00000327946	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	18.8388	0.92174	0.0:1.0:0.0:0.0	.	.	.	.	X	310	.	ENSP00000330148:E310X	E	-	1	0	GRID1	87618770	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.411000	0.80078	2.686000	0.91538	0.655000	0.94253	GAA		0.577	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		25	54	1	0	1.1804e-14	0.003954	1.92705e-14	25	54				
MYOF	26509	broad.mit.edu	37	10	95116586	95116586	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:95116586T>C	ENST00000359263.4	-	30	3139	c.3140A>G	c.(3139-3141)gAc>gGc	p.D1047G	MYOF_ENST00000371502.4_Missense_Mutation_p.D1047G|MYOF_ENST00000371501.4_Missense_Mutation_p.D1047G|MYOF_ENST00000358334.5_Missense_Mutation_p.D1034G	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1047					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GCCCTCTTGGTCTTGCAATTC	0.398																																							uc001kin.2		NA																	0				ovary(3)|breast(1)	4						c.(3139-3141)GAC>GGC		myoferlin isoform a							73.0	69.0	70.0					10																	95116586		1939	4136	6075	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95116586T>C	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.3140A>G	10.37:g.95116586T>C	ENSP00000352208:p.Asp1047Gly		Somatic				MYOF_uc001kio.2_Missense_Mutation_p.D1034G|MYOF_uc009xue.2_RNA	p.D1047G	NM_013451	NP_038479	WXS	Illumina HiSeq	Unspecified	Q9NZM1	MYOF_HUMAN			30	3263	-			1047			Cytoplasmic (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.3140A>G	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	T	7.227	0.598531	0.13939	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.83419	-1.72;-1.71;-1.71;-1.71	5.74	4.61	0.57282	.	0.215134	0.47093	N	0.000257	T	0.79828	0.4513	M	0.61703	1.905	0.48632	D	0.999682	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.74124	-0.3766	10	0.39692	T	0.17	-18.8843	11.6679	0.51385	0.0:0.0691:0.0:0.9309	.	1034;1047	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	G	1034;1047;1047;1047	ENSP00000351094:D1034G;ENSP00000352208:D1047G;ENSP00000360556:D1047G;ENSP00000360557:D1047G	ENSP00000351094:D1034G	D	-	2	0	MYOF	95106576	1.000000	0.71417	0.962000	0.40283	0.235000	0.25334	5.223000	0.65283	1.014000	0.39417	0.459000	0.35465	GAC		0.398	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		9	23	0	0	0	0.008291	0	9	23				
HPSE2	60495	broad.mit.edu	37	10	100481549	100481549	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:100481549A>G	ENST00000370552.3	-	5	880	c.821T>C	c.(820-822)gTa>gCa	p.V274A	HPSE2_ENST00000404542.1_Missense_Mutation_p.V162A|HPSE2_ENST00000370546.1_Missense_Mutation_p.V274A|HPSE2_ENST00000370549.1_Missense_Mutation_p.V216A	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	274					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GCTGCCATTTACTGCCCGGCC	0.468																																							uc001kpn.1		NA																	0				ovary(1)	1						c.(820-822)GTA>GCA		heparanase 2							91.0	80.0	84.0					10																	100481549		2203	4300	6503	SO:0001583	missense	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100481549A>G	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.821T>C	10.37:g.100481549A>G	ENSP00000359583:p.Val274Ala		Somatic				HPSE2_uc009xwc.1_Missense_Mutation_p.V264A|HPSE2_uc001kpo.1_Missense_Mutation_p.V206A|HPSE2_uc009xwd.1_Missense_Mutation_p.V152A	p.V274A	NM_021828	NP_068600	WXS	Illumina HiSeq	Unspecified	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	5	881	-			274					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	c.821T>C	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003493	0.74932	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.44	5.44	0.79542	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.070725	0.56097	D	0.000036	T	0.59932	0.2230	L	0.55481	1.735	0.58432	D	0.999999	D;P;P;B	0.61697	0.99;0.587;0.587;0.409	D;B;B;B	0.73380	0.98;0.266;0.266;0.298	T	0.60637	-0.7224	10	0.52906	T	0.07	-6.1923	15.7994	0.78439	1.0:0.0:0.0:0.0	.	162;274;216;274	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	A	274;216;274;162	ENSP00000359583:V274A;ENSP00000359580:V216A;ENSP00000359577:V274A;ENSP00000384384:V162A	ENSP00000359577:V274A	V	-	2	0	HPSE2	100471539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.396000	0.90190	2.185000	0.69588	0.450000	0.29827	GTA		0.468	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		11	42	0	0	0	0.001368	0	11	42				
WBP1L	54838	broad.mit.edu	37	10	104572996	104572996	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:104572996C>A	ENST00000369889.4	+	4	1079	c.937C>A	c.(937-939)Ccg>Acg	p.P313T	WBP1L_ENST00000448841.1_Missense_Mutation_p.P334T	NM_017787.4	NP_060257.4	Q9NX94	WBP1L_HUMAN	WW domain binding protein 1-like	313						integral component of membrane (GO:0016021)											GCCTGGGCACCCGCACCTGCC	0.662																																							uc001kwe.3		NA																	0				central_nervous_system(1)	1						c.(937-939)CCG>ACG		hypothetical protein LOC54838 isoform 2							21.0	26.0	24.0					10																	104572996		2202	4297	6499	SO:0001583	missense	54838					integral to membrane		g.chr10:104572996C>A	AK056285	CCDS7540.1, CCDS44473.1	10q24.33	2012-05-02	2012-05-02	2012-05-02	ENSG00000166272	ENSG00000166272			23510	protein-coding gene	gene with protein product	"""outcome predictor in acute leukemia 1"""	611129	"""chromosome 10 open reading frame 26"""	C10orf26			Standard	NM_017787		Approved	FLJ20154, OPAL1	uc001kwf.4	Q9NX94	OTTHUMG00000018968	ENST00000369889.4:c.937C>A	10.37:g.104572996C>A	ENSP00000358905:p.Pro313Thr		Somatic				C10orf26_uc001kwf.3_Missense_Mutation_p.P334T|C10orf26_uc009xxg.1_Intron	p.P313T	NM_017787	NP_060257	WXS	Illumina HiSeq	Unspecified	Q9NX94	OPA1L_HUMAN		Epithelial(162;6.14e-09)|all cancers(201;1.66e-07)|BRCA - Breast invasive adenocarcinoma(275;0.224)	4	1197	+		Colorectal(252;0.122)|all_hematologic(284;0.152)	313					B3KPF4|B7Z6S7|D3DR90|Q1EG70|Q2HIY7|Q5F2G6	Missense_Mutation	SNP	ENST00000369889.4	37	c.937C>A	CCDS7540.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180153	0.38511	.	.	ENSG00000166272	ENST00000448841;ENST00000369889	T;T	0.32988	1.43;1.46	5.94	1.97	0.26223	.	0.548665	0.21457	N	0.074240	T	0.15782	0.0380	N	0.22421	0.69	0.32991	D	0.525008	B;B	0.32071	0.355;0.059	B;B	0.27380	0.079;0.022	T	0.14699	-1.0463	10	0.48119	T	0.1	-2.3039	3.9642	0.09424	0.1235:0.5093:0.2389:0.1283	.	334;313	Q9NX94-2;Q9NX94	.;OPA1L_HUMAN	T	334;313	ENSP00000414721:P334T;ENSP00000358905:P313T	ENSP00000358905:P313T	P	+	1	0	C10orf26	104562986	0.147000	0.22687	0.887000	0.34795	0.881000	0.50899	0.563000	0.23547	0.112000	0.17975	0.561000	0.74099	CCG		0.662	WBP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050100.1	NM_017787		18	63	1	0	1.99824e-07	0.00499	2.62216e-07	18	63				
PWWP2B	170394	broad.mit.edu	37	10	134219612	134219612	+	Silent	SNP	G	G	T	rs372035621		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:134219612G>T	ENST00000305233.5	+	2	1667	c.1608G>T	c.(1606-1608)acG>acT	p.T536T	PWWP2B_ENST00000368609.4_Intron	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	536	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.									central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CTCCGACTACGTCGTTCTTGT	0.498																																							uc001lll.3		NA																	0					0						c.(1606-1608)ACG>ACT		PWWP domain containing 2 isoform 1							163.0	167.0	165.0					10																	134219612		2202	4300	6502	SO:0001819	synonymous_variant	170394							g.chr10:134219612G>T	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1608G>T	10.37:g.134219612G>T			Somatic				PWWP2B_uc009ybe.2_Intron	p.T536T	NM_138499	NP_612508	WXS	Illumina HiSeq	Unspecified	Q6NUJ5	PWP2B_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)	2	1637	+		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)	536			PWWP.		A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	c.1608G>T	CCDS7667.2																																																																																				0.498	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499		35	54	1	0	7.11191e-15	0.002836	1.16718e-14	35	54				
MTG1	92170	broad.mit.edu	37	10	135209744	135209744	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr10:135209744G>T	ENST00000317502.6	+	3	305	c.255G>T	c.(253-255)atG>atT	p.M85I	RP11-108K14.8_ENST00000468317.2_Missense_Mutation_p.M90I|MTG1_ENST00000477902.2_Missense_Mutation_p.M44I	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	85	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		TCAACAAGATGGACTTGGCGG	0.498																																							uc001lnd.2		NA																	0				skin(1)	1						c.(253-255)ATG>ATT		GTP_binding protein precursor							169.0	166.0	167.0					10																	135209744		2203	4300	6503	SO:0001583	missense	92170					mitochondrion	GTP binding|protein binding	g.chr10:135209744G>T		CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.255G>T	10.37:g.135209744G>T	ENSP00000323047:p.Met85Ile		Somatic				MTG1_uc010qve.1_Missense_Mutation_p.M1I	p.M85I	NM_138384	NP_612393	WXS	Illumina HiSeq	Unspecified	Q9BT17	MTG1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)	3	359	+		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	85			GTP (By similarity).		Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Missense_Mutation	SNP	ENST00000317502.6	37	c.255G>T	CCDS31320.1	.	.	.	.	.	.	.	.	.	.	g	14.57	2.574224	0.45902	.	.	ENSG00000254536;ENSG00000148824;ENSG00000148824;ENSG00000148824	ENST00000468317;ENST00000317502;ENST00000432508;ENST00000537620	T;T;T	0.12039	2.72;2.72;2.72	5.4	5.4	0.78164	.	2.518390	0.02506	N	0.091026	T	0.15955	0.0384	L	0.27975	0.815	0.58432	D	0.999999	B;B	0.25563	0.126;0.129	B;B	0.26517	0.07;0.067	T	0.14035	-1.0487	10	0.21540	T	0.41	-2.0956	16.6591	0.85236	0.0:0.0:1.0:0.0	.	85;85	E7EVK2;Q9BT17	.;MTG1_HUMAN	I	90;85;85;44	ENSP00000436767:M90I;ENSP00000323047:M85I;ENSP00000393480:M85I	ENSP00000323047:M85I	M	+	3	0	AL360181.1;MTG1	135059734	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.024000	0.70857	2.535000	0.85469	0.478000	0.44815	ATG		0.498	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384		48	78	1	0	1.02687e-29	0.013114	1.92383e-29	48	78				
MUC6	4588	broad.mit.edu	37	11	1025222	1025222	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:1025222C>T	ENST00000421673.2	-	23	2995	c.2945G>A	c.(2944-2946)aGg>aAg	p.R982K		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	982	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTCATGTGCCTGTTCCAGAT	0.657																																							uc001lsw.2		NA																	0				ovary(1)	1						c.(2944-2946)AGG>AAG		mucin 6, gastric							102.0	114.0	110.0					11																	1025222		2154	4250	6404	SO:0001583	missense	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1025222C>T	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2945G>A	11.37:g.1025222C>T	ENSP00000406861:p.Arg982Lys		Somatic					p.R982K	NM_005961	NP_005952	WXS	Illumina HiSeq	Unspecified	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	23	2996	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	982			VWFD 3.		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	c.2945G>A	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	2.081	-0.410716	0.04799	.	.	ENSG00000184956	ENST00000421673	T	0.57752	0.38	4.34	3.21	0.36854	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.16769	0.0403	N	0.00648	-1.295	0.20703	N	0.999869	B	0.11235	0.004	B	0.08055	0.003	T	0.27938	-1.0059	9	0.02654	T	1	.	7.7358	0.28812	0.0:0.1801:0.0:0.8199	.	982	Q6W4X9	MUC6_HUMAN	K	982	ENSP00000406861:R982K	ENSP00000406861:R982K	R	-	2	0	MUC6	1015222	1.000000	0.71417	0.998000	0.56505	0.374000	0.29953	1.150000	0.31639	0.664000	0.31047	-0.378000	0.06908	AGG		0.657	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		61	153	0	0	0	0.00361	0	61	153				
BRSK2	9024	broad.mit.edu	37	11	1466580	1466580	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:1466580G>A	ENST00000528841.1	+	10	1253	c.869G>A	c.(868-870)cGc>cAc	p.R290H	BRSK2_ENST00000531197.1_Missense_Mutation_p.R290H|BRSK2_ENST00000382179.1_Missense_Mutation_p.R336H|BRSK2_ENST00000544817.1_5'UTR|BRSK2_ENST00000528710.1_Missense_Mutation_p.R230H|BRSK2_ENST00000526678.1_Missense_Mutation_p.R290H|BRSK2_ENST00000308219.9_Missense_Mutation_p.R290H|BRSK2_ENST00000308230.5_Missense_Mutation_p.R290H			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	290					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GTGCAGATCCGCTCGCTGCCC	0.657																																							uc001lti.2		NA																	0					0						c.(868-870)CGC>CAC		BR serine/threonine kinase 2							35.0	45.0	42.0					11																	1466580		2153	4256	6409	SO:0001583	missense	9024				establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr11:1466580G>A	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.869G>A	11.37:g.1466580G>A	ENSP00000432000:p.Arg290His		Somatic				BRSK2_uc009ycv.1_Missense_Mutation_p.R290H|BRSK2_uc001lth.1_Missense_Mutation_p.R290H|BRSK2_uc001ltj.2_Missense_Mutation_p.R290H|BRSK2_uc001ltk.2_RNA|BRSK2_uc001ltl.2_Missense_Mutation_p.R290H|BRSK2_uc001ltm.2_Missense_Mutation_p.R336H|BRSK2_uc001ltn.2_RNA|BRSK2_uc010qwx.1_RNA	p.R290H	NM_003957	NP_003948	WXS	Illumina HiSeq	Unspecified	Q8IWQ3	BRSK2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)	10	1255	+		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	290					B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	c.869G>A	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959974	0.74016	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179	T;T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.66;-0.69;-0.66;-0.49;-0.52	3.85	3.85	0.44370	Protein kinase-like domain (1);	0.067267	0.56097	U	0.000033	T	0.69495	0.3117	L	0.28115	0.83	0.45342	D	0.998331	D;D;D;B;B	0.76494	0.998;0.999;0.988;0.029;0.012	D;P;P;B;B	0.66497	0.944;0.897;0.873;0.011;0.003	T	0.64483	-0.6397	10	0.02654	T	1	.	15.9597	0.79918	0.0:0.0:1.0:0.0	.	290;336;290;290;290	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	H	290;290;290;290;290;230;336	ENSP00000310697:R290H;ENSP00000431152:R290H;ENSP00000310805:R290H;ENSP00000432000:R290H;ENSP00000433370:R290H;ENSP00000433235:R230H;ENSP00000371614:R336H	ENSP00000310697:R290H	R	+	2	0	BRSK2	1423156	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	6.262000	0.72514	1.993000	0.58246	0.462000	0.41574	CGC		0.657	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957		6	48	0	0	0	0.001984	0	6	48				
TNNT3	7140	broad.mit.edu	37	11	1955808	1955808	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:1955808C>A	ENST00000397301.1	+	14	554	c.546C>A	c.(544-546)gcC>gcA	p.A182A	TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000446240.1_Silent_p.A152A|TNNT3_ENST00000397304.2_Silent_p.A152A|TNNT3_ENST00000381561.4_Silent_p.A174A|TNNT3_ENST00000381558.1_Silent_p.A163A|TNNT3_ENST00000360603.3_Silent_p.A165A|TNNT3_ENST00000278317.6_Silent_p.A171A|TNNT3_ENST00000381579.3_Silent_p.A163A|TNNT3_ENST00000381548.3_Silent_p.A173A|TNNT3_ENST00000381549.3_Silent_p.A163A|TNNT3_ENST00000381589.3_Silent_p.A169A			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	182					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		AGCAGACAGCCCGGGAAATGA	0.587																																							uc001luu.3		NA																	0				ovary(1)	1						c.(511-513)GCC>GCA		troponin T3, skeletal, fast isoform 1							30.0	30.0	30.0					11																	1955808		2197	4294	6491	SO:0001819	synonymous_variant	7140				muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding	g.chr11:1955808C>A	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.546C>A	11.37:g.1955808C>A			Somatic				TNNT3_uc001lun.2_Silent_p.A67A|TNNT3_uc001luw.3_Silent_p.A163A|TNNT3_uc001luo.3_Silent_p.A163A|TNNT3_uc001lup.3_Silent_p.A169A|TNNT3_uc001luq.3_Silent_p.A163A|TNNT3_uc001lur.2_Silent_p.A163A|TNNT3_uc010qxf.1_Silent_p.A169A|TNNT3_uc010qxg.1_Silent_p.A103A	p.A171A	NM_006757	NP_006748	WXS	Illumina HiSeq	Unspecified	P45378	TNNT3_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)	13	725	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	182					A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Silent	SNP	ENST00000397301.1	37	c.513C>A																																																																																					0.587	TNNT3-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000142920.3	NM_006757		6	11	1	0	0.00116845	0.001168	0.0012886	6	11				
OR51A4	401666	broad.mit.edu	37	11	4967808	4967809	+	Missense_Mutation	DNP	GG	GG	TT	rs375550618		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:4967808_4967809GG>TT	ENST00000380373.2	-	1	547_548	c.522_523CC>AA	c.(520-525)aaCCaa>aaAAaa	p.174_175NQ>KK	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGGATAATTGGTTTTTCTTGC	0.416																																							uc010qys.1		NA																	0				ovary(2)|skin(1)	3						c.(520-525)AACCAA>AAAAAA		olfactory receptor, family 51, subfamily A,																																				SO:0001583	missense	401666				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4967808_4967809GG>TT	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.522_523delinsTT	11.37:g.4967808_4967809delinsTT	ENSP00000369731:p.N174_Q175delinsKK		Somatic					p.174_175NQ>KK	NM_001005329	NP_001005329	WXS	Illumina HiSeq	Unspecified	Q8NGJ6	O51A4_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	522_523	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	174_175			Extracellular (Potential).			Missense_Mutation	DNP	ENST00000380373.2	37	c.522_523CC>AA	CCDS31367.1																																																																																				0.416	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		41	247	0	0	0	0.004672	0	41	247				
OR51A4	401666	broad.mit.edu	37	11	4968008	4968009	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:4968008_4968009CC>AA	ENST00000380373.2	-	1	347_348	c.322_323GG>TT	c.(322-324)GGa>TTa	p.G108L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TACTGAGAATCCATGAATGAAG	0.441																																							uc010qys.1		NA																	0				ovary(2)|skin(1)	3						c.(322-324)GGA>TTA		olfactory receptor, family 51, subfamily A,																																				SO:0001583	missense	401666				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4968008_4968009CC>AA	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.322_323delinsAA	11.37:g.4968008_4968009delinsAA	ENSP00000369731:p.Gly108Leu		Somatic					p.G108L	NM_001005329	NP_001005329	WXS	Illumina HiSeq	Unspecified	Q8NGJ6	O51A4_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	322_323	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	108			Helical; Name=3; (Potential).			Missense_Mutation	DNP	ENST00000380373.2	37	c.322_323GG>TT	CCDS31367.1																																																																																				0.441	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		35	336	0	0	0	0.004672	0	35	336				
OR51B5	282763	broad.mit.edu	37	11	5364119	5364119	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:5364119G>A	ENST00000300773.2	-	1	690	c.636C>T	c.(634-636)atC>atT	p.I212I	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	212					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGAGATGAAGATAATCAGAT	0.468																																							uc001map.1		NA																	0				skin(1)	1						c.(634-636)ATC>ATT		olfactory receptor, family 51, subfamily B,							107.0	107.0	107.0					11																	5364119		2201	4297	6498	SO:0001819	synonymous_variant	282763				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5364119G>A	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.636C>T	11.37:g.5364119G>A			Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	p.I212I	NM_001005567	NP_001005567	WXS	Illumina HiSeq	Unspecified	Q9H339	O51B5_HUMAN		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	636	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	212			Helical; Name=5; (Potential).		B2RN59	Silent	SNP	ENST00000300773.2	37	c.636C>T	CCDS31378.1																																																																																				0.468	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567		13	108	0	0	0	0.001368	0	13	108				
OR52N4	390072	broad.mit.edu	37	11	5776415	5776415	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:5776415G>C	ENST00000317254.3	+	1	493	c.445G>C	c.(445-447)Gcc>Ccc	p.A149P	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		GGTTGGGACTGCCACCTTCCT	0.488																																							uc001mbu.2		NA																	0				ovary(1)|skin(1)	2						c.(445-447)GCC>CCC		olfactory receptor, family 52, subfamily N,							147.0	146.0	146.0					11																	5776415		2200	4297	6497	SO:0001583	missense	390072				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5776415G>C	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.445G>C	11.37:g.5776415G>C	ENSP00000323224:p.Ala149Pro		Somatic				TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.A149P	NM_001005175	NP_001005175	WXS	Illumina HiSeq	Unspecified	Q8NGI2	O52N4_HUMAN		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)	1	493	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	149			Helical; Name=4; (Potential).		B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	c.445G>C	CCDS44528.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887383	0.33348	.	.	ENSG00000181074	ENST00000317254	T	0.40225	1.04	5.97	-4.11	0.03928	GPCR, rhodopsin-like superfamily (1);	1.033860	0.07705	N	0.940968	T	0.63745	0.2537	H	0.95712	3.71	0.09310	N	1	P	0.44986	0.847	P	0.59424	0.857	T	0.60167	-0.7316	10	0.87932	D	0	.	1.4019	0.02273	0.2589:0.0891:0.2669:0.3851	.	149	Q8NGI2	O52N4_HUMAN	P	149	ENSP00000323224:A149P	ENSP00000323224:A149P	A	+	1	0	OR52N4	5732991	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.958000	0.01519	-0.323000	0.08602	-1.000000	0.02509	GCC		0.488	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		44	107	0	0	0	0.009718	0	44	107				
OR56A3	390083	broad.mit.edu	37	11	5968677	5968677	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:5968677C>A	ENST00000329564.6	+	1	108	c.101C>A	c.(100-102)cCc>cAc	p.P34H	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGTCCCTGCCCCTCAGCCTC	0.572																																							uc010qzt.1		NA																	0					0						c.(100-102)CCC>CAC		olfactory receptor, family 56, subfamily A,							96.0	100.0	99.0					11																	5968677		2201	4296	6497	SO:0001583	missense	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5968677C>A		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.101C>A	11.37:g.5968677C>A	ENSP00000331572:p.Pro34His		Somatic					p.P34H	NM_001003443	NP_001003443	WXS	Illumina HiSeq	Unspecified	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	101	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	34			Helical; Name=1; (Potential).		A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	37	c.101C>A	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529828	0.64860	.	.	ENSG00000184478	ENST00000329564	T	0.00382	7.62	5.12	5.12	0.69794	.	0.224039	0.32002	N	0.006724	T	0.01661	0.0053	H	0.97158	3.95	0.42102	D	0.991348	D	0.71674	0.998	D	0.63033	0.91	T	0.19257	-1.0311	10	0.87932	D	0	-56.3141	16.1802	0.81892	0.0:1.0:0.0:0.0	.	34	Q8NH54	O56A3_HUMAN	H	34	ENSP00000331572:P34H	ENSP00000331572:P34H	P	+	2	0	OR56A3	5925253	0.033000	0.19621	1.000000	0.80357	0.984000	0.73092	1.119000	0.31258	2.683000	0.91414	0.644000	0.83932	CCC		0.572	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		62	71	1	0	3.76628e-20	0.00361	6.79023e-20	62	71				
DCHS1	8642	broad.mit.edu	37	11	6648047	6648047	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:6648047C>A	ENST00000299441.3	-	14	6634	c.6223G>T	c.(6223-6225)Gct>Tct	p.A2075S		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2075	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGAATCGTAGCCTCACTGCTA	0.587																																							uc001mem.1		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(6223-6225)GCT>TCT		dachsous 1 precursor							28.0	28.0	28.0					11																	6648047		2201	4296	6497	SO:0001583	missense	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6648047C>A	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6223G>T	11.37:g.6648047C>A	ENSP00000299441:p.Ala2075Ser		Somatic					p.A2075S	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	14	6633	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	2075			Cadherin 20.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000299441.3	37	c.6223G>T	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687587	0.29962	.	.	ENSG00000166341	ENST00000299441	T	0.55760	0.5	4.79	3.88	0.44766	Cadherin (3);Cadherin-like (1);	0.159298	0.29383	N	0.012303	T	0.45975	0.1369	L	0.59436	1.845	0.36095	D	0.843717	B	0.24317	0.101	B	0.28385	0.089	T	0.48670	-0.9015	10	0.22109	T	0.4	.	8.5683	0.33554	0.0:0.8258:0.0:0.1742	.	2075	Q96JQ0	PCD16_HUMAN	S	2075	ENSP00000299441:A2075S	ENSP00000299441:A2075S	A	-	1	0	DCHS1	6604623	0.884000	0.30299	0.390000	0.26220	0.079000	0.17450	3.049000	0.49869	1.244000	0.43870	0.462000	0.41574	GCT		0.587	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		5	34	1	0	3.59834e-05	0.001168	4.22295e-05	5	34				
DCHS1	8642	broad.mit.edu	37	11	6662271	6662271	+	Silent	SNP	G	G	T	rs267603132		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:6662271G>T	ENST00000299441.3	-	2	985	c.574C>A	c.(574-576)Cgg>Agg	p.R192R		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	192	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCTCCAGCCGGAAGGTCTCT	0.607																																							uc001mem.1		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(574-576)CGG>AGG		dachsous 1 precursor							75.0	72.0	73.0					11																	6662271		2201	4296	6497	SO:0001819	synonymous_variant	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6662271G>T	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.574C>A	11.37:g.6662271G>T			Somatic					p.R192R	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	984	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	192			Cadherin 2.|Extracellular (Potential).		O15098	Silent	SNP	ENST00000299441.3	37	c.574C>A	CCDS7771.1																																																																																				0.607	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		37	80	1	0	8.73648e-17	0.004289	1.48472e-16	37	80				
OR10A4	283297	broad.mit.edu	37	11	6898303	6898303	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:6898303G>T	ENST00000379829.2	+	1	448	c.425G>T	c.(424-426)tGt>tTt	p.C142F		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	142					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACATATCCTGTGCCCAGCTG	0.572																																							uc010rat.1		NA																	0				ovary(1)	1						c.(424-426)TGT>TTT		olfactory receptor, family 10, subfamily A,							63.0	58.0	60.0					11																	6898303		2201	4296	6497	SO:0001583	missense	283297				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6898303G>T	AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.425G>T	11.37:g.6898303G>T	ENSP00000369157:p.Cys142Phe		Somatic					p.C142F	NM_207186	NP_997069	WXS	Illumina HiSeq	Unspecified	Q9H209	O10A4_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	425	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	142			Helical; Name=4; (Potential).		B2RNP5|B9EH36|Q96R20	Missense_Mutation	SNP	ENST00000379829.2	37	c.425G>T	CCDS7774.1	.	.	.	.	.	.	.	.	.	.	g	4.665	0.123662	0.08931	.	.	ENSG00000170782	ENST00000379829	T	0.00220	8.52	4.6	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.137283	0.34046	N	0.004305	T	0.00552	0.0018	M	0.88105	2.93	0.09310	N	1	D	0.57257	0.979	D	0.63283	0.913	T	0.33007	-0.9885	10	0.46703	T	0.11	.	11.0307	0.47772	0.0917:0.0:0.9083:0.0	.	142	Q9H209	O10A4_HUMAN	F	142	ENSP00000369157:C142F	ENSP00000369157:C142F	C	+	2	0	OR10A4	6854879	0.134000	0.22483	0.669000	0.29828	0.000000	0.00434	2.388000	0.44398	1.297000	0.44761	-0.126000	0.14955	TGT		0.572	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186		23	78	1	0	1.87028e-06	0.012319	2.33597e-06	23	78				
CTR9	9646	broad.mit.edu	37	11	10791812	10791812	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:10791812A>G	ENST00000361367.2	+	17	2591	c.2165A>G	c.(2164-2166)tAt>tGt	p.Y722C		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	722					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTTGTACTCTATTTGGCCCGG	0.378																																							uc001mja.2		NA																	0				ovary(2)	2						c.(2164-2166)TAT>TGT		SH2 domain binding protein 1							96.0	96.0	96.0					11																	10791812		2201	4294	6495	SO:0001583	missense	9646				histone H2B ubiquitination|histone monoubiquitination	Cdc73/Paf1 complex|nuclear speck		g.chr11:10791812A>G	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2165A>G	11.37:g.10791812A>G	ENSP00000355013:p.Tyr722Cys		Somatic					p.Y722C	NM_014633	NP_055448	WXS	Illumina HiSeq	Unspecified	Q6PD62	CTR9_HUMAN		all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)	17	2314	+			722			TPR 16.		D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	c.2165A>G	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563787	0.86335	.	.	ENSG00000198730	ENST00000361367	T	0.74106	-0.81	6.02	6.02	0.97574	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.72906	0.3519	M	0.69823	2.125	0.80722	D	1	P	0.36587	0.559	B	0.33295	0.161	T	0.72414	-0.4301	10	0.32370	T	0.25	-20.3765	16.5446	0.84426	1.0:0.0:0.0:0.0	.	722	Q6PD62	CTR9_HUMAN	C	722	ENSP00000355013:Y722C	ENSP00000355013:Y722C	Y	+	2	0	CTR9	10748388	1.000000	0.71417	0.998000	0.56505	0.835000	0.47333	7.220000	0.78008	2.311000	0.77944	0.533000	0.62120	TAT		0.378	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633		11	59	0	0	0	0.010729	0	11	59				
INSC	387755	broad.mit.edu	37	11	15267485	15267485	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:15267485T>C	ENST00000379554.3	+	13	1685	c.1639T>C	c.(1639-1641)Tgc>Cgc	p.C547R	INSC_ENST00000528567.1_3'UTR|INSC_ENST00000424273.1_Missense_Mutation_p.C458R|INSC_ENST00000447214.2_3'UTR|INSC_ENST00000525218.1_Missense_Mutation_p.C458R|INSC_ENST00000530161.1_Missense_Mutation_p.C500R|INSC_ENST00000379556.3_Missense_Mutation_p.C500R	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	547					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GGCTGGGGTCTGCCCTGAAGG	0.547																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(1639-1641)TGC>CGC		inscuteable isoform a							112.0	115.0	114.0					11																	15267485		2034	4170	6204	SO:0001583	missense	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15267485T>C	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1639T>C	11.37:g.15267485T>C	ENSP00000368872:p.Cys547Arg		Somatic				INSC_uc001mlz.2_Missense_Mutation_p.C500R|INSC_uc001mma.2_3'UTR|INSC_uc010rcs.1_Missense_Mutation_p.C535R|INSC_uc001mmb.2_Missense_Mutation_p.C500R|INSC_uc001mmc.2_Missense_Mutation_p.C458R	p.C547R	NM_001031853	NP_001027024	WXS	Illumina HiSeq	Unspecified	Q1MX18	INSC_HUMAN			13	1685	+			547					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	c.1639T>C	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.815755	0.70912	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000530161;ENST00000525218	T;T;T;T;T	0.34275	1.37;1.39;1.45;1.39;1.45	6.17	6.17	0.99709	Armadillo-type fold (1);	0.052138	0.85682	D	0.000000	T	0.42449	0.1203	L	0.46157	1.445	0.58432	D	0.999996	D;D;P	0.54964	0.969;0.962;0.919	P;P;P	0.51385	0.668;0.605;0.483	T	0.36383	-0.9750	10	0.66056	D	0.02	-16.8846	11.399	0.49860	0.1354:0.0:0.0:0.8645	.	535;458;547	Q1MX18-5;Q1MX18-4;Q1MX18	.;.;INSC_HUMAN	R	547;500;458;500;458	ENSP00000368872:C547R;ENSP00000368874:C500R;ENSP00000389161:C458R;ENSP00000436194:C500R;ENSP00000436113:C458R	ENSP00000368872:C547R	C	+	1	0	INSC	15224061	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.564000	0.67359	2.371000	0.80710	0.533000	0.62120	TGC		0.547	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		26	102	0	0	0	0.003954	0	26	102				
ABCC8	6833	broad.mit.edu	37	11	17419927	17419927	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:17419927G>A	ENST00000389817.3	-	30	3780	c.3712C>T	c.(3712-3714)Ctc>Ttc	p.L1238F	ABCC8_ENST00000302539.4_Missense_Mutation_p.L1239F			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1238	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GTGAGGAAGAGGGAAGCAATG	0.552																																							uc001mnc.2		NA																	0				ovary(1)	1						c.(3712-3714)CTC>TTC		ATP-binding cassette, sub-family C, member 8	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)						221.0	193.0	203.0					11																	17419927		2200	4293	6493	SO:0001583	missense	6833				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity	g.chr11:17419927G>A	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3712C>T	11.37:g.17419927G>A	ENSP00000374467:p.Leu1238Phe		Somatic					p.L1238F	NM_000352	NP_000343	WXS	Illumina HiSeq	Unspecified	Q09428	ABCC8_HUMAN		READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	30	3838	-			1238			ABC transmembrane type-1 2.|Cytoplasmic (By similarity).		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	c.3712C>T	CCDS31437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.765948|4.765948	0.90020|0.90020	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000389817;ENST00000302539|ENST00000528374	D;D|.	0.89810|.	-2.57;-2.57|.	5.46|5.46	5.46|5.46	0.80206|0.80206	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57301|0.57301	0.2044|0.2044	N|N	0.26042|0.26042	0.785|0.785	0.80722|0.80722	D|D	1|1	B|.	0.28470|.	0.213|.	B|.	0.36989|.	0.238|.	T|T	0.51513|0.51513	-0.8696|-0.8696	10|5	0.27785|.	T|.	0.31|.	.|.	19.3004|19.3004	0.94141|0.94141	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1238|.	Q09428|.	ABCC8_HUMAN|.	F|L	1238;1239|61	ENSP00000374467:L1238F;ENSP00000303960:L1239F|.	ENSP00000303960:L1239F|.	L|P	-|-	1|2	0|0	ABCC8|ABCC8	17376503|17376503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.869000|9.869000	0.99810|0.99810	2.576000|2.576000	0.86940|0.86940	0.555000|0.555000	0.69702|0.69702	CTC|CCT		0.552	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352		5	74	0	0	0	0.001984	0	5	74				
MRGPRX3	117195	broad.mit.edu	37	11	18159074	18159075	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:18159074_18159075GG>TT	ENST00000396275.2	+	3	686_687	c.325_326GG>TT	c.(325-327)GGc>TTc	p.G109F		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CTACTTTATAGGCCTAAGCATG	0.55																																							uc001mnu.2		NA																	0				ovary(1)|pancreas(1)	2						c.(325-327)GGC>TTC		MAS-related GPR, member X3																																				SO:0001583	missense	117195					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18159074_18159075GG>TT		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	Exception_encountered	11.37:g.18159074_18159075delinsTT	ENSP00000379571:p.Gly109Phe		Somatic					p.G109F	NM_054031	NP_473372	WXS	Illumina HiSeq	Unspecified	Q96LB0	MRGX3_HUMAN			3	686_687	+			109			Helical; Name=3; (Potential).		B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	DNP	ENST00000396275.2	37	c.325_326GG>TT	CCDS7830.1																																																																																				0.550	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031		35	160	0	0	0	0.004672	0	35	160				
LDHA	3939	broad.mit.edu	37	11	18421090	18421090	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:18421090G>T	ENST00000422447.3	+	3	512	c.239G>T	c.(238-240)gGc>gTc	p.G80V	LDHA_ENST00000540430.1_Missense_Mutation_p.G109V|LDHA_ENST00000430553.2_Missense_Mutation_p.G80V|LDHA_ENST00000542179.1_Missense_Mutation_p.G80V|LDHA_ENST00000227157.4_Missense_Mutation_p.G80V|LDHA_ENST00000396222.2_Missense_Mutation_p.G80V|LDHA_ENST00000379412.5_Missense_Mutation_p.G80V	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	80					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						ATTGTCTCTGGCAAAGGTTGA	0.393																																							uc001mok.3		NA																	0				central_nervous_system(3)	3						c.(238-240)GGC>GTC		lactate dehydrogenase A isoform 1	NADH(DB00157)						93.0	88.0	89.0					11																	18421090		2199	4293	6492	SO:0001583	missense	3939				glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity|protein binding	g.chr11:18421090G>T	X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.239G>T	11.37:g.18421090G>T	ENSP00000395337:p.Gly80Val		Somatic				LDHA_uc010rdc.1_Missense_Mutation_p.G80V|LDHA_uc009yhn.2_Missense_Mutation_p.G80V|LDHA_uc009yho.2_Intron|LDHA_uc001mol.3_Missense_Mutation_p.G80V|LDHA_uc010rdd.1_Missense_Mutation_p.G109V	p.G80V	NM_005566	NP_005557	WXS	Illumina HiSeq	Unspecified	P00338	LDHA_HUMAN			3	511	+			80					B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Missense_Mutation	SNP	ENST00000422447.3	37	c.239G>T	CCDS7839.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.186296	0.57909	.	.	ENSG00000134333	ENST00000422447;ENST00000543445;ENST00000430553;ENST00000396222;ENST00000445376;ENST00000227157;ENST00000478970;ENST00000495052;ENST00000540430;ENST00000379412;ENST00000542179	D;D;D;D;D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.65;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69	5.03	5.03	0.67393	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.312181	0.34555	N	0.003875	D	0.93275	0.7857	M	0.78049	2.395	0.58432	D	0.999996	D;P;B;P;P	0.59767	0.986;0.585;0.267;0.776;0.885	P;P;B;B;P	0.56163	0.793;0.641;0.388;0.205;0.493	D	0.93523	0.6863	10	0.87932	D	0	-2.1744	12.271	0.54706	0.0776:0.0:0.9224:0.0	.	109;80;53;80;80	B7Z5E3;B4DKQ2;B4DJI1;F8W819;P00338	.;.;.;.;LDHA_HUMAN	V	80;80;80;80;53;80;80;80;109;80;80	ENSP00000395337:G80V;ENSP00000440161:G80V;ENSP00000406172:G80V;ENSP00000379524:G80V;ENSP00000227157:G80V;ENSP00000441241:G80V;ENSP00000446415:G80V;ENSP00000445175:G109V;ENSP00000368722:G80V;ENSP00000445331:G80V	ENSP00000227157:G80V	G	+	2	0	LDHA	18377666	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	5.190000	0.65104	2.768000	0.95171	0.655000	0.94253	GGC		0.393	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2	NM_005566		11	55	1	0	3.07112e-06	0.010729	3.79015e-06	11	55				
MRGPRX2	117194	broad.mit.edu	37	11	19077263	19077263	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:19077263C>A	ENST00000329773.2	-	2	774	c.687G>T	c.(685-687)gtG>gtT	p.V229V		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	229					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGAACACCAGCACTGTGAGCA	0.532																																					GBM(198;1966 2199 4849 37227 49954)	GBM(198;1966 2199 4849 37227 49954)	uc001mph.2		NA																	0				ovary(1)	1						c.(685-687)GTG>GTT		MAS-related GPR, member X2							55.0	57.0	56.0					11																	19077263		2199	4293	6492	SO:0001819	synonymous_variant	117194				sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding	g.chr11:19077263C>A		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.687G>T	11.37:g.19077263C>A			Somatic					p.V229V	NM_054030	NP_473371	WXS	Illumina HiSeq	Unspecified	Q96LB1	MRGX2_HUMAN			2	775	-			229			Helical; Name=6; (Potential).		B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Silent	SNP	ENST00000329773.2	37	c.687G>T	CCDS7847.1																																																																																				0.532	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	NM_054030		25	45	1	0	1.85244e-09	0.00333	2.6427e-09	25	45				
SLC17A6	57084	broad.mit.edu	37	11	22397583	22397583	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:22397583G>T	ENST00000263160.3	+	10	1667	c.1230G>T	c.(1228-1230)ggG>ggT	p.G410G		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	410					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						ATACTAGAGGGGTAGCAATCT	0.373																																							uc001mqk.2		NA																	0				ovary(3)|breast(1)	4						c.(1228-1230)GGG>GGT		solute carrier family 17 (sodium-dependent							171.0	179.0	177.0					11																	22397583		2203	4300	6503	SO:0001819	synonymous_variant	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22397583G>T	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1230G>T	11.37:g.22397583G>T			Somatic					p.G410G	NM_020346	NP_065079	WXS	Illumina HiSeq	Unspecified	Q9P2U8	VGLU2_HUMAN			10	1643	+			410			Helical; (Potential).		A6NKS2	Silent	SNP	ENST00000263160.3	37	c.1230G>T	CCDS7856.1																																																																																				0.373	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		7	220	1	0	2.74318e-10	0.006214	4.02419e-10	7	220				
ANO3	63982	broad.mit.edu	37	11	26463584	26463584	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:26463584C>A	ENST00000256737.3	+	2	1018	c.166C>A	c.(166-168)Ctc>Atc	p.L56I	ANO3_ENST00000537978.1_Missense_Mutation_p.L40I|ANO3_ENST00000531646.1_Missense_Mutation_p.L56I|ANO3_ENST00000525139.1_Missense_Mutation_p.L40I	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	56					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.L56F(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						GTCTACTTCCCTCTTCCAGTC	0.473																																							uc001mqt.3		NA																	1	Substitution - Missense(1)		skin(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(166-168)CTC>ATC		transmembrane protein 16C							164.0	167.0	166.0					11																	26463584		2203	4300	6503	SO:0001583	missense	63982					chloride channel complex	chloride channel activity	g.chr11:26463584C>A	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.166C>A	11.37:g.26463584C>A	ENSP00000256737:p.Leu56Ile		Somatic				ANO3_uc010rdr.1_Missense_Mutation_p.L40I	p.L56I	NM_031418	NP_113606	WXS	Illumina HiSeq	Unspecified	Q9BYT9	ANO3_HUMAN			2	311	+			56			Cytoplasmic (Potential).		B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	c.166C>A	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.818327	0.71028	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531646	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.24	4.32	0.51571	.	0.167266	0.41194	D	0.000937	T	0.41858	0.1177	N	0.22421	0.69	0.25403	N	0.988423	B	0.30406	0.278	B	0.24155	0.051	T	0.18429	-1.0337	10	0.27785	T	0.31	.	8.8143	0.34987	0.0:0.902:0.0:0.098	.	56	Q9BYT9	ANO3_HUMAN	I	40;40;56;56	ENSP00000440737:L40I;ENSP00000432576:L40I;ENSP00000256737:L56I;ENSP00000435275:L56I	ENSP00000256737:L56I	L	+	1	0	ANO3	26420160	0.996000	0.38824	0.973000	0.42090	0.962000	0.63368	2.685000	0.46959	2.831000	0.97527	0.650000	0.86243	CTC		0.473	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418		47	159	1	0	7.77372e-23	0.00361	1.42213e-22	47	159				
KCNA4	3739	broad.mit.edu	37	11	30034191	30034191	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:30034191C>A	ENST00000328224.6	-	2	1268	c.35G>T	c.(34-36)gGg>gTg	p.G12V	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	12					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ACTGTTGCACCCTGAGCTCTC	0.562																																							uc001msk.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(34-36)GGG>GTG		potassium voltage-gated channel, shaker-related							70.0	71.0	71.0					11																	30034191		1972	4145	6117	SO:0001583	missense	3739					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity	g.chr11:30034191C>A	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.35G>T	11.37:g.30034191C>A	ENSP00000328511:p.Gly12Val		Somatic					p.G12V	NM_002233	NP_002224	WXS	Illumina HiSeq	Unspecified	P22459	KCNA4_HUMAN			2	1187	-			12						Missense_Mutation	SNP	ENST00000328224.6	37	c.35G>T	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725218	0.48833	.	.	ENSG00000182255	ENST00000328224	D	0.98617	-5.03	5.18	5.18	0.71444	Potassium channel, voltage dependent, Kv1.4, tandem inactivation (2);	384.303000	0.00682	U	0.000688	D	0.98754	0.9581	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91616	0.5307	10	0.87932	D	0	.	18.7248	0.91710	0.0:1.0:0.0:0.0	.	12	P22459	KCNA4_HUMAN	V	12	ENSP00000328511:G12V	ENSP00000328511:G12V	G	-	2	0	KCNA4	29990767	1.000000	0.71417	0.998000	0.56505	0.040000	0.13550	5.696000	0.68287	2.420000	0.82092	0.655000	0.94253	GGG		0.562	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		41	134	1	0	1.04594e-18	0.00623	1.8326e-18	41	134				
DCDC1	341019	broad.mit.edu	37	11	31312234	31312234	+	Missense_Mutation	SNP	T	T	A	rs200169786		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:31312234T>A	ENST00000452803.1	-	7	1121	c.920A>T	c.(919-921)gAt>gTt	p.D307V	DCDC1_ENST00000597505.1_Missense_Mutation_p.D307V	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	307					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CTCATGCCCATCCTGCCCCAT	0.343																																							uc001msv.2		NA																	0				skin(1)	1						c.(919-921)GAT>GTT		doublecortin domain containing 1							79.0	80.0	80.0					11																	31312234		2202	4299	6501	SO:0001583	missense	341019				intracellular signal transduction			g.chr11:31312234T>A	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.920A>T	11.37:g.31312234T>A	ENSP00000389792:p.Asp307Val		Somatic				DCDC1_uc001msu.1_Intron	p.D307V	NM_181807	NP_861523	WXS	Illumina HiSeq	Unspecified	P59894	DCDC1_HUMAN			7	1122	-	Lung SC(675;0.225)		307					A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	c.920A>T	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.156815	0.38119	.	.	ENSG00000188682	ENST00000452803	D	0.93763	-3.28	5.54	4.39	0.52855	Doublecortin domain (2);	0.596788	0.15414	N	0.263602	D	0.93664	0.7976	L	0.55481	1.735	0.42829	D	0.994019	D	0.57257	0.979	P	0.56042	0.79	D	0.92576	0.6070	10	0.49607	T	0.09	-20.5277	9.8533	0.41070	0.0:0.1354:0.0:0.8646	.	307	P59894	DCDC1_HUMAN	V	307	ENSP00000389792:D307V	ENSP00000389792:D307V	D	-	2	0	DCDC1	31268810	0.995000	0.38212	1.000000	0.80357	0.990000	0.78478	2.077000	0.41557	2.216000	0.71823	0.533000	0.62120	GAT		0.343	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807		9	49	0	0	0	0.006214	0	9	49				
KIAA1549L	25758	broad.mit.edu	37	11	33566805	33566805	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:33566805C>A	ENST00000321505.4	+	2	2555	c.2375C>A	c.(2374-2376)cCa>cAa	p.P792Q	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.P798Q|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.P798Q			Q6ZVL6	K154L_HUMAN	KIAA1549-like	792						integral component of membrane (GO:0016021)											CGGTTGCCACCATTGCGAGCA	0.582																																							uc001mup.3		NA																	0				ovary(2)	2						c.(2392-2394)CCA>CAA		hypothetical protein LOC25758							63.0	77.0	72.0					11																	33566805		2178	4279	6457	SO:0001583	missense	25758					integral to membrane		g.chr11:33566805C>A	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2375C>A	11.37:g.33566805C>A	ENSP00000315295:p.Pro792Gln		Somatic				C11orf41_uc001mun.1_Missense_Mutation_p.P798Q	p.P798Q	NM_012194	NP_036326	WXS	Illumina HiSeq	Unspecified	Q6ZVL6	CK041_HUMAN			2	2517	+			792					B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	c.2393C>A	CCDS44565.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.39|14.39	2.520651|2.520651	0.44866|0.44866	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000526400|ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.180536	.|0.48767	.|D	.|0.000162	T|T	0.65523|0.65523	0.2699|0.2699	L|L	0.59436|0.59436	1.845|1.845	0.22684|0.22684	N|N	0.998856|0.998856	.|P;D	.|0.76494	.|0.933;0.999	.|P;D	.|0.65987	.|0.486;0.94	T|T	0.60276|0.60276	-0.7295|-0.7295	5|9	.|0.72032	.|D	.|0.01	-2.8794|-2.8794	18.2527|18.2527	0.90009|0.90009	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|798;798	.|E9PAT2;Q6ZVL6-2	.|.;.	N|Q	190|792;798;798;631	.|.	.|ENSP00000265654:P798Q	H|P	+|+	1|2	0|0	C11orf41|C11orf41	33523381|33523381	0.036000|0.036000	0.19791|0.19791	0.030000|0.030000	0.17652|0.17652	0.214000|0.214000	0.24535|0.24535	3.327000|3.327000	0.52045|0.52045	2.751000|2.751000	0.94390|0.94390	0.561000|0.561000	0.74099|0.74099	CAT|CCA		0.582	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194		29	75	1	0	2.48779e-11	0.005443	3.7377e-11	29	75				
TP53I11	9537	broad.mit.edu	37	11	44956479	44956479	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:44956479T>A	ENST00000533940.1	-	10	1130	c.526A>T	c.(526-528)Att>Ttt	p.I176F	TP53I11_ENST00000531130.2_5'Flank|TP53I11_ENST00000395648.3_Missense_Mutation_p.I176F|TP53I11_ENST00000308212.5_Missense_Mutation_p.I176F|TP53I11_ENST00000525680.1_Missense_Mutation_p.I176F	NM_001258320.1	NP_001245249.1	O14683	P5I11_HUMAN	tumor protein p53 inducible protein 11	176					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5						TAGTAGTAAATGCTGATGACG	0.627																																							uc001myi.2		NA																	0		p.I176M(1)		ovary(1)	1						c.(526-528)ATT>TTT		p53-induced protein							103.0	100.0	101.0					11																	44956479		2203	4299	6502	SO:0001583	missense	9537				negative regulation of cell proliferation|response to stress	integral to membrane		g.chr11:44956479T>A	AF010315	CCDS7911.1	11p11.2	2005-09-22				ENSG00000175274			16842	protein-coding gene	gene with protein product						9305847	Standard	NM_006034		Approved	PIG11	uc001myk.3	O14683		ENST00000533940.1:c.526A>T	11.37:g.44956479T>A	ENSP00000436152:p.Ile176Phe		Somatic				TP53I11_uc001myf.1_Intron|TP53I11_uc001myj.2_Missense_Mutation_p.I176F|TP53I11_uc001myk.2_Missense_Mutation_p.I176F|TP53I11_uc001myl.2_Missense_Mutation_p.I176F|TP53I11_uc001mym.2_Missense_Mutation_p.I123F	p.I176F	NM_006034	NP_006025	WXS	Illumina HiSeq	Unspecified	O14683	P5I11_HUMAN			10	1131	-			176			Helical; (Potential).		Q3ZCS0	Missense_Mutation	SNP	ENST00000533940.1	37	c.526A>T	CCDS7911.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291946	0.40594	.	.	ENSG00000175274	ENST00000395648;ENST00000308212;ENST00000308220;ENST00000533940;ENST00000525680	.	.	.	5.1	-5.46	0.02608	.	.	.	.	.	T	0.40619	0.1124	N	0.25647	0.755	0.45747	D	0.99864	B;B	0.16603	0.018;0.018	B;B	0.25884	0.064;0.044	T	0.07751	-1.0756	8	0.26408	T	0.33	.	13.7766	0.63057	0.0:0.5931:0.0:0.4069	.	123;176	Q8N8U5;O14683	.;P5I11_HUMAN	F	176;176;123;176;176	.	ENSP00000309532:I176F	I	-	1	0	TP53I11	44913055	0.024000	0.19004	0.938000	0.37757	0.793000	0.44817	-1.133000	0.03232	-1.042000	0.03262	-0.451000	0.05528	ATT		0.627	TP53I11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389909.1	NM_006034		26	67	0	0	0	0.00333	0	26	67				
CHRM4	1132	broad.mit.edu	37	11	46406886	46406886	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:46406886C>A	ENST00000433765.2	-	1	1221	c.1222G>T	c.(1222-1224)Gcc>Tcc	p.A408S		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	408					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGGATGAAGGCTAGCAGAATG	0.597																																					Esophageal Squamous(171;1020 1936 4566 30205 42542)	Esophageal Squamous(171;1020 1936 4566 30205 42542)	uc001nct.1		NA																	0					0						c.(1222-1224)GCC>TCC		cholinergic receptor, muscarinic 4	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)|Tropicamide(DB00809)						115.0	117.0	117.0					11																	46406886		2202	4299	6501	SO:0001583	missense	1132				cell proliferation	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity	g.chr11:46406886C>A	M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.1222G>T	11.37:g.46406886C>A	ENSP00000409378:p.Ala408Ser		Somatic					p.A408S	NM_000741	NP_000732	WXS	Illumina HiSeq	Unspecified	P08173	ACM4_HUMAN		GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	1	1222	-			408			Helical; Name=6; (By similarity).		B2RPP4|Q0VD60|Q4VBK7	Missense_Mutation	SNP	ENST00000433765.2	37	c.1222G>T	CCDS44581.1	.	.	.	.	.	.	.	.	.	.	c	19.37	3.815164	0.70912	.	.	ENSG00000180720	ENST00000433765	T	0.73047	-0.71	4.58	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.83285	0.5221	M	0.87827	2.91	0.58432	D	0.999999	D	0.56968	0.978	P	0.59221	0.854	D	0.86941	0.2079	9	0.87932	D	0	-12.9357	14.6736	0.68961	0.0:0.8538:0.1462:0.0	.	408	P08173	ACM4_HUMAN	S	408	ENSP00000409378:A408S	ENSP00000409378:A408S	A	-	1	0	CHRM4	46363462	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.640000	0.83355	1.134000	0.42165	0.457000	0.33378	GCC		0.597	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334985.1	NM_000741		17	29	1	0	3.45872e-05	0.004007	4.08997e-05	17	29				
OR4C46	119749	broad.mit.edu	37	11	51515557	51515557	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:51515557C>A	ENST00000328188.1	+	1	276	c.276C>A	c.(274-276)ttC>ttA	p.F92L		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CCATCCTATTCAATGGATGCA	0.463																																							uc010ric.1		NA																	0				ovary(1)	1						c.(274-276)TTC>TTA		olfactory receptor, family 4, subfamily C,							163.0	151.0	155.0					11																	51515557		2201	4296	6497	SO:0001583	missense	119749				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51515557C>A		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.276C>A	11.37:g.51515557C>A	ENSP00000329056:p.Phe92Leu		Somatic					p.F92L	NM_001004703	NP_001004703	WXS	Illumina HiSeq	Unspecified	A6NHA9	O4C46_HUMAN			1	276	+			92			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000328188.1	37	c.276C>A	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	3.230	-0.157738	0.06544	.	.	ENSG00000185926	ENST00000328188	T	0.00547	6.66	2.63	-0.618	0.11576	GPCR, rhodopsin-like superfamily (1);	0.143577	0.32357	N	0.006215	T	0.00496	0.0016	L	0.46614	1.455	0.09310	N	1	B	0.22003	0.063	B	0.25987	0.065	T	0.45659	-0.9246	10	0.33940	T	0.23	.	5.7828	0.18316	0.0:0.4356:0.0:0.5644	.	92	A6NHA9	O4C46_HUMAN	L	92	ENSP00000329056:F92L	ENSP00000329056:F92L	F	+	3	2	OR4C46	51372133	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.342000	0.07801	0.024000	0.15214	0.134000	0.15878	TTC		0.463	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		52	122	1	0	1.51926e-22	0.00361	2.77119e-22	52	122				
OR4C15	81309	broad.mit.edu	37	11	55322784	55322784	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:55322784G>T	ENST00000314644.2	+	1	1002	c.1002G>T	c.(1000-1002)ttG>ttT	p.L334F		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TAAATCCCTTGCTCAATCCTT	0.363										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(1000-1002)TTG>TTT		olfactory receptor, family 4, subfamily C,							139.0	137.0	138.0					11																	55322784		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322784G>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.1002G>T	11.37:g.55322784G>T	ENSP00000324958:p.Leu334Phe	HNSCC(20;0.049)	Somatic					p.L334F	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	1002	+			280			Helical; Name=7; (Potential).		Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.1002G>T	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	7.253	0.603596	0.14002	.	.	ENSG00000181939	ENST00000314644	T	0.37915	1.17	5.02	-0.498	0.12019	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.16300	0.0392	N	0.11201	0.11	0.09310	N	1	B	0.22851	0.076	B	0.23852	0.049	T	0.22208	-1.0223	9	0.52906	T	0.07	.	1.6873	0.02844	0.1589:0.1288:0.3173:0.3951	.	280	Q8NGM1	OR4CF_HUMAN	F	334	ENSP00000324958:L334F	ENSP00000324958:L334F	L	+	3	2	OR4C15	55079360	0.254000	0.23992	0.182000	0.23118	0.358000	0.29455	0.688000	0.25422	0.005000	0.14708	0.385000	0.25706	TTG		0.363	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		22	87	1	0	3.62473e-10	0.012319	5.26772e-10	22	87				
OR5D14	219436	broad.mit.edu	37	11	55563449	55563449	+	Missense_Mutation	SNP	C	C	A	rs200877014		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:55563449C>A	ENST00000335605.1	+	1	418	c.418C>A	c.(418-420)Cag>Aag	p.Q140K		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				GGCCATGTCACAGAGGCTCTG	0.537													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18582	0.0		0.0	False		,,,				2504	0.0						uc010rim.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(418-420)CAG>AAG		olfactory receptor, family 5, subfamily D,							104.0	95.0	98.0					11																	55563449		2200	4296	6496	SO:0001583	missense	219436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55563449C>A	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.418C>A	11.37:g.55563449C>A	ENSP00000334456:p.Gln140Lys		Somatic					p.Q140K	NM_001004735	NP_001004735	WXS	Illumina HiSeq	Unspecified	Q8NGL3	OR5DE_HUMAN			1	418	+		all_epithelial(135;0.196)	140			Cytoplasmic (Potential).		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	c.418C>A	CCDS31508.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	c	1.370	-0.586381	0.03827	.	.	ENSG00000186113	ENST00000335605	T	0.35421	1.31	5.08	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.537327	0.15558	N	0.256062	T	0.21186	0.0510	N	0.21097	0.63	0.09310	N	1	B	0.09022	0.002	B	0.16722	0.016	T	0.25257	-1.0137	10	0.02654	T	1	-0.4652	10.4676	0.44618	0.0:0.9088:0.0:0.0912	.	140	Q8NGL3	OR5DE_HUMAN	K	140	ENSP00000334456:Q140K	ENSP00000334456:Q140K	Q	+	1	0	OR5D14	55320025	0.000000	0.05858	0.019000	0.16419	0.166000	0.22503	-0.437000	0.06914	1.136000	0.42199	0.643000	0.83706	CAG		0.537	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		19	86	1	0	1.67942e-08	0.006122	2.30087e-08	19	86				
OR10AG1	282770	broad.mit.edu	37	11	55735071	55735071	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:55735071A>T	ENST00000312345.2	-	1	919	c.869T>A	c.(868-870)gTg>gAg	p.V290E		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TCTCAATGCCACCATGATATC	0.328																																							uc010rit.1		NA																	0				skin(2)	2						c.(868-870)GTG>GAG		olfactory receptor, family 10, subfamily AG,							55.0	61.0	59.0					11																	55735071		2201	4296	6497	SO:0001583	missense	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735071A>T	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.869T>A	11.37:g.55735071A>T	ENSP00000311477:p.Val290Glu		Somatic					p.V290E	NM_001005491	NP_001005491	WXS	Illumina HiSeq	Unspecified	Q8NH19	O10AG_HUMAN			1	869	-	Esophageal squamous(21;0.0137)		290			Cytoplasmic (Potential).		B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	c.869T>A	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	A	7.676	0.688000	0.14973	.	.	ENSG00000174970	ENST00000312345	T	0.35236	1.32	5.37	-5.51	0.02568	.	1.628170	0.03489	N	0.216251	T	0.15998	0.0385	N	0.16130	0.375	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.23048	-1.0199	10	0.06891	T	0.86	.	5.2882	0.15712	0.2243:0.0:0.2297:0.546	.	290	Q8NH19	O10AG_HUMAN	E	290	ENSP00000311477:V290E	ENSP00000311477:V290E	V	-	2	0	OR10AG1	55491647	0.000000	0.05858	0.000000	0.03702	0.919000	0.55068	-4.800000	0.00184	-0.515000	0.06479	0.391000	0.25812	GTG		0.328	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		7	37	0	0	0	0.006214	0	7	37				
OR5J2	282775	broad.mit.edu	37	11	55944484	55944484	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:55944484C>A	ENST00000312298.1	+	1	391	c.391C>A	c.(391-393)Ctt>Att	p.L131I		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					GAGTCCCTTGCTTTACACTGT	0.453																																							uc010rjb.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(391-393)CTT>ATT		olfactory receptor, family 5, subfamily J,							160.0	145.0	150.0					11																	55944484		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944484C>A	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.391C>A	11.37:g.55944484C>A	ENSP00000310788:p.Leu131Ile		Somatic					p.L131I	NM_001005492	NP_001005492	WXS	Illumina HiSeq	Unspecified	Q8NH18	OR5J2_HUMAN			1	391	+	Esophageal squamous(21;0.00693)		131			Cytoplasmic (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.391C>A	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.633840	0.29068	.	.	ENSG00000174957	ENST00000312298	T	0.01359	4.98	4.67	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000134	T	0.03739	0.0106	M	0.87456	2.885	0.24736	N	0.99306	B	0.16802	0.019	B	0.23018	0.043	T	0.20075	-1.0286	10	0.59425	D	0.04	.	13.5426	0.61684	0.5296:0.4704:0.0:0.0	.	131	Q8NH18	OR5J2_HUMAN	I	131	ENSP00000310788:L131I	ENSP00000310788:L131I	L	+	1	0	OR5J2	55701060	0.835000	0.29415	0.080000	0.20451	0.007000	0.05969	1.578000	0.36525	0.099000	0.17552	-0.292000	0.09595	CTT		0.453	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		19	65	1	0	1.00905e-13	0.008871	1.6176e-13	19	65				
OR6Q1	219952	broad.mit.edu	37	11	57798435	57798435	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:57798435A>T	ENST00000302622.3	+	1	34	c.11A>T	c.(10-12)tAt>tTt	p.Y4F	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				ATGCAACCATATACCAAAAAC	0.448																																							uc010rjz.1		NA																	0				kidney(1)	1						c.(10-12)TAT>TTT		olfactory receptor, family 6, subfamily Q,							148.0	141.0	143.0					11																	57798435		2201	4296	6497	SO:0001583	missense	219952				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57798435A>T	AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.11A>T	11.37:g.57798435A>T	ENSP00000307734:p.Tyr4Phe		Somatic				OR9Q1_uc001nmj.2_Intron	p.Y4F	NM_001005186	NP_001005186	WXS	Illumina HiSeq	Unspecified	Q8NGQ2	OR6Q1_HUMAN			1	11	+		Breast(21;0.0707)|all_epithelial(135;0.142)	4			Extracellular (Potential).		B9EKW1|Q6IFH1|Q96R34	Missense_Mutation	SNP	ENST00000302622.3	37	c.11A>T	CCDS31541.1	.	.	.	.	.	.	.	.	.	.	A	9.669	1.146110	0.21288	.	.	ENSG00000172381	ENST00000302622	T	0.37058	1.22	5.32	2.88	0.33553	.	1.639210	0.04315	U	0.349688	T	0.19846	0.0477	N	0.08118	0	0.09310	N	1	B	0.21381	0.055	B	0.20384	0.029	T	0.25152	-1.0140	10	0.10111	T	0.7	.	7.5393	0.27729	0.7818:0.1417:0.0765:0.0	.	4	Q8NGQ2	OR6Q1_HUMAN	F	4	ENSP00000307734:Y4F	ENSP00000307734:Y4F	Y	+	2	0	OR6Q1	57555011	0.000000	0.05858	0.001000	0.08648	0.220000	0.24768	-0.190000	0.09615	0.291000	0.22468	0.523000	0.50628	TAT		0.448	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186		35	113	0	0	0	0.003271	0	35	113				
SYT7	9066	broad.mit.edu	37	11	61295448	61295448	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:61295448C>T	ENST00000263846.4	-	5	888	c.561G>A	c.(559-561)ctG>ctA	p.L187L	SYT7_ENST00000539008.1_Silent_p.L470L|SYT7_ENST00000542836.1_Silent_p.L231L|SYT7_ENST00000540831.1_5'UTR|SYT7_ENST00000535826.1_Silent_p.L306L|SYT7_ENST00000542670.1_Silent_p.L395L|SYT7_ENST00000540677.1_Silent_p.L262L	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	187	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCTTGGTCTCCAGCTTGTGCT	0.582																																							uc001nrv.2		NA																	0				ovary(3)|pancreas(1)	4						c.(559-561)CTG>CTA		synaptotagmin VII							122.0	113.0	116.0					11																	61295448		2202	4299	6501	SO:0001819	synonymous_variant	9066					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr11:61295448C>T	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.561G>A	11.37:g.61295448C>T			Somatic				SYT7_uc009ynr.2_Silent_p.L262L	p.L187L	NM_004200	NP_004191	WXS	Illumina HiSeq	Unspecified	O43581	SYT7_HUMAN			5	567	-			187			C2 1.|Cytoplasmic (Potential).		F5GZU9|Q08AH6	Silent	SNP	ENST00000263846.4	37	c.561G>A	CCDS31577.1																																																																																				0.582	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200		9	91	0	0	0	0.004482	0	9	91				
ASRGL1	80150	broad.mit.edu	37	11	62123819	62123819	+	Silent	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:62123819A>G	ENST00000415229.2	+	3	428	c.213A>G	c.(211-213)acA>acG	p.T71T	ASRGL1_ENST00000301776.5_Silent_p.T71T|ASRGL1_ENST00000535727.1_Intron	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	71					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	TCTTGAACACAAATGGTGAGG	0.478																																							uc001nte.3		NA																	0					0						c.(211-213)ACA>ACG		asparaginase-like 1	L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)						194.0	184.0	188.0					11																	62123819		2202	4299	6501	SO:0001819	synonymous_variant	80150				asparagine catabolic process via L-aspartate|protein maturation	cytoplasm|microtubule cytoskeleton|nucleus	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity	g.chr11:62123819A>G		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.213A>G	11.37:g.62123819A>G			Somatic				ASRGL1_uc001ntf.3_Silent_p.T71T|ASRGL1_uc001ntg.3_Intron|ASRGL1_uc001nth.1_5'Flank	p.T71T	NM_025080	NP_079356	WXS	Illumina HiSeq	Unspecified	Q7L266	ASGL1_HUMAN			3	497	+			71					B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Silent	SNP	ENST00000415229.2	37	c.213A>G	CCDS8019.1																																																																																				0.478	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394865.1	NM_001083926		32	67	0	0	0	0.012213	0	32	67				
SLC22A8	9376	broad.mit.edu	37	11	62782359	62782359	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:62782359C>A	ENST00000336232.2	-	2	207	c.72G>T	c.(70-72)ctG>ctT	p.L24L	SLC22A8_ENST00000545207.1_Intron|SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000311438.8_Silent_p.L24L|SLC22A8_ENST00000430500.2_Silent_p.L24L	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	24					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TCGGGAGGCCCAGTATGGCTA	0.607																																							uc001nwo.2		NA																	0				skin(2)|ovary(1)	3						c.(70-72)CTG>CTT		solute carrier family 22 member 8							175.0	166.0	169.0					11																	62782359		2201	4298	6499	SO:0001819	synonymous_variant	9376				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity	g.chr11:62782359C>A	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.72G>T	11.37:g.62782359C>A			Somatic				SLC22A8_uc001nwp.2_Silent_p.L24L|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Silent_p.L24L	p.L24L	NM_004254	NP_004245	WXS	Illumina HiSeq	Unspecified	Q8TCC7	S22A8_HUMAN			2	208	-			24			Helical; (Potential).		B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Silent	SNP	ENST00000336232.2	37	c.72G>T	CCDS8042.1																																																																																				0.607	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254		5	170	1	0	3.59834e-05	0.001168	4.22295e-05	5	170				
SART1	9092	broad.mit.edu	37	11	65733831	65733831	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:65733831G>T	ENST00000312397.5	+	9	1084	c.992G>T	c.(991-993)cGc>cTc	p.R331L		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	331					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CAAAAACCTCGCTCTATCCTG	0.607																																							uc001ogl.2		NA																	0				ovary(1)	1						c.(991-993)CGC>CTC		squamous cell carcinoma antigen recognized by T							53.0	50.0	51.0					11																	65733831		2201	4296	6497	SO:0001583	missense	9092				cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol		g.chr11:65733831G>T	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.992G>T	11.37:g.65733831G>T	ENSP00000310448:p.Arg331Leu		Somatic				SART1_uc010rot.1_Missense_Mutation_p.A217S	p.R331L	NM_005146	NP_005137	WXS	Illumina HiSeq	Unspecified	O43290	SNUT1_HUMAN			9	1084	+			331					A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	37	c.992G>T	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	G	9.556	1.117109	0.20795	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.25414	1.8	3.9	2.98	0.34508	.	0.359158	0.22539	N	0.058742	T	0.26629	0.0651	M	0.64997	1.995	0.40643	D	0.981962	B	0.27559	0.181	B	0.32533	0.147	T	0.11084	-1.0602	10	0.87932	D	0	-18.4107	6.6857	0.23144	0.2237:0.0:0.7763:0.0	.	331	O43290	SNUT1_HUMAN	L	331;173	ENSP00000310448:R331L	ENSP00000310448:R331L	R	+	2	0	SART1	65490407	0.944000	0.32072	1.000000	0.80357	0.117000	0.20001	2.398000	0.44486	0.780000	0.33566	-0.680000	0.03767	CGC		0.607	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391409.1			24	35	1	0	1.55469e-16	0.00333	2.63493e-16	24	35				
ZDHHC24	254359	broad.mit.edu	37	11	66311271	66311271	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:66311271C>T	ENST00000310442.3	-	2	697	c.463G>A	c.(463-465)Gtg>Atg	p.V155M	ZDHHC24_ENST00000526986.1_Missense_Mutation_p.V155M|ZDHHC24_ENST00000525925.1_5'UTR|ACTN3_ENST00000502692.1_RNA	NM_207340.1	NP_997223.1	Q6UX98	ZDH24_HUMAN	zinc finger, DHHC-type containing 24	155	Leu-rich.					integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|ovary(1)|prostate(1)|skin(1)	7						CCCAGCAGCACAGAGACGTGG	0.692											OREG0021110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oin.1		NA																	0					0						c.(463-465)GTG>ATG		zinc finger, DHHC-type containing 24							33.0	34.0	34.0					11																	66311271		2194	4292	6486	SO:0001583	missense	254359					integral to membrane	acyltransferase activity|zinc ion binding	g.chr11:66311271C>T	BC005015	CCDS8143.1	11q13.2	2008-05-02				ENSG00000174165		"""Zinc fingers, DHHC-type"""	27387	protein-coding gene	gene with protein product							Standard	NM_207340		Approved		uc001oin.1	Q6UX98		ENST00000310442.3:c.463G>A	11.37:g.66311271C>T	ENSP00000309429:p.Val155Met		Somatic	OREG0021110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1090	ACTN3_uc010rpi.1_5'Flank|ZDHHC24_uc001oim.1_RNA|ZDHHC24_uc009yrg.1_Missense_Mutation_p.V155M	p.V155M	NM_207340	NP_997223	WXS	Illumina HiSeq	Unspecified	Q6UX98	ZDH24_HUMAN			2	660	-			155			Leu-rich.|Helical; (Potential).		Q6PEW7|Q9BSJ0	Missense_Mutation	SNP	ENST00000310442.3	37	c.463G>A	CCDS8143.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205311	0.39003	.	.	ENSG00000174165	ENST00000526986;ENST00000310442	T;T	0.27557	1.66;1.66	3.91	3.91	0.45181	.	0.412070	0.21855	N	0.068115	T	0.43077	0.1231	L	0.41906	1.305	0.34573	D	0.713596	D;P	0.76494	0.999;0.918	D;P	0.70016	0.967;0.776	T	0.55630	-0.8111	10	0.56958	D	0.05	-23.7486	11.2834	0.49208	0.0:1.0:0.0:0.0	.	155;155	E9PLR9;Q6UX98	.;ZDH24_HUMAN	M	155	ENSP00000431321:V155M;ENSP00000309429:V155M	ENSP00000309429:V155M	V	-	1	0	ZDHHC24	66067847	0.989000	0.36119	0.922000	0.36590	0.167000	0.22549	2.773000	0.47686	2.027000	0.59764	0.462000	0.41574	GTG		0.692	ZDHHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393089.1	NM_207340		4	26	0	0	0	0.009096	0	4	26				
ANKRD13D	338692	broad.mit.edu	37	11	67059113	67059113	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:67059113G>T	ENST00000447274.2	+	5	1351	c.176G>T	c.(175-177)cGc>cTc	p.R59L	ANKRD13D_ENST00000514166.1_Missense_Mutation_p.R59L|ANKRD13D_ENST00000511455.2_Missense_Mutation_p.R146L|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.R59L			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	59						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GATGTGTACCGCGTGTGGAAG	0.622																																							uc001okc.1		NA																	0				ovary(1)	1						c.(175-177)CGC>CTC		ankyrin repeat domain 13 family, member D							73.0	76.0	75.0					11																	67059113		2200	4295	6495	SO:0001583	missense	338692							g.chr11:67059113G>T	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.176G>T	11.37:g.67059113G>T	ENSP00000402616:p.Arg59Leu		Somatic				ANKRD13D_uc001okd.1_Missense_Mutation_p.R146L|ANKRD13D_uc001oke.1_Missense_Mutation_p.R59L	p.R59L	NM_207354	NP_997237	WXS	Illumina HiSeq	Unspecified	Q6ZTN6	AN13D_HUMAN	BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		6	687	+			59					D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	37	c.176G>T		.	.	.	.	.	.	.	.	.	.	G	22.5	4.303594	0.81136	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.35048	1.33;1.52;1.33;1.33	3.95	3.04	0.35103	.	0.081744	0.48767	D	0.000177	T	0.44222	0.1283	L	0.56340	1.77	0.49915	D	0.999833	P;P	0.52316	0.952;0.906	P;P	0.56042	0.79;0.621	T	0.38887	-0.9640	10	0.87932	D	0	-8.8452	7.6297	0.28232	0.1997:0.0:0.8003:0.0	.	146;59	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	L	59;146;59;59	ENSP00000402616:R59L;ENSP00000427130:R146L;ENSP00000310874:R59L;ENSP00000444404:R59L	ENSP00000310874:R59L	R	+	2	0	ANKRD13D	66815689	0.998000	0.40836	0.797000	0.32132	0.949000	0.60115	2.896000	0.48656	1.034000	0.39945	0.561000	0.74099	CGC		0.622	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354		22	57	1	0	1.10513e-12	0.002299	1.72712e-12	22	57				
KRTAP5-11	440051	broad.mit.edu	37	11	71293801	71293801	+	Missense_Mutation	SNP	C	C	G	rs202232812		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:71293801C>G	ENST00000398530.1	-	1	120	c.83G>C	c.(82-84)tGt>tCt	p.C28S	AP000867.1_ENST00000343767.3_Intron|KRTAP5-11_ENST00000526239.1_Intron	NM_001005405.2	NP_001005405.1	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11	28						keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						ACAGCCCCCACAGCCAGAGCC	0.647																																							uc001oqu.2		NA																	0					0						c.(82-84)TGT>TCT		keratin associated protein 5-11		C	SER/CYS	0,4396		0,0,2198	41.0	56.0	51.0		83	2.1	1.0	11		51	4,8570		0,4,4283	no	missense	KRTAP5-11	NM_001005405.2	112	0,4,6481	GG,GC,CC		0.0467,0.0,0.0308	probably-damaging	28/157	71293801	4,12966	2198	4287	6485	SO:0001583	missense	440051					keratin filament		g.chr11:71293801C>G	AB126080	CCDS41685.1	11q13.4	2008-11-06			ENSG00000204571	ENSG00000204571		"""Keratin associated proteins"""	23606	protein-coding gene	gene with protein product						15144888	Standard	NM_001005405		Approved	KRTAP5.11, KRTAP5-6	uc001oqu.3	Q6L8G4	OTTHUMG00000057586	ENST00000398530.1:c.83G>C	11.37:g.71293801C>G	ENSP00000381541:p.Cys28Ser		Somatic					p.C28S	NM_001005405	NP_001005405	WXS	Illumina HiSeq	Unspecified	Q6L8G4	KR511_HUMAN			1	121	-			28						Missense_Mutation	SNP	ENST00000398530.1	37	c.83G>C	CCDS41685.1	.	.	.	.	.	.	.	.	.	.	.	9.853	1.194128	0.22037	0.0	4.67E-4	ENSG00000204571	ENST00000376535;ENST00000398530	T	0.01113	5.32	2.07	2.07	0.26955	.	.	.	.	.	T	0.03520	0.0101	L	0.58302	1.8	0.30028	N	0.813758	D	0.64830	0.994	P	0.62885	0.908	T	0.34925	-0.9809	9	0.23891	T	0.37	.	9.8088	0.40810	0.0:1.0:0.0:0.0	.	28	Q6L8G4	KR511_HUMAN	S	28	ENSP00000381541:C28S	ENSP00000365718:C28S	C	-	2	0	KRTAP5-11	70971449	0.942000	0.31987	0.984000	0.44739	0.734000	0.41952	1.015000	0.29963	1.151000	0.42436	0.545000	0.68477	TGT		0.647	KRTAP5-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127969.1	NM_001005405		5	142	0	0	0	0.000602	0	5	142				
TSKU	25987	broad.mit.edu	37	11	76506887	76506887	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:76506887C>T	ENST00000527881.1	+	2	1253	c.227C>T	c.(226-228)tCg>tTg	p.S76L	TSKU_ENST00000333090.4_Missense_Mutation_p.S76L			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	76					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					GTGAATGAGTCGGTGTTGGCG	0.637																																							uc001oxt.2		NA																	0					0						c.(226-228)TCG>TTG		tsukushin precursor							70.0	56.0	61.0					11																	76506887		2200	4292	6492	SO:0001583	missense	25987					extracellular region		g.chr11:76506887C>T	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.227C>T	11.37:g.76506887C>T	ENSP00000434847:p.Ser76Leu		Somatic					p.S76L	NM_015516	NP_056331	WXS	Illumina HiSeq	Unspecified	Q8WUA8	TSK_HUMAN			2	399	+	Ovarian(111;0.112)		76			LRR 1.		B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	ENST00000527881.1	37	c.227C>T	CCDS8246.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972582	0.53614	.	.	ENSG00000182704	ENST00000533752;ENST00000333090;ENST00000439807;ENST00000525167;ENST00000527881	T;T;T;T	0.05081	3.5;3.5;4.18;3.5	5.4	5.4	0.78164	.	0.127409	0.53938	D	0.000052	T	0.23289	0.0563	M	0.62723	1.935	0.53005	D	0.999968	D	0.89917	1.0	D	0.70487	0.969	T	0.00119	-1.2031	10	0.66056	D	0.02	-15.3483	17.734	0.88387	0.0:1.0:0.0:0.0	.	76	Q8WUA8	TSK_HUMAN	L	76	ENSP00000435133:S76L;ENSP00000332668:S76L;ENSP00000434873:S76L;ENSP00000434847:S76L	ENSP00000332668:S76L	S	+	2	0	TSKU	76184535	1.000000	0.71417	0.948000	0.38648	0.038000	0.13279	5.743000	0.68655	2.512000	0.84698	0.650000	0.86243	TCG		0.637	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382871.1	NM_015516		16	53	0	0	0	0.004007	0	16	53				
CAPN5	726	broad.mit.edu	37	11	76833670	76833670	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:76833670C>A	ENST00000278559.3	+	12	1841	c.1652C>A	c.(1651-1653)tCg>tAg	p.S551*	CAPN5_ENST00000456580.2_Nonsense_Mutation_p.S591*|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Nonsense_Mutation_p.S551*	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	551	C2.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.S551L(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						AAAGTCCGCTCGGCTGTGCAG	0.582																																							uc001oxx.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(1651-1653)TCG>TAG		calpain 5							112.0	95.0	101.0					11																	76833670		2200	4292	6492	SO:0001587	stop_gained	726				proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity	g.chr11:76833670C>A		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.1652C>A	11.37:g.76833670C>A	ENSP00000278559:p.Ser551*		Somatic				CAPN5_uc009yup.2_Nonsense_Mutation_p.S591*|CAPN5_uc009yuq.2_Nonsense_Mutation_p.S587*|CAPN5_uc001oxy.2_Nonsense_Mutation_p.S591*|CAPN5_uc001oya.2_Nonsense_Mutation_p.S113*	p.S551*	NM_004055	NP_004046	WXS	Illumina HiSeq	Unspecified	O15484	CAN5_HUMAN			12	1837	+			551			C2.		O00263	Nonsense_Mutation	SNP	ENST00000278559.3	37	c.1652C>A	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	C	40	8.446343	0.98815	.	.	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.1909	0.86879	0.0:1.0:0.0:0.0	.	.	.	.	X	551;591;551;591	.	ENSP00000278559:S551X	S	+	2	0	CAPN5	76511318	1.000000	0.71417	0.947000	0.38551	0.990000	0.78478	7.400000	0.79949	2.358000	0.79984	0.561000	0.74099	TCG		0.582	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055		21	39	1	0	8.10497e-08	0.010504	1.07951e-07	21	39				
PCF11	51585	broad.mit.edu	37	11	82868580	82868580	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:82868580C>A	ENST00000298281.4	+	1	551	c.99C>A	c.(97-99)agC>agA	p.S33R		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	33	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CCTTCAATAGCAAGCCGCACA	0.587																																							uc001ozx.3		NA																	0				ovary(1)	1						c.(97-99)AGC>AGA		pre-mRNA cleavage complex II protein Pcf11							86.0	94.0	91.0					11																	82868580		2023	4188	6211	SO:0001583	missense	51585				mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex		g.chr11:82868580C>A	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.99C>A	11.37:g.82868580C>A	ENSP00000298281:p.Ser33Arg		Somatic				PCF11_uc010rsu.1_Missense_Mutation_p.S33R|PCF11_uc001ozy.2_Missense_Mutation_p.S33R	p.S33R	NM_015885	NP_056969	WXS	Illumina HiSeq	Unspecified	O94913	PCF11_HUMAN			1	444	+			33			CID.		A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	c.99C>A	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	c	18.56	3.651402	0.67472	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304;ENST00000533018	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	4.84	3.85	0.44370	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);	0.000000	0.64402	D	0.000008	T	0.72486	0.3466	M	0.84433	2.695	0.58432	D	0.999997	P;D;D	0.71674	0.893;0.991;0.998	P;D;D	0.78314	0.572;0.986;0.991	T	0.75668	-0.3238	9	.	.	.	.	12.2045	0.54345	0.0:0.9021:0.0:0.0979	.	33;116;33	E9PQ01;Q0D2H7;O94913	.;.;PCF11_HUMAN	R	33	ENSP00000298281:S33R;ENSP00000434540:S33R;ENSP00000431567:S33R;ENSP00000436806:S33R	.	S	+	3	2	PCF11	82546228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.557000	0.67313	2.534000	0.85438	0.651000	0.88453	AGC		0.587	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885		11	96	1	0	4.68919e-08	0.008291	6.29952e-08	11	96				
KIAA1377	57562	broad.mit.edu	37	11	101833442	101833442	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:101833442A>G	ENST00000263468.8	+	6	1946	c.1676A>G	c.(1675-1677)cAt>cGt	p.H559R	KIAA1377_ENST00000537689.1_Missense_Mutation_p.H360R	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	559										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GTTGGCCAGCATAAGAAAATG	0.294																																							uc001pgm.2		NA																	0				breast(2)|ovary(1)|central_nervous_system(1)	4						c.(1675-1677)CAT>CGT		hypothetical protein LOC57562							38.0	41.0	40.0					11																	101833442		2196	4281	6477	SO:0001583	missense	57562						protein binding	g.chr11:101833442A>G	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1676A>G	11.37:g.101833442A>G	ENSP00000263468:p.His559Arg		Somatic				KIAA1377_uc001pgn.2_Missense_Mutation_p.H515R|KIAA1377_uc010run.1_Missense_Mutation_p.H360R|KIAA1377_uc009yxa.1_Missense_Mutation_p.H360R	p.H559R	NM_020802	NP_065853	WXS	Illumina HiSeq	Unspecified	Q9P2H0	K1377_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.038)	6	1946	+	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)	559					Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	c.1676A>G	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	A	5.367	0.253025	0.10185	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08008	3.14;3.14	5.28	2.75	0.32379	.	0.437967	0.23596	N	0.046485	T	0.08133	0.0203	M	0.64997	1.995	0.09310	N	1	P	0.38440	0.631	B	0.33521	0.165	T	0.23332	-1.0191	10	0.28530	T	0.3	0.0926	7.2289	0.26030	0.6509:0.2768:0.0723:0.0	.	559	Q9P2H0	K1377_HUMAN	R	559;360	ENSP00000263468:H559R;ENSP00000443184:H360R	ENSP00000263468:H559R	H	+	2	0	KIAA1377	101338652	0.004000	0.15560	0.081000	0.20488	0.483000	0.33249	1.855000	0.39378	0.918000	0.36919	0.529000	0.55759	CAT		0.294	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802		10	26	0	0	0	0.006214	0	10	26				
DYNC2H1	79659	broad.mit.edu	37	11	103182692	103182692	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:103182692G>T	ENST00000375735.2	+	79	11723	c.11579G>T	c.(11578-11580)cGa>cTa	p.R3860L	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R3867L|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3860	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R1300Q(3)|p.R1300P(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AATACACATCGAGCTCATGCT	0.358																																							uc001pho.2		NA																	4	Substitution - Missense(4)	p.R1300Q(3)	breast(3)|lung(1)		0						c.(11578-11580)CGA>CTA		dynein, cytoplasmic 2, heavy chain 1							114.0	111.0	112.0					11																	103182692		1852	4097	5949	SO:0001583	missense	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:103182692G>T	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11579G>T	11.37:g.103182692G>T	ENSP00000364887:p.Arg3860Leu		Somatic				DYNC2H1_uc001phn.1_Missense_Mutation_p.R3867L|DYNC2H1_uc009yxe.1_Intron	p.R3860L	NM_001080463	NP_001073932	WXS	Illumina HiSeq	Unspecified	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	79	11723	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	3860			AAA 6 (By similarity).		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	c.11579G>T	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853482	0.91355	.	.	ENSG00000187240	ENST00000375735;ENST00000398093;ENST00000540621	T;T	0.08546	3.08;3.08	4.69	4.69	0.59074	Dynein heavy chain (1);	0.000000	0.64402	D	0.000002	T	0.21962	0.0529	M	0.72353	2.195	0.80722	D	1	P;P	0.51351	0.897;0.944	P;P	0.53649	0.731;0.611	T	0.01330	-1.1383	10	0.38643	T	0.18	.	17.62	0.88078	0.0:0.0:1.0:0.0	.	3860;3867	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	3860;3867;106	ENSP00000364887:R3860L;ENSP00000381167:R3867L	ENSP00000364887:R3860L	R	+	2	0	DYNC2H1	102687902	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	9.195000	0.94971	2.147000	0.66899	0.555000	0.69702	CGA		0.358	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		8	38	1	0	0.000274275	0.004482	0.000308498	8	38				
ANKK1	255239	broad.mit.edu	37	11	113264300	113264300	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:113264300G>T	ENST00000303941.3	+	2	377	c.283G>T	c.(283-285)Ggt>Tgt	p.G95C		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	95	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		GCAGCCCCTGGGTATTGTGAT	0.512																																							uc001pny.2		NA																	0				lung(5)|stomach(1)|ovary(1)|breast(1)	8						c.(283-285)GGT>TGT		ankyrin repeat and kinase domain containing 1							82.0	84.0	83.0					11																	113264300		2001	4178	6179	SO:0001583	missense	255239						ATP binding|protein serine/threonine kinase activity	g.chr11:113264300G>T	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.283G>T	11.37:g.113264300G>T	ENSP00000306678:p.Gly95Cys		Somatic					p.G95C	NM_178510	NP_848605	WXS	Illumina HiSeq	Unspecified	Q8NFD2	ANKK1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)	2	377	+		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)	95			Protein kinase.			Missense_Mutation	SNP	ENST00000303941.3	37	c.283G>T	CCDS44734.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253582	0.59212	.	.	ENSG00000170209	ENST00000303941	T	0.33216	1.42	4.84	4.84	0.62591	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000041	T	0.43188	0.1236	N	0.21240	0.645	0.53688	D	0.999978	D	0.89917	1.0	D	0.87578	0.998	T	0.45687	-0.9244	10	0.72032	D	0.01	-30.755	17.1001	0.86647	0.0:0.0:1.0:0.0	.	95	Q8NFD2	ANKK1_HUMAN	C	95	ENSP00000306678:G95C	ENSP00000306678:G95C	G	+	1	0	ANKK1	112769510	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	9.326000	0.96389	2.491000	0.84063	0.462000	0.41574	GGT		0.512	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510		10	33	1	0	7.48243e-07	0.006214	9.55661e-07	10	33				
PVRL1	5818	broad.mit.edu	37	11	119548513	119548513	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:119548513C>A	ENST00000264025.3	-	3	1015	c.485G>T	c.(484-486)gGg>gTg	p.G162V	PVRL1_ENST00000524510.1_5'UTR|PVRL1_ENST00000341398.2_Missense_Mutation_p.G162V|PVRL1_ENST00000340882.2_Missense_Mutation_p.G162V	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	162	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GTCATCCTGCCCCTTCTTGGC	0.562																																							uc001pwv.2		NA																	0					0						c.(484-486)GGG>GTG		poliovirus receptor-related 1 isoform 1							113.0	87.0	96.0					11																	119548513		2199	4295	6494	SO:0001583	missense	5818				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity	g.chr11:119548513C>A	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.485G>T	11.37:g.119548513C>A	ENSP00000264025:p.Gly162Val		Somatic				PVRL1_uc001pwu.1_Missense_Mutation_p.G162V|PVRL1_uc001pww.2_Missense_Mutation_p.G162V	p.G162V	NM_002855	NP_002846	WXS	Illumina HiSeq	Unspecified	Q15223	PVRL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)	3	657	-		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	162			Extracellular (Potential).|Ig-like C2-type 1.		O75465|Q2M3D3|Q9HBE6|Q9HBW2	Missense_Mutation	SNP	ENST00000264025.3	37	c.485G>T	CCDS8426.1	.	.	.	.	.	.	.	.	.	.	c	16.88	3.243915	0.58995	.	.	ENSG00000110400	ENST00000341398;ENST00000264025;ENST00000340882	T;T;T	0.80304	-1.31;-1.36;-1.27	5.31	5.31	0.75309	CD80-like, immunoglobulin C2-set (1);	0.203244	0.52532	D	0.000070	D	0.83608	0.5291	L	0.44542	1.39	0.80722	D	1	D;D;D	0.65815	0.991;0.981;0.995	P;P;P	0.57101	0.68;0.713;0.813	T	0.82472	-0.0440	9	.	.	.	.	17.9759	0.89127	0.0:1.0:0.0:0.0	.	162;162;162	Q15223-3;Q15223;Q15223-2	.;PVRL1_HUMAN;.	V	162	ENSP00000344974:G162V;ENSP00000264025:G162V;ENSP00000345289:G162V	.	G	-	2	0	PVRL1	119053723	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	5.514000	0.67043	2.509000	0.84616	0.556000	0.70494	GGG		0.562	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388231.1			13	30	1	0	1.49906e-05	0.00245	1.80003e-05	13	30				
ADAMTS15	170689	broad.mit.edu	37	11	130319110	130319110	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:130319110C>T	ENST00000299164.2	+	1	242	c.242C>T	c.(241-243)aCt>aTt	p.T81I		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	81						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GCCTTCTCCACTGAGCATCTG	0.597																																							uc010scd.1		NA																	0				large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(241-243)ACT>ATT		a disintegrin-like and metalloprotease							51.0	58.0	56.0					11																	130319110		2201	4296	6497	SO:0001583	missense	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130319110C>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.242C>T	11.37:g.130319110C>T	ENSP00000299164:p.Thr81Ile		Somatic					p.T81I	NM_139055	NP_620686	WXS	Illumina HiSeq	Unspecified	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	1	242	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	81					Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	c.242C>T	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	C	6.206	0.406191	0.11754	.	.	ENSG00000166106	ENST00000299164	T	0.05513	3.43	4.92	4.92	0.64577	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.03739	0.0106	N	0.13003	0.285	0.25822	N	0.984271	P	0.34864	0.473	B	0.28385	0.089	T	0.34279	-0.9835	9	0.36615	T	0.2	.	7.7642	0.28970	0.1634:0.754:0.0:0.0826	.	81	Q8TE58	ATS15_HUMAN	I	81	ENSP00000299164:T81I	ENSP00000299164:T81I	T	+	2	0	ADAMTS15	129824320	0.503000	0.26115	0.856000	0.33681	0.874000	0.50279	0.884000	0.28214	2.714000	0.92807	0.561000	0.74099	ACT		0.597	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		29	76	0	0	0	0.007291	0	29	76				
A2M	2	broad.mit.edu	37	12	9230301	9230301	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:9230301A>G	ENST00000318602.7	-	26	3579	c.3272T>C	c.(3271-3273)aTa>aCa	p.I1091T	A2M_ENST00000542567.1_5'Flank	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1091					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	ATTCACCTTTATGGCATTGTT	0.438																																							uc001qvk.1		NA																	0				central_nervous_system(4)|skin(1)	5						c.(3271-3273)ATA>ACA		alpha-2-macroglobulin precursor	Bacitracin(DB00626)|Becaplermin(DB00102)						87.0	89.0	88.0					12																	9230301		2203	4300	6503	SO:0001583	missense	2				blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding	g.chr12:9230301A>G	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3272T>C	12.37:g.9230301A>G	ENSP00000323929:p.Ile1091Thr		Somatic				A2M_uc001qvj.1_Missense_Mutation_p.I133T|A2M_uc009zgk.1_Missense_Mutation_p.I941T	p.I1091T	NM_000014	NP_000005	WXS	Illumina HiSeq	Unspecified	P01023	A2MG_HUMAN			26	3385	-			1091					Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	c.3272T>C	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.852566	0.91355	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.33438	1.41	5.76	5.76	0.90799	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.324480	0.31949	N	0.006811	T	0.56848	0.2013	M	0.81942	2.565	0.39338	D	0.965527	D	0.53151	0.958	P	0.62740	0.906	T	0.64339	-0.6431	10	0.87932	D	0	.	15.7411	0.77899	1.0:0.0:0.0:0.0	.	1091	P01023	A2MG_HUMAN	T	1091;1106	ENSP00000323929:I1091T	ENSP00000323929:I1091T	I	-	2	0	A2M	9121568	1.000000	0.71417	0.982000	0.44146	0.959000	0.62525	9.256000	0.95535	2.199000	0.70637	0.477000	0.44152	ATA		0.438	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		12	60	0	0	0	0.00245	0	12	60				
SLCO1B1	10599	broad.mit.edu	37	12	21358833	21358833	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:21358833C>A	ENST00000256958.2	+	11	1459	c.1363C>A	c.(1363-1365)Cca>Aca	p.P455T		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	455	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TAGAGATGTACCACTTTCTTA	0.383																																							uc001req.3		NA																	0				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1363-1365)CCA>ACA		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						113.0	109.0	110.0					12																	21358833		2203	4300	6503	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21358833C>A		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1363C>A	12.37:g.21358833C>A	ENSP00000256958:p.Pro455Thr		Somatic					p.P455T	NM_006446	NP_006437	WXS	Illumina HiSeq	Unspecified	Q9Y6L6	SO1B1_HUMAN			11	1467	+			455			Extracellular (Potential).|Kazal-like.		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.1363C>A	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	C	5.094	0.203005	0.09704	.	.	ENSG00000134538	ENST00000256958	T	0.38887	1.11	4.06	2.04	0.26737	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.38837	N	0.001545	T	0.33760	0.0874	L	0.55213	1.73	0.27029	N	0.964295	B	0.14012	0.009	B	0.25987	0.065	T	0.15780	-1.0425	10	0.39692	T	0.17	.	5.2379	0.15456	0.205:0.6753:0.0:0.1197	.	455	Q9Y6L6	SO1B1_HUMAN	T	455	ENSP00000256958:P455T	ENSP00000256958:P455T	P	+	1	0	SLCO1B1	21250100	0.166000	0.22962	0.999000	0.59377	0.469000	0.32828	0.351000	0.20096	1.783000	0.52377	0.484000	0.47621	CCA		0.383	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		18	42	1	0	2.4624e-09	0.008871	3.48093e-09	18	42				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		7	20	1	0	3.09899e-07	0.004482	3.99083e-07	7	20				
FAR2	55711	broad.mit.edu	37	12	29464033	29464033	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:29464033G>C	ENST00000536681.3	+	7	1087	c.841G>C	c.(841-843)Gtc>Ctc	p.V281L	FAR2_ENST00000547116.1_Missense_Mutation_p.V184L|RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Missense_Mutation_p.V281L	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	281					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						AGTTGATACAGTCGTCAATCT	0.438																																							uc001ris.3		NA																	0					0						c.(841-843)GTC>CTC		fatty acyl CoA reductase 2							168.0	158.0	162.0					12																	29464033		2203	4300	6503	SO:0001583	missense	55711				ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	g.chr12:29464033G>C	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.841G>C	12.37:g.29464033G>C	ENSP00000443291:p.Val281Leu		Somatic				FAR2_uc001rit.2_Missense_Mutation_p.V281L|FAR2_uc009zjm.2_Missense_Mutation_p.V184L|uc001riu.1_Intron	p.V281L	NM_018099	NP_060569	WXS	Illumina HiSeq	Unspecified	Q96K12	FACR2_HUMAN			7	988	+			281					F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	ENST00000536681.3	37	c.841G>C	CCDS8717.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348947	0.82132	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.53206	0.63;0.63;0.63	4.38	4.38	0.52667	NAD(P)-binding domain (1);Male sterility, NAD-binding (1);	0.000000	0.85682	D	0.000000	T	0.69305	0.3096	M	0.89163	3.01	0.54753	D	0.999982	D	0.59767	0.986	D	0.63033	0.91	T	0.74785	-0.3547	10	0.56958	D	0.05	-6.0485	12.6448	0.56728	0.0:0.0:1.0:0.0	.	281	Q96K12	FACR2_HUMAN	L	281;281;184	ENSP00000443291:V281L;ENSP00000182377:V281L;ENSP00000449349:V184L	ENSP00000182377:V281L	V	+	1	0	FAR2	29355300	1.000000	0.71417	0.392000	0.26245	0.985000	0.73830	9.128000	0.94424	2.426000	0.82243	0.655000	0.94253	GTC		0.438	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099		33	133	0	0	0	0.003271	0	33	133				
ABCD2	225	broad.mit.edu	37	12	40013091	40013091	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:40013091C>A	ENST00000308666.3	-	1	462	c.327G>T	c.(325-327)ctG>ctT	p.L109L		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	109	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						CCACTGAGTGCAGGCAGAGCC	0.438																																							uc001rmb.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						c.(325-327)CTG>CTT		ATP-binding cassette, sub-family D, member 2							77.0	80.0	79.0					12																	40013091		2203	4300	6503	SO:0001819	synonymous_variant	225				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding	g.chr12:40013091C>A	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.327G>T	12.37:g.40013091C>A			Somatic					p.L109L	NM_005164	NP_005155	WXS	Illumina HiSeq	Unspecified	Q9UBJ2	ABCD2_HUMAN			1	753	-			109			ABC transmembrane type-1.|Interaction with PEX19.|Helical; (Potential).		B2RAM3|Q13210|Q2M3H9	Silent	SNP	ENST00000308666.3	37	c.327G>T	CCDS8734.1																																																																																				0.438	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		13	47	1	0	0.00136819	0.001368	0.00150356	13	47				
PRPF40B	25766	broad.mit.edu	37	12	50029645	50029645	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:50029645G>T	ENST00000380281.1	+	14	1293	c.1229G>T	c.(1228-1230)cGg>cTg	p.R410L	PRPF40B_ENST00000261897.1_Missense_Mutation_p.R404L|FMNL3_ENST00000550668.1_5'Flank|PRPF40B_ENST00000548825.2_Missense_Mutation_p.R432L			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	410	FF 3.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						AAGCAGCTCCGGCGCCGCAAT	0.597																																							uc001rur.1		NA																	0				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						c.(1228-1230)CGG>CTG		Huntingtin interacting protein C isoform 1							72.0	62.0	65.0					12																	50029645		2203	4300	6503	SO:0001583	missense	25766				mRNA processing|RNA splicing	nuclear speck		g.chr12:50029645G>T	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.1229G>T	12.37:g.50029645G>T	ENSP00000369634:p.Arg410Leu		Somatic				PRPF40B_uc001rup.1_Missense_Mutation_p.R432L|PRPF40B_uc001ruq.1_Missense_Mutation_p.R404L|PRPF40B_uc001rus.1_Missense_Mutation_p.R353L	p.R410L	NM_001031698	NP_001026868	WXS	Illumina HiSeq	Unspecified	Q6NWY9	PR40B_HUMAN			14	1293	+			410					O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation	SNP	ENST00000380281.1	37	c.1229G>T		.	.	.	.	.	.	.	.	.	.	G	32	5.192968	0.94960	.	.	ENSG00000110844	ENST00000261897;ENST00000380281	T;T	0.33438	1.41;1.41	5.0	5.0	0.66597	FF domain (3);	0.000000	0.64402	D	0.000008	T	0.58337	0.2115	M	0.80982	2.52	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.998	P;D;D	0.74674	0.903;0.956;0.984	T	0.59862	-0.7374	9	.	.	.	-21.7777	17.599	0.88021	0.0:0.0:1.0:0.0	.	410;404;410	Q6NWY9;Q6NWY9-2;Q6NWY9-3	PR40B_HUMAN;.;.	L	404;410	ENSP00000261897:R404L;ENSP00000369634:R410L	.	R	+	2	0	PRPF40B	48315912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.388000	0.97237	2.775000	0.95449	0.563000	0.77884	CGG		0.597	PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1	NM_012272		14	26	1	0	9.31168e-06	0.001855	1.13566e-05	14	26				
OR6C3	254786	broad.mit.edu	37	12	55725826	55725826	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:55725826C>A	ENST00000379667.1	+	1	342	c.342C>A	c.(340-342)gcC>gcA	p.A114A		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	114					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						TTTTAACTGCCATGTCCTATG	0.423																																							uc010spj.1		NA																	0				skin(1)	1						c.(340-342)GCC>GCA		olfactory receptor, family 6, subfamily C,							128.0	123.0	125.0					12																	55725826		2203	4300	6503	SO:0001819	synonymous_variant	254786				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55725826C>A	AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.342C>A	12.37:g.55725826C>A			Somatic					p.A114A	NM_054104	NP_473445	WXS	Illumina HiSeq	Unspecified	Q9NZP0	OR6C3_HUMAN			1	342	+			114			Helical; Name=3; (Potential).			Silent	SNP	ENST00000379667.1	37	c.342C>A	CCDS31819.1																																																																																				0.423	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406309.1			20	105	1	0	1.33834e-09	0.007413	1.91367e-09	20	105				
GLS2	27165	broad.mit.edu	37	12	56867050	56867050	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:56867050G>T	ENST00000311966.4	-	14	1689	c.1411C>A	c.(1411-1413)Cgg>Agg	p.R471R	GLS2_ENST00000476991.1_5'Flank	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	471					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.R471W(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	TCTAACTTCCGAGCACAGTGC	0.453																																							uc001slj.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|central_nervous_system(1)	2						c.(1411-1413)CGG>AGG		glutaminase 2 precursor	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						102.0	100.0	101.0					12																	56867050		2203	4300	6503	SO:0001819	synonymous_variant	27165				cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding	g.chr12:56867050G>T		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.1411C>A	12.37:g.56867050G>T			Somatic				GLS2_uc009zos.2_RNA|GLS2_uc001slk.2_Silent_p.R206R|GLS2_uc009zot.2_Silent_p.R132R	p.R471R	NM_013267	NP_037399	WXS	Illumina HiSeq	Unspecified	Q9UI32	GLSL_HUMAN			14	1690	-			471					B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Silent	SNP	ENST00000311966.4	37	c.1411C>A	CCDS8921.1																																																																																				0.453	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267		3	57	1	0	0.00909568	0.009096	0.00963801	3	57				
SLC26A10	65012	broad.mit.edu	37	12	58018651	58018651	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:58018651C>G	ENST00000320442.4	+	10	1541	c.1230C>G	c.(1228-1230)ctC>ctG	p.L410L	SLC26A10_ENST00000379218.2_Missense_Mutation_p.S446C|SLC26A10_ENST00000490243.1_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	410	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CCTCTTAGCTCCTCCAGGTCC	0.587																																							uc001spe.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(1228-1230)CTC>CTG		solute carrier family 26, member 10							91.0	90.0	90.0					12																	58018651		2203	4300	6503	SO:0001819	synonymous_variant	65012					integral to membrane	antiporter activity	g.chr12:58018651C>G		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1230C>G	12.37:g.58018651C>G			Somatic				SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_RNA	p.L410L	NM_133489	NP_597996	WXS	Illumina HiSeq	Unspecified	Q8NG04	S2610_HUMAN			10	1541	+	Melanoma(17;0.122)		410			STAS.		A6NMJ2|B6ZDQ3|Q6ZWI7	Silent	SNP	ENST00000320442.4	37	c.1230C>G	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	12.78	2.040167	0.35989	.	.	ENSG00000135502	ENST00000379218	D	0.94576	-3.46	4.83	3.0	0.34707	.	.	.	.	.	D	0.94761	0.8309	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.93215	0.6603	6	0.87932	D	0	.	7.3602	0.26742	0.0:0.8017:0.0:0.1983	.	.	.	.	C	446	ENSP00000368520:S446C	ENSP00000368520:S446C	S	+	2	0	SLC26A10	56304918	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	1.192000	0.32150	0.637000	0.30526	-0.291000	0.09656	TCC		0.587	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2			21	85	0	0	0	0.002299	0	21	85				
TSPAN31	6302	broad.mit.edu	37	12	58139966	58139966	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:58139966T>A	ENST00000257910.3	+	3	513	c.239T>A	c.(238-240)aTc>aAc	p.I80N	TSPAN31_ENST00000553221.1_3'UTR|TSPAN31_ENST00000547992.1_Intron|TSPAN31_ENST00000547472.1_Intron	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	80					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CAGTACATGATCATCCTTGGT	0.373																																							uc001spt.2		NA																	0					0						c.(238-240)ATC>AAC		sarcoma amplified sequence							270.0	241.0	251.0					12																	58139966		2203	4300	6503	SO:0001583	missense	6302				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction		g.chr12:58139966T>A		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.239T>A	12.37:g.58139966T>A	ENSP00000257910:p.Ile80Asn		Somatic				TSPAN31_uc009zqb.2_Intron|TSPAN31_uc010ssa.1_Missense_Mutation_p.I2N	p.I80N	NM_005981	NP_005972	WXS	Illumina HiSeq	Unspecified	Q12999	TSN31_HUMAN	GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		3	393	+	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		80			Helical; (Potential).		O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	c.239T>A	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.558648	0.86231	.	.	ENSG00000135452	ENST00000257910;ENST00000552816;ENST00000548167	D	0.82433	-1.61	4.82	4.82	0.62117	.	0.062082	0.64402	D	0.000004	D	0.87958	0.6309	M	0.62723	1.935	0.80722	D	1	D	0.59767	0.986	P	0.60541	0.876	D	0.89305	0.3629	10	0.87932	D	0	-1.8632	13.804	0.63218	0.0:0.0:0.0:1.0	.	80	Q12999	TSN31_HUMAN	N	80;2;2	ENSP00000257910:I80N	ENSP00000257910:I80N	I	+	2	0	TSPAN31	56426233	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.266000	0.78452	2.152000	0.67230	0.455000	0.32223	ATC		0.373	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1			9	55	0	0	0	0.001368	0	9	55				
SLC16A7	9194	broad.mit.edu	37	12	60168655	60168655	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:60168655C>G	ENST00000261187.4	+	4	743	c.579C>G	c.(577-579)tcC>tcG	p.S193S	SLC16A7_ENST00000552024.1_Silent_p.S193S|SLC16A7_ENST00000543448.1_Silent_p.S94S|SLC16A7_ENST00000552432.1_Silent_p.S193S|SLC16A7_ENST00000547379.1_Silent_p.S193S	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	193					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	TGGCTGGTTCCCTCATGAGAC	0.408																																							uc001sqs.2		NA																	0				ovary(1)	1						c.(577-579)TCC>TCG		solute carrier family 16, member 7	Pyruvic acid(DB00119)						55.0	55.0	55.0					12																	60168655		2203	4300	6503	SO:0001819	synonymous_variant	9194					integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr12:60168655C>G	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.579C>G	12.37:g.60168655C>G			Somatic				SLC16A7_uc001sqt.2_Silent_p.S193S|SLC16A7_uc001squ.2_Silent_p.S193S|SLC16A7_uc009zqi.2_Silent_p.S94S|SLC16A7_uc010ssi.1_Silent_p.S94S	p.S193S	NM_004731	NP_004722	WXS	Illumina HiSeq	Unspecified	O60669	MOT2_HUMAN		GBM - Glioblastoma multiforme(3;0.0303)	5	878	+			193			Helical; (Potential).		Q8NEM3|Q9UPB3	Silent	SNP	ENST00000261187.4	37	c.579C>G	CCDS8961.1																																																																																				0.408	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731		5	30	0	0	0	0.001168	0	5	30				
LUM	4060	broad.mit.edu	37	12	91502264	91502264	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:91502264G>T	ENST00000266718.4	-	2	947	c.493C>A	c.(493-495)Cat>Aat	p.H165N	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	165					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						TGCTGGAGATGGATGAAGGTC	0.453																																							uc001tbm.2		NA																	0				central_nervous_system(2)	2						c.(493-495)CAT>AAT		lumican precursor							102.0	104.0	103.0					12																	91502264		2203	4300	6503	SO:0001583	missense	4060				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent	g.chr12:91502264G>T	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.493C>A	12.37:g.91502264G>T	ENSP00000266718:p.His165Asn		Somatic				LUM_uc001tbn.2_Intron	p.H165N	NM_002345	NP_002336	WXS	Illumina HiSeq	Unspecified	P51884	LUM_HUMAN			2	882	-			165			LRR 5.		B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	37	c.493C>A	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	G	1.689	-0.504550	0.04261	.	.	ENSG00000139329	ENST00000266718	T	0.51817	0.69	5.6	1.07	0.20283	.	0.331964	0.34025	N	0.004321	T	0.18882	0.0453	N	0.02345	-0.59	0.37323	D	0.909624	B	0.02656	0.0	B	0.12837	0.008	T	0.09773	-1.0659	10	0.15066	T	0.55	-15.0042	10.023	0.42055	0.0706:0.0:0.5401:0.3893	.	165	P51884	LUM_HUMAN	N	165	ENSP00000266718:H165N	ENSP00000266718:H165N	H	-	1	0	LUM	90026395	0.847000	0.29606	0.015000	0.15790	0.862000	0.49288	0.799000	0.27028	0.270000	0.21984	0.557000	0.71058	CAT		0.453	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345		11	48	1	0	7.03913e-09	0.001368	9.75131e-09	11	48				
TMCC3	57458	broad.mit.edu	37	12	94976286	94976286	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:94976286C>T	ENST00000261226.4	-	2	238	c.107G>A	c.(106-108)aGc>aAc	p.S36N	TMCC3_ENST00000551457.1_Missense_Mutation_p.S5N	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	36						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						CAGGGGCAGGCTTAAGGTATT	0.458																																							uc001tdj.2		NA																	0				ovary(1)|skin(1)	2						c.(106-108)AGC>AAC		transmembrane and coiled-coil domain family 3							78.0	78.0	78.0					12																	94976286		2203	4300	6503	SO:0001583	missense	57458					integral to membrane		g.chr12:94976286C>T	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.107G>A	12.37:g.94976286C>T	ENSP00000261226:p.Ser36Asn		Somatic				TMCC3_uc001tdi.2_Missense_Mutation_p.S5N	p.S36N	NM_020698	NP_065749	WXS	Illumina HiSeq	Unspecified	Q9ULS5	TMCC3_HUMAN			2	225	-			36					Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	37	c.107G>A	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	C	31	5.078024	0.94000	.	.	ENSG00000057704	ENST00000261226;ENST00000551457;ENST00000548918	T;T	0.51071	1.3;0.72	5.91	5.91	0.95273	.	0.033572	0.85682	D	0.000000	T	0.59238	0.2179	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.59789	-0.7388	10	0.59425	D	0.04	-42.2718	20.3522	0.98815	0.0:1.0:0.0:0.0	.	36	Q9ULS5	TMCC3_HUMAN	N	36;5;5	ENSP00000261226:S36N;ENSP00000449888:S5N	ENSP00000261226:S36N	S	-	2	0	TMCC3	93500417	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.313000	0.78978	2.821000	0.97095	0.485000	0.47835	AGC		0.458	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698		12	59	0	0	0	0.001855	0	12	59				
SLC5A8	160728	broad.mit.edu	37	12	101598296	101598296	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:101598296G>A	ENST00000536262.2	-	2	957	c.399C>T	c.(397-399)gtC>gtT	p.V133V		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAATGAAGAGGACTGTTCCAC	0.333																																					GBM(60;420 1056 13605 22380 47675)	GBM(60;420 1056 13605 22380 47675)	uc001thz.3		NA																	0					0						c.(397-399)GTC>GTT		solute carrier family 5 (iodide transporter),							67.0	67.0	67.0					12																	101598296		2203	4299	6502	SO:0001819	synonymous_variant	160728				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity	g.chr12:101598296G>A	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.399C>T	12.37:g.101598296G>A			Somatic					p.V133V	NM_145913	NP_666018	WXS	Illumina HiSeq	Unspecified	Q8N695	SC5A8_HUMAN			2	789	-			133			Helical; (Potential).			Silent	SNP	ENST00000536262.2	37	c.399C>T	CCDS9080.1																																																																																				0.333	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913		11	21	0	0	0	0.010729	0	11	21				
CUX2	23316	broad.mit.edu	37	12	111785481	111785481	+	Silent	SNP	C	C	A	rs201865813		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:111785481C>A	ENST00000261726.6	+	22	3967	c.3813C>A	c.(3811-3813)acC>acA	p.T1271T		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1271					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						AGAAGCCAACCGTGAAGGAAC	0.617																																							uc001tsa.1		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(3811-3813)ACC>ACA		cut-like 2							56.0	64.0	61.0					12																	111785481		2028	4171	6199	SO:0001819	synonymous_variant	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111785481C>A	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3813C>A	12.37:g.111785481C>A			Somatic					p.T1271T	NM_015267	NP_056082	WXS	Illumina HiSeq	Unspecified	O14529	CUX2_HUMAN			22	3966	+			1271					A7E2Y4	Silent	SNP	ENST00000261726.6	37	c.3813C>A	CCDS41837.1																																																																																				0.617	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		12	43	1	0	0.00010058	0.001368	0.000115213	12	43				
DTX1	1840	broad.mit.edu	37	12	113534535	113534535	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:113534535A>T	ENST00000257600.3	+	9	2157	c.1654A>T	c.(1654-1656)Atc>Ttc	p.I552F	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	552					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						GCGGCTGCTCATCACGGCCTG	0.652																																							uc001tuk.1		NA																	0				lung(2)|ovary(1)|central_nervous_system(1)	4						c.(1654-1656)ATC>TTC		deltex homolog 1							52.0	34.0	40.0					12																	113534535		2203	4300	6503	SO:0001583	missense	1840				negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding	g.chr12:113534535A>T	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1654A>T	12.37:g.113534535A>T	ENSP00000257600:p.Ile552Phe		Somatic					p.I552F	NM_004416	NP_004407	WXS	Illumina HiSeq	Unspecified	Q86Y01	DTX1_HUMAN			9	1990	+			552					O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	c.1654A>T	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.355977	0.41700	.	.	ENSG00000135144	ENST00000257600	T	0.21734	1.99	4.86	3.68	0.42216	.	0.064020	0.64402	D	0.000008	T	0.18467	0.0443	L	0.53249	1.67	0.48571	D	0.99967	P	0.36712	0.566	B	0.31390	0.129	T	0.02288	-1.1182	10	0.54805	T	0.06	-15.1972	9.8276	0.40921	0.6669:0.3331:0.0:0.0	.	552	Q86Y01	DTX1_HUMAN	F	552	ENSP00000257600:I552F	ENSP00000257600:I552F	I	+	1	0	DTX1	112018918	1.000000	0.71417	0.994000	0.49952	0.918000	0.54935	2.946000	0.49050	0.670000	0.31165	0.379000	0.24179	ATC		0.652	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2			5	18	0	0	0	0.000602	0	5	18				
RBM19	9904	broad.mit.edu	37	12	114386693	114386693	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:114386693C>A	ENST00000545145.2	-	10	1299	c.1221G>T	c.(1219-1221)cgG>cgT	p.R407R	RBM19_ENST00000392561.3_Silent_p.R407R|RBM19_ENST00000261741.5_Silent_p.R407R	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	407	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AGGGCAGGTTCCGTACAAAGA	0.592																																							uc009zwi.2		NA																	0				skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6						c.(1219-1221)CGG>CGT		RNA binding motif protein 19							142.0	130.0	134.0					12																	114386693		2203	4300	6503	SO:0001819	synonymous_variant	9904				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding	g.chr12:114386693C>A	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1221G>T	12.37:g.114386693C>A			Somatic				RBM19_uc001tvn.3_Silent_p.R407R|RBM19_uc001tvm.2_Silent_p.R407R	p.R407R	NM_001146699	NP_001140171	WXS	Illumina HiSeq	Unspecified	Q9Y4C8	RBM19_HUMAN			10	1365	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		407			RRM 3.		A8K5X9|Q9BPY6|Q9UFN5	Silent	SNP	ENST00000545145.2	37	c.1221G>T	CCDS9172.1																																																																																				0.592	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196		25	58	1	0	3.01185e-09	0.003954	4.23839e-09	25	58				
CIT	11113	broad.mit.edu	37	12	120135562	120135562	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr12:120135562C>T	ENST00000261833.7	-	45	5710	c.5658G>A	c.(5656-5658)gcG>gcA	p.A1886A	RP1-127H14.3_ENST00000535109.1_5'Flank|CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Silent_p.A1928A	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1886					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GGTATGAGGACGCCAAGTAAA	0.602																																							uc001txi.1		NA																	0				ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10						c.(5656-5658)GCG>GCA		citron							99.0	103.0	102.0					12																	120135562		2203	4300	6503	SO:0001819	synonymous_variant	11113				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity	g.chr12:120135562C>T	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5658G>A	12.37:g.120135562C>T			Somatic				CIT_uc001txh.1_Silent_p.A1405A|CIT_uc001txj.1_Silent_p.A1928A	p.A1886A	NM_007174	NP_009105	WXS	Illumina HiSeq	Unspecified	O14578	CTRO_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.211)	45	5711	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)	1886					Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	c.5658G>A	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	7.211	0.595383	0.13875	.	.	ENSG00000122966	ENST00000392520	.	.	.	5.07	-8.95	0.00765	.	.	.	.	.	T	0.33059	0.0850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38415	-0.9662	4	.	.	.	.	1.2524	0.01985	0.2043:0.2406:0.1519:0.4032	.	.	.	.	H	1499	.	.	R	-	2	0	CIT	118619945	0.010000	0.17322	0.463000	0.27130	0.756000	0.42949	-0.944000	0.03913	-2.121000	0.00825	-2.048000	0.00412	CGT		0.602	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		32	105	0	0	0	0.010818	0	32	105				
NUPL1	9818	broad.mit.edu	37	13	25899149	25899149	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr13:25899149C>T	ENST00000381736.3	+	10	1224	c.974C>T	c.(973-975)gCt>gTt	p.A325V	NUPL1_ENST00000466694.1_3'UTR|NUPL1_ENST00000381718.3_Missense_Mutation_p.A313V|NUPL1_ENST00000463407.1_Missense_Mutation_p.A325V	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1	325	14 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		GCTGAAATAGCTTTAAGAACC	0.328																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)	Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)	uc001uqi.2		NA																	0					0						c.(973-975)GCT>GTT		nucleoporin like 1 isoform a							79.0	81.0	81.0					13																	25899149		2203	4300	6503	SO:0001583	missense	9818				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore		g.chr13:25899149C>T	AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.974C>T	13.37:g.25899149C>T	ENSP00000371155:p.Ala325Val		Somatic				NUPL1_uc001uqg.1_Missense_Mutation_p.A325V|NUPL1_uc001uqj.2_Missense_Mutation_p.A313V	p.A325V	NM_014089	NP_054808	WXS	Illumina HiSeq	Unspecified	Q9BVL2	NUPL1_HUMAN		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)	10	1220	+		Lung SC(185;0.0225)|Breast(139;0.0351)	325			14 X 2 AA repeats of F-G.|Potential.		A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	ENST00000381736.3	37	c.974C>T	CCDS9314.1	.	.	.	.	.	.	.	.	.	.	C	32	5.181093	0.94846	.	.	ENSG00000139496	ENST00000381736;ENST00000381745;ENST00000313619;ENST00000463407;ENST00000381718;ENST00000381747;ENST00000394327	T;T;T;T;T	0.60424	0.59;0.43;0.36;0.51;0.19	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.76154	0.3948	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.74674	0.96;0.947;0.984	T	0.77582	-0.2534	10	0.66056	D	0.02	-15.6566	19.1889	0.93656	0.0:1.0:0.0:0.0	.	313;325;325	A6NI12;Q9BVL2;Q9BVL2-2	.;NUPL1_HUMAN;.	V	325;313;302;325;313;325;272	ENSP00000371155:A325V;ENSP00000418555:A325V;ENSP00000371137:A313V;ENSP00000371166:A325V;ENSP00000408147:A272V	ENSP00000318459:A302V	A	+	2	0	NUPL1	24797149	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.709000	0.84645	2.699000	0.92147	0.591000	0.81541	GCT		0.328	NUPL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044228.2			4	45	0	0	0	0.000602	0	4	45				
WASF3	10810	broad.mit.edu	37	13	27259977	27259977	+	Missense_Mutation	SNP	G	G	A	rs538866473		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr13:27259977G>A	ENST00000335327.5	+	10	1682	c.1504G>A	c.(1504-1506)Gac>Aac	p.D502N	WASF3_ENST00000361042.4_Missense_Mutation_p.D499N	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	502					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)		p.D502N(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CGACTGGTCCGACTGAGCAAA	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18843	0.0		0.0	False		,,,				2504	0.0						uc001uqv.2		NA																	1	Substitution - Missense(1)		breast(1)	pancreas(1)	1						c.(1504-1506)GAC>AAC		WAS protein family, member 3							59.0	50.0	53.0					13																	27259977		2203	4300	6503	SO:0001583	missense	10810				actin filament polymerization	cytoplasm|cytoskeleton	actin binding	g.chr13:27259977G>A	AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.1504G>A	13.37:g.27259977G>A	ENSP00000335055:p.Asp502Asn		Somatic				WASF3_uc001uqw.2_Missense_Mutation_p.D499N	p.D502N	NM_006646	NP_006637	WXS	Illumina HiSeq	Unspecified	Q9UPY6	WASF3_HUMAN		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)	10	1729	+	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)	502					O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	37	c.1504G>A	CCDS9318.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770136	0.90108	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.74737	-0.87;-0.8	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.85327	0.5671	M	0.62016	1.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.84648	0.0699	10	0.49607	T	0.09	.	19.6727	0.95916	0.0:0.0:1.0:0.0	.	499;502	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	N	499;502	ENSP00000354325:D499N;ENSP00000335055:D502N	ENSP00000335055:D502N	D	+	1	0	WASF3	26157977	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	9.282000	0.95840	2.645000	0.89757	0.561000	0.74099	GAC		0.572	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1			6	32	0	0	0	0.004482	0	6	32				
FLT1	2321	broad.mit.edu	37	13	28882994	28882994	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr13:28882994T>A	ENST00000282397.4	-	28	3957	c.3706A>T	c.(3706-3708)Acc>Tcc	p.T1236S	FLT1_ENST00000540678.1_Missense_Mutation_p.T454S|FLT1_ENST00000543394.1_Missense_Mutation_p.T259S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1236					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AACATGGAGGTGGCATTCGGT	0.403																																							uc001usb.3		NA																	0				lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(3706-3708)ACC>TCC		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						112.0	98.0	103.0					13																	28882994		2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:28882994T>A	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3706A>T	13.37:g.28882994T>A	ENSP00000282397:p.Thr1236Ser		Somatic				FLT1_uc010aap.2_Missense_Mutation_p.T241S|FLT1_uc010aaq.2_Missense_Mutation_p.T361S|FLT1_uc001usa.3_Missense_Mutation_p.T454S	p.T1236S	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	28	3991	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	1236			Cytoplasmic (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.3706A>T	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	T	8.740	0.918695	0.17982	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	T;T;T	0.77489	-0.86;-1.09;-1.1	5.11	2.45	0.29901	.	0.503008	0.20067	N	0.099957	T	0.66944	0.2841	L	0.47190	1.495	0.19575	N	0.999968	B	0.19817	0.039	B	0.14023	0.01	T	0.50808	-0.8784	10	0.18710	T	0.47	.	9.9559	0.41666	0.0:0.0:0.3271:0.6729	.	1236	P17948	VGFR1_HUMAN	S	1236;259;454	ENSP00000282397:T1236S;ENSP00000437841:T259S;ENSP00000443311:T454S	ENSP00000282397:T1236S	T	-	1	0	FLT1	27780994	0.002000	0.14202	0.716000	0.30569	0.964000	0.63967	0.621000	0.24418	0.886000	0.36113	0.459000	0.35465	ACC		0.403	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			5	17	0	0	0	0.001168	0	5	17				
BRCA2	675	broad.mit.edu	37	13	32907344	32907344	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr13:32907344G>T	ENST00000380152.3	+	10	1962	c.1729G>T	c.(1729-1731)Gca>Tca	p.A577S	BRCA2_ENST00000544455.1_Missense_Mutation_p.A577S			P51587	BRCA2_HUMAN	breast cancer 2, early onset	577					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTTGAAGAATGCAGGTTTAAT	0.338			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	D|Mis|N|F|S	familial breast/ovarian cancer gene 2			"""L, E"""		breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		0				ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64						c.(1729-1731)GCA>TCA	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							48.0	54.0	52.0					13																	32907344		2203	4300	6503	SO:0001583	missense	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32907344G>T	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.1729G>T	13.37:g.32907344G>T	ENSP00000369497:p.Ala577Ser	TCGA Ovarian(8;0.087)	Somatic				BRCA2_uc001uua.1_Missense_Mutation_p.A454S	p.A577S	NM_000059	NP_000050	WXS	Illumina HiSeq	Unspecified	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	10	1956	+		Lung SC(185;0.0262)	577					O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	c.1729G>T	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	2.927	-0.221812	0.06061	.	.	ENSG00000139618	ENST00000380152;ENST00000544455;ENST00000530893	T;T	0.00700	5.82;5.82	5.5	-8.96	0.00761	.	1.465340	0.03779	N	0.261086	T	0.00468	0.0015	N	0.12746	0.255	0.09310	N	1	B;B	0.22346	0.068;0.031	B;B	0.13407	0.009;0.009	T	0.48703	-0.9012	10	0.14252	T	0.57	.	4.0486	0.09785	0.5412:0.0878:0.1113:0.2597	.	577;577	P51587;A1YBP1	BRCA2_HUMAN;.	S	577;577;575	ENSP00000369497:A577S;ENSP00000439902:A577S	ENSP00000369497:A577S	A	+	1	0	BRCA2	31805344	0.000000	0.05858	0.000000	0.03702	0.437000	0.31866	-1.253000	0.02877	-2.052000	0.00902	-0.781000	0.03364	GCA		0.338	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		9	45	1	0	3.09899e-07	0.004482	3.99083e-07	9	45				
POSTN	10631	broad.mit.edu	37	13	38166303	38166303	+	Splice_Site	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr13:38166303T>A	ENST00000379747.4	-	3	336		c.e3-2		POSTN_ENST00000379742.4_Splice_Site|POSTN_ENST00000541179.1_Splice_Site|POSTN_ENST00000379749.4_Splice_Site|POSTN_ENST00000541481.1_Splice_Site|POSTN_ENST00000379743.4_Splice_Site	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor						cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		AACACAGTCCTGTACATAGGA	0.289																																							uc001uwo.3		NA																	0				ovary(2)	2						c.e3-1		periostin, osteoblast specific factor isoform 1							49.0	48.0	49.0					13																	38166303		2203	4300	6503	SO:0001630	splice_region_variant	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38166303T>A	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.219-2A>T	13.37:g.38166303T>A			Somatic				POSTN_uc001uwp.3_Splice_Site_p.T73_splice|POSTN_uc001uwr.2_Splice_Site_p.T73_splice|POSTN_uc001uwq.2_Splice_Site_p.T73_splice|POSTN_uc010teu.1_Splice_Site_p.T73_splice|POSTN_uc010tev.1_Splice_Site_p.T73_splice|POSTN_uc010tew.1_Splice_Site_p.T73_splice|POSTN_uc010tex.1_Splice_Site	p.T73_splice	NM_006475	NP_006466	WXS	Illumina HiSeq	Unspecified	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	3	337	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)						B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Splice_Site	SNP	ENST00000379747.4	37	c.219_splice	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.659932	0.67586	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6872	0.77421	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	POSTN	37064303	1.000000	0.71417	0.955000	0.39395	0.771000	0.43674	7.630000	0.83225	2.155000	0.67459	0.460000	0.39030	.		0.289	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	Intron	7	18	0	0	0	0.001984	0	7	18				
RASA3	22821	broad.mit.edu	37	13	114781695	114781695	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr13:114781695C>A	ENST00000334062.7	-	13	1380	c.1259G>T	c.(1258-1260)gGa>gTa	p.G420V	RASA3_ENST00000389544.4_Missense_Mutation_p.G388V	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	420	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			AAGGTTTTCTCCGTCTTTCAA	0.507																																							uc001vui.2		NA																	0				lung(3)|skin(1)	4						c.(1258-1260)GGA>GTA		RAS p21 protein activator 3							173.0	145.0	155.0					13																	114781695		2203	4300	6503	SO:0001583	missense	22821				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity	g.chr13:114781695C>A		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1259G>T	13.37:g.114781695C>A	ENSP00000335029:p.Gly420Val		Somatic				RASA3_uc010tkk.1_Missense_Mutation_p.G388V|RASA3_uc001vuj.2_Missense_Mutation_p.G37V	p.G420V	NM_007368	NP_031394	WXS	Illumina HiSeq	Unspecified	Q14644	RASA3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.128)		13	1390	-	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	420			Ras-GAP.		A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	c.1259G>T	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869055	0.32977	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.19806	2.12;2.12	4.67	4.67	0.58626	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.122077	0.56097	D	0.000031	T	0.44726	0.1307	M	0.83312	2.635	0.80722	D	1	P	0.40909	0.732	P	0.56216	0.794	T	0.39396	-0.9616	9	.	.	.	.	12.8699	0.57958	0.0:0.8348:0.1652:0.0	.	420	Q14644	RASA3_HUMAN	V	420;388	ENSP00000335029:G420V;ENSP00000374195:G388V	.	G	-	2	0	RASA3	113799797	0.947000	0.32204	0.132000	0.22025	0.190000	0.23558	2.508000	0.45450	2.155000	0.67459	0.591000	0.81541	GGA		0.507	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		11	30	1	0	3.86212e-05	0.008291	4.51549e-05	11	30				
CEBPE	1053	broad.mit.edu	37	14	23587927	23587927	+	Missense_Mutation	SNP	C	C	T	rs61737804		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:23587927C>T	ENST00000206513.5	-	1	898	c.374G>A	c.(373-375)cGg>cAg	p.R125Q		NM_001805.3	NP_001796.2	Q15744	CEBPE_HUMAN	CCAAT/enhancer binding protein (C/EBP), epsilon	125					cellular response to lipopolysaccharide (GO:0071222)|cytokine biosynthetic process (GO:0042089)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|macrophage differentiation (GO:0030225)|phagocytosis (GO:0006909)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0064)		CTCTGGCCCCCGGGGCTCCTC	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		11987	0.0		0.0	False		,,,				2504	0.0				NSCLC(63;1230 1818 14565 22565)	NSCLC(63;1230 1818 14565 22565)	uc001wiv.1		NA																	0				ovary(2)	2						c.(373-375)CGG>CAG		CCAAT/enhancer binding protein epsilon																																				SO:0001583	missense	1053					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:23587927C>T		CCDS9589.1	14q11.2	2014-09-17			ENSG00000092067	ENSG00000092067		"""basic leucine zipper proteins"""	1836	protein-coding gene	gene with protein product		600749				8661101	Standard	NM_001805		Approved	CRP1	uc001wiv.2	Q15744	OTTHUMG00000028719	ENST00000206513.5:c.374G>A	14.37:g.23587927C>T	ENSP00000206513:p.Arg125Gln		Somatic					p.R125Q	NM_001805	NP_001796	WXS	Illumina HiSeq	Unspecified	Q15744	CEBPE_HUMAN		GBM - Glioblastoma multiforme(265;0.0064)	1	548	-	all_cancers(95;4.6e-05)		125					Q15745|Q8IYI2|Q99803	Missense_Mutation	SNP	ENST00000206513.5	37	c.374G>A	CCDS9589.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598147	0.87055	.	.	ENSG00000092067	ENST00000206513	T	0.32515	1.45	5.22	5.22	0.72569	.	0.240817	0.36519	N	0.002546	T	0.25082	0.0609	L	0.47016	1.485	0.41548	D	0.988553	P	0.47106	0.89	B	0.31547	0.132	T	0.11251	-1.0595	10	0.40728	T	0.16	-26.151	17.5482	0.87869	0.0:1.0:0.0:0.0	.	125	Q15744	CEBPE_HUMAN	Q	125	ENSP00000206513:R125Q	ENSP00000206513:R125Q	R	-	2	0	CEBPE	22657767	1.000000	0.71417	0.988000	0.46212	0.953000	0.61014	2.417000	0.44653	2.421000	0.82119	0.561000	0.74099	CGG		0.672	CEBPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071716.2	NM_001805		4	54	0	0	0	0.000602	0	4	54				
HEATR5A	25938	broad.mit.edu	37	14	31855777	31855777	+	Silent	SNP	G	G	A	rs547560643		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:31855777G>A	ENST00000389961.3	-	8	1175	c.1176C>T	c.(1174-1176)gcC>gcT	p.A392A	HEATR5A_ENST00000404677.3_Silent_p.A398A|HEATR5A_ENST00000543095.2_Silent_p.A398A|HEATR5A_ENST00000439727.1_Silent_p.A105A|HEATR5A_ENST00000439348.1_Silent_p.A392A			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	392										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		CACTCATTACGGCATCTGATA	0.373													G|||	1	0.000199681	0.0	0.0	5008	,	,		18114	0.0		0.001	False		,,,				2504	0.0						uc001wrf.3		NA																	0				ovary(1)	1						c.(313-315)GCC>GCT		HEAT repeat containing 5A							134.0	129.0	131.0					14																	31855777		1848	4087	5935	SO:0001819	synonymous_variant	25938						binding	g.chr14:31855777G>A	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.1176C>T	14.37:g.31855777G>A			Somatic				HEATR5A_uc010ami.2_Silent_p.A3A|HEATR5A_uc001wrg.1_Intron|HEATR5A_uc010tpk.1_Silent_p.A398A	p.A105A	NM_015473	NP_056288	WXS	Illumina HiSeq	Unspecified	Q86XA9	HTR5A_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)	3	392	-	Hepatocellular(127;0.0877)|Breast(36;0.137)		392					Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Silent	SNP	ENST00000389961.3	37	c.315C>T		.	.	.	.	.	.	.	.	.	.	G	0.812	-0.751756	0.03041	.	.	ENSG00000129493	ENST00000538864	.	.	.	5.92	-7.23	0.01480	.	.	.	.	.	T	0.43897	0.1268	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46386	-0.9195	4	.	.	.	.	4.9805	0.14162	0.3594:0.0:0.323:0.3176	.	.	.	.	L	26	.	.	P	-	2	0	HEATR5A	30925528	0.000000	0.05858	0.027000	0.17364	0.143000	0.21401	-0.767000	0.04720	-1.348000	0.02205	-1.105000	0.02106	CCG		0.373	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473		10	164	0	0	0	0.006214	0	10	164				
FRMD6	122786	broad.mit.edu	37	14	52188672	52188672	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:52188672G>A	ENST00000344768.5	+	12	1562	c.1366G>A	c.(1366-1368)Gag>Aag	p.E456K	FRMD6_ENST00000553556.1_Missense_Mutation_p.E98K|RNU6-301P_ENST00000384277.1_RNA|FRMD6_ENST00000356218.4_Missense_Mutation_p.E448K|FRMD6_ENST00000395718.2_Missense_Mutation_p.E448K|FRMD6_ENST00000554167.1_Missense_Mutation_p.E379K			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	456					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GTCAGAAATAGAGATGTTGGT	0.418																																							uc001wzd.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1366-1368)GAG>AAG		FERM domain containing 6							112.0	108.0	109.0					14																	52188672		2203	4300	6503	SO:0001583	missense	122786					cytoskeleton|mitochondrion|plasma membrane	binding	g.chr14:52188672G>A	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1366G>A	14.37:g.52188672G>A	ENSP00000343899:p.Glu456Lys		Somatic				FRMD6_uc001wzb.2_Missense_Mutation_p.E448K|FRMD6_uc001wzc.2_Missense_Mutation_p.E448K|FRMD6_uc001wze.2_Missense_Mutation_p.E379K|FRMD6_uc001wzf.2_Missense_Mutation_p.E149K|FRMD6_uc001wzg.2_Missense_Mutation_p.E98K	p.E456K	NM_152330	NP_689543	WXS	Illumina HiSeq	Unspecified	Q96NE9	FRMD6_HUMAN			12	1651	+	all_epithelial(31;0.0163)|Breast(41;0.089)		456					D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	ENST00000344768.5	37	c.1366G>A	CCDS58318.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.327251|4.327251	0.81690|0.81690	.|.	.|.	ENSG00000139926|ENSG00000139926	ENST00000555703|ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000553556	.|T;T;T;T	.|0.80033	.|-1.33;-1.33;-1.12;-0.91	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.86838	.|0.6029	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.68765	.|0.96;0.913;0.96	.|D	.|0.85506	.|0.1194	.|10	.|0.45353	.|T	.|0.12	.|.	19.7209|19.7209	0.96143|0.96143	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|379;456;448	.|G3V4T7;Q96NE9;Q96NE9-2	.|.;FRMD6_HUMAN;.	.|K	-1|448;448;456;379;98	.|ENSP00000348550:E448K;ENSP00000379068:E448K;ENSP00000343899:E456K;ENSP00000451977:E379K	.|ENSP00000343899:E456K	.|E	+|+	.|1	.|0	FRMD6|FRMD6	51258422|51258422	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.904000|0.904000	0.53231|0.53231	9.079000|9.079000	0.94032|0.94032	2.835000|2.835000	0.97688|0.97688	0.650000|0.650000	0.86243|0.86243	.|GAG		0.418	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330		19	42	0	0	0	0.008871	0	19	42				
NID2	22795	broad.mit.edu	37	14	52505539	52505539	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:52505539C>A	ENST00000216286.5	-	9	2182	c.2183G>T	c.(2182-2184)cGg>cTg	p.R728L	NID2_ENST00000541773.1_Missense_Mutation_p.R675L	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	728	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GGCAAAGACCCGGTCCACGTT	0.522																																							uc001wzo.2		NA																	0				pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(2182-2184)CGG>CTG		nidogen 2 precursor							109.0	110.0	110.0					14																	52505539		2203	4300	6503	SO:0001583	missense	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52505539C>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2183G>T	14.37:g.52505539C>A	ENSP00000216286:p.Arg728Leu		Somatic				NID2_uc010tqs.1_Missense_Mutation_p.R728L|NID2_uc010tqt.1_Missense_Mutation_p.R728L|NID2_uc001wzp.2_Missense_Mutation_p.R728L	p.R728L	NM_007361	NP_031387	WXS	Illumina HiSeq	Unspecified	Q14112	NID2_HUMAN			9	2417	-	Breast(41;0.0639)|all_epithelial(31;0.123)		728			Nidogen G2 beta-barrel.		A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	c.2183G>T	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227213	0.79576	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.24908	1.83;1.83	6.17	5.27	0.74061	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.094428	0.64402	D	0.000001	T	0.55737	0.1939	M	0.83953	2.67	0.41430	D	0.987855	D;D;D;D	0.89917	0.975;1.0;1.0;0.996	P;D;D;D	0.91635	0.809;0.998;0.999;0.928	T	0.61515	-0.7047	10	0.46703	T	0.11	.	17.1457	0.86766	0.0:0.8735:0.1265:0.0	.	322;675;730;728	E7EPP3;Q14112-2;Q5CZI2;Q14112	.;.;.;NID2_HUMAN	L	728;322;675;730	ENSP00000216286:R728L;ENSP00000443730:R675L	ENSP00000216286:R728L	R	-	2	0	NID2	51575289	0.846000	0.29590	0.982000	0.44146	0.759000	0.43091	1.698000	0.37794	1.578000	0.49821	0.655000	0.94253	CGG		0.522	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			20	76	1	0	5.26018e-13	0.012319	8.28312e-13	20	76				
WDHD1	11169	broad.mit.edu	37	14	55411173	55411173	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:55411173G>A	ENST00000360586.3	-	25	3131	c.3066C>T	c.(3064-3066)ttC>ttT	p.F1022F	WDHD1_ENST00000420358.2_Silent_p.F899F|WDHD1_ENST00000359167.4_Silent_p.F540F|WDHD1_ENST00000421192.1_Silent_p.F899F	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1022					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						ACCACATCTGGAACCCGGTCT	0.318																																							uc001xbm.1		NA																	0				skin(1)	1						c.(3064-3066)TTC>TTT		WD repeat and HMG-box DNA binding protein 1							70.0	70.0	70.0					14																	55411173		2203	4299	6502	SO:0001819	synonymous_variant	11169					cytoplasm|nucleoplasm	DNA binding	g.chr14:55411173G>A	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.3066C>T	14.37:g.55411173G>A			Somatic				WDHD1_uc010aom.1_Silent_p.F539F|WDHD1_uc001xbn.1_Silent_p.F899F	p.F1022F	NM_007086	NP_009017	WXS	Illumina HiSeq	Unspecified	O75717	WDHD1_HUMAN			25	3144	-			1022			HMG box.		C9JW18|F6W0U7	Silent	SNP	ENST00000360586.3	37	c.3066C>T	CCDS9721.1																																																																																				0.318	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086		12	32	0	0	0	0.001368	0	12	32				
DLGAP5	9787	broad.mit.edu	37	14	55643878	55643878	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:55643878C>T	ENST00000247191.2	-	8	1167	c.951G>A	c.(949-951)ctG>ctA	p.L317L	DLGAP5_ENST00000395425.2_Silent_p.L317L	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	317					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						TCAGACCATCCAGTGGCTGAA	0.383																																							uc001xbs.2		NA																	0				ovary(1)|skin(1)	2						c.(949-951)CTG>CTA		discs large homolog 7 isoform a							117.0	120.0	119.0					14																	55643878		2203	4300	6503	SO:0001819	synonymous_variant	9787				cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding	g.chr14:55643878C>T	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.951G>A	14.37:g.55643878C>T			Somatic				DLGAP5_uc001xbt.2_Silent_p.L317L	p.L317L	NM_014750	NP_055565	WXS	Illumina HiSeq	Unspecified	Q15398	DLGP5_HUMAN			8	1168	-			317					A8MTM6|B4DRM8|Q86T11|Q8NG58	Silent	SNP	ENST00000247191.2	37	c.951G>A	CCDS9723.1																																																																																				0.383	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750		18	34	0	0	0	0.006122	0	18	34				
PCNX	22990	broad.mit.edu	37	14	71445031	71445031	+	Silent	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:71445031A>T	ENST00000304743.2	+	6	2423	c.1977A>T	c.(1975-1977)acA>acT	p.T659T	PCNX_ENST00000238570.5_Silent_p.T659T|PCNX_ENST00000439984.3_Silent_p.T659T	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	659						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTGAACACACACACAAAGCTC	0.493																																							uc001xmo.2		NA																	0				ovary(1)	1						c.(1975-1977)ACA>ACT		pecanex-like 1							154.0	144.0	148.0					14																	71445031		2203	4300	6503	SO:0001819	synonymous_variant	22990					integral to membrane		g.chr14:71445031A>T	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.1977A>T	14.37:g.71445031A>T			Somatic				PCNX_uc001xmn.3_Silent_p.T659T|PCNX_uc010are.1_Silent_p.T659T	p.T659T	NM_014982	NP_055797	WXS	Illumina HiSeq	Unspecified	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)	6	2423	+			659					B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	37	c.1977A>T	CCDS9806.1																																																																																				0.493	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982		25	124	0	0	0	0.00333	0	25	124				
GPR65	8477	broad.mit.edu	37	14	88477216	88477216	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:88477216C>G	ENST00000267549.3	+	2	583	c.25C>G	c.(25-27)Cag>Gag	p.Q9E	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	9					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						TATTGAAGAACAGCATGACCT	0.348											OREG0031336	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																											uc001xvv.2		NA																	0					0						c.(25-27)CAG>GAG		G protein-coupled receptor 65							109.0	97.0	101.0					14																	88477216		2203	4300	6503	SO:0001583	missense	8477				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity	g.chr14:88477216C>G	U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.25C>G	14.37:g.88477216C>G	ENSP00000267549:p.Gln9Glu		Somatic	OREG0031336	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	1260		p.Q9E	NM_003608	NP_003599	WXS	Illumina HiSeq	Unspecified	Q8IYL9	PSYR_HUMAN			2	555	+			9			Extracellular (Potential).		O75819	Missense_Mutation	SNP	ENST00000267549.3	37	c.25C>G	CCDS9879.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113543	0.56398	.	.	ENSG00000140030	ENST00000267549	T	0.35973	1.28	5.49	5.49	0.81192	.	0.255201	0.27631	N	0.018514	T	0.33731	0.0873	L	0.44542	1.39	0.45183	D	0.998193	P	0.39831	0.69	B	0.36666	0.23	T	0.04178	-1.0971	10	0.27082	T	0.32	.	19.5721	0.95425	0.0:1.0:0.0:0.0	.	9	Q8IYL9	PSYR_HUMAN	E	9	ENSP00000267549:Q9E	ENSP00000267549:Q9E	Q	+	1	0	GPR65	87546969	0.998000	0.40836	0.823000	0.32752	0.992000	0.81027	2.600000	0.46240	2.857000	0.98124	0.650000	0.86243	CAG		0.348	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4			5	47	0	0	0	0.000602	0	5	47				
CPSF2	53981	broad.mit.edu	37	14	92600367	92600367	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:92600367G>T	ENST00000298875.4	+	4	447	c.162G>T	c.(160-162)caG>caT	p.Q54H		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	54					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		ATGTTCACCAGATTGATGCAG	0.433																																					Ovarian(78;28 1788 18702 44111)	Ovarian(78;28 1788 18702 44111)	uc001yah.1		NA																	0				ovary(2)	2						c.(160-162)CAG>CAT		cleavage and polyadenylation specific factor 2							272.0	231.0	245.0					14																	92600367		2203	4300	6503	SO:0001583	missense	53981				histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding	g.chr14:92600367G>T	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.162G>T	14.37:g.92600367G>T	ENSP00000298875:p.Gln54His		Somatic					p.Q54H	NM_017437	NP_059133	WXS	Illumina HiSeq	Unspecified	Q9P2I0	CPSF2_HUMAN		COAD - Colon adenocarcinoma(157;0.222)	4	399	+		all_cancers(154;0.0766)	54					B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	ENST00000298875.4	37	c.162G>T	CCDS9902.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.380913	0.61845	.	.	ENSG00000165934	ENST00000298875;ENST00000553427	T;T	0.80123	-1.34;-1.34	5.88	4.99	0.66335	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	D	0.84352	0.5453	L	0.45228	1.405	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	T	0.82204	-0.0573	10	0.28530	T	0.3	.	13.0828	0.59123	0.1338:0.0:0.8662:0.0	.	54	Q9P2I0	CPSF2_HUMAN	H	54	ENSP00000298875:Q54H;ENSP00000451418:Q54H	ENSP00000298875:Q54H	Q	+	3	2	CPSF2	91670120	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	3.353000	0.52247	1.482000	0.48325	0.591000	0.81541	CAG		0.433	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1			37	112	1	0	1.52319e-26	0.00874	2.81134e-26	37	112				
UNC79	57578	broad.mit.edu	37	14	94063707	94063707	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:94063707G>T	ENST00000393151.2	+	24	3193	c.3193G>T	c.(3193-3195)Gaa>Taa	p.E1065*	UNC79_ENST00000256339.4_Nonsense_Mutation_p.E888*|UNC79_ENST00000555664.1_Nonsense_Mutation_p.E1065*|UNC79_ENST00000553484.1_Nonsense_Mutation_p.E1065*			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1065					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CATTGCAGTGGAAAAAGTTGC	0.423																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(2662-2664)GAA>TAA		hypothetical protein LOC57578							118.0	99.0	106.0					14																	94063707		2203	4300	6503	SO:0001587	stop_gained	57578					integral to membrane		g.chr14:94063707G>T	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3193G>T	14.37:g.94063707G>T	ENSP00000376858:p.Glu1065*		Somatic				KIAA1409_uc001ybs.1_Nonsense_Mutation_p.E888*	p.E888*	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	21	2745	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1065					B5MDL6|Q6ZUT7	Nonsense_Mutation	SNP	ENST00000393151.2	37	c.2662G>T		.	.	.	.	.	.	.	.	.	.	G	42	9.506427	0.99190	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.5156	20.1535	0.98095	0.0:0.0:1.0:0.0	.	.	.	.	X	888;1065;1065;1065;1065	.	ENSP00000256339:E888X	E	+	1	0	KIAA1409	93133460	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.764000	0.94973	0.650000	0.86243	GAA		0.423	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		11	43	1	0	1.58986e-06	0.008291	1.99374e-06	11	43				
OR4M2	390538	broad.mit.edu	37	15	22369217	22369217	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:22369217G>T	ENST00000332663.2	+	1	740	c.642G>T	c.(640-642)ctG>ctT	p.L214L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGATTGCTCTGTTAATGTCCT	0.483																																							uc010tzu.1		NA																	0				ovary(1)	1						c.(640-642)CTG>CTT		olfactory receptor, family 4, subfamily M,							635.0	436.0	504.0					15																	22369217		2203	4300	6503	SO:0001819	synonymous_variant	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369217G>T	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.642G>T	15.37:g.22369217G>T			Somatic				LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.L214L	NM_001004719	NP_001004719	WXS	Illumina HiSeq	Unspecified	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	642	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	214			Helical; Name=5; (Potential).		B9EH16|Q6IEY2	Silent	SNP	ENST00000332663.2	37	c.642G>T	CCDS32172.1																																																																																				0.483	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			45	422	1	0	1.61863e-15	0.00361	2.69916e-15	45	422				
GABRG3	2567	broad.mit.edu	37	15	27572044	27572044	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:27572044G>T	ENST00000333743.6	+	4	613	c.359G>T	c.(358-360)aGc>aTc	p.S120I	GABRG3_ENST00000555083.1_Missense_Mutation_p.S120I	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	120					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACTCTGAACAGCAACATGGTG	0.458																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(358-360)AGC>ATC		gamma-aminobutyric acid (GABA) A receptor, gamma							150.0	149.0	150.0					15																	27572044		1992	4211	6203	SO:0001583	missense	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27572044G>T		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.359G>T	15.37:g.27572044G>T	ENSP00000331912:p.Ser120Ile		Somatic				GABRG3_uc001zbf.2_Missense_Mutation_p.S120I	p.S120I	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	4	525	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	120			Extracellular (Probable).		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	c.359G>T	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905071	0.92035	.	.	ENSG00000182256	ENST00000333743;ENST00000555083;ENST00000554696	T;T;T	0.77750	-1.12;-1.12;-1.12	5.75	5.75	0.90469	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85923	0.5810	L	0.49126	1.545	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.76071	0.987;0.978	D	0.86476	0.1788	10	0.87932	D	0	.	19.016	0.92894	0.0:0.0:1.0:0.0	.	120;120	Q99928;G3V594	GBRG3_HUMAN;.	I	120;120;62	ENSP00000331912:S120I;ENSP00000452244:S120I;ENSP00000451862:S62I	ENSP00000331912:S120I	S	+	2	0	GABRG3	25154790	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.531000	0.98054	2.718000	0.92993	0.650000	0.86243	AGC		0.458	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			23	57	1	0	3.01185e-09	0.003954	4.23839e-09	23	57				
RYR3	6263	broad.mit.edu	37	15	34072493	34072493	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:34072493C>A	ENST00000389232.4	+	65	9289	c.9219C>A	c.(9217-9219)cgC>cgA	p.R3073R	RYR3_ENST00000415757.3_Silent_p.R3073R	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3073					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCCTTAATCGCTACAATCCAC	0.537																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(9217-9219)CGC>CGA		ryanodine receptor 3							74.0	71.0	72.0					15																	34072493		1928	4147	6075	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34072493C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9219C>A	15.37:g.34072493C>A			Somatic				RYR3_uc010bar.2_Silent_p.R3073R	p.R3073R	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	65	9289	+		all_lung(180;7.18e-09)	3073					O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.9219C>A	CCDS45210.1																																																																																				0.537	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			7	14	1	0	8.12818e-05	0.001984	9.34516e-05	7	14				
RPAP1	26015	broad.mit.edu	37	15	41820068	41820069	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41820068_41820069GG>AT	ENST00000304330.4	-	11	1533_1534	c.1417_1418CC>AT	c.(1417-1419)CCt>ATt	p.P473I	RPAP1_ENST00000568413.1_5'Flank|RPAP1_ENST00000561603.1_Missense_Mutation_p.P473I	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	473						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCATCTCCAGGAGCCACCAGC	0.584																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(1417-1419)CCT>ATT		RNA polymerase II associated protein 1																																				SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41820068_41820069GG>AT	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1417_1418delinsAT	15.37:g.41820068_41820069delinsAT	ENSP00000306123:p.Pro473Ile		Somatic					p.P473I	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	11	1541_1542	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	473					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	DNP	ENST00000304330.4	37	c.1417_1418CC>AT	CCDS10079.1																																																																																				0.584	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		4	49	0	0	0	0.004672	0	4	49				
RPAP1	26015	broad.mit.edu	37	15	41820194	41820194	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41820194G>C	ENST00000304330.4	-	11	1408	c.1292C>G	c.(1291-1293)gCa>gGa	p.A431G	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Missense_Mutation_p.A431G	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	431						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GACACTGCCTGCTAGCCGGTC	0.542																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(1291-1293)GCA>GGA		RNA polymerase II associated protein 1							39.0	33.0	35.0					15																	41820194		2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41820194G>C	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1292C>G	15.37:g.41820194G>C	ENSP00000306123:p.Ala431Gly		Somatic					p.A431G	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	11	1416	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	431					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.1292C>G	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	4.989	0.183623	0.09495	.	.	ENSG00000103932	ENST00000304330	T	0.64085	-0.08	5.65	-1.19	0.09585	.	0.950577	0.08829	N	0.887601	T	0.36826	0.0981	N	0.08118	0	0.09310	N	1	B	0.19073	0.033	B	0.17433	0.018	T	0.23440	-1.0188	10	0.52906	T	0.07	-19.1685	4.7246	0.12935	0.1883:0.0:0.2945:0.5172	.	431	Q9BWH6	RPAP1_HUMAN	G	431	ENSP00000306123:A431G	ENSP00000306123:A431G	A	-	2	0	RPAP1	39607486	0.130000	0.22417	0.101000	0.21167	0.366000	0.29705	0.379000	0.20585	-0.159000	0.11021	-0.302000	0.09304	GCA		0.542	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		3	16	0	0	0	0.009096	0	3	16				
RPAP1	26015	broad.mit.edu	37	15	41822100	41822100	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41822100G>A	ENST00000304330.4	-	8	1137	c.1021C>T	c.(1021-1023)Cag>Tag	p.Q341*	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Nonsense_Mutation_p.Q341*	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	341						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGCAAGTCCTGGGTCCAGTGG	0.612																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(1021-1023)CAG>TAG		RNA polymerase II associated protein 1							50.0	45.0	47.0					15																	41822100		2203	4300	6503	SO:0001587	stop_gained	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41822100G>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1021C>T	15.37:g.41822100G>A	ENSP00000306123:p.Gln341*		Somatic					p.Q341*	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	8	1145	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	341					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Nonsense_Mutation	SNP	ENST00000304330.4	37	c.1021C>T	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	35	5.529881	0.96446	.	.	ENSG00000103932	ENST00000304330	.	.	.	4.66	4.66	0.58398	.	0.176895	0.48767	D	0.000179	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.276	10.1955	0.43051	0.0:0.0:0.6876:0.3124	.	.	.	.	X	341	.	ENSP00000306123:Q341X	Q	-	1	0	RPAP1	39609392	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	4.792000	0.62467	2.394000	0.81467	0.563000	0.77884	CAG		0.612	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		7	21	0	0	0	0.00308	0	7	21				
RPAP1	26015	broad.mit.edu	37	15	41822157	41822157	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41822157G>A	ENST00000304330.4	-	8	1080	c.964C>T	c.(964-966)Cct>Tct	p.P322S	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Missense_Mutation_p.P322S	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	322						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCTTTCTGAGGGGTCACGGGC	0.592																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(964-966)CCT>TCT		RNA polymerase II associated protein 1							52.0	46.0	48.0					15																	41822157		2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41822157G>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.964C>T	15.37:g.41822157G>A	ENSP00000306123:p.Pro322Ser		Somatic					p.P322S	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	8	1088	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	322					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.964C>T	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528990	0.27387	.	.	ENSG00000103932	ENST00000304330	T	0.12361	2.69	4.77	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.21227	0.0511	L	0.57536	1.79	0.58432	D	0.999999	P	0.41214	0.742	P	0.48270	0.572	T	0.01512	-1.1336	10	0.31617	T	0.26	-9.0491	12.021	0.53344	0.0856:0.0:0.9144:0.0	.	322	Q9BWH6	RPAP1_HUMAN	S	322	ENSP00000306123:P322S	ENSP00000306123:P322S	P	-	1	0	RPAP1	39609449	1.000000	0.71417	0.112000	0.21494	0.428000	0.31595	8.620000	0.90943	1.232000	0.43678	-0.259000	0.10710	CCT		0.592	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		8	23	0	0	0	0.004482	0	8	23				
RPAP1	26015	broad.mit.edu	37	15	41823307	41823307	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41823307G>A	ENST00000304330.4	-	7	973	c.857C>T	c.(856-858)tCt>tTt	p.S286F	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Missense_Mutation_p.S286F	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	286						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GACATTAGCAGAGGGTCCTCC	0.572																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(856-858)TCT>TTT		RNA polymerase II associated protein 1							167.0	164.0	165.0					15																	41823307		2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41823307G>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.857C>T	15.37:g.41823307G>A	ENSP00000306123:p.Ser286Phe		Somatic					p.S286F	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	7	981	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	286					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.857C>T	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426593	0.43020	.	.	ENSG00000103932	ENST00000304330	T	0.14516	2.5	5.21	0.305	0.15801	.	0.905535	0.09655	N	0.773167	T	0.12092	0.0294	L	0.51422	1.61	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34354	-0.9832	10	0.87932	D	0	-16.7853	4.1362	0.10172	0.2464:0.3676:0.386:0.0	.	286	Q9BWH6	RPAP1_HUMAN	F	286	ENSP00000306123:S286F	ENSP00000306123:S286F	S	-	2	0	RPAP1	39610599	0.000000	0.05858	0.000000	0.03702	0.577000	0.36160	0.296000	0.19083	0.580000	0.29522	-0.302000	0.09304	TCT		0.572	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		56	168	0	0	0	0.00361	0	56	168				
RPAP1	26015	broad.mit.edu	37	15	41823309	41823309	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41823309G>A	ENST00000304330.4	-	7	971	c.855C>T	c.(853-855)ccC>ccT	p.P285P	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Silent_p.P285P	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	285						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CATTAGCAGAGGGTCCTCCTG	0.572																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(853-855)CCC>CCT		RNA polymerase II associated protein 1							168.0	165.0	166.0					15																	41823309		2203	4300	6503	SO:0001819	synonymous_variant	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41823309G>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.855C>T	15.37:g.41823309G>A			Somatic					p.P285P	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	7	979	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	285					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	ENST00000304330.4	37	c.855C>T	CCDS10079.1																																																																																				0.572	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		56	170	0	0	0	0.00361	0	56	170				
RPAP1	26015	broad.mit.edu	37	15	41823359	41823359	+	Nonsense_Mutation	SNP	G	G	A	rs78256246		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41823359G>A	ENST00000304330.4	-	7	921	c.805C>T	c.(805-807)Caa>Taa	p.Q269*	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Nonsense_Mutation_p.Q269*	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	269						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTTTGCTCTTGCGTGTGGCTG	0.562																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(805-807)CAA>TAA		RNA polymerase II associated protein 1							161.0	156.0	158.0					15																	41823359		2203	4300	6503	SO:0001587	stop_gained	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41823359G>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.805C>T	15.37:g.41823359G>A	ENSP00000306123:p.Gln269*		Somatic					p.Q269*	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	7	929	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	269					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Nonsense_Mutation	SNP	ENST00000304330.4	37	c.805C>T	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669597	0.67814	.	.	ENSG00000103932	ENST00000304330	.	.	.	5.36	0.923	0.19413	.	1.095260	0.06998	N	0.822761	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-23.4083	1.4802	0.02435	0.1914:0.2296:0.4251:0.1538	.	.	.	.	X	269	.	ENSP00000306123:Q269X	Q	-	1	0	RPAP1	39610651	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.213000	0.17521	0.654000	0.30846	0.563000	0.77884	CAA		0.562	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		41	158	0	0	0	0.00361	0	41	158				
RPAP1	26015	broad.mit.edu	37	15	41823373	41823373	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:41823373G>C	ENST00000304330.4	-	7	907	c.791C>G	c.(790-792)tCt>tGt	p.S264C	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Missense_Mutation_p.S264C	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	264						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTGGCTGTGAGATCTCAAGAA	0.572																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(790-792)TCT>TGT		RNA polymerase II associated protein 1							147.0	143.0	144.0					15																	41823373		2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41823373G>C	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.791C>G	15.37:g.41823373G>C	ENSP00000306123:p.Ser264Cys		Somatic					p.S264C	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	7	915	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	264					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.791C>G	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911293	0.52439	.	.	ENSG00000103932	ENST00000304330	T	0.14391	2.51	5.36	5.36	0.76844	RNA polymerase II-associated protein 1, N-terminal (1);	0.059798	0.64402	D	0.000001	T	0.39226	0.1070	M	0.81682	2.555	0.51767	D	0.999935	D	0.76494	0.999	D	0.71656	0.974	T	0.26395	-1.0104	10	0.87932	D	0	-16.847	14.5922	0.68373	0.0:0.0:1.0:0.0	.	264	Q9BWH6	RPAP1_HUMAN	C	264	ENSP00000306123:S264C	ENSP00000306123:S264C	S	-	2	0	RPAP1	39610665	1.000000	0.71417	0.972000	0.41901	0.182000	0.23217	5.433000	0.66520	2.518000	0.84900	0.563000	0.77884	TCT		0.572	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		39	137	0	0	0	0.00361	0	39	137				
GATM	2628	broad.mit.edu	37	15	45657019	45657019	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:45657019G>A	ENST00000396659.3	-	7	1357	c.1018C>T	c.(1018-1020)Cct>Tct	p.P340S	GATM_ENST00000558336.1_Missense_Mutation_p.P340S	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	340					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	GGTGTTGGAGGAGTAATGATA	0.343																																							uc001zvc.2		NA																	0					0						c.(1018-1020)CCT>TCT		L-arginine:glycine amidinotransferase precursor	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)						130.0	125.0	127.0					15																	45657019		2198	4298	6496	SO:0001583	missense	2628				creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding	g.chr15:45657019G>A	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.1018C>T	15.37:g.45657019G>A	ENSP00000379895:p.Pro340Ser		Somatic				GATM_uc001zvb.2_Missense_Mutation_p.P211S|GATM_uc010uev.1_Missense_Mutation_p.P393S	p.P340S	NM_001482	NP_001473	WXS	Illumina HiSeq	Unspecified	P50440	GATM_HUMAN		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	7	1347	-		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	340					B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	ENST00000396659.3	37	c.1018C>T	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001806	0.74932	.	.	ENSG00000171766	ENST00000396659	T	0.42513	0.97	5.41	4.48	0.54585	.	0.047701	0.85682	D	0.000000	T	0.46288	0.1385	L	0.48218	1.51	0.58432	D	0.999998	D;D	0.63880	0.993;0.965	P;P	0.53401	0.725;0.648	T	0.31530	-0.9940	10	0.31617	T	0.26	-6.6615	12.014	0.53303	0.0:0.1744:0.8256:0.0	.	340;340	P50440-3;P50440	.;GATM_HUMAN	S	340	ENSP00000379895:P340S	ENSP00000379895:P340S	P	-	1	0	GATM	43444311	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.215000	0.89762	1.228000	0.43614	0.591000	0.81541	CCT		0.343	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482		6	13	0	0	0	0.00308	0	6	13				
HDC	3067	broad.mit.edu	37	15	50540498	50540498	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:50540498G>A	ENST00000267845.3	-	10	1486	c.1084C>T	c.(1084-1086)Ctc>Ttc	p.L362F	HDC_ENST00000543581.1_Intron	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		ACGAACCAGAGTTTAACAGAG	0.542																																					GBM(95;1627 1936 6910 9570)	GBM(95;1627 1936 6910 9570)	uc001zxz.2		NA																	0				large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6						c.(1084-1086)CTC>TTC		histidine decarboxylase	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)						93.0	83.0	86.0					15																	50540498		2196	4295	6491	SO:0001583	missense	3067				catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity	g.chr15:50540498G>A		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1084C>T	15.37:g.50540498G>A	ENSP00000267845:p.Leu362Phe		Somatic				HDC_uc001zxy.2_Missense_Mutation_p.L105F|HDC_uc010uff.1_Intron	p.L362F	NM_002112	NP_002103	WXS	Illumina HiSeq	Unspecified	P19113	DCHS_HUMAN		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	10	1190	-		all_lung(180;0.0138)	362						Missense_Mutation	SNP	ENST00000267845.3	37	c.1084C>T	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	G	34	5.327658	0.95733	.	.	ENSG00000140287	ENST00000267845	T	0.45668	0.89	5.47	5.47	0.80525	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.058568	0.64402	D	0.000001	T	0.72843	0.3511	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.78851	-0.2041	10	0.87932	D	0	-24.9098	19.4109	0.94671	0.0:0.0:1.0:0.0	.	362	P19113	DCHS_HUMAN	F	362	ENSP00000267845:L362F	ENSP00000267845:L362F	L	-	1	0	HDC	48327790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.686000	0.84128	2.579000	0.87056	0.650000	0.86243	CTC		0.542	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1			17	45	0	0	0	0.004007	0	17	45				
TRPM7	54822	broad.mit.edu	37	15	50899520	50899520	+	Silent	SNP	T	T	C	rs376363705		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:50899520T>C	ENST00000313478.7	-	20	2867	c.2586A>G	c.(2584-2586)gcA>gcG	p.A862A	TRPM7_ENST00000560955.1_Silent_p.A862A	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	862					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		ATCCTAAATATGCCAACTAAT	0.264																																							uc001zyt.3		NA																	0				ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10						c.(2584-2586)GCA>GCG		transient receptor potential cation channel,							62.0	57.0	58.0					15																	50899520		1810	4056	5866	SO:0001819	synonymous_variant	54822				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity	g.chr15:50899520T>C	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2586A>G	15.37:g.50899520T>C			Somatic				TRPM7_uc010bew.1_Silent_p.A862A|TRPM7_uc001zyu.2_Silent_p.A420A	p.A862A	NM_017672	NP_060142	WXS	Illumina HiSeq	Unspecified	Q96QT4	TRPM7_HUMAN		all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)	20	2850	-			862			Helical; (Potential).		Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Silent	SNP	ENST00000313478.7	37	c.2586A>G	CCDS42035.1																																																																																				0.264	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672		14	32	0	0	0	0.001855	0	14	32				
HERC1	8925	broad.mit.edu	37	15	63988517	63988517	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:63988517G>A	ENST00000443617.2	-	27	5014	c.4927C>T	c.(4927-4929)Cag>Tag	p.Q1643*	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1643					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ACGAGGATCTGATGAAGTGCC	0.413																																							uc002amp.2		NA																	0				ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						c.(4927-4929)CAG>TAG		hect domain and RCC1-like domain 1							62.0	57.0	58.0					15																	63988517		1884	4110	5994	SO:0001587	stop_gained	8925				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity	g.chr15:63988517G>A	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4927C>T	15.37:g.63988517G>A	ENSP00000390158:p.Gln1643*		Somatic				HERC1_uc010uil.1_Nonsense_Mutation_p.Q627*	p.Q1643*	NM_003922	NP_003913	WXS	Illumina HiSeq	Unspecified	Q15751	HERC1_HUMAN			27	5075	-			1643					Q8IW65	Nonsense_Mutation	SNP	ENST00000443617.2	37	c.4927C>T	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	45	11.351498	0.99550	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	.	.	.	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.8309	0.96634	0.0:0.0:1.0:0.0	.	.	.	.	X	1643;627	.	ENSP00000389613:Q627X	Q	-	1	0	HERC1	61775570	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.727000	0.98787	2.684000	0.91462	0.650000	0.86243	CAG		0.413	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		3	9	0	0	0	0.004672	0	3	9				
NTRK3	4916	broad.mit.edu	37	15	88690601	88690601	+	Silent	SNP	C	C	A	rs138266478		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:88690601C>A	ENST00000360948.2	-	5	590	c.429G>T	c.(427-429)tcG>tcT	p.S143S	NTRK3_ENST00000317501.3_Silent_p.S143S|NTRK3_ENST00000557856.1_Silent_p.S143S|NTRK3_ENST00000542733.2_Silent_p.S45S|NTRK3_ENST00000355254.2_Silent_p.S143S|NTRK3_ENST00000540489.2_Silent_p.S143S|NTRK3_ENST00000558676.1_Silent_p.S143S|NTRK3_ENST00000357724.2_Silent_p.S143S|NTRK3_ENST00000394480.2_Silent_p.S143S	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	143					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGAGCTGCCACGAGAGTGTGG	0.453			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(427-429)TCG>TCT		neurotrophic tyrosine kinase, receptor, type 3							71.0	62.0	65.0					15																	88690601		2201	4299	6500	SO:0001819	synonymous_variant	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88690601C>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.429G>T	15.37:g.88690601C>A		TSP Lung(13;0.10)	Somatic				NTRK3_uc002bmh.2_Silent_p.S143S|NTRK3_uc002bmf.1_Silent_p.S143S|NTRK3_uc010upl.1_Silent_p.S45S|NTRK3_uc010bnh.1_Silent_p.S143S|NTRK3_uc002bmg.2_Silent_p.S143S	p.S143S	NM_001012338	NP_001012338	WXS	Illumina HiSeq	Unspecified	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		5	591	-			143			LRR 2.|Extracellular (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	c.429G>T	CCDS32322.1																																																																																				0.453	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				11	23	1	0	0.000978159	0.010729	0.00108646	11	23				
CHD2	1106	broad.mit.edu	37	15	93558024	93558024	+	Silent	SNP	C	C	T	rs560317096		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr15:93558024C>T	ENST00000394196.4	+	37	5859	c.4791C>T	c.(4789-4791)acC>acT	p.T1597T	CHD2_ENST00000557381.1_Silent_p.T1597T	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1597					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AGTCCCATACCTCACACAACC	0.527																																							uc002bsp.2		NA																	0				ovary(1)|skin(1)	2						c.(4789-4791)ACC>ACT		chromodomain helicase DNA binding protein 2							169.0	164.0	166.0					15																	93558024		2197	4298	6495	SO:0001819	synonymous_variant	1106				regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr15:93558024C>T	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4791C>T	15.37:g.93558024C>T			Somatic				CHD2_uc002bso.1_Silent_p.T1597T	p.T1597T	NM_001271	NP_001262	WXS	Illumina HiSeq	Unspecified	O14647	CHD2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)		37	5366	+	Lung NSC(78;0.00976)|all_lung(78;0.016)		1597					C6G482|Q96IP5	Silent	SNP	ENST00000394196.4	37	c.4791C>T	CCDS10374.2																																																																																				0.527	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271		7	105	0	0	0	0.00308	0	7	105				
PRSS22	64063	broad.mit.edu	37	16	2903323	2903323	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:2903323G>A	ENST00000161006.3	-	6	790	c.725C>T	c.(724-726)tCc>tTc	p.S242F	PRSS22_ENST00000571228.1_Missense_Mutation_p.S132F|PRSS22_ENST00000574768.1_5'Flank	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	242	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						GGGGCCCCCGGAGTCGCCCTG	0.711																																							uc002cry.1		NA																	0				central_nervous_system(1)	1						c.(724-726)TCC>TTC		protease, serine, 22 precursor							7.0	9.0	9.0					16																	2903323		2116	4193	6309	SO:0001583	missense	64063				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:2903323G>A	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.725C>T	16.37:g.2903323G>A	ENSP00000161006:p.Ser242Phe		Somatic				PRSS22_uc002crz.1_Missense_Mutation_p.S132F	p.S242F	NM_022119	NP_071402	WXS	Illumina HiSeq	Unspecified	Q9GZN4	BSSP4_HUMAN			6	791	-			242			Peptidase S1.	Charge relay system (By similarity).	O43342|Q6UXE0	Missense_Mutation	SNP	ENST00000161006.3	37	c.725C>T	CCDS10481.1	.	.	.	.	.	.	.	.	.	.	g	14.56	2.571125	0.45798	.	.	ENSG00000005001	ENST00000161006	D	0.96802	-4.13	4.05	4.05	0.47172	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.47093	D	0.000243	D	0.98639	0.9544	H	0.96430	3.82	0.50813	D	0.999891	D	0.69078	0.997	D	0.83275	0.996	D	0.99474	1.0946	10	0.87932	D	0	.	14.1573	0.65426	0.0:0.0:1.0:0.0	.	242	Q9GZN4	BSSP4_HUMAN	F	242	ENSP00000161006:S242F	ENSP00000161006:S242F	S	-	2	0	PRSS22	2843324	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	4.654000	0.61469	1.977000	0.57605	0.456000	0.33151	TCC		0.711	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1	NM_022119		9	21	0	0	0	0.006214	0	9	21				
GPRC5B	51704	broad.mit.edu	37	16	19883154	19883154	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:19883154C>A	ENST00000300571.2	-	2	1205	c.1014G>T	c.(1012-1014)atG>atT	p.M338I	GPRC5B_ENST00000537135.1_Missense_Mutation_p.M364I|GPRC5B_ENST00000569479.1_Missense_Mutation_p.M338I|GPRC5B_ENST00000535671.1_Missense_Mutation_p.M338I|GPRC5B_ENST00000569847.1_Missense_Mutation_p.M338I	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	338					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGTGTTCATCCATGGAGAAGG	0.587																																							uc002dgt.2		NA																	0				lung(1)|breast(1)|skin(1)	3						c.(1012-1014)ATG>ATT		G protein-coupled receptor, family C, group 5,							90.0	87.0	88.0					16																	19883154		2197	4300	6497	SO:0001583	missense	51704							g.chr16:19883154C>A	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.1014G>T	16.37:g.19883154C>A	ENSP00000300571:p.Met338Ile		Somatic				GPRC5B_uc010vav.1_Missense_Mutation_p.M364I	p.M338I	NM_016235	NP_057319	WXS	Illumina HiSeq	Unspecified	Q9NZH0	GPC5B_HUMAN			2	1122	-			338			Cytoplasmic (Potential).		D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	ENST00000300571.2	37	c.1014G>T	CCDS10581.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684130	0.68157	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000538074;ENST00000537135	T;T;T	0.29655	1.58;1.57;1.56	5.03	5.03	0.67393	.	0.280544	0.42053	D	0.000774	T	0.47801	0.1465	L	0.52573	1.65	0.46396	D	0.99902	P;P	0.50528	0.936;0.936	P;P	0.61201	0.885;0.885	T	0.24368	-1.0162	9	.	.	.	.	17.5362	0.87832	0.0:1.0:0.0:0.0	.	364;338	B7Z831;Q9NZH0	.;GPC5B_HUMAN	I	338;338;187;364	ENSP00000300571:M338I;ENSP00000442858:M338I;ENSP00000441775:M364I	.	M	-	3	0	GPRC5B	19790655	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.950000	0.40323	2.608000	0.88229	0.655000	0.94253	ATG		0.587	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1			23	133	1	0	2.21704e-12	0.00278	3.42183e-12	23	133				
PLK1	5347	broad.mit.edu	37	16	23703537	23703538	+	IGR	DNP	GG	GG	TT			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:23703537_23703538GG>TT	ENST00000300093.4	+	0	2227				ERN2_ENST00000256797.4_Missense_Mutation_p.P787N|ERN2_ENST00000457008.2_Missense_Mutation_p.P687N	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		AGCCAGACAGGGAGCCCCTGTG	0.604																																					Colon(12;240 564 27038 33155)		uc002dma.3		NA																	0				large_intestine(2)|lung(2)|ovary(2)	6						c.(2359-2361)CCC>AAC		endoplasmic reticulum to nucleus signalling 2																																				SO:0001628	intergenic_variant	10595				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity	g.chr16:23703537_23703538GG>TT		CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	Exception_encountered	16.37:g.23703537_23703538delinsTT			Somatic				ERN2_uc010bxp.2_Missense_Mutation_p.P735N	p.P787N	NM_033266	NP_150296	WXS	Illumina HiSeq	Unspecified	Q76MJ5	ERN2_HUMAN		GBM - Glioblastoma multiforme(48;0.0156)	18	2528_2529	-			739			Protein kinase.|Cytoplasmic (Potential).		Q15153|Q99746	Missense_Mutation	DNP	ENST00000300093.4	37	c.2359_2360CC>AA	CCDS10616.1																																																																																				0.604	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030		58	66	0	0	0	0.004672	0	58	66				
SULT1A2	6799	broad.mit.edu	37	16	28604843	28604843	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:28604843T>C	ENST00000395630.1	-	5	769	c.419A>G	c.(418-420)tAc>tGc	p.Y140C	SULT1A2_ENST00000335715.4_Missense_Mutation_p.Y140C|SULT1A2_ENST00000533150.1_Intron	NM_177528.2	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2	140					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine biosynthetic process (GO:0009309)|catecholamine metabolic process (GO:0006584)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|sulfotransferase activity (GO:0008146)			NS(2)|breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|skin(2)	14						GTAGAAGTGGTAGTAGGAAAC	0.577																																							uc002dqg.1		NA																	0					0						c.(418-420)TAC>TGC		sulfotransferase family, cytosolic, 1A,							149.0	138.0	141.0					16																	28604843		2197	4300	6497	SO:0001583	missense	6799				3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity	g.chr16:28604843T>C	U34804	CCDS10636.1	16p12.1	2008-02-05			ENSG00000197165	ENSG00000197165	2.8.2.1	"""Sulfotransferases, cytosolic"""	11454	protein-coding gene	gene with protein product		601292		STP2		8661000, 8912648	Standard	NM_001054		Approved	HAST4	uc002dqh.2	P50226	OTTHUMG00000048082	ENST00000395630.1:c.419A>G	16.37:g.28604843T>C	ENSP00000378992:p.Tyr140Cys		Somatic				uc010vct.1_Intron|SULT1A2_uc002dqh.1_Missense_Mutation_p.Y140C	p.Y140C	NM_177528	NP_803564	WXS	Illumina HiSeq	Unspecified	P50226	ST1A2_HUMAN			5	770	-			140					A9QY25|P78393|Q14CJ7	Missense_Mutation	SNP	ENST00000395630.1	37	c.419A>G	CCDS10636.1	.	.	.	.	.	.	.	.	.	.	t	11.42	1.632375	0.29068	.	.	ENSG00000197165	ENST00000335715;ENST00000395630;ENST00000526384	D;D;D	0.85773	-2.03;-2.03;-2.03	4.6	3.37	0.38596	Sulfotransferase domain (1);	0.089485	0.47852	D	0.000204	D	0.94712	0.8294	H	0.98965	4.385	0.34207	D	0.673838	D	0.89917	1.0	D	0.75020	0.985	D	0.96408	0.9302	10	0.87932	D	0	.	9.5965	0.39578	0.1689:0.0:0.0:0.8311	.	140	P50226	ST1A2_HUMAN	C	140	ENSP00000338742:Y140C;ENSP00000378992:Y140C;ENSP00000435358:Y140C	ENSP00000338742:Y140C	Y	-	2	0	SULT1A2	28512344	1.000000	0.71417	0.990000	0.47175	0.078000	0.17371	1.620000	0.36976	1.699000	0.51192	0.454000	0.30748	TAC		0.577	SULT1A2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109415.2	NM_001054		52	47	0	0	0	0.00361	0	52	47				
SLC6A2	6530	broad.mit.edu	37	16	55703493	55703493	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:55703493G>A	ENST00000379906.2	+	2	546	c.291G>A	c.(289-291)ccG>ccA	p.P97P	SLC6A2_ENST00000566163.1_Silent_p.P97P|SLC6A2_ENST00000219833.8_Silent_p.P97P|SLC6A2_ENST00000567238.1_5'Flank|SLC6A2_ENST00000568943.1_Silent_p.P97P|SLC6A2_ENST00000414754.3_Silent_p.P97P|SLC6A2_ENST00000561820.1_Silent_p.P97P	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	97					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TCTTGATCCCGTACACACTGT	0.577																																							uc002eif.2		NA																	0				lung(4)|ovary(2)|pancreas(2)	8						c.(289-291)CCG>CCA		solute carrier family 6 member 2	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)						96.0	82.0	86.0					16																	55703493		2198	4300	6498	SO:0001819	synonymous_variant	6530				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity	g.chr16:55703493G>A		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.291G>A	16.37:g.55703493G>A			Somatic				SLC6A2_uc010ccd.2_Silent_p.P97P|SLC6A2_uc002eig.2_Silent_p.P97P|SLC6A2_uc002eih.2_Silent_p.P97P|SLC6A2_uc002eii.2_5'Flank	p.P97P	NM_001043	NP_001034	WXS	Illumina HiSeq	Unspecified	P23975	SC6A2_HUMAN		BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	3	402	+			97			Helical; Name=2; (Potential).		B2R707|B4DX48|Q96KH8	Silent	SNP	ENST00000379906.2	37	c.291G>A	CCDS10754.1																																																																																				0.577	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			5	74	0	0	0	0.001168	0	5	74				
CNOT1	23019	broad.mit.edu	37	16	58608961	58608961	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:58608961C>T	ENST00000317147.5	-	15	2109	c.1777G>A	c.(1777-1779)Gaa>Aaa	p.E593K	CNOT1_ENST00000441024.2_Missense_Mutation_p.E593K|CNOT1_ENST00000569240.1_Missense_Mutation_p.E593K	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	593					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TTGAGGTATTCACGACGTGAA	0.393																																							uc002env.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(1777-1779)GAA>AAA		CCR4-NOT transcription complex, subunit 1							132.0	119.0	124.0					16																	58608961		2198	4300	6498	SO:0001583	missense	23019				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol		g.chr16:58608961C>T	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1777G>A	16.37:g.58608961C>T	ENSP00000320949:p.Glu593Lys		Somatic				CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.E593K|CNOT1_uc002enx.2_Missense_Mutation_p.E593K|CNOT1_uc002enz.1_Missense_Mutation_p.E22K	p.E593K	NM_016284	NP_057368	WXS	Illumina HiSeq	Unspecified	A5YKK6	CNOT1_HUMAN		Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)	15	2070	-			593					Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	c.1777G>A	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	C	36	5.715635	0.96830	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.19938	2.11;2.11	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.55081	0.1898	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	0.974;0.999;1.0	D;D;D	0.80764	0.969;0.994;0.982	T	0.62840	-0.6769	9	.	.	.	.	18.9339	0.92577	0.0:1.0:0.0:0.0	.	593;593;593	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	K	593;22;593;593	ENSP00000320949:E593K;ENSP00000413113:E593K	.	E	-	1	0	CNOT1	57166462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.794000	0.85869	2.473000	0.83533	0.563000	0.77884	GAA		0.393	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284		8	71	0	0	0	0.00308	0	8	71				
SLC12A4	6560	broad.mit.edu	37	16	67997387	67997387	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:67997387C>T	ENST00000316341.3	-	2	331	c.191G>A	c.(190-192)aGg>aAg	p.R64K	SLC12A4_ENST00000537830.2_Missense_Mutation_p.R58K|SLC12A4_ENST00000572010.1_5'UTR|SLC12A4_ENST00000422611.2_Intron|SLC12A4_ENST00000338335.3_Missense_Mutation_p.R64K|SLC12A4_ENST00000576616.1_Missense_Mutation_p.R64K|SLC12A4_ENST00000541864.2_Missense_Mutation_p.R33K|SLC12A4_ENST00000572037.1_Intron	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	64					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TGCCAGGTTCCTGTCATAGTA	0.547																																							uc002euz.2		NA																	0				ovary(1)	1						c.(190-192)AGG>AAG		solute carrier family 12, member 4 isoform a	Bumetanide(DB00887)|Potassium Chloride(DB00761)						75.0	71.0	72.0					16																	67997387		2198	4300	6498	SO:0001583	missense	6560				cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity	g.chr16:67997387C>T		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.191G>A	16.37:g.67997387C>T	ENSP00000318557:p.Arg64Lys		Somatic				SLC12A4_uc010ceu.2_Missense_Mutation_p.R58K|SLC12A4_uc010vkh.1_Missense_Mutation_p.R33K|SLC12A4_uc010vki.1_Missense_Mutation_p.R64K|SLC12A4_uc010vkj.1_Intron|SLC12A4_uc002eva.2_Missense_Mutation_p.R64K|SLC12A4_uc002evb.2_RNA|SLC12A4_uc010cew.1_5'UTR	p.R64K	NM_005072	NP_005063	WXS	Illumina HiSeq	Unspecified	Q9UP95	S12A4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	2	332	-		Ovarian(137;0.192)	64			Cytoplasmic (Potential).		B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	c.191G>A	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	C	9.021	0.984892	0.18889	.	.	ENSG00000124067	ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D	0.87256	-1.68;-1.69;-2.23;-1.71	5.31	5.31	0.75309	.	0.086186	0.85682	D	0.000000	T	0.67636	0.2914	N	0.03253	-0.375	0.40824	D	0.98353	B;B;B;B;B	0.11235	0.0;0.004;0.0;0.0;0.0	B;B;B;B;B	0.14578	0.001;0.011;0.001;0.002;0.002	T	0.64732	-0.6338	10	0.02654	T	1	.	10.6269	0.45512	0.0:0.8508:0.0:0.1492	.	64;33;58;64;64	B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;S12A4_HUMAN	K	33;58;64;64	ENSP00000438334:R33K;ENSP00000445962:R58K;ENSP00000343374:R64K;ENSP00000318557:R64K	ENSP00000318557:R64K	R	-	2	0	SLC12A4	66554888	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.010000	0.49559	2.491000	0.84063	0.462000	0.41574	AGG		0.547	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072		25	31	0	0	0	0.007291	0	25	31				
DPEP3	64180	broad.mit.edu	37	16	68014139	68014139	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:68014139G>A	ENST00000268793.4	-	1	593	c.220C>T	c.(220-222)Ctg>Ttg	p.L74L	DPEP3_ENST00000574342.1_5'UTR	NM_001129758.1|NM_022357.3	NP_001123230.1|NP_071752.3	Q9H4B8	DPEP3_HUMAN	dipeptidase 3	49					male meiosis (GO:0007140)	anchored component of membrane (GO:0031225)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			breast(4)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		GGGGAGCCCAGCGTGGAGAGG	0.711																																							uc002evc.3		NA																	0				breast(3)	3						c.(220-222)CTG>TTG		dipeptidase 3 isoform a							11.0	16.0	14.0					16																	68014139		2182	4280	6462	SO:0001819	synonymous_variant	64180				meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity	g.chr16:68014139G>A	AJ291679	CCDS10856.1	16q22.1	2011-07-22			ENSG00000141096	ENSG00000141096	3.4.13.19		23029	protein-coding gene	gene with protein product		609926					Standard	NM_022357		Approved		uc002evc.4	Q9H4B8	OTTHUMG00000137544	ENST00000268793.4:c.220C>T	16.37:g.68014139G>A			Somatic				DPEP3_uc010cex.2_Silent_p.L74L	p.L74L	NM_022357	NP_071752	WXS	Illumina HiSeq	Unspecified	Q9H4B8	DPEP3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)	1	314	-		Ovarian(137;0.192)	49					B3KQ48|Q6PEZ5|Q6UXE4	Silent	SNP	ENST00000268793.4	37	c.220C>T	CCDS10856.1																																																																																				0.711	DPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268875.3	NM_022357		10	12	0	0	0	0.008291	0	10	12				
PMFBP1	83449	broad.mit.edu	37	16	72153719	72153719	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:72153719C>A	ENST00000537465.1	-	20	3211	c.3053G>T	c.(3052-3054)tGt>tTt	p.C1018F	PMFBP1_ENST00000237353.10_Intron|PMFBP1_ENST00000355636.6_Intron|PMFBP1_ENST00000537792.1_Intron			Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	1018						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AAAAAAATCACACTTATTTTT	0.433																																							uc002fcc.3		NA																	0				ovary(2)	2						c.(3052-3054)TGT>TTT		polyamine modulated factor 1 binding protein 1							41.0	43.0	42.0					16																	72153719		2198	4300	6498	SO:0001583	missense	83449							g.chr16:72153719C>A	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000537465.1:c.3053G>T	16.37:g.72153719C>A	ENSP00000443817:p.Cys1018Phe		Somatic				PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron	p.C1018F	NM_031293	NP_112583	WXS	Illumina HiSeq	Unspecified	Q8TBY8	PMFBP_HUMAN			20	3225	-		Ovarian(137;0.179)	1018					B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000537465.1	37	c.3053G>T		.	.	.	.	.	.	.	.	.	.	C	4.669	0.124388	0.08931	.	.	ENSG00000118557	ENST00000537465	T	0.12672	2.66	3.42	-4.72	0.03269	.	.	.	.	.	T	0.08313	0.0207	.	.	.	0.09310	N	1	B	0.28636	0.218	B	0.19148	0.024	T	0.28235	-1.0050	8	0.87932	D	0	.	6.5506	0.22431	0.0:0.225:0.163:0.612	.	1018	G3V1Q7	.	F	1018	ENSP00000443817:C1018F	ENSP00000443817:C1018F	C	-	2	0	PMFBP1	70711220	0.000000	0.05858	0.000000	0.03702	0.204000	0.24138	-0.299000	0.08254	-0.982000	0.03515	-0.363000	0.07495	TGT		0.433	PMFBP1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000396483.2	NM_031293		3	37	1	0	0.004672	0.004672	0.00502765	3	37				
FA2H	79152	broad.mit.edu	37	16	74750356	74750356	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:74750356G>A	ENST00000219368.3	-	6	997	c.928C>T	c.(928-930)Ctc>Ttc	p.L310F	FA2H_ENST00000544337.1_Missense_Mutation_p.L97F	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	310					cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						ATGTCATAGAGGACGTAGCCC	0.597																																							uc002fde.1		NA																	0					0						c.(928-930)CTC>TTC		fatty acid 2-hydroxylase							94.0	75.0	81.0					16																	74750356		2198	4300	6498	SO:0001583	missense	79152				cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity	g.chr16:74750356G>A	BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.928C>T	16.37:g.74750356G>A	ENSP00000219368:p.Leu310Phe		Somatic				FA2H_uc002fdd.1_Missense_Mutation_p.L83F|FA2H_uc010vmy.1_RNA	p.L310F	NM_024306	NP_077282	WXS	Illumina HiSeq	Unspecified	Q7L5A8	FA2H_HUMAN			6	996	-			310			Helical; (Potential).		B7Z8T6|O75213|Q96DK1|Q9H1A5	Missense_Mutation	SNP	ENST00000219368.3	37	c.928C>T	CCDS10911.1	.	.	.	.	.	.	.	.	.	.	g	14.33	2.502523	0.44455	.	.	ENSG00000103089	ENST00000219368;ENST00000544337	D;D	0.84800	-1.9;-1.9	5.39	-8.54	0.00912	Fatty acid hydroxylase (1);	0.795703	0.11894	N	0.519313	T	0.72495	0.3467	L	0.33339	1.005	0.20307	N	0.999914	P;P	0.47034	0.889;0.841	P;B	0.47528	0.549;0.446	T	0.66520	-0.5903	10	0.09843	T	0.71	.	7.5485	0.27781	0.0631:0.2083:0.1082:0.6205	.	310;218	Q7L5A8;B2RDE6	FA2H_HUMAN;.	F	310;97	ENSP00000219368:L310F;ENSP00000442334:L97F	ENSP00000219368:L310F	L	-	1	0	FA2H	73307857	0.014000	0.17966	0.057000	0.19452	0.437000	0.31866	-0.316000	0.08071	-1.061000	0.03185	-0.909000	0.02823	CTC		0.597	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269015.2	NM_024306		12	18	0	0	0	0.00245	0	12	18				
KLHL36	79786	broad.mit.edu	37	16	84691417	84691417	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:84691417G>T	ENST00000564996.1	+	3	1145	c.1004G>T	c.(1003-1005)cGg>cTg	p.R335L	KLHL36_ENST00000258157.5_Missense_Mutation_p.R335L	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	335					protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CCCGCCCGGCGGAGCCACCAC	0.652																																							uc002fig.2		NA																	0				skin(2)	2						c.(1003-1005)CGG>CTG		kelch-like 36							12.0	13.0	13.0					16																	84691417		2188	4272	6460	SO:0001583	missense	79786							g.chr16:84691417G>T	AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.1004G>T	16.37:g.84691417G>T	ENSP00000456743:p.Arg335Leu		Somatic				KLHL36_uc010chl.2_Missense_Mutation_p.R334L	p.R335L	NM_024731	NP_079007	WXS	Illumina HiSeq	Unspecified	Q8N4N3	KLH36_HUMAN			3	1145	+			335			Kelch 1.		Q8N5G6|Q9H9U6	Missense_Mutation	SNP	ENST00000564996.1	37	c.1004G>T	CCDS10948.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260476	0.59431	.	.	ENSG00000135686	ENST00000325279;ENST00000258157	T	0.54279	0.58	5.64	5.64	0.86602	Kelch-type beta propeller (1);	0.057111	0.64402	D	0.000002	T	0.72819	0.3508	M	0.82193	2.58	0.80722	D	1	D;B	0.59357	0.985;0.004	P;B	0.58721	0.844;0.013	T	0.76966	-0.2763	10	0.87932	D	0	.	18.6977	0.91607	0.0:0.0:1.0:0.0	.	335;335	Q8N4N3-2;Q8N4N3	.;KLH36_HUMAN	L	335	ENSP00000258157:R335L	ENSP00000258157:R335L	R	+	2	0	KLHL36	83248918	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	7.708000	0.84633	2.647000	0.89833	0.655000	0.94253	CGG		0.652	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269084.2			5	12	1	0	3.59834e-05	0.001168	4.22295e-05	5	12				
CBFA2T3	863	broad.mit.edu	37	16	88945811	88945811	+	Missense_Mutation	SNP	G	G	C	rs535005481		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:88945811G>C	ENST00000268679.4	-	11	1925	c.1529C>G	c.(1528-1530)tCg>tGg	p.S510W	RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.S472W|RP11-830F9.5_ENST00000562574.1_RNA|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.S424W|CBFA2T3_ENST00000327483.5_Missense_Mutation_p.S424W|CBFA2T3_ENST00000448839.1_Missense_Mutation_p.S434W	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	510					cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CTCCGCGTCCGACACGGCTTT	0.672			T	RUNX1	AML																																		uc002fmm.1		NA		Dom	yes		16	16q24	863	T	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""			L	RUNX1		AML		0				large_intestine(3)|ovary(1)	4						c.(1528-1530)TCG>TGG		myeloid translocation gene on chromosome 16							79.0	65.0	70.0					16																	88945811		2198	4299	6497	SO:0001583	missense	863				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:88945811G>C	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.1529C>G	16.37:g.88945811G>C	ENSP00000268679:p.Ser510Trp		Somatic				CBFA2T3_uc002fml.1_Missense_Mutation_p.S424W|CBFA2T3_uc002fmk.1_Missense_Mutation_p.S9W	p.S510W	NM_005187	NP_005178	WXS	Illumina HiSeq	Unspecified	O75081	MTG16_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0275)	11	1715	-			510			Potential.		D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	c.1529C>G	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827255	0.50739	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000448839;ENST00000360302	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	4.7	3.73	0.42828	.	0.000000	0.64402	D	0.000001	T	0.66752	0.2821	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.985;0.987	T	0.69895	-0.5021	10	0.87932	D	0	-8.3861	11.3303	0.49473	0.1551:0.0:0.8449:0.0	.	510;424	O75081;O75081-2	MTG16_HUMAN;.	W	424;510;472;434;424	ENSP00000332122:S424W;ENSP00000268679:S510W;ENSP00000395739:S472W;ENSP00000401254:S434W;ENSP00000353449:S424W	ENSP00000268679:S510W	S	-	2	0	CBFA2T3	87473312	1.000000	0.71417	0.057000	0.19452	0.220000	0.24768	6.316000	0.72857	0.949000	0.37715	0.462000	0.41574	TCG		0.672	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187		18	35	0	0	0	0.012319	0	18	35				
CDH15	1013	broad.mit.edu	37	16	89258091	89258091	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr16:89258091C>A	ENST00000289746.2	+	10	1469	c.1404C>A	c.(1402-1404)acC>acA	p.T468T		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	468	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCACCGGCACCCTGTCCATCG	0.721																																							uc002fmt.2		NA																	0				skin(1)	1						c.(1402-1404)ACC>ACA		cadherin 15 preproprotein							10.0	11.0	11.0					16																	89258091		2148	4260	6408	SO:0001819	synonymous_variant	1013				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding	g.chr16:89258091C>A	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1404C>A	16.37:g.89258091C>A			Somatic					p.T468T	NM_004933	NP_004924	WXS	Illumina HiSeq	Unspecified	P55291	CAD15_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0261)	10	1481	+			468			Cadherin 4.|Extracellular (Potential).			Silent	SNP	ENST00000289746.2	37	c.1404C>A	CCDS10976.1																																																																																				0.721	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933		11	14	1	0	1.58986e-06	0.008291	1.99374e-06	11	14				
TP53	7157	broad.mit.edu	37	17	7577536	7577536	+	Missense_Mutation	SNP	T	T	A	rs587782082		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:7577536T>A	ENST00000269305.4	-	7	934	c.745A>T	c.(745-747)Agg>Tgg	p.R249W	TP53_ENST00000420246.2_Missense_Mutation_p.R249W|TP53_ENST00000413465.2_Missense_Mutation_p.R249W|TP53_ENST00000455263.2_Missense_Mutation_p.R249W|TP53_ENST00000445888.2_Missense_Mutation_p.R249W|TP53_ENST00000359597.4_Missense_Mutation_p.R249W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249W(37)|p.R249G(30)|p.0?(8)|p.?(5)|p.M246_P250delMNRRP(2)|p.R249R(1)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.N247_R248delNR(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.G245fs*14(1)|p.R249fs*15(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.R249fs*19(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGATGGGCCTCCGGTTCATG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		95	Substitution - Missense(67)|Deletion - In frame(9)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Substitution - coding silent(1)	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.N247_P250delNRRP(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.N247_R248delNR(1)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.R249_T256delRPILTIIT(1)|p.R249_P250>SS(1)|p.G245fs*14(1)|p.R249fs*19(1)	lung(22)|upper_aerodigestive_tract(10)|urinary_tract(9)|large_intestine(7)|breast(7)|central_nervous_system(5)|biliary_tract(5)|oesophagus(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|endometrium(3)|ovary(3)|soft_tissue(2)|skin(2)|peritoneum(1)|small_intestine(1)|pancreas(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(745-747)AGG>TGG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							153.0	113.0	126.0					17																	7577536		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577536T>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.745A>T	17.37:g.7577536T>A	ENSP00000269305:p.Arg249Trp	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.R249W|TP53_uc002gih.2_Missense_Mutation_p.R249W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117W|TP53_uc010cng.1_Missense_Mutation_p.R117W|TP53_uc002gii.1_Missense_Mutation_p.R117W|TP53_uc010cnh.1_Missense_Mutation_p.R249W|TP53_uc010cni.1_Missense_Mutation_p.R249W|TP53_uc002gij.2_Missense_Mutation_p.R249W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156W|TP53_uc002gio.2_Missense_Mutation_p.R117W	p.R249W	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	939	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	249		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.745A>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.796639	0.70567	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	-0.0234	0.13943	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.92367	3.3	0.50313	D	0.999866	P;D;P;B;P	0.89917	0.797;1.0;0.831;0.422;0.862	P;D;P;B;P	0.97110	0.48;1.0;0.753;0.394;0.655	D	0.97959	1.0336	10	0.87932	D	0	-3.0658	12.7443	0.57273	0.0:0.0:0.4175:0.5825	.	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	W	249;249;249;249;249;249;238;117	ENSP00000410739:R249W;ENSP00000352610:R249W;ENSP00000269305:R249W;ENSP00000398846:R249W;ENSP00000391127:R249W;ENSP00000391478:R249W;ENSP00000425104:R117W	ENSP00000269305:R249W	R	-	1	2	TP53	7518261	0.009000	0.17119	0.995000	0.50966	0.814000	0.46013	0.039000	0.13884	-0.029000	0.13827	-0.648000	0.03929	AGG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		22	24	0	0	0	0.00278	0	22	24				
PIK3R6	146850	broad.mit.edu	37	17	8732150	8732150	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:8732150C>G	ENST00000311434.9	-	11	1286	c.1047G>C	c.(1045-1047)ggG>ggC	p.G349G	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	349					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										GCTCATCAGCCCCCGTGGGAA	0.662																																							uc002glq.1		NA																	0					0						c.(1045-1047)GGG>GGC		phosphoinositide-3-kinase, regulatory subunit 6							19.0	21.0	20.0					17																	8732150		1984	4137	6121	SO:0001819	synonymous_variant	146850				platelet activation	cytosol		g.chr17:8732150C>G	AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.1047G>C	17.37:g.8732150C>G			Somatic				PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	p.G349G	NM_001010855	NP_001010855	WXS	Illumina HiSeq	Unspecified	Q5UE93	PI3R6_HUMAN			11	1287	-			349					Q658R3	Silent	SNP	ENST00000311434.9	37	c.1047G>C																																																																																					0.662	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001010855		7	15	0	0	0	0.00308	0	7	15				
NCOR1	9611	broad.mit.edu	37	17	16068441	16068441	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:16068441G>A	ENST00000268712.3	-	5	727	c.470C>T	c.(469-471)tCc>tTc	p.S157F	NCOR1_ENST00000395851.1_Missense_Mutation_p.S157F|NCOR1_ENST00000395848.1_Missense_Mutation_p.S48F	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	157	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AATTGGAGAGGATGGAGCTTC	0.393																																							uc002gpo.2		NA																	0				upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5						c.(469-471)TCC>TTC		nuclear receptor co-repressor 1							113.0	107.0	109.0					17																	16068441		2203	4300	6503	SO:0001583	missense	9611				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding	g.chr17:16068441G>A	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.470C>T	17.37:g.16068441G>A	ENSP00000268712:p.Ser157Phe		Somatic				NCOR1_uc002gpn.2_Missense_Mutation_p.S157F|NCOR1_uc002gpp.1_Missense_Mutation_p.S48F|NCOR1_uc002gpr.2_Missense_Mutation_p.S48F|NCOR1_uc002gps.1_Missense_Mutation_p.S157F|NCOR1_uc010coz.1_5'UTR|NCOR1_uc010cpb.1_Missense_Mutation_p.S157F|NCOR1_uc010cpa.1_Missense_Mutation_p.S157F|NCOR1_uc002gpu.2_Missense_Mutation_p.S157F	p.S157F	NM_006311	NP_006302	WXS	Illumina HiSeq	Unspecified	O75376	NCOR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)	5	710	-			157			Interaction with ZBTB33 and HEXIM1.		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	c.470C>T	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710460	0.48517	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T	0.46819	0.86;1.46;0.91	5.04	5.04	0.67666	.	0.049550	0.85682	D	0.000000	T	0.62660	0.2446	L	0.56769	1.78	0.80722	D	1	D;P;D;P;D;B;D	0.69078	0.985;0.592;0.993;0.592;0.988;0.259;0.997	D;B;D;B;P;B;D	0.74023	0.933;0.239;0.917;0.239;0.733;0.105;0.982	T	0.56625	-0.7948	10	0.13470	T	0.59	-10.7569	17.4183	0.87507	0.0:0.0:1.0:0.0	.	157;157;157;157;48;157;157	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	F	157;157;48;157;48;157;157	ENSP00000268712:S157F;ENSP00000379192:S157F;ENSP00000379189:S48F	ENSP00000268712:S157F	S	-	2	0	NCOR1	16009166	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.203000	0.77864	2.349000	0.79799	0.478000	0.44815	TCC		0.393	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311		6	80	0	0	0	0.00308	0	6	80				
RAB11FIP4	84440	broad.mit.edu	37	17	29857480	29857480	+	Missense_Mutation	SNP	G	G	T	rs147400342		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:29857480G>T	ENST00000325874.8	+	14	2019	c.1790G>T	c.(1789-1791)cGc>cTc	p.R597L	RAB11FIP4_ENST00000394744.2_Missense_Mutation_p.R495L	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	597	FIP-RBD. {ECO:0000255|PROSITE- ProRule:PRU00844}.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				ACCGCCTCGCGCGATGAGGTA	0.587																																							uc002hgn.1		NA																	0				skin(1)	1						c.(1789-1791)CGC>CTC		RAB11 family interacting protein 4 (class II)							72.0	74.0	73.0					17																	29857480		2203	4300	6503	SO:0001583	missense	84440				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding	g.chr17:29857480G>T	AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.1790G>T	17.37:g.29857480G>T	ENSP00000312837:p.Arg597Leu		Somatic				RAB11FIP4_uc002hgo.2_Missense_Mutation_p.R495L	p.R597L	NM_032932	NP_116321	WXS	Illumina HiSeq	Unspecified	Q86YS3	RFIP4_HUMAN			14	2019	+		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)	597			Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.|FIP-RBD.		Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	ENST00000325874.8	37	c.1790G>T	CCDS11267.1	.	.	.	.	.	.	.	.	.	.	G	9.815	1.184332	0.21870	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	6.04	6.04	0.98038	Rab-binding domain FIP-RBD (2);	0.045738	0.85682	D	0.000000	T	0.69396	0.3106	L	0.47716	1.5	0.48571	D	0.999675	D;D	0.71674	0.998;0.984	D;P	0.70487	0.969;0.892	T	0.65393	-0.6179	8	.	.	.	-20.0423	16.0793	0.80989	0.0:0.0:1.0:0.0	.	495;597	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	L	597	.	.	R	+	2	0	RAB11FIP4	26881600	1.000000	0.71417	0.343000	0.25615	0.051000	0.14879	7.619000	0.83057	2.873000	0.98535	0.561000	0.74099	CGC		0.587	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932		16	94	1	0	9.16793e-09	0.00499	1.2644e-08	16	94				
C17orf102	400591	broad.mit.edu	37	17	32904574	32904574	+	Missense_Mutation	SNP	G	G	T	rs549690989		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:32904574G>T	ENST00000357754.1	-	2	564	c.476C>A	c.(475-477)gCt>gAt	p.A159D		NM_207454.2	NP_997337.2	A2RUQ5	CQ102_HUMAN	chromosome 17 open reading frame 102	159										central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(3)|ovary(1)	9						gaggacaagagctggttttgt	0.473																																							uc002hie.1		NA																	0		p.A159T(1)		ovary(1)	1						c.(475-477)GCT>GAT		hypothetical protein LOC400591							113.0	107.0	109.0					17																	32904574		2018	4195	6213	SO:0001583	missense	400591							g.chr17:32904574G>T		CCDS42297.1	17q12	2009-02-11			ENSG00000197322	ENSG00000197322			34412	protein-coding gene	gene with protein product							Standard	NM_207454		Approved	FLJ44815	uc002hie.1	A2RUQ5	OTTHUMG00000156883	ENST00000357754.1:c.476C>A	17.37:g.32904574G>T	ENSP00000350392:p.Ala159Asp		Somatic					p.A159D	NM_207454	NP_997337	WXS	Illumina HiSeq	Unspecified	A2RUQ5	CQ102_HUMAN			2	565	-			159					A5PKX0|Q6ZTB3	Missense_Mutation	SNP	ENST00000357754.1	37	c.476C>A	CCDS42297.1	.	.	.	.	.	.	.	.	.	.	G	5.280	0.237094	0.10023	.	.	ENSG00000197322	ENST00000357754	T	0.39229	1.09	2.64	-4.93	0.03066	.	.	.	.	.	T	0.22282	0.0537	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.27434	-1.0074	9	0.87932	D	0	.	7.9369	0.29935	0.0:0.5989:0.2434:0.1578	.	159	A2RUQ5	CQ102_HUMAN	D	159	ENSP00000350392:A159D	ENSP00000350392:A159D	A	-	2	0	C17orf102	29928687	0.009000	0.17119	0.000000	0.03702	0.075000	0.17131	1.305000	0.33493	-0.882000	0.03987	0.655000	0.94253	GCT		0.473	C17orf102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346435.1	NM_207454		10	30	1	0	2.52707e-12	0.006214	3.89068e-12	10	30				
LIG3	3980	broad.mit.edu	37	17	33323635	33323635	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:33323635G>C	ENST00000378526.4	+	11	1919	c.1786G>C	c.(1786-1788)Gat>Cat	p.D596H	LIG3_ENST00000262327.5_Missense_Mutation_p.D596H	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	596					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	GTTTGTTTTTGATTGTATCTA	0.403								Other BER factors																															uc002hik.1		NA																	0				skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9						c.(1786-1788)GAT>CAT	Other_BER_factors	ligase III, DNA, ATP-dependent isoform alpha	Bleomycin(DB00290)						234.0	198.0	210.0					17																	33323635		2203	4300	6503	SO:0001583	missense	3980				base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding	g.chr17:33323635G>C		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1786G>C	17.37:g.33323635G>C	ENSP00000367787:p.Asp596His		Somatic				LIG3_uc002hij.2_Missense_Mutation_p.D596H	p.D596H	NM_013975	NP_039269	WXS	Illumina HiSeq	Unspecified	P49916	DNLI3_HUMAN			11	1894	+		Ovarian(249;0.17)	596					Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	c.1786G>C	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798225	0.90538	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	D;D	0.97232	-4.3;-4.3	5.47	5.47	0.80525	DNA ligase, ATP-dependent, central (2);	0.090545	0.64402	D	0.000001	D	0.99263	0.9743	H	0.99143	4.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98591	1.0654	10	0.87932	D	0	-17.702	18.6738	0.91521	0.0:0.0:1.0:0.0	.	596;596	P49916;E5KLB6	DNLI3_HUMAN;.	H	596	ENSP00000367787:D596H;ENSP00000262327:D596H	ENSP00000262327:D596H	D	+	1	0	LIG3	30347748	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.576000	0.98192	2.728000	0.93425	0.655000	0.94253	GAT		0.403	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975		15	117	0	0	0	0.006122	0	15	117				
LIG3	3980	broad.mit.edu	37	17	33323660	33323660	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:33323660G>C	ENST00000378526.4	+	11	1944	c.1811G>C	c.(1810-1812)aGc>aCc	p.S604T	LIG3_ENST00000262327.5_Missense_Mutation_p.S604T	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	604					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AATGATGTCAGCTTGATGGAC	0.433								Other BER factors																															uc002hik.1		NA																	0				skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9						c.(1810-1812)AGC>ACC	Other_BER_factors	ligase III, DNA, ATP-dependent isoform alpha	Bleomycin(DB00290)						221.0	188.0	199.0					17																	33323660		2203	4300	6503	SO:0001583	missense	3980				base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding	g.chr17:33323660G>C		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1811G>C	17.37:g.33323660G>C	ENSP00000367787:p.Ser604Thr		Somatic				LIG3_uc002hij.2_Missense_Mutation_p.S604T	p.S604T	NM_013975	NP_039269	WXS	Illumina HiSeq	Unspecified	P49916	DNLI3_HUMAN			11	1919	+		Ovarian(249;0.17)	604					Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	c.1811G>C	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829009	0.71258	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	D;D	0.85339	-1.97;-1.97	5.34	5.34	0.76211	DNA ligase, ATP-dependent, central (2);	0.111366	0.85682	D	0.000000	D	0.88168	0.6364	M	0.69823	2.125	0.80722	D	1	P;P	0.46859	0.885;0.792	P;B	0.48089	0.566;0.411	D	0.88101	0.2819	10	0.45353	T	0.12	-18.2876	18.3892	0.90477	0.0:0.0:1.0:0.0	.	604;604	P49916;E5KLB6	DNLI3_HUMAN;.	T	604	ENSP00000367787:S604T;ENSP00000262327:S604T	ENSP00000262327:S604T	S	+	2	0	LIG3	30347773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.576000	0.98192	2.659000	0.90383	0.563000	0.77884	AGC		0.433	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975		11	102	0	0	0	0.010729	0	11	102				
KRT37	8688	broad.mit.edu	37	17	39579095	39579095	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:39579095C>A	ENST00000225550.3	-	3	666	c.667G>T	c.(667-669)Gac>Tac	p.D223Y	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	223	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				GCCTCCAGGTCGGCCTTGGCC	0.662																																							uc002hwp.1		NA																	0				skin(1)	1						c.(667-669)GAC>TAC		keratin 37							68.0	59.0	62.0					17																	39579095		2203	4300	6503	SO:0001583	missense	8688					intermediate filament	structural molecule activity	g.chr17:39579095C>A	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.667G>T	17.37:g.39579095C>A	ENSP00000225550:p.Asp223Tyr		Somatic				uc002hwo.1_Intron	p.D223Y	NM_003770	NP_003761	WXS	Illumina HiSeq	Unspecified	O76014	KRT37_HUMAN			3	714	-		Breast(137;0.000496)	223			Rod.|Coil 1B.			Missense_Mutation	SNP	ENST00000225550.3	37	c.667G>T	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	20.7	4.034169	0.75617	.	.	ENSG00000108417	ENST00000225550	D	0.92299	-3.01	4.86	4.86	0.63082	Filament (1);	0.000000	0.49305	D	0.000152	D	0.98049	0.9357	H	0.99391	4.545	0.36172	D	0.8488	D	0.89917	1.0	D	0.97110	1.0	D	0.99975	1.2163	10	0.87932	D	0	.	16.959	0.86267	0.0:1.0:0.0:0.0	.	223	O76014	KRT37_HUMAN	Y	223	ENSP00000225550:D223Y	ENSP00000225550:D223Y	D	-	1	0	KRT37	36832621	0.475000	0.25894	0.991000	0.47740	0.963000	0.63663	1.131000	0.31406	2.253000	0.74438	0.655000	0.94253	GAC		0.662	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		17	55	1	0	4.7546e-09	0.004007	6.67576e-09	17	55				
KRT36	8689	broad.mit.edu	37	17	39645847	39645847	+	Missense_Mutation	SNP	G	G	T	rs188302666		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:39645847G>T	ENST00000328119.6	-	1	269	c.270C>A	c.(268-270)aaC>aaA	p.N90K	KRT36_ENST00000393986.2_Missense_Mutation_p.N40K	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	90	Head.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				TCTCGCTGCCGTTGAAGGAGC	0.632																																							uc002hwt.2		NA																	0					0						c.(268-270)AAC>AAA		keratin 36							92.0	90.0	90.0					17																	39645847		2203	4300	6503	SO:0001583	missense	8689					intermediate filament	protein binding|structural constituent of epidermis	g.chr17:39645847G>T	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.270C>A	17.37:g.39645847G>T	ENSP00000329165:p.Asn90Lys		Somatic					p.N90K	NM_003771	NP_003762	WXS	Illumina HiSeq	Unspecified	O76013	KRT36_HUMAN			1	270	-		Breast(137;0.000286)	90			Head.		Q86XG4	Missense_Mutation	SNP	ENST00000328119.6	37	c.270C>A	CCDS11395.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478638	0.26511	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	D;T	0.81739	-1.53;-1.41	5.57	-0.499	0.12015	.	0.129344	0.34025	N	0.004329	D	0.83211	0.5205	M	0.71206	2.165	0.09310	N	1	P	0.45986	0.87	P	0.52514	0.701	T	0.78145	-0.2318	10	0.72032	D	0.01	.	12.2728	0.54716	0.549:0.0:0.451:0.0	.	90	O76013	KRT36_HUMAN	K	40;90	ENSP00000377555:N40K;ENSP00000329165:N90K	ENSP00000329165:N90K	N	-	3	2	KRT36	36899373	0.000000	0.05858	0.965000	0.40720	0.144000	0.21451	-1.504000	0.02275	-0.419000	0.07439	-2.233000	0.00290	AAC		0.632	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771		28	113	1	0	2.08457e-15	0.010818	3.4576e-15	28	113				
BRCA1	672	broad.mit.edu	37	17	41234512	41234513	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:41234512_41234513CC>AA	ENST00000357654.3	-	12	4383_4384	c.4265_4266GG>TT	c.(4264-4266)gGG>gTT	p.G1422V	BRCA1_ENST00000491747.2_Missense_Mutation_p.G319V|BRCA1_ENST00000493795.1_Missense_Mutation_p.G1375V|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.G1126V|BRCA1_ENST00000468300.1_Missense_Mutation_p.G319V|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.G1422V|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000351666.3_Missense_Mutation_p.G239V|BRCA1_ENST00000352993.3_Missense_Mutation_p.G280V|BRCA1_ENST00000471181.2_Missense_Mutation_p.G1422V|BRCA1_ENST00000346315.3_Missense_Mutation_p.G1422V	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1422	Interaction with PALB2.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAGGCTGGCTCCCATGCTGTTC	0.45			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		0				ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52						c.(4264-4266)GGG>GTT	Homologous_recombination	breast cancer 1, early onset isoform 1																																				SO:0001583	missense	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41234512_41234513CC>AA	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4265_4266delinsAA	17.37:g.41234512_41234513delinsAA	ENSP00000350283:p.Gly1422Val	TCGA Ovarian(2;0.000030)	Somatic				BRCA1_uc010whp.1_Missense_Mutation_p.G272V|BRCA1_uc010whl.1_Missense_Mutation_p.G319V|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.G1351V|BRCA1_uc002icu.2_Missense_Mutation_p.G319V|BRCA1_uc010cyx.2_Missense_Mutation_p.G1375V|BRCA1_uc002ict.2_Missense_Mutation_p.G1422V|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Missense_Mutation_p.G151V|BRCA1_uc002idc.1_Missense_Mutation_p.G318V|BRCA1_uc010whr.1_Missense_Mutation_p.G272V	p.G1422V	NM_007294	NP_009225	WXS	Illumina HiSeq	Unspecified	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	12	4497_4498	-		Breast(137;0.000717)	1422			Interaction with PALB2.		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	DNP	ENST00000357654.3	37	c.4265_4266GG>TT	CCDS11453.1																																																																																				0.450	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		20	69	0	0	0	0.004672	0	20	69				
CUEDC1	404093	broad.mit.edu	37	17	55950963	55950963	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:55950963C>A	ENST00000577830.1	-	4	993	c.580G>T	c.(580-582)Gac>Tac	p.D194Y	CUEDC1_ENST00000407144.2_Missense_Mutation_p.D194Y|CUEDC1_ENST00000360238.2_Missense_Mutation_p.D194Y|CUEDC1_ENST00000577840.1_Missense_Mutation_p.D57Y	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	194										endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						TGTATGCTGTCCAGCTGCTGG	0.587																																							uc002ivd.1		NA																	0				skin(2)	2						c.(580-582)GAC>TAC		CUE domain-containing 1							75.0	70.0	72.0					17																	55950963		2203	4300	6503	SO:0001583	missense	404093							g.chr17:55950963C>A	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.580G>T	17.37:g.55950963C>A	ENSP00000462717:p.Asp194Tyr		Somatic				CUEDC1_uc002ive.1_Missense_Mutation_p.D194Y	p.D194Y	NM_017949	NP_060419	WXS	Illumina HiSeq	Unspecified	Q9NWM3	CUED1_HUMAN			4	1299	-			194					D3DTZ2|Q9NWD0	Missense_Mutation	SNP	ENST00000577830.1	37	c.580G>T	CCDS11599.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356910	0.61293	.	.	ENSG00000180891	ENST00000407144;ENST00000360238	T;T	0.27890	1.64;1.64	5.47	5.47	0.80525	.	0.138303	0.64402	D	0.000005	T	0.36799	0.0980	M	0.68952	2.095	0.80722	D	1	B	0.22746	0.074	B	0.24155	0.051	T	0.11842	-1.0571	10	0.41790	T	0.15	.	17.569	0.87930	0.0:1.0:0.0:0.0	.	194	Q9NWM3	CUED1_HUMAN	Y	194	ENSP00000384712:D194Y;ENSP00000353373:D194Y	ENSP00000353373:D194Y	D	-	1	0	CUEDC1	53305962	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	3.621000	0.54210	2.578000	0.87016	0.650000	0.86243	GAC		0.587	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1	NM_017949		26	69	1	0	3.28513e-13	0.003954	5.19936e-13	26	69				
PPM1E	22843	broad.mit.edu	37	17	57046944	57046944	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:57046944G>T	ENST00000308249.2	+	4	957	c.828G>T	c.(826-828)ggG>ggT	p.G276G	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			ATGGCCATGGGGGAGTAGATG	0.493																																							uc002iwx.2		NA																	0				breast(3)|lung(1)|skin(1)	5						c.(826-828)GGG>GGT		protein phosphatase 1E							190.0	154.0	166.0					17																	57046944		2203	4300	6503	SO:0001819	synonymous_variant	22843				protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr17:57046944G>T	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.828G>T	17.37:g.57046944G>T			Somatic				PPM1E_uc010ddd.2_Silent_p.G39G	p.G276G	NM_014906	NP_055721	WXS	Illumina HiSeq	Unspecified	Q8WY54	PPM1E_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.76e-11)		4	955	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		285			PP2C-like.		Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	37	c.828G>T	CCDS11613.1																																																																																				0.493	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906		23	50	1	0	5.35356e-11	0.00278	7.94729e-11	23	50				
SOX9	6662	broad.mit.edu	37	17	70117637	70117637	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:70117637C>A	ENST00000245479.2	+	1	477	c.105C>A	c.(103-105)tgC>tgA	p.C35*		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	35					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCTCGCCCTGCCCGTCGGGCT	0.672																																					Pancreas(42;83 1041 2320 35205 39456)	Pancreas(42;83 1041 2320 35205 39456)	uc002jiw.2		NA																	0					0						c.(103-105)TGC>TGA		transcription factor SOX9							13.0	14.0	14.0					17																	70117637		2196	4287	6483	SO:0001587	stop_gained	6662				cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr17:70117637C>A	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.105C>A	17.37:g.70117637C>A	ENSP00000245479:p.Cys35*		Somatic				uc002jiv.2_5'Flank	p.C35*	NM_000346	NP_000337	WXS	Illumina HiSeq	Unspecified	P48436	SOX9_HUMAN	STAD - Stomach adenocarcinoma(260;0.119)		1	477	+		Colorectal(1115;0.245)	35					Q53Y80	Nonsense_Mutation	SNP	ENST00000245479.2	37	c.105C>A	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	C	40	8.097686	0.98651	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	.	.	.	4.39	2.32	0.28847	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	10.9581	0.47368	0.0:0.8577:0.0:0.1423	.	.	.	.	X	35	.	ENSP00000245479:C35X	C	+	3	2	SOX9	67629232	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	2.021000	0.41020	0.290000	0.22444	0.491000	0.48974	TGC		0.672	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346		4	16	1	0	0.00909568	0.009096	0.00963801	4	16				
SDK2	54549	broad.mit.edu	37	17	71334933	71334933	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:71334933C>A	ENST00000392650.3	-	45	6312	c.6312G>T	c.(6310-6312)gaG>gaT	p.E2104D	SDK2_ENST00000388726.3_Missense_Mutation_p.E2085D|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	2104					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CCGAGTCGCTCTCCGTGTAGC	0.617																																							uc010dfm.2		NA																	0				ovary(2)	2						c.(6310-6312)GAG>GAT		sidekick 2							171.0	134.0	147.0					17																	71334933		2203	4300	6503	SO:0001583	missense	54549				cell adhesion	integral to membrane		g.chr17:71334933C>A	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.6312G>T	17.37:g.71334933C>A	ENSP00000376421:p.Glu2104Asp		Somatic				SDK2_uc002jjt.3_Missense_Mutation_p.E1244D	p.E2104D	NM_001144952	NP_001138424	WXS	Illumina HiSeq	Unspecified	Q58EX2	SDK2_HUMAN			45	6312	-			2104			Cytoplasmic (Potential).		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	c.6312G>T	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609203	0.87258	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.57752	0.42;0.38;1.62	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.55924	0.1951	L	0.40543	1.245	0.58432	D	0.999998	B;P	0.52170	0.079;0.951	B;P	0.57548	0.08;0.823	T	0.49826	-0.8898	10	0.06494	T	0.89	.	17.3033	0.87188	0.0:1.0:0.0:0.0	.	2104;2085	Q58EX2;Q58EX2-3	SDK2_HUMAN;.	D	1728;2104;2085;1261;2104;445	ENSP00000376421:E2104D;ENSP00000373378:E2085D;ENSP00000407098:E1261D	ENSP00000324967:E2104D	E	-	3	2	SDK2	68846528	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	5.906000	0.69900	2.168000	0.68352	0.650000	0.86243	GAG		0.617	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		12	33	1	0	3.07112e-06	0.010729	3.79015e-06	12	33				
KIF19	124602	broad.mit.edu	37	17	72346894	72346894	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:72346894G>A	ENST00000389916.4	+	12	1575	c.1437G>A	c.(1435-1437)caG>caA	p.Q479Q		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	479					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GGGAGGAGCAGCGAAAGGAGT	0.652																																							uc002jkm.3		NA																	0					0						c.(1435-1437)CAG>CAA		kinesin family member 19							86.0	78.0	81.0					17																	72346894		2203	4300	6503	SO:0001819	synonymous_variant	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72346894G>A	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1437G>A	17.37:g.72346894G>A			Somatic				KIF19_uc002jkj.2_Silent_p.Q479Q|KIF19_uc002jkk.2_Silent_p.Q437Q|KIF19_uc002jkl.2_Silent_p.Q437Q	p.Q479Q	NM_153209	NP_694941	WXS	Illumina HiSeq	Unspecified	Q2TAC6	KIF19_HUMAN			12	1575	+			479					A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	ENST00000389916.4	37	c.1437G>A	CCDS32718.2																																																																																				0.652	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		38	90	0	0	0	0.013114	0	38	90				
BTBD17	388419	broad.mit.edu	37	17	72356255	72356255	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:72356255G>T	ENST00000375366.3	-	2	341	c.215C>A	c.(214-216)gCg>gAg	p.A72E		NM_001080466.1	NP_001073935.1	A6NE02	BTBDH_HUMAN	BTB (POZ) domain containing 17	72	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|lung(4)	6						ATCGGTGCCCGCAGCCTGCAC	0.662																																							uc002jkn.2		NA																	0					0						c.(214-216)GCG>GAG		BTB (POZ) domain containing 17 precursor							34.0	34.0	34.0					17																	72356255		2203	4300	6503	SO:0001583	missense	388419					extracellular region		g.chr17:72356255G>T		CCDS32719.1	17q25.1	2013-01-08			ENSG00000204347	ENSG00000204347		"""BTB/POZ domain containing"""	33758	protein-coding gene	gene with protein product	"""transport and golgi organization 10 homolog A (Drosophila)"""						Standard	NM_001080466		Approved	LGALS3BPL, BTBD17A, TANGO10A	uc002jkn.2	A6NE02	OTTHUMG00000178580	ENST00000375366.3:c.215C>A	17.37:g.72356255G>T	ENSP00000364515:p.Ala72Glu		Somatic					p.A72E	NM_001080466	NP_001073935	WXS	Illumina HiSeq	Unspecified	A6NE02	BTBDH_HUMAN			2	215	-			72			BTB.			Missense_Mutation	SNP	ENST00000375366.3	37	c.215C>A	CCDS32719.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946393	0.34377	.	.	ENSG00000204347	ENST00000375366	T	0.77098	-1.07	5.26	-1.97	0.07503	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.516529	0.21166	N	0.079073	T	0.60287	0.2257	L	0.44542	1.39	0.09310	N	1	B	0.25609	0.13	B	0.32211	0.142	T	0.50964	-0.8765	10	0.02654	T	1	-1.9236	5.1677	0.15094	0.3658:0.0:0.5078:0.1264	.	72	A6NE02	BTBDH_HUMAN	E	72	ENSP00000364515:A72E	ENSP00000364515:A72E	A	-	2	0	BTBD17	69867850	0.000000	0.05858	0.005000	0.12908	0.743000	0.42351	0.391000	0.20784	-0.266000	0.09339	-0.347000	0.07816	GCG		0.662	BTBD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442542.1	NM_001080466		12	30	1	0	2.27111e-07	0.001368	2.96771e-07	12	30				
GGA3	23163	broad.mit.edu	37	17	73240717	73240717	+	Missense_Mutation	SNP	T	T	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:73240717T>G	ENST00000245541.6	-	4	499	c.283A>C	c.(283-285)Aaa>Caa	p.K95Q	GGA3_ENST00000582717.1_Missense_Mutation_p.K23Q|GGA3_ENST00000537686.1_Missense_Mutation_p.K95Q|GGA3_ENST00000578348.1_Intron|GGA3_ENST00000579743.1_5'UTR|GGA3_ENST00000582486.1_Missense_Mutation_p.K23Q|GGA3_ENST00000538886.1_Intron|GGA3_ENST00000351904.7_Intron	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	95	Binds to ARF1 (in long isoform).|VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			GAGACGACTTTGATTAACTCA	0.488																																							uc002jni.1		NA																	0				ovary(1)|breast(1)	2						c.(283-285)AAA>CAA		ADP-ribosylation factor binding protein 3							205.0	199.0	201.0					17																	73240717		2203	4300	6503	SO:0001583	missense	23163				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding	g.chr17:73240717T>G	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.283A>C	17.37:g.73240717T>G	ENSP00000245541:p.Lys95Gln		Somatic				GGA3_uc002jnj.1_Intron|GGA3_uc010wrw.1_Intron|GGA3_uc002jnk.1_Missense_Mutation_p.K23Q|GGA3_uc010wrx.1_Intron|GGA3_uc010wry.1_Missense_Mutation_p.K23Q|GGA3_uc010wrz.1_Intron	p.K95Q	NM_138619	NP_619525	WXS	Illumina HiSeq	Unspecified	Q9NZ52	GGA3_HUMAN	all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)		4	292	-			95			VHS.|Binds to ARF1 (in long isoform).		B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	ENST00000245541.6	37	c.283A>C	CCDS11717.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.872940	0.51695	.	.	ENSG00000125447	ENST00000245541;ENST00000537584;ENST00000537686	T;T	0.23552	1.9;1.9	5.12	5.12	0.69794	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.58736	0.2143	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68387	-0.5422	10	0.72032	D	0.01	-24.5582	15.095	0.72226	0.0:0.0:0.0:1.0	.	95	Q9NZ52	GGA3_HUMAN	Q	95;23;95	ENSP00000245541:K95Q;ENSP00000438085:K95Q	ENSP00000245541:K95Q	K	-	1	0	GGA3	70752312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.838000	0.86804	2.149000	0.67028	0.533000	0.62120	AAA		0.488	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619		69	187	0	0	0	0.00361	0	69	187				
MGAT5B	146664	broad.mit.edu	37	17	74921063	74921063	+	Silent	SNP	G	G	A	rs114240204	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:74921063G>A	ENST00000569840.2	+	9	1615	c.1041G>A	c.(1039-1041)ccG>ccA	p.P347P	MGAT5B_ENST00000301618.4_Silent_p.P347P|MGAT5B_ENST00000428789.2_Silent_p.P358P	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	347					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TAGGGGTACCGCCAGGCCGGG	0.607													G|||	7	0.00139776	0.0038	0.0	5008	,	,		11217	0.0		0.002	False		,,,				2504	0.0						uc002jti.2		NA																	0				ovary(2)|skin(1)	3						c.(1072-1074)CCG>CCA		N-acetylglucosaminyltranferase VB isoform 2		G	,,	12,4394	19.1+/-41.9	0,12,2191	79.0	84.0	82.0		1041,1041,1074	3.2	1.0	17	dbSNP_133	82	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	MGAT5B	NM_001199172.1,NM_144677.2,NM_198955.1	,,	0,18,6485	AA,AG,GG		0.0698,0.2724,0.1384	,,	347/793,347/791,358/802	74921063	18,12988	2203	4300	6503	SO:0001819	synonymous_variant	146664					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr17:74921063G>A	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1041G>A	17.37:g.74921063G>A			Somatic				MGAT5B_uc002jth.2_Silent_p.P347P	p.P358P	NM_198955	NP_945193	WXS	Illumina HiSeq	Unspecified	Q3V5L5	MGT5B_HUMAN			8	1177	+			347			Lumenal (Potential).		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Silent	SNP	ENST00000569840.2	37	c.1074G>A	CCDS59299.1																																																																																				0.607	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677		15	112	0	0	0	0.004007	0	15	112				
CBX2	84733	broad.mit.edu	37	17	77758716	77758716	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:77758716G>T	ENST00000310942.4	+	5	1578	c.1474G>T	c.(1474-1476)Gac>Tac	p.D492Y		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	492					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GACCAGCCAGGACTGGAAGCC	0.637																																							uc002jxc.2		NA																	0					0						c.(1474-1476)GAC>TAC		chromobox homolog 2 isoform 1							68.0	61.0	64.0					17																	77758716		2203	4300	6503	SO:0001583	missense	84733				cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	g.chr17:77758716G>T	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.1474G>T	17.37:g.77758716G>T	ENSP00000308750:p.Asp492Tyr		Somatic					p.D492Y	NM_005189	NP_005180	WXS	Illumina HiSeq	Unspecified	Q14781	CBX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	1516	+			492					Q0VDA5|Q9BTB1	Missense_Mutation	SNP	ENST00000310942.4	37	c.1474G>T	CCDS32757.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384036	0.82792	.	.	ENSG00000173894	ENST00000310942	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	T	0.73969	0.3655	L	0.41415	1.275	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.76127	-0.3073	8	0.87932	D	0	-3.0112	19.3216	0.94243	0.0:0.0:1.0:0.0	.	492	Q14781	CBX2_HUMAN	Y	492	.	ENSP00000308750:D492Y	D	+	1	0	CBX2	75373311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.439000	0.97543	2.573000	0.86826	0.655000	0.94253	GAC		0.637	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1	NM_032647		18	37	1	0	2.37509e-13	0.010504	3.78797e-13	18	37				
RPTOR	57521	broad.mit.edu	37	17	78931471	78931471	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:78931471A>T	ENST00000306801.3	+	29	3780	c.3418A>T	c.(3418-3420)Agc>Tgc	p.S1140C	RPTOR_ENST00000544334.2_Missense_Mutation_p.S982C|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1140					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CCTCCTCATGAGCTCAGGAGA	0.632																																							uc002jyt.1		NA																	0				lung(4)|urinary_tract(1)|ovary(1)	6						c.(3418-3420)AGC>TGC		raptor isoform 1							156.0	135.0	142.0					17																	78931471		2203	4300	6503	SO:0001583	missense	57521				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding	g.chr17:78931471A>T		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3418A>T	17.37:g.78931471A>T	ENSP00000307272:p.Ser1140Cys		Somatic				RPTOR_uc010wug.1_Missense_Mutation_p.S982C|RPTOR_uc002jyu.1_Missense_Mutation_p.S33C	p.S1140C	NM_020761	NP_065812	WXS	Illumina HiSeq	Unspecified	Q8N122	RPTOR_HUMAN			29	4223	+			1140			WD 3.		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	c.3418A>T	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.983166	0.74474	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.39056	1.1;1.1	5.19	5.19	0.71726	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.050537	0.85682	D	0.000000	T	0.39911	0.1096	L	0.41492	1.28	0.80722	D	1	B;B	0.31351	0.32;0.0	B;B	0.37239	0.244;0.001	T	0.24584	-1.0156	10	0.36615	T	0.2	.	15.0421	0.71799	1.0:0.0:0.0:0.0	.	982;1140	F5H7J5;Q8N122	.;RPTOR_HUMAN	C	1140;982	ENSP00000307272:S1140C;ENSP00000442479:S982C	ENSP00000307272:S1140C	S	+	1	0	RPTOR	76546066	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.961000	0.76042	1.958000	0.56883	0.533000	0.62120	AGC		0.632	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761		23	125	0	0	0	0.00278	0	23	125				
SLC38A10	124565	broad.mit.edu	37	17	79219556	79219556	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr17:79219556G>A	ENST00000374759.3	-	16	3543	c.3160C>T	c.(3160-3162)Cgg>Tgg	p.R1054W		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	1054					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCAAGGTCCCGCCGTCGCCTC	0.672																																							uc002jzz.1		NA																	0				pancreas(1)|skin(1)	2						c.(3160-3162)CGG>TGG		solute carrier family 38, member 10 isoform a							20.0	25.0	23.0					17																	79219556		1994	4125	6119	SO:0001583	missense	124565				amino acid transport|sodium ion transport	integral to membrane		g.chr17:79219556G>A	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.3160C>T	17.37:g.79219556G>A	ENSP00000363891:p.Arg1054Trp		Somatic				SLC38A10_uc002jzy.1_Missense_Mutation_p.R972W	p.R1054W	NM_001037984	NP_001033073	WXS	Illumina HiSeq	Unspecified	Q9HBR0	S38AA_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		16	3535	-	all_neural(118;0.0804)|Melanoma(429;0.242)		1054					Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	ENST00000374759.3	37	c.3160C>T	CCDS42397.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345554	0.61073	.	.	ENSG00000157637	ENST00000374759	T	0.30448	1.53	4.63	3.67	0.42095	.	0.815625	0.09576	U	0.783474	T	0.50973	0.1647	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40289	-0.9571	10	0.87932	D	0	-28.7953	7.8842	0.29640	0.0815:0.0:0.7593:0.1591	.	1054	Q9HBR0	S38AA_HUMAN	W	1054	ENSP00000363891:R1054W	ENSP00000363891:R1054W	R	-	1	2	SLC38A10	76834151	0.999000	0.42202	0.983000	0.44433	0.597000	0.36814	3.205000	0.51090	1.178000	0.42870	0.655000	0.94253	CGG		0.672	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570		17	41	0	0	0	0.004007	0	17	41				
ANKRD12	23253	broad.mit.edu	37	18	9255152	9255152	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:9255152T>C	ENST00000262126.4	+	9	2127	c.1887T>C	c.(1885-1887)caT>caC	p.H629H	ANKRD12_ENST00000400020.3_Silent_p.H606H|ANKRD12_ENST00000383440.2_Silent_p.H606H	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	629						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ATGAAGATCATAGTCCAACAT	0.289																																							uc002knv.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1885-1887)CAT>CAC		ankyrin repeat domain 12 isoform 1							36.0	39.0	38.0					18																	9255152		2202	4290	6492	SO:0001819	synonymous_variant	23253					nucleus		g.chr18:9255152T>C	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1887T>C	18.37:g.9255152T>C			Somatic				ANKRD12_uc002knw.2_Silent_p.H606H|ANKRD12_uc002knx.2_Silent_p.H606H|ANKRD12_uc010dkx.1_Silent_p.H336H	p.H629H	NM_015208	NP_056023	WXS	Illumina HiSeq	Unspecified	Q6UB98	ANR12_HUMAN			9	2144	+			629					O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	c.1887T>C	CCDS11843.1																																																																																				0.289	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		5	63	0	0	0	0.001168	0	5	63				
MPPE1	65258	broad.mit.edu	37	18	11885721	11885721	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:11885721A>C	ENST00000588072.1	-	10	2183	c.962T>G	c.(961-963)gTc>gGc	p.V321G	MPPE1_ENST00000344987.7_Missense_Mutation_p.V299G|MPPE1_ENST00000399978.2_Missense_Mutation_p.V322G|MPPE1_ENST00000317235.7_Missense_Mutation_p.V258G|MPPE1_ENST00000592755.1_5'Flank|MPPE1_ENST00000309976.9_Missense_Mutation_p.V258G	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	321					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GAAAGATGGGACGCTGAGCTC	0.527																																							uc002kqf.2		NA																	0					0						c.(961-963)GTC>GGC		metallophosphoesterase 1 precursor							55.0	55.0	55.0					18																	11885721		2203	4300	6503	SO:0001583	missense	65258				ER to Golgi vesicle-mediated transport|GPI anchor biosynthetic process	cis-Golgi network|endoplasmic reticulum exit site|ER-Golgi intermediate compartment membrane|integral to membrane	GPI anchor binding|manganese ion binding|phosphoric diester hydrolase activity	g.chr18:11885721A>C	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.962T>G	18.37:g.11885721A>C	ENSP00000465894:p.Val321Gly		Somatic				MPPE1_uc002kqn.2_Missense_Mutation_p.V258G|MPPE1_uc002kqg.2_RNA|MPPE1_uc002kqh.2_RNA|MPPE1_uc002kqi.2_RNA|MPPE1_uc002kqj.2_Missense_Mutation_p.V322G|MPPE1_uc002kqk.2_Missense_Mutation_p.V299G|MPPE1_uc002kql.2_Missense_Mutation_p.V322G|MPPE1_uc002kqm.2_Missense_Mutation_p.V258G	p.V321G	NM_023075	NP_075563	WXS	Illumina HiSeq	Unspecified	Q53F39	MPPE1_HUMAN			10	1603	-			321					B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Missense_Mutation	SNP	ENST00000588072.1	37	c.962T>G	CCDS11853.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.854263	0.71719	.	.	ENSG00000154889	ENST00000317235;ENST00000309976;ENST00000317251;ENST00000344987;ENST00000399978	T;T;T	0.17528	2.27;2.27;2.27	5.63	5.63	0.86233	Calcineurin-like phosphoesterase superfamily domain (1);	0.107462	0.64402	D	0.000006	T	0.47581	0.1453	M	0.86502	2.82	0.80722	D	1	D;D;D;D	0.61697	0.966;0.99;0.988;0.983	P;D;D;D	0.69654	0.806;0.95;0.917;0.965	T	0.55192	-0.8179	10	0.66056	D	0.02	-5.3761	15.8568	0.78983	1.0:0.0:0.0:0.0	.	258;224;321;321	Q53F39-4;B3KNP1;Q53F39-2;Q53F39	.;.;.;MPPE1_HUMAN	G	258;321;224;322;322	ENSP00000327257:V258G;ENSP00000312935:V224G;ENSP00000382860:V322G	ENSP00000311200:V321G	V	-	2	0	MPPE1	11875721	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	8.703000	0.91344	2.152000	0.67230	0.528000	0.53228	GTC		0.527	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075		5	41	0	0	0	0.00308	0	5	41				
RIOK3	8780	broad.mit.edu	37	18	21057143	21057143	+	Splice_Site	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:21057143G>T	ENST00000339486.3	+	11	1872	c.1255G>T	c.(1255-1257)Gtc>Ttc	p.V419F	RIOK3_ENST00000581585.1_Splice_Site_p.V403F|RIOK3_ENST00000577501.1_Splice_Site_p.V419F	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	419	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATTGAAATAGGTCTGGTTGAT	0.413																																							uc002kui.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1255-1257)GTC>TTC		sudD suppressor of bimD6 homolog							155.0	132.0	140.0					18																	21057143		2203	4300	6503	SO:0001630	splice_region_variant	8780				chromosome segregation		ATP binding|protein binding|protein serine/threonine kinase activity	g.chr18:21057143G>T	AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.1255-1G>T	18.37:g.21057143G>T			Somatic				RIOK3_uc010dls.2_Missense_Mutation_p.V419F|RIOK3_uc010xas.1_Missense_Mutation_p.V403F|RIOK3_uc010xat.1_Missense_Mutation_p.V163F	p.V419F	NM_003831	NP_003822	WXS	Illumina HiSeq	Unspecified	O14730	RIOK3_HUMAN			11	1872	+	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)		419			Protein kinase.		Q8IXN9	Missense_Mutation	SNP	ENST00000339486.3	37	c.1255G>T	CCDS11877.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954100	0.92726	.	.	ENSG00000101782	ENST00000339486	T	0.10192	2.9	5.96	5.09	0.68999	RIO kinase (1);Protein kinase-like domain (1);RIO-like kinase (1);	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	M	0.80746	2.51	0.80722	D	1	D;D;D;D	0.67145	0.993;0.992;0.995;0.996	D;D;D;D	0.70487	0.969;0.945;0.938;0.963	T	0.15037	-1.0451	9	.	.	.	-13.4371	15.3456	0.74334	0.0668:0.0:0.9332:0.0	.	163;403;419;419	E7ESK5;B4E1Q4;O14730-2;O14730	.;.;.;RIOK3_HUMAN	F	419	ENSP00000341874:V419F	.	V	+	1	0	RIOK3	19311141	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.720000	0.84759	1.546000	0.49388	0.632000	0.83419	GTC		0.413	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254756.1	NM_003831	Missense_Mutation	20	49	1	0	1.28384e-07	0.012319	1.68826e-07	20	49				
LAMA3	3909	broad.mit.edu	37	18	21485527	21485527	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:21485527G>T	ENST00000313654.9	+	52	6898	c.6657G>T	c.(6655-6657)ctG>ctT	p.L2219L	LAMA3_ENST00000399516.3_Silent_p.L2163L|LAMA3_ENST00000587184.1_Silent_p.L554L|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Silent_p.L610L	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2219	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTAAAACCCTGAGTTCCAACA	0.393																																							uc002kuq.2		NA																	0				ovary(8)|skin(2)|central_nervous_system(1)	11						c.(6655-6657)CTG>CTT		laminin alpha 3 subunit isoform 1	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						125.0	119.0	121.0					18																	21485527		2203	4300	6503	SO:0001819	synonymous_variant	3909				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr18:21485527G>T	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.6657G>T	18.37:g.21485527G>T			Somatic				LAMA3_uc002kur.2_Silent_p.L2163L|LAMA3_uc002kus.3_Silent_p.L610L|LAMA3_uc002kut.3_Silent_p.L554L	p.L2219L	NM_198129	NP_937762	WXS	Illumina HiSeq	Unspecified	Q16787	LAMA3_HUMAN			52	6743	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		2219			Domain II and I.		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	c.6657G>T	CCDS42419.1																																																																																				0.393	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		27	50	1	0	3.65163e-15	0.00632	6.0247e-15	27	50				
LAMA3	3909	broad.mit.edu	37	18	21512237	21512237	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:21512237G>A	ENST00000313654.9	+	66	8931	c.8690G>A	c.(8689-8691)aGc>aAc	p.S2897N	LAMA3_ENST00000399516.3_Missense_Mutation_p.S2841N|LAMA3_ENST00000587184.1_Missense_Mutation_p.S1232N|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.S1288N	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2897	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GGTTGTATTAGCAATGTTTTT	0.468																																							uc002kuq.2		NA																	0				ovary(8)|skin(2)|central_nervous_system(1)	11						c.(8689-8691)AGC>AAC		laminin alpha 3 subunit isoform 1	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						154.0	134.0	141.0					18																	21512237		2203	4300	6503	SO:0001583	missense	3909				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr18:21512237G>A	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8690G>A	18.37:g.21512237G>A	ENSP00000324532:p.Ser2897Asn		Somatic				LAMA3_uc002kur.2_Missense_Mutation_p.S2841N|LAMA3_uc002kus.3_Missense_Mutation_p.S1288N|LAMA3_uc002kut.3_Missense_Mutation_p.S1232N	p.S2897N	NM_198129	NP_937762	WXS	Illumina HiSeq	Unspecified	Q16787	LAMA3_HUMAN			66	8776	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		2897			Laminin G-like 3.		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	c.8690G>A	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896731	0.72639	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.79247	-1.25;-1.25;-1.25	5.91	4.14	0.48551	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.82857	0.5128	M	0.83774	2.66	0.42758	D	0.993794	P;P;D;D	0.60575	0.896;0.916;0.988;0.978	P;P;P;P	0.60286	0.519;0.6;0.872;0.784	T	0.79855	-0.1627	9	0.28530	T	0.3	.	3.4529	0.07505	0.103:0.3072:0.464:0.1259	.	1232;1288;2841;2897	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	N	2897;2841;1288	ENSP00000324532:S2897N;ENSP00000382432:S2841N;ENSP00000269217:S1288N	ENSP00000269217:S1288N	S	+	2	0	LAMA3	19766235	0.989000	0.36119	0.994000	0.49952	0.973000	0.67179	1.197000	0.32211	0.848000	0.35191	0.655000	0.94253	AGC		0.468	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		33	73	0	0	0	0.003271	0	33	73				
TTC39C	125488	broad.mit.edu	37	18	21698196	21698196	+	Splice_Site	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:21698196G>T	ENST00000317571.3	+	8	1422	c.1186G>T	c.(1186-1188)Gtt>Ttt	p.V396F	TTC39C_ENST00000540918.2_Splice_Site_p.V89F|RP11-799B12.2_ENST00000583782.1_RNA|TTC39C_ENST00000304621.6_Splice_Site_p.V335F	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	396										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						CTTGACTGCAGGTGAGTCGCC	0.493																																							uc002kuw.2		NA																	0				ovary(1)	1						c.(1186-1188)GTT>TTT		tetratricopeptide repeat domain 39C isoform 1							101.0	89.0	93.0					18																	21698196		2203	4300	6503	SO:0001630	splice_region_variant	125488						binding	g.chr18:21698196G>T	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.1186+1G>T	18.37:g.21698196G>T			Somatic				TTC39C_uc002kuu.2_Missense_Mutation_p.V335F	p.V396F	NM_001135993	NP_001129465	WXS	Illumina HiSeq	Unspecified	Q8N584	TT39C_HUMAN			8	1638	+			396					B7WP63|J3QRR1|Q0VAJ2|Q8N284	Missense_Mutation	SNP	ENST00000317571.3	37	c.1186G>T	CCDS45839.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.962000	0.53400	.	.	ENSG00000168234	ENST00000304621;ENST00000317571;ENST00000540918	T;T;T	0.47177	0.85;0.85;0.85	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.68760	0.3036	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.71269	-0.4643	10	0.66056	D	0.02	-1.2893	18.0387	0.89313	0.0:0.0:1.0:0.0	.	396	Q8N584	TT39C_HUMAN	F	335;396;89	ENSP00000306598:V335F;ENSP00000323645:V396F;ENSP00000443016:V89F	ENSP00000306598:V335F	V	+	1	0	TTC39C	19952194	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.343000	0.79319	2.544000	0.85801	0.655000	0.94253	GTT		0.493	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1	NM_153211	Missense_Mutation	5	45	1	0	0.000602214	0.000602	0.000670085	5	45				
DSC2	1824	broad.mit.edu	37	18	28648987	28648987	+	Missense_Mutation	SNP	G	G	A	rs1617629		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:28648987G>A	ENST00000280904.6	-	15	2824	c.2381C>T	c.(2380-2382)tCg>tTg	p.S794L	DSC2_ENST00000251081.6_Missense_Mutation_p.S794L	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	794					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GCAGGATTCCGAGGTCTGGTG	0.592																																							uc002kwl.3		NA																	0				ovary(2)|skin(1)	3						c.(2380-2382)TCG>TTG		desmocollin 2 isoform Dsc2a preproprotein		G	LEU/SER,LEU/SER	0,4406		0,0,2203	84.0	75.0	78.0		2381,2381	4.3	0.9	18	dbSNP_89	78	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DSC2	NM_004949.3,NM_024422.3	145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	794/848,794/902	28648987	1,13005	2203	4300	6503	SO:0001583	missense	1824				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28648987G>A	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2381C>T	18.37:g.28648987G>A	ENSP00000280904:p.Ser794Leu		Somatic				DSC2_uc002kwk.3_Missense_Mutation_p.S794L	p.S794L	NM_024422	NP_077740	WXS	Illumina HiSeq	Unspecified	Q02487	DSC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0241)		15	2835	-			794			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000280904.6	37	c.2381C>T	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	G	0.122	-1.124104	0.01770	0.0	1.16E-4	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.76709	0.54;-1.04	5.46	4.3	0.51218	Cadherin, cytoplasmic domain (1);	0.398358	0.14773	N	0.299252	T	0.32585	0.0834	N	0.00034	-2.555	0.21147	N	0.99977	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35847	-0.9772	10	0.02654	T	1	.	11.4427	0.50107	0.929:0.0:0.071:0.0	rs1617629	794;794	Q02487;Q02487-2	DSC2_HUMAN;.	L	794;794;560;807	ENSP00000251081:S794L;ENSP00000280904:S794L	ENSP00000251081:S794L	S	-	2	0	DSC2	26902985	0.981000	0.34729	0.933000	0.37362	0.013000	0.08279	4.341000	0.59335	1.022000	0.39626	-0.487000	0.04747	TCG		0.592	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949		11	62	0	0	0	0.008291	0	11	62				
MOCOS	55034	broad.mit.edu	37	18	33775249	33775249	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:33775249A>T	ENST00000261326.5	+	2	193	c.172A>T	c.(172-174)Acc>Tcc	p.T58S		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGCAGGTGCCACCTTGTTCTC	0.388																																							uc002kzq.3		NA																	0				skin(1)	1						c.(172-174)ACC>TCC		molybdenum cofactor sulfurase	Pyridoxal Phosphate(DB00114)						150.0	153.0	152.0					18																	33775249		2203	4300	6503	SO:0001583	missense	55034				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding	g.chr18:33775249A>T	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.172A>T	18.37:g.33775249A>T	ENSP00000261326:p.Thr58Ser		Somatic					p.T58S	NM_017947	NP_060417	WXS	Illumina HiSeq	Unspecified	Q96EN8	MOCOS_HUMAN			2	195	+			58						Missense_Mutation	SNP	ENST00000261326.5	37	c.172A>T	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.854691	0.91355	.	.	ENSG00000075643	ENST00000261326	D	0.87809	-2.3	5.41	5.41	0.78517	Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.90841	0.7123	M	0.67517	2.055	0.44762	D	0.997769	D	0.56521	0.976	P	0.61070	0.883	D	0.90801	0.4694	10	0.49607	T	0.09	-22.4309	11.855	0.52431	1.0:0.0:0.0:0.0	.	58	Q96EN8	MOCOS_HUMAN	S	58	ENSP00000261326:T58S	ENSP00000261326:T58S	T	+	1	0	MOCOS	32029247	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	4.999000	0.63934	2.053000	0.61076	0.460000	0.39030	ACC		0.388	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			56	87	0	0	0	0.00361	0	56	87				
RIT2	6014	broad.mit.edu	37	18	40503541	40503541	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:40503541C>T	ENST00000326695.5	-	4	593	c.422G>A	c.(421-423)cGc>cAc	p.R141H	RIT2_ENST00000589109.1_Missense_Mutation_p.R141H|RIT2_ENST00000590910.1_Missense_Mutation_p.A162T|RIT2_ENST00000282028.4_Missense_Mutation_p.R141H	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	141					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACTCACCTGGCGGAACTGTTC	0.458																																							uc002lav.2		NA																	0				ovary(1)	1						c.(421-423)CGC>CAC		Ras-like without CAAX 2							158.0	159.0	159.0					18																	40503541		2203	4300	6503	SO:0001583	missense	6014				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity	g.chr18:40503541C>T	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.422G>A	18.37:g.40503541C>T	ENSP00000321805:p.Arg141His		Somatic				RIT2_uc010dnf.2_Missense_Mutation_p.R141H	p.R141H	NM_002930	NP_002921	WXS	Illumina HiSeq	Unspecified	Q99578	RIT2_HUMAN			4	595	-			141					B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	ENST00000326695.5	37	c.422G>A	CCDS11921.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154975	0.78114	.	.	ENSG00000152214	ENST00000326695;ENST00000282028	T;T	0.80304	-1.36;-1.36	5.23	3.45	0.39498	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000010	D	0.91774	0.7398	H	0.95187	3.635	0.28806	N	0.898529	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.87239	0.2265	10	0.87932	D	0	.	11.5506	0.50719	0.0:0.8548:0.0:0.1452	.	141;141	Q99578-2;Q99578	.;RIT2_HUMAN	H	141	ENSP00000321805:R141H;ENSP00000282028:R141H	ENSP00000282028:R141H	R	-	2	0	RIT2	38757539	0.998000	0.40836	0.983000	0.44433	0.991000	0.79684	3.726000	0.54977	0.714000	0.32081	0.655000	0.94253	CGC		0.458	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930		24	191	0	0	0	0.003954	0	24	191				
SETBP1	26040	broad.mit.edu	37	18	42530368	42530368	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:42530368G>T	ENST00000282030.5	+	4	1359	c.1063G>T	c.(1063-1065)Gtc>Ttc	p.V355F		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	355						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCTGGATTGGGTCAAGAATGC	0.488									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(1063-1065)GTC>TTC		SET binding protein 1 isoform a							77.0	78.0	78.0					18																	42530368		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42530368G>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1063G>T	18.37:g.42530368G>T	ENSP00000282030:p.Val355Phe		Somatic					p.V355F	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	1359	+			355					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.1063G>T	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602901	0.46423	.	.	ENSG00000152217	ENST00000282030	T	0.37058	1.22	5.78	4.9	0.64082	.	0.132655	0.49916	D	0.000130	T	0.31327	0.0793	L	0.29908	0.895	0.37509	D	0.917052	B	0.34200	0.441	B	0.38428	0.273	T	0.20605	-1.0270	10	0.27082	T	0.32	.	15.4443	0.75216	0.0675:0.0:0.9325:0.0	.	355	Q9Y6X0	SETBP_HUMAN	F	355	ENSP00000282030:V355F	ENSP00000282030:V355F	V	+	1	0	SETBP1	40784366	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.990000	0.56965	1.562000	0.49601	0.655000	0.94253	GTC		0.488	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		16	82	1	0	5.01169e-05	0.00499	5.84854e-05	16	82				
ALPK2	115701	broad.mit.edu	37	18	56203989	56203989	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:56203989G>T	ENST00000361673.3	-	5	3643	c.3430C>A	c.(3430-3432)Cag>Aag	p.Q1144K	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1144						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GAACCCTGCTGGGACAGGCTC	0.522																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(3430-3432)CAG>AAG		heart alpha-kinase							116.0	122.0	120.0					18																	56203989		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56203989G>T	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3430C>A	18.37:g.56203989G>T	ENSP00000354991:p.Gln1144Lys		Somatic				ALPK2_uc002lhk.1_Missense_Mutation_p.Q475K	p.Q1144K	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			5	3644	-			1144					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.3430C>A	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327809	0.24080	.	.	ENSG00000198796	ENST00000361673	T	0.42131	0.98	5.21	-1.02	0.10135	.	2.911760	0.00738	N	0.000990	T	0.27832	0.0685	N	0.24115	0.695	0.09310	N	1	B;B	0.13594	0.008;0.005	B;B	0.16289	0.015;0.007	T	0.08186	-1.0734	10	0.18710	T	0.47	19.9793	5.6006	0.17351	0.3991:0.1304:0.4706:0.0	.	1139;1144	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	K	1144	ENSP00000354991:Q1144K	ENSP00000354991:Q1144K	Q	-	1	0	ALPK2	54354969	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.244000	0.18124	-0.254000	0.09500	-0.175000	0.13238	CAG		0.522	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		12	201	1	0	1.08611e-07	0.010729	1.43736e-07	12	201				
CDH20	28316	broad.mit.edu	37	18	59217383	59217383	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:59217383C>A	ENST00000262717.4	+	11	2219	c.1821C>A	c.(1819-1821)agC>agA	p.S607R	CDH20_ENST00000538374.1_Missense_Mutation_p.S607R|CDH20_ENST00000536675.2_Missense_Mutation_p.S607R			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	607	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TGTCCTGCAGCCCAGAGGCCT	0.597																																							uc010dps.1		NA																	0				breast(3)|ovary(1)|pancreas(1)	5						c.(1819-1821)AGC>AGA		cadherin 20, type 2 preproprotein							74.0	54.0	61.0					18																	59217383		2203	4300	6503	SO:0001583	missense	28316				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:59217383C>A	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1821C>A	18.37:g.59217383C>A	ENSP00000262717:p.Ser607Arg		Somatic				CDH20_uc002lif.2_Missense_Mutation_p.S601R	p.S607R	NM_031891	NP_114097	WXS	Illumina HiSeq	Unspecified	Q9HBT6	CAD20_HUMAN			10	1833	+		Colorectal(73;0.186)	607			Cadherin 5.|Extracellular (Potential).		Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	c.1821C>A	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148036	0.37923	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.38077	1.16;1.16;1.16	5.93	2.68	0.31781	Cadherin (1);	0.137167	0.64402	D	0.000005	T	0.17450	0.0419	N	0.05230	-0.09	0.35542	D	0.803159	B	0.06786	0.001	B	0.11329	0.006	T	0.09773	-1.0659	10	0.39692	T	0.17	.	9.4682	0.38826	0.0:0.5917:0.0:0.4083	.	607	Q9HBT6	CAD20_HUMAN	R	607	ENSP00000444767:S607R;ENSP00000442226:S607R;ENSP00000262717:S607R	ENSP00000262717:S607R	S	+	3	2	CDH20	57368363	0.986000	0.35501	0.999000	0.59377	0.996000	0.88848	0.291000	0.18994	0.817000	0.34445	0.655000	0.94253	AGC		0.597	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891		23	42	1	0	3.62473e-10	0.012319	5.26772e-10	23	42				
SERPINB12	89777	broad.mit.edu	37	18	61232776	61232776	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:61232776C>A	ENST00000269491.1	+	6	744	c.744C>A	c.(742-744)acC>acA	p.T248T	SERPINB12_ENST00000382768.1_Silent_p.T268T	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	248					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						TGAGGTACACCAAGGGGAAGC	0.443																																							uc010xen.1		NA																	0					0						c.(742-744)ACC>ACA		serine (or cysteine) proteinase inhibitor, clade							162.0	141.0	148.0					18																	61232776		2203	4300	6503	SO:0001819	synonymous_variant	89777				negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity	g.chr18:61232776C>A	AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.744C>A	18.37:g.61232776C>A			Somatic				SERPINB12_uc010xeo.1_Silent_p.T268T	p.T248T	NM_080474	NP_536722	WXS	Illumina HiSeq	Unspecified	Q96P63	SPB12_HUMAN			6	744	+			248					Q3SYB4	Silent	SNP	ENST00000269491.1	37	c.744C>A	CCDS11984.1																																																																																				0.443	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474		4	79	1	0	0.00024832	0.009096	0.000280318	4	79				
FBXO15	201456	broad.mit.edu	37	18	71796748	71796748	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:71796748A>G	ENST00000419743.2	-	5	756	c.677T>C	c.(676-678)gTt>gCt	p.V226A	FBXO15_ENST00000269500.5_Missense_Mutation_p.V150A	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	226						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		ATACCATATAACAGTAACTGA	0.368																																							uc002lle.2		NA																	0				ovary(2)|pancreas(1)	3						c.(448-450)GTT>GCT		F-box protein 15 isoform 1							129.0	111.0	117.0					18																	71796748		2203	4300	6503	SO:0001583	missense	201456							g.chr18:71796748A>G	AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.677T>C	18.37:g.71796748A>G	ENSP00000393154:p.Val226Ala		Somatic				FBXO15_uc002llf.2_Missense_Mutation_p.V226A	p.V150A	NM_152676	NP_689889	WXS	Illumina HiSeq	Unspecified	Q8NCQ5	FBX15_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.143)	5	785	-		Esophageal squamous(42;0.103)|Prostate(75;0.173)	150					B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	c.449T>C	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	A	8.430	0.848480	0.17034	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.60040	0.24;0.22	5.85	3.43	0.39272	.	0.389173	0.26883	N	0.022007	T	0.50990	0.1648	L	0.55481	1.735	0.09310	N	1	B;B	0.18310	0.022;0.027	B;B	0.17433	0.018;0.018	T	0.49960	-0.8883	10	0.87932	D	0	-10.869	9.7734	0.40603	0.8572:0.0:0.1428:0.0	.	226;150	B3KST3;Q8NCQ5	.;FBX15_HUMAN	A	150;226	ENSP00000269500:V150A;ENSP00000393154:V226A	ENSP00000269500:V150A	V	-	2	0	FBXO15	69947728	0.050000	0.20438	0.000000	0.03702	0.250000	0.25880	3.609000	0.54117	0.460000	0.27045	0.533000	0.62120	GTT		0.368	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676		7	35	0	0	0	0.00308	0	7	35				
ZNF516	9658	broad.mit.edu	37	18	74091856	74091856	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:74091856C>A	ENST00000443185.2	-	4	2531	c.2214G>T	c.(2212-2214)agG>agT	p.R738S	ZNF516_ENST00000524431.2_5'UTR|RP11-504I13.3_ENST00000583287.1_RNA	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	738					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CCCGCGTCGACCTCGCACTTA	0.592																																							uc010dqx.1		NA																	0				ovary(1)	1						c.(2212-2214)AGG>AGT		zinc finger protein 516							50.0	53.0	52.0					18																	74091856		2017	4172	6189	SO:0001583	missense	9658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:74091856C>A	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.2214G>T	18.37:g.74091856C>A	ENSP00000394757:p.Arg738Ser		Somatic				ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	p.R738S	NM_014643	NP_055458	WXS	Illumina HiSeq	Unspecified	Q92618	ZN516_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)	3	2449	-		Prostate(75;0.0869)|Esophageal squamous(42;0.129)	738						Missense_Mutation	SNP	ENST00000443185.2	37	c.2214G>T		.	.	.	.	.	.	.	.	.	.	C	6.669	0.491988	0.12702	.	.	ENSG00000101493	ENST00000443185	T	0.11604	2.76	4.55	2.56	0.30785	.	0.745817	0.12140	N	0.495931	T	0.06826	0.0174	.	.	.	0.09310	N	0.999999	P	0.35433	0.501	B	0.28139	0.086	T	0.33240	-0.9876	9	0.87932	D	0	-16.5927	3.0809	0.06261	0.0:0.5083:0.2996:0.1921	.	738	Q92618	ZN516_HUMAN	S	738	ENSP00000394757:R738S	ENSP00000394757:R738S	R	-	3	2	ZNF516	72220844	0.984000	0.35163	0.051000	0.19133	0.005000	0.04900	1.561000	0.36342	1.108000	0.41662	-0.176000	0.13171	AGG		0.592	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643		37	25	1	0	1.836e-18	0.003755	3.19886e-18	37	25				
NFATC1	4772	broad.mit.edu	37	18	77227449	77227449	+	Splice_Site	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr18:77227449G>C	ENST00000427363.2	+	8	1959		c.e8-1		NFATC1_ENST00000591814.1_Splice_Site|NFATC1_ENST00000329101.4_Splice_Site|NFATC1_ENST00000592223.1_Splice_Site|NFATC1_ENST00000253506.5_Splice_Site|NFATC1_ENST00000586434.1_Splice_Site|NFATC1_ENST00000587635.1_Splice_Site|NFATC1_ENST00000542384.1_Splice_Site|NFATC1_ENST00000545796.1_Splice_Site|NFATC1_ENST00000397790.2_Splice_Site|NFATC1_ENST00000318065.5_Splice_Site			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1						calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	TTCTCCTGTAGAATTCTCTGG	0.612																																					GBM(151;1210 2593 28719 45011)	GBM(151;1210 2593 28719 45011)	uc010xfg.1		NA																	0				large_intestine(1)|ovary(1)	2						c.e8-1		nuclear factor of activated T-cells, cytosolic							89.0	71.0	77.0					18																	77227449		2203	4300	6503	SO:0001630	splice_region_variant	4772				intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr18:77227449G>C	U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1960-1G>C	18.37:g.77227449G>C			Somatic				NFATC1_uc002lnc.1_Splice_Site_p.N654_splice|NFATC1_uc010xff.1_Splice_Site_p.R625_splice|NFATC1_uc002lnd.2_Splice_Site_p.N654_splice|NFATC1_uc002lne.2_Splice_Site_p.N182_splice|NFATC1_uc010xfh.1_Splice_Site_p.N654_splice|NFATC1_uc010xfi.1_Splice_Site_p.N641_splice|NFATC1_uc010xfj.1_Splice_Site_p.N182_splice|NFATC1_uc002lnf.2_Splice_Site_p.N641_splice|NFATC1_uc002lng.2_Splice_Site_p.N641_splice|NFATC1_uc010xfk.1_Splice_Site_p.N641_splice	p.N654_splice	NM_006162	NP_006153	WXS	Illumina HiSeq	Unspecified	O95644	NFAC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	8	2413	+		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)						B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Splice_Site	SNP	ENST00000427363.2	37	c.1960_splice		.	.	.	.	.	.	.	.	.	.	G	12.89	2.073385	0.36566	.	.	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000397790;ENST00000542384;ENST00000329101;ENST00000545796;ENST00000427363;ENST00000397794	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9777	0.89132	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NFATC1	75328437	1.000000	0.71417	0.584000	0.28653	0.038000	0.13279	9.062000	0.93920	2.293000	0.77203	0.650000	0.86243	.		0.612	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1	NM_172390	Intron	3	79	0	0	0	0.004672	0	3	79				
ABCA7	10347	broad.mit.edu	37	19	1055905	1055905	+	Splice_Site	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:1055905G>T	ENST00000263094.6	+	31	4436		c.e31-1		ABCA7_ENST00000433129.1_Splice_Site|ABCA7_ENST00000435683.2_Splice_Site	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7						apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTCCCACAGCCTGAAGACT	0.582																																							uc002lqw.3		NA																	0				pancreas(7)|ovary(1)|central_nervous_system(1)	9						c.e31-1		ATP-binding cassette, sub-family A, member 7							150.0	124.0	133.0					19																	1055905		2202	4300	6502	SO:0001630	splice_region_variant	10347				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity	g.chr19:1055905G>T	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.4206-1G>T	19.37:g.1055905G>T			Somatic				ABCA7_uc010dsb.1_Splice_Site_p.G1264_splice|ABCA7_uc002lqy.2_5'Flank|ABCA7_uc010dsc.2_5'Flank	p.G1402_splice	NM_019112	NP_061985	WXS	Illumina HiSeq	Unspecified	Q8IZY2	ABCA7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	31	4437	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)						Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Splice_Site	SNP	ENST00000263094.6	37	c.4206_splice	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660102	0.47572	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	.	.	.	3.29	3.29	0.37713	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3996	0.49862	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCA7	1006905	1.000000	0.71417	0.967000	0.41034	0.744000	0.42396	4.230000	0.58632	1.679000	0.50963	0.561000	0.74099	.		0.582	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	Intron	45	31	1	0	3.68337e-26	0.00361	6.77828e-26	45	31				
TMIGD2	126259	broad.mit.edu	37	19	4292808	4292808	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:4292808C>T	ENST00000301272.2	-	5	682	c.637G>A	c.(637-639)Ggg>Agg	p.G213R	TMIGD2_ENST00000595645.1_Missense_Mutation_p.G209R|TMIGD2_ENST00000600349.1_Missense_Mutation_p.G41R|TMIGD2_ENST00000600114.1_Missense_Mutation_p.G93R	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	213					positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTCCTTCCCCTCTCCAGAG	0.622																																							uc002lzx.1		NA																	0					0						c.(637-639)GGG>AGG		transmembrane and immunoglobulin domain							50.0	55.0	53.0					19																	4292808		2203	4300	6503	SO:0001583	missense	126259					integral to membrane		g.chr19:4292808C>T	BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.637G>A	19.37:g.4292808C>T	ENSP00000301272:p.Gly213Arg		Somatic				TMIGD2_uc010dtv.1_Missense_Mutation_p.G209R	p.G213R	NM_144615	NP_653216	WXS	Illumina HiSeq	Unspecified	Q96BF3	TMIG2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)	5	683	-			213			Cytoplasmic (Potential).		Q6UW59	Missense_Mutation	SNP	ENST00000301272.2	37	c.637G>A	CCDS12126.1	.	.	.	.	.	.	.	.	.	.	C	4.487	0.090267	0.08632	.	.	ENSG00000167664	ENST00000301272	T	0.34472	1.36	2.35	-1.36	0.09085	.	.	.	.	.	T	0.18383	0.0441	N	0.12746	0.255	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.12156	0.007;0.003	T	0.22871	-1.0204	9	0.72032	D	0.01	.	5.4684	0.16656	0.0:0.5544:0.0:0.4456	.	209;213	Q96BF3-2;Q96BF3	.;TMIG2_HUMAN	R	213	ENSP00000301272:G213R	ENSP00000301272:G213R	G	-	1	0	TMIGD2	4243808	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.793000	0.04589	-0.172000	0.10779	-0.263000	0.10527	GGG		0.622	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458088.1	NM_144615		52	43	0	0	0	0.00361	0	52	43				
VAV1	7409	broad.mit.edu	37	19	6772756	6772756	+	5'UTR	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:6772756G>A	ENST00000602142.1	+	0	20				VAV1_ENST00000596764.1_5'UTR|VAV1_ENST00000304076.2_5'UTR|VAV1_ENST00000539284.1_5'Flank	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CAGGGCAGGCGTGCGGGCGGG	0.672																																							uc002mfu.1		NA																	0				lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						c.(-64--60)GCGTG>GCATG		vav 1 guanine nucleotide exchange factor																																				SO:0001623	5_prime_UTR_variant	7409				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr19:6772756G>A		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.-63G>A	19.37:g.6772756G>A			Somatic				VAV1_uc010xjh.1_Translation_Start_Site|VAV1_uc010dva.1_Translation_Start_Site		NM_005428	NP_005419	WXS	Illumina HiSeq	Unspecified	P15498	VAV_HUMAN			1	35	+								B4DVK9|M0QXX6|Q15860	Translation_Start_Site	SNP	ENST00000602142.1	37	c.-62G>A	CCDS12174.1																																																																																				0.672	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1			18	14	0	0	0	0.008871	0	18	14				
MUC16	94025	broad.mit.edu	37	19	8976586	8976586	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:8976586G>A	ENST00000397910.4	-	74	42593	c.42390C>T	c.(42388-42390)tcC>tcT	p.S14130S	MUC16_ENST00000380951.5_Silent_p.S771S|MUC16_ENST00000596956.1_5'UTR	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14161	SEA 14. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCACCTGAGGGAGATCAGTT	0.557																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(42388-42390)TCC>TCT		mucin 16							67.0	68.0	68.0					19																	8976586		1923	4151	6074	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:8976586G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42390C>T	19.37:g.8976586G>A			Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.S930S|MUC16_uc010xki.1_Intron	p.S14130S	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			74	42594	-			14161	Missing (in Ref. 3; AAK74120).		SEA 14.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.42390C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.731	-0.779845	0.02929	.	.	ENSG00000181143	ENST00000542240	.	.	.	3.59	-0.0275	0.13926	.	.	.	.	.	T	0.36635	0.0974	.	.	.	.	.	.	.	.	.	.	.	.	T	0.42832	-0.9428	3	.	.	.	.	5.7569	0.18178	0.1123:0.3823:0.5054:0.0	.	.	.	.	L	953	.	.	P	-	2	0	MUC16	8837586	0.162000	0.22906	0.684000	0.30055	0.234000	0.25298	-0.423000	0.07034	0.112000	0.17975	-0.516000	0.04426	CCC		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		9	16	0	0	0	0.004482	0	9	16				
ZNF560	147741	broad.mit.edu	37	19	9578679	9578679	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:9578679C>T	ENST00000301480.4	-	10	1157	c.944G>A	c.(943-945)aGt>aAt	p.S315N		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TTTTTCTCCACTCTGAGTTTT	0.398																																							uc002mlp.1		NA																	0				skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(943-945)AGT>AAT		zinc finger protein 560							173.0	147.0	156.0					19																	9578679		2203	4300	6503	SO:0001583	missense	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9578679C>T	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.944G>A	19.37:g.9578679C>T	ENSP00000301480:p.Ser315Asn		Somatic				ZNF560_uc010dwr.1_Missense_Mutation_p.S209N	p.S315N	NM_152476	NP_689689	WXS	Illumina HiSeq	Unspecified	Q96MR9	ZN560_HUMAN			10	1154	-			315					Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	c.944G>A	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556810	0.27827	.	.	ENSG00000198028	ENST00000301480	T	0.16073	2.37	1.91	-1.96	0.07525	.	.	.	.	.	T	0.09158	0.0226	N	0.19112	0.55	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.31336	-0.9947	9	0.62326	D	0.03	.	3.6558	0.08220	0.2108:0.4878:0.0:0.3014	.	315	Q96MR9	ZN560_HUMAN	N	315	ENSP00000301480:S315N	ENSP00000301480:S315N	S	-	2	0	ZNF560	9439679	0.000000	0.05858	0.000000	0.03702	0.462000	0.32619	-0.671000	0.05250	-0.663000	0.05331	-0.339000	0.08088	AGT		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		6	82	0	0	0	0.001168	0	6	82				
CD97	976	broad.mit.edu	37	19	14515282	14515282	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:14515282T>C	ENST00000242786.5	+	13	1617	c.1537T>C	c.(1537-1539)Tgc>Cgc	p.C513R	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.C464R|CD97_ENST00000358600.3_Missense_Mutation_p.C420R	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	513	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CACCGAGGGCTGCCAGGTGCT	0.617																																							uc002myl.2		NA																	0				ovary(3)|breast(1)	4						c.(1537-1539)TGC>CGC		CD97 antigen isoform 1 precursor							66.0	63.0	64.0					19																	14515282		2203	4300	6503	SO:0001583	missense	976				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr19:14515282T>C		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1537T>C	19.37:g.14515282T>C	ENSP00000242786:p.Cys513Arg		Somatic				CD97_uc002mym.2_Missense_Mutation_p.C464R|CD97_uc002myn.2_Missense_Mutation_p.C420R	p.C513R	NM_078481	NP_510966	WXS	Illumina HiSeq	Unspecified	P48960	CD97_HUMAN			13	1660	+			513			Extracellular (Potential).|GPS.		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	c.1537T>C	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.722943	0.48728	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	D;D;D	0.86865	-2.18;-2.18;-2.18	4.85	4.85	0.62838	GPS domain (3);	.	.	.	.	D	0.95900	0.8665	H	0.98594	4.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.991;0.994;0.999	D	0.96949	0.9693	9	0.87932	D	0	.	12.4099	0.55461	0.0:0.0:0.0:1.0	.	420;464;513	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	R	513;464;420;463	ENSP00000242786:C513R;ENSP00000349918:C464R;ENSP00000351413:C420R	ENSP00000242786:C513R	C	+	1	0	CD97	14376282	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	7.183000	0.77697	2.047000	0.60756	0.459000	0.35465	TGC		0.617	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		37	54	0	0	0	0.003271	0	37	54				
CYP4F22	126410	broad.mit.edu	37	19	15651465	15651465	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:15651465G>T	ENST00000269703.3	+	8	1075	c.876G>T	c.(874-876)gaG>gaT	p.E292D	CYP4F22_ENST00000601005.2_Missense_Mutation_p.E292D	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	292						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						AGGGGGCCGAGGCCTGGCTTA	0.647																																							uc002nbh.3		NA																	0				ovary(1)|pancreas(1)	2						c.(874-876)GAG>GAT		cytochrome P450, family 4, subfamily F,							52.0	47.0	49.0					19																	15651465		2203	4299	6502	SO:0001583	missense	126410					endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr19:15651465G>T		CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.876G>T	19.37:g.15651465G>T	ENSP00000269703:p.Glu292Asp		Somatic					p.E292D	NM_173483	NP_775754	WXS	Illumina HiSeq	Unspecified	Q6NT55	CP4FN_HUMAN			8	1043	+			292					Q8N8H4	Missense_Mutation	SNP	ENST00000269703.3	37	c.876G>T	CCDS12331.1	.	.	.	.	.	.	.	.	.	.	G	1.527	-0.545338	0.04024	.	.	ENSG00000171954	ENST00000269703	T	0.73047	-0.71	5.15	1.78	0.24846	.	0.609721	0.16806	N	0.198771	T	0.31857	0.0810	N	0.01277	-0.915	0.38269	D	0.942106	B	0.02656	0.0	B	0.09377	0.004	T	0.36016	-0.9765	10	0.02654	T	1	.	5.2346	0.15439	0.081:0.1439:0.6259:0.1492	.	292	Q6NT55	CP4FN_HUMAN	D	292	ENSP00000269703:E292D	ENSP00000269703:E292D	E	+	3	2	CYP4F22	15512465	1.000000	0.71417	0.716000	0.30569	0.449000	0.32228	1.478000	0.35442	0.188000	0.20168	0.453000	0.30009	GAG		0.647	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461338.2	NM_173483		33	50	1	0	6.00712e-18	0.012213	1.0379e-17	33	50				
MYO9B	4650	broad.mit.edu	37	19	17313008	17313008	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:17313008A>G	ENST00000594824.1	+	28	4879	c.4732A>G	c.(4732-4734)Act>Gct	p.T1578A	MYO9B_ENST00000397274.2_Missense_Mutation_p.T1578A|MYO9B_ENST00000595618.1_Missense_Mutation_p.T1578A			Q13459	MYO9B_HUMAN	myosin IXB	1578	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CAACCTGGCCACTGAGCGTGG	0.562																																							uc010eak.2		NA																	0				breast(1)	1						c.(4732-4734)ACT>GCT		myosin IXB isoform 1							45.0	48.0	47.0					19																	17313008		2004	4174	6178	SO:0001583	missense	4650				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity	g.chr19:17313008A>G		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4732A>G	19.37:g.17313008A>G	ENSP00000471367:p.Thr1578Ala		Somatic				MYO9B_uc002nfi.2_Missense_Mutation_p.T1578A|MYO9B_uc002nfj.1_Missense_Mutation_p.T1578A|MYO9B_uc002nfl.1_Missense_Mutation_p.T127A	p.T1578A	NM_004145	NP_004136	WXS	Illumina HiSeq	Unspecified	Q13459	MYO9B_HUMAN			28	4884	+			1578			Tail.		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37	c.4732A>G		.	.	.	.	.	.	.	.	.	.	A	1.621	-0.521600	0.04171	.	.	ENSG00000099331	ENST00000397274	D	0.83837	-1.77	4.5	-0.753	0.11068	.	0.994962	0.08143	N	0.991315	T	0.44074	0.1276	N	0.00538	-1.39	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.52609	-0.8553	10	0.02654	T	1	.	0.6511	0.00826	0.4134:0.1748:0.2339:0.1779	.	1578;1578;1578;1584	Q13459;Q13459-2;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.;.	A	1578	ENSP00000380444:T1578A	ENSP00000380444:T1578A	T	+	1	0	MYO9B	17174008	0.000000	0.05858	0.375000	0.26029	0.706000	0.40770	0.901000	0.28445	0.323000	0.23307	0.254000	0.18369	ACT		0.562	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1			17	12	0	0	0	0.006122	0	17	12				
JAK3	3718	broad.mit.edu	37	19	17955088	17955088	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:17955088C>A	ENST00000527670.1	-	1	168	c.139G>T	c.(139-141)Gac>Tac	p.D47Y	JAK3_ENST00000534444.1_Missense_Mutation_p.D47Y|JAK3_ENST00000458235.1_Missense_Mutation_p.D47Y|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	47	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GCCAAGTGGTCCCCAAAGGAG	0.677		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																		uc002nhn.3		2		Dom	yes		19	19p13.1	3718	Mis	Janus kinase 3			L			acute megakaryocytic leukemia|		0				haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						c.(139-141)GAC>TAC		Janus kinase 3							15.0	17.0	16.0					19																	17955088		2199	4296	6495	SO:0001583	missense	3718				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr19:17955088C>A	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.139G>T	19.37:g.17955088C>A	ENSP00000432511:p.Asp47Tyr		Somatic				JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Missense_Mutation_p.D47Y|JAK3_uc010xpx.1_Missense_Mutation_p.D47Y|JAK3_uc010xpy.1_Missense_Mutation_p.D47Y	p.D47Y	NM_000215	NP_000206	WXS	Illumina HiSeq	Unspecified	P52333	JAK3_HUMAN			2	239	-			47			FERM.|Interaction with cytokine/interferon/growth hormone receptors (By similarity).		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	c.139G>T	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600129	0.66332	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.66280	-0.2;-0.2;-0.2	5.28	5.28	0.74379	Band 4.1 domain (1);FERM domain (1);	0.301745	0.31542	N	0.007478	T	0.65439	0.2691	N	0.22421	0.69	0.32543	N	0.533425	D;D;P;P	0.71674	0.993;0.998;0.889;0.89	P;D;P;B	0.63381	0.891;0.914;0.8;0.264	T	0.74103	-0.3773	10	0.87932	D	0	-26.9526	14.4146	0.67139	0.0:1.0:0.0:0.0	.	90;47;47;47	B4E2R5;B4DK43;P52333-2;P52333	.;.;.;JAK3_HUMAN	Y	47	ENSP00000391676:D47Y;ENSP00000432511:D47Y;ENSP00000436421:D47Y	ENSP00000413248:D47Y	D	-	1	0	JAK3	17816088	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.022000	0.41030	2.452000	0.82932	0.655000	0.94253	GAC		0.677	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215		8	10	1	0	0.00448238	0.004482	0.00485721	8	10				
MAST3	23031	broad.mit.edu	37	19	18235560	18235560	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:18235560G>T	ENST00000262811.6	+	10	967	c.967G>T	c.(967-969)Ggc>Tgc	p.G323C	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	323							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						TGGGCAGCTGGGCCTGGCCAA	0.617																																							uc002nhz.3		NA																	0				large_intestine(2)|ovary(2)|stomach(1)	5						c.(967-969)GGC>TGC		microtubule associated serine/threonine kinase							32.0	36.0	35.0					19																	18235560		1949	4149	6098	SO:0001583	missense	23031						ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr19:18235560G>T	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.967G>T	19.37:g.18235560G>T	ENSP00000262811:p.Gly323Cys		Somatic					p.G323C	NM_015016	NP_055831	WXS	Illumina HiSeq	Unspecified	O60307	MAST3_HUMAN			10	967	+			323					Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	c.967G>T	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453976	0.84209	.	.	ENSG00000099308	ENST00000262811	T	0.55760	0.5	4.42	4.42	0.53409	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.85682	D	0.000000	T	0.78874	0.4352	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85251	0.1044	10	0.87932	D	0	-39.3253	16.3773	0.83410	0.0:0.0:1.0:0.0	.	323	O60307	MAST3_HUMAN	C	323	ENSP00000262811:G323C	ENSP00000262811:G323C	G	+	1	0	MAST3	18096560	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.616000	0.98359	2.168000	0.68352	0.462000	0.41574	GGC		0.617	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150		9	23	1	0	0.00829132	0.008291	0.00890708	9	23				
MAST3	23031	broad.mit.edu	37	19	18235570	18235570	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:18235570A>T	ENST00000262811.6	+	10	977	c.977A>T	c.(976-978)aAg>aTg	p.K326M	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	326							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GGCCTGGCCAAGGACCCCCTG	0.612																																							uc002nhz.3		NA																	0				large_intestine(2)|ovary(2)|stomach(1)	5						c.(976-978)AAG>ATG		microtubule associated serine/threonine kinase							30.0	34.0	33.0					19																	18235570		1936	4144	6080	SO:0001583	missense	23031						ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr19:18235570A>T	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.977A>T	19.37:g.18235570A>T	ENSP00000262811:p.Lys326Met		Somatic					p.K326M	NM_015016	NP_055831	WXS	Illumina HiSeq	Unspecified	O60307	MAST3_HUMAN			10	977	+			326					Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	c.977A>T	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.756870	0.69648	.	.	ENSG00000099308	ENST00000262811	T	0.35973	1.28	4.42	4.42	0.53409	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.048137	0.85682	D	0.000000	T	0.57577	0.2063	M	0.72894	2.215	0.39290	D	0.964725	P	0.50528	0.936	D	0.68353	0.957	T	0.64867	-0.6306	10	0.87932	D	0	-36.9113	13.1412	0.59436	1.0:0.0:0.0:0.0	.	326	O60307	MAST3_HUMAN	M	326	ENSP00000262811:K326M	ENSP00000262811:K326M	K	+	2	0	MAST3	18096570	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	4.050000	0.57404	1.760000	0.52011	0.379000	0.24179	AAG		0.612	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150		11	25	0	0	0	0.010729	0	11	25				
ZNF257	113835	broad.mit.edu	37	19	22271202	22271202	+	Missense_Mutation	SNP	C	C	A	rs199774213	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:22271202C>A	ENST00000594947.1	+	4	794	c.650C>A	c.(649-651)aCt>aAt	p.T217N	ZNF257_ENST00000600162.1_3'UTR	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T217N(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCAGCTCTTACTCGACATAAG	0.388																																							uc010ecx.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(649-651)ACT>AAT		zinc finger protein 257							40.0	43.0	42.0					19																	22271202		2187	4294	6481	SO:0001583	missense	113835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22271202C>A	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.650C>A	19.37:g.22271202C>A	ENSP00000470209:p.Thr217Asn		Somatic				ZNF257_uc010ecy.2_Missense_Mutation_p.T185N	p.T217N	NM_033468	NP_258429	WXS	Illumina HiSeq	Unspecified	Q9Y2Q1	ZN257_HUMAN			4	819	+		all_lung(12;0.0961)|Lung NSC(12;0.103)	217			C2H2-type 2.		B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	c.650C>A	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	C	6.814	0.519266	0.13005	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	0.926	-0.301	0.12800	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17365	0.0417	N	0.11818	0.18	0.09310	N	1	B	0.12630	0.006	B	0.17433	0.018	T	0.21415	-1.0246	8	0.41790	T	0.15	.	3.3883	0.07280	0.0:0.5017:0.2722:0.2261	.	217	Q9Y2Q1	ZN257_HUMAN	N	217;189	.	ENSP00000380312:T189N	T	+	2	0	ZNF257	22063042	0.000000	0.05858	0.029000	0.17559	0.037000	0.13140	-4.361000	0.00246	0.308000	0.22923	0.313000	0.20887	ACT		0.388	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			10	45	1	0	9.70103e-10	0.008291	1.40001e-09	10	45				
ZNF98	148198	broad.mit.edu	37	19	22586258	22586258	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:22586258G>T	ENST00000357774.5	-	2	208	c.87C>A	c.(85-87)tgC>tgA	p.C29*	ZNF98_ENST00000601553.1_Nonsense_Mutation_p.C29*	NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	29	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CGGTGTCCAGGCATTGCCACT	0.413																																							uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(85-87)TGC>TGA		zinc finger protein 98							85.0	90.0	89.0					19																	22586258		2201	4297	6498	SO:0001587	stop_gained	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22586258G>T		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.87C>A	19.37:g.22586258G>T	ENSP00000350418:p.Cys29*		Somatic					p.C29*	NM_001098626	NP_001092096	WXS	Illumina HiSeq	Unspecified	A6NK75	ZNF98_HUMAN			2	209	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	29			KRAB.			Nonsense_Mutation	SNP	ENST00000357774.5	37	c.87C>A	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	14.49	2.550169	0.45383	.	.	ENSG00000197360	ENST00000357774	.	.	.	1.06	-0.858	0.10689	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.2543	0.10710	0.0:0.4408:0.5592:0.0	.	.	.	.	X	29	.	ENSP00000350418:C29X	C	-	3	2	ZNF98	22378098	0.001000	0.12720	0.066000	0.19879	0.241000	0.25554	-2.296000	0.01142	0.532000	0.28657	0.298000	0.19748	TGC		0.413	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		49	72	1	0	1.89013e-27	0.00361	3.50943e-27	49	72				
ZNF536	9745	broad.mit.edu	37	19	31040290	31040290	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:31040290C>A	ENST00000355537.3	+	4	3911	c.3764C>A	c.(3763-3765)cCc>cAc	p.P1255H		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1255					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GAGCGGGGGCCCCAGAGCCTG	0.597																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(3763-3765)CCC>CAC		zinc finger protein 536							19.0	20.0	20.0					19																	31040290		2194	4288	6482	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31040290C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3764C>A	19.37:g.31040290C>A	ENSP00000347730:p.Pro1255His		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.P1255H	p.P1255H	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3902	+	Esophageal squamous(110;0.0834)		1255					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3764C>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	9.304	1.053828	0.19907	.	.	ENSG00000198597	ENST00000355537	T	0.08370	3.1	5.18	5.18	0.71444	.	0.063344	0.64402	D	0.000004	T	0.09423	0.0232	N	0.17082	0.46	0.36832	D	0.886976	D;B	0.57571	0.98;0.016	P;B	0.50231	0.635;0.005	T	0.14559	-1.0468	10	0.72032	D	0.01	-33.2905	12.1056	0.53810	0.0:0.9212:0.0:0.0788	.	1255;1255	A7E228;O15090	.;ZN536_HUMAN	H	1255	ENSP00000347730:P1255H	ENSP00000347730:P1255H	P	+	2	0	ZNF536	35732130	0.989000	0.36119	0.999000	0.59377	0.726000	0.41606	3.119000	0.50422	2.401000	0.81631	0.650000	0.86243	CCC		0.597	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		14	32	1	0	3.27435e-08	0.00245	4.41789e-08	14	32				
SLC7A9	11136	broad.mit.edu	37	19	33355045	33355045	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:33355045C>A	ENST00000023064.4	-	4	626	c.435G>T	c.(433-435)aaG>aaT	p.K145N	SLC7A9_ENST00000590341.1_Missense_Mutation_p.K145N|RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000587772.1_Missense_Mutation_p.K145N	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	145					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	TTTGAGGAGGCTTGCAGCCCA	0.592																																					GBM(181;1335 2108 9644 44178 46689)	GBM(181;1335 2108 9644 44178 46689)	uc002ntv.3		NA																	0				skin(1)	1						c.(433-435)AAG>AAT		solute carrier family 7, member 9	L-Cystine(DB00138)						89.0	72.0	78.0					19																	33355045		2203	4300	6503	SO:0001583	missense	11136				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding	g.chr19:33355045C>A	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.435G>T	19.37:g.33355045C>A	ENSP00000023064:p.Lys145Asn		Somatic				SLC7A9_uc002ntt.3_RNA|SLC7A9_uc002ntu.3_Missense_Mutation_p.K145N|SLC7A9_uc002ntw.3_5'UTR	p.K145N	NM_001126335	NP_001119807	WXS	Illumina HiSeq	Unspecified	P82251	BAT1_HUMAN			4	552	-	Esophageal squamous(110;0.137)		145			Extracellular (Potential).		B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	c.435G>T	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	C	7.515	0.655378	0.14580	.	.	ENSG00000021488	ENST00000023064	D	0.89270	-2.49	4.97	-1.29	0.09288	Amino acid permease domain (1);	0.914029	0.09668	N	0.771507	T	0.71702	0.3371	N	0.05351	-0.065	0.23406	N	0.997746	B	0.06786	0.001	B	0.16722	0.016	T	0.56123	-0.8031	10	0.20519	T	0.43	.	2.3354	0.04246	0.3523:0.3339:0.1808:0.1329	.	145	P82251	BAT1_HUMAN	N	145	ENSP00000023064:K145N	ENSP00000023064:K145N	K	-	3	2	SLC7A9	38046885	0.002000	0.14202	0.048000	0.18961	0.010000	0.07245	-0.934000	0.03955	-0.556000	0.06134	-1.579000	0.00862	AAG		0.592	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1			8	35	1	0	0.00010058	0.001368	0.000115213	8	35				
KIAA0355	9710	broad.mit.edu	37	19	34818678	34818678	+	Silent	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:34818678A>T	ENST00000299505.6	+	5	1722	c.849A>T	c.(847-849)gcA>gcT	p.A283A		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	283										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					ATTTCCAGGCATATAAGATAG	0.338																																							uc002nvd.3		NA																	0				ovary(1)	1						c.(847-849)GCA>GCT		hypothetical protein LOC9710							59.0	62.0	61.0					19																	34818678		2203	4300	6503	SO:0001819	synonymous_variant	9710							g.chr19:34818678A>T		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.849A>T	19.37:g.34818678A>T			Somatic					p.A283A	NM_014686	NP_055501	WXS	Illumina HiSeq	Unspecified	O15063	K0355_HUMAN			5	1708	+	Esophageal squamous(110;0.162)		283					Q2M3W4	Silent	SNP	ENST00000299505.6	37	c.849A>T	CCDS12436.1																																																																																				0.338	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686		14	34	0	0	0	0.003163	0	14	34				
RYR1	6261	broad.mit.edu	37	19	38933001	38933001	+	Missense_Mutation	SNP	G	G	A	rs118192160		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:38933001G>A	ENST00000359596.3	+	3	178	c.178G>A	c.(178-180)Gat>Aat	p.D60N	RYR1_ENST00000360985.3_Missense_Mutation_p.D60N|RYR1_ENST00000355481.4_Missense_Mutation_p.D60N			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	60					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGTGCCCCCCGATCTGGCCAT	0.632																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	GRCh37	CM061939	RYR1	M	rs118192160	c.(178-180)GAT>AAT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						67.0	59.0	62.0					19																	38933001		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38933001G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.178G>A	19.37:g.38933001G>A	ENSP00000352608:p.Asp60Asn		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.D60N	p.D60N	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		3	308	+	all_cancers(60;7.91e-06)		60			Cytoplasmic.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.178G>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	g	11.14	1.551150	0.27739	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98567	-5.0;-5.0;-5.0	3.66	3.66	0.41972	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.000000	0.64402	U	0.000002	D	0.98121	0.9380	L	0.60904	1.88	0.46542	D	0.999099	D;D	0.76494	0.999;0.999	P;D	0.66602	0.893;0.945	D	0.97454	1.0030	10	0.36615	T	0.2	.	12.9082	0.58164	0.0:0.0:1.0:0.0	.	60;60	P21817-2;P21817	.;RYR1_HUMAN	N	60	ENSP00000352608:D60N;ENSP00000347667:D60N;ENSP00000354254:D60N	ENSP00000347667:D60N	D	+	1	0	RYR1	43624841	1.000000	0.71417	0.921000	0.36526	0.308000	0.27856	9.185000	0.94900	1.885000	0.54596	0.290000	0.19541	GAT		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			18	97	0	0	0	0.007413	0	18	97				
PHLDB3	653583	broad.mit.edu	37	19	44001416	44001416	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:44001416C>A	ENST00000292140.5	-	6	1039	c.679G>T	c.(679-681)Gat>Tat	p.D227Y	PHLDB3_ENST00000599242.1_Missense_Mutation_p.D227Y	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	227							enzyme binding (GO:0019899)	p.D227Y(2)		breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TGGGCCACATCCAGTTGTTCC	0.622																																							uc002own.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(679-681)GAT>TAT		pleckstrin homology-like domain, family B,							30.0	27.0	28.0					19																	44001416		2203	4299	6502	SO:0001583	missense	653583							g.chr19:44001416C>A		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.679G>T	19.37:g.44001416C>A	ENSP00000292140:p.Asp227Tyr		Somatic				PHLDB3_uc010eit.2_5'Flank|PHLDB3_uc002owo.2_Missense_Mutation_p.D227Y	p.D227Y	NM_198850	NP_942147	WXS	Illumina HiSeq	Unspecified	Q6NSJ2	PHLB3_HUMAN			6	938	-		Prostate(69;0.0153)	227			Potential.		Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	37	c.679G>T	CCDS12621.2	.	.	.	.	.	.	.	.	.	.	c	15.43	2.830680	0.50845	.	.	ENSG00000176531	ENST00000292140	T	0.55052	0.54	4.51	4.51	0.55191	.	0.427436	0.19864	N	0.104355	T	0.62024	0.2394	L	0.54323	1.7	0.26743	N	0.97035	D;D	0.69078	0.997;0.996	P;P	0.57548	0.823;0.75	T	0.57522	-0.7797	10	0.66056	D	0.02	.	13.1615	0.59547	0.0:1.0:0.0:0.0	.	227;227	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	Y	227	ENSP00000292140:D227Y	ENSP00000292140:D227Y	D	-	1	0	PHLDB3	48693256	1.000000	0.71417	0.991000	0.47740	0.681000	0.39784	4.113000	0.57851	2.235000	0.73313	0.299000	0.19835	GAT		0.622	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2			7	28	1	0	2.0095e-06	0.001984	2.49483e-06	7	28				
IGLON5	402665	broad.mit.edu	37	19	51826942	51826942	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:51826942G>T	ENST00000270642.8	+	3	185	c.185G>T	c.(184-186)cGc>cTc	p.R62L		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	62	Ig-like C2-type 1.					extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						CACGTGACCCGCGTGGCCTGG	0.647																																							uc002pwc.2		NA																	0					0						c.(184-186)CGC>CTC		IgLON family member 5 precursor							25.0	29.0	28.0					19																	51826942		2122	4242	6364	SO:0001583	missense	402665					extracellular region		g.chr19:51826942G>T		CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.185G>T	19.37:g.51826942G>T	ENSP00000270642:p.Arg62Leu		Somatic					p.R62L	NM_001101372	NP_001094842	WXS	Illumina HiSeq	Unspecified	A6NGN9	IGLO5_HUMAN			3	185	+			62			Ig-like C2-type 1.			Missense_Mutation	SNP	ENST00000270642.8	37	c.185G>T	CCDS46158.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384863	0.82792	.	.	ENSG00000142549	ENST00000270642	T	0.66280	-0.2	4.9	4.9	0.64082	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.054903	0.64402	D	0.000001	T	0.77974	0.4211	M	0.72118	2.19	0.43819	D	0.996386	D	0.89917	1.0	D	0.83275	0.996	T	0.80555	-0.1330	10	0.66056	D	0.02	-17.8105	15.5652	0.76287	0.0:0.0:1.0:0.0	.	62	A6NGN9	IGLO5_HUMAN	L	62	ENSP00000270642:R62L	ENSP00000270642:R62L	R	+	2	0	IGLON5	56518754	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	5.789000	0.69029	2.275000	0.75901	0.591000	0.81541	CGC		0.647	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372		12	34	1	0	7.03913e-09	0.001368	9.75131e-09	12	34				
ZNF610	162963	broad.mit.edu	37	19	52869860	52869860	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:52869860G>T	ENST00000403906.3	+	6	1685	c.1229G>T	c.(1228-1230)gGg>gTg	p.G410V	ZNF610_ENST00000601151.1_Missense_Mutation_p.G367V|ZNF610_ENST00000321287.8_Missense_Mutation_p.G410V|ZNF610_ENST00000327920.8_Missense_Mutation_p.G410V	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		AAAGTCTTTGGGCGCAAATTA	0.423																																							uc002pyx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(1228-1230)GGG>GTG		zinc finger protein 610 isoform a							58.0	56.0	56.0					19																	52869860		2203	4300	6503	SO:0001583	missense	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52869860G>T	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.1229G>T	19.37:g.52869860G>T	ENSP00000383922:p.Gly410Val		Somatic				ZNF610_uc002pyy.3_Missense_Mutation_p.G410V|ZNF610_uc002pyz.3_Missense_Mutation_p.G367V|ZNF610_uc002pza.2_Missense_Mutation_p.G410V	p.G410V	NM_001161426	NP_001154898	WXS	Illumina HiSeq	Unspecified	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	6	1635	+			410			C2H2-type 8.		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	c.1229G>T	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	8.261	0.811086	0.16537	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.07444	3.19;3.19	1.88	-0.761	0.11038	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03011	0.0089	N	0.04275	-0.24	0.09310	N	1	B;P	0.34462	0.4;0.454	B;B	0.31191	0.076;0.125	T	0.38200	-0.9672	9	0.54805	T	0.06	.	2.4555	0.04528	0.3021:0.0:0.3432:0.3547	.	367;410	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	V	410;367;410	ENSP00000383922:G410V;ENSP00000327597:G410V	ENSP00000324441:G367V	G	+	2	0	ZNF610	57561672	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.897000	0.00092	-0.288000	0.09051	-0.229000	0.12294	GGG		0.423	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		7	35	1	0	0.00307968	0.00308	0.00334304	7	35				
ZNF534	147658	broad.mit.edu	37	19	52937242	52937242	+	Missense_Mutation	SNP	T	T	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:52937242T>G	ENST00000332323.6	+	2	111	c.50T>G	c.(49-51)tTc>tGc	p.F17C	ZNF534_ENST00000301085.4_Missense_Mutation_p.F17C|ZNF534_ENST00000432303.2_Missense_Mutation_p.F17C|ZNF534_ENST00000433050.1_Missense_Mutation_p.F17C	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						GCCATAGAATTCTCTCAGGAG	0.453																																							uc002pzk.2		NA																	0					0						c.(49-51)TTC>TGC		zinc finger protein 534 isoform 2							113.0	104.0	107.0					19																	52937242		1568	3582	5150	SO:0001583	missense	147658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52937242T>G	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.50T>G	19.37:g.52937242T>G	ENSP00000327538:p.Phe17Cys		Somatic				ZNF534_uc002pzj.1_Missense_Mutation_p.F17C|ZNF534_uc010epo.1_Missense_Mutation_p.F17C|ZNF534_uc002pzl.2_Missense_Mutation_p.F17C	p.F17C	NM_001143939	NP_001137411	WXS	Illumina HiSeq	Unspecified	Q76KX8	ZN534_HUMAN			2	111	+			17			KRAB.		Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	c.50T>G	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	T	10.14	1.267376	0.23136	.	.	ENSG00000198633	ENST00000301085;ENST00000432303;ENST00000332323;ENST00000433050;ENST00000391790	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	0.978	0.978	0.19740	Krueppel-associated box (4);	.	.	.	.	T	0.58921	0.2156	H	0.99877	4.88	0.23673	N	0.997143	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.97110	1.0;0.984;0.997;1.0	T	0.50634	-0.8805	9	0.87932	D	0	.	7.4499	0.27231	0.0:0.0:0.0:1.0	.	17;17;17;17	Q1T7F6;Q76KX8-2;Q76KX8;Q1T7F5	.;.;ZN534_HUMAN;.	C	17;17;17;17;16	ENSP00000301085:F17C;ENSP00000409421:F17C;ENSP00000327538:F17C;ENSP00000391358:F17C	ENSP00000301085:F17C	F	+	2	0	ZNF534	57629054	0.644000	0.27277	0.935000	0.37517	0.277000	0.26821	2.052000	0.41316	0.691000	0.31592	0.332000	0.21555	TTC		0.453	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512		27	64	0	0	0	0.005443	0	27	64				
ZNF28	7576	broad.mit.edu	37	19	53304938	53304938	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:53304938T>C	ENST00000457749.2	-	4	279	c.160A>G	c.(160-162)Atg>Gtg	p.M54V	ZNF28_ENST00000414252.2_Start_Codon_SNP_p.M1V|ZNF28_ENST00000438150.2_Start_Codon_SNP_p.M1V|ZNF28_ENST00000339844.6_Intron|ZNF28_ENST00000594602.1_Missense_Mutation_p.H93R|ZNF28_ENST00000360272.4_Start_Codon_SNP_p.M1V	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	54	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		GTCTTCATCATGCATTTGGAA	0.363																																							uc002qad.2		NA																	0				skin(1)	1						c.(160-162)ATG>GTG		zinc finger protein 28							117.0	118.0	118.0					19																	53304938		2202	4296	6498	SO:0001583	missense	7576				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53304938T>C	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.160A>G	19.37:g.53304938T>C	ENSP00000397693:p.Met54Val		Somatic				ZNF28_uc002qac.2_Missense_Mutation_p.M1V|ZNF28_uc010eqe.2_5'UTR	p.M54V	NM_006969	NP_008900	WXS	Illumina HiSeq	Unspecified	P17035	ZNF28_HUMAN		GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)	4	280	-			54			KRAB.		A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	c.160A>G	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	2.951	-0.216673	0.06101	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.08193	3.12;3.33;3.12;3.12;3.18	2.29	-1.9	0.07665	Krueppel-associated box (3);	.	.	.	.	T	0.06050	0.0157	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45775	-0.9238	9	0.15952	T	0.53	.	5.1562	0.15036	0.0:0.525:0.0:0.475	.	54	P17035	ZNF28_HUMAN	V	1;54;1;1;1	ENSP00000412143:M1V;ENSP00000397693:M54V;ENSP00000353410:M1V;ENSP00000444965:M1V;ENSP00000375661:M1V	ENSP00000353410:M1V	M	-	1	0	ZNF28	57996750	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.711000	0.05019	-0.454000	0.07066	0.248000	0.18094	ATG		0.363	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969		57	67	0	0	0	0.00361	0	57	67				
NLRP12	91662	broad.mit.edu	37	19	54308698	54308698	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:54308698C>A	ENST00000324134.6	-	5	2418	c.2250G>T	c.(2248-2250)aaG>aaT	p.K750N	NLRP12_ENST00000535162.1_Missense_Mutation_p.K750N|NLRP12_ENST00000345770.5_Missense_Mutation_p.K751N|NLRP12_ENST00000351894.4_Missense_Mutation_p.K750N|NLRP12_ENST00000391775.3_Missense_Mutation_p.K750N|NLRP12_ENST00000354278.3_Missense_Mutation_p.K750N|NLRP12_ENST00000391772.1_Missense_Mutation_p.K751N|NLRP12_ENST00000391773.1_Missense_Mutation_p.K751N	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	750					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGCGGCACCTCTTCAGCCTGG	0.463																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(2248-2250)AAG>AAT		NLR family, pyrin domain containing 12 isoform							72.0	74.0	73.0					19																	54308698		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54308698C>A	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2250G>T	19.37:g.54308698C>A	ENSP00000319377:p.Lys750Asn		Somatic				NLRP12_uc010eqw.2_Missense_Mutation_p.K33N|NLRP12_uc002qci.3_Missense_Mutation_p.K750N|NLRP12_uc002qcj.3_Missense_Mutation_p.K751N|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.K751N	p.K750N	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	5	2470	-	Ovarian(34;0.19)		750					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.2250G>T	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337578	0.24253	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000358661;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79;-2.79;-2.79;-2.79	3.12	3.12	0.35913	.	.	.	.	.	D	0.89220	0.6653	N	0.17248	0.465	0.32999	D	0.525985	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.988;0.987;0.998;0.993;0.959	D	0.87121	0.2191	9	0.25106	T	0.35	.	9.9434	0.41593	0.0:1.0:0.0:0.0	.	751;33;750;750;750	F2Z321;P59046-5;A8K407;A8MTQ2;P59046	.;.;.;.;NAL12_HUMAN	N	750;750;750;750;33;750;751;751;751	ENSP00000319377:K750N;ENSP00000438030:K750N;ENSP00000340473:K750N;ENSP00000346231:K750N;ENSP00000375655:K750N;ENSP00000375653:K751N;ENSP00000375652:K751N	ENSP00000319377:K750N	K	-	3	2	NLRP12	59000510	0.094000	0.21725	0.994000	0.49952	0.471000	0.32888	0.306000	0.19279	1.783000	0.52377	0.289000	0.19496	AAG		0.463	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		15	75	1	0	4.93089e-13	0.00245	7.7843e-13	15	75				
MYADM	91663	broad.mit.edu	37	19	54377348	54377348	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:54377348G>T	ENST00000391769.2	+	3	845	c.565G>T	c.(565-567)Gcg>Tcg	p.A189S	MYADM_ENST00000391768.2_Missense_Mutation_p.A189S|MYADM_ENST00000391770.4_Missense_Mutation_p.A189S|MYADM_ENST00000336967.3_Missense_Mutation_p.A189S|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391771.1_Missense_Mutation_p.A189S	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	189	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CATCATCTTCGCGTTCATCAG	0.652																																							uc002qcl.2		NA																	0				ovary(1)	1						c.(565-567)GCG>TCG		myeloid-associated differentiation marker							159.0	132.0	141.0					19																	54377348		2203	4300	6503	SO:0001583	missense	91663					integral to membrane		g.chr19:54377348G>T	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.565G>T	19.37:g.54377348G>T	ENSP00000375649:p.Ala189Ser		Somatic				MYADM_uc002qcm.2_Missense_Mutation_p.A189S|MYADM_uc002qcn.2_Missense_Mutation_p.A189S|MYADM_uc002qco.2_Missense_Mutation_p.A189S|MYADM_uc002qcp.2_Missense_Mutation_p.A189S	p.A189S	NM_001020820	NP_001018656	WXS	Illumina HiSeq	Unspecified	Q96S97	MYADM_HUMAN		GBM - Glioblastoma multiforme(134;0.0488)	3	713	+	Ovarian(34;0.19)		189			MARVEL 2.|Helical; (Potential).		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	c.565G>T	CCDS12866.1	.	.	.	.	.	.	.	.	.	.	G	7.810	0.715565	0.15306	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	4.21	3.14	0.36123	Marvel (1);MARVEL-like domain (1);	0.256502	0.31721	N	0.007173	T	0.30008	0.0751	M	0.62723	1.935	0.28396	N	0.918857	B	0.24258	0.1	B	0.29785	0.107	T	0.18808	-1.0325	10	0.30854	T	0.27	.	8.7913	0.34852	0.1247:0.0:0.8753:0.0	.	189	Q96S97	MYADM_HUMAN	S	189;189;189;189;189;152;189;189	ENSP00000398269:A189S;ENSP00000337222:A189S;ENSP00000375650:A189S;ENSP00000416919:A189S;ENSP00000375651:A189S;ENSP00000375649:A189S;ENSP00000375648:A189S	ENSP00000337222:A189S	A	+	1	0	MYADM	59069160	0.960000	0.32886	0.535000	0.28026	0.103000	0.19146	1.281000	0.33214	0.825000	0.34637	0.313000	0.20887	GCG		0.652	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373		31	154	1	0	3.99451e-17	0.009535	6.80708e-17	31	154				
LILRA1	11024	broad.mit.edu	37	19	55106637	55106637	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:55106637A>G	ENST00000251372.3	+	5	613	c.431A>G	c.(430-432)cAt>cGt	p.H144R	LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.H144R|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	144	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		GTGACCCTCCATTGTGTCTCA	0.542																																							uc002qgh.1		NA																	0				skin(2)|ovary(1)	3						c.(430-432)CAT>CGT		leukocyte immunoglobulin-like receptor,							154.0	142.0	146.0					19																	55106637		2203	4300	6503	SO:0001583	missense	11024				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity	g.chr19:55106637A>G	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.431A>G	19.37:g.55106637A>G	ENSP00000251372:p.His144Arg		Somatic				LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Missense_Mutation_p.H144R	p.H144R	NM_006863	NP_006854	WXS	Illumina HiSeq	Unspecified	O75019	LIRA1_HUMAN		GBM - Glioblastoma multiforme(193;0.0348)	5	613	+			144			Ig-like C2-type 2.|Extracellular (Potential).		O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	c.431A>G	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	A	4.299	0.054744	0.08291	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.02682	4.2;4.2	2.24	2.24	0.28232	Immunoglobulin-like fold (1);	0.399081	0.21532	N	0.073037	T	0.01092	0.0036	N	0.01188	-0.97	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.09377	0.0;0.004	T	0.48547	-0.9026	10	0.28530	T	0.3	.	6.7616	0.23544	1.0:0.0:0.0:0.0	.	144;144	O75019-2;O75019	.;LIRA1_HUMAN	R	144	ENSP00000251372:H144R;ENSP00000413715:H144R	ENSP00000251372:H144R	H	+	2	0	LILRA1	59798449	0.001000	0.12720	0.091000	0.20842	0.012000	0.07955	-0.191000	0.09601	0.988000	0.38734	0.163000	0.16589	CAT		0.542	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863		21	136	0	0	0	0.002299	0	21	136				
KIR3DL1	3811	broad.mit.edu	37	19	55349047	55349047	+	Intron	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:55349047T>A	ENST00000402254.2	+	6	1033				KIR2DS4_ENST00000339924.8_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.P29P(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		ACAGAAAACCTTCCTTCCTGG	0.502																																							uc002qhm.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(85-87)CCT>CCA		killer cell immunoglobulin-like receptor, two							194.0	174.0	181.0					19																	55349047		2169	4157	6326	SO:0001627	intron_variant	3809					integral to plasma membrane	receptor activity	g.chr19:55349047T>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000402254.2:c.1000+12514T>A	19.37:g.55349047T>A			Somatic				KIR2DS4_uc010yfj.1_Silent_p.P22P|KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Silent_p.P29P|KIR2DS4_uc002qhn.1_5'UTR	p.P29P	NM_012314	NP_036446	WXS	Illumina HiSeq	Unspecified	P43632	KI2S4_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	3	133	+			29			Extracellular (Potential).		O43473|Q14946|Q16541	Silent	SNP	ENST00000402254.2	37	c.87T>A																																																																																					0.502	KIR3DL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_013289		44	76	0	0	0	0.011902	0	44	76				
NLRP7	199713	broad.mit.edu	37	19	55445885	55445885	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:55445885G>A	ENST00000590030.1	-	6	2483	c.2443C>T	c.(2443-2445)Cgc>Tgc	p.R815C	NLRP7_ENST00000448121.2_Missense_Mutation_p.R787C|NLRP7_ENST00000340844.2_Missense_Mutation_p.R815C|NLRP7_ENST00000328092.5_Missense_Mutation_p.R787C|NLRP7_ENST00000588756.1_Missense_Mutation_p.R815C|NLRP7_ENST00000446217.1_Missense_Mutation_p.R843C|NLRP7_ENST00000592784.1_Missense_Mutation_p.R815C			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	815							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TGTTTTGGGCGTGTCATGGTC	0.517																																							uc002qih.3		NA																	0				large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(2443-2445)CGC>TGC		NACHT, leucine rich repeat and PYD containing 7							175.0	147.0	157.0					19																	55445885		2203	4300	6503	SO:0001583	missense	199713						ATP binding	g.chr19:55445885G>A	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2443C>T	19.37:g.55445885G>A	ENSP00000465520:p.Arg815Cys		Somatic				NLRP7_uc002qig.3_Missense_Mutation_p.R787C|NLRP7_uc002qii.3_Missense_Mutation_p.R815C|NLRP7_uc010esk.2_Missense_Mutation_p.R815C|NLRP7_uc010esl.2_Missense_Mutation_p.R843C	p.R815C	NM_206828	NP_996611	WXS	Illumina HiSeq	Unspecified	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	7	2519	-			815					E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	c.2443C>T	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	G	7.158	0.585103	0.13749	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T	0.54071	0.59;0.59;2.49	2.28	1.19	0.21007	.	.	.	.	.	T	0.32941	0.0846	N	0.12182	0.205	0.09310	N	1	P;P;P;P	0.46395	0.877;0.611;0.738;0.717	B;B;B;B	0.42522	0.39;0.019;0.276;0.03	T	0.13308	-1.0514	9	0.56958	D	0.05	.	6.8525	0.24022	0.0:0.3407:0.6593:0.0	.	843;815;815;787	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	C	815;787;815;843;582	ENSP00000409137:R787C;ENSP00000339491:R815C;ENSP00000414273:R843C	ENSP00000329568:R815C	R	-	1	0	NLRP7	60137697	0.908000	0.30866	0.008000	0.14137	0.001000	0.01503	1.845000	0.39279	0.509000	0.28195	-0.319000	0.08680	CGC		0.517	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		14	81	0	0	0	0.00245	0	14	81				
NLRP7	199713	broad.mit.edu	37	19	55450993	55450993	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:55450993G>T	ENST00000590030.1	-	3	1234	c.1194C>A	c.(1192-1194)ctC>ctA	p.L398L	NLRP7_ENST00000448121.2_Silent_p.L398L|NLRP7_ENST00000340844.2_Silent_p.L398L|NLRP7_ENST00000328092.5_Silent_p.L398L|NLRP7_ENST00000588756.1_Silent_p.L398L|NLRP7_ENST00000446217.1_Silent_p.L426L|NLRP7_ENST00000592784.1_Silent_p.L398L			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	398	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.		L -> R (in HYDM1). {ECO:0000269|PubMed:19246479}.				ATP binding (GO:0005524)	p.L398L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		ACCGGCTGCAGAGGAAACGCA	0.692																																							uc002qih.3		NA																	1	Substitution - coding silent(1)	p.L398L(1)	breast(1)	large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(1192-1194)CTC>CTA		NACHT, leucine rich repeat and PYD containing 7							7.0	7.0	7.0					19																	55450993		2034	4021	6055	SO:0001819	synonymous_variant	199713						ATP binding	g.chr19:55450993G>T	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1194C>A	19.37:g.55450993G>T			Somatic				NLRP7_uc002qig.3_Silent_p.L398L|NLRP7_uc002qii.3_Silent_p.L398L|NLRP7_uc010esk.2_Silent_p.L398L|NLRP7_uc010esl.2_Silent_p.L426L	p.L398L	NM_206828	NP_996611	WXS	Illumina HiSeq	Unspecified	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	4	1270	-			398		L -> R (in HYDM).	NACHT.		E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	37	c.1194C>A	CCDS33109.1																																																																																				0.692	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		7	20	1	0	1.58986e-06	0.008291	1.99374e-06	7	20				
NLRP7	199713	broad.mit.edu	37	19	55451569	55451569	+	Nonsense_Mutation	SNP	G	G	T	rs202205894		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:55451569G>T	ENST00000590030.1	-	3	658	c.618C>A	c.(616-618)taC>taA	p.Y206*	NLRP7_ENST00000448121.2_Nonsense_Mutation_p.Y206*|NLRP7_ENST00000340844.2_Nonsense_Mutation_p.Y206*|NLRP7_ENST00000328092.5_Nonsense_Mutation_p.Y206*|NLRP7_ENST00000588756.1_Nonsense_Mutation_p.Y206*|NLRP7_ENST00000446217.1_Nonsense_Mutation_p.Y234*|NLRP7_ENST00000592784.1_Nonsense_Mutation_p.Y206*			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	206	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GGTAGAACGCGTATCTGAGCG	0.587																																							uc002qih.3		NA																	0				large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(616-618)TAC>TAA		NACHT, leucine rich repeat and PYD containing 7							111.0	106.0	108.0					19																	55451569		2203	4300	6503	SO:0001587	stop_gained	199713						ATP binding	g.chr19:55451569G>T	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.618C>A	19.37:g.55451569G>T	ENSP00000465520:p.Tyr206*		Somatic				NLRP7_uc002qig.3_Nonsense_Mutation_p.Y206*|NLRP7_uc002qii.3_Nonsense_Mutation_p.Y206*|NLRP7_uc010esk.2_Nonsense_Mutation_p.Y206*|NLRP7_uc010esl.2_Nonsense_Mutation_p.Y234*	p.Y206*	NM_206828	NP_996611	WXS	Illumina HiSeq	Unspecified	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	4	694	-			206			NACHT.		E9PE16|Q32MH8|Q7RTR1	Nonsense_Mutation	SNP	ENST00000590030.1	37	c.618C>A	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827226	0.50739	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217	.	.	.	1.88	-3.26	0.05064	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3121	0.32077	0.4564:0.0:0.5436:0.0	.	.	.	.	X	206;206;206;234	.	ENSP00000329568:Y206X	Y	-	3	2	NLRP7	60143381	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.486000	0.06513	-1.144000	0.02862	-0.379000	0.06801	TAC		0.587	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		32	58	1	0	1.39806e-14	0.008361	2.27642e-14	32	58				
PPP6R1	22870	broad.mit.edu	37	19	55751251	55751251	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:55751251C>A	ENST00000412770.2	-	13	2072	c.1506G>T	c.(1504-1506)tgG>tgT	p.W502C	PPP6R1_ENST00000587283.1_Missense_Mutation_p.W502C	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	502					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CGAAGGCTTCCCACTGCTCCT	0.632																																							uc002qjw.3		NA																	0					0						c.(1504-1506)TGG>TGT		SAPS domain family, member 1							43.0	53.0	49.0					19																	55751251		2023	4178	6201	SO:0001583	missense	22870				regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding	g.chr19:55751251C>A	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1506G>T	19.37:g.55751251C>A	ENSP00000414202:p.Trp502Cys		Somatic				SAPS1_uc002qjv.2_Missense_Mutation_p.W564C	p.W502C	NM_014931	NP_055746	WXS	Illumina HiSeq	Unspecified	Q9UPN7	PP6R1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)	13	1748	-		Renal(1328;0.245)	502					Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	37	c.1506G>T	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360364	0.61403	.	.	ENSG00000105063	ENST00000412770	D	0.82081	-1.57	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000018	D	0.93396	0.7894	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94768	0.7942	10	0.87932	D	0	-14.8585	17.4054	0.87472	0.0:1.0:0.0:0.0	.	502	Q9UPN7	PP6R1_HUMAN	C	502	ENSP00000414202:W502C	ENSP00000414202:W502C	W	-	3	0	PPP6R1	60443063	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	7.050000	0.76620	2.719000	0.93026	0.557000	0.71058	TGG		0.632	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931		11	30	1	0	1.5842e-08	0.001855	2.18003e-08	11	30				
U2AF2	11338	broad.mit.edu	37	19	56180848	56180848	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:56180848G>T	ENST00000308924.4	+	11	1123	c.1083G>T	c.(1081-1083)ccG>ccT	p.P361P	CTD-2537I9.12_ENST00000585940.1_RNA|U2AF2_ENST00000590551.1_Silent_p.P193P|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000450554.2_Silent_p.P357P			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	361					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TGCAAGTGCCGGGCTTGATGA	0.647																																							uc002qlu.2		NA																	0				ovary(1)	1						c.(1081-1083)CCG>CCT		U2 (RNU2) small nuclear RNA auxiliary factor 2							62.0	63.0	63.0					19																	56180848		2203	4299	6502	SO:0001819	synonymous_variant	11338				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding	g.chr19:56180848G>T	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.1083G>T	19.37:g.56180848G>T			Somatic				U2AF2_uc002qlt.2_Silent_p.P357P	p.P361P	NM_007279	NP_009210	WXS	Illumina HiSeq	Unspecified	P26368	U2AF2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)	11	2138	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	361					Q96HC5	Silent	SNP	ENST00000308924.4	37	c.1083G>T	CCDS12933.1																																																																																				0.647	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279		4	31	1	0	0.00909568	0.009096	0.00963801	4	31				
NLRP5	126206	broad.mit.edu	37	19	56538692	56538692	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:56538692G>A	ENST00000390649.3	+	7	1093	c.1093G>A	c.(1093-1095)Gat>Aat	p.D365N		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	365	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGACGGTTTCGATGACCTGGG	0.547																																							uc002qmj.2		NA																	0				ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(1093-1095)GAT>AAT		NACHT, LRR and PYD containing protein 5							46.0	47.0	47.0					19																	56538692		2079	4219	6298	SO:0001583	missense	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56538692G>A	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1093G>A	19.37:g.56538692G>A	ENSP00000375063:p.Asp365Asn		Somatic				NLRP5_uc002qmi.2_Missense_Mutation_p.D346N	p.D365N	NM_153447	NP_703148	WXS	Illumina HiSeq	Unspecified	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	7	1093	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	365			NACHT.		A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	c.1093G>A	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010999	0.54361	.	.	ENSG00000171487	ENST00000390649	D	0.88354	-2.37	3.35	2.31	0.28768	NACHT nucleoside triphosphatase (1);	0.408988	0.18032	N	0.153882	D	0.93387	0.7891	M	0.85099	2.735	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84623	0.0685	10	0.87932	D	0	.	6.7707	0.23593	0.1299:0.0:0.8701:0.0	.	365	P59047	NALP5_HUMAN	N	365	ENSP00000375063:D365N	ENSP00000375063:D365N	D	+	1	0	NLRP5	61230504	0.997000	0.39634	0.008000	0.14137	0.025000	0.11179	4.073000	0.57570	0.975000	0.38392	0.655000	0.94253	GAT		0.547	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		4	21	0	0	0	0.009096	0	4	21				
ZNF667	63934	broad.mit.edu	37	19	56953937	56953937	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:56953937G>T	ENST00000504904.3	-	7	1146	c.427C>A	c.(427-429)Cct>Act	p.P143T	ZNF667_ENST00000292069.6_Missense_Mutation_p.P143T|ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000342634.3_Missense_Mutation_p.P271T			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		CATTTTAAAGGTTTCTTCCCT	0.378																																							uc002qnd.2		NA																	0				pancreas(1)	1						c.(427-429)CCT>ACT		zinc finger protein 667							99.0	104.0	102.0					19																	56953937		2203	4300	6503	SO:0001583	missense	63934				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:56953937G>T		CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.427C>A	19.37:g.56953937G>T	ENSP00000439402:p.Pro143Thr		Somatic				ZNF667_uc010etl.2_5'UTR|ZNF667_uc002qne.2_Missense_Mutation_p.P143T|ZNF667_uc010etm.2_Missense_Mutation_p.P86T	p.P143T	NM_022103	NP_071386	WXS	Illumina HiSeq	Unspecified	Q5HYK9	ZN667_HUMAN		GBM - Glioblastoma multiforme(193;0.0615)	5	589	-		Colorectal(82;0.000256)|Ovarian(87;0.243)	143					B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	ENST00000504904.3	37	c.427C>A	CCDS12944.1	.	.	.	.	.	.	.	.	.	.	G	4.468	0.086811	0.08583	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000360227	T;T;T	0.16897	2.31;2.31;2.31	4.86	-5.11	0.02901	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.934161	0.08869	N	0.881787	T	0.15825	0.0381	M	0.67397	2.05	0.09310	N	1	P;B	0.35793	0.521;0.379	B;B	0.38378	0.272;0.129	T	0.23190	-1.0195	10	0.62326	D	0.03	0.0012	2.7009	0.05149	0.1808:0.3843:0.3083:0.1266	.	271;143	E7EPS0;Q5HYK9	.;ZN667_HUMAN	T	271;143;143;17	ENSP00000344699:P271T;ENSP00000439402:P143T;ENSP00000292069:P143T	ENSP00000292069:P143T	P	-	1	0	ZNF667	61645749	0.000000	0.05858	0.029000	0.17559	0.067000	0.16453	-0.536000	0.06135	-1.024000	0.03338	-0.237000	0.12165	CCT		0.378	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458394.1	NM_022103		9	103	1	0	3.09899e-07	0.004482	3.99083e-07	9	103				
ZIM2	23619	broad.mit.edu	37	19	57293363	57293363	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:57293363T>A	ENST00000391708.3	-	10	1146	c.604A>T	c.(604-606)Agg>Tgg	p.R202W	ZIM2_ENST00000593711.1_Missense_Mutation_p.R202W|ZIM2_ENST00000221722.5_Missense_Mutation_p.R202W|ZIM2_ENST00000599935.1_Missense_Mutation_p.R202W|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000601070.1_Missense_Mutation_p.R202W|AC006115.3_ENST00000594400.1_RNA|AC006115.3_ENST00000595954.1_RNA	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	202	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		ATCACCTCCCTGTAGAGGTTT	0.512																																							uc002qnr.2		NA																	0				ovary(3)	3						c.(604-606)AGG>TGG		zinc finger, imprinted 2							137.0	128.0	131.0					19																	57293363		2203	4300	6503	SO:0001583	missense	23619				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57293363T>A	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.604A>T	19.37:g.57293363T>A	ENSP00000375589:p.Arg202Trp		Somatic				uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_5'UTR|ZIM2_uc010ygr.1_5'UTR|ZIM2_uc002qnq.2_Missense_Mutation_p.R202W|ZIM2_uc010etp.2_Missense_Mutation_p.R202W|ZIM2_uc010ygs.1_Missense_Mutation_p.R202W	p.R202W	NM_015363	NP_056178	WXS	Illumina HiSeq	Unspecified	Q9NZV7	ZIM2_HUMAN		GBM - Glioblastoma multiforme(193;0.0314)	9	986	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	202			KRAB.		Q2M3K1	Missense_Mutation	SNP	ENST00000391708.3	37	c.604A>T	CCDS33123.1	.	.	.	.	.	.	.	.	.	.	T	12.61	1.989055	0.35131	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.02631	4.22;4.22	5.21	-4.18	0.03846	Krueppel-associated box (4);	.	.	.	.	T	0.04952	0.0133	M	0.83384	2.64	.	.	.	B	0.25390	0.125	B	0.29598	0.104	T	0.37267	-0.9713	8	0.62326	D	0.03	.	4.5608	0.12160	0.2393:0.0:0.2361:0.5245	.	202	Q9NZV7	ZIM2_HUMAN	W	202	ENSP00000375589:R202W;ENSP00000221722:R202W	ENSP00000221722:R202W	R	-	1	2	ZIM2	61985175	0.000000	0.05858	0.004000	0.12327	0.126000	0.20510	-0.967000	0.03821	-0.294000	0.08973	-0.894000	0.02916	AGG		0.512	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2			12	105	0	0	0	0.001368	0	12	105				
ZIM3	114026	broad.mit.edu	37	19	57647108	57647108	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:57647108G>C	ENST00000269834.1	-	5	982	c.597C>G	c.(595-597)agC>agG	p.S199R	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTCTTCCACAGCTATGACATT	0.433																																							uc002qnz.1		NA																	0				pancreas(1)|skin(1)	2						c.(595-597)AGC>AGG		zinc finger, imprinted 3							160.0	155.0	157.0					19																	57647108		2203	4300	6503	SO:0001583	missense	114026				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57647108G>C	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.597C>G	19.37:g.57647108G>C	ENSP00000269834:p.Ser199Arg		Somatic					p.S199R	NM_052882	NP_443114	WXS	Illumina HiSeq	Unspecified	Q96PE6	ZIM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	983	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)	199			C2H2-type 2.		Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	c.597C>G	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	7.419	0.636426	0.14386	.	.	ENSG00000141946	ENST00000269834	T	0.07567	3.18	2.08	-4.17	0.03857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05090	0.0136	N	0.13043	0.29	0.09310	N	1	B	0.19935	0.04	B	0.29440	0.102	T	0.44345	-0.9334	9	0.87932	D	0	.	6.3801	0.21529	0.0:0.5133:0.1514:0.3353	.	199	Q96PE6	ZIM3_HUMAN	R	199	ENSP00000269834:S199R	ENSP00000269834:S199R	S	-	3	2	ZIM3	62338920	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.256000	0.00265	-1.285000	0.02387	0.313000	0.20887	AGC		0.433	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1			37	134	0	0	0	0.00623	0	37	134				
RNASEH1	246243	broad.mit.edu	37	2	3598004	3598004	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:3598004C>A	ENST00000315212.3	-	4	823	c.468G>T	c.(466-468)ccG>ccT	p.P156P	RP13-512J5.1_ENST00000438485.1_5'Flank	NM_002936.3	NP_002927.2	O60930	RNH1_HUMAN	ribonuclease H1	156	RNase H. {ECO:0000255|PROSITE- ProRule:PRU00408}.				mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	13	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		TTCCTGCTCGCGGCCTTCTAC	0.502																																							uc002qxt.2		NA																	0				ovary(1)	1						c.(466-468)CCG>CCT		ribonuclease H1							109.0	120.0	116.0					2																	3598004		2203	4300	6503	SO:0001819	synonymous_variant	246243				RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding	g.chr2:3598004C>A	AF039652	CCDS1647.1	2p25	2008-03-11			ENSG00000171865	ENSG00000171865	3.1.26.-		18466	protein-coding gene	gene with protein product	"""RNase H1"""	604123				12036296, 17964265	Standard	XR_244873		Approved		uc002qxt.3	O60930	OTTHUMG00000090279	ENST00000315212.3:c.468G>T	2.37:g.3598004C>A			Somatic				RNASEH1_uc002qxs.2_Silent_p.P39P	p.P156P	NM_002936	NP_002927	WXS	Illumina HiSeq	Unspecified	O60930	RNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)	4	558	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)		156			RNase H.		B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Silent	SNP	ENST00000315212.3	37	c.468G>T	CCDS1647.1																																																																																				0.502	RNASEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206605.2			47	116	1	0	3.39706e-21	0.00361	6.17827e-21	47	116				
LPIN1	23175	broad.mit.edu	37	2	11943039	11943039	+	Missense_Mutation	SNP	G	G	T	rs145608684		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:11943039G>T	ENST00000256720.2	+	14	1878	c.1785G>T	c.(1783-1785)aaG>aaT	p.K595N	LPIN1_ENST00000396099.1_Missense_Mutation_p.K637N|LPIN1_ENST00000449576.2_Missense_Mutation_p.K680N|LPIN1_ENST00000425416.2_Missense_Mutation_p.K601N|LPIN1_ENST00000404113.2_Missense_Mutation_p.K96N|LPIN1_ENST00000396097.1_Missense_Mutation_p.K325N	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	595					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		CCAGGGTAAAGCATGAATCAT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20711	0.0		0.0	False		,,,				2504	0.0						uc010yjn.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(1783-1785)AAG>AAT		lipin 1		G	ASN/LYS	3,4403	6.2+/-15.9	0,3,2200	222.0	208.0	213.0		1785	4.7	1.0	2	dbSNP_134	213	0,8600		0,0,4300	yes	missense	LPIN1	NM_145693.1	94	0,3,6500	TT,TG,GG		0.0,0.0681,0.0231	possibly-damaging	595/891	11943039	3,13003	2203	4300	6503	SO:0001583	missense	23175				fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity	g.chr2:11943039G>T	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1785G>T	2.37:g.11943039G>T	ENSP00000256720:p.Lys595Asn		Somatic				LPIN1_uc010yjm.1_Missense_Mutation_p.K680N|LPIN1_uc002rbt.2_Missense_Mutation_p.K595N|LPIN1_uc010yjo.1_Missense_Mutation_p.K96N	p.K595N	NM_145693	NP_663731	WXS	Illumina HiSeq	Unspecified	Q14693	LPIN1_HUMAN		Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)	15	2059	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		595					A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	c.1785G>T	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981378	0.53827	6.81E-4	0.0	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113;ENST00000454151	D;D;D;D;T;T;T	0.81821	-1.54;-1.53;-1.52;-1.52;-1.36;-0.49;0.36	4.69	4.69	0.59074	.	0.196730	0.53938	D	0.000055	D	0.83538	0.5276	L	0.54908	1.71	0.80722	D	1	B;D;P	0.89917	0.114;1.0;0.94	B;D;P	0.91635	0.087;0.999;0.696	T	0.80084	-0.1530	10	0.22109	T	0.4	-32.0934	6.4387	0.21837	0.2377:0.0:0.7623:0.0	.	96;680;595	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	N	680;637;601;595;325;96;122	ENSP00000397908:K680N;ENSP00000379406:K637N;ENSP00000401522:K601N;ENSP00000256720:K595N;ENSP00000379404:K325N;ENSP00000386120:K96N;ENSP00000413714:K122N	ENSP00000256720:K595N	K	+	3	2	LPIN1	11860490	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	1.337000	0.33862	2.310000	0.77875	0.561000	0.74099	AAG		0.468	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693		7	252	1	0	1.26484e-09	0.00308	1.81694e-09	7	252				
PLB1	151056	broad.mit.edu	37	2	28739673	28739673	+	Splice_Site	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:28739673A>T	ENST00000327757.5	+	2	99		c.e2-1		PLB1_ENST00000422425.2_Splice_Site	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1						glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GCTTTCTTTCAGGGACCCCTC	0.488																																							uc002rmb.1		NA																	0				ovary(4)|large_intestine(2)|skin(2)|breast(1)	9						c.e2-2		phospholipase B1 precursor							127.0	129.0	129.0					2																	28739673		2203	4300	6503	SO:0001630	splice_region_variant	151056				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	g.chr2:28739673A>T		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.56-1A>T	2.37:g.28739673A>T			Somatic				PLB1_uc010ezj.1_Splice_Site_p.G19_splice	p.G19_splice	NM_153021	NP_694566	WXS	Illumina HiSeq	Unspecified	Q6P1J6	PLB1_HUMAN			2	56	+	Acute lymphoblastic leukemia(172;0.155)							A8KAX2|Q53S03|Q8IUP7|Q96DP9	Splice_Site	SNP	ENST00000327757.5	37	c.56_splice	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.237126	0.39498	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000404858	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7451	0.51815	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLB1	28593177	0.997000	0.39634	0.555000	0.28281	0.036000	0.12997	4.084000	0.57650	2.090000	0.63153	0.459000	0.35465	.		0.488	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		Intron	28	77	0	0	0	0.005443	0	28	77				
PREPL	9581	broad.mit.edu	37	2	44548542	44548542	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:44548542C>A	ENST00000409936.1	-	15	2574	c.2137G>T	c.(2137-2139)Gac>Tac	p.D713Y	PREPL_ENST00000541738.1_Missense_Mutation_p.D624Y|PREPL_ENST00000409957.1_Missense_Mutation_p.D624Y|PREPL_ENST00000409411.1_Missense_Mutation_p.D624Y|PREPL_ENST00000409272.1_Missense_Mutation_p.D713Y|PREPL_ENST00000260648.6_Missense_Mutation_p.D713Y|PREPL_ENST00000378511.3_Missense_Mutation_p.D651Y|SLC3A1_ENST00000260649.6_3'UTR|PREPL_ENST00000410081.1_Missense_Mutation_p.D713Y|PREPL_ENST00000378520.3_Missense_Mutation_p.D647Y	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	713						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGGTGCTGTCAAGTCCAAGT	0.343																																							uc002ruf.2		NA																	0				ovary(1)	1						c.(2137-2139)GAC>TAC		prolyl endopeptidase-like isoform C							65.0	69.0	67.0					2																	44548542		2203	4300	6503	SO:0001583	missense	9581				proteolysis	cytosol	serine-type endopeptidase activity	g.chr2:44548542C>A	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.2137G>T	2.37:g.44548542C>A	ENSP00000386543:p.Asp713Tyr		Somatic				PREPL_uc002rug.2_Missense_Mutation_p.D647Y|PREPL_uc002ruh.2_Missense_Mutation_p.D651Y|PREPL_uc010fax.2_Missense_Mutation_p.D713Y|PREPL_uc002rui.3_Missense_Mutation_p.D624Y|PREPL_uc002ruj.1_Missense_Mutation_p.D624Y|PREPL_uc002ruk.1_Missense_Mutation_p.D713Y	p.D713Y	NM_006036	NP_006027	WXS	Illumina HiSeq	Unspecified	Q4J6C6	PPCEL_HUMAN			14	2172	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	713					A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	37	c.2137G>T	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709841	0.68730	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511	.	.	.	5.1	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	N	0.08118	0	0.48288	D	0.999626	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.987;0.968	T	0.59899	-0.7367	9	0.87932	D	0	-19.3723	11.0385	0.47816	0.0:0.9134:0.0:0.0866	.	651;647;713	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	Y	624;624;624;713;713;713;713;647;651	.	ENSP00000260648:D713Y	D	-	1	0	PREPL	44402046	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.566000	0.45948	1.381000	0.46364	0.655000	0.94253	GAC		0.343	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036		7	27	1	0	0.00307968	0.00308	0.00334304	7	27				
SRBD1	55133	broad.mit.edu	37	2	45616508	45616508	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:45616508C>A	ENST00000263736.4	-	21	2991	c.2929G>T	c.(2929-2931)Gta>Tta	p.V977L	SRBD1_ENST00000490133.1_5'UTR|SRBD1_ENST00000535761.1_Missense_Mutation_p.V496L	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	977	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			ATGTTGAGTACTTGGACTTCC	0.448																																							uc002rus.2		NA																	0				central_nervous_system(1)	1						c.(2929-2931)GTA>TTA		S1 RNA binding domain 1							102.0	102.0	102.0					2																	45616508		2203	4300	6503	SO:0001583	missense	55133				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding	g.chr2:45616508C>A	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2929G>T	2.37:g.45616508C>A	ENSP00000263736:p.Val977Leu		Somatic				SRBD1_uc010yoc.1_Missense_Mutation_p.V496L	p.V977L	NM_018079	NP_060549	WXS	Illumina HiSeq	Unspecified	Q8N5C6	SRBD1_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)		21	3005	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	977			S1 motif.		Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	c.2929G>T	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730953	0.89390	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.54279	0.58;0.58	3.99	3.99	0.46301	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.77644	0.4161	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83705	0.0184	10	0.87932	D	0	.	17.383	0.87409	0.0:1.0:0.0:0.0	.	977	Q8N5C6	SRBD1_HUMAN	L	977;496	ENSP00000263736:V977L;ENSP00000441272:V496L	ENSP00000263736:V977L	V	-	1	0	SRBD1	45470012	1.000000	0.71417	0.945000	0.38365	0.956000	0.61745	7.121000	0.77160	2.517000	0.84864	0.563000	0.77884	GTA		0.448	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079		18	52	1	0	1.00905e-13	0.008871	1.6176e-13	18	52				
BCL11A	53335	broad.mit.edu	37	2	60688990	60688990	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:60688990G>T	ENST00000335712.6	-	4	1284	c.1057C>A	c.(1057-1059)Ccc>Acc	p.P353T	BCL11A_ENST00000356842.4_Missense_Mutation_p.P353T|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.P319T|BCL11A_ENST00000538214.1_Missense_Mutation_p.P319T	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	353	Pro-rich.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GCCAGGAAGGGCGGCTTGCTA	0.647			T	IGH@	B-CLL																																		uc002sae.1		NA		Dom	yes		2	2p13	53335	T	B-cell CLL/lymphoma 11A			L	IGH@		B-CLL		0				central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13						c.(1057-1059)CCC>ACC		B-cell CLL/lymphoma 11A isoform 1							50.0	60.0	57.0					2																	60688990		2201	4297	6498	SO:0001583	missense	53335				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding	g.chr2:60688990G>T	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1057C>A	2.37:g.60688990G>T	ENSP00000338774:p.Pro353Thr		Somatic				BCL11A_uc002sab.2_Missense_Mutation_p.P353T|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Missense_Mutation_p.P319T|BCL11A_uc002sad.1_Missense_Mutation_p.P201T|BCL11A_uc002saf.1_Missense_Mutation_p.P319T	p.P353T	NM_022893	NP_075044	WXS	Illumina HiSeq	Unspecified	Q9H165	BC11A_HUMAN	LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)		4	1285	-			353			Pro-rich.		D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	c.1057C>A	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614840	0.28712	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000335712;ENST00000358510	T;T;T;T	0.10763	2.84;3.05;3.08;3.01	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.33731	0.0873	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.976;1.0	D;D;P;D	0.83275	0.996;0.991;0.893;0.99	T	0.00380	-1.1776	10	0.34782	T	0.22	-2.3313	19.9231	0.97094	0.0:0.0:1.0:0.0	.	319;319;353;353	F5H2Y4;Q9H165-6;Q9H165;D9YZV9	.;.;BC11A_HUMAN;.	T	353;389;319;353;319	ENSP00000349300:P353T;ENSP00000438303:P319T;ENSP00000338774:P353T;ENSP00000351307:P319T	ENSP00000338774:P353T	P	-	1	0	BCL11A	60542494	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.601000	0.74136	2.717000	0.92951	0.655000	0.94253	CCC		0.647	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893		21	87	1	0	1.28384e-07	0.012319	1.68826e-07	21	87				
USP34	9736	broad.mit.edu	37	2	61575333	61575333	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:61575333T>C	ENST00000398571.2	-	15	2033	c.1957A>G	c.(1957-1959)Att>Gtt	p.I653V		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	653					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CCCAGGCAAATGCCTGCTTGA	0.458																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(1957-1959)ATT>GTT		ubiquitin specific protease 34							66.0	62.0	63.0					2																	61575333		1919	4125	6044	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61575333T>C	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.1957A>G	2.37:g.61575333T>C	ENSP00000381577:p.Ile653Val		Somatic					p.I653V	NM_014709	NP_055524	WXS	Illumina HiSeq	Unspecified	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		15	1979	-			653					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.1957A>G	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	10.53	1.377030	0.24857	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.52983	0.64	5.75	3.31	0.37934	.	0.286388	0.38837	N	0.001552	T	0.28896	0.0717	N	0.19112	0.55	0.34057	D	0.65681	B	0.18461	0.028	B	0.10450	0.005	T	0.25984	-1.0116	10	0.23302	T	0.38	.	8.7602	0.34669	0.0:0.0668:0.1286:0.8047	.	653	Q70CQ2	UBP34_HUMAN	V	501;501;653	ENSP00000381577:I653V	ENSP00000263989:I501V	I	-	1	0	USP34	61428837	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	1.232000	0.32636	0.420000	0.25954	0.455000	0.32223	ATT		0.458	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			6	41	0	0	0	0.001168	0	6	41				
NAGK	55577	broad.mit.edu	37	2	71300684	71300684	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:71300684A>G	ENST00000244204.6	+	6	601	c.539A>G	c.(538-540)gAt>gGt	p.D180G	NAGK_ENST00000443938.2_Missense_Mutation_p.D180G|NAGK_ENST00000418807.3_Missense_Mutation_p.D129G|NAGK_ENST00000455662.2_Missense_Mutation_p.D226G|NAGK_ENST00000443872.2_Missense_Mutation_p.D32G			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	180					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	GCTCCTCATGATATCGGCTAC	0.522																																							uc002shp.3		NA																	0					0						c.(538-540)GAT>GGT		N-Acetylglucosamine kinase	N-Acetyl-D-glucosamine(DB00141)						266.0	254.0	258.0					2																	71300684		2203	4300	6503	SO:0001583	missense	55577				N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding	g.chr2:71300684A>G	AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.539A>G	2.37:g.71300684A>G	ENSP00000244204:p.Asp180Gly		Somatic				NAGK_uc010fea.2_RNA|NAGK_uc002shq.3_Missense_Mutation_p.D31G|NAGK_uc002shr.2_Missense_Mutation_p.D129G	p.D180G	NM_017567	NP_060037	WXS	Illumina HiSeq	Unspecified	Q9UJ70	NAGK_HUMAN			6	945	+			180					B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	ENST00000244204.6	37	c.539A>G		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	23.4|23.4|23.4	4.416953|4.416953|4.416953	0.83449|0.83449|0.83449	.|.|.	.|.|.	ENSG00000124357|ENSG00000124357|ENSG00000124357	ENST00000244204;ENST00000455662;ENST00000531934;ENST00000418807;ENST00000529236|ENST00000443938|ENST00000524537	T;T;T|.|.	0.48522|.|.	1.38;1.37;0.81|.|.	5.99|5.99|5.99	5.99|5.99|5.99	0.97316|0.97316|0.97316	ATPase, BadF/BadG/BcrA/BcrD type (1);|.|.	0.445129|.|.	0.23450|.|.	N|.|.	0.048041|.|.	T|T|.	0.75700|0.75700|.	0.3885|0.3885|.	M|M|M	0.79475|0.79475|0.79475	2.455|2.455|2.455	0.80722|0.80722|0.80722	D|D|D	1|1|1	P|.|.	0.50369|.|.	0.934|.|.	P|.|.	0.56648|.|.	0.803|.|.	T|T|.	0.76743|0.76743|.	-0.2847|-0.2847|.	10|5|.	0.24483|.|.	T|.|.	0.36|.|.	-10.8563|-10.8563|-10.8563	14.4413|14.4413|14.4413	0.67321|0.67321|0.67321	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	180|.|.	Q9UJ70|.|.	NAGK_HUMAN|.|.	G|V|W	180;226;32;129;74|202|6	ENSP00000244204:D180G;ENSP00000389087:D226G;ENSP00000396070:D129G|.|.	ENSP00000244204:D180G|.|.	D|I|X	+|+|+	2|1|3	0|0|0	NAGK|NAGK|NAGK	71154192|71154192|71154192	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.941000|0.941000|0.941000	0.58515|0.58515|0.58515	5.398000|5.398000|5.398000	0.66308|0.66308|0.66308	2.296000|2.296000|2.296000	0.77279|0.77279|0.77279	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAT|ATA|TGA		0.522	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1			76	253	0	0	0	0.00361	0	76	253				
DYSF	8291	broad.mit.edu	37	2	71886086	71886086	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:71886086C>T	ENST00000258104.3	+	43	4994	c.4717C>T	c.(4717-4719)Cag>Tag	p.Q1573*	DYSF_ENST00000409651.1_Nonsense_Mutation_p.Q1605*|DYSF_ENST00000429174.2_Nonsense_Mutation_p.Q1594*|DYSF_ENST00000409582.3_Nonsense_Mutation_p.Q1611*|DYSF_ENST00000409366.1_Nonsense_Mutation_p.Q1595*|DYSF_ENST00000410041.1_Nonsense_Mutation_p.Q1591*|DYSF_ENST00000409744.1_Nonsense_Mutation_p.Q1581*|DYSF_ENST00000394120.2_Nonsense_Mutation_p.Q1574*|DYSF_ENST00000413539.2_Nonsense_Mutation_p.Q1604*|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000410020.3_Nonsense_Mutation_p.Q1612*|DYSF_ENST00000409762.1_Nonsense_Mutation_p.Q1590*	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1573	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GCTGGCCGCCCAGGGACCCCA	0.557																																							uc002sie.2		NA																	0				ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(4717-4719)CAG>TAG		dysferlin isoform 8							85.0	92.0	89.0					2																	71886086		2203	4300	6503	SO:0001587	stop_gained	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71886086C>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4717C>T	2.37:g.71886086C>T	ENSP00000258104:p.Gln1573*		Somatic				DYSF_uc010feg.2_Nonsense_Mutation_p.Q1604*|DYSF_uc010feh.2_Nonsense_Mutation_p.Q1580*|DYSF_uc002sig.3_Nonsense_Mutation_p.Q1559*|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Nonsense_Mutation_p.Q1594*|DYSF_uc010fef.2_Nonsense_Mutation_p.Q1611*|DYSF_uc010fei.2_Nonsense_Mutation_p.Q1590*|DYSF_uc010fek.2_Nonsense_Mutation_p.Q1591*|DYSF_uc010fej.2_Nonsense_Mutation_p.Q1581*|DYSF_uc010fel.2_Nonsense_Mutation_p.Q1560*|DYSF_uc010feo.2_Nonsense_Mutation_p.Q1605*|DYSF_uc010fem.2_Nonsense_Mutation_p.Q1595*|DYSF_uc010fen.2_Nonsense_Mutation_p.Q1612*|DYSF_uc002sif.2_Nonsense_Mutation_p.Q1574*|DYSF_uc010yqy.1_Nonsense_Mutation_p.Q454*|DYSF_uc010yqz.1_Nonsense_Mutation_p.Q334*	p.Q1573*	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			43	5093	+			1573			Cytoplasmic (Potential).|C2 5.		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Nonsense_Mutation	SNP	ENST00000258104.3	37	c.4717C>T	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	46	12.471037	0.99670	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	5.36	5.36	0.76844	.	0.496845	0.21699	N	0.070447	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-25.5631	16.6027	0.84820	0.0:1.0:0.0:0.0	.	.	.	.	X	1604;1590;1611;1594;1573;1605;1574;1581;1595;1612;1591	.	ENSP00000258104:Q1573X	Q	+	1	0	DYSF	71739594	1.000000	0.71417	0.996000	0.52242	0.692000	0.40212	4.553000	0.60753	2.508000	0.84585	0.650000	0.86243	CAG		0.557	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		28	118	0	0	0	0.009535	0	28	118				
TET3	200424	broad.mit.edu	37	2	74307667	74307667	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:74307667C>T	ENST00000409262.3	+	3	2223	c.2223C>T	c.(2221-2223)atC>atT	p.I741I		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	741					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGAAGGTCATCTACACGGGGA	0.557																																							uc002skb.3		NA																	0					0						c.(2221-2223)ATC>ATT		tet oncogene family member 3							55.0	58.0	57.0					2																	74307667		1962	4147	6109	SO:0001819	synonymous_variant	200424						metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr2:74307667C>T		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2223C>T	2.37:g.74307667C>T			Somatic					p.I741I	NM_144993	NP_659430	WXS	Illumina HiSeq	Unspecified	O43151	TET3_HUMAN			3	2223	+			741					A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	ENST00000409262.3	37	c.2223C>T	CCDS46339.1																																																																																				0.557	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4			5	26	0	0	0	0.001168	0	5	26				
REG1B	5968	broad.mit.edu	37	2	79314699	79314699	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:79314699G>T	ENST00000305089.3	-	2	120	c.40C>A	c.(40-42)Ctg>Atg	p.L14M		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	14					cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						AGGAACATCAGGGAGGAGATC	0.483																																							uc002sny.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(40-42)CTG>ATG		regenerating islet-derived 1 beta precursor							143.0	118.0	126.0					2																	79314699		2203	4300	6503	SO:0001583	missense	5968				cell proliferation	extracellular region	sugar binding	g.chr2:79314699G>T		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.40C>A	2.37:g.79314699G>T	ENSP00000303206:p.Leu14Met		Somatic				REG1B_uc010ffv.1_Missense_Mutation_p.L14M|REG1B_uc010ffw.2_Missense_Mutation_p.L14M	p.L14M	NM_006507	NP_006498	WXS	Illumina HiSeq	Unspecified	P48304	REG1B_HUMAN			2	152	-			14						Missense_Mutation	SNP	ENST00000305089.3	37	c.40C>A	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	15.90	2.969208	0.53614	.	.	ENSG00000172023	ENST00000305089	T	0.05382	3.45	2.71	1.8	0.24995	.	0.000000	0.29126	N	0.013075	T	0.22859	0.0552	M	0.86740	2.835	0.21627	N	0.999616	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.02307	-1.1179	10	0.72032	D	0.01	.	5.8691	0.18793	0.1547:0.0:0.8453:0.0	.	14;14	Q6ICS1;P48304	.;REG1B_HUMAN	M	14	ENSP00000303206:L14M	ENSP00000303206:L14M	L	-	1	2	REG1B	79168207	0.990000	0.36364	0.646000	0.29493	0.459000	0.32528	0.857000	0.27831	0.678000	0.31325	0.555000	0.69702	CTG		0.483	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507		6	21	1	0	0.00116845	0.001168	0.0012886	6	21				
REG1A	5967	broad.mit.edu	37	2	79348739	79348739	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:79348739G>A	ENST00000233735.1	+	3	219	c.116G>A	c.(115-117)gGc>gAc	p.G39D		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	39	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						TGCCCAGAAGGCACCAATGCC	0.532																																							uc002snz.2		NA																	0					0						c.(115-117)GGC>GAC		regenerating islet-derived 1 alpha precursor							178.0	180.0	179.0					2																	79348739		2203	4300	6503	SO:0001583	missense	5967				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding	g.chr2:79348739G>A		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.116G>A	2.37:g.79348739G>A	ENSP00000233735:p.Gly39Asp		Somatic				REG1A_uc010ffx.1_Missense_Mutation_p.G39D|REG1A_uc010ysd.1_Missense_Mutation_p.G39D	p.G39D	NM_002909	NP_002900	WXS	Illumina HiSeq	Unspecified	P05451	REG1A_HUMAN			3	219	+			39			C-type lectin.		P11379|Q4ZG28	Missense_Mutation	SNP	ENST00000233735.1	37	c.116G>A	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	g	19.50	3.840245	0.71488	.	.	ENSG00000115386	ENST00000233735	T	0.10960	2.82	2.85	1.95	0.26073	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.000000	0.39687	N	0.001281	T	0.27765	0.0683	M	0.80332	2.49	0.18873	N	0.999985	D;D	0.89917	0.96;1.0	P;D	0.85130	0.513;0.997	T	0.02450	-1.1157	10	0.52906	T	0.07	.	5.5778	0.17233	0.1568:0.0:0.8432:0.0	.	39;39	A8K7G6;P05451	.;REG1A_HUMAN	D	39	ENSP00000233735:G39D	ENSP00000233735:G39D	G	+	2	0	REG1A	79202247	0.928000	0.31464	0.203000	0.23512	0.786000	0.44442	2.297000	0.43593	0.746000	0.32786	0.563000	0.77884	GGC		0.532	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909		83	194	0	0	0	0.00361	0	83	194				
REG3A	5068	broad.mit.edu	37	2	79386464	79386464	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:79386464T>A	ENST00000409839.3	-	2	104	c.68A>T	c.(67-69)cAg>cTg	p.Q23L	AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000305165.2_Missense_Mutation_p.Q23L|REG3A_ENST00000393878.1_Missense_Mutation_p.Q23L	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	23					acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						ACCTTGAACCTGAGACAGCAG	0.527																																							uc002sod.1		NA																	0				skin(1)	1						c.(67-69)CAG>CTG		pancreatitis-associated protein precursor							183.0	133.0	150.0					2																	79386464		2203	4300	6503	SO:0001583	missense	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79386464T>A	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.68A>T	2.37:g.79386464T>A	ENSP00000386630:p.Gln23Leu		Somatic				REG3A_uc002soe.1_Missense_Mutation_p.Q23L|REG3A_uc002sof.1_Missense_Mutation_p.Q23L	p.Q23L	NM_138938	NP_620355	WXS	Illumina HiSeq	Unspecified	Q06141	REG3A_HUMAN			1	323	-			23						Missense_Mutation	SNP	ENST00000409839.3	37	c.68A>T	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	T	1.083	-0.666391	0.03428	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.13196	2.61;2.61;2.61	3.67	2.46	0.29980	.	1.073890	0.07316	N	0.876716	T	0.12561	0.0305	L	0.52905	1.665	0.09310	N	1	P	0.36065	0.535	B	0.34301	0.179	T	0.30060	-0.9991	10	0.10902	T	0.67	.	6.9987	0.24797	0.0:0.0:0.2336:0.7664	.	23	Q06141	REG3A_HUMAN	L	23	ENSP00000386630:Q23L;ENSP00000377456:Q23L;ENSP00000304311:Q23L	ENSP00000304311:Q23L	Q	-	2	0	REG3A	79239972	0.748000	0.28294	0.022000	0.16811	0.007000	0.05969	0.553000	0.23391	0.723000	0.32274	0.496000	0.49642	CAG		0.527	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		11	38	0	0	0	0.008291	0	11	38				
RAB6C	84084	broad.mit.edu	37	2	130738066	130738066	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:130738066T>C	ENST00000410061.2	+	1	832	c.378T>C	c.(376-378)aaT>aaC	p.N126N	AC079776.7_ENST00000412425.1_RNA	NM_032144.2	NP_115520.2	Q9H0N0	RAB6C_HUMAN	RAB6C, member RAS oncogene family	126	Required for centrosome localization.				cell cycle process (GO:0022402)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of centrosome duplication (GO:0010824)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	5	Colorectal(110;0.1)					TAGTAGGAAATAGAACAGATC	0.413																																							uc002tpx.1		NA																	0				lung(1)	1						c.(376-378)AAT>AAC		RAB6C, member RAS oncogene family							296.0	280.0	285.0					2																	130738066		2203	4300	6503	SO:0001819	synonymous_variant	84084				protein transport|response to drug|small GTPase mediated signal transduction		GTP binding|GTPase activity	g.chr2:130738066T>C	AF124200	CCDS46408.1	2q21.1	2012-07-02			ENSG00000222014	ENSG00000222014		"""RAB, member RAS oncogene"""	16525	protein-coding gene	gene with protein product		612909				11054569, 17426708	Standard	NM_032144		Approved	WTH3	uc002tpx.1	Q9H0N0	OTTHUMG00000153487	ENST00000410061.2:c.378T>C	2.37:g.130738066T>C			Somatic				uc002tpw.1_5'Flank	p.N126N	NM_032144	NP_115520	WXS	Illumina HiSeq	Unspecified	Q9H0N0	RAB6C_HUMAN			1	832	+	Colorectal(110;0.1)		126			GTP (By similarity).		Q53RU3|Q6FIF7|Q9P128	Silent	SNP	ENST00000410061.2	37	c.378T>C	CCDS46408.1																																																																																				0.413	RAB6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331384.1	NM_032144		73	168	0	0	0	0.00361	0	73	168				
NCKAP5	344148	broad.mit.edu	37	2	133541593	133541593	+	Missense_Mutation	SNP	G	G	A	rs539140310		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:133541593G>A	ENST00000409261.1	-	14	3164	c.2791C>T	c.(2791-2793)Ccc>Tcc	p.P931S	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.P931S	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	931	Poly-Pro.			PP -> QS (in Ref. 5; BAA22433). {ECO:0000305}.						NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CCTGGAGGGGGCGGAGGGGAA	0.622																																							uc002ttp.2		NA																	0					0						c.(2791-2793)CCC>TCC		Nck-associated protein 5 isoform 1							18.0	20.0	19.0					2																	133541593		1938	4119	6057	SO:0001583	missense	344148						protein binding	g.chr2:133541593G>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2791C>T	2.37:g.133541593G>A	ENSP00000387128:p.Pro931Ser		Somatic				NCKAP5_uc002ttq.2_Intron	p.P931S	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	3165	-			931	PP -> QS (in Ref. 5; BAA22433).		Poly-Pro.		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.2791C>T	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	g	5.221	0.226321	0.09916	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11821	2.74;2.74	5.18	1.11	0.20524	.	0.657771	0.12430	N	0.469676	T	0.05547	0.0146	N	0.14661	0.345	0.80722	D	1	B	0.27351	0.176	B	0.21917	0.037	T	0.35919	-0.9769	10	0.06891	T	0.86	.	4.6575	0.12624	0.1659:0.0:0.5192:0.3148	.	931	O14513	NCKP5_HUMAN	S	931	ENSP00000387128:P931S;ENSP00000380603:P931S	ENSP00000380603:P931S	P	-	1	0	NCKAP5	133258063	0.994000	0.37717	0.122000	0.21767	0.134000	0.20937	2.151000	0.42263	0.023000	0.15187	0.645000	0.84053	CCC		0.622	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		4	30	0	0	0	0.009096	0	4	30				
LRP1B	53353	broad.mit.edu	37	2	141806654	141806654	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:141806654G>A	ENST00000389484.3	-	11	2661	c.1690C>T	c.(1690-1692)Cac>Tac	p.H564Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	564					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTTTCTGCGTGAAAGTCTAAA	0.438										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(1690-1692)CAC>TAC		low density lipoprotein-related protein 1B							208.0	198.0	201.0					2																	141806654		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141806654G>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1690C>T	2.37:g.141806654G>A	ENSP00000374135:p.His564Tyr	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.H564Y	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	11	2662	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	564			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.1690C>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311595	0.23821	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91237	-2.81	5.49	5.49	0.81192	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.067844	0.64402	U	0.000020	D	0.90106	0.6909	M	0.64567	1.98	0.46981	D	0.999271	B	0.15141	0.012	B	0.11329	0.006	D	0.86403	0.1743	10	0.59425	D	0.04	.	19.3798	0.94527	0.0:0.0:1.0:0.0	.	564	Q9NZR2	LRP1B_HUMAN	Y	564;502	ENSP00000374135:H564Y	ENSP00000374135:H564Y	H	-	1	0	LRP1B	141523124	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	6.572000	0.74005	2.565000	0.86533	0.563000	0.77884	CAC		0.438	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		8	111	0	0	0	0.006214	0	8	111				
LRP1B	53353	broad.mit.edu	37	2	142238100	142238100	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:142238100G>T	ENST00000389484.3	-	3	1179	c.208C>A	c.(208-210)Ccc>Acc	p.P70T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	70	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCTCCTCGGGACCTGAAAAG	0.373										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(208-210)CCC>ACC		low density lipoprotein-related protein 1B							105.0	98.0	100.0					2																	142238100		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:142238100G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.208C>A	2.37:g.142238100G>T	ENSP00000374135:p.Pro70Thr	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.P70T	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	3	1180	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	70			Extracellular (Potential).|LDL-receptor class A 1.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.208C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551499	0.27739	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.89810	-2.57	5.67	4.79	0.61399	.	0.337042	0.27298	N	0.020001	D	0.82540	0.5059	N	0.24115	0.695	0.41404	D	0.987695	B	0.14805	0.011	B	0.10450	0.005	T	0.76940	-0.2773	10	0.29301	T	0.29	.	16.9914	0.86354	0.0:0.1276:0.8724:0.0	.	70	Q9NZR2	LRP1B_HUMAN	T	70;6	ENSP00000374135:P70T	ENSP00000374135:P70T	P	-	1	0	LRP1B	141954570	1.000000	0.71417	0.993000	0.49108	0.021000	0.10359	3.645000	0.54389	1.517000	0.48917	-0.176000	0.13171	CCC		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		7	22	1	0	2.7689e-08	0.001984	3.76038e-08	7	22				
ERMN	57471	broad.mit.edu	37	2	158178139	158178139	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:158178139G>T	ENST00000410096.1	-	3	790	c.499C>A	c.(499-501)Caa>Aaa	p.Q167K	ERMN_ENST00000397283.2_Missense_Mutation_p.Q180K|ERMN_ENST00000535935.1_Missense_Mutation_p.Q61K|ERMN_ENST00000420719.2_Missense_Mutation_p.Q147K	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	167					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)				endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						ATGTCAGCTTGGCTAGGTTTT	0.408																																							uc002tzh.2		NA																	0				ovary(1)|skin(1)	2						c.(499-501)CAA>AAA		ermin, ERM-like protein isoform b							178.0	167.0	171.0					2																	158178139		1940	4142	6082	SO:0001583	missense	57471					cytoplasm|cytoskeleton		g.chr2:158178139G>T	AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.499C>A	2.37:g.158178139G>T	ENSP00000387047:p.Gln167Lys		Somatic				ERMN_uc010zcj.1_Missense_Mutation_p.Q61K|ERMN_uc010zck.1_Missense_Mutation_p.Q147K|ERMN_uc002tzi.2_Missense_Mutation_p.Q180K	p.Q167K	NM_020711	NP_065762	WXS	Illumina HiSeq	Unspecified	Q8TAM6	ERMIN_HUMAN			3	761	-			167					B4DKA6|Q9ULN1	Missense_Mutation	SNP	ENST00000410096.1	37	c.499C>A	CCDS46431.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677350	0.29783	.	.	ENSG00000136541	ENST00000410096;ENST00000397283;ENST00000535935;ENST00000420719	.	.	.	5.83	1.42	0.22433	.	0.502038	0.20173	N	0.097700	T	0.23014	0.0556	L	0.27053	0.805	0.09310	N	1	B;B;B	0.17268	0.009;0.009;0.021	B;B;B	0.18561	0.013;0.022;0.013	T	0.28996	-1.0026	9	0.02654	T	1	-7.4112	9.4251	0.38574	0.0:0.1212:0.4736:0.4052	.	147;180;167	B4DIZ1;Q8TAM6-2;Q8TAM6	.;.;ERMIN_HUMAN	K	167;180;61;147	.	ENSP00000380453:Q180K	Q	-	1	0	ERMN	157886385	0.003000	0.15002	0.002000	0.10522	0.784000	0.44337	0.928000	0.28831	0.354000	0.24105	-0.181000	0.13052	CAA		0.408	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332659.1	NM_001009959		43	66	1	0	8.20599e-20	0.011902	1.47518e-19	43	66				
ACVR1	90	broad.mit.edu	37	2	158656003	158656003	+	Start_Codon_SNP	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:158656003C>A	ENST00000263640.3	-	3	432	c.3G>T	c.(1-3)atG>atT	p.M1I	ACVR1_ENST00000409283.2_Start_Codon_SNP_p.M1I|ACVR1_ENST00000434821.1_Start_Codon_SNP_p.M1I|ACVR1_ENST00000410057.2_Start_Codon_SNP_p.M1I	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	1					activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	CTCCATCTACCATTGTACAAC	0.383																																							uc002tzm.3		NA																	0				ovary(2)|skin(1)	3						c.(1-3)ATG>ATT		activin A receptor, type I precursor	Adenosine triphosphate(DB00171)						141.0	122.0	129.0					2																	158656003		2203	4299	6502	SO:0001582	initiator_codon_variant	90				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding	g.chr2:158656003C>A		CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.3G>T	2.37:g.158656003C>A	ENSP00000263640:p.Met1Ile		Somatic				ACVR1_uc002tzn.3_Missense_Mutation_p.M1I|ACVR1_uc010fog.2_Missense_Mutation_p.M1I	p.M1I	NM_001111067	NP_001104537	WXS	Illumina HiSeq	Unspecified	Q04771	ACVR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.104)	4	342	-			1						Missense_Mutation	SNP	ENST00000263640.3	37	c.3G>T	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320999	0.60634	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057;ENST00000412025;ENST00000440523;ENST00000539637;ENST00000424669;ENST00000413751	D;D;D;D;D;D;D;D;T	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-0.43	5.84	5.84	0.93424	.	0.129851	0.64402	D	0.000002	D	0.92325	0.7565	.	.	.	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	D	0.91996	0.5607	9	0.59425	D	0.04	.	17.649	0.88157	0.0:1.0:0.0:0.0	.	1	Q04771	ACVR1_HUMAN	I	1	ENSP00000263640:M1I;ENSP00000387273:M1I;ENSP00000405004:M1I;ENSP00000387127:M1I;ENSP00000403006:M1I;ENSP00000401189:M1I;ENSP00000440091:M1I;ENSP00000400767:M1I;ENSP00000399322:M1I	ENSP00000263640:M1I	M	-	3	0	ACVR1	158364249	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	4.676000	0.61627	2.760000	0.94817	0.655000	0.94253	ATG		0.383	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105	Missense_Mutation	10	27	1	0	0.00136819	0.001368	0.00150356	10	27				
LY75	4065	broad.mit.edu	37	2	160673472	160673472	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:160673472T>C	ENST00000263636.4	-	30	4252	c.4225A>G	c.(4225-4227)Att>Gtt	p.I1409V	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.I1409V|LY75_ENST00000554112.1_Missense_Mutation_p.I1409V|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.I1409V|LY75_ENST00000553424.1_Missense_Mutation_p.I1409V	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1409	C-type lectin 9. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TTTTTTTGAATAACACTGTAA	0.353																																							uc002ubc.3		NA																	0					0						c.(4225-4227)ATT>GTT		lymphocyte antigen 75 precursor							119.0	116.0	117.0					2																	160673472		2203	4300	6503	SO:0001583	missense	4065				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding	g.chr2:160673472T>C	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4225A>G	2.37:g.160673472T>C	ENSP00000263636:p.Ile1409Val		Somatic				LY75_uc002ubb.3_Missense_Mutation_p.I1409V|LY75_uc010fos.2_Missense_Mutation_p.I1409V	p.I1409V	NM_002349	NP_002340	WXS	Illumina HiSeq	Unspecified	O60449	LY75_HUMAN		COAD - Colon adenocarcinoma(177;0.132)	30	4294	-			1409			Extracellular (Potential).|C-type lectin 9.		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	c.4225A>G	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	T	6.895	0.534736	0.13188	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.15718	2.4;2.4;2.4;2.4;2.4	5.65	1.54	0.23209	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.470911	0.15773	N	0.245339	T	0.07954	0.0199	N	0.20881	0.62	0.32727	N	0.509545	B;B;B	0.19583	0.028;0.028;0.037	B;B;B	0.17722	0.015;0.019;0.01	T	0.37934	-0.9684	10	0.02654	T	1	-12.4809	5.6366	0.17540	0.0:0.1892:0.3388:0.472	.	1409;1409;1409	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	V	1409	ENSP00000451511:I1409V;ENSP00000451446:I1409V;ENSP00000263636:I1409V;ENSP00000423463:I1409V;ENSP00000421035:I1409V	ENSP00000423463:I1409V	I	-	1	0	LY75;LY75-CD302	160381718	0.999000	0.42202	0.988000	0.46212	0.943000	0.58893	0.987000	0.29603	0.483000	0.27608	0.528000	0.53228	ATT		0.353	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1			26	26	0	0	0	0.003954	0	26	26				
PLA2R1	22925	broad.mit.edu	37	2	160833814	160833814	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:160833814C>A	ENST00000283243.7	-	15	2588	c.2382G>T	c.(2380-2382)tgG>tgT	p.W794C	PLA2R1_ENST00000392771.1_Missense_Mutation_p.W794C	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	794	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TTTTGCATATCCATTCACGTT	0.348																																							uc002ube.1		NA																	0				skin(2)|ovary(1)	3						c.(2380-2382)TGG>TGT		phospholipase A2 receptor 1 isoform 1 precursor							133.0	125.0	128.0					2																	160833814		2203	4300	6503	SO:0001583	missense	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160833814C>A	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2382G>T	2.37:g.160833814C>A	ENSP00000283243:p.Trp794Cys		Somatic				PLA2R1_uc010zcp.1_Missense_Mutation_p.W794C|PLA2R1_uc002ubf.2_Missense_Mutation_p.W794C	p.W794C	NM_007366	NP_031392	WXS	Illumina HiSeq	Unspecified	Q13018	PLA2R_HUMAN			15	2589	-			794			Extracellular (Potential).|C-type lectin 4.		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	c.2382G>T	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593310	0.66219	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.17528	2.27;2.27	5.09	5.09	0.68999	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	M	0.91717	3.235	0.80722	D	1	P;D;D	0.89917	0.892;1.0;1.0	P;D;D	0.97110	0.747;1.0;1.0	T	0.64002	-0.6509	10	0.72032	D	0.01	.	17.261	0.87069	0.0:1.0:0.0:0.0	.	794;794;794	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	C	794	ENSP00000283243:W794C;ENSP00000376524:W794C	ENSP00000283243:W794C	W	-	3	0	PLA2R1	160542060	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.393000	0.73217	2.364000	0.80123	0.561000	0.74099	TGG		0.348	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			14	26	1	0	2.61681e-11	0.00245	3.92207e-11	14	26				
TTN	7273	broad.mit.edu	37	2	179412568	179412568	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:179412568A>T	ENST00000591111.1	-	289	89086	c.88862T>A	c.(88861-88863)gTg>gAg	p.V29621E	RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V31262E|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V22197E|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V22389E|TTN_ENST00000359218.5_Missense_Mutation_p.V22322E|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V28694E|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29621	Ig-like 135.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTAATGCTCACTCGATCTGT	0.453																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(86080-86082)GTG>GAG		titin isoform N2-A							135.0	126.0	129.0					2																	179412568		2058	4191	6249	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179412568A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.88862T>A	2.37:g.179412568A>T	ENSP00000465570:p.Val29621Glu		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V22389E|TTN_uc010zfi.1_Missense_Mutation_p.V22322E|TTN_uc010zfj.1_Missense_Mutation_p.V22197E	p.V28694E	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		288	86305	-			29621					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.86081T>A		.	.	.	.	.	.	.	.	.	.	A	15.14	2.745552	0.49151	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	5.92	5.92	0.95590	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78672	0.4320	M	0.90705	3.14	0.52501	D	0.999953	P;P;P;P	0.35107	0.484;0.484;0.484;0.484	B;B;B;B	0.42112	0.376;0.376;0.376;0.376	T	0.81833	-0.0751	9	0.87932	D	0	.	16.3526	0.83220	1.0:0.0:0.0:0.0	.	22197;22322;22389;29621	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	28694;22197;22389;22322;22194	ENSP00000343764:V28694E;ENSP00000434586:V22197E;ENSP00000340554:V22389E;ENSP00000352154:V22322E	ENSP00000340554:V22389E	V	-	2	0	TTN	179120814	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	9.339000	0.96797	2.255000	0.74692	0.533000	0.62120	GTG		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	47	0	0	0	0.001168	0	6	47				
TTN	7273	broad.mit.edu	37	2	179598167	179598167	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:179598167C>T	ENST00000591111.1	-	52	15126	c.14902G>A	c.(14902-14904)Gca>Aca	p.A4968T	TTN_ENST00000589042.1_Missense_Mutation_p.A5285T|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.A4041T			Q8WZ42	TITIN_HUMAN	titin	12348	Ig-like 30.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCGTGCCTGCCACTGTGTAC	0.468																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(12121-12123)GCA>ACA		titin isoform N2-A							153.0	156.0	155.0					2																	179598167		1912	4146	6058	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179598167C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14902G>A	2.37:g.179598167C>T	ENSP00000465570:p.Ala4968Thr		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A702T	p.A4041T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		51	12345	-			4968					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.12121G>A		.	.	.	.	.	.	.	.	.	.	C	11.67	1.708698	0.30322	.	.	ENSG00000155657	ENST00000342992	T	0.65916	-0.18	5.86	-11.7	0.00046	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31009	0.0783	N	0.04275	-0.24	0.43187	D	0.995011	B	0.02656	0.0	B	0.04013	0.001	T	0.35674	-0.9779	9	0.87932	D	0	.	9.9036	0.41362	0.2251:0.5818:0.0:0.193	.	4968	Q8WZ42	TITIN_HUMAN	T	4041	ENSP00000343764:A4041T	ENSP00000343764:A4041T	A	-	1	0	TTN	179306412	0.000000	0.05858	0.203000	0.23512	0.966000	0.64601	-0.806000	0.04525	-2.199000	0.00748	-0.150000	0.13652	GCA		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	195	0	0	0	0.004482	0	7	195				
ITGA4	3676	broad.mit.edu	37	2	182399575	182399575	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:182399575C>G	ENST00000397033.2	+	27	3346	c.2916C>G	c.(2914-2916)ccC>ccG	p.P972P		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	972					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ATCAAAGACCCAAACGTTATT	0.313																																							uc002unu.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(2914-2916)CCC>CCG		integrin alpha 4 precursor	Natalizumab(DB00108)						157.0	144.0	148.0					2																	182399575		1851	4084	5935	SO:0001819	synonymous_variant	3676				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity	g.chr2:182399575C>G		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2916C>G	2.37:g.182399575C>G			Somatic				ITGA4_uc002unv.2_Silent_p.P217P	p.P972P	NM_000885	NP_000876	WXS	Illumina HiSeq	Unspecified	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)		27	3679	+			972			Extracellular (Potential).		D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	37	c.2916C>G	CCDS42788.1																																																																																				0.313	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1			4	35	0	0	0	0.009096	0	4	35				
IGFBP5	3488	broad.mit.edu	37	2	217541567	217541567	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:217541567C>T	ENST00000233813.4	-	4	1475	c.726G>A	c.(724-726)tgG>tgA	p.W242*		NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	242	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTCCACGCACCAGCAGATGC	0.617																																							uc002vgj.3		NA																	0					0						c.(724-726)TGG>TGA		insulin-like growth factor binding protein 5							203.0	168.0	180.0					2																	217541567		2203	4300	6503	SO:0001587	stop_gained	3488				negative regulation of insulin-like growth factor receptor signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of translation|signal transduction		insulin-like growth factor I binding	g.chr2:217541567C>T		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.726G>A	2.37:g.217541567C>T	ENSP00000233813:p.Trp242*		Somatic					p.W242*	NM_000599	NP_000590	WXS	Illumina HiSeq	Unspecified	P24593	IBP5_HUMAN		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	1500	-		Renal(323;0.0822)	242			Thyroglobulin type-1.		Q5U0A3	Nonsense_Mutation	SNP	ENST00000233813.4	37	c.726G>A	CCDS2405.1	.	.	.	.	.	.	.	.	.	.	C	44	10.751758	0.99461	.	.	ENSG00000115461	ENST00000233813	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5399	0.84382	0.0:1.0:0.0:0.0	.	.	.	.	X	242	.	ENSP00000233813:W242X	W	-	3	0	IGFBP5	217249812	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.118000	0.77137	2.488000	0.83962	0.563000	0.77884	TGG		0.617	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599		5	129	0	0	0	0.001168	0	5	129				
SP100	6672	broad.mit.edu	37	2	231308915	231308915	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:231308915A>T	ENST00000264052.5	+	4	648	c.293A>T	c.(292-294)aAc>aTc	p.N98I	SP100_ENST00000409341.1_Missense_Mutation_p.N98I|SP100_ENST00000340126.4_Missense_Mutation_p.N98I|SP100_ENST00000427101.2_Missense_Mutation_p.N73I|SP100_ENST00000409897.1_Missense_Mutation_p.N63I|SP100_ENST00000409112.1_Missense_Mutation_p.N98I|SP100_ENST00000341950.4_Missense_Mutation_p.N98I|SP100_ENST00000409824.1_Missense_Mutation_p.N73I	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	98	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TCTTGTAGAAACCTGGTCCCT	0.383																																							uc002vqt.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(292-294)AAC>ATC		nuclear antigen Sp100 isoform 2							91.0	93.0	93.0					2																	231308915		2203	4300	6503	SO:0001583	missense	6672				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding	g.chr2:231308915A>T	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.293A>T	2.37:g.231308915A>T	ENSP00000264052:p.Asn98Ile		Somatic				SP100_uc002vqs.2_Missense_Mutation_p.N98I|SP100_uc002vqu.1_Missense_Mutation_p.N98I|SP100_uc010zmb.1_Missense_Mutation_p.N98I|SP100_uc002vqq.1_Missense_Mutation_p.N98I|SP100_uc002vqr.1_Missense_Mutation_p.N73I|SP100_uc010zmc.1_Missense_Mutation_p.N73I|SP100_uc002vqv.1_Missense_Mutation_p.N62I	p.N98I	NM_003113	NP_003104	WXS	Illumina HiSeq	Unspecified	P23497	SP100_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	4	434	+		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)	98			HSR.		B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	ENST00000264052.5	37	c.293A>T	CCDS2477.1	.	.	.	.	.	.	.	.	.	.	A	10.37	1.331490	0.24167	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000432979;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	D;D;D;D;D;D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58	3.89	2.71	0.32032	Sp100 (2);	.	.	.	.	D	0.96626	0.8899	M	0.82323	2.585	0.09310	N	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;0.999;0.993;1.0;0.999	D;D;D;D;D;D;D;D	0.97110	0.977;0.985;0.987;0.967;0.996;0.912;1.0;0.977	D	0.89583	0.3822	9	0.87932	D	0	.	7.2304	0.26038	0.7589:0.2411:0.0:0.0	.	73;98;63;98;98;98;73;98	F8WFE2;B4E2B9;B8ZZD8;P23497-4;P23497;E7EUA7;E9PHV6;P23497-2	.;.;.;.;SP100_HUMAN;.;.;.	I	98;73;73;73;98;98;98;98;63	ENSP00000264052:N98I;ENSP00000399389:N73I;ENSP00000391616:N73I;ENSP00000387311:N73I;ENSP00000386404:N98I;ENSP00000386427:N98I;ENSP00000343023:N98I;ENSP00000342729:N98I;ENSP00000386998:N63I	ENSP00000264052:N98I	N	+	2	0	SP100	231017159	0.007000	0.16637	0.160000	0.22671	0.065000	0.16274	0.366000	0.20365	0.827000	0.34685	0.455000	0.32223	AAC		0.383	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113		11	60	0	0	0	0.010729	0	11	60				
CHRNG	1146	broad.mit.edu	37	2	233406084	233406084	+	Splice_Site	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:233406084C>A	ENST00000389494.3	+	5	372	c.351C>A	c.(349-351)aaC>aaA	p.N117K	CHRNG_ENST00000389492.3_Intron	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	117					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)			breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	GTGCATACAGCGTGGACGGTG	0.657																																							uc002vsx.1		NA																	0					0						c.(349-351)AAC>AAA		cholinergic receptor, nicotinic, gamma							189.0	153.0	166.0					2																	233406084		2203	4300	6503	SO:0001630	splice_region_variant	1146				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity	g.chr2:233406084C>A	X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.351-1C>A	2.37:g.233406084C>A			Somatic				CHRNG_uc010fyd.2_Missense_Mutation_p.N117K|CHRNG_uc010fye.1_Intron	p.N117K	NM_005199	NP_005190	WXS	Illumina HiSeq	Unspecified	P07510	ACHG_HUMAN		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	5	372	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	117			Extracellular (Potential).		B3KWM8|Q14DU4|Q53RG2	Missense_Mutation	SNP	ENST00000389494.3	37	c.351C>A	CCDS33400.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945378	0.53079	.	.	ENSG00000196811	ENST00000389494;ENST00000541596	T	0.78003	-1.14	5.16	-4.24	0.03777	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	U	0.000000	D	0.85084	0.5616	M	0.80183	2.485	0.42572	D	0.993186	D	0.71674	0.998	D	0.78314	0.991	D	0.84486	0.0608	9	.	.	.	.	14.5013	0.67724	0.0:0.3295:0.0:0.6705	.	117	P07510	ACHG_HUMAN	K	117	ENSP00000374145:N117K	.	N	+	3	2	CHRNG	233114328	0.000000	0.05858	0.937000	0.37676	0.466000	0.32739	-1.538000	0.02204	-0.729000	0.04875	-0.379000	0.06801	AAC		0.657	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330743.1	NM_005199	Missense_Mutation	13	107	1	0	7.03913e-09	0.001368	9.75131e-09	13	107				
UGT1A9	54600	broad.mit.edu	37	2	234580712	234580712	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:234580712G>T	ENST00000354728.4	+	1	214	c.132G>T	c.(130-132)gtG>gtT	p.V44V	UGT1A1_ENST00000609637.1_Silent_p.V44V|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	44					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TGAGGTCGGTGGTGGAGAAAC	0.532																																							uc002vus.2		NA																	0				ovary(3)|breast(1)|skin(1)	5						c.(130-132)GTG>GTT		UDP glycosyltransferase 1 family, polypeptide A9	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)						92.0	77.0	82.0					2																	234580712		2203	4300	6503	SO:0001819	synonymous_variant	54600				drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding	g.chr2:234580712G>T	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.132G>T	2.37:g.234580712G>T			Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Silent_p.V44V	p.V44V	NM_021027	NP_066307	WXS	Illumina HiSeq	Unspecified	O60656	UD19_HUMAN		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	1	169	+		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)	44					B8K285|P36509|Q9HAX0	Silent	SNP	ENST00000354728.4	37	c.132G>T	CCDS2505.1																																																																																				0.532	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027		14	67	1	0	7.93312e-07	0.00245	1.00908e-06	14	67				
COL6A3	1293	broad.mit.edu	37	2	238275811	238275811	+	Silent	SNP	G	G	T	rs140516220		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:238275811G>T	ENST00000295550.4	-	11	5471	c.5019C>A	c.(5017-5019)ggC>ggA	p.G1673G	COL6A3_ENST00000409809.1_Silent_p.G1467G|COL6A3_ENST00000472056.1_Silent_p.G1066G|COL6A3_ENST00000346358.4_Silent_p.G1473G|COL6A3_ENST00000347401.3_Silent_p.G1472G|COL6A3_ENST00000353578.4_Silent_p.G1467G	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1673	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGATGGAGTCGCCATCTTCAT	0.473																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(5017-5019)GGC>GGA		alpha 3 type VI collagen isoform 1 precursor							77.0	67.0	70.0					2																	238275811		2203	4300	6503	SO:0001819	synonymous_variant	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238275811G>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5019C>A	2.37:g.238275811G>T			Somatic				COL6A3_uc002vwo.2_Silent_p.G1467G|COL6A3_uc010znj.1_Silent_p.G1066G	p.G1673G	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	11	5304	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	1673			VWFA 9.|Nonhelical region.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	c.5019C>A	CCDS33412.1																																																																																				0.473	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		9	25	1	0	2.17888e-05	0.006214	2.58145e-05	9	25				
SLC23A2	9962	broad.mit.edu	37	20	4842670	4842670	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:4842670G>T	ENST00000379333.1	-	15	1940	c.1548C>A	c.(1546-1548)aaC>aaA	p.N516K	SLC23A2_ENST00000338244.1_Missense_Mutation_p.N516K|SLC23A2_ENST00000424750.2_Missense_Mutation_p.N402K	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	516					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCACAAAGAGGTTCCGGGAAG	0.468																																							uc002wlg.1		NA																	0				ovary(2)	2						c.(1546-1548)AAC>AAA		solute carrier family 23 (nucleobase							93.0	95.0	94.0					20																	4842670		2203	4300	6503	SO:0001583	missense	9962				L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity	g.chr20:4842670G>T	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1548C>A	20.37:g.4842670G>T	ENSP00000368637:p.Asn516Lys		Somatic				SLC23A2_uc010zqr.1_Missense_Mutation_p.N401K|SLC23A2_uc002wlh.1_Missense_Mutation_p.N516K	p.N516K	NM_005116	NP_005107	WXS	Illumina HiSeq	Unspecified	Q9UGH3	S23A2_HUMAN			15	1923	-			516			Helical; (Potential).		B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	c.1548C>A	CCDS13085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.944119|3.944119	0.73672|0.73672	.|.	.|.	ENSG00000089057|ENSG00000089057	ENST00000379333;ENST00000338244;ENST00000424750|ENST00000423430	T;T;T|.	0.22945|.	1.93;1.93;1.93|.	5.35|5.35	3.41|3.41	0.39046|0.39046	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80014|0.80014	0.4546|0.4546	M|M	0.92219|0.92219	3.285|3.285	0.58432|0.58432	D|D	0.999999|0.999999	P;D|.	0.63046|.	0.924;0.992|.	P;D|.	0.68353|.	0.784;0.957|.	T|T	0.82727|0.82727	-0.0314|-0.0314	10|5	0.87932|.	D|.	0|.	-23.3602|-23.3602	11.3182|11.3182	0.49405|0.49405	0.1505:0.0:0.8495:0.0|0.1505:0.0:0.8495:0.0	.|.	402;516|.	B4DJZ1;Q9UGH3|.	.;S23A2_HUMAN|.	K|T	516;516;402|273	ENSP00000368637:N516K;ENSP00000344322:N516K;ENSP00000406601:N402K|.	ENSP00000344322:N516K|.	N|P	-|-	3|1	2|0	SLC23A2|SLC23A2	4790670|4790670	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	3.329000|3.329000	0.52060|0.52060	0.758000|0.758000	0.33059|0.33059	-0.369000|-0.369000	0.07265|0.07265	AAC|CCT		0.468	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1			12	33	1	0	1.08611e-07	0.010729	1.43736e-07	12	33				
CST3	1471	broad.mit.edu	37	20	23614635	23614635	+	Splice_Site	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:23614635T>A	ENST00000398411.1	-	3	441	c.359A>T	c.(358-360)aAa>aTa	p.K120I	RP11-218C14.8_ENST00000602977.1_lincRNA|CST3_ENST00000398409.1_Splice_Site_p.K120I|CST3_ENST00000376925.3_Splice_Site_p.K120I			P01034	CYTC_HUMAN	cystatin C	120					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell activation (GO:0001775)|cellular response to hydrogen peroxide (GO:0070301)|circadian sleep/wake cycle, REM sleep (GO:0042747)|defense response (GO:0006952)|embryo implantation (GO:0007566)|extracellular fibril organization (GO:0043206)|eye development (GO:0001654)|negative regulation of blood vessel remodeling (GO:0060313)|negative regulation of cell death (GO:0060548)|negative regulation of collagen catabolic process (GO:0010711)|negative regulation of elastin catabolic process (GO:0060311)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|regulation of programmed cell death (GO:0043067)|regulation of tissue remodeling (GO:0034103)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|salivary gland development (GO:0007431)|Sertoli cell development (GO:0060009)	basement membrane (GO:0005604)|cell projection (GO:0042995)|contractile fiber (GO:0043292)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)			large_intestine(2)|lung(1)|ovary(1)	4	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					GCAGAATGCTTTCTGTGAAAG	0.537																																							uc002wtm.2		NA																	0				ovary(1)	1						c.(358-360)AAA>ATA		cystatin C precursor							142.0	109.0	120.0					20																	23614635		2203	4300	6503	SO:0001630	splice_region_variant	1471				defense response|fibril organization|negative regulation of blood vessel remodeling|negative regulation of collagen catabolic process|negative regulation of elastin catabolic process|negative regulation of extracellular matrix disassembly	extracellular space	beta-amyloid binding|cysteine-type endopeptidase inhibitor activity|protease binding	g.chr20:23614635T>A		CCDS13158.1	20p11.2	2008-04-15	2008-04-15		ENSG00000101439	ENSG00000101439			2475	protein-coding gene	gene with protein product		604312	"""cystatin C (amyloid angiopathy and cerebral hemorrhage)"""			8486384	Standard	NM_000099		Approved		uc002wtn.1	P01034	OTTHUMG00000032080	ENST00000398411.1:c.358-1A>T	20.37:g.23614635T>A			Somatic				CST3_uc002wtn.1_Missense_Mutation_p.K120I	p.K120I	NM_000099	NP_000090	WXS	Illumina HiSeq	Unspecified	P01034	CYTC_HUMAN			3	434	-	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)		120					B2R5J9|D3DW42|Q6FGW9	Missense_Mutation	SNP	ENST00000398411.1	37	c.359A>T	CCDS13158.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.776139	0.49786	.	.	ENSG00000101439	ENST00000398411;ENST00000376925;ENST00000398409	T;T;T	0.26810	1.71;1.71;1.71	2.97	1.86	0.25419	Proteinase inhibitor I25, cystatin (2);	0.935537	0.09065	U	0.853740	T	0.42291	0.1196	M	0.76838	2.35	0.19300	N	0.999979	B	0.27068	0.167	P	0.46389	0.515	T	0.53690	-0.8403	10	0.49607	T	0.09	.	4.8279	0.13425	0.0:0.1458:0.0:0.8542	.	120	P01034	CYTC_HUMAN	I	120	ENSP00000381448:K120I;ENSP00000366124:K120I;ENSP00000381446:K120I	ENSP00000366124:K120I	K	-	2	0	CST3	23562635	0.169000	0.23002	0.238000	0.24106	0.227000	0.25037	1.014000	0.29950	0.555000	0.29079	0.397000	0.26171	AAA		0.537	CST3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256831.1	NM_000099	Missense_Mutation	16	53	0	0	0	0.004007	0	16	53				
VSX1	30813	broad.mit.edu	37	20	25056973	25056973	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:25056973G>T	ENST00000376709.4	-	5	1285	c.1022C>A	c.(1021-1023)cCt>cAt	p.P341H	VSX1_ENST00000424574.1_Intron|VSX1_ENST00000444511.2_Intron|VSX1_ENST00000451258.1_Intron|VSX1_ENST00000429762.3_Intron	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	341					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						ACCAGCCCCAGGGTGCACTTT	0.597																																							uc002wuf.2		NA																	0					0						c.(1021-1023)CCT>CAT		visual system homeobox 1 isoform a							54.0	56.0	55.0					20																	25056973		2203	4300	6503	SO:0001583	missense	30813				response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:25056973G>T	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.1022C>A	20.37:g.25056973G>T	ENSP00000365899:p.Pro341His		Somatic				VSX1_uc002wue.2_Intron|VSX1_uc010gdd.1_Intron|VSX1_uc010gde.1_Intron|VSX1_uc010gdf.1_Intron	p.P341H	NM_014588	NP_055403	WXS	Illumina HiSeq	Unspecified	Q9NZR4	VSX1_HUMAN			5	1057	-			341					B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	c.1022C>A	CCDS13168.1	.	.	.	.	.	.	.	.	.	.	G	9.408	1.079785	0.20309	.	.	ENSG00000100987	ENST00000376709	D	0.92699	-3.09	4.35	-8.7	0.00851	.	2.693200	0.01095	N	0.005261	D	0.84866	0.5567	N	0.22421	0.69	0.09310	N	1	B	0.30664	0.289	B	0.26614	0.071	T	0.77156	-0.2691	10	0.38643	T	0.18	.	13.4277	0.61035	0.0:0.3541:0.5392:0.1067	.	341	Q9NZR4	VSX1_HUMAN	H	341	ENSP00000365899:P341H	ENSP00000365899:P341H	P	-	2	0	VSX1	25004973	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.575000	0.02131	-3.024000	0.00268	-0.262000	0.10625	CCT		0.597	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3			12	58	1	0	5.16669e-11	0.010729	7.68823e-11	12	58				
FRG1B	284802	broad.mit.edu	37	20	29628263	29628263	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:29628263A>G	ENST00000278882.3	+	6	645	c.265A>G	c.(265-267)Att>Gtt	p.I89V	FRG1B_ENST00000358464.4_Missense_Mutation_p.I89V|FRG1B_ENST00000439954.2_Missense_Mutation_p.I94V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	89								p.I89V(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TAGCTGCTTTATTAGATGCAA	0.363																																							uc010ztl.1		NA																	4	Substitution - Missense(4)		prostate(2)|kidney(2)		0						c.(175-177)ATT>GTT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29628263A>G			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.265A>G	20.37:g.29628263A>G	ENSP00000278882:p.Ile89Val		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.I11V	p.I59V			WXS	Illumina HiSeq	Unspecified					3	207	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.175A>G		.	.	.	.	.	.	.	.	.	.	a	8.196	0.797144	0.16327	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.44482	0.92	2.08	2.08	0.27032	Actin cross-linking (1);	0.052017	0.85682	D	0.000000	T	0.22666	0.0547	.	.	.	0.33862	D	0.633895	B;B	0.06786	0.0;0.001	B;B	0.20767	0.018;0.031	T	0.12041	-1.0563	9	0.22706	T	0.39	.	3.8663	0.09018	0.8139:0.0:0.1861:0.0	.	94;89	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	89;94;89	ENSP00000408863:I94V	ENSP00000278882:I89V	I	+	1	0	FRG1B	28241924	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.345000	0.59360	1.208000	0.43306	0.347000	0.21830	ATT		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		3	67	0	0	0	0.000602	0	3	67				
PTPRT	11122	broad.mit.edu	37	20	40980762	40980762	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:40980762C>A	ENST00000373187.1	-	10	1723	c.1724G>T	c.(1723-1725)gGg>gTg	p.G575V	PTPRT_ENST00000373198.4_Missense_Mutation_p.G575V|PTPRT_ENST00000373190.1_Missense_Mutation_p.G575V|PTPRT_ENST00000373184.1_Missense_Mutation_p.G575V|PTPRT_ENST00000356100.2_Missense_Mutation_p.G575V|PTPRT_ENST00000373193.3_Missense_Mutation_p.G575V|PTPRT_ENST00000373201.1_Missense_Mutation_p.G575V			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	575	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GACAGGGGGCCCAAAGCCCTT	0.502																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(1723-1725)GGG>GTG		protein tyrosine phosphatase, receptor type, T							83.0	87.0	86.0					20																	40980762		1924	4131	6055	SO:0001583	missense	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40980762C>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1724G>T	20.37:g.40980762C>A	ENSP00000362283:p.Gly575Val		Somatic				PTPRT_uc010ggj.2_Missense_Mutation_p.G575V	p.G575V	NM_007050	NP_008981	WXS	Illumina HiSeq	Unspecified	O14522	PTPRT_HUMAN			10	1908	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	575			Extracellular (Potential).|Fibronectin type-III 3.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.1724G>T	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866447	0.91511	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	6.03	6.03	0.97812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.106435	0.64402	D	0.000005	D	0.88070	0.6338	H	0.98133	4.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.985;0.987	D	0.91469	0.5195	10	0.87932	D	0	.	20.5541	0.99286	0.0:1.0:0.0:0.0	.	575;575	O14522-1;O14522	.;PTPRT_HUMAN	V	575	ENSP00000362286:G575V;ENSP00000362283:G575V;ENSP00000362289:G575V;ENSP00000348408:G575V;ENSP00000362294:G575V;ENSP00000362280:G575V;ENSP00000362297:G575V	ENSP00000348408:G575V	G	-	2	0	PTPRT	40414176	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.864000	0.98301	0.551000	0.68910	GGG		0.502	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			19	66	1	0	7.21436e-19	0.008871	1.26761e-18	19	66				
PREX1	57580	broad.mit.edu	37	20	47361667	47361667	+	Missense_Mutation	SNP	G	G	C	rs141887028		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:47361667G>C	ENST00000371941.3	-	3	331	c.309C>G	c.(307-309)atC>atG	p.I103M	PREX1_ENST00000396220.1_Missense_Mutation_p.I103M	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	103	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGATGTCTTCGATGTTCGAGA	0.483																																							uc002xtw.1		NA																	0				lung(3)|ovary(2)|pancreas(1)	6						c.(307-309)ATC>ATG		phosphatidylinositol-3,4,							151.0	156.0	154.0					20																	47361667		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47361667G>C	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.309C>G	20.37:g.47361667G>C	ENSP00000361009:p.Ile103Met		Somatic					p.I103M	NM_020820	NP_065871	WXS	Illumina HiSeq	Unspecified	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		3	332	-			103			DH.		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.309C>G	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099139	0.56183	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.68624	-0.34;-0.34	4.98	-3.22	0.05125	Dbl homology (DH) domain (5);	0.000000	0.49916	U	0.000134	T	0.74045	0.3665	M	0.70595	2.14	0.54753	D	0.999988	D	0.76494	0.999	D	0.83275	0.996	T	0.72534	-0.4264	10	0.87932	D	0	.	7.8985	0.29721	0.594:0.0:0.2929:0.1131	.	103	Q8TCU6	PREX1_HUMAN	M	103	ENSP00000361009:I103M;ENSP00000379522:I103M	ENSP00000361009:I103M	I	-	3	3	PREX1	46795074	0.092000	0.21681	0.979000	0.43373	0.838000	0.47535	-0.566000	0.05922	-0.439000	0.07222	0.655000	0.94253	ATC		0.483	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		4	204	0	0	0	0.000602	0	4	204				
TSHZ2	128553	broad.mit.edu	37	20	51870553	51870553	+	Missense_Mutation	SNP	G	G	T	rs377066962		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:51870553G>T	ENST00000371497.5	+	2	1443	c.556G>T	c.(556-558)Gtc>Ttc	p.V186F	TSHZ2_ENST00000603338.2_Missense_Mutation_p.V183F|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.V183F	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	186					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TTCTCGGTCCGTCTCGAAACC	0.557																																							uc002xwo.2		NA																	0				ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(556-558)GTC>TTC		teashirt zinc finger homeobox 2							68.0	67.0	67.0					20																	51870553		2203	4300	6503	SO:0001583	missense	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51870553G>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.556G>T	20.37:g.51870553G>T	ENSP00000360552:p.Val186Phe		Somatic					p.V186F	NM_173485	NP_775756	WXS	Illumina HiSeq	Unspecified	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	1512	+			186					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	c.556G>T	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	8.829	0.939432	0.18281	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.15139	2.45;2.45	5.2	2.03	0.26663	.	0.116919	0.56097	N	0.000021	T	0.16685	0.0401	L	0.54323	1.7	0.52099	D	0.999947	B	0.11235	0.004	B	0.12156	0.007	T	0.04930	-1.0917	10	0.72032	D	0.01	-0.131	9.6119	0.39668	0.0675:0.0:0.6654:0.2671	.	186	Q9NRE2	TSH2_HUMAN	F	186;183	ENSP00000360552:V186F;ENSP00000333114:V183F	ENSP00000333114:V183F	V	+	1	0	TSHZ2	51303960	0.931000	0.31567	0.001000	0.08648	0.238000	0.25445	2.672000	0.46850	0.225000	0.20959	-0.149000	0.13747	GTC		0.557	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		13	60	1	0	9.05144e-12	0.001855	1.37653e-11	13	60				
DIDO1	11083	broad.mit.edu	37	20	61513243	61513243	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:61513243C>A	ENST00000266070.4	-	16	4390	c.4065G>T	c.(4063-4065)ccG>ccT	p.P1355P	DIDO1_ENST00000395343.1_Silent_p.P1355P	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1355					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ACGGAGGTGCCGGCACCCCGT	0.587																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(4063-4065)CCG>CCT		death inducer-obliterator 1 isoform c							93.0	108.0	103.0					20																	61513243		2203	4300	6503	SO:0001819	synonymous_variant	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61513243C>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4065G>T	20.37:g.61513243C>A			Somatic				DIDO1_uc002yds.1_Silent_p.P1355P	p.P1355P	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			16	4329	-	Breast(26;5.68e-08)		1355					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	c.4065G>T	CCDS33506.1																																																																																				0.587	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		50	120	1	0	1.47857e-17	0.00361	2.54053e-17	50	120				
GRIK1	2897	broad.mit.edu	37	21	30953768	30953768	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:30953768C>A	ENST00000399907.1	-	13	2300	c.1889G>T	c.(1888-1890)gGa>gTa	p.G630V	GRIK1_ENST00000535441.1_Missense_Mutation_p.G632V|GRIK1_ENST00000399909.1_Missense_Mutation_p.G615V|GRIK1_ENST00000399913.1_Missense_Mutation_p.G630V|GRIK1_ENST00000389125.3_Missense_Mutation_p.G615V|GRIK1_ENST00000327783.4_Missense_Mutation_p.G630V|GRIK1_ENST00000399914.1_Missense_Mutation_p.G615V|GRIK1_ENST00000389124.2_Missense_Mutation_p.G630V|GRIK1_ENST00000309434.7_Missense_Mutation_p.G632V	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	630					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	AGCTCCAACTCCAAACCAGAA	0.483																																							uc002yno.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1888-1890)GGA>GTA		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						118.0	107.0	110.0					21																	30953768		2203	4299	6502	SO:0001583	missense	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:30953768C>A		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1889G>T	21.37:g.30953768C>A	ENSP00000382791:p.Gly630Val		Somatic				GRIK1_uc002ynn.2_Missense_Mutation_p.G615V|GRIK1_uc011acs.1_Missense_Mutation_p.G630V|GRIK1_uc011act.1_Missense_Mutation_p.G491V|GRIK1_uc010glq.1_Missense_Mutation_p.G473V	p.G630V	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			13	2353	-			630			Cytoplasmic (Potential).		Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	c.1889G>T	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539488	0.85917	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	D;D;D;D;D;D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29;-4.29;-4.29;-4.29;-4.29;-4.29	5.5	5.5	0.81552	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.95890	0.8662	N	0.04880	-0.145	0.80722	D	1	D;D;B;D;D	0.63046	0.992;0.992;0.176;0.992;0.989	D;D;B;D;P	0.66351	0.943;0.943;0.27;0.943;0.905	D	0.96773	0.9570	10	0.51188	T	0.08	.	19.1941	0.93679	0.0:1.0:0.0:0.0	.	615;630;615;630;615	E7EPY9;E9PD61;E7EPZ0;P39086;P39086-2	.;.;.;GRIK1_HUMAN;.	V	630;615;630;615;632;491;630;630;615;632	ENSP00000327687:G630V;ENSP00000373777:G615V;ENSP00000382797:G630V;ENSP00000382798:G615V;ENSP00000446326:G632V;ENSP00000373776:G630V;ENSP00000382791:G630V;ENSP00000382793:G615V;ENSP00000311646:G632V	ENSP00000311646:G632V	G	-	2	0	GRIK1	29875639	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.645000	0.83430	2.854000	0.98071	0.655000	0.94253	GGA		0.483	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			43	36	1	0	1.7489e-18	0.011902	3.05567e-18	43	36				
KRTAP19-7	337974	broad.mit.edu	37	21	31933445	31933445	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:31933445C>A	ENST00000334849.2	-	1	188	c.164G>T	c.(163-165)gGg>gTg	p.G55V		NM_181614.1	NP_853645.1	Q3SYF9	KR197_HUMAN	keratin associated protein 19-7	55						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	11						CCAGTATCCCCCATAGCATGA	0.453																																							uc011adb.1		NA																	0					0						c.(163-165)GGG>GTG		keratin associated protein 19-7							117.0	123.0	121.0					21																	31933445		2203	4300	6503	SO:0001583	missense	337974					intermediate filament		g.chr21:31933445C>A	AP001708	CCDS13599.1	21q22.1	2006-03-13			ENSG00000244362	ENSG00000244362		"""Keratin associated proteins"""	18942	protein-coding gene	gene with protein product						12359730	Standard	NM_181614		Approved	KAP19.7	uc011adb.2	Q3SYF9	OTTHUMG00000057785	ENST00000334849.2:c.164G>T	21.37:g.31933445C>A	ENSP00000334696:p.Gly55Val		Somatic					p.G55V	NM_181614	NP_853645	WXS	Illumina HiSeq	Unspecified	Q3SYF9	KR197_HUMAN			1	164	-			55					Q08EP7	Missense_Mutation	SNP	ENST00000334849.2	37	c.164G>T	CCDS13599.1	.	.	.	.	.	.	.	.	.	.	c	1.427	-0.571356	0.03882	.	.	ENSG00000244362	ENST00000334849	T	0.13538	2.58	4.21	3.32	0.38043	.	0.000000	0.44902	U	0.000405	T	0.26412	0.0645	.	.	.	0.09310	N	1	D	0.63046	0.992	P	0.59357	0.856	T	0.02868	-1.1100	9	0.87932	D	0	1.8457	8.5371	0.33371	0.0:0.8874:0.0:0.1126	.	55	Q3SYF9	KR197_HUMAN	V	55	ENSP00000334696:G55V	ENSP00000334696:G55V	G	-	2	0	KRTAP19-7	30855316	0.044000	0.20184	0.012000	0.15200	0.142000	0.21351	3.168000	0.50801	1.111000	0.41721	0.530000	0.56133	GGG		0.453	KRTAP19-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128237.2			140	89	1	0	5.62954e-76	0.00361	1.09083e-75	140	89				
KRTAP6-2	337967	broad.mit.edu	37	21	31971160	31971160	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:31971160C>A	ENST00000334897.3	-	1	59	c.34G>T	c.(34-36)Gac>Tac	p.D12Y	KRTAP22-1_ENST00000334680.2_5'Flank	NM_181604.1	NP_853635.1	Q3LI66	KRA62_HUMAN	keratin associated protein 6-2	12						intermediate filament (GO:0005882)				endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11						TAGCCATGGTCGCCGTAGTAG	0.542																																							uc011adc.1		NA																	0					0						c.(34-36)GAC>TAC		keratin associated protein 6-2							202.0	165.0	178.0					21																	31971160		2203	4300	6503	SO:0001583	missense	337967					intermediate filament		g.chr21:31971160C>A	AP001708	CCDS13600.1	21q22.1	2011-02-10			ENSG00000186930	ENSG00000186930		"""Keratin associated proteins"""	18932	protein-coding gene	gene with protein product						12359730	Standard	NM_181604		Approved	KAP6.2	uc011adc.2	Q3LI66	OTTHUMG00000057794	ENST00000334897.3:c.34G>T	21.37:g.31971160C>A	ENSP00000334560:p.Asp12Tyr		Somatic				KRTAP22-1_uc011add.1_5'Flank	p.D12Y	NM_181604	NP_853635	WXS	Illumina HiSeq	Unspecified	Q3LI66	KRA62_HUMAN			1	34	-			12						Missense_Mutation	SNP	ENST00000334897.3	37	c.34G>T	CCDS13600.1	.	.	.	.	.	.	.	.	.	.	C	1.132	-0.652107	0.03506	.	.	ENSG00000186930	ENST00000334897	T	0.10382	2.88	4.37	2.55	0.30701	.	0.569208	0.14457	U	0.318442	T	0.12603	0.0306	.	.	.	0.09310	N	1	P	0.49447	0.924	P	0.47044	0.535	T	0.13415	-1.0510	9	0.87932	D	0	.	5.4664	0.16646	0.197:0.7022:0.0:0.1008	.	12	Q3LI66	KRA62_HUMAN	Y	12	ENSP00000334560:D12Y	ENSP00000334560:D12Y	D	-	1	0	KRTAP6-2	30893031	0.026000	0.19158	0.362000	0.25862	0.023000	0.10783	0.217000	0.17603	0.788000	0.33755	-0.142000	0.14014	GAC		0.542	KRTAP6-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128246.3			102	56	1	0	3.52173e-36	0.00361	6.63792e-36	102	56				
OLIG2	10215	broad.mit.edu	37	21	34399437	34399437	+	Silent	SNP	G	G	C	rs562023180		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:34399437G>C	ENST00000333337.3	+	1	1195	c.267G>C	c.(265-267)gcG>gcC	p.A89A	AP000282.2_ENST00000420356.1_RNA|OLIG2_ENST00000382357.3_Silent_p.A89A|AP000282.2_ENST00000454622.1_RNA			Q13516	OLIG2_HUMAN	oligodendrocyte lineage transcription factor 2	89					myelination (GO:0042552)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|positive regulation of oligodendrocyte differentiation (GO:0048714)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|thalamus development (GO:0021794)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|central_nervous_system(2)	3						CGTCGTCGGCGGCTGCGTCGT	0.632			T	TRA@	T-ALL								G|||	1	0.000199681	0.0	0.0014	5008	,	,		14247	0.0		0.0	False		,,,				2504	0.0						uc002yqx.1		NA		Dom	yes		21	21q22.11	10215	T	oligodendrocyte lineage transcription factor 2 (BHLHB1)			L	TRA@		T-ALL		0				central_nervous_system(2)	2						c.(265-267)GCG>GCC		oligodendrocyte lineage transcription factor 2							23.0	25.0	24.0					21																	34399437		2201	4299	6500	SO:0001819	synonymous_variant	10215					cytoplasm|nucleus|plasma membrane	DNA binding	g.chr21:34399437G>C	U48250	CCDS13620.1	21q22.11	2013-05-21	2001-12-04	2001-12-07	ENSG00000205927	ENSG00000205927		"""Basic helix-loop-helix proteins"""	9398	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 2"", ""protein kinase C binding protein 2"", ""human protein kinase C-binding protein RACK17"", ""basic domain, helix-loop-helix protein, class B, 1"""	606386	"""protein kinase C binding protein 2"""	PRKCBP2, BHLHB1		11526205	Standard	NM_005806		Approved	RACK17, OLIGO2, bHLHe19	uc002yqx.2	Q13516	OTTHUMG00000065032	ENST00000333337.3:c.267G>C	21.37:g.34399437G>C			Somatic					p.A89A	NM_005806	NP_005797	WXS	Illumina HiSeq	Unspecified	Q13516	OLIG2_HUMAN			2	425	+			89					B3KRF3|Q05BP9|Q49AL3|Q86X04|Q9NZ14	Silent	SNP	ENST00000333337.3	37	c.267G>C	CCDS13620.1																																																																																				0.632	OLIG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139663.1	NM_005806		6	10	0	0	0	0.001168	0	6	10				
DSCAM	1826	broad.mit.edu	37	21	41459132	41459132	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:41459132C>A	ENST00000400454.1	-	22	4410	c.3933G>T	c.(3931-3933)ggG>ggT	p.G1311G		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1311	Ig-like C2-type 10.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAGAAGGGTCCCCAACAGCCT	0.468																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(3931-3933)GGG>GGT		Down syndrome cell adhesion molecule isoform							145.0	143.0	144.0					21																	41459132		1988	4173	6161	SO:0001819	synonymous_variant	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41459132C>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3933G>T	21.37:g.41459132C>A			Somatic				DSCAM_uc002yyr.1_RNA	p.G1311G	NM_001389	NP_001380	WXS	Illumina HiSeq	Unspecified	O60469	DSCAM_HUMAN			22	4385	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	1311			Extracellular (Potential).|Ig-like C2-type 10.		O60468	Silent	SNP	ENST00000400454.1	37	c.3933G>T	CCDS42929.1																																																																																				0.468	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		8	95	1	0	1.12685e-05	0.004482	1.36628e-05	8	95				
KRTAP10-9	386676	broad.mit.edu	37	21	46047279	46047279	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:46047279C>T	ENST00000397911.3	+	1	240	c.191C>T	c.(190-192)cCc>cTc	p.P64L	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	64	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ACCTGTGAGCCCAGCCCCTGC	0.697																																							uc002zfp.3		NA																	0					0						c.(190-192)CCC>CTC		keratin associated protein 10-9							53.0	63.0	60.0					21																	46047279		2197	4297	6494	SO:0001583	missense	386676					keratin filament		g.chr21:46047279C>T	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.191C>T	21.37:g.46047279C>T	ENSP00000381009:p.Pro64Leu		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.P64L	NM_198690	NP_941963	WXS	Illumina HiSeq	Unspecified	P60411	KR109_HUMAN			1	240	+			64			25 X 5 AA repeats of C-C-X(3).		A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	c.191C>T	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	c	4.058	0.008567	0.07912	.	.	ENSG00000221837	ENST00000397911	T	0.00711	5.8	2.19	1.24	0.21308	.	.	.	.	.	T	0.01489	0.0048	M	0.85630	2.765	0.33127	D	0.542535	B	0.17465	0.022	B	0.17098	0.017	T	0.03630	-1.1018	8	.	.	.	.	7.1196	0.25437	0.0:0.7168:0.2832:0.0	.	64	P60411	KR109_HUMAN	L	64	ENSP00000381009:P64L	.	P	+	2	0	KRTAP10-9	44871707	0.000000	0.05858	0.015000	0.15790	0.010000	0.07245	0.175000	0.16762	0.211000	0.20683	-0.314000	0.08810	CCC		0.697	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1			23	142	0	0	0	0.00278	0	23	142				
DIP2A	23181	broad.mit.edu	37	21	47929244	47929244	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:47929244C>T	ENST00000417564.2	+	7	880	c.859C>T	c.(859-861)Cca>Tca	p.P287S	DIP2A_ENST00000318711.7_Missense_Mutation_p.P288S|DIP2A_ENST00000400274.1_Missense_Mutation_p.P287S|DIP2A_ENST00000457905.3_Missense_Mutation_p.P287S|DIP2A_ENST00000435722.3_Missense_Mutation_p.P287S|DIP2A_ENST00000466639.1_Missense_Mutation_p.P244S|DIP2A_ENST00000427143.2_Missense_Mutation_p.P223S			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	287					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AAAGCGCCCTCCACTGAAGGA	0.493																																							uc002zjo.2		NA																	0				ovary(2)	2						c.(859-861)CCA>TCA		disco-interacting protein 2A isoform a							132.0	133.0	132.0					21																	47929244		1938	4164	6102	SO:0001583	missense	23181				multicellular organismal development	nucleus	catalytic activity|transcription factor binding	g.chr21:47929244C>T	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.859C>T	21.37:g.47929244C>T	ENSP00000392066:p.Pro287Ser		Somatic				DIP2A_uc011afy.1_Missense_Mutation_p.P223S|DIP2A_uc011afz.1_Missense_Mutation_p.P287S|DIP2A_uc002zjl.2_Missense_Mutation_p.P287S|DIP2A_uc002zjm.2_Missense_Mutation_p.P287S|DIP2A_uc010gql.2_Missense_Mutation_p.P244S|DIP2A_uc002zjn.2_Missense_Mutation_p.P287S|DIP2A_uc002zjp.1_Missense_Mutation_p.P32S	p.P287S	NM_015151	NP_055966	WXS	Illumina HiSeq	Unspecified	Q14689	DIP2A_HUMAN		Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)	7	1042	+	Breast(49;0.0933)		287					A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	c.859C>T	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468825	0.84533	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.75939	0.3918	M	0.85197	2.74	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.983;0.998;0.999;1.0;1.0;0.999	T	0.79743	-0.1675	10	0.56958	D	0.05	-14.6169	17.3979	0.87451	0.0:1.0:0.0:0.0	.	288;223;244;287;287;287	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	S	287;223;288;244;287;244;287;287	ENSP00000383133:P287S;ENSP00000400528:P223S;ENSP00000323633:P288S;ENSP00000393434:P287S;ENSP00000430249:P244S;ENSP00000415089:P287S;ENSP00000392066:P287S	ENSP00000323633:P288S	P	+	1	0	DIP2A	46753672	1.000000	0.71417	0.958000	0.39756	0.750000	0.42670	5.907000	0.69908	2.353000	0.79882	0.655000	0.94253	CCA		0.493	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		44	85	0	0	0	0.00361	0	44	85				
PRAME	23532	broad.mit.edu	37	22	22893340	22893340	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:22893340G>T	ENST00000398741.1	-	4	499	c.193C>A	c.(193-195)Cac>Aac	p.H65N	PRAME_ENST00000485532.1_5'UTR|PRAME_ENST00000405655.3_Missense_Mutation_p.H65N|PRAME_ENST00000402697.1_Missense_Mutation_p.H65N|PRAME_ENST00000424204.2_Missense_Mutation_p.H49N|PRAME_ENST00000543184.1_Missense_Mutation_p.H65N|PRAME_ENST00000406503.1_Missense_Mutation_p.H65N|PRAME_ENST00000539862.1_Missense_Mutation_p.H49N|PRAME_ENST00000398743.2_Missense_Mutation_p.H65N	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	65					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		GTCTGGCTGTGTCTCCCGTCA	0.612																																					Melanoma(73;1707 1838 15168 27201)	Melanoma(73;1707 1838 15168 27201)	uc002zwf.2		NA																	0				central_nervous_system(2)	2						c.(193-195)CAC>AAC		preferentially expressed antigen in melanoma							94.0	87.0	90.0					22																	22893340		2203	4300	6503	SO:0001583	missense	23532				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding	g.chr22:22893340G>T	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.193C>A	22.37:g.22893340G>T	ENSP00000381726:p.His65Asn		Somatic				LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.H49N|PRAME_uc010gtr.2_Missense_Mutation_p.H65N|PRAME_uc002zwg.2_Missense_Mutation_p.H65N|PRAME_uc002zwh.2_Missense_Mutation_p.H65N|PRAME_uc002zwi.2_Missense_Mutation_p.H65N|PRAME_uc002zwj.2_Missense_Mutation_p.H65N|PRAME_uc002zwk.2_Missense_Mutation_p.H65N	p.H65N	NM_206956	NP_996839	WXS	Illumina HiSeq	Unspecified	P78395	PRAME_HUMAN		READ - Rectum adenocarcinoma(21;0.0649)	3	349	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)	65					B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	ENST00000398741.1	37	c.193C>A	CCDS13801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.70|10.70	1.424737|1.424737	0.25639|0.25639	.|.	.|.	ENSG00000185686|ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204;ENST00000439106;ENST00000420709;ENST00000406503;ENST00000403441|ENST00000438888	T;T;T;T;T;T;T;T;T;T;T|.	0.12361|.	2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69|.	3.46|3.46	0.16|0.16	0.14972|0.14972	.|.	0.353958|.	0.25467|.	N|.	0.030472|.	T|T	0.48822|0.48822	0.1521|0.1521	M|M	0.84326|0.84326	2.69|2.69	0.09310|0.09310	N|N	1|1	D|.	0.62365|.	0.991|.	P|.	0.62813|.	0.907|.	T|T	0.46925|0.46925	-0.9156|-0.9156	10|5	0.62326|.	D|.	0.03|.	.|.	2.9456|2.9456	0.05845|0.05845	0.3381:0.0:0.4662:0.1957|0.3381:0.0:0.4662:0.1957	.|.	65|.	P78395|.	PRAME_HUMAN|.	N|K	65;65;65;65;49;65;49;65;65;65;65|88	ENSP00000381728:H65N;ENSP00000445675:H65N;ENSP00000381726:H65N;ENSP00000384343:H65N;ENSP00000445097:H49N;ENSP00000385198:H65N;ENSP00000407342:H49N;ENSP00000407320:H65N;ENSP00000412318:H65N;ENSP00000384058:H65N;ENSP00000385091:H65N|.	ENSP00000381726:H65N|.	H|T	-|-	1|2	0|0	PRAME|PRAME	21223340|21223340	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.025000|0.025000	0.11179|0.11179	0.000000|0.000000	0.12993|0.12993	0.116000|0.116000	0.18110|0.18110	0.655000|0.655000	0.94253|0.94253	CAC|ACA		0.612	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953		17	89	1	0	2.39187e-15	0.008871	3.95677e-15	17	89				
APOL3	80833	broad.mit.edu	37	22	36537770	36537770	+	Silent	SNP	C	C	A	rs146525352	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:36537770C>A	ENST00000349314.2	-	3	724	c.687G>T	c.(685-687)gcG>gcT	p.A229A	APOL3_ENST00000361710.2_Silent_p.A29A|APOL3_ENST00000397293.2_Silent_p.A158A|APOL3_ENST00000487423.1_5'UTR|APOL3_ENST00000424878.2_Silent_p.A29A|APOL3_ENST00000397287.2_Silent_p.A29A	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	229					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						TCACAGCAGACGCTGCTCCCA	0.567																																							uc003aot.2		NA																	0					0						c.(685-687)GCG>GCT		apolipoprotein L3 isoform 1							58.0	47.0	51.0					22																	36537770		2203	4300	6503	SO:0001819	synonymous_variant	80833				inflammatory response|lipoprotein metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	lipid binding|lipid transporter activity|signal transducer activity	g.chr22:36537770C>A	AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.687G>T	22.37:g.36537770C>A			Somatic				APOL3_uc003aoq.2_Silent_p.A158A|APOL3_uc003aor.2_Silent_p.A158A|APOL3_uc003aos.2_Silent_p.A158A|APOL3_uc003aou.2_Silent_p.A29A|APOL3_uc003aov.2_Silent_p.A29A	p.A229A	NM_145640	NP_663615	WXS	Illumina HiSeq	Unspecified	O95236	APOL3_HUMAN			3	725	-			229					B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Silent	SNP	ENST00000349314.2	37	c.687G>T	CCDS13922.1																																																																																				0.567	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319268.1	NM_145641		3	29	1	0	0.00909568	0.009096	0.00963801	3	29				
CACNG2	10369	broad.mit.edu	37	22	37098411	37098411	+	Splice_Site	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:37098411C>T	ENST00000300105.6	-	1	1192	c.211G>A	c.(211-213)Ggg>Agg	p.G71R	RP1-293L6.1_ENST00000430281.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	71					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						AGTCAAGTACCTTCTAGGCAG	0.527																																							uc003aps.1		NA																	0					0						c.(211-213)GGG>AGG		voltage-dependent calcium channel gamma-2							198.0	161.0	174.0					22																	37098411		2203	4300	6503	SO:0001630	splice_region_variant	10369				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chr22:37098411C>T	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.211+1G>A	22.37:g.37098411C>T			Somatic				uc003apt.1_5'Flank	p.G71R	NM_006078	NP_006069	WXS	Illumina HiSeq	Unspecified	Q9Y698	CCG2_HUMAN			1	493	-			71					Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	37	c.211G>A	CCDS13931.1	.	.	.	.	.	.	.	.	.	.	c	18.56	3.650523	0.67472	.	.	ENSG00000166862	ENST00000300105	D	0.88818	-2.43	4.2	4.2	0.49525	.	0.155049	0.44688	D	0.000427	D	0.92014	0.7470	M	0.67953	2.075	0.80722	D	1	D	0.60575	0.988	P	0.56823	0.807	D	0.92044	0.5643	9	.	.	.	.	16.9822	0.86331	0.0:1.0:0.0:0.0	.	71	Q9Y698	CCG2_HUMAN	R	71	ENSP00000300105:G71R	.	G	-	1	0	CACNG2	35428357	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.284000	0.78650	2.050000	0.60909	0.546000	0.68486	GGG		0.527	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		Missense_Mutation	18	55	0	0	0	0.006122	0	18	55				
MFNG	4242	broad.mit.edu	37	22	37882095	37882095	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:37882095G>C	ENST00000356998.3	-	1	344	c.121C>G	c.(121-123)Ctg>Gtg	p.L41V	MFNG_ENST00000416983.3_Missense_Mutation_p.L41V	NM_002405.3	NP_002396.2	O00587	MFNG_HUMAN	MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	41					pattern specification process (GO:0007389)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)	extracellular space (GO:0005615)|integral component of Golgi membrane (GO:0030173)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			large_intestine(2)|lung(2)|skin(1)	5	Melanoma(58;0.0574)					GGCTGGCTCAGCTCGGGGGTC	0.652																																							uc003ass.1		NA																	0				lung(1)	1						c.(121-123)CTG>GTG		O-fucosylpeptide							30.0	35.0	33.0					22																	37882095		2203	4300	6503	SO:0001583	missense	4242				pattern specification process	extracellular space|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity	g.chr22:37882095G>C	BC094814	CCDS13947.1, CCDS54525.1	22q13.1	2013-02-19	2006-11-13		ENSG00000100060	ENSG00000100060	2.4.1.222	"""Beta 3-glycosyltransferases"""	7038	protein-coding gene	gene with protein product		602577	"""manic fringe (Drosophila) homolog"", ""manic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_002405		Approved		uc003ass.2	O00587	OTTHUMG00000150560	ENST00000356998.3:c.121C>G	22.37:g.37882095G>C	ENSP00000349490:p.Leu41Val		Somatic				MFNG_uc011ani.1_5'UTR|MFNG_uc011anj.1_Missense_Mutation_p.L41V|CARD10_uc003ast.1_Intron	p.L41V	NM_002405	NP_002396	WXS	Illumina HiSeq	Unspecified	O00587	MFNG_HUMAN			1	291	-	Melanoma(58;0.0574)		41			Lumenal (Potential).		B4DLT6|O43730|Q504S9	Missense_Mutation	SNP	ENST00000356998.3	37	c.121C>G	CCDS13947.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878407	0.33162	.	.	ENSG00000100060	ENST00000416983;ENST00000356998;ENST00000424765	T;T	0.54675	0.57;0.56	4.31	3.23	0.37069	.	1.042900	0.07604	N	0.924103	T	0.37785	0.1016	L	0.41236	1.265	0.09310	N	1	B;P	0.39391	0.442;0.671	B;B	0.26770	0.05;0.073	T	0.14090	-1.0485	10	0.29301	T	0.29	-0.2009	8.9526	0.35799	0.0:0.2838:0.5667:0.1495	.	41;41	B4DLT6;O00587	.;MFNG_HUMAN	V	41	ENSP00000413855:L41V;ENSP00000349490:L41V	ENSP00000349490:L41V	L	-	1	2	MFNG	36212041	0.000000	0.05858	0.039000	0.18376	0.142000	0.21351	0.060000	0.14342	1.964000	0.57103	0.298000	0.19748	CTG		0.652	MFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318902.1	NM_002405		10	36	0	0	0	0.001368	0	10	36				
ACO2	50	broad.mit.edu	37	22	41895792	41895792	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:41895792G>T	ENST00000216254.4	+	2	121	c.99G>T	c.(97-99)gcG>gcT	p.A33A	ACO2_ENST00000396512.3_Silent_p.A33A	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	33					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						CCAAGGTGGCGATGAGCCACT	0.522																																							uc003bac.2		NA																	0				breast(2)|ovary(1)|lung(1)	4						c.(97-99)GCG>GCT		aconitase 2, mitochondrial precursor							225.0	209.0	214.0					22																	41895792		2203	4300	6503	SO:0001819	synonymous_variant	50				citrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron ion binding|isocitrate hydro-lyase (cis-aconitate-forming) activity	g.chr22:41895792G>T	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.99G>T	22.37:g.41895792G>T			Somatic				ACO2_uc003bad.2_Silent_p.A33A	p.A33A	NM_001098	NP_001089	WXS	Illumina HiSeq	Unspecified	Q99798	ACON_HUMAN			2	121	+			33					O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Silent	SNP	ENST00000216254.4	37	c.99G>T	CCDS14017.1																																																																																				0.522	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098		49	255	1	0	2.64894e-19	0.00361	4.6808e-19	49	255				
FAM118A	55007	broad.mit.edu	37	22	45726535	45726535	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:45726535G>C	ENST00000216214.3	+	6	1408	c.574G>C	c.(574-576)Ggc>Cgc	p.G192R	FAM118A_ENST00000405548.3_Missense_Mutation_p.G10R|FAM118A_ENST00000441876.2_Missense_Mutation_p.G192R	NM_001104595.1	NP_001098065.1	Q9NWS6	F118A_HUMAN	family with sequence similarity 118, member A	192						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CCACATTCACGGCCTCTACAC	0.522																																							uc003bfz.3		NA																	0					0						c.(574-576)GGC>CGC		hypothetical protein LOC55007							108.0	95.0	100.0					22																	45726535		2203	4300	6503	SO:0001583	missense	55007					integral to membrane		g.chr22:45726535G>C	BC013696	CCDS14065.1	22q13.3	2006-04-26	2006-04-26	2006-04-26	ENSG00000100376	ENSG00000100376			1313	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 8"""	C22orf8		12477932	Standard	NM_001104595		Approved	FLJ20635, bK268H5.C22.4	uc003bga.4	Q9NWS6	OTTHUMG00000151338	ENST00000216214.3:c.574G>C	22.37:g.45726535G>C	ENSP00000216214:p.Gly192Arg		Somatic				FAM118A_uc003bga.3_Missense_Mutation_p.G192R|FAM118A_uc011aqr.1_Missense_Mutation_p.G10R	p.G192R	NM_001104595	NP_001098065	WXS	Illumina HiSeq	Unspecified	Q9NWS6	F118A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)	6	1190	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	192					B3KWG4|B4DY02|Q5TII5|Q96CY3	Missense_Mutation	SNP	ENST00000216214.3	37	c.574G>C	CCDS14065.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652577	0.67472	.	.	ENSG00000100376	ENST00000216214;ENST00000441876;ENST00000405548	D;D;D	0.95656	-3.77;-3.77;-3.77	6.17	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.97009	0.9023	L	0.58101	1.795	0.58432	D	0.999991	D	0.89917	1.0	D	0.79108	0.992	D	0.97669	1.0165	10	0.87932	D	0	-5.5888	16.394	0.83550	0.0:0.0:0.8672:0.1328	.	192	Q9NWS6	F118A_HUMAN	R	192;192;10	ENSP00000216214:G192R;ENSP00000395892:G192R;ENSP00000384836:G10R	ENSP00000216214:G192R	G	+	1	0	FAM118A	44105199	1.000000	0.71417	0.149000	0.22428	0.120000	0.20174	8.663000	0.91134	1.561000	0.49584	0.655000	0.94253	GGC		0.522	FAM118A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322260.1	NM_017911		10	33	0	0	0	0.006214	0	10	33				
CHL1	10752	broad.mit.edu	37	3	447382	447382	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:447382C>A	ENST00000256509.2	+	28	4305	c.3663C>A	c.(3661-3663)ccC>ccA	p.P1221P	CHL1_ENST00000397491.2_Silent_p.P1205P	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CAACTTTTCCCCTTCGGGCAT	0.418																																							uc003bou.2		NA																	0				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(3613-3615)CCC>CCA		cell adhesion molecule with homology to L1CAM							110.0	102.0	105.0					3																	447382		2203	4300	6503	SO:0001819	synonymous_variant	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:447382C>A	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3663C>A	3.37:g.447382C>A			Somatic				CHL1_uc003bot.2_Silent_p.P1221P|CHL1_uc011asi.1_Silent_p.P1168P	p.P1205P	NM_006614	NP_006605	WXS	Illumina HiSeq	Unspecified	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	27	3886	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	1205			Cytoplasmic (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000256509.2	37	c.3615C>A	CCDS2556.1																																																																																				0.418	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		9	20	1	0	0.000274275	0.004482	0.000308498	9	20				
TTLL3	26140	broad.mit.edu	37	3	9877118	9877118	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:9877118G>A	ENST00000547186.1	+	13	2480	c.2264G>A	c.(2263-2265)gGg>gAg	p.G755E	TTLL3_ENST00000426895.4_Missense_Mutation_p.G898E|TTLL3_ENST00000455274.1_Intron|TTLL3_ENST00000383827.1_3'UTR|TTLL3_ENST00000397241.1_3'UTR	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	755					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					GCTGTTGGAGGGTCAAGAGTG	0.567																																							uc003btg.2		NA																	0				large_intestine(2)	2						c.(2263-2265)GGG>GAG		tubulin tyrosine ligase-like family, member 3							127.0	133.0	131.0					3																	9877118		1951	4157	6108	SO:0001583	missense	26140				axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity	g.chr3:9877118G>A		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.2264G>A	3.37:g.9877118G>A	ENSP00000446659:p.Gly755Glu		Somatic				ARPC4_uc003btc.1_Intron	p.G755E	NM_001025930	NP_001021100	WXS	Illumina HiSeq	Unspecified	Q9Y4R7	TTLL3_HUMAN			13	2480	+	Medulloblastoma(99;0.227)		755					Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	ENST00000547186.1	37	c.2264G>A		.	.	.	.	.	.	.	.	.	.	G	14.50	2.554176	0.45487	.	.	ENSG00000214021	ENST00000426895;ENST00000547186	T;T	0.06933	3.24;3.37	3.94	3.05	0.35203	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	0.99999	P	0.46987	0.888	P	0.44990	0.466	T	0.30119	-0.9989	9	0.87932	D	0	.	6.8315	0.23913	0.128:0.0:0.872:0.0	.	755	Q9Y4R7	TTLL3_HUMAN	E	898;755	ENSP00000392549:G898E;ENSP00000446659:G755E	ENSP00000392549:G898E	G	+	2	0	TTLL3	9852118	0.023000	0.18921	0.002000	0.10522	0.044000	0.14063	1.788000	0.38714	1.226000	0.43582	0.561000	0.74099	GGG		0.567	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2		16	135	0	0	0	0.004007	0	16	135				
SLC6A1	6529	broad.mit.edu	37	3	11067189	11067189	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:11067189C>A	ENST00000287766.4	+	8	1190	c.769C>A	c.(769-771)Cgt>Agt	p.R257S	SLC6A1_ENST00000536032.1_Missense_Mutation_p.R79S	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	257					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	CCTGTTCTTCCGTGGAGTGAC	0.587																																							uc010hdq.2		NA																	0				ovary(1)|skin(1)	2						c.(769-771)CGT>AGT		solute carrier family 6 (neurotransmitter	Cocaine(DB00907)|Tiagabine(DB00906)						153.0	112.0	126.0					3																	11067189		2203	4300	6503	SO:0001583	missense	6529				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr3:11067189C>A		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.769C>A	3.37:g.11067189C>A	ENSP00000287766:p.Arg257Ser		Somatic					p.R257S	NM_003042	NP_003033	WXS	Illumina HiSeq	Unspecified	P30531	SC6A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	8	1180	+		Ovarian(110;0.0392)	257					Q8N4K8	Missense_Mutation	SNP	ENST00000287766.4	37	c.769C>A	CCDS2603.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909330	0.92107	.	.	ENSG00000157103	ENST00000287766;ENST00000536032	T;T	0.78924	-1.22;-1.22	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000008	D	0.87845	0.6280	H	0.97635	4.045	0.80722	D	1	B	0.21606	0.058	B	0.31442	0.13	D	0.88612	0.3157	10	0.87932	D	0	.	18.2427	0.89973	0.0:1.0:0.0:0.0	.	257	P30531	SC6A1_HUMAN	S	257;79	ENSP00000287766:R257S;ENSP00000445171:R79S	ENSP00000287766:R257S	R	+	1	0	SLC6A1	11042189	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.512000	0.81728	2.547000	0.85894	0.491000	0.48974	CGT		0.587	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042		8	40	1	0	0.000442599	0.006214	0.000496926	8	40				
FGD5	152273	broad.mit.edu	37	3	14861743	14861743	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:14861743A>T	ENST00000285046.5	+	1	1275	c.1165A>T	c.(1165-1167)Atg>Ttg	p.M389L	FGD5_ENST00000543601.1_Missense_Mutation_p.M148L	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	389					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GGAGAACCCCATGGTGGGGGC	0.607																																							uc003bzc.2		NA																	0				ovary(3)|kidney(1)|pancreas(1)	5						c.(1165-1167)ATG>TTG		FYVE, RhoGEF and PH domain containing 5							31.0	35.0	34.0					3																	14861743		1939	4143	6082	SO:0001583	missense	152273				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr3:14861743A>T	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1165A>T	3.37:g.14861743A>T	ENSP00000285046:p.Met389Leu		Somatic				FGD5_uc011avk.1_Missense_Mutation_p.M389L	p.M389L	NM_152536	NP_689749	WXS	Illumina HiSeq	Unspecified	Q6ZNL6	FGD5_HUMAN			1	1275	+			389					B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	c.1165A>T	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	A	0.188	-1.055605	0.01965	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.73897	-0.79;-0.63	4.73	-0.524	0.11920	.	1.511340	0.04355	N	0.356442	T	0.46795	0.1411	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38265	-0.9669	10	0.08599	T	0.76	-0.1167	5.4158	0.16374	0.3265:0.2346:0.4389:0.0	.	148;389	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	L	389;148	ENSP00000285046:M389L;ENSP00000445949:M148L	ENSP00000285046:M389L	M	+	1	0	FGD5	14836747	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.842000	0.04354	0.102000	0.17638	-0.696000	0.03686	ATG		0.607	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		9	49	0	0	0	0.006214	0	9	49				
KCNH8	131096	broad.mit.edu	37	3	19575056	19575056	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:19575056C>A	ENST00000328405.2	+	16	3055	c.2789C>A	c.(2788-2790)gCa>gAa	p.A930E		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	930					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AGCTGGAGTGCACACCAGCCT	0.527																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	0				lung(4)|ovary(1)	5						c.(2788-2790)GCA>GAA		potassium voltage-gated channel, subfamily H,							91.0	85.0	87.0					3																	19575056		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19575056C>A	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2789C>A	3.37:g.19575056C>A	ENSP00000328813:p.Ala930Glu		Somatic				KCNH8_uc010hex.1_Missense_Mutation_p.A391E	p.A930E	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			16	2984	+			930			Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.2789C>A	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.178380	0.00027	.	.	ENSG00000183960	ENST00000328405	D	0.98531	-4.98	5.58	3.79	0.43588	.	0.562373	0.12820	U	0.436525	D	0.94443	0.8212	N	0.19112	0.55	0.09310	N	1	B	0.14012	0.009	B	0.15484	0.013	D	0.85700	0.1312	9	.	.	.	.	10.4346	0.44428	0.1126:0.7582:0.0:0.1292	.	930	Q96L42	KCNH8_HUMAN	E	930	ENSP00000328813:A930E	.	A	+	2	0	KCNH8	19550060	0.007000	0.16637	0.000000	0.03702	0.014000	0.08584	2.307000	0.43682	0.323000	0.23307	-0.797000	0.03246	GCA		0.527	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		4	76	1	0	0.00909568	0.009096	0.00963801	4	76				
PTPN23	25930	broad.mit.edu	37	3	47450286	47450286	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:47450286G>A	ENST00000265562.4	+	16	1428	c.1351G>A	c.(1351-1353)Gat>Aat	p.D451N	PTPN23_ENST00000431726.1_Missense_Mutation_p.D325N	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	451					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGTGTTCACGGATGTGGAGGC	0.612																																							uc003crf.1		NA																	0				breast(1)|central_nervous_system(1)|skin(1)	3						c.(1351-1353)GAT>AAT		protein tyrosine phosphatase, non-receptor type							91.0	83.0	86.0					3																	47450286		2203	4300	6503	SO:0001583	missense	25930				cilium morphogenesis	cilium|cytoplasmic membrane-bounded vesicle|microtubule basal body	protein tyrosine phosphatase activity	g.chr3:47450286G>A	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1351G>A	3.37:g.47450286G>A	ENSP00000265562:p.Asp451Asn		Somatic				PTPN23_uc011baw.1_Missense_Mutation_p.D416N|PTPN23_uc011bax.1_RNA|PTPN23_uc011bay.1_Missense_Mutation_p.D321N	p.D451N	NM_015466	NP_056281	WXS	Illumina HiSeq	Unspecified	Q9H3S7	PTN23_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	16	1447	+			451					A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	c.1351G>A	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861162	0.91433	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.28454	1.61	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.52677	0.1749	M	0.72118	2.19	0.80722	D	1	B;D	0.64830	0.048;0.994	B;D	0.64595	0.159;0.927	T	0.58036	-0.7707	10	0.62326	D	0.03	-18.382	15.6718	0.77283	0.0:0.0:1.0:0.0	.	325;451	B4DST5;Q9H3S7	.;PTN23_HUMAN	N	416;451	ENSP00000265562:D451N	ENSP00000265562:D451N	D	+	1	0	PTPN23	47425290	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.176000	0.94839	2.220000	0.72140	0.557000	0.71058	GAT		0.612	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466		23	85	0	0	0	0.00278	0	23	85				
UBA7	7318	broad.mit.edu	37	3	49841780	49841780	+	IGR	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:49841780T>A	ENST00000333486.3	-	0	3299				MIR5193_ENST00000584510.1_RNA|FAM212A_ENST00000333323.4_Missense_Mutation_p.V75E	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		gaggaAGCAGTGGTGACAGAA	0.627																																							uc003cxq.1		NA																	0					0						c.(223-225)GTG>GAG		hypothetical protein LOC389119							69.0	68.0	68.0					3																	49841780		2203	4300	6503	SO:0001628	intergenic_variant	389119							g.chr3:49841780T>A	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		3.37:g.49841780T>A			Somatic					p.V75E	NM_203370	NP_976248	WXS	Illumina HiSeq	Unspecified	Q96EL1	CC054_HUMAN		BRCA - Breast invasive adenocarcinoma(193;3.55e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)	2	357	+			73					Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	c.224T>A	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	T	8.785	0.929224	0.18131	.	.	ENSG00000185614	ENST00000333323	.	.	.	3.81	1.4	0.22301	.	1.041630	0.07689	N	0.938358	T	0.21145	0.0509	N	0.19112	0.55	0.09310	N	1	B	0.29716	0.255	B	0.29942	0.109	T	0.28554	-1.0040	9	0.26408	T	0.33	.	3.9407	0.09326	0.0:0.1128:0.2165:0.6707	.	73	Q96EL1	CC054_HUMAN	E	75	.	ENSP00000329735:V75E	V	+	2	0	C3orf54	49816784	0.001000	0.12720	0.027000	0.17364	0.981000	0.71138	0.349000	0.20055	0.306000	0.22856	0.459000	0.35465	GTG		0.627	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335		16	46	0	0	0	0.003163	0	16	46				
GRM2	2912	broad.mit.edu	37	3	51746673	51746673	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:51746673C>A	ENST00000395052.3	+	3	869	c.635C>A	c.(634-636)tCt>tAt	p.S212Y	GRM2_ENST00000442933.2_Missense_Mutation_p.S212Y|GRM2_ENST00000475478.1_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	212					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACTGTGGCGTCTGAGGGCGAC	0.582																																							uc010hlv.2		NA																	0				lung(1)	1						c.(634-636)TCT>TAT		glutamate receptor, metabotropic 2 isoform a	Acamprosate(DB00659)|Nicotine(DB00184)						113.0	103.0	106.0					3																	51746673		2203	4300	6503	SO:0001583	missense	2912				synaptic transmission	integral to plasma membrane		g.chr3:51746673C>A	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.635C>A	3.37:g.51746673C>A	ENSP00000378492:p.Ser212Tyr		Somatic				GRM2_uc003dbo.3_Intron|GRM2_uc010hlu.2_RNA	p.S212Y	NM_000839	NP_000830	WXS	Illumina HiSeq	Unspecified	Q14416	GRM2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	3	874	+			212			Extracellular (Potential).		B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	c.635C>A	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610011	0.87258	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.84146	-1.81;-1.81	4.95	4.95	0.65309	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.94335	0.8179	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95571	0.8638	10	0.87932	D	0	.	18.5541	0.91077	0.0:1.0:0.0:0.0	.	212	Q14416	GRM2_HUMAN	Y	212	ENSP00000378492:S212Y;ENSP00000408906:S212Y	ENSP00000296479:S212Y	S	+	2	0	GRM2	51721713	1.000000	0.71417	0.889000	0.34880	0.992000	0.81027	7.818000	0.86416	2.476000	0.83614	0.591000	0.81541	TCT		0.582	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1			20	57	1	0	2.4624e-09	0.008871	3.48093e-09	20	57				
ITIH3	3699	broad.mit.edu	37	3	52840398	52840398	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:52840398C>A	ENST00000449956.2	+	18	2038	c.2032C>A	c.(2032-2034)Cgc>Agc	p.R678S	ITIH3_ENST00000416872.2_Intron	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	678					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CACAGTGCTGCGCCTTATTCA	0.612																																							uc003dfv.2		NA																	0				ovary(2)|liver(1)	3						c.(2032-2034)CGC>AGC		inter-alpha (globulin) inhibitor H3							45.0	45.0	45.0					3																	52840398		1966	4141	6107	SO:0001583	missense	3699				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr3:52840398C>A		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.2032C>A	3.37:g.52840398C>A	ENSP00000415769:p.Arg678Ser		Somatic				ITIH3_uc011bek.1_Intron	p.R678S	NM_002217	NP_002208	WXS	Illumina HiSeq	Unspecified	Q06033	ITIH3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)	18	2068	+			678					Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	37	c.2032C>A	CCDS46845.1	.	.	.	.	.	.	.	.	.	.	C	5.674	0.308956	0.10733	.	.	ENSG00000162267	ENST00000273291;ENST00000449956	T	0.01548	4.78	5.38	2.05	0.26809	.	0.337826	0.33496	N	0.004854	T	0.01523	0.0049	L	0.28274	0.84	0.29911	N	0.823583	B	0.06786	0.001	B	0.08055	0.003	T	0.35871	-0.9771	10	0.11182	T	0.66	-10.1344	12.7828	0.57487	0.6466:0.3534:0.0:0.0	.	678	Q06033	ITIH3_HUMAN	S	673;678	ENSP00000415769:R678S	ENSP00000273291:R673S	R	+	1	0	ITIH3	52815438	0.797000	0.28877	1.000000	0.80357	0.093000	0.18481	0.444000	0.21661	0.724000	0.32296	0.561000	0.74099	CGC		0.612	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217		13	30	1	0	9.16793e-09	0.00499	1.2644e-08	13	30				
ADAMTS9	56999	broad.mit.edu	37	3	64617141	64617141	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:64617141G>T	ENST00000498707.1	-	16	2721	c.2379C>A	c.(2377-2379)gaC>gaA	p.D793E	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.D765E	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	793	Spacer.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTAAGTAGTTGTCATCGTCTG	0.483																																							uc003dmg.2		NA																	0				ovary(2)|urinary_tract(1)|skin(1)	4						c.(2377-2379)GAC>GAA		ADAM metallopeptidase with thrombospondin type 1							165.0	170.0	169.0					3																	64617141		2203	4300	6503	SO:0001583	missense	56999				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr3:64617141G>T	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2379C>A	3.37:g.64617141G>T	ENSP00000418735:p.Asp793Glu		Somatic				ADAMTS9_uc011bfo.1_Missense_Mutation_p.D765E|ADAMTS9_uc003dmh.1_Missense_Mutation_p.D622E|ADAMTS9_uc003dmk.1_Missense_Mutation_p.D793E	p.D793E	NM_182920	NP_891550	WXS	Illumina HiSeq	Unspecified	Q9P2N4	ATS9_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)	16	2411	-		Lung NSC(201;0.00682)	793			Spacer.		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	c.2379C>A	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818787	0.50633	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.58506	0.33;0.35	6.07	2.06	0.26882	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.72070	0.3415	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;1.0	D;D;D;D	0.81914	0.995;0.979;0.961;0.995	T	0.71774	-0.4491	10	0.72032	D	0.01	.	9.3703	0.38250	0.3728:0.0:0.6272:0.0	.	765;793;793;793	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	E	765;793	ENSP00000295903:D765E;ENSP00000418735:D793E	ENSP00000295903:D765E	D	-	3	2	ADAMTS9	64592181	1.000000	0.71417	1.000000	0.80357	0.137000	0.21094	0.928000	0.28831	0.355000	0.24131	0.650000	0.86243	GAC		0.483	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			6	108	1	0	8.12818e-05	0.001984	9.34516e-05	6	108				
HTR1F	3355	broad.mit.edu	37	3	88040418	88040418	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:88040418C>G	ENST00000319595.4	+	1	573	c.519C>G	c.(517-519)atC>atG	p.I173M		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	173					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	ATGAATGCATCATCAAGCACG	0.378																																							uc003dqr.2		NA																	0				ovary(3)	3						c.(517-519)ATC>ATG		5-hydroxytryptamine (serotonin) receptor 1F	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)						80.0	80.0	80.0					3																	88040418		2203	4300	6503	SO:0001583	missense	3355				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity	g.chr3:88040418C>G	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.519C>G	3.37:g.88040418C>G	ENSP00000322924:p.Ile173Met		Somatic					p.I173M	NM_000866	NP_000857	WXS	Illumina HiSeq	Unspecified	P30939	5HT1F_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	2	677	+	all_cancers(8;0.147)	Lung NSC(201;0.0283)	173			Extracellular (By similarity).			Missense_Mutation	SNP	ENST00000319595.4	37	c.519C>G	CCDS2920.1	.	.	.	.	.	.	.	.	.	.	C	9.764	1.170917	0.21621	.	.	ENSG00000179097	ENST00000319595	T	0.37752	1.18	5.15	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.105355	0.64402	D	0.000006	T	0.48642	0.1511	L	0.58969	1.84	0.29945	N	0.82073	D	0.54397	0.966	P	0.62435	0.902	T	0.46162	-0.9211	10	0.46703	T	0.11	.	9.4453	0.38693	0.1523:0.7599:0.0:0.0878	.	173	P30939	5HT1F_HUMAN	M	173	ENSP00000322924:I173M	ENSP00000322924:I173M	I	+	3	3	HTR1F	88123108	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	3.977000	0.56874	1.175000	0.42826	0.460000	0.39030	ATC		0.378	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866		7	42	0	0	0	0.001984	0	7	42				
PROS1	5627	broad.mit.edu	37	3	93619740	93619740	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:93619740C>A	ENST00000394236.3	-	7	951	c.635G>T	c.(634-636)tGt>tTt	p.C212F	PROS1_ENST00000407433.1_Missense_Mutation_p.C81F	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	212	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	AGCTGTGCCACAAATGCTTGG	0.388																																							uc003drb.3		NA																	0				large_intestine(1)	1						c.(634-636)TGT>TTT		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						66.0	61.0	63.0					3																	93619740		2203	4297	6500	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93619740C>A		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.635G>T	3.37:g.93619740C>A	ENSP00000377783:p.Cys212Phe		Somatic				PROS1_uc010hoo.2_Missense_Mutation_p.C81F|PROS1_uc003dqz.3_Missense_Mutation_p.C81F	p.C212F	NM_000313	NP_000304	WXS	Illumina HiSeq	Unspecified	P07225	PROS_HUMAN			7	976	-			212			EGF-like 3; calcium-binding (Potential).		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.635G>T	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018854	0.54576	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	D;D	0.99445	-5.91;-5.91	4.19	4.19	0.49359	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.050176	0.85682	D	0.000000	D	0.99736	0.9896	H	0.97874	4.095	0.58432	D	0.999993	D	0.76494	0.999	D	0.91635	0.999	D	0.96873	0.9641	10	0.87932	D	0	.	17.061	0.86547	0.0:1.0:0.0:0.0	.	212	P07225	PROS_HUMAN	F	212;81	ENSP00000377783:C212F;ENSP00000385794:C81F	ENSP00000377783:C212F	C	-	2	0	PROS1	95102430	1.000000	0.71417	0.996000	0.52242	0.471000	0.32888	6.018000	0.70811	2.341000	0.79615	0.591000	0.81541	TGT		0.388	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		6	35	1	0	8.12818e-05	0.001984	9.34516e-05	6	35				
MINA	84864	broad.mit.edu	37	3	97686352	97686352	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:97686352C>A	ENST00000333396.7	-	2	668	c.86G>T	c.(85-87)gGg>gTg	p.G29V	MINA_ENST00000360258.4_Missense_Mutation_p.G29V|MINA_ENST00000394198.2_Missense_Mutation_p.G29V|MINA_ENST00000330299.2_Missense_Mutation_p.G29V	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen											breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						AGCTGAAGGCCCCCCAGCTGC	0.483																																							uc003drz.1		NA																	0				ovary(1)	1						c.(85-87)GGG>GTG		MYC induced nuclear antigen isoform a							50.0	52.0	52.0					3																	97686352		2203	4300	6503	SO:0001583	missense	84864				ribosome biogenesis	cytoplasm|nucleolus		g.chr3:97686352C>A	AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.86G>T	3.37:g.97686352C>A	ENSP00000328251:p.Gly29Val		Somatic				MINA_uc003dsa.1_Missense_Mutation_p.G29V|MINA_uc003dsb.1_Missense_Mutation_p.G29V|MINA_uc003dsc.1_Missense_Mutation_p.G29V|MINA_uc010hpa.1_RNA|MINA_uc010hpb.1_Intron	p.G29V	NM_001042533	NP_001035998	WXS	Illumina HiSeq	Unspecified	Q8IUF8	MINA_HUMAN			2	592	-			29						Missense_Mutation	SNP	ENST00000333396.7	37	c.86G>T	CCDS43114.1	.	.	.	.	.	.	.	.	.	.	C	7.973	0.749510	0.15778	.	.	ENSG00000170854	ENST00000333396;ENST00000394198;ENST00000360258;ENST00000330299;ENST00000506099	T;T;T;T;T	0.21734	2.82;2.82;2.82;2.58;1.99	5.92	0.12	0.14691	.	1.166450	0.05948	N	0.638291	T	0.20129	0.0484	L	0.54323	1.7	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.33111	-0.9881	10	0.27785	T	0.31	-0.0564	7.2199	0.25981	0.1066:0.1979:0.6078:0.0878	.	29;29	Q8IUF8-4;Q8IUF8	.;MINA_HUMAN	V	29	ENSP00000328251:G29V;ENSP00000377748:G29V;ENSP00000353395:G29V;ENSP00000327424:G29V;ENSP00000423816:G29V	ENSP00000327424:G29V	G	-	2	0	MINA	99169042	0.000000	0.05858	0.000000	0.03702	0.374000	0.29953	-0.065000	0.11617	0.010000	0.14839	0.650000	0.86243	GGG		0.483	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359244.3	NM_032778		10	51	1	0	2.17888e-05	0.006214	2.58145e-05	10	51				
TIGIT	201633	broad.mit.edu	37	3	114014612	114014612	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:114014612C>T	ENST00000486257.1	+	3	539	c.282C>T	c.(280-282)acC>acT	p.T94T	TIGIT_ENST00000383671.3_Silent_p.T94T|TIGIT_ENST00000481065.1_Silent_p.T161T			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	94	Ig-like V-type.				negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						TGGGCCTCACCCTCCAGTCGC	0.577																																							uc003ebg.1		NA																	0				central_nervous_system(1)	1						c.(280-282)ACC>ACT		T cell immunoreceptor with Ig and ITIM domains							71.0	68.0	69.0					3																	114014612		2203	4300	6503	SO:0001819	synonymous_variant	201633				negative regulation of interleukin-12 production|negative regulation of T cell activation|positive regulation of interleukin-10 production	cell surface|integral to membrane|plasma membrane	protein binding	g.chr3:114014612C>T	AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.282C>T	3.37:g.114014612C>T			Somatic					p.T94T	NM_173799	NP_776160	WXS	Illumina HiSeq	Unspecified	Q495A1	TIGIT_HUMAN			2	316	+			94			Extracellular (Potential).|Ig-like V-type.		Q495A3|Q5JPD8|Q6MZS2|Q8N877	Silent	SNP	ENST00000486257.1	37	c.282C>T	CCDS2980.1																																																																																				0.577	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799		14	50	0	0	0	0.001855	0	14	50				
FBXO40	51725	broad.mit.edu	37	3	121341270	121341270	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:121341270A>G	ENST00000338040.4	+	3	1408	c.994A>G	c.(994-996)Aga>Gga	p.R332G		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	332					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		ACCCAAGGAGAGAGACTTTGT	0.468																																							uc003eeg.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(994-996)AGA>GGA		F-box protein 40							97.0	85.0	89.0					3																	121341270		2203	4300	6503	SO:0001583	missense	51725				muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding	g.chr3:121341270A>G	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.994A>G	3.37:g.121341270A>G	ENSP00000337510:p.Arg332Gly		Somatic					p.R332G	NM_016298	NP_057382	WXS	Illumina HiSeq	Unspecified	Q9UH90	FBX40_HUMAN		GBM - Glioblastoma multiforme(114;0.189)	3	1204	+			332					B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	c.994A>G	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	A	14.56	2.572339	0.45798	.	.	ENSG00000163833	ENST00000338040	T	0.51325	0.71	5.73	5.73	0.89815	.	0.304797	0.40302	N	0.001137	T	0.44456	0.1294	L	0.54323	1.7	0.43275	D	0.995233	B	0.30361	0.277	B	0.30495	0.116	T	0.33675	-0.9859	10	0.30078	T	0.28	-5.7106	13.985	0.64328	1.0:0.0:0.0:0.0	.	332	Q9UH90	FBX40_HUMAN	G	332	ENSP00000337510:R332G	ENSP00000337510:R332G	R	+	1	2	FBXO40	122823960	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.962000	0.93254	2.197000	0.70478	0.533000	0.62120	AGA		0.468	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298		12	53	0	0	0	0.001368	0	12	53				
AADAC	13	broad.mit.edu	37	3	151545806	151545806	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:151545806G>A	ENST00000232892.7	+	5	1172	c.1046G>A	c.(1045-1047)gGa>gAa	p.G349E	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	349					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AGAGATGATGGACTCATGTAT	0.458																																					Ovarian(30;839 841 2699 32801 46334)	Ovarian(30;839 841 2699 32801 46334)	uc003eze.2		NA																	0				skin(2)	2						c.(1045-1047)GGA>GAA		arylacetamide deacetylase							104.0	96.0	98.0					3																	151545806		2203	4300	6503	SO:0001583	missense	13				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity	g.chr3:151545806G>A	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.1046G>A	3.37:g.151545806G>A	ENSP00000232892:p.Gly349Glu		Somatic					p.G349E	NM_001086	NP_001077	WXS	Illumina HiSeq	Unspecified	P22760	AAAD_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		5	1136	+		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	349			Lumenal (Potential).		A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	c.1046G>A	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647690	0.87958	.	.	ENSG00000114771	ENST00000232892	T	0.12984	2.63	4.91	4.91	0.64330	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77127	-0.2702	10	0.87932	D	0	-23.8145	18.0885	0.89466	0.0:0.0:1.0:0.0	.	349	P22760	AAAD_HUMAN	E	349	ENSP00000232892:G349E	ENSP00000232892:G349E	G	+	2	0	AADAC	153028496	1.000000	0.71417	0.984000	0.44739	0.969000	0.65631	8.778000	0.91785	2.255000	0.74692	0.591000	0.81541	GGA		0.458	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086		11	43	0	0	0	0.008291	0	11	43				
SI	6476	broad.mit.edu	37	3	164735453	164735453	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:164735453G>T	ENST00000264382.3	-	31	3704	c.3642C>A	c.(3640-3642)ggC>ggA	p.G1214G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1214	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGACTGGATGGCCAATTACCT	0.318										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(3640-3642)GGC>GGA		sucrase-isomaltase	Acarbose(DB00284)						49.0	46.0	47.0					3																	164735453		2203	4298	6501	SO:0001819	synonymous_variant	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164735453G>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3642C>A	3.37:g.164735453G>T		HNSCC(35;0.089)	Somatic					p.G1214G	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			31	3704	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1214			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	c.3642C>A	CCDS3196.1																																																																																				0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		5	12	1	0	0.00198382	0.001984	0.00216101	5	12				
MECOM	2122	broad.mit.edu	37	3	169099123	169099123	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:169099123A>C	ENST00000494292.1	-	2	324	c.227T>G	c.(226-228)aTt>aGt	p.I76S	MECOM_ENST00000485957.1_5'UTR	NM_004991.3	NP_004982.2	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	76					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						CTCAGCAGGAATGGGGATATC	0.473																																							uc011bpj.1		NA																	0				lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						c.(226-228)ATT>AGT		MDS1 and EVI1 complex locus isoform c							132.0	124.0	127.0					3																	169099123		1862	4106	5968	SO:0001583	missense	2122				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:169099123A>C	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000494292.1:c.227T>G	3.37:g.169099123A>C	ENSP00000417899:p.Ile76Ser		Somatic				MECOM_uc003ffl.2_Missense_Mutation_p.I48S|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Missense_Mutation_p.I76S|MECOM_uc011bpl.1_Missense_Mutation_p.I76S	p.I76S	NM_004991	NP_004982	WXS	Illumina HiSeq	Unspecified	Q03112	EVI1_HUMAN			2	630	-			Error:Variant_position_missing_in_Q03112_after_alignment					Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000494292.1	37	c.227T>G		.	.	.	.	.	.	.	.	.	.	A	21.0	4.077497	0.76528	.	.	ENSG00000085276	ENST00000494292;ENST00000486748	T;T	0.51817	0.69;0.69	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000007	T	0.69214	0.3086	M	0.76328	2.33	0.80722	D	1	D;P	0.76494	0.999;0.95	D;P	0.72075	0.976;0.625	T	0.72874	-0.4160	10	0.87932	D	0	.	16.3782	0.83418	1.0:0.0:0.0:0.0	.	76;76	Q13465;Q03112-3	MDS1_HUMAN;.	S	76;100	ENSP00000417899:I76S;ENSP00000419537:I100S	ENSP00000419537:I100S	I	-	2	0	MECOM	170581817	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	7.067000	0.76741	2.277000	0.76020	0.528000	0.53228	ATT		0.473	MECOM-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000351517.3	NM_005241, NM_004991		25	80	0	0	0	0.00333	0	25	80				
MASP1	5648	broad.mit.edu	37	3	186943230	186943230	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:186943230G>T	ENST00000337774.5	-	13	2012	c.1623C>A	c.(1621-1623)caC>caA	p.H541Q		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	541	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CATACTGGGGGTGGAGAGTGG	0.547																																							uc003frh.1		NA																	0				ovary(2)|breast(1)|liver(1)	4						c.(1621-1623)CAC>CAA		mannan-binding lectin serine protease 1 isoform							253.0	232.0	239.0					3																	186943230		2203	4300	6503	SO:0001583	missense	5648				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity	g.chr3:186943230G>T	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1623C>A	3.37:g.186943230G>T	ENSP00000336792:p.His541Gln		Somatic					p.H541Q	NM_001879	NP_001870	WXS	Illumina HiSeq	Unspecified	P48740	MASP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)	13	1955	-	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		541			Peptidase S1.		A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	c.1623C>A	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525391	0.44969	.	.	ENSG00000127241	ENST00000337774	D	0.96232	-3.95	5.9	-3.93	0.04143	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.98356	0.9454	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98771	1.0728	9	0.87932	D	0	.	13.2685	0.60148	0.4132:0.0:0.5868:0.0	.	541	P48740	MASP1_HUMAN	Q	541	ENSP00000336792:H541Q	ENSP00000336792:H541Q	H	-	3	2	MASP1	188425924	0.245000	0.23899	0.864000	0.33941	0.053000	0.15095	-0.702000	0.05069	-0.627000	0.05589	-0.440000	0.05779	CAC		0.547	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879		20	105	1	0	1.96292e-10	0.010504	2.88638e-10	20	105				
IL1RAP	3556	broad.mit.edu	37	3	190362060	190362060	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:190362060G>T	ENST00000412504.2	+	9	1327	c.1075G>T	c.(1075-1077)Gaa>Taa	p.E359*	IL1RAP_ENST00000439062.1_Nonsense_Mutation_p.E359*|IL1RAP_ENST00000072516.3_Nonsense_Mutation_p.E359*|RN7SKP296_ENST00000411185.1_RNA|IL1RAP_ENST00000443369.2_Nonsense_Mutation_p.E359*|IL1RAP_ENST00000317757.3_Nonsense_Mutation_p.E359*|IL1RAP_ENST00000447382.1_Nonsense_Mutation_p.E359*			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	359					immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		ATACACAGTGGAACTGGCTTG	0.473																																							uc003fsm.1		NA																	0				ovary(1)	1						c.(1075-1077)GAA>TAA		interleukin 1 receptor accessory protein isoform							155.0	120.0	132.0					3																	190362060		2203	4300	6503	SO:0001587	stop_gained	3556				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane		g.chr3:190362060G>T	AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.1075G>T	3.37:g.190362060G>T	ENSP00000412053:p.Glu359*		Somatic				IL1RAP_uc010hzg.1_Nonsense_Mutation_p.E359*|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Nonsense_Mutation_p.E359*|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Nonsense_Mutation_p.E359*	p.E359*	NM_002182	NP_002173	WXS	Illumina HiSeq	Unspecified	Q9NPH3	IL1AP_HUMAN	Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)	10	1281	+	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		359			Extracellular (Potential).		B1NLD0|D3DNW0|O14915|Q86WJ7	Nonsense_Mutation	SNP	ENST00000412504.2	37	c.1075G>T	CCDS3298.1	.	.	.	.	.	.	.	.	.	.	G	40	8.402108	0.98796	.	.	ENSG00000196083	ENST00000072516;ENST00000443369;ENST00000412504;ENST00000439062;ENST00000447382;ENST00000317757	.	.	.	5.89	5.02	0.67125	.	0.157633	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	14.099	0.65042	0.0716:0.0:0.9284:0.0	.	.	.	.	X	359	.	ENSP00000072516:E359X	E	+	1	0	IL1RAP	191844754	1.000000	0.71417	0.991000	0.47740	0.878000	0.50629	8.621000	0.90949	1.511000	0.48818	0.563000	0.77884	GAA		0.473	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343497.1			4	16	1	0	0.00909568	0.009096	0.00963801	4	16				
FGF12	2257	broad.mit.edu	37	3	191888365	191888365	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:191888365G>A	ENST00000454309.2	-	4	1320	c.495C>T	c.(493-495)cgC>cgT	p.R165R	FGF12_ENST00000430714.1_Silent_p.R66R|FGF12_ENST00000450716.1_Silent_p.R103R|FGF12_ENST00000445105.2_Silent_p.R103R|FGF12_ENST00000264730.3_Silent_p.R103R	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	165					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)			endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		ATTCTTGCTGGCGGTACAGTG	0.393																																							uc003fsx.2		NA																	0				ovary(1)|skin(1)|lung(1)|pancreas(1)	4						c.(493-495)CGC>CGT		fibroblast growth factor 12 isoform 1							206.0	210.0	209.0					3																	191888365		2203	4300	6503	SO:0001819	synonymous_variant	2257				cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding	g.chr3:191888365G>A	U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.495C>T	3.37:g.191888365G>A			Somatic				FGF12_uc003fsy.2_Silent_p.R103R	p.R165R	NM_021032	NP_066360	WXS	Illumina HiSeq	Unspecified	P61328	FGF12_HUMAN	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)	4	1321	-	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	165					B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Silent	SNP	ENST00000454309.2	37	c.495C>T	CCDS3301.1																																																																																				0.393	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032		41	144	0	0	0	0.00623	0	41	144				
DLG1	1739	broad.mit.edu	37	3	196867097	196867097	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr3:196867097C>A	ENST00000419354.1	-	9	1012	c.726G>T	c.(724-726)acG>acT	p.T242T	DLG1_ENST00000450955.1_Silent_p.T209T|DLG1_ENST00000452595.1_Silent_p.T126T|DLG1_ENST00000314062.3_Silent_p.T191T|DLG1_ENST00000443183.1_Silent_p.T126T|DLG1_ENST00000392382.2_Silent_p.T209T|DLG1_ENST00000448528.2_Silent_p.T242T|DLG1_ENST00000422288.1_Silent_p.T191T|DLG1_ENST00000357674.4_Silent_p.T209T|DLG1_ENST00000346964.2_Silent_p.T242T			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	242	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GTGGGTTGTCCGTACCTCCTG	0.428																																							uc003fxo.3		NA																	0				ovary(3)	3						c.(724-726)ACG>ACT		discs, large homolog 1 isoform 1							151.0	146.0	148.0					3																	196867097		2203	4300	6503	SO:0001819	synonymous_variant	1739				actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding	g.chr3:196867097C>A	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.726G>T	3.37:g.196867097C>A			Somatic				DLG1_uc011bub.1_Silent_p.T126T|DLG1_uc011buc.1_Silent_p.T126T|DLG1_uc011bud.1_5'UTR|DLG1_uc003fxn.3_Silent_p.T242T|DLG1_uc011bue.1_Silent_p.T209T|DLG1_uc010ial.2_Silent_p.T242T|DLG1_uc011buf.1_RNA|DLG1_uc003fxp.2_RNA|DLG1_uc010iam.1_Silent_p.T209T|DLG1_uc010ian.2_Silent_p.T109T	p.T242T	NM_001098424	NP_001091894	WXS	Illumina HiSeq	Unspecified	Q12959	DLG1_HUMAN	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)	9	916	-	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	242			PDZ 1.		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Silent	SNP	ENST00000419354.1	37	c.726G>T	CCDS43194.1																																																																																				0.428	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087		14	49	1	0	6.72482e-11	0.003163	9.93549e-11	14	49				
PDE6B	5158	broad.mit.edu	37	4	651145	651145	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:651145G>A	ENST00000496514.1	+	10	1284	c.1263G>A	c.(1261-1263)ctG>ctA	p.L421L	PDE6B_ENST00000429163.2_Silent_p.L142L|PDE6B_ENST00000255622.6_Silent_p.L421L|RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	421	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	TCCAGTCCCTGACACAGTTCC	0.637																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	0					0						c.(1261-1263)CTG>CTA		phosphodiesterase 6B isoform 1							127.0	78.0	94.0					4																	651145		2203	4299	6502	SO:0001819	synonymous_variant	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:651145G>A	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1263G>A	4.37:g.651145G>A			Somatic				PDE6B_uc003gao.3_Silent_p.L421L|PDE6B_uc011buy.1_Silent_p.L142L|uc003gaq.1_5'Flank	p.L421L	NM_000283	NP_000274	WXS	Illumina HiSeq	Unspecified	P35913	PDE6B_HUMAN			10	1316	+			421			GAF 2.		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Silent	SNP	ENST00000496514.1	37	c.1263G>A	CCDS33932.1																																																																																				0.637	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		8	22	0	0	0	0.00308	0	8	22				
WHSC1	7468	broad.mit.edu	37	4	1920134	1920134	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:1920134G>T	ENST00000382895.3	+	7	1625	c.1194G>T	c.(1192-1194)aaG>aaT	p.K398N	WHSC1_ENST00000508803.1_Missense_Mutation_p.K398N|WHSC1_ENST00000382892.2_Missense_Mutation_p.K398N|WHSC1_ENST00000382891.5_Missense_Mutation_p.K398N|WHSC1_ENST00000503128.1_Missense_Mutation_p.K398N|WHSC1_ENST00000514045.1_Missense_Mutation_p.K398N|WHSC1_ENST00000420906.2_Missense_Mutation_p.K398N|WHSC1_ENST00000398261.1_Missense_Mutation_p.K398N	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	398					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TTCCCATGAAGAGAAGGCGGA	0.532			T	IGH@	MM																																		uc003gdz.3		NA		Dom	yes		4	4p16.3	7468	T	Wolf-Hirschhorn syndrome candidate 1(MMSET)			L	IGH@		MM		0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(1192-1194)AAG>AAT		Wolf-Hirschhorn syndrome candidate 1 protein							61.0	61.0	61.0					4																	1920134		2203	4300	6503	SO:0001583	missense	7468				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr4:1920134G>T	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1194G>T	4.37:g.1920134G>T	ENSP00000372351:p.Lys398Asn		Somatic				WHSC1_uc003geb.3_Missense_Mutation_p.K398N|WHSC1_uc003gec.3_Missense_Mutation_p.K398N|WHSC1_uc003ged.3_Missense_Mutation_p.K398N|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gdx.2_Missense_Mutation_p.K398N|WHSC1_uc003gdy.1_Missense_Mutation_p.K398N|WHSC1_uc010icd.1_Missense_Mutation_p.K398N|WHSC1_uc003gea.1_Missense_Mutation_p.K398N|WHSC1_uc010ice.1_Missense_Mutation_p.K398N|WHSC1_uc003geh.1_Missense_Mutation_p.K398N	p.K398N	NM_001042424	NP_001035889	WXS	Illumina HiSeq	Unspecified	O96028	NSD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)	5	1370	+		all_epithelial(65;1.34e-05)	398					A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	c.1194G>T	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925176	0.52759	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000382891;ENST00000382892;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000398261	D;T;D;D;T;D;T;T	0.95588	-3.75;0.85;-3.75;-3.75;0.85;-3.75;0.83;0.83	5.22	4.38	0.52667	.	0.000000	0.56097	D	0.000027	D	0.95900	0.8665	L	0.36672	1.1	0.80722	D	1	D;B;D;D	0.89917	0.999;0.31;0.999;1.0	D;B;D;D	0.87578	0.972;0.031;0.972;0.998	D	0.95626	0.8685	10	0.48119	T	0.1	.	13.8628	0.63571	0.0738:0.0:0.9262:0.0	.	398;398;398;398	O96028-3;O96028;O96028-5;O96028-6	.;NSD2_HUMAN;.;.	N	398	ENSP00000423972:K398N;ENSP00000421681:K398N;ENSP00000372347:K398N;ENSP00000372348:K398N;ENSP00000399251:K398N;ENSP00000372351:K398N;ENSP00000425761:K398N;ENSP00000381311:K398N	ENSP00000308780:K398N	K	+	3	2	WHSC1	1889932	1.000000	0.71417	0.738000	0.30950	0.826000	0.46750	4.946000	0.63576	1.333000	0.45449	0.555000	0.69702	AAG		0.532	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		5	41	1	0	0.000602214	0.000602	0.000670085	5	41				
RGS12	6002	broad.mit.edu	37	4	3441281	3441281	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:3441281G>T	ENST00000344733.5	+	18	5118	c.4214G>T	c.(4213-4215)gGg>gTg	p.G1405V	HGFAC_ENST00000382774.3_5'Flank|RGS12_ENST00000338806.4_Missense_Mutation_p.G757V|HGFAC_ENST00000511533.1_5'Flank	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1405					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGCATAGCGGGGGCACAGGCT	0.662																																							uc003ggw.2		NA																	0				skin(1)	1						c.(4213-4215)GGG>GTG		regulator of G-protein signalling 12 isoform 1							37.0	37.0	37.0					4																	3441281		2202	4296	6498	SO:0001583	missense	6002					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity	g.chr4:3441281G>T	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.4214G>T	4.37:g.3441281G>T	ENSP00000339381:p.Gly1405Val		Somatic				RGS12_uc003ggz.2_Missense_Mutation_p.G757V|RGS12_uc003gha.2_Missense_Mutation_p.G747V|RGS12_uc010icv.2_Missense_Mutation_p.G604V|HGFAC_uc003ghc.2_5'Flank|HGFAC_uc010icw.2_5'Flank	p.G1405V	NM_198229	NP_937872	WXS	Illumina HiSeq	Unspecified	O14924	RGS12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	18	5118	+			1405					B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	c.4214G>T	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981506	0.34942	.	.	ENSG00000159788	ENST00000344733;ENST00000338806	T;T	0.60040	0.64;0.22	2.66	2.66	0.31614	.	0.553031	0.14073	U	0.343279	T	0.53530	0.1802	N	0.24115	0.695	0.23282	N	0.997981	D;D;D	0.57899	0.981;0.981;0.967	P;P;P	0.55999	0.789;0.789;0.619	T	0.38585	-0.9654	10	0.51188	T	0.08	-19.907	8.9974	0.36061	0.0:0.0:1.0:0.0	.	747;757;1405	O14924-2;O14924-3;O14924	.;.;RGS12_HUMAN	V	1405;757	ENSP00000339381:G1405V;ENSP00000342133:G757V	ENSP00000342133:G757V	G	+	2	0	RGS12	3411079	0.681000	0.27614	0.006000	0.13384	0.008000	0.06430	2.927000	0.48900	1.807000	0.52817	0.462000	0.41574	GGG		0.662	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926		10	38	1	0	2.17888e-05	0.006214	2.58145e-05	10	38				
ZBTB49	166793	broad.mit.edu	37	4	4317389	4317389	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:4317389G>A	ENST00000337872.4	+	6	1524	c.1403G>A	c.(1402-1404)cGt>cAt	p.R468H	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Intron	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						GACGTCCAGCGTCACATTATT	0.403																																							uc003ghu.2		NA																	0				ovary(1)|skin(1)	2						c.(1402-1404)CGT>CAT		zinc finger protein 509							89.0	91.0	90.0					4																	4317389		2203	4300	6503	SO:0001583	missense	166793				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:4317389G>A	AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.1403G>A	4.37:g.4317389G>A	ENSP00000338807:p.Arg468His		Somatic				ZBTB49_uc003ghv.2_5'UTR|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_Intron	p.R468H	NM_145291	NP_660334	WXS	Illumina HiSeq	Unspecified	Q6ZSB9	ZBT49_HUMAN			6	1578	+			468			C2H2-type 3.		Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	c.1403G>A	CCDS3375.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862047	0.71949	.	.	ENSG00000168826	ENST00000337872	T	0.26810	1.71	5.45	5.45	0.79879	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000019	T	0.40670	0.1126	L	0.52364	1.645	0.80722	D	1	D	0.54772	0.968	P	0.54026	0.74	T	0.12142	-1.0559	10	0.54805	T	0.06	.	19.2829	0.94058	0.0:0.0:1.0:0.0	.	468	Q6ZSB9	ZBT49_HUMAN	H	468	ENSP00000338807:R468H	ENSP00000338807:R468H	R	+	2	0	ZBTB49	4368290	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.959000	0.93110	2.572000	0.86782	0.462000	0.41574	CGT		0.403	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291		3	21	0	0	0	0.004672	0	3	21				
CRMP1	1400	broad.mit.edu	37	4	5862766	5862766	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:5862766C>A	ENST00000397890.2	-	3	514	c.300G>T	c.(298-300)ggG>ggT	p.G100G	CRMP1_ENST00000512574.1_Silent_p.G98G|CRMP1_ENST00000324989.7_Silent_p.G214G|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	100					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TCATCGTGGTCCCGCCCACCA	0.582																																							uc003gip.2		NA																	0				ovary(2)	2						c.(298-300)GGG>GGT		collapsin response mediator protein 1 isoform 2							90.0	82.0	85.0					4																	5862766		2203	4300	6503	SO:0001819	synonymous_variant	1400				axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding	g.chr4:5862766C>A	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.300G>T	4.37:g.5862766C>A			Somatic				CRMP1_uc003gin.1_Intron|CRMP1_uc003giq.2_Silent_p.G100G|CRMP1_uc003gir.2_Silent_p.G95G|CRMP1_uc003gis.2_Silent_p.G214G	p.G100G	NM_001313	NP_001304	WXS	Illumina HiSeq	Unspecified	Q14194	DPYL1_HUMAN		Colorectal(103;0.0721)	4	401	-			100					A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	37	c.300G>T	CCDS43207.1																																																																																				0.582	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313		6	35	1	0	0.00198382	0.001984	0.00216101	6	35				
GABRA2	2555	broad.mit.edu	37	4	46264116	46264116	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:46264116G>T	ENST00000510861.1	-	9	1059	c.886C>A	c.(886-888)Cta>Ata	p.L296I	GABRA2_ENST00000540012.1_Missense_Mutation_p.L241I|GABRA2_ENST00000514090.1_Missense_Mutation_p.L296I|GABRA2_ENST00000515082.1_Missense_Mutation_p.L296I|GABRA2_ENST00000507069.1_Missense_Mutation_p.L296I|GABRA2_ENST00000381620.4_Missense_Mutation_p.L296I|GABRA2_ENST00000356504.1_Missense_Mutation_p.L296I			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	296					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGATGCTTAGAGTTGTCATT	0.418																																							uc003gxc.3		NA																	0				ovary(2)|skin(2)	4						c.(886-888)CTA>ATA		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						108.0	100.0	102.0					4																	46264116		2203	4300	6503	SO:0001583	missense	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46264116G>T		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.886C>A	4.37:g.46264116G>T	ENSP00000421828:p.Leu296Ile		Somatic				GABRA2_uc010igc.2_Missense_Mutation_p.L296I|GABRA2_uc011bzc.1_Missense_Mutation_p.L241I|GABRA2_uc003gxe.2_Missense_Mutation_p.L296I	p.L296I	NM_001114175	NP_001107647	WXS	Illumina HiSeq	Unspecified	P47869	GBRA2_HUMAN			8	1559	-			296			Helical; (Probable).		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	c.886C>A	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172124	0.78452	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	D;D;D;D;D;T;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-0.64;-2.17	5.35	3.59	0.41128	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90363	0.6984	L	0.58510	1.815	0.52501	D	0.999958	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.999	D	0.87299	0.2304	10	0.29301	T	0.29	.	10.4232	0.44363	0.1608:0.0:0.8392:0.0	.	241;296;296	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	I	296;296;296;296;241;296;296	ENSP00000421828:L296I;ENSP00000421300:L296I;ENSP00000371033:L296I;ENSP00000348897:L296I;ENSP00000444409:L241I;ENSP00000427603:L296I;ENSP00000423840:L296I	ENSP00000348897:L296I	L	-	1	2	GABRA2	45958873	0.987000	0.35691	0.943000	0.38184	0.995000	0.86356	1.910000	0.39927	0.727000	0.32360	0.591000	0.81541	CTA		0.418	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			4	22	1	0	0.00024832	0.009096	0.000280318	4	22				
UBA6	55236	broad.mit.edu	37	4	68490785	68490785	+	Missense_Mutation	SNP	C	C	A	rs199591856		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:68490785C>A	ENST00000322244.5	-	29	2698	c.2639G>T	c.(2638-2640)cGt>cTt	p.R880L		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	880					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TGTTTTGAAACGGTCAGCTGG	0.363																																							uc003hdg.3		NA																	0					0						c.(2638-2640)CGT>CTT		ubiquitin-activating enzyme E1-like 2							132.0	122.0	125.0					4																	68490785		2203	4299	6502	SO:0001583	missense	55236				protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding	g.chr4:68490785C>A	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2639G>T	4.37:g.68490785C>A	ENSP00000313454:p.Arg880Leu		Somatic					p.R880L	NM_018227	NP_060697	WXS	Illumina HiSeq	Unspecified	A0AVT1	UBA6_HUMAN			29	2691	-			880					A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	c.2639G>T	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.786571	0.90367	.	.	ENSG00000033178	ENST00000322244	T	0.46451	0.87	5.52	5.52	0.82312	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.051214	0.85682	D	0.000000	T	0.69269	0.3092	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.73889	-0.3840	10	0.66056	D	0.02	-18.959	17.6191	0.88076	0.0:1.0:0.0:0.0	.	880	A0AVT1	UBA6_HUMAN	L	880	ENSP00000313454:R880L	ENSP00000313454:R880L	R	-	2	0	UBA6	68173380	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.008000	0.76341	2.566000	0.86566	0.655000	0.94253	CGT		0.363	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227		12	33	1	0	1.08611e-07	0.010729	1.43736e-07	12	33				
CCDC158	339965	broad.mit.edu	37	4	77272874	77272874	+	Splice_Site	SNP	T	T	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:77272874T>G	ENST00000388914.3	-	16	2689	c.2537A>C	c.(2536-2538)aAa>aCa	p.K846T		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	846										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TGACCTTACTTTTATATCCAA	0.323																																							uc003hkb.3		NA																	0				skin(3)|ovary(2)|pancreas(1)	6						c.(2536-2538)AAA>ACA		coiled-coil domain containing 158							134.0	117.0	122.0					4																	77272874		1857	4106	5963	SO:0001630	splice_region_variant	339965							g.chr4:77272874T>G	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.2538+1A>C	4.37:g.77272874T>G			Somatic					p.K846T	NM_001042784	NP_001036249	WXS	Illumina HiSeq	Unspecified	Q5M9N0	CD158_HUMAN			16	2690	-			846					Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	c.2537A>C	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.219753	0.58560	.	.	ENSG00000163749	ENST00000388914	T	0.39229	1.09	5.86	4.68	0.58851	.	0.000000	0.51477	D	0.000099	T	0.45518	0.1346	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.38607	-0.9653	10	0.44086	T	0.13	.	9.3765	0.38286	0.0:0.0814:0.0:0.9186	.	846	Q5M9N0	CD158_HUMAN	T	846	ENSP00000373566:K846T	ENSP00000373566:K846T	K	-	2	0	CCDC158	77491898	1.000000	0.71417	0.999000	0.59377	0.775000	0.43874	2.802000	0.47916	2.367000	0.80283	0.528000	0.53228	AAA		0.323	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	Missense_Mutation	6	21	0	0	0	0.001168	0	6	21				
PRKG2	5593	broad.mit.edu	37	4	82031648	82031648	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:82031648C>A	ENST00000395578.1	-	15	2010	c.1894G>T	c.(1894-1896)Gat>Tat	p.D632Y	PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Missense_Mutation_p.D212Y|PRKG2_ENST00000418486.2_Missense_Mutation_p.D603Y|PRKG2_ENST00000264399.1_Missense_Mutation_p.D632Y			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	632	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						GACCAGAAATCCACACTGAAG	0.428																																							uc003hmh.2		NA																	0				breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						c.(1894-1896)GAT>TAT		protein kinase, cGMP-dependent, type II							122.0	118.0	119.0					4																	82031648		2203	4300	6503	SO:0001583	missense	5593				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr4:82031648C>A	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1894G>T	4.37:g.82031648C>A	ENSP00000378945:p.Asp632Tyr		Somatic				PRKG2_uc011ccf.1_Missense_Mutation_p.D212Y|PRKG2_uc011ccg.1_Missense_Mutation_p.D212Y|PRKG2_uc011cch.1_Missense_Mutation_p.D603Y	p.D632Y	NM_006259	NP_006250	WXS	Illumina HiSeq	Unspecified	Q13237	KGP2_HUMAN			14	1908	-			632			Protein kinase.		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	c.1894G>T	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662455	0.88251	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486;ENST00000545647	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85652	0.5746	H	0.99475	4.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91973	0.5588	10	0.87932	D	0	-23.8528	19.0127	0.92881	0.0:1.0:0.0:0.0	.	603;632	E7EPE6;Q13237	.;KGP2_HUMAN	Y	632;632;603;212	ENSP00000378945:D632Y;ENSP00000264399:D632Y;ENSP00000389038:D603Y;ENSP00000439967:D212Y	ENSP00000264399:D632Y	D	-	1	0	PRKG2	82250672	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.792000	0.85828	2.596000	0.87737	0.650000	0.86243	GAT		0.428	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259		8	35	1	0	5.4927e-09	0.004482	7.69473e-09	8	35				
AFF1	4299	broad.mit.edu	37	4	88035845	88035845	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:88035845C>T	ENST00000307808.6	+	11	2259	c.1839C>T	c.(1837-1839)gcC>gcT	p.A613A	AFF1_ENST00000544085.1_Silent_p.A251A|AFF1_ENST00000395146.4_Silent_p.A620A	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	613					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A620A(1)		breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AGGCCTCTGCCCGGGCAGGTT	0.587																																							uc003hqj.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1837-1839)GCC>GCT		myeloid/lymphoid or mixed-lineage leukemia							29.0	36.0	33.0					4																	88035845		2199	4297	6496	SO:0001819	synonymous_variant	4299					nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:88035845C>T	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1839C>T	4.37:g.88035845C>T			Somatic				AFF1_uc011ccz.1_Silent_p.A620A|AFF1_uc003hqk.3_Silent_p.A613A|AFF1_uc011cda.1_Silent_p.A251A	p.A613A	NM_005935	NP_005926	WXS	Illumina HiSeq	Unspecified	P51825	AFF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000233)	11	2246	+		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)	613					B4DTU1|E9PBM3	Silent	SNP	ENST00000307808.6	37	c.1839C>T	CCDS3616.1																																																																																				0.587	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935		21	51	0	0	0	0.008871	0	21	51				
UNC5C	8633	broad.mit.edu	37	4	96106324	96106324	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:96106324C>T	ENST00000453304.1	-	13	2508	c.2160G>A	c.(2158-2160)caG>caA	p.Q720Q		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	720					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GTCCTCCCATCTGTCTCTCAA	0.443																																							uc003htp.1		NA																	0				ovary(3)|pancreas(1)	4						c.(2158-2160)CAG>CAA		unc5C precursor							108.0	103.0	105.0					4																	96106324		2203	4300	6503	SO:0001819	synonymous_variant	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96106324C>T	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2160G>A	4.37:g.96106324C>T			Somatic				UNC5C_uc010ilc.1_Silent_p.Q739Q	p.Q720Q	NM_003728	NP_003719	WXS	Illumina HiSeq	Unspecified	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	13	2314	-		Hepatocellular(203;0.114)	720			Cytoplasmic (Potential).		Q8IUT0	Silent	SNP	ENST00000453304.1	37	c.2160G>A	CCDS3643.1																																																																																				0.443	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		15	72	0	0	0	0.004007	0	15	72				
ADH1A	124	broad.mit.edu	37	4	100212093	100212093	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:100212093G>T	ENST00000209668.2	-	0	92				RP11-696N14.1_ENST00000509939.1_RNA|RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'UTR	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide						alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	CTTCTCTGCAGACCAGGAGAC	0.348																																							uc003hur.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(-23--19)GTCTG>GTATG		class I alcohol dehydrogenase, alpha subunit	Fomepizole(DB01213)|NADH(DB00157)						181.0	170.0	174.0					4																	100212093		2203	4300	6503			124				ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding	g.chr4:100212093G>T	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.-22C>A	4.37:g.100212093G>T			Somatic				uc003hum.1_Splice_Site|ADH1A_uc011ceg.1_Intron|ADH1A_uc010ilg.1_Translation_Start_Site		NM_000667	NP_000658	WXS	Illumina HiSeq	Unspecified	P07327	ADH1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	1	50	-								A8K3E3|Q17R68	Translation_Start_Site	SNP	ENST00000209668.2	37	c.-21C>A	CCDS3648.1																																																																																				0.348	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667		26	64	1	0	7.26314e-15	0.007291	1.18886e-14	26	64				
C4orf17	84103	broad.mit.edu	37	4	100443848	100443848	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:100443848C>A	ENST00000326581.4	+	3	681	c.319C>A	c.(319-321)Cct>Act	p.P107T	C4orf17_ENST00000514652.1_Missense_Mutation_p.P107T|C4orf17_ENST00000503257.1_3'UTR	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	107										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		TGCCAAAGTGCCTCCACGGCC	0.498																																							uc003huw.2		NA																	0					0						c.(319-321)CCT>ACT		hypothetical protein LOC84103							60.0	59.0	59.0					4																	100443848		2203	4300	6503	SO:0001583	missense	84103							g.chr4:100443848C>A	AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.319C>A	4.37:g.100443848C>A	ENSP00000322582:p.Pro107Thr		Somatic				C4orf17_uc003hux.2_RNA	p.P107T	NM_032149	NP_115525	WXS	Illumina HiSeq	Unspecified	Q53FE4	CD017_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)	3	642	+			107					Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	ENST00000326581.4	37	c.319C>A	CCDS3649.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522637	0.44866	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.17370	2.28;2.28	5.27	4.43	0.53597	.	0.435095	0.22945	N	0.053728	T	0.32675	0.0837	M	0.68952	2.095	0.09310	N	1	D	0.61697	0.99	P	0.59487	0.858	T	0.09079	-1.0691	10	0.52906	T	0.07	-0.8808	9.6625	0.39962	0.0:0.9065:0.0:0.0935	.	107	Q53FE4	CD017_HUMAN	T	107	ENSP00000322582:P107T;ENSP00000427663:P107T	ENSP00000322582:P107T	P	+	1	0	C4orf17	100662871	0.005000	0.15991	0.013000	0.15412	0.023000	0.10783	1.741000	0.38238	1.465000	0.48006	-0.142000	0.14014	CCT		0.498	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149		9	49	1	0	5.68852e-11	0.004482	8.42443e-11	9	49				
ANK2	287	broad.mit.edu	37	4	114278492	114278492	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:114278492G>T	ENST00000357077.4	+	38	8771	c.8718G>T	c.(8716-8718)atG>atT	p.M2906I	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.M2873I	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2906					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GATTTTCCATGGATGTTCCCG	0.398																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(8716-8718)ATG>ATT		ankyrin 2 isoform 1							171.0	171.0	171.0					4																	114278492		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114278492G>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8718G>T	4.37:g.114278492G>T	ENSP00000349588:p.Met2906Ile		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.M208I|ANK2_uc011cgb.1_Missense_Mutation_p.M2921I	p.M2906I	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	8818	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2873					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.8718G>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399732	0.25291	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.65364	-0.13;-0.15	5.43	1.71	0.24356	.	1.002590	0.08041	N	0.995180	T	0.42698	0.1214	N	0.19112	0.55	0.18873	N	0.999983	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25467	-1.0131	9	.	.	.	.	5.5337	0.16999	0.2248:0.0:0.6267:0.1486	.	2873;2906	Q01484;Q01484-4	ANK2_HUMAN;.	I	2906;2873	ENSP00000349588:M2906I;ENSP00000264366:M2873I	.	M	+	3	0	ANK2	114497941	0.006000	0.16342	0.005000	0.12908	0.908000	0.53690	0.667000	0.25112	0.636000	0.30508	-0.182000	0.12963	ATG		0.398	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		34	106	1	0	2.20474e-14	0.003755	3.58054e-14	34	106				
UGT8	7368	broad.mit.edu	37	4	115544302	115544302	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:115544302A>T	ENST00000310836.6	+	2	788	c.266A>T	c.(265-267)aAg>aTg	p.K89M	UGT8_ENST00000394511.3_Missense_Mutation_p.K89M	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	89					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		CTACAGTCCAAGATGCGGAAT	0.473																																							uc003ibs.2		NA																	0				ovary(1)|skin(1)	2						c.(265-267)AAG>ATG		UDP-galactose-ceramide galactosyltransferase 8							137.0	129.0	132.0					4																	115544302		2203	4300	6503	SO:0001583	missense	7368				central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity	g.chr4:115544302A>T	AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.266A>T	4.37:g.115544302A>T	ENSP00000311648:p.Lys89Met		Somatic				UGT8_uc003ibt.2_Missense_Mutation_p.K89M|UGT8_uc011cge.1_RNA	p.K89M	NM_001128174	NP_001121646	WXS	Illumina HiSeq	Unspecified	Q16880	CGT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000632)	2	788	+		Ovarian(17;0.156)	89					B3KXU7|O00196	Missense_Mutation	SNP	ENST00000310836.6	37	c.266A>T	CCDS3705.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853693	0.71719	.	.	ENSG00000174607	ENST00000310836;ENST00000507710;ENST00000394511	T;T;T	0.06449	3.3;3.3;3.3	5.3	5.3	0.74995	.	0.227871	0.43747	D	0.000536	T	0.05502	0.0145	N	0.08118	0	0.80722	D	1	B	0.30236	0.274	B	0.37304	0.246	T	0.54609	-0.8268	10	0.31617	T	0.26	.	15.5386	0.76021	1.0:0.0:0.0:0.0	.	89	Q16880	CGT_HUMAN	M	89	ENSP00000311648:K89M;ENSP00000421446:K89M;ENSP00000378019:K89M	ENSP00000311648:K89M	K	+	2	0	UGT8	115763751	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.121000	0.94375	2.137000	0.66172	0.528000	0.53228	AAG		0.473	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256426.2	NM_003360		19	60	0	0	0	0.008871	0	19	60				
NDST4	64579	broad.mit.edu	37	4	115998118	115998118	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:115998118G>A	ENST00000264363.2	-	2	753	c.75C>T	c.(73-75)agC>agT	p.S25S		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	25					heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAATGACAATGCTCACCAAGC	0.358																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(73-75)AGC>AGT		heparan sulfate N-deacetylase/N-sulfotransferase							39.0	42.0	41.0					4																	115998118		2203	4300	6503	SO:0001819	synonymous_variant	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115998118G>A	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.75C>T	4.37:g.115998118G>A			Somatic				NDST4_uc010imw.2_Intron	p.S25S	NM_022569	NP_072091	WXS	Illumina HiSeq	Unspecified	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	2	754	-		Ovarian(17;0.156)	25			Helical; Signal-anchor for type II membrane protein; (Potential).		Q2KHM8	Silent	SNP	ENST00000264363.2	37	c.75C>T	CCDS3706.1																																																																																				0.358	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		6	20	0	0	0	0.001168	0	6	20				
SYNPO2	171024	broad.mit.edu	37	4	119978927	119978927	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:119978927C>A	ENST00000307142.4	+	5	3820	c.3624C>A	c.(3622-3624)tcC>tcA	p.S1208S	SYNPO2_ENST00000448416.2_3'UTR	NM_133477.2	NP_597734.2	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	0						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ATAATATGTCCACCACCTCCC	0.413																																							uc010inb.2		NA																	0				ovary(2)	2						c.(3622-3624)TCC>TCA		synaptopodin 2 isoform a							91.0	86.0	88.0					4																	119978927		2203	4300	6503	SO:0001819	synonymous_variant	171024					nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding	g.chr4:119978927C>A	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000307142.4:c.3624C>A	4.37:g.119978927C>A			Somatic				SYNPO2_uc011cgh.1_3'UTR|SYNPO2_uc010inc.2_Silent_p.S1078S	p.S1208S	NM_133477	NP_597734	WXS	Illumina HiSeq	Unspecified	Q9UMS6	SYNP2_HUMAN			5	3820	+			Error:Variant_position_missing_in_Q9UMS6_after_alignment					B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000307142.4	37	c.3624C>A	CCDS34054.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.479113	0.01035	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.63	-1.22	0.09494	.	.	.	.	.	T	0.29158	0.0725	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30592	-0.9973	4	.	.	.	-0.0052	6.6905	0.23169	0.0:0.3156:0.1294:0.555	.	.	.	.	N	1102	.	.	H	+	1	0	SYNPO2	120198375	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.450000	0.02390	-0.147000	0.11254	-0.140000	0.14226	CAC		0.413	SYNPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364018.1			17	52	1	0	1.15088e-07	0.004007	1.51984e-07	17	52				
ADAD1	132612	broad.mit.edu	37	4	123317427	123317427	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:123317427G>T	ENST00000296513.2	+	7	804	c.619G>T	c.(619-621)Gca>Tca	p.A207S	ADAD1_ENST00000492454.1_3'UTR|ADAD1_ENST00000388725.2_Missense_Mutation_p.A189S|ADAD1_ENST00000388724.2_Missense_Mutation_p.A207S	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	207					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TATTCAATATGCAAAGATTTC	0.294																																							uc003ieo.2		NA																	0					0						c.(619-621)GCA>TCA		adenosine deaminase domain containing 1							53.0	59.0	57.0					4																	123317427		2201	4288	6489	SO:0001583	missense	132612				multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding	g.chr4:123317427G>T	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.619G>T	4.37:g.123317427G>T	ENSP00000296513:p.Ala207Ser		Somatic				ADAD1_uc003iep.2_Missense_Mutation_p.A207S|ADAD1_uc003ieq.2_Missense_Mutation_p.A189S	p.A207S	NM_139243	NP_640336	WXS	Illumina HiSeq	Unspecified	Q96M93	ADAD1_HUMAN			7	851	+			207					A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	ENST00000296513.2	37	c.619G>T	CCDS34058.1	.	.	.	.	.	.	.	.	.	.	G	9.140	1.013497	0.19277	.	.	ENSG00000164113	ENST00000296513;ENST00000439307;ENST00000388724;ENST00000388725	T;T;T	0.29917	1.55;1.55;1.55	6.05	4.31	0.51392	Adenosine deaminase/editase (1);	0.550402	0.19835	N	0.105000	T	0.25531	0.0621	L	0.44542	1.39	0.27403	N	0.9548	B;B	0.13145	0.004;0.007	B;B	0.13407	0.009;0.003	T	0.14531	-1.0469	10	0.30078	T	0.28	-1.8422	10.3341	0.43839	0.0704:0.0:0.7939:0.1357	.	207;207	Q96M93-2;Q96M93	.;ADAD1_HUMAN	S	207;207;207;189	ENSP00000296513:A207S;ENSP00000373376:A207S;ENSP00000373377:A189S	ENSP00000296513:A207S	A	+	1	0	ADAD1	123536877	1.000000	0.71417	0.993000	0.49108	0.917000	0.54804	2.899000	0.48679	0.872000	0.35775	-0.136000	0.14681	GCA		0.294	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243		5	23	1	0	5.9392e-07	0.001168	7.61687e-07	5	23				
PCDH10	57575	broad.mit.edu	37	4	134071464	134071464	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:134071464C>A	ENST00000264360.5	+	1	995	c.169C>A	c.(169-171)Ccc>Acc	p.P57T	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	57	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TCAGACGGTGCCCAACTCAAG	0.527																																							uc003iha.2		NA																	0				ovary(2)	2						c.(169-171)CCC>ACC		protocadherin 10 isoform 1 precursor							95.0	97.0	96.0					4																	134071464		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134071464C>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.169C>A	4.37:g.134071464C>A	ENSP00000264360:p.Pro57Thr		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.P57T	p.P57T	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	995	+			57			Cadherin 1.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.169C>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	9.781	1.175270	0.21704	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.38077	1.16	4.77	2.97	0.34412	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.163396	0.29100	N	0.013143	T	0.20659	0.0497	N	0.12527	0.23	0.50171	D	0.999857	B;B	0.31752	0.338;0.001	B;B	0.33121	0.158;0.007	T	0.05451	-1.0884	10	0.41790	T	0.15	.	9.5683	0.39411	0.0:0.6777:0.2424:0.0799	.	57;57	Q9P2E7;Q96SF0	PCD10_HUMAN;.	T	57	ENSP00000264360:P57T	ENSP00000264360:P57T	P	+	1	0	PCDH10	134290914	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.931000	0.56529	0.558000	0.29135	0.555000	0.69702	CCC		0.527	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		34	90	1	0	4.34311e-12	0.003271	6.65372e-12	34	90				
PCDH10	57575	broad.mit.edu	37	4	134072738	134072738	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:134072738C>A	ENST00000264360.5	+	1	2269	c.1443C>A	c.(1441-1443)taC>taA	p.Y481*	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	481	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CTGGCGCCTACATCTACGCGG	0.602																																							uc003iha.2		NA																	0				ovary(2)	2						c.(1441-1443)TAC>TAA		protocadherin 10 isoform 1 precursor							76.0	73.0	74.0					4																	134072738		2203	4300	6503	SO:0001587	stop_gained	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134072738C>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1443C>A	4.37:g.134072738C>A	ENSP00000264360:p.Tyr481*		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Nonsense_Mutation_p.Y481*	p.Y481*	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2269	+			481			Extracellular (Potential).|Cadherin 5.		Q4W5F6|Q96SF0	Nonsense_Mutation	SNP	ENST00000264360.5	37	c.1443C>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	45	11.926094	0.99618	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	.	.	.	4.71	2.05	0.26809	.	0.000000	0.41001	D	0.000972	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	7.7573	0.28932	0.0:0.6593:0.0:0.3407	.	.	.	.	X	481	.	ENSP00000264360:Y481X	Y	+	3	2	PCDH10	134292188	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.921000	0.28718	0.216000	0.20781	0.655000	0.94253	TAC		0.602	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		24	94	1	0	2.98393e-07	0.00278	3.891e-07	24	94				
OTUD4	54726	broad.mit.edu	37	4	146058708	146058708	+	Missense_Mutation	SNP	C	C	A	rs193048642		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:146058708C>A	ENST00000447906.2	-	21	3406	c.3219G>T	c.(3217-3219)tgG>tgT	p.W1073C	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Missense_Mutation_p.W1008C			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	1073					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GCTGTCCTTTCCAGGACTCCT	0.473																																							uc003ika.3		NA																	0				ovary(2)|breast(1)	3						c.(3022-3024)TGG>TGT		OTU domain containing 4 protein isoform 3							203.0	195.0	198.0					4																	146058708		2203	4300	6503	SO:0001583	missense	54726						protein binding	g.chr4:146058708C>A		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.3219G>T	4.37:g.146058708C>A	ENSP00000395487:p.Trp1073Cys		Somatic				OTUD4_uc003ijz.3_Missense_Mutation_p.W1007C	p.W1008C	NM_001102653	NP_001096123	WXS	Illumina HiSeq	Unspecified	Q01804	OTUD4_HUMAN			21	3162	-	all_hematologic(180;0.151)		1072					B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37	c.3024G>T		1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	15.84	2.951451	0.53186	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.41065	1.04;1.01	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000002	T	0.58293	0.2112	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.57359	-0.7825	10	0.87932	D	0	-7.8629	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1073;1072	G3V0I6;Q01804	.;OTUD4_HUMAN	C	1008;1073	ENSP00000409279:W1008C;ENSP00000395487:W1073C	ENSP00000395487:W1073C	W	-	3	0	OTUD4	146278158	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.296000	0.65698	2.941000	0.99782	0.655000	0.94253	TGG		0.473	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493		61	161	1	0	4.17052e-40	0.00361	7.90873e-40	61	161				
TTC29	83894	broad.mit.edu	37	4	147741356	147741356	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:147741356A>G	ENST00000325106.4	-	10	1248	c.1022T>C	c.(1021-1023)gTg>gCg	p.V341A	TTC29_ENST00000398886.4_Missense_Mutation_p.V367A|TTC29_ENST00000513335.1_Missense_Mutation_p.V367A	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	341										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TGCAATTTTCACAAATTTTTT	0.343																																							uc003ikw.3		NA																	0					0						c.(1021-1023)GTG>GCG		tetratricopeptide repeat domain 29							97.0	92.0	93.0					4																	147741356		1811	4079	5890	SO:0001583	missense	83894						binding	g.chr4:147741356A>G	AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1022T>C	4.37:g.147741356A>G	ENSP00000316740:p.Val341Ala		Somatic				TTC29_uc010ipc.2_RNA|TTC29_uc003ikx.3_Missense_Mutation_p.V367A|TTC29_uc010ipd.1_Missense_Mutation_p.V341A	p.V341A	NM_031956	NP_114162	WXS	Illumina HiSeq	Unspecified	Q8NA56	TTC29_HUMAN			10	1249	-	all_hematologic(180;0.151)		341			TPR 4.		A4GU95|Q9BXB6	Missense_Mutation	SNP	ENST00000325106.4	37	c.1022T>C	CCDS47141.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.054251	0.55218	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000504425	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	5.91	5.91	0.95273	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.446305	0.23552	N	0.046941	D	0.92808	0.7713	L	0.49126	1.545	0.27717	N	0.945248	P;P;P	0.42908	0.793;0.763;0.793	P;B;P	0.47645	0.553;0.291;0.553	D	0.89439	0.3722	10	0.72032	D	0.01	-10.6104	12.5649	0.56304	0.8757:0.0:0.0:0.1243	.	341;367;341	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	A	367;367;341;341	ENSP00000423505:V367A;ENSP00000381861:V367A;ENSP00000316740:V341A;ENSP00000425778:V341A	ENSP00000316740:V341A	V	-	2	0	TTC29	147960806	0.998000	0.40836	0.128000	0.21923	0.915000	0.54546	4.438000	0.59961	2.262000	0.75019	0.528000	0.53228	GTG		0.343	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_031956		11	47	0	0	0	0.010729	0	11	47				
KIAA0922	23240	broad.mit.edu	37	4	154524568	154524568	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:154524568A>T	ENST00000409663.3	+	24	2802	c.2750A>T	c.(2749-2751)aAt>aTt	p.N917I	KIAA0922_ENST00000440693.1_Missense_Mutation_p.N834I|KIAA0922_ENST00000409959.3_Missense_Mutation_p.N918I	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	917						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				CAGCAAAACAATGGTCCTATG	0.413																																							uc003inm.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(2749-2751)AAT>ATT		hypothetical protein LOC23240 isoform 2							140.0	132.0	134.0					4																	154524568		2203	4300	6503	SO:0001583	missense	23240					integral to membrane		g.chr4:154524568A>T	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2750A>T	4.37:g.154524568A>T	ENSP00000386574:p.Asn917Ile		Somatic				KIAA0922_uc010ipp.2_Missense_Mutation_p.N918I|KIAA0922_uc010ipq.2_Missense_Mutation_p.N686I	p.N917I	NM_015196	NP_056011	WXS	Illumina HiSeq	Unspecified	A2VDJ0	T131L_HUMAN			24	2802	+	all_hematologic(180;0.093)	Renal(120;0.118)	917			Cytoplasmic (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	c.2750A>T	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	A	8.295	0.818676	0.16607	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.19669	2.39;2.13;2.39;2.13	6.17	-4.36	0.03645	.	0.582872	0.21556	N	0.072659	T	0.10078	0.0247	N	0.22421	0.69	0.09310	N	1	B;P;P	0.48089	0.178;0.905;0.846	B;B;B	0.39419	0.176;0.299;0.157	T	0.18335	-1.0340	10	0.46703	T	0.11	-0.1426	8.0673	0.30667	0.5159:0.1943:0.2897:0.0	.	834;918;917	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	I	917;834;918;695	ENSP00000386574:N917I;ENSP00000409663:N834I;ENSP00000386787:N918I;ENSP00000240487:N695I	ENSP00000240487:N695I	N	+	2	0	KIAA0922	154744018	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.420000	0.07062	-1.519000	0.01775	-0.408000	0.06270	AAT		0.413	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		7	56	0	0	0	0.00308	0	7	56				
FGA	2243	broad.mit.edu	37	4	155508744	155508744	+	Nonsense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:155508744T>A	ENST00000302053.3	-	4	508	c.430A>T	c.(430-432)Aaa>Taa	p.K144*	FGA_ENST00000403106.3_Nonsense_Mutation_p.K144*	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	144					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCTATGACTTTGCGCTTCAGG	0.418																																					NSCLC(143;340 1922 20892 22370 48145)	NSCLC(143;340 1922 20892 22370 48145)	uc003iod.1		NA																	0				ovary(2)|breast(1)	3						c.(430-432)AAA>TAA		fibrinogen, alpha polypeptide isoform alpha-E	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)						200.0	183.0	189.0					4																	155508744		2203	4300	6503	SO:0001587	stop_gained	2243				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155508744T>A		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.430A>T	4.37:g.155508744T>A	ENSP00000306361:p.Lys144*		Somatic				FGA_uc003ioe.1_Nonsense_Mutation_p.K144*|FGA_uc003iof.1_Nonsense_Mutation_p.K144*	p.K144*	NM_000508	NP_000499	WXS	Illumina HiSeq	Unspecified	P02671	FIBA_HUMAN			4	488	-	all_hematologic(180;0.215)	Renal(120;0.0458)	144			By similarity.		A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Nonsense_Mutation	SNP	ENST00000302053.3	37	c.430A>T	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	T	36	5.845783	0.97016	.	.	ENSG00000171560	ENST00000302053;ENST00000403106;ENST00000457487	.	.	.	6.16	4.96	0.65561	.	0.350194	0.35436	N	0.003218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.712	0.57094	0.0:0.0:0.2578:0.7422	.	.	.	.	X	144	.	ENSP00000306361:K144X	K	-	1	0	FGA	155728194	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	2.158000	0.42329	1.107000	0.41642	0.528000	0.53228	AAA		0.418	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508		16	42	0	0	0	0.00499	0	16	42				
NPY2R	4887	broad.mit.edu	37	4	156135828	156135828	+	Nonsense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:156135828T>A	ENST00000329476.3	+	2	1226	c.737T>A	c.(736-738)tTg>tAg	p.L246*	NPY2R_ENST00000506608.1_Nonsense_Mutation_p.L246*	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	246					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	TGGAGTAAATTGAAGAACCAT	0.443																																							uc003ioq.2		NA																	0				lung(2)|skin(1)	3						c.(736-738)TTG>TAG		neuropeptide Y receptor Y2							99.0	101.0	101.0					4																	156135828		2203	4300	6503	SO:0001587	stop_gained	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156135828T>A	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.737T>A	4.37:g.156135828T>A	ENSP00000332591:p.Leu246*		Somatic				NPY2R_uc003ior.2_Nonsense_Mutation_p.L246*	p.L246*	NM_000910	NP_000901	WXS	Illumina HiSeq	Unspecified	P49146	NPY2R_HUMAN			2	1232	+	all_hematologic(180;0.24)	Renal(120;0.0854)	246			Cytoplasmic (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Nonsense_Mutation	SNP	ENST00000329476.3	37	c.737T>A	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	T	37	6.403046	0.97537	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3171	0.74089	0.0:0.0:0.0:1.0	.	.	.	.	X	246	.	ENSP00000332591:L246X	L	+	2	0	NPY2R	156355278	1.000000	0.71417	0.927000	0.36925	0.268000	0.26511	8.040000	0.89188	2.213000	0.71641	0.523000	0.50628	TTG		0.443	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		14	57	0	0	0	0.001855	0	14	57				
GLRA3	8001	broad.mit.edu	37	4	175604028	175604028	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:175604028C>T	ENST00000274093.3	-	6	1139	c.637G>A	c.(637-639)Gaa>Aaa	p.E213K	GLRA3_ENST00000340217.5_Missense_Mutation_p.E213K	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	213					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	GTGAGTCCTTCTGCCACTTGT	0.368																																							uc003ity.1		NA																	0				ovary(3)	3						c.(637-639)GAA>AAA		glycine receptor, alpha 3 isoform a	Glycine(DB00145)						118.0	116.0	117.0					4																	175604028		2203	4300	6503	SO:0001583	missense	8001				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chr4:175604028C>T	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.637G>A	4.37:g.175604028C>T	ENSP00000274093:p.Glu213Lys		Somatic				GLRA3_uc003itz.1_Missense_Mutation_p.E213K	p.E213K	NM_006529	NP_006520	WXS	Illumina HiSeq	Unspecified	O75311	GLRA3_HUMAN		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	6	1140	-		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)	213			Extracellular (Probable).		D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	c.637G>A	CCDS3822.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307030	0.60305	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.77750	-1.12;-1.12	5.62	5.62	0.85841	Neurotransmitter-gated ion-channel ligand-binding (3);	0.138725	0.64402	D	0.000004	T	0.71056	0.3295	L	0.35542	1.07	0.80722	D	1	B;B	0.15473	0.003;0.013	B;B	0.23018	0.015;0.043	T	0.63976	-0.6515	10	0.21014	T	0.42	.	19.6472	0.95784	0.0:1.0:0.0:0.0	.	213;213	O75311-2;O75311	.;GLRA3_HUMAN	K	213	ENSP00000274093:E213K;ENSP00000345284:E213K	ENSP00000274093:E213K	E	-	1	0	GLRA3	175840603	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.767000	0.85331	2.642000	0.89623	0.655000	0.94253	GAA		0.368	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			5	34	0	0	0	0.000602	0	5	34				
TENM3	55714	broad.mit.edu	37	4	183713454	183713454	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:183713454C>T	ENST00000511685.1	+	26	5752	c.5629C>T	c.(5629-5631)Cgg>Tgg	p.R1877W	TENM3_ENST00000406950.2_Missense_Mutation_p.R1877W			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1877					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCATAGCCAGCGGCAGTACAT	0.498																																							uc003ivd.1		NA																	0					0						c.(5629-5631)CGG>TGG		odz, odd Oz/ten-m homolog 3							100.0	101.0	101.0					4																	183713454		2034	4192	6226	SO:0001583	missense	55714				signal transduction	integral to membrane		g.chr4:183713454C>T	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5629C>T	4.37:g.183713454C>T	ENSP00000424226:p.Arg1877Trp		Somatic					p.R1877W	NM_001080477	NP_001073946	WXS	Illumina HiSeq	Unspecified	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	25	5666	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	1877			Extracellular (Potential).|YD 6.		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	c.5629C>T	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431222	0.62844	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.88741	-2.42;-2.42	5.18	3.38	0.38709	.	.	.	.	.	D	0.93884	0.8043	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.94012	0.7285	9	0.87932	D	0	.	13.8764	0.63655	0.2927:0.7073:0.0:0.0	.	1877	Q9P273	TEN3_HUMAN	W	1877	ENSP00000424226:R1877W;ENSP00000385276:R1877W	ENSP00000385276:R1877W	R	+	1	2	ODZ3	183950448	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.878000	0.56130	0.683000	0.31428	0.591000	0.81541	CGG		0.498	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			20	56	0	0	0	0.008871	0	20	56				
LRRC14B	389257	broad.mit.edu	37	5	195279	195279	+	Missense_Mutation	SNP	C	C	A	rs369879424		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:195279C>A	ENST00000328278.3	+	2	1384	c.1356C>A	c.(1354-1356)gaC>gaA	p.D452E	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	452										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						AGAAATACGACGAGATCGCCG	0.592																																							uc003jal.1		NA																	0				skin(1)	1						c.(1354-1356)GAC>GAA		leucine rich repeat containing 14B							107.0	120.0	116.0					5																	195279		2168	4270	6438	SO:0001583	missense	389257							g.chr5:195279C>A		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1356C>A	5.37:g.195279C>A	ENSP00000327675:p.Asp452Glu		Somatic					p.D452E	NM_001080478	NP_001073947	WXS	Illumina HiSeq	Unspecified	A6NHZ5	LR14B_HUMAN			2	1384	+			452						Missense_Mutation	SNP	ENST00000328278.3	37	c.1356C>A	CCDS47184.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.636510	0.00806	.	.	ENSG00000185028	ENST00000328278	T	0.01228	5.14	5.41	-10.1	0.00402	.	0.830192	0.11507	N	0.557064	T	0.00468	0.0015	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.47302	-0.9128	10	0.02654	T	1	.	0.3835	0.00399	0.2235:0.2449:0.2021:0.3294	.	452	A6NHZ5	LR14B_HUMAN	E	452	ENSP00000327675:D452E	ENSP00000327675:D452E	D	+	3	2	LRRC14B	248279	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.176000	0.09811	-2.181000	0.00765	-0.997000	0.02515	GAC		0.592	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478		42	187	1	0	4.07013e-28	0.00874	7.5797e-28	42	187				
NKD2	85409	broad.mit.edu	37	5	1034410	1034410	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:1034410T>C	ENST00000296849.5	+	6	620	c.391T>C	c.(391-393)Tat>Cat	p.Y131H	NKD2_ENST00000382730.2_5'Flank|NKD2_ENST00000537972.1_Missense_Mutation_p.Y131H|NKD2_ENST00000274150.4_Missense_Mutation_p.Y131H	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	131	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Interaction with DVL1, DVL2 and DVL3. {ECO:0000250}.|Targeting to the basolateral cell membrane.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			GTTCACGCTCTATGACTTTGA	0.622																																							uc003jbt.1		NA																	0					0						c.(391-393)TAT>CAT		naked cuticle homolog 2							133.0	99.0	111.0					5																	1034410		2202	4297	6499	SO:0001583	missense	85409				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding	g.chr5:1034410T>C	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.391T>C	5.37:g.1034410T>C	ENSP00000296849:p.Tyr131His		Somatic				NKD2_uc010itf.1_Missense_Mutation_p.Y131H	p.Y131H	NM_033120	NP_149111	WXS	Illumina HiSeq	Unspecified	Q969F2	NKD2_HUMAN	Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)		6	396	+	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		131			Targeting to the basolateral cell membrane.|EF-hand.|Interaction with DVL1, DVL2 and DVL3 (By similarity).		Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	37	c.391T>C	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.478909	0.44044	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	T;T;T	0.49720	0.77;0.77;0.77	3.65	3.65	0.41850	EF-hand-like domain (1);	0.000000	0.64402	D	0.000002	T	0.66287	0.2774	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.69057	-0.5246	10	0.87932	D	0	-0.3863	8.6817	0.34212	0.0:0.0:0.0:1.0	.	131;131	Q969F2-2;Q969F2	.;NKD2_HUMAN	H	131	ENSP00000296849:Y131H;ENSP00000274150:Y131H;ENSP00000440925:Y131H	ENSP00000274150:Y131H	Y	+	1	0	NKD2	1087410	1.000000	0.71417	0.594000	0.28785	0.077000	0.17291	4.522000	0.60539	1.306000	0.44926	0.454000	0.30748	TAT		0.622	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120		16	67	0	0	0	0.012319	0	16	67				
IRX4	50805	broad.mit.edu	37	5	1878849	1878849	+	Missense_Mutation	SNP	G	G	T	rs529979691		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:1878849G>T	ENST00000505790.1	-	6	1250	c.794C>A	c.(793-795)cCg>cAg	p.P265Q	IRX4_ENST00000513692.1_Missense_Mutation_p.P265Q|IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Missense_Mutation_p.P265Q	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	265					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		TGCTTCCAGCGGGTCGAAGTC	0.682																																							uc003jcz.2		NA																	0					0						c.(793-795)CCG>CAG		iroquois homeobox 4							28.0	30.0	30.0					5																	1878849		2203	4300	6503	SO:0001583	missense	50805				heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:1878849G>T	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.794C>A	5.37:g.1878849G>T	ENSP00000423161:p.Pro265Gln		Somatic				IRX4_uc011cmf.1_Missense_Mutation_p.P126Q	p.P265Q	NM_016358	NP_057442	WXS	Illumina HiSeq	Unspecified	P78413	IRX4_HUMAN		GBM - Glioblastoma multiforme(108;0.242)	5	913	-			265					B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	37	c.794C>A	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	g	12.43	1.934750	0.34189	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692	T;T;T	0.63744	-0.06;-0.06;-0.06	3.75	3.75	0.43078	.	0.405249	0.24954	U	0.034271	T	0.52208	0.1720	L	0.43152	1.355	0.40573	D	0.981328	P	0.46327	0.876	B	0.40256	0.324	T	0.53151	-0.8479	10	0.18276	T	0.48	-6.2487	15.3728	0.74581	0.0:0.0:1.0:0.0	.	265	P78413	IRX4_HUMAN	Q	265	ENSP00000231357:P265Q;ENSP00000423161:P265Q;ENSP00000424235:P265Q	ENSP00000231357:P265Q	P	-	2	0	IRX4	1931849	0.998000	0.40836	0.644000	0.29465	0.127000	0.20565	4.497000	0.60367	1.919000	0.55581	0.450000	0.29827	CCG		0.682	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358		17	29	1	0	3.41278e-10	0.00499	4.98298e-10	17	29				
FBXL7	23194	broad.mit.edu	37	5	15928506	15928506	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:15928506C>A	ENST00000504595.1	+	3	1116	c.635C>A	c.(634-636)cCc>cAc	p.P212H	FBXL7_ENST00000510662.1_Missense_Mutation_p.P165H|FBXL7_ENST00000329673.7_Missense_Mutation_p.P200H	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	212					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CAGTGCTGCCCCGAACTGAGG	0.582																																							uc003jfn.1		NA																	0				ovary(2)|lung(1)	3						c.(634-636)CCC>CAC		F-box and leucine-rich repeat protein 7							68.0	68.0	68.0					5																	15928506		2067	4199	6266	SO:0001583	missense	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15928506C>A	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.635C>A	5.37:g.15928506C>A	ENSP00000423630:p.Pro212His		Somatic					p.P212H	NM_012304	NP_036436	WXS	Illumina HiSeq	Unspecified	Q9UJT9	FBXL7_HUMAN			3	1116	+			212			LRR 2.		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	c.635C>A	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584922	0.86748	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.02345	4.33;4.33;4.33	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.15435	0.0372	M	0.75884	2.315	0.80722	D	1	D	0.89917	1.0	D	0.68765	0.96	T	0.00201	-1.1926	10	0.49607	T	0.09	.	19.0832	0.93190	0.0:1.0:0.0:0.0	.	212	Q9UJT9	FBXL7_HUMAN	H	212;165;200	ENSP00000423630:P212H;ENSP00000425184:P165H;ENSP00000329632:P200H	ENSP00000329632:P200H	P	+	2	0	FBXL7	15981506	1.000000	0.71417	0.967000	0.41034	0.993000	0.82548	7.818000	0.86416	2.520000	0.84964	0.561000	0.74099	CCC		0.582	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		29	55	1	0	1.77063e-15	0.005443	2.94474e-15	29	55				
PRDM9	56979	broad.mit.edu	37	5	23527395	23527395	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:23527395C>A	ENST00000296682.3	+	11	2380	c.2198C>A	c.(2197-2199)tCa>tAa	p.S733*		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	733					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGCAATAAGTCACACCTCCTC	0.582										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(2197-2199)TCA>TAA		PR domain containing 9							19.0	20.0	19.0					5																	23527395		2039	4154	6193	SO:0001587	stop_gained	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527395C>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2198C>A	5.37:g.23527395C>A	ENSP00000296682:p.Ser733*	HNSCC(3;0.000094)	Somatic					p.S733*	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	2380	+			733			C2H2-type 9.		B4DX22|Q27Q50	Nonsense_Mutation	SNP	ENST00000296682.3	37	c.2198C>A	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967252	0.74131	.	.	ENSG00000164256	ENST00000296682	.	.	.	3.0	2.11	0.27256	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2084	0.31469	0.0:0.8692:0.0:0.1308	.	.	.	.	X	733	.	ENSP00000296682:S733X	S	+	2	0	PRDM9	23563152	0.000000	0.05858	0.015000	0.15790	0.001000	0.01503	-0.186000	0.09670	0.802000	0.34089	0.484000	0.47621	TCA		0.582	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		29	135	1	0	6.4308e-24	0.00361	1.17993e-23	29	135				
CDH9	1007	broad.mit.edu	37	5	26915805	26915805	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:26915805G>C	ENST00000231021.4	-	3	628	c.456C>G	c.(454-456)atC>atG	p.I152M		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	152	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I152I(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CATTGTCATTGATATCATGTA	0.373																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(454-456)ATC>ATG		cadherin 9, type 2 preproprotein							97.0	96.0	96.0					5																	26915805		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26915805G>C	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.456C>G	5.37:g.26915805G>C	ENSP00000231021:p.Ile152Met		Somatic				CDH9_uc010iug.2_Missense_Mutation_p.I152M	p.I152M	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			3	625	-			152			Extracellular (Potential).|Cadherin 1.		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.456C>G	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173109	0.57584	.	.	ENSG00000113100	ENST00000231021	T	0.62232	0.04	4.62	2.75	0.32379	Cadherin (3);Cadherin conserved site (1);Cadherin-like (2);	0.000000	0.85682	D	0.000000	T	0.76421	0.3985	M	0.86953	2.85	0.41346	D	0.987339	D	0.71674	0.998	D	0.71414	0.973	T	0.74487	-0.3649	9	.	.	.	.	5.4572	0.16598	0.1722:0.0:0.6676:0.1603	.	152	Q9ULB4	CADH9_HUMAN	M	152	ENSP00000231021:I152M	.	I	-	3	3	CDH9	26951562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.239000	0.43079	0.436000	0.26393	0.650000	0.86243	ATC		0.373	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		49	56	0	0	0	0.00361	0	49	56				
NPR3	4883	broad.mit.edu	37	5	32780871	32780871	+	Silent	SNP	T	T	C	rs368653320		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:32780871T>C	ENST00000265074.8	+	5	1582	c.1239T>C	c.(1237-1239)taT>taC	p.Y413Y	NPR3_ENST00000434067.2_Silent_p.Y197Y|NPR3_ENST00000415685.2_Silent_p.Y197Y|AC026703.2_ENST00000607869.1_RNA|NPR3_ENST00000415167.2_Silent_p.Y413Y	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	413					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GAGACCGATATGGGGATTTCT	0.552																																							uc003jhv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1237-1239)TAT>TAC		natriuretic peptide receptor C/guanylate cyclase	Nesiritide(DB04899)	T	,,	0,4386		0,0,2193	170.0	186.0	181.0		1239,1239,591	-11.3	0.0	5		181	1,8575	1.2+/-3.3	0,1,4287	no	coding-synonymous,coding-synonymous,coding-synonymous	NPR3	NM_000908.3,NM_001204375.1,NM_001204376.1	,,	0,1,6480	CC,CT,TT		0.0117,0.0,0.0077	,,	413/541,413/542,197/325	32780871	1,12961	2193	4288	6481	SO:0001819	synonymous_variant	4883				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity	g.chr5:32780871T>C		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1239T>C	5.37:g.32780871T>C			Somatic				NPR3_uc010iuo.2_Silent_p.Y197Y|NPR3_uc011cnz.1_Silent_p.Y197Y|NPR3_uc003jhu.2_Silent_p.Y413Y	p.Y413Y	NM_000908	NP_000899	WXS	Illumina HiSeq	Unspecified	P17342	ANPRC_HUMAN			5	1457	+			413			Extracellular (Potential).		A2RRD1|B4DT84|E7EPG9	Silent	SNP	ENST00000265074.8	37	c.1239T>C	CCDS56357.1																																																																																				0.552	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908		63	196	0	0	0	0.00361	0	63	196				
ADAMTS12	81792	broad.mit.edu	37	5	33751635	33751635	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:33751635G>A	ENST00000504830.1	-	3	843	c.508C>T	c.(508-510)Cca>Tca	p.P170S	ADAMTS12_ENST00000515401.1_Missense_Mutation_p.P170S|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.P170S|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	170					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCTCCATGTGGTAGTTGGAAA	0.378										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(508-510)CCA>TCA		ADAM metallopeptidase with thrombospondin type 1							103.0	106.0	105.0					5																	33751635		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33751635G>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.508C>T	5.37:g.33751635G>A	ENSP00000422554:p.Pro170Ser	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.P170S|ADAMTS12_uc003jib.1_Missense_Mutation_p.P170S	p.P170S	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			3	671	-			170					A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.508C>T	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486164	0.26686	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.05382	3.45;3.45;3.45	5.8	5.8	0.92144	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.11537	0.0281	N	0.19112	0.55	0.37230	D	0.905624	D;D;B	0.89917	1.0;1.0;0.027	D;D;B	0.97110	0.998;1.0;0.089	T	0.23368	-1.0190	10	0.07175	T	0.84	.	15.5694	0.76323	0.0:0.0:1.0:0.0	.	170;170;170	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	S	170	ENSP00000422554:P170S;ENSP00000344847:P170S;ENSP00000421638:P170S	ENSP00000344847:P170S	P	-	1	0	ADAMTS12	33787392	1.000000	0.71417	0.999000	0.59377	0.833000	0.47200	5.498000	0.66931	2.758000	0.94735	0.563000	0.77884	CCA		0.378	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		6	122	0	0	0	0.00308	0	6	122				
MROH2B	133558	broad.mit.edu	37	5	41008745	41008745	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:41008745G>A	ENST00000399564.4	-	33	4021	c.3571C>T	c.(3571-3573)Cag>Tag	p.Q1191*	MROH2B_ENST00000506092.2_Nonsense_Mutation_p.Q746*	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1191																	TCTCCCTGCTGCATCACATGC	0.562																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(3571-3573)CAG>TAG		HEAT repeat family member 7B2							89.0	91.0	90.0					5																	41008745		2075	4205	6280	SO:0001587	stop_gained	133558						binding	g.chr5:41008745G>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3571C>T	5.37:g.41008745G>A	ENSP00000382476:p.Gln1191*		Somatic				HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.Q746*	p.Q1191*	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			33	4061	-			1191			HEAT 13.		Q68DM1|Q7Z4U4|Q8N7X3	Nonsense_Mutation	SNP	ENST00000399564.4	37	c.3571C>T	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	40	7.914101	0.98560	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	.	.	.	5.97	4.12	0.48240	.	0.221905	0.31709	N	0.007189	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	12.2366	0.54518	0.0:0.0:0.6844:0.3156	.	.	.	.	X	746;896;1191	.	ENSP00000296803:Q896X	Q	-	1	0	HEATR7B2	41044502	0.034000	0.19679	0.003000	0.11579	0.737000	0.42083	1.242000	0.32755	0.780000	0.33566	0.561000	0.74099	CAG		0.562	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		44	61	0	0	0	0.00361	0	44	61				
NDUFS4	4724	broad.mit.edu	37	5	52979007	52979007	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:52979007G>T	ENST00000296684.5	+	5	512	c.484G>T	c.(484-486)Gca>Tca	p.A162S		NM_002495.2	NP_002486.1	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase)	162					brain development (GO:0007420)|cAMP-mediated signaling (GO:0019933)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|positive regulation of fibroblast proliferation (GO:0048146)|reactive oxygen species metabolic process (GO:0072593)|regulation of protein phosphorylation (GO:0001932)|respiratory electron transport chain (GO:0022904)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(3)	10		Lung NSC(810;8.27e-05)|Breast(144;0.0848)				GTCTTATGGTGCAAACTTTTC	0.388																																							uc003jpe.2		NA																	0				central_nervous_system(1)	1						c.(484-486)GCA>TCA		NADH dehydrogenase (ubiquinone) Fe-S protein 4	NADH(DB00157)						130.0	134.0	133.0					5																	52979007		2203	4300	6503	SO:0001583	missense	4724				brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr5:52979007G>T	AF020351	CCDS3960.1	5q11.1	2011-07-04	2002-08-29		ENSG00000164258	ENSG00000164258		"""Mitochondrial respiratory chain complex / Complex I"""	7711	protein-coding gene	gene with protein product	"""complex I 18kDa subunit"""	602694	"""NADH dehydrogenase (ubiquinone) Fe-S protein 4 (18kD) (NADH-coenzyme Q reductase)"""			9463323, 9763677	Standard	NM_002495		Approved	AQDQ, CI-18	uc003jpe.2	O43181	OTTHUMG00000096987	ENST00000296684.5:c.484G>T	5.37:g.52979007G>T	ENSP00000296684:p.Ala162Ser		Somatic					p.A162S	NM_002495	NP_002486	WXS	Illumina HiSeq	Unspecified	O43181	NDUS4_HUMAN			5	512	+		Lung NSC(810;8.27e-05)|Breast(144;0.0848)	162					Q9BS69	Missense_Mutation	SNP	ENST00000296684.5	37	c.484G>T	CCDS3960.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736491	0.30774	.	.	ENSG00000164258	ENST00000296684	T	0.76709	-1.04	5.96	5.09	0.68999	.	0.048140	0.85682	D	0.000000	D	0.83257	0.5215	L	0.51422	1.61	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.79548	-0.1758	10	0.13470	T	0.59	.	15.1353	0.72558	0.0675:0.0:0.9325:0.0	.	162	O43181	NDUS4_HUMAN	S	162	ENSP00000296684:A162S	ENSP00000296684:A162S	A	+	1	0	NDUFS4	53014764	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	8.500000	0.90498	1.535000	0.49220	0.655000	0.94253	GCA		0.388	NDUFS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214062.2	NM_002495		51	66	1	0	4.44712e-29	0.00361	8.30664e-29	51	66				
MAST4	375449	broad.mit.edu	37	5	66426037	66426037	+	Splice_Site	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:66426037G>T	ENST00000403625.2	+	15	2040		c.e15-1		MAST4_ENST00000261569.7_Splice_Site|MAST4_ENST00000404260.3_Splice_Site|MAST4_ENST00000403666.1_Splice_Site|MAST4_ENST00000405643.1_Splice_Site	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTCCTTTTCAGGGCAGTCTAC	0.418																																							uc003jut.1		NA																	0				lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.e14-1		microtubule associated serine/threonine kinase							24.0	23.0	24.0					5																	66426037		1925	4148	6073	SO:0001630	splice_region_variant	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66426037G>T	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.1746-1G>T	5.37:g.66426037G>T			Somatic				MAST4_uc003juu.1_Splice_Site_p.G403_splice|MAST4_uc011cra.1_Splice_Site_p.G376_splice|MAST4_uc003juv.2_Splice_Site_p.G388_splice|MAST4_uc003juw.2_Splice_Site_p.G388_splice	p.G393_splice	NM_015183	NP_055998	WXS	Illumina HiSeq	Unspecified	O15021	MAST4_HUMAN		Lung(70;0.011)	14	1247	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)						A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Splice_Site	SNP	ENST00000403625.2	37	c.1179_splice	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691459	0.88735	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.382	0.94540	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAST4	66461793	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.869000	0.99810	2.636000	0.89361	0.655000	0.94253	.		0.418	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		Intron	3	9	1	0	0.004672	0.004672	0.00502765	3	9				
BDP1	55814	broad.mit.edu	37	5	70809190	70809190	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:70809190A>G	ENST00000358731.4	+	19	4689	c.4426A>G	c.(4426-4428)Atg>Gtg	p.M1476V	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1476					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GACTATTGTGATGCAAGAAAA	0.328																																							uc003kbp.1		NA																	0				skin(2)	2						c.(4426-4428)ATG>GTG		transcription factor-like nuclear regulator							173.0	177.0	175.0					5																	70809190		1817	4070	5887	SO:0001583	missense	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70809190A>G	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.4426A>G	5.37:g.70809190A>G	ENSP00000351575:p.Met1476Val		Somatic				BDP1_uc003kbo.2_Missense_Mutation_p.M1476V	p.M1476V	NM_018429	NP_060899	WXS	Illumina HiSeq	Unspecified	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	19	4689	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	1476					Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	c.4426A>G	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	A	6.630	0.484775	0.12641	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.09445	2.98	5.0	-10.0	0.00425	.	1.675570	0.03097	N	0.160614	T	0.02649	0.0080	N	0.03115	-0.41	0.09310	N	0.999999	B;B	0.09022	0.0;0.002	B;B	0.04013	0.001;0.001	T	0.35895	-0.9770	10	0.07644	T	0.81	.	0.9615	0.01397	0.2274:0.3208:0.2408:0.2109	.	1476;1476	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	V	1476;1056	ENSP00000351575:M1476V	ENSP00000351575:M1476V	M	+	1	0	BDP1	70844946	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-0.599000	0.05700	-1.548000	0.01712	0.397000	0.26171	ATG		0.328	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		9	207	0	0	0	0.006214	0	9	207				
EDIL3	10085	broad.mit.edu	37	5	83433124	83433124	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:83433124G>T	ENST00000296591.5	-	5	822	c.404C>A	c.(403-405)aCa>aAa	p.T135K	EDIL3_ENST00000380138.3_Missense_Mutation_p.T125K	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	135	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		AACAAGATCTGTACATATTCC	0.368																																							uc003kio.1		NA																	0				skin(2)	2						c.(403-405)ACA>AAA		EGF-like repeats and discoidin I-like							210.0	183.0	192.0					5																	83433124		2203	4300	6503	SO:0001583	missense	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83433124G>T	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.404C>A	5.37:g.83433124G>T	ENSP00000296591:p.Thr135Lys		Somatic				EDIL3_uc003kip.1_Missense_Mutation_p.T125K	p.T135K	NM_005711	NP_005702	WXS	Illumina HiSeq	Unspecified	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	5	823	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	135			EGF-like 3.		B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	c.404C>A	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547932	0.45383	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.91740	-2.9;-2.9	5.44	5.44	0.79542	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.92244	0.7540	N	0.21373	0.66	0.80722	D	1	D;B	0.61080	0.989;0.056	D;B	0.75020	0.985;0.024	D	0.87969	0.2735	10	0.09338	T	0.73	-21.9255	19.6248	0.95674	0.0:0.0:1.0:0.0	.	125;135	O43854-2;O43854	.;EDIL3_HUMAN	K	135;125	ENSP00000296591:T135K;ENSP00000369483:T125K	ENSP00000296591:T135K	T	-	2	0	EDIL3	83468880	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	7.513000	0.81739	2.716000	0.92895	0.563000	0.77884	ACA		0.368	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		12	81	1	0	0.000219431	0.00245	0.000249975	12	81				
NBPF22P	285622	broad.mit.edu	37	5	85578556	85578556	+	RNA	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:85578556C>A	ENST00000590707.1	+	0	279					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		CAGTCCCTGGCTCTACCTCTT	0.463																																							uc003kiq.2		NA																	0					0						c.(31-33)GGC>GGA		SubName: Full=Putative uncharacterized protein NBPF22P;																																						285622							g.chr5:85578556C>A	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85578556C>A			Somatic					p.G11G	NR_003719		WXS	Illumina HiSeq	Unspecified					1	295	+									Silent	SNP	ENST00000590707.1	37	c.33C>A																																																																																					0.463	NBPF22P-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000453100.1	XM_208333		22	95	1	0	0.000229342	0.012319	0.000260787	22	95				
APBB3	10307	broad.mit.edu	37	5	139941196	139941196	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:139941196A>T	ENST00000357560.4	-	8	1166	c.723T>A	c.(721-723)agT>agA	p.S241R	APBB3_ENST00000354402.5_Missense_Mutation_p.S248R|APBB3_ENST00000358580.5_Missense_Mutation_p.S241R|APBB3_ENST00000412920.3_Missense_Mutation_p.S239R|APBB3_ENST00000507279.1_5'Flank|SLC35A4_ENST00000323146.3_5'Flank|APBB3_ENST00000356738.2_Missense_Mutation_p.S246R|APBB3_ENST00000508496.2_Missense_Mutation_p.S18R|APBB3_ENST00000511201.2_Missense_Mutation_p.S239R	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	241	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S248R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATGTAGGGCACTGGCAATGG	0.542																																							uc003lgd.1		NA																	1	Substitution - Missense(1)	p.S248R(1)	ovary(1)	ovary(2)	2						c.(736-738)AGT>AGA		amyloid beta precursor protein-binding, family							128.0	122.0	124.0					5																	139941196		2203	4300	6503	SO:0001583	missense	10307					actin cytoskeleton|cytoplasm		g.chr5:139941196A>T	AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.723T>A	5.37:g.139941196A>T	ENSP00000350171:p.Ser241Arg		Somatic				APBB3_uc003lgb.1_Missense_Mutation_p.S18R|APBB3_uc003lgc.1_Missense_Mutation_p.S18R|APBB3_uc003lge.1_Missense_Mutation_p.S239R|APBB3_uc003lgf.1_RNA|APBB3_uc010jfp.1_RNA|APBB3_uc011czi.1_Missense_Mutation_p.S18R|APBB3_uc010jfq.1_Missense_Mutation_p.S18R	p.S246R	NM_133172	NP_573418	WXS	Illumina HiSeq	Unspecified	O95704	APBB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		7	1097	-			241			PID 1.		B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	c.738T>A	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.966031	0.53507	.	.	ENSG00000113108	ENST00000358580;ENST00000356738;ENST00000354402;ENST00000357560;ENST00000508496;ENST00000412920;ENST00000511201	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.99	5.99	0.97316	.	0.325064	0.38272	N	0.001759	T	0.23727	0.0574	L	0.44542	1.39	0.51012	D	0.999902	P;P;P	0.49783	0.88;0.855;0.928	P;B;P	0.47402	0.468;0.359;0.546	T	0.11792	-1.0573	9	.	.	.	-14.8831	3.3031	0.06990	0.6421:0.1537:0.074:0.1302	.	239;239;246	D6RBA1;O95704-2;O95704-3	.;.;.	R	241;246;248;241;18;239;239	ENSP00000351389:S241R;ENSP00000349177:S246R;ENSP00000346378:S248R;ENSP00000350171:S241R;ENSP00000444013:S18R;ENSP00000402591:S239R;ENSP00000424317:S239R	.	S	-	3	2	APBB3	139921380	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.461000	0.21940	2.291000	0.77112	0.533000	0.62120	AGT		0.542	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251677.2	NM_006051		78	98	0	0	0	0.00361	0	78	98				
PCDHA13	56136	broad.mit.edu	37	5	140263343	140263343	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:140263343G>T	ENST00000289272.2	+	1	1490	c.1490G>T	c.(1489-1491)cGg>cTg	p.R497L	PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.R497L|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	497	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGGAGCGGCGGGTGGGC	0.662																																					Melanoma(147;1739 1852 5500 27947 37288)	Melanoma(147;1739 1852 5500 27947 37288)	uc003lif.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1489-1491)CGG>CTG		protocadherin alpha 13 isoform 1 precursor							64.0	67.0	66.0					5																	140263343		2202	4299	6501	SO:0001583	missense	56136				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140263343G>T	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1490G>T	5.37:g.140263343G>T	ENSP00000289272:p.Arg497Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.R497L|PCDHA13_uc003lid.2_Missense_Mutation_p.R497L	p.R497L	NM_018904	NP_061727	WXS	Illumina HiSeq	Unspecified	Q9Y5I0	PCDAD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1490	+			497			Cadherin 5.|Extracellular (Potential).		O75277	Missense_Mutation	SNP	ENST00000289272.2	37	c.1490G>T	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824835	0.32237	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.51325	0.71;0.71	4.62	4.62	0.57501	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43722	0.1260	N	0.20685	0.6	0.09310	N	0.999999	B;B;B	0.30563	0.285;0.248;0.209	P;B;B	0.44597	0.454;0.234;0.15	T	0.45527	-0.9255	9	0.52906	T	0.07	.	9.942	0.41587	0.0941:0.0:0.9059:0.0	.	497;497;497	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	497	ENSP00000386821:R497L;ENSP00000289272:R497L	ENSP00000289272:R497L	R	+	2	0	PCDHA13	140243527	0.001000	0.12720	1.000000	0.80357	0.897000	0.52465	0.318000	0.19504	2.386000	0.81285	0.556000	0.70494	CGG		0.662	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904		79	48	1	0	9.04243e-43	0.00361	1.72e-42	79	48				
PCDHGA9	56107	broad.mit.edu	37	5	140784509	140784509	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:140784509A>T	ENST00000573521.1	+	1	1990	c.1990A>T	c.(1990-1992)Ata>Tta	p.I664L	PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACAGTAGCCATAGCTGACAG	0.592																																							uc003lkh.1		NA																	0					0						c.(1990-1992)ATA>TTA		protocadherin gamma subfamily A, 9 isoform 1							66.0	75.0	72.0					5																	140784509		2181	4294	6475	SO:0001583	missense	56107				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140784509A>T	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.1990A>T	5.37:g.140784509A>T	ENSP00000460274:p.Ile664Leu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.I664L	p.I664L	NM_018921	NP_061744	WXS	Illumina HiSeq	Unspecified	Q9Y5G4	PCDG9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1990	+			664			Cadherin 6.|Extracellular (Potential).		A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	c.1990A>T	CCDS58981.1																																																																																				0.592	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921		44	48	0	0	0	0.007835	0	44	48				
PPP2R2B	5521	broad.mit.edu	37	5	145969781	145969781	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:145969781A>C	ENST00000394413.3	-	9	1631	c.1061T>G	c.(1060-1062)aTg>aGg	p.M354R	PPP2R2B_ENST00000508545.2_Missense_Mutation_p.M343R|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.M354R|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000394414.1_Missense_Mutation_p.M420R|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.M354R|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.M357R|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.M412R|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.M343R|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.M360R|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.M354R			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	354					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAGCCTGTCATGATGACACT	0.473																																							uc003loe.2		NA																	0				ovary(1)|prostate(1)	2						c.(1060-1062)ATG>AGG		beta isoform of regulatory subunit B55, protein							57.0	52.0	53.0					5																	145969781		2203	4300	6503	SO:0001583	missense	5521				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr5:145969781A>C	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.1061T>G	5.37:g.145969781A>C	ENSP00000377935:p.Met354Arg		Somatic				PPP2R2B_uc010jgm.2_Missense_Mutation_p.M343R|PPP2R2B_uc003log.3_Missense_Mutation_p.M354R|PPP2R2B_uc003lof.3_Missense_Mutation_p.M354R|PPP2R2B_uc003loi.3_Missense_Mutation_p.M357R|PPP2R2B_uc003loh.3_Missense_Mutation_p.M354R|PPP2R2B_uc003loj.3_Missense_Mutation_p.M334R|PPP2R2B_uc003lok.3_Missense_Mutation_p.M343R|PPP2R2B_uc011dbu.1_Missense_Mutation_p.M360R|PPP2R2B_uc011dbv.1_Missense_Mutation_p.M412R	p.M354R	NM_004576	NP_004567	WXS	Illumina HiSeq	Unspecified	Q00005	2ABB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		9	1586	-			354			WD 6.		A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	ENST00000394413.3	37	c.1061T>G	CCDS4284.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852263	0.71719	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.076324	0.85682	N	0.000000	T	0.58104	0.2099	M	0.88570	2.965	0.80722	D	1	P;D;D;P;D;D	0.62365	0.808;0.961;0.961;0.923;0.991;0.961	P;P;P;P;P;P	0.59221	0.72;0.854;0.72;0.72;0.854;0.854	T	0.67902	-0.5550	10	0.87932	D	0	-15.1486	15.3991	0.74823	1.0:0.0:0.0:0.0	.	412;360;343;420;357;354	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	R	354;343;420;354;354;354;343;357;360;412	ENSP00000377935:M354R;ENSP00000431320:M343R;ENSP00000377936:M420R;ENSP00000377933:M354R;ENSP00000349283:M354R;ENSP00000398779:M354R;ENSP00000377932:M343R;ENSP00000336591:M357R;ENSP00000421396:M360R;ENSP00000377931:M412R	ENSP00000336591:M357R	M	-	2	0	AC011357.1	145949974	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.761000	0.91691	2.234000	0.73211	0.533000	0.62120	ATG		0.473	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678		23	35	0	0	0	0.00278	0	23	35				
FAT2	2196	broad.mit.edu	37	5	150946570	150946570	+	Silent	SNP	T	T	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:150946570T>G	ENST00000261800.5	-	1	1935	c.1923A>C	c.(1921-1923)acA>acC	p.T641T		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	641	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATCTGAGGCTGTAATCTTCA	0.413																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(1921-1923)ACA>ACC		FAT tumor suppressor 2 precursor							98.0	98.0	98.0					5																	150946570		2203	4300	6503	SO:0001819	synonymous_variant	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150946570T>G	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1923A>C	5.37:g.150946570T>G			Somatic				GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Silent_p.T641T	p.T641T	NM_001447	NP_001438	WXS	Illumina HiSeq	Unspecified	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		1	1936	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	641			Extracellular (Potential).|Cadherin 5.		O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	c.1923A>C	CCDS4317.1																																																																																				0.413	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		25	24	0	0	0	0.003954	0	25	24				
KIF4B	285643	broad.mit.edu	37	5	154394885	154394885	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:154394885A>G	ENST00000435029.4	+	1	1626	c.1466A>G	c.(1465-1467)gAt>gGt	p.D489G		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	489					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCAGCCATTGATACTGCGGTA	0.453																																							uc010jih.1		NA																	0				ovary(1)	1						c.(1465-1467)GAT>GGT		kinesin family member 4B							100.0	109.0	106.0					5																	154394885		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154394885A>G	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1466A>G	5.37:g.154394885A>G	ENSP00000387875:p.Asp489Gly		Somatic					p.D489G	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	1626	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	489			Potential.			Missense_Mutation	SNP	ENST00000435029.4	37	c.1466A>G	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	a	1.582	-0.531452	0.04112	.	.	ENSG00000226650	ENST00000435029	T	0.69685	-0.42	1.34	1.34	0.21922	.	.	.	.	.	T	0.55561	0.1928	L	0.55481	1.735	0.09310	N	1	B	0.23058	0.079	B	0.23275	0.045	T	0.44221	-0.9342	9	0.31617	T	0.26	.	4.8013	0.13298	1.0:0.0:0.0:0.0	.	489	Q2VIQ3	KIF4B_HUMAN	G	489	ENSP00000387875:D489G	ENSP00000387875:D489G	D	+	2	0	KIF4B	154375078	0.557000	0.26546	0.002000	0.10522	0.008000	0.06430	1.851000	0.39338	0.872000	0.35775	0.374000	0.22700	GAT		0.453	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			37	60	0	0	0	0.005524	0	37	60				
KIF4B	285643	broad.mit.edu	37	5	154396536	154396536	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:154396536G>C	ENST00000435029.4	+	1	3277	c.3117G>C	c.(3115-3117)atG>atC	p.M1039I		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1039	Globular. {ECO:0000250}.|Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGCAAAGCATGGACATCGAGG	0.418																																							uc010jih.1		NA																	0				ovary(1)	1						c.(3115-3117)ATG>ATC		kinesin family member 4B							123.0	121.0	122.0					5																	154396536		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154396536G>C	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.3117G>C	5.37:g.154396536G>C	ENSP00000387875:p.Met1039Ile		Somatic					p.M1039I	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	3277	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	1039			Interaction with PRC1 (By similarity).|Globular (By similarity).			Missense_Mutation	SNP	ENST00000435029.4	37	c.3117G>C	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	G	2.596	-0.294170	0.05568	.	.	ENSG00000226650	ENST00000435029	T	0.66638	-0.22	1.77	0.871	0.19107	.	.	.	.	.	T	0.46386	0.1390	L	0.31664	0.95	0.27598	N	0.949071	B	0.02656	0.0	B	0.04013	0.001	T	0.26395	-1.0104	9	0.17369	T	0.5	.	4.1167	0.10084	0.2235:0.0:0.7765:0.0	.	1039	Q2VIQ3	KIF4B_HUMAN	I	1039	ENSP00000387875:M1039I	ENSP00000387875:M1039I	M	+	3	0	KIF4B	154376729	0.800000	0.28916	0.857000	0.33713	0.971000	0.66376	1.892000	0.39748	0.299000	0.22661	0.563000	0.77884	ATG		0.418	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			35	33	0	0	0	0.002836	0	35	33				
DOCK2	1794	broad.mit.edu	37	5	169129338	169129338	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:169129338C>T	ENST00000256935.8	+	14	1370	c.1290C>T	c.(1288-1290)ctC>ctT	p.L430L	DOCK2_ENST00000520908.1_5'Flank|DOCK2_ENST00000540750.1_5'Flank	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	430	DHR-1.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACATTACTCTCTTACAAGGTG	0.493											OREG0017017	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(1288-1290)CTC>CTT		dedicator of cytokinesis 2							167.0	141.0	150.0					5																	169129338		2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169129338C>T	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1290C>T	5.37:g.169129338C>T			Somatic	OREG0017017	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1875	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_5'Flank|DOCK2_uc010jjl.1_5'UTR	p.L430L	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		14	1370	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	430			DHR-1.		Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.1290C>T	CCDS4371.1																																																																																				0.493	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		6	114	0	0	0	0.001168	0	6	114				
SH3PXD2B	285590	broad.mit.edu	37	5	171777438	171777438	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:171777438T>A	ENST00000311601.5	-	10	1111	c.941A>T	c.(940-942)aAg>aTg	p.K314M	SH3PXD2B_ENST00000519643.1_Missense_Mutation_p.K314M	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	314					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAGCAGCTCCTTCTCCCTGCC	0.677																																							uc003mbr.2		NA																	0				ovary(3)|skin(1)	4						c.(940-942)AAG>ATG		SH3 and PX domains 2B							34.0	36.0	35.0					5																	171777438		2203	4300	6503	SO:0001583	missense	285590				adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding	g.chr5:171777438T>A	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.941A>T	5.37:g.171777438T>A	ENSP00000309714:p.Lys314Met		Somatic					p.K314M	NM_001017995	NP_001017995	WXS	Illumina HiSeq	Unspecified	A1X283	SPD2B_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		10	1112	-	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	314					B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	37	c.941A>T	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	T	15.72	2.916243	0.52546	.	.	ENSG00000174705	ENST00000519643;ENST00000311601	T;T	0.29917	1.55;1.55	5.03	2.25	0.28309	Src homology-3 domain (1);	0.314050	0.32687	N	0.005761	T	0.38161	0.1030	L	0.50333	1.59	0.38239	D	0.941256	D	0.54601	0.967	P	0.56788	0.806	T	0.24261	-1.0165	10	0.66056	D	0.02	-14.3478	6.9412	0.24494	0.0:0.3737:0.0:0.6263	.	314	A1X283	SPD2B_HUMAN	M	314	ENSP00000430890:K314M;ENSP00000309714:K314M	ENSP00000309714:K314M	K	-	2	0	SH3PXD2B	171710043	1.000000	0.71417	0.995000	0.50966	0.660000	0.38997	2.343000	0.44001	0.115000	0.18071	-0.366000	0.07423	AAG		0.677	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963		34	28	0	0	0	0.012213	0	34	28				
SLC34A1	6569	broad.mit.edu	37	5	176823992	176823992	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:176823992C>A	ENST00000324417.5	+	12	1424	c.1333C>A	c.(1333-1335)Ctg>Atg	p.L445M	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	445					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCGCTCACACTGGGTTCCAA	0.647																																							uc003mgk.3		NA																	0				ovary(1)	1						c.(1333-1335)CTG>ATG		solute carrier family 34 (sodium phosphate),							61.0	56.0	58.0					5																	176823992		2203	4300	6503	SO:0001583	missense	6569				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr5:176823992C>A	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1333C>A	5.37:g.176823992C>A	ENSP00000321424:p.Leu445Met		Somatic					p.L445M	NM_003052	NP_003043	WXS	Illumina HiSeq	Unspecified	Q06495	NPT2A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		12	1434	+	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	445			Extracellular (Potential).		B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	c.1333C>A	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538107	0.85917	.	.	ENSG00000131183	ENST00000324417	D	0.87334	-2.24	5.29	5.29	0.74685	.	0.078023	0.50627	D	0.000106	D	0.91680	0.7370	L	0.48935	1.535	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.92145	0.5723	10	0.62326	D	0.03	-9.2179	18.958	0.92668	0.0:1.0:0.0:0.0	.	445	Q06495	NPT2A_HUMAN	M	445	ENSP00000321424:L445M	ENSP00000321424:L445M	L	+	1	2	SLC34A1	176756598	0.995000	0.38212	0.953000	0.39169	0.729000	0.41735	3.266000	0.51569	2.478000	0.83669	0.561000	0.74099	CTG		0.647	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052		30	27	1	0	1.68575e-08	0.007291	2.30448e-08	30	27				
SERPINB9	5272	broad.mit.edu	37	6	2892184	2892184	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:2892184G>A	ENST00000380698.4	-	6	695	c.606C>T	c.(604-606)gcC>gcT	p.A202A		NM_004155.5	NP_004146.1	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 9	202					cellular response to estrogen stimulus (GO:0071391)|immune response (GO:0006955)|mast cell mediated immunity (GO:0002448)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	15	Ovarian(93;0.0412)	all_hematologic(90;0.108)				GCTTAAACGTGGCCTCCTGAT	0.577																																							uc003mug.2		NA																	0					0						c.(604-606)GCC>GCT		serpin peptidase inhibitor, clade B, member 9							72.0	73.0	73.0					6																	2892184		2203	4300	6503	SO:0001819	synonymous_variant	5272				anti-apoptosis|cellular response to estrogen stimulus|immune response|mast cell mediated immunity|regulation of proteolysis	cytosol|extracellular space|nucleus	caspase inhibitor activity|protease binding|serine-type endopeptidase inhibitor activity	g.chr6:2892184G>A	L40378	CCDS4478.1	6p25.2	2014-02-18	2005-08-18		ENSG00000170542	ENSG00000170542		"""Serine (or cysteine) peptidase inhibitors"""	8955	protein-coding gene	gene with protein product		601799	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9"""	PI9		8530382, 9858835, 24172014	Standard	NM_004155		Approved	CAP3	uc003mug.4	P50453	OTTHUMG00000014131	ENST00000380698.4:c.606C>T	6.37:g.2892184G>A			Somatic				uc003mue.2_Intron|SERPINB9_uc003muf.2_Silent_p.A5A	p.A202A	NM_004155	NP_004146	WXS	Illumina HiSeq	Unspecified	P50453	SPB9_HUMAN			6	727	-	Ovarian(93;0.0412)	all_hematologic(90;0.108)	202					B2RBW3|Q5TD03	Silent	SNP	ENST00000380698.4	37	c.606C>T	CCDS4478.1																																																																																				0.577	SERPINB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039656.1			8	115	0	0	0	0.006214	0	8	115				
HIVEP1	3096	broad.mit.edu	37	6	12124237	12124237	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:12124237A>T	ENST00000379388.2	+	4	4541	c.4209A>T	c.(4207-4209)gaA>gaT	p.E1403D	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1403					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CACTTACTGAATTGCAGCCTC	0.478																																							uc003nac.2		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(4207-4209)GAA>GAT		human immunodeficiency virus type I enhancer							126.0	129.0	128.0					6																	12124237		2055	4194	6249	SO:0001583	missense	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12124237A>T	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4209A>T	6.37:g.12124237A>T	ENSP00000368698:p.Glu1403Asp		Somatic				HIVEP1_uc011diq.1_RNA	p.E1403D	NM_002114	NP_002105	WXS	Illumina HiSeq	Unspecified	P15822	ZEP1_HUMAN			4	4388	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	1403					B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	c.4209A>T	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.274812	0.40194	.	.	ENSG00000095951	ENST00000379388	T	0.51817	0.69	5.79	-7.95	0.01148	.	0.206471	0.24285	N	0.039867	T	0.13543	0.0328	M	0.65320	2	0.51482	D	0.999928	B	0.21606	0.058	B	0.17722	0.019	T	0.12477	-1.0546	9	.	.	.	-5.4008	0.9123	0.01297	0.2729:0.2605:0.2829:0.1837	.	1403	P15822	ZEP1_HUMAN	D	1403	ENSP00000368698:E1403D	.	E	+	3	2	HIVEP1	12232223	0.000000	0.05858	0.000000	0.03702	0.141000	0.21300	-0.922000	0.04004	-1.349000	0.02202	0.533000	0.62120	GAA		0.478	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		4	105	0	0	0	0.000602	0	4	105				
TDP2	51567	broad.mit.edu	37	6	24651078	24651078	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:24651078C>A	ENST00000378198.4	-	7	1197	c.1027G>T	c.(1027-1029)Gac>Tac	p.D343Y	TDP2_ENST00000545995.1_Missense_Mutation_p.D373Y|TDP2_ENST00000341060.3_Missense_Mutation_p.D285Y			O95551	TYDP2_HUMAN	tyrosyl-DNA phosphodiesterase 2	343					cell surface receptor signaling pathway (GO:0007166)|double-strand break repair (GO:0006302)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|PML body (GO:0016605)	5'-tyrosyl-DNA phosphodiesterase activity (GO:0070260)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)|tyrosyl-RNA phosphodiesterase activity (GO:0036317)			kidney(2)|large_intestine(1)|lung(5)|ovary(1)	9						CTACCACAGTCCAGTTTTTCT	0.398								Direct reversal of damage																															uc003nej.2		NA																	0				ovary(1)|lung(1)	2						c.(1027-1029)GAC>TAC	Direct_reversal_of_damage|Editing_and_processing_nucleases	TRAF and TNF receptor-associated protein							86.0	84.0	85.0					6																	24651078		2203	4300	6503	SO:0001583	missense	51567				cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity	g.chr6:24651078C>A	AJ269473	CCDS4557.1	6p22.3-p22.1	2010-05-07	2010-05-07	2010-05-07	ENSG00000111802	ENSG00000111802	3.1.4.-		17768	protein-coding gene	gene with protein product		605764	"""TRAF and TNF receptor associated protein"""	TTRAP		11478795	Standard	NM_016614		Approved		uc003nej.3	O95551	OTTHUMG00000014360	ENST00000378198.4:c.1027G>T	6.37:g.24651078C>A	ENSP00000367440:p.Asp343Tyr		Somatic				TDP2_uc003nei.2_Missense_Mutation_p.D231Y	p.D343Y	NM_016614	NP_057698	WXS	Illumina HiSeq	Unspecified	O95551	TYDP2_HUMAN			7	1052	-			343					B4DKL8|B4DQ95|Q2TBE2|Q5JYM0|Q7Z6U5|Q9NUK5|Q9NYY9	Missense_Mutation	SNP	ENST00000378198.4	37	c.1027G>T	CCDS4557.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668318	0.88348	.	.	ENSG00000111802	ENST00000378198;ENST00000545995;ENST00000545780;ENST00000341060	T;T;T	0.23754	1.89;1.89;1.89	6.07	5.2	0.72013	Endonuclease/exonuclease/phosphatase (2);	0.087618	0.85682	D	0.000000	T	0.37433	0.1003	M	0.65975	2.015	0.80722	D	1	D	0.55385	0.971	P	0.62491	0.903	T	0.32348	-0.9910	10	0.66056	D	0.02	-11.3682	15.583	0.76459	0.0:0.9341:0.0:0.0659	.	343	O95551	TYDP2_HUMAN	Y	343;373;265;285	ENSP00000367440:D343Y;ENSP00000437637:D373Y;ENSP00000345345:D285Y	ENSP00000345345:D285Y	D	-	1	0	TDP2	24759057	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.661000	0.68025	1.577000	0.49804	0.655000	0.94253	GAC		0.398	TDP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000040012.1			8	52	1	0	3.09899e-07	0.004482	3.99083e-07	8	52				
ZBED9	114821	broad.mit.edu	37	6	28539765	28539765	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:28539765G>A	ENST00000452236.2	-	4	4518	c.3901C>T	c.(3901-3903)Ctg>Ttg	p.L1301L		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						gctaccctcaggggataatgt	0.338																																							uc003nlo.2		NA																	0				ovary(1)	1						c.(3901-3903)CTG>TTG		SCAN domain containing 3							94.0	92.0	93.0					6																	28539765		2203	4300	6503	SO:0001819	synonymous_variant	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28539765G>A																												ENST00000452236.2:c.3901C>T	6.37:g.28539765G>A			Somatic					p.L1301L	NM_052923	NP_443155	WXS	Illumina HiSeq	Unspecified	Q6R2W3	SCND3_HUMAN			4	4519	-			1301						Silent	SNP	ENST00000452236.2	37	c.3901C>T	CCDS34355.1																																																																																				0.338	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			17	45	0	0	0	0.004007	0	17	45				
TRIM27	5987	broad.mit.edu	37	6	28872429	28872429	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:28872429C>G	ENST00000377199.3	-	8	1316	c.960G>C	c.(958-960)ctG>ctC	p.L320L	TRIM27_ENST00000377194.3_Silent_p.L320L	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	320	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TGTCTGGGTCCAGAGTCACGT	0.557			T	RET	papillary thyroid																																		uc003nlr.2		NA		Dom	yes		6	6p22	5987	T	tripartite motif-containing 27			E	RET		papillary thyroid		0				ovary(1)	1						c.(958-960)CTG>CTC		ret finger protein							31.0	33.0	33.0					6																	28872429		1509	2708	4217	SO:0001819	synonymous_variant	5987				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding	g.chr6:28872429C>G	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.960G>C	6.37:g.28872429C>G			Somatic				TRIM27_uc003nls.2_Silent_p.L320L|TRIM27_uc003nlt.1_3'UTR	p.L320L	NM_006510	NP_006501	WXS	Illumina HiSeq	Unspecified	P14373	TRI27_HUMAN			8	1319	-			320			B30.2/SPRY.		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Silent	SNP	ENST00000377199.3	37	c.960G>C	CCDS4654.1	.	.	.	.	.	.	.	.	.	.	C	7.873	0.728586	0.15507	.	.	ENSG00000204713	ENST00000414543	.	.	.	4.74	3.87	0.44632	.	.	.	.	.	T	0.50650	0.1628	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51450	-0.8704	4	.	.	.	.	11.5696	0.50826	0.0:0.9095:0.0:0.0905	.	.	.	.	R	55	.	.	G	-	1	0	TRIM27	28980408	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.986000	0.40677	1.310000	0.45006	0.650000	0.86243	GGA		0.557	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950		7	39	0	0	0	0.001984	0	7	39				
OR14J1	442191	broad.mit.edu	37	6	29274893	29274893	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:29274893G>T	ENST00000377160.2	+	1	491	c.427G>T	c.(427-429)Gtg>Ttg	p.V143L		NM_030946.1	NP_112208.1	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 14, subfamily J, member 1	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(2)	17						TAGGCATGCAGTGATAGCTGT	0.488																																							uc011dln.1		NA																	0				ovary(1)	1						c.(427-429)GTG>TTG		olfactory receptor, family 5, subfamily U member							149.0	149.0	149.0					6																	29274893		1511	2709	4220	SO:0001583	missense	442191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29274893G>T		CCDS34362.1	6p21.3	2012-08-09	2008-04-02	2008-04-02	ENSG00000204695	ENSG00000204695		"""GPCR / Class A : Olfactory receptors"""	13971	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily U, member 1"""	OR5U1			Standard	NM_030946		Approved	hs6M1-28	uc011dln.2	Q9UGF5	OTTHUMG00000031184	ENST00000377160.2:c.427G>T	6.37:g.29274893G>T	ENSP00000366365:p.Val143Leu		Somatic					p.V143L	NM_030946	NP_112208	WXS	Illumina HiSeq	Unspecified	Q9UGF5	O14J1_HUMAN			1	427	+			143			Helical; Name=4; (Potential).		A2BEC2|B0V078|Q5ST27	Missense_Mutation	SNP	ENST00000377160.2	37	c.427G>T	CCDS34362.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713132	0.48517	.	.	ENSG00000204695	ENST00000377160	T	0.36878	1.23	4.86	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.170957	0.27202	N	0.020446	T	0.11367	0.0277	L	0.35414	1.06	0.09310	N	1	B	0.27380	0.177	B	0.31614	0.133	T	0.14615	-1.0466	10	0.56958	D	0.05	.	5.6022	0.17359	0.0762:0.1393:0.6404:0.1441	.	143	Q9UGF5	O14J1_HUMAN	L	143	ENSP00000366365:V143L	ENSP00000366365:V143L	V	+	1	0	OR14J1	29382872	0.000000	0.05858	0.007000	0.13788	0.630000	0.37929	0.629000	0.24538	0.745000	0.32763	0.650000	0.86243	GTG		0.488	OR14J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076362.2			100	105	1	0	1.7666e-45	0.00361	3.381e-45	100	105				
PPP1R18	170954	broad.mit.edu	37	6	30653751	30653751	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:30653751G>T	ENST00000274853.3	-	1	1921	c.45C>A	c.(43-45)cgC>cgA	p.R15R	NRM_ENST00000470733.1_5'Flank|PPP1R18_ENST00000399199.3_Silent_p.R15R|PPP1R18_ENST00000488324.1_Intron	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	15						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CCTCCTGCCGGCGCCGGGCTA	0.662																																							uc003nra.2		NA																	0					0						c.(43-45)CGC>CGA		phostensin							105.0	129.0	121.0					6																	30653751		1240	2453	3693	SO:0001819	synonymous_variant	170954					cytoplasm|cytoskeleton	actin binding	g.chr6:30653751G>T	AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.45C>A	6.37:g.30653751G>T			Somatic				KIAA1949_uc003nrb.3_Silent_p.R15R	p.R15R	NM_001134870	NP_001128342	WXS	Illumina HiSeq	Unspecified	Q6NYC8	PHTNS_HUMAN			2	276	-			15					A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Silent	SNP	ENST00000274853.3	37	c.45C>A	CCDS43444.1																																																																																				0.662	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076498.2	NM_133471		45	186	1	0	2.0833e-19	0.00361	3.70232e-19	45	186				
PRRC2A	7916	broad.mit.edu	37	6	31600360	31600360	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:31600360G>T	ENST00000376033.2	+	16	4144	c.3910G>T	c.(3910-3912)Gcc>Tcc	p.A1304S	PRRC2A_ENST00000376007.4_Missense_Mutation_p.A1304S	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1304	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCGGGCAGCTGCCAAGTCTCC	0.607																																							uc003nvb.3		NA																	0					0						c.(3910-3912)GCC>TCC		HLA-B associated transcript-2							80.0	86.0	84.0					6																	31600360		1511	2709	4220	SO:0001583	missense	7916					cytoplasm|nucleus	protein binding	g.chr6:31600360G>T	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3910G>T	6.37:g.31600360G>T	ENSP00000365201:p.Ala1304Ser		Somatic				BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.A1304S	p.A1304S	NM_080686	NP_542417	WXS	Illumina HiSeq	Unspecified	P48634	PRC2A_HUMAN			16	4159	+			1304			4 X 57 AA type A repeats.		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	c.3910G>T	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632805	0.29068	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01538	4.79;4.79	5.08	5.08	0.68730	.	0.000000	0.53938	D	0.000044	T	0.02047	0.0064	N	0.19112	0.55	0.37763	D	0.926396	D	0.62365	0.991	P	0.58820	0.846	T	0.65076	-0.6256	10	0.87932	D	0	-13.7418	15.5008	0.75698	0.0:0.0:1.0:0.0	.	1304	P48634	PRC2A_HUMAN	S	1298;1287;1304;1304;529	ENSP00000365175:A1304S;ENSP00000365201:A1304S	ENSP00000365175:A1304S	A	+	1	0	PRRC2A	31708339	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	5.566000	0.67372	2.626000	0.88956	0.561000	0.74099	GCC		0.607	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686		23	127	1	0	2.32416e-17	0.002299	3.9715e-17	23	127				
NOTCH4	4855	broad.mit.edu	37	6	32180263	32180263	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:32180263C>A	ENST00000375023.3	-	17	2806	c.2668G>T	c.(2668-2670)Gca>Tca	p.A890S	NOTCH4_ENST00000465528.1_5'UTR	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	890	EGF-like 23. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGGCTCAGTGCAGCCTTCTGG	0.587																																							uc003obb.2		NA																	0				lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(2668-2670)GCA>TCA		notch4 preproprotein							114.0	110.0	112.0					6																	32180263		1508	2708	4216	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32180263C>A		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2668G>T	6.37:g.32180263C>A	ENSP00000364163:p.Ala890Ser		Somatic				NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.A890S	NM_004557	NP_004548	WXS	Illumina HiSeq	Unspecified	Q99466	NOTC4_HUMAN			17	2807	-			890			EGF-like 23.|Extracellular (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.2668G>T	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040333	0.75732	.	.	ENSG00000204301	ENST00000375023	D	0.88509	-2.39	4.49	4.49	0.54785	Epidermal growth factor-like (1);	0.000000	0.42420	D	0.000706	D	0.89543	0.6745	L	0.38175	1.15	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.90601	0.4544	10	0.62326	D	0.03	.	15.048	0.71841	0.0:1.0:0.0:0.0	.	890	Q99466	NOTC4_HUMAN	S	890	ENSP00000364163:A890S	ENSP00000364163:A890S	A	-	1	0	NOTCH4	32288241	1.000000	0.71417	0.990000	0.47175	0.658000	0.38924	5.644000	0.67902	2.492000	0.84095	0.561000	0.74099	GCA		0.587	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			109	76	1	0	4.44732e-65	0.00361	8.53776e-65	109	76				
TAP1	6890	broad.mit.edu	37	6	32816584	32816584	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:32816584C>A	ENST00000354258.4	-	7	1752	c.1591G>T	c.(1591-1593)Gct>Tct	p.A531S	TAP1_ENST00000425148.2_Missense_Mutation_p.A270S|TAPSAR1_ENST00000453426.1_lincRNA|PSMB9_ENST00000395330.1_Intron	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	531	Involved in peptide-binding site.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GAGCCCACAGCCTTCTGTACT	0.527																																							uc003ocg.2		NA																	0				skin(1)	1						c.(1591-1593)GCT>TCT		transporter 1, ATP-binding cassette, sub-family							99.0	100.0	100.0					6																	32816584		2203	4300	6503	SO:0001583	missense	6890				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding	g.chr6:32816584C>A		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.1591G>T	6.37:g.32816584C>A	ENSP00000346206:p.Ala531Ser		Somatic				TAP1_uc011dqi.1_Missense_Mutation_p.A270S	p.A531S	NM_000593	NP_000584	WXS	Illumina HiSeq	Unspecified	Q03518	TAP1_HUMAN			7	1746	-			531			Involved in peptide-binding site.|Cytoplasmic (Potential).		Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	37	c.1591G>T	CCDS4758.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331765	0.60853	.	.	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.83163	-1.69;-1.69	5.02	3.2	0.36748	ABC transporter, transmembrane domain, type 1 (1);	1.304240	0.05526	N	0.563099	T	0.75895	0.3912	L	0.42008	1.315	0.54753	D	0.999982	P	0.46621	0.881	P	0.49665	0.618	T	0.67201	-0.5730	10	0.28530	T	0.3	-11.0708	12.047	0.53485	0.3119:0.6881:0.0:0.0	.	531	Q03518	TAP1_HUMAN	S	531;270	ENSP00000346206:A531S;ENSP00000401919:A270S	ENSP00000346206:A531S	A	-	1	0	TAP1	32924562	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.904000	0.63279	0.667000	0.31107	0.643000	0.83706	GCT		0.527	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593		43	42	1	0	1.97e-11	0.010771	2.97413e-11	43	42				
COL11A2	1302	broad.mit.edu	37	6	33151934	33151934	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:33151934G>T	ENST00000341947.2	-	8	1334	c.1107C>A	c.(1105-1107)gcC>gcA	p.A369A	COL11A2_ENST00000361917.1_Intron|COL11A2_ENST00000357486.1_Silent_p.A348A|COL11A2_ENST00000395197.1_Intron|COL11A2_ENST00000374714.1_Silent_p.A343A|COL11A2_ENST00000374713.1_Silent_p.A322A|COL11A2_ENST00000374708.4_Intron|COL11A2_ENST00000374712.1_Intron	NM_080680.2	NP_542411.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	369	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CTCCTGAGTGGGCTGTCTCCG	0.532																																					Melanoma(1;90 116 3946 5341 17093)	Melanoma(1;90 116 3946 5341 17093)	uc003ocx.1		NA																	0				ovary(3)|skin(2)	5						c.(1105-1107)GCC>GCA		collagen, type XI, alpha 2 isoform 1							61.0	57.0	58.0					6																	33151934		2203	4300	6503	SO:0001819	synonymous_variant	1302				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging	g.chr6:33151934G>T	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000341947.2:c.1107C>A	6.37:g.33151934G>T			Somatic				COL11A2_uc003ocy.1_Intron|COL11A2_uc003ocz.1_Intron	p.A369A	NM_080680	NP_542411	WXS	Illumina HiSeq	Unspecified	P13942	COBA2_HUMAN			8	1335	-			369			Nonhelical region.		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000341947.2	37	c.1107C>A																																																																																					0.532	COL11A2-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				6	119	1	0	0.00116845	0.001168	0.0012886	6	119				
KCNK16	83795	broad.mit.edu	37	6	39282878	39282878	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:39282878G>T	ENST00000373229.5	-	6	843	c.830C>A	c.(829-831)gCg>gAg	p.A277E	KCNK17_ENST00000453413.2_5'Flank|KCNK16_ENST00000373227.4_Missense_Mutation_p.A230E|KCNK16_ENST00000507712.1_Missense_Mutation_p.A165E|KCNK17_ENST00000373231.4_5'Flank|KCNK16_ENST00000425054.2_3'UTR	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	277					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						GCCTGGAGCCGCCTTGGCTCC	0.572																																							uc003ooq.2		NA																	0				ovary(2)|skin(1)	3						c.(829-831)GCG>GAG		potassium channel, subfamily K, member 16							106.0	104.0	105.0					6																	39282878		2203	4300	6503	SO:0001583	missense	83795					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr6:39282878G>T	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.830C>A	6.37:g.39282878G>T	ENSP00000362326:p.Ala277Glu		Somatic				KCNK17_uc003ooo.2_5'Flank|KCNK17_uc003oop.2_5'Flank|KCNK16_uc003oor.3_3'UTR|KCNK16_uc010jwy.2_Missense_Mutation_p.A230E	p.A277E	NM_032115	NP_115491	WXS	Illumina HiSeq	Unspecified	Q96T55	KCNKG_HUMAN			6	844	-			277			Cytoplasmic (Potential).		B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	c.830C>A	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.819277	0.00595	.	.	ENSG00000095981	ENST00000373229;ENST00000507712;ENST00000373227	T;T;T	0.16457	2.49;2.34;2.93	3.28	-0.489	0.12052	.	450.126000	0.00166	U	0.000000	T	0.01189	0.0039	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27020	-1.0086	10	0.02654	T	1	.	3.2418	0.06783	0.0:0.2433:0.219:0.5377	.	230;277	Q96T55-5;Q96T55	.;KCNKG_HUMAN	E	277;165;230	ENSP00000362326:A277E;ENSP00000423842:A165E;ENSP00000362324:A230E	ENSP00000362324:A230E	A	-	2	0	KCNK16	39390856	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.786000	0.04623	-0.085000	0.12573	-0.520000	0.04383	GCG		0.572	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115		31	127	1	0	2.47316e-13	0.003271	3.93428e-13	31	127				
CRIP3	401262	broad.mit.edu	37	6	43275482	43275482	+	Splice_Site	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:43275482C>A	ENST00000274990.4	-	4	201		c.e4-1		CRIP3_ENST00000372569.3_Splice_Site|ZNF318_ENST00000607252.1_5'UTR			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3						T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			ATGTTCACCCCTGAAGAGAGA	0.612																																							uc010jyn.1		NA																	0				skin(1)	1						c.e4-1		cysteine-rich protein 3							39.0	42.0	41.0					6																	43275482		2203	4300	6503	SO:0001630	splice_region_variant	401262					cytoplasm	zinc ion binding	g.chr6:43275482C>A	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.197-1G>T	6.37:g.43275482C>A			Somatic				CRIP3_uc003ouu.1_Splice_Site_p.G66_splice	p.G66_splice	NM_206922	NP_996805	WXS	Illumina HiSeq	Unspecified	Q6Q6R5	CRIP3_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		4	197	-								A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Splice_Site	SNP	ENST00000274990.4	37	c.197_splice		.	.	.	.	.	.	.	.	.	.	C	20.3	3.962771	0.74016	.	.	ENSG00000146215	ENST00000416431;ENST00000372569;ENST00000274990	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2937	0.87164	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CRIP3	43383460	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.086000	0.57664	2.748000	0.94277	0.655000	0.94253	.		0.612	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		Intron	20	62	1	0	2.4624e-09	0.008871	3.48093e-09	20	62				
YIPF3	25844	broad.mit.edu	37	6	43480928	43480928	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:43480928G>T	ENST00000372422.2	-	6	727	c.545C>A	c.(544-546)aCc>aAc	p.T182N	LRRC73_ENST00000372441.1_5'Flank|YIPF3_ENST00000506469.1_Missense_Mutation_p.T188N	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	182					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GCCCATCAGGGTGCCCTCCCG	0.587																																							uc003ovl.1		NA																	0					0						c.(544-546)ACC>AAC		natural killer cell-specific antigen KLIP1							140.0	144.0	143.0					6																	43480928		2203	4300	6503	SO:0001583	missense	25844				cell differentiation	integral to membrane|plasma membrane|transport vesicle		g.chr6:43480928G>T	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.545C>A	6.37:g.43480928G>T	ENSP00000361499:p.Thr182Asn		Somatic				C6orf154_uc003ovk.1_5'Flank|YIPF3_uc011dvk.1_Missense_Mutation_p.T147N|YIPF3_uc010jyr.1_Missense_Mutation_p.T188N|YIPF3_uc010jys.1_Missense_Mutation_p.T25N|YIPF3_uc003ovm.1_Missense_Mutation_p.T56N|YIPF3_uc010jyt.1_Missense_Mutation_p.T131N	p.T182N	NM_015388	NP_056203	WXS	Illumina HiSeq	Unspecified	Q9GZM5	YIPF3_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)		6	702	-	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		182					Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Missense_Mutation	SNP	ENST00000372422.2	37	c.545C>A	CCDS4899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.009739|4.009739	0.75046|0.75046	.|.	.|.	ENSG00000137207|ENSG00000137207	ENST00000500090|ENST00000372422;ENST00000504851;ENST00000506469	.|T;T	.|0.46819	.|0.86;0.86	5.62|5.62	4.7|4.7	0.59300|0.59300	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63343|0.63343	0.2503|0.2503	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.99;0.999;0.99	.|D;P;D;P	.|0.85130	.|0.997;0.836;0.991;0.836	T|T	0.67173|0.67173	-0.5737|-0.5737	5|10	.|0.87932	.|D	.|0	-35.2422|-35.2422	16.006|16.006	0.80362|0.80362	0.0:0.1345:0.8655:0.0|0.0:0.1345:0.8655:0.0	.|.	.|131;188;147;182	.|D6RED8;E7EQR8;Q5JTD5;Q9GZM5	.|.;.;.;YIPF3_HUMAN	T|N	120|182;131;188	.|ENSP00000361499:T182N;ENSP00000425494:T188N	.|ENSP00000361499:T182N	P|T	-|-	1|2	0|0	YIPF3|YIPF3	43588906|43588906	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.284000|9.284000	0.95882|0.95882	2.653000|2.653000	0.90120|0.90120	0.655000|0.655000	0.94253|0.94253	CCC|ACC		0.587	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388		44	135	1	0	6.21074e-16	0.011902	1.04126e-15	44	135				
PGK2	5232	broad.mit.edu	37	6	49754702	49754702	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:49754702G>T	ENST00000304801.3	-	1	351	c.199C>A	c.(199-201)Cct>Act	p.P67T		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	67					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					ACACCATCAGGCCGACCTAGA	0.483																																							uc003ozu.2		NA																	0				ovary(1)	1						c.(199-201)CCT>ACT		phosphoglycerate kinase 2							191.0	159.0	170.0					6																	49754702		2203	4300	6503	SO:0001583	missense	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754702G>T	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.199C>A	6.37:g.49754702G>T	ENSP00000305995:p.Pro67Thr		Somatic					p.P67T	NM_138733	NP_620061	WXS	Illumina HiSeq	Unspecified	P07205	PGK2_HUMAN			1	306	-	Lung NSC(77;0.0402)		67					B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	c.199C>A	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.762909	0.69763	.	.	ENSG00000170950	ENST00000304801	D	0.96459	-4.02	4.09	4.09	0.47781	Phosphoglycerate kinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.98786	4.33	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.98705	1.0702	10	0.87932	D	0	-16.3818	14.5839	0.68310	0.0:0.0:1.0:0.0	.	67	P07205	PGK2_HUMAN	T	67	ENSP00000305995:P67T	ENSP00000305995:P67T	P	-	1	0	PGK2	49862661	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	8.930000	0.92872	2.562000	0.86427	0.585000	0.79938	CCT		0.483	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			42	62	1	0	2.54651e-27	0.006999	4.71407e-27	42	62				
BEND6	221336	broad.mit.edu	37	6	56819367	56819367	+	5'Flank	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:56819367G>T	ENST00000370746.3	+	0	0				BEND6_ENST00000370748.3_5'Flank|BEND6_ENST00000370745.1_5'Flank|BEND6_ENST00000370750.2_5'Flank|DST_ENST00000370754.5_Missense_Mutation_p.L7I	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						AGCAAGACGAGGAAAGCCGCG	0.682																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(19-21)CTC>ATC		dystonin isoform 2							40.0	39.0	39.0					6																	56819367		1568	3582	5150	SO:0001631	upstream_gene_variant	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56819367G>T	AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914		6.37:g.56819367G>T	Exception_encountered		Somatic				BEND6_uc010kab.2_5'Flank|BEND6_uc003pdg.2_5'Flank	p.L7I	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		1	47	-	Lung NSC(77;0.103)		Error:Variant_position_missing_in_Q03001_after_alignment					Q4G0W8|Q8N662|Q96NS6	Missense_Mutation	SNP	ENST00000370746.3	37	c.19C>A	CCDS43476.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372796	0.61624	.	.	ENSG00000151914	ENST00000370754;ENST00000449297	T;D	0.96587	-1.32;-4.06	4.0	2.16	0.27623	.	.	.	.	.	D	0.96950	0.9004	.	.	.	.	.	.	D	0.63880	0.993	D	0.73708	0.981	D	0.96062	0.9039	7	0.87932	D	0	.	9.837	0.40975	0.1756:0.0:0.8244:0.0	.	7	E9PEB9	.	I	7	ENSP00000359790:L7I;ENSP00000393082:L7I	ENSP00000359790:L7I	L	-	1	0	DST	56927326	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.145000	0.42207	0.887000	0.36136	0.467000	0.42956	CTC		0.682	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041032.4	NM_152731		7	14	1	0	8.12818e-05	0.001984	9.34516e-05	7	14				
BEND6	221336	broad.mit.edu	37	6	56880084	56880084	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:56880084C>T	ENST00000370746.3	+	4	721	c.452C>T	c.(451-453)tCt>tTt	p.S151F	BEND6_ENST00000484701.1_3'UTR|BEND6_ENST00000545789.1_Missense_Mutation_p.S53F|BEND6_ENST00000370750.2_3'UTR	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	151					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						TGCAGTAATTCTAATTCTAAC	0.458																																							uc010kab.2		NA																	0					0						c.(451-453)TCT>TTT		BEN domain containing 6							132.0	129.0	130.0					6																	56880084		1904	4116	6020	SO:0001583	missense	221336							g.chr6:56880084C>T	AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	ENST00000370746.3:c.452C>T	6.37:g.56880084C>T	ENSP00000359782:p.Ser151Phe		Somatic				BEND6_uc003pdi.3_Missense_Mutation_p.S53F	p.S151F	NM_152731	NP_689944	WXS	Illumina HiSeq	Unspecified	Q5SZJ8	BEND6_HUMAN			4	1038	+			151					Q4G0W8|Q8N662|Q96NS6	Missense_Mutation	SNP	ENST00000370746.3	37	c.452C>T	CCDS43476.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960169	0.53400	.	.	ENSG00000151917	ENST00000322055;ENST00000370746;ENST00000545789	.	.	.	3.58	3.58	0.41010	.	0.000000	0.64402	D	0.000017	T	0.45895	0.1365	N	0.19112	0.55	0.38263	D	0.941925	D;D	0.61697	0.99;0.984	D;D	0.74348	0.962;0.983	T	0.53844	-0.8381	9	0.87932	D	0	-10.1659	11.1535	0.48473	0.0:1.0:0.0:0.0	.	151;53	Q5SZJ8;Q5SZJ8-3	BEND6_HUMAN;.	F	151;151;53	.	ENSP00000322773:S151F	S	+	2	0	BEND6	56988043	1.000000	0.71417	0.980000	0.43619	0.483000	0.33249	2.599000	0.46231	2.352000	0.79861	0.579000	0.79373	TCT		0.458	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041032.4	NM_152731		20	23	0	0	0	0.008871	0	20	23				
BAI3	577	broad.mit.edu	37	6	70071353	70071353	+	Silent	SNP	A	A	T	rs144565451	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:70071353A>T	ENST00000370598.1	+	29	5009	c.4188A>T	c.(4186-4188)gcA>gcT	p.A1396A	BAI3_ENST00000238918.8_Silent_p.A602A|BAI3_ENST00000546190.1_Silent_p.A360A	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1396					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ATGATAATGCAGGACTATCAA	0.403																																							uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(4186-4188)GCA>GCT		brain-specific angiogenesis inhibitor 3							99.0	105.0	103.0					6																	70071353		2202	4299	6501	SO:0001819	synonymous_variant	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:70071353A>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4188A>T	6.37:g.70071353A>T			Somatic				BAI3_uc010kak.2_Silent_p.A1396A|BAI3_uc011dxx.1_Silent_p.A602A	p.A1396A	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			29	4636	+		all_lung(197;0.212)	1396			Cytoplasmic (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	37	c.4188A>T	CCDS4968.1																																																																																				0.403	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			19	34	0	0	0	0.008871	0	19	34				
RIMS1	22999	broad.mit.edu	37	6	73102455	73102455	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:73102455G>T	ENST00000521978.1	+	31	4561	c.4561G>T	c.(4561-4563)Gat>Tat	p.D1521Y	RIMS1_ENST00000264839.7_Missense_Mutation_p.D1370Y|RIMS1_ENST00000348717.5_Missense_Mutation_p.D1304Y|RIMS1_ENST00000517960.1_Missense_Mutation_p.D1304Y|RIMS1_ENST00000517827.1_Missense_Mutation_p.D655Y|RIMS1_ENST00000401910.3_Missense_Mutation_p.D841Y|RIMS1_ENST00000523963.1_Missense_Mutation_p.D646Y|RIMS1_ENST00000425662.2_Missense_Mutation_p.D589Y|RIMS1_ENST00000520567.1_Missense_Mutation_p.D1171Y|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000522291.1_Missense_Mutation_p.D1120Y|RIMS1_ENST00000518273.1_Missense_Mutation_p.D1200Y|RIMS1_ENST00000414192.2_Missense_Mutation_p.D48Y|RIMS1_ENST00000491071.2_Missense_Mutation_p.D1344Y|RIMS1_ENST00000538414.1_Missense_Mutation_p.D327Y	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1521					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGATTTTCTTGATGGATTGGG	0.408																																							uc003pga.2		NA																	0				ovary(7)|pancreas(2)|breast(1)	10						c.(4561-4563)GAT>TAT		regulating synaptic membrane exocytosis 1							99.0	93.0	95.0					6																	73102455		1849	4101	5950	SO:0001583	missense	22999				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr6:73102455G>T	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4561G>T	6.37:g.73102455G>T	ENSP00000428417:p.Asp1521Tyr		Somatic				RIMS1_uc011dyb.1_Missense_Mutation_p.D918Y|RIMS1_uc003pgc.2_Missense_Mutation_p.D970Y|RIMS1_uc010kaq.2_Missense_Mutation_p.D841Y|RIMS1_uc011dyc.1_Missense_Mutation_p.D646Y|RIMS1_uc010kar.2_Missense_Mutation_p.D589Y|RIMS1_uc011dyd.1_Missense_Mutation_p.D655Y|RIMS1_uc003pgf.2_Missense_Mutation_p.D521Y|RIMS1_uc003pgg.2_Missense_Mutation_p.D417Y|RIMS1_uc003pgi.2_Missense_Mutation_p.D337Y|RIMS1_uc003pgh.2_Missense_Mutation_p.D388Y|RIMS1_uc003pgd.2_Missense_Mutation_p.D587Y|RIMS1_uc003pge.2_Missense_Mutation_p.D561Y|RIMS1_uc011dye.1_Missense_Mutation_p.D327Y|RIMS1_uc011dyf.1_Missense_Mutation_p.D145Y|RIMS1_uc011dyg.1_Missense_Mutation_p.D48Y	p.D1521Y	NM_014989	NP_055804	WXS	Illumina HiSeq	Unspecified	Q86UR5	RIMS1_HUMAN			31	4638	+		all_epithelial(107;0.179)|all_hematologic(105;0.212)	1521					A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	c.4561G>T	CCDS47449.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	28.3|28.3|28.3	4.907417|4.907417|4.907417	0.92107|0.92107|0.92107	.|.|.	.|.|.	ENSG00000079841|ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192|ENST00000522211|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|T|.	0.24538|0.23950|.	1.85;2.4;2.32;2.41;2.48;2.5;2.49;2.29;2.35;2.48;2.45;1.97;2.45;1.96;2.02;2.12|1.88|.	5.5|5.5|5.5	5.5|5.5|5.5	0.81552|0.81552|0.81552	.|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000003|.|.	T|T|.	0.73791|0.73791|.	0.3632|0.3632|.	M|M|M	0.79258|0.79258|0.79258	2.445|2.445|2.445	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D;D;D;D;D;D;D;D;D;D|.|.	0.89917|.|.	0.999;0.999;0.999;0.969;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0|.|.	D;D;D;D;D;D;D;D;D;D;D;D;D|.|.	0.91635|.|.	0.971;0.976;0.984;0.963;0.999;0.998;0.998;0.971;0.992;0.999;0.996;0.999;0.996|.|.	T|T|.	0.73861|0.73861|.	-0.3849|-0.3849|.	10|7|.	0.87932|0.54805|.	D|T|.	0|0.06|.	-19.6998|-19.6998|-19.6998	19.3783|19.3783|19.3783	0.94521|0.94521|0.94521	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	145;327;655;646;1370;841;1120;424;1200;1304;597;1344;1521|.|.	B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.|.	.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.|.	Y|F|L	1344;1370;1344;1304;1200;1120;1370;1304;1200;1171;1120;1521;841;646;589;686;655;569;327;48|438|866	ENSP00000430101:D1344Y;ENSP00000275037:D1304Y;ENSP00000264839:D1370Y;ENSP00000429959:D1304Y;ENSP00000430408:D1200Y;ENSP00000430502:D1171Y;ENSP00000430932:D1120Y;ENSP00000428417:D1521Y;ENSP00000385649:D841Y;ENSP00000428328:D646Y;ENSP00000411235:D589Y;ENSP00000389503:D686Y;ENSP00000428367:D655Y;ENSP00000359448:D569Y;ENSP00000439730:D327Y;ENSP00000402273:D48Y|ENSP00000429338:L438F|.	ENSP00000264839:D1370Y|ENSP00000429338:L438F|.	D|L|X	+|+|+	1|3|2	0|2|2	RIMS1|RIMS1|RIMS1	73159176|73159176|73159176	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.990000|0.990000|0.990000	0.78478|0.78478|0.78478	9.869000|9.869000|9.869000	0.99810|0.99810|0.99810	2.582000|2.582000|2.582000	0.87167|0.87167|0.87167	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GAT|TTG|TGA		0.408	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			19	43	1	0	2.89027e-11	0.002299	4.31114e-11	19	43				
CNR1	1268	broad.mit.edu	37	6	88853946	88853946	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:88853946C>G	ENST00000537554.1	-	2	4610	c.1048G>C	c.(1048-1050)Gtg>Ctg	p.V350L	CNR1_ENST00000369501.2_Missense_Mutation_p.V350L|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000549890.1_Missense_Mutation_p.V350L|CNR1_ENST00000535130.1_Missense_Mutation_p.V350L|CNR1_ENST00000468898.1_Missense_Mutation_p.V317L|CNR1_ENST00000549716.1_Missense_Mutation_p.V289L|CNR1_ENST00000369499.2_Missense_Mutation_p.V350L|CNR1_ENST00000428600.2_Missense_Mutation_p.V350L	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	350					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	ATCAACACCACCAGGATCAGG	0.522																																							uc011dzq.1		NA																	0		p.V350V(1)		skin(2)	2						c.(1048-1050)GTG>CTG		cannabinoid receptor 1 isoform a	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)						152.0	161.0	158.0					6																	88853946		2203	4300	6503	SO:0001583	missense	1268				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding	g.chr6:88853946C>G	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1048G>C	6.37:g.88853946C>G	ENSP00000441046:p.Val350Leu		Somatic				CNR1_uc010kbz.2_Missense_Mutation_p.V350L|CNR1_uc011dzr.1_Missense_Mutation_p.V350L|CNR1_uc011dzs.1_Missense_Mutation_p.V350L|CNR1_uc003pmq.3_Missense_Mutation_p.V350L|CNR1_uc011dzt.1_Missense_Mutation_p.V350L|CNR1_uc010kca.2_Missense_Mutation_p.V317L	p.V350L	NM_001160260	NP_001153732	WXS	Illumina HiSeq	Unspecified	P21554	CNR1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.15)	2	4611	-		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)	350			Helical; Name=6; (Potential).		B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	ENST00000537554.1	37	c.1048G>C	CCDS5015.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707776	0.48412	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	6.05	6.05	0.98169	GPCR, rhodopsin-like superfamily (1);	0.119129	0.56097	D	0.000026	T	0.23171	0.0560	L	0.28608	0.87	0.80722	D	1	P;B	0.44429	0.835;0.053	B;B	0.41271	0.352;0.032	T	0.01805	-1.1270	10	0.48119	T	0.1	.	20.6086	0.99469	0.0:1.0:0.0:0.0	.	317;350	P21554-3;P21554	.;CNR1_HUMAN	L	350;350;350;350;350;317;350;289	ENSP00000358513:V350L;ENSP00000442689:V350L;ENSP00000441046:V350L;ENSP00000358511:V350L;ENSP00000446819:V350L;ENSP00000420188:V317L;ENSP00000412192:V350L;ENSP00000449549:V289L	ENSP00000358511:V350L	V	-	1	0	CNR1	88910665	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.818000	0.86416	2.880000	0.98712	0.655000	0.94253	GTG		0.522	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2			5	120	0	0	0	0.001168	0	5	120				
CLVS2	134829	broad.mit.edu	37	6	123332140	123332140	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:123332140G>A	ENST00000275162.5	+	3	1735	c.400G>A	c.(400-402)Gtg>Atg	p.V134M	CLVS2_ENST00000368438.1_5'UTR	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	134	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						GTACACACTGGTGGATATTTT	0.363																																							uc003pzi.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(400-402)GTG>ATG		retinaldehyde binding protein 1-like 2							148.0	137.0	141.0					6																	123332140		2203	4299	6502	SO:0001583	missense	134829				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr6:123332140G>A	AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.400G>A	6.37:g.123332140G>A	ENSP00000275162:p.Val134Met		Somatic					p.V134M	NM_001010852	NP_001010852	WXS	Illumina HiSeq	Unspecified	Q5SYC1	CLVS2_HUMAN			3	1269	+			134			CRAL-TRIO.		B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Missense_Mutation	SNP	ENST00000275162.5	37	c.400G>A	CCDS34525.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076576	0.76415	.	.	ENSG00000146352	ENST00000275162	T	0.75477	-0.94	4.87	4.87	0.63330	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	T	0.72669	0.3489	L	0.42245	1.32	0.80722	D	1	P	0.44690	0.841	P	0.52514	0.701	T	0.74825	-0.3533	10	0.52906	T	0.07	-1.0527	18.1872	0.89796	0.0:0.0:1.0:0.0	.	134	Q5SYC1	CLVS2_HUMAN	M	134	ENSP00000275162:V134M	ENSP00000275162:V134M	V	+	1	0	CLVS2	123373839	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.578000	0.98200	2.519000	0.84933	0.585000	0.79938	GTG		0.363	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852		27	50	0	0	0	0.007291	0	27	50				
LAMA2	3908	broad.mit.edu	37	6	129762043	129762043	+	Silent	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:129762043A>G	ENST00000421865.2	+	43	6217	c.6168A>G	c.(6166-6168)acA>acG	p.T2056T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2056	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CACAGATTACAGAGCTCCACC	0.463																																							uc003qbn.2		NA																	0				ovary(8)|breast(1)|skin(1)	10						c.(6166-6168)ACA>ACG		laminin alpha 2 subunit isoform a precursor							117.0	104.0	109.0					6																	129762043		2203	4300	6503	SO:0001819	synonymous_variant	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129762043A>G	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6168A>G	6.37:g.129762043A>G			Somatic				LAMA2_uc003qbo.2_Silent_p.T2056T	p.T2056T	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	43	6273	+			2056			Domain II and I.|Potential.		Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	c.6168A>G	CCDS5138.1																																																																																				0.463	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			11	25	0	0	0	0.010729	0	11	25				
HIVEP2	3097	broad.mit.edu	37	6	143091866	143091866	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:143091866C>T	ENST00000367604.1	-	4	4649	c.4010G>A	c.(4009-4011)cGg>cAg	p.R1337Q	HIVEP2_ENST00000367603.2_Missense_Mutation_p.R1337Q|HIVEP2_ENST00000012134.2_Missense_Mutation_p.R1337Q			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1337Q(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CGTCTGGATCCGAACAGGAAC	0.488																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	Esophageal Squamous(107;843 1510 13293 16805 42198)	uc003qjd.2		NA																	1	Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(4009-4011)CGG>CAG		human immunodeficiency virus type I enhancer							72.0	71.0	71.0					6																	143091866		1942	4151	6093	SO:0001583	missense	3097				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:143091866C>T	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4010G>A	6.37:g.143091866C>T	ENSP00000356576:p.Arg1337Gln		Somatic					p.R1337Q	NM_006734	NP_006725	WXS	Illumina HiSeq	Unspecified	P31629	ZEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)	5	4753	-			1337					Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	c.4010G>A	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788924	0.90367	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.05855	3.38;3.38;3.38	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.24736	0.0600	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01042	-1.1471	10	0.87932	D	0	-22.2042	20.6634	0.99662	0.0:1.0:0.0:0.0	.	1337	P31629	ZEP2_HUMAN	Q	1337	ENSP00000356576:R1337Q;ENSP00000356575:R1337Q;ENSP00000012134:R1337Q	ENSP00000012134:R1337Q	R	-	2	0	HIVEP2	143133559	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.818000	0.86416	2.894000	0.99253	0.655000	0.94253	CGG		0.488	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			15	66	0	0	0	0.00245	0	15	66				
GRM1	2911	broad.mit.edu	37	6	146351126	146351126	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:146351126G>A	ENST00000282753.1	+	1	708	c.473G>A	c.(472-474)gGa>gAa	p.G158E	GRM1_ENST00000507907.1_Missense_Mutation_p.G158E|GRM1_ENST00000392299.2_Missense_Mutation_p.G158E|GRM1_ENST00000355289.4_Missense_Mutation_p.G158E|GRM1_ENST00000492807.2_Missense_Mutation_p.G158E|GRM1_ENST00000361719.2_Missense_Mutation_p.G158E			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	158					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CCCATTGCGGGAGTGATCGGT	0.572																																							uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(472-474)GGA>GAA		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						69.0	73.0	72.0					6																	146351126		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146351126G>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.473G>A	6.37:g.146351126G>A	ENSP00000282753:p.Gly158Glu		Somatic				GRM1_uc010khu.1_Missense_Mutation_p.G158E|GRM1_uc010khv.1_Missense_Mutation_p.G158E|GRM1_uc003qll.2_Missense_Mutation_p.G158E|GRM1_uc011edz.1_Missense_Mutation_p.G158E|GRM1_uc011eea.1_Missense_Mutation_p.G158E	p.G158E	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	2	943	+		Ovarian(120;0.0387)	158			Extracellular (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.473G>A	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010506	0.75046	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.69	5.69	0.88448	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93858	0.8035	M	0.91972	3.26	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.79108	0.978;0.992;0.987;0.978	D	0.94463	0.7678	10	0.87932	D	0	.	19.8011	0.96507	0.0:0.0:1.0:0.0	.	158;158;153;158	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	E	158	ENSP00000354896:G158E;ENSP00000376119:G158E;ENSP00000424095:G158E;ENSP00000282753:G158E;ENSP00000347437:G158E;ENSP00000425599:G158E	ENSP00000282753:G158E	G	+	2	0	GRM1	146392819	1.000000	0.71417	0.428000	0.26697	0.536000	0.34869	9.869000	0.99810	2.679000	0.91253	0.561000	0.74099	GGA		0.572	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		4	81	0	0	0	0.009096	0	4	81				
GRM1	2911	broad.mit.edu	37	6	146719925	146719925	+	Missense_Mutation	SNP	C	C	T	rs146996893		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:146719925C>T	ENST00000282753.1	+	7	1985	c.1750C>T	c.(1750-1752)Cgc>Tgc	p.R584C	GRM1_ENST00000507907.1_Missense_Mutation_p.R584C|GRM1_ENST00000392299.2_Missense_Mutation_p.R584C|GRM1_ENST00000355289.4_Missense_Mutation_p.R584C|GRM1_ENST00000492807.2_Missense_Mutation_p.R584C|GRM1_ENST00000361719.2_Missense_Mutation_p.R584C			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	584					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CATTCCTGTGCGCTATCTTGA	0.423																																							uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(1750-1752)CGC>TGC		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	C	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	211.0	194.0	200.0		1750,1750	5.8	1.0	6	dbSNP_134	200	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GRM1	NM_000838.3,NM_001114329.1	180,180	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	584/1195,584/907	146719925	2,13004	2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146719925C>T	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1750C>T	6.37:g.146719925C>T	ENSP00000282753:p.Arg584Cys		Somatic				GRM1_uc010khv.1_Missense_Mutation_p.R584C|GRM1_uc003qll.2_Missense_Mutation_p.R584C|GRM1_uc011edz.1_Missense_Mutation_p.R584C|GRM1_uc011eea.1_Missense_Mutation_p.R584C	p.R584C	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	8	2220	+		Ovarian(120;0.0387)	584			Extracellular (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.1750C>T	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207795	0.58343	2.27E-4	1.16E-4	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.88201	-2.31;-2.35;-2.35;-2.31;-2.35;-2.35	5.81	5.81	0.92471	.	0.220594	0.45126	D	0.000394	D	0.86896	0.6043	L	0.51422	1.61	0.53005	D	0.999969	P;D;D	0.69078	0.951;0.997;0.987	P;P;P	0.51229	0.663;0.628;0.663	D	0.88561	0.3123	10	0.87932	D	0	.	13.0397	0.58891	0.2663:0.7337:0.0:0.0	.	584;584;584	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	C	584	ENSP00000354896:R584C;ENSP00000376119:R584C;ENSP00000424095:R584C;ENSP00000282753:R584C;ENSP00000347437:R584C;ENSP00000425599:R584C	ENSP00000282753:R584C	R	+	1	0	GRM1	146761618	0.999000	0.42202	0.997000	0.53966	0.955000	0.61496	4.081000	0.57627	2.761000	0.94854	0.585000	0.79938	CGC		0.423	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		7	174	0	0	0	0.001984	0	7	174				
PARK2	5071	broad.mit.edu	37	6	162683678	162683678	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:162683678C>A	ENST00000366898.1	-	3	393	c.291G>T	c.(289-291)cgG>cgT	p.R97R	PARK2_ENST00000338468.3_5'UTR|PARK2_ENST00000366897.1_Silent_p.R97R|PARK2_ENST00000366892.1_Silent_p.R97R|PARK2_ENST00000366894.1_Intron|PARK2_ENST00000366896.1_Intron	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	97					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TCTGGGGCTCCCGCTCACAGC	0.582																																							uc003qtx.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(289-291)CGG>CGT		parkin isoform 1							75.0	75.0	75.0					6																	162683678		2203	4300	6503	SO:0001819	synonymous_variant	5071				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr6:162683678C>A		CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.291G>T	6.37:g.162683678C>A			Somatic				PARK2_uc003qtv.3_RNA|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_5'UTR|PARK2_uc003qty.3_Silent_p.R97R|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Silent_p.R97R	p.R97R	NM_004562	NP_004553	WXS	Illumina HiSeq	Unspecified	O60260	PRKN2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)	3	425	-		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)	97					A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Silent	SNP	ENST00000366898.1	37	c.291G>T	CCDS5281.1																																																																																				0.582	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1			22	56	1	0	3.5997e-14	0.002299	5.81562e-14	22	56				
THBS2	7058	broad.mit.edu	37	6	169640673	169640673	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:169640673C>A	ENST00000366787.3	-	7	1155	c.906G>T	c.(904-906)caG>caT	p.Q302H	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	302					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCCAGAGAAACTGGTTATCAT	0.433																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	0				ovary(5)	5						c.(904-906)CAG>CAT		thrombospondin 2 precursor							81.0	78.0	79.0					6																	169640673		2203	4300	6503	SO:0001583	missense	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169640673C>A		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.906G>T	6.37:g.169640673C>A	ENSP00000355751:p.Gln302His		Somatic					p.Q302H	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	7	1154	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	302					A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	c.906G>T	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092881	0.56075	.	.	ENSG00000186340	ENST00000366787	T	0.80909	-1.43	5.29	4.3	0.51218	.	0.000000	0.39083	U	0.001469	T	0.66557	0.2801	M	0.65975	2.015	0.23845	N	0.99669	P	0.47910	0.902	P	0.44447	0.45	T	0.67197	-0.5731	10	0.66056	D	0.02	-30.5743	3.4055	0.07339	0.0:0.6258:0.0:0.3742	.	302	P35442	TSP2_HUMAN	H	302	ENSP00000355751:Q302H	ENSP00000355751:Q302H	Q	-	3	2	THBS2	169382598	0.968000	0.33430	1.000000	0.80357	0.928000	0.56348	0.867000	0.27968	2.469000	0.83416	0.561000	0.74099	CAG		0.433	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		7	32	1	0	0.00198382	0.001984	0.00216101	7	32				
CARD11	84433	broad.mit.edu	37	7	2976714	2976714	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:2976714C>G	ENST00000396946.4	-	9	1701	c.1298G>C	c.(1297-1299)aGc>aCc	p.S433T		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	433					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCGCAGCTTGCTCTCCAGGTT	0.642			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(1297-1299)AGC>ACC		caspase recruitment domain family, member 11							115.0	96.0	102.0					7																	2976714		2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2976714C>G	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1298G>C	7.37:g.2976714C>G	ENSP00000380150:p.Ser433Thr		Somatic					p.S433T	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	9	1702	-		Ovarian(82;0.0115)	433			Potential.		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.1298G>C	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736923	0.30774	.	.	ENSG00000198286	ENST00000396946	T	0.32753	1.44	5.22	4.34	0.51931	.	0.207319	0.50627	D	0.000111	T	0.17195	0.0413	N	0.20685	0.6	0.30455	N	0.774871	B	0.18310	0.027	B	0.19946	0.027	T	0.18903	-1.0322	10	0.13470	T	0.59	-32.6815	8.3189	0.32117	0.0:0.7608:0.1568:0.0825	.	433	Q9BXL7	CAR11_HUMAN	T	433	ENSP00000380150:S433T	ENSP00000380150:S433T	S	-	2	0	CARD11	2943240	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	3.564000	0.53791	1.207000	0.43291	0.561000	0.74099	AGC		0.642	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		21	47	0	0	0	0.002299	0	21	47				
RNF216	54476	broad.mit.edu	37	7	5760761	5760761	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:5760761T>A	ENST00000425013.2	-	9	1600	c.1376A>T	c.(1375-1377)aAg>aTg	p.K459M	RNF216_ENST00000389902.3_Missense_Mutation_p.K516M	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	459					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATGTCGTCGCTTATTTTCAAG	0.428																																							uc003soy.1		NA																	0				ovary(3)|breast(2)	5						c.(1375-1377)AAG>ATG		ring finger protein 216 isoform b							149.0	141.0	144.0					7																	5760761		2203	4300	6503	SO:0001583	missense	54476				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding	g.chr7:5760761T>A	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1376A>T	7.37:g.5760761T>A	ENSP00000404602:p.Lys459Met		Somatic				RNF216_uc010ksz.1_Missense_Mutation_p.K81M|RNF216_uc010kta.1_Missense_Mutation_p.K81M|RNF216_uc011jwj.1_Missense_Mutation_p.K81M|RNF216_uc003sox.1_Missense_Mutation_p.K516M	p.K459M	NM_207116	NP_996999	WXS	Illumina HiSeq	Unspecified	Q9NWF9	RN216_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)	9	1566	-		Ovarian(82;0.07)	459					Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	c.1376A>T	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560401	0.86335	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.30714	1.52;1.52	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.40862	0.1134	N	0.19112	0.55	0.49915	D	0.99983	D;D	0.89917	0.999;1.0	D;D	0.73708	0.965;0.981	T	0.39742	-0.9599	10	0.62326	D	0.03	-22.4989	14.9607	0.71156	0.0:0.0:0.0:1.0	.	459;516	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	M	459;516;271	ENSP00000404602:K459M;ENSP00000374552:K516M	ENSP00000374552:K516M	K	-	2	0	RNF216	5727287	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.334000	0.79224	2.140000	0.66376	0.397000	0.26171	AAG		0.428	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111		29	62	0	0	0	0.005443	0	29	62				
HDAC9	9734	broad.mit.edu	37	7	18688117	18688117	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:18688117C>T	ENST00000432645.2	+	10	1269	c.1269C>T	c.(1267-1269)ccC>ccT	p.P423P	HDAC9_ENST00000428307.2_Silent_p.P379P|HDAC9_ENST00000456174.2_Silent_p.P395P|HDAC9_ENST00000406451.4_Silent_p.P423P|HDAC9_ENST00000406072.1_Silent_p.P410P|HDAC9_ENST00000441542.2_Silent_p.P426P|HDAC9_ENST00000401921.1_Silent_p.P382P|HDAC9_ENST00000524023.1_Silent_p.P346P|HDAC9_ENST00000417496.2_Silent_p.P421P|HDAC9_ENST00000405010.3_Silent_p.P423P	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	423					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CTCAGTCTCCCTTGGCAACAA	0.453																																							uc003suh.2		NA																	0				lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1267-1269)CCC>CCT		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						76.0	75.0	76.0					7																	18688117		1888	4118	6006	SO:0001819	synonymous_variant	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18688117C>T	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1269C>T	7.37:g.18688117C>T			Somatic				HDAC9_uc003sue.2_Silent_p.P423P|HDAC9_uc011jyd.1_Silent_p.P423P|HDAC9_uc003sui.2_Silent_p.P426P|HDAC9_uc003suj.2_Silent_p.P382P|HDAC9_uc011jya.1_Silent_p.P420P|HDAC9_uc003sua.1_Silent_p.P401P|HDAC9_uc011jyb.1_Silent_p.P379P|HDAC9_uc003sud.1_Silent_p.P423P|HDAC9_uc011jyc.1_Silent_p.P382P|HDAC9_uc003suf.1_Silent_p.P454P|HDAC9_uc010kud.1_Silent_p.P426P|HDAC9_uc011jye.1_Silent_p.P395P|HDAC9_uc011jyf.1_Silent_p.P346P|HDAC9_uc010kue.1_Silent_p.P166P	p.P423P	NM_058176	NP_478056	WXS	Illumina HiSeq	Unspecified	Q9UKV0	HDAC9_HUMAN			10	1310	+	all_lung(11;0.187)		423					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	c.1269C>T	CCDS47555.1																																																																																				0.453	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			18	98	0	0	0	0.008871	0	18	98				
DNAH11	8701	broad.mit.edu	37	7	21784546	21784546	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:21784546G>C	ENST00000409508.3	+	51	8406	c.8375G>C	c.(8374-8376)aGa>aCa	p.R2792T	DNAH11_ENST00000328843.6_Missense_Mutation_p.R2799T	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2799					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTTGCTGATAGAGGGAAGGAC	0.443									Kartagener syndrome																														uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(8395-8397)AGA>ACA		dynein, axonemal, heavy chain 11							86.0	81.0	82.0					7																	21784546		1987	4167	6154	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21784546G>C	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8375G>C	7.37:g.21784546G>C	ENSP00000475939:p.Arg2792Thr		Somatic					p.R2799T	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			52	8427	+			2799					Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.8396G>C		.	.	.	.	.	.	.	.	.	.	G	8.911	0.958681	0.18507	.	.	ENSG00000105877	ENST00000328843	T	0.22134	1.97	5.4	5.4	0.78164	.	0.326457	0.32901	N	0.005510	T	0.17109	0.0411	.	.	.	0.09310	N	1	B	0.18610	0.029	B	0.20384	0.029	T	0.12016	-1.0564	9	0.21014	T	0.42	.	18.7841	0.91947	0.0:0.0:1.0:0.0	.	2799	Q96DT5	DYH11_HUMAN	T	2799	ENSP00000330671:R2799T	ENSP00000330671:R2799T	R	+	2	0	DNAH11	21751071	0.985000	0.35326	0.007000	0.13788	0.012000	0.07955	3.441000	0.52893	2.538000	0.85594	0.655000	0.94253	AGA		0.443	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		7	17	0	0	0	0.001984	0	7	17				
HOXA5	3202	broad.mit.edu	37	7	27182927	27182927	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:27182927C>A	ENST00000222726.3	-	1	360	c.300G>T	c.(298-300)ccG>ccT	p.P100P	HOXA5_ENST00000520854.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000521197.1_RNA	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	100					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						AGCAGGGCAGCGGATCGGGCT	0.751																																					Colon(119;75 2200 7557 42868)	Colon(119;75 2200 7557 42868)	uc003syn.1		NA																	0					0						c.(298-300)CCG>CCT		homeobox A5							12.0	14.0	13.0					7																	27182927		2153	4181	6334	SO:0001819	synonymous_variant	3202				negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27182927C>A		CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.300G>T	7.37:g.27182927C>A			Somatic					p.P100P	NM_019102	NP_061975	WXS	Illumina HiSeq	Unspecified	P20719	HXA5_HUMAN			1	361	-			100					A4D179|O43367|Q96CY6	Silent	SNP	ENST00000222726.3	37	c.300G>T	CCDS5406.1																																																																																				0.751	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1			10	21	1	0	7.48243e-07	0.006214	9.55661e-07	10	21				
GPR141	353345	broad.mit.edu	37	7	37780847	37780847	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:37780847C>T	ENST00000447769.1	+	4	1141	c.852C>T	c.(850-852)gtC>gtT	p.V284V	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.V284V			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTCTCTTTGTCTTTGGGGGAA	0.378																																							uc003tfm.1		NA																	0				ovary(3)	3						c.(850-852)GTC>GTT		G protein-coupled receptor 141							112.0	110.0	110.0					7																	37780847		2203	4300	6503	SO:0001819	synonymous_variant	353345					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr7:37780847C>T	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.852C>T	7.37:g.37780847C>T			Somatic				uc003tfl.2_Intron	p.V284V	NM_181791	NP_861456	WXS	Illumina HiSeq	Unspecified	Q7Z602	GP141_HUMAN			1	852	+			284			Helical; Name=7; (Potential).		A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	ENST00000447769.1	37	c.852C>T	CCDS5451.1																																																																																				0.378	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791		18	59	0	0	0	0.00499	0	18	59				
POU6F2	11281	broad.mit.edu	37	7	39247051	39247051	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:39247051C>A	ENST00000403058.1	+	5	497	c.343C>A	c.(343-345)Cca>Aca	p.P115T	POU6F2_ENST00000518318.2_Missense_Mutation_p.P115T|POU6F2_ENST00000517348.1_3'UTR|POU6F2_ENST00000559001.1_Missense_Mutation_p.P107T	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	115					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						GGGAGGCCCCCCAGCCCTCAA	0.577																																							uc003thb.1		NA																	0				central_nervous_system(1)	1						c.(343-345)CCA>ACA		POU class 6 homeobox 2 isoform 1							100.0	103.0	102.0					7																	39247051		2203	4300	6503	SO:0001583	missense	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39247051C>A	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.343C>A	7.37:g.39247051C>A	ENSP00000384004:p.Pro115Thr		Somatic				POU6F2_uc010kxo.2_Missense_Mutation_p.P107T	p.P115T	NM_007252	NP_009183	WXS	Illumina HiSeq	Unspecified	P78424	PO6F2_HUMAN			4	385	+			115					A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	c.343C>A	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	C	32	5.141561	0.94560	.	.	ENSG00000106536	ENST00000403058;ENST00000518318;ENST00000451021	D;D	0.86497	-1.99;-2.13	6.17	6.17	0.99709	.	1.318270	0.04737	N	0.422082	D	0.93278	0.7858	L	0.44542	1.39	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.84164	0.0430	10	0.48119	T	0.1	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	115;115	P78424-2;P78424	.;PO6F2_HUMAN	T	115;115;116	ENSP00000384004:P115T;ENSP00000430514:P115T	ENSP00000384004:P115T	P	+	1	0	POU6F2	39213576	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CCA		0.577	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		71	201	1	0	1.45978e-39	0.00361	2.75983e-39	71	201				
HECW1	23072	broad.mit.edu	37	7	43447293	43447293	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:43447293T>A	ENST00000395891.2	+	8	1369	c.764T>A	c.(763-765)aTc>aAc	p.I255N	HECW1_ENST00000453890.1_Missense_Mutation_p.I255N|HECW1_ENST00000471043.1_3'UTR	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	255	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AGATCCAAGATCATAGGCAAC	0.527																																							uc003tid.1		NA																	0				ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(763-765)ATC>AAC		NEDD4-like ubiquitin-protein ligase 1							63.0	63.0	63.0					7																	43447293		1954	4166	6120	SO:0001583	missense	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43447293T>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.764T>A	7.37:g.43447293T>A	ENSP00000379228:p.Ile255Asn		Somatic				HECW1_uc011kbi.1_Missense_Mutation_p.I255N|HECW1_uc003tie.1_Missense_Mutation_p.I287N	p.I255N	NM_015052	NP_055867	WXS	Illumina HiSeq	Unspecified	Q76N89	HECW1_HUMAN			8	1369	+			255			C2.		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	c.764T>A	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779651	0.90195	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.70749	-0.51;-0.51	5.35	5.35	0.76521	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.110120	0.64402	D	0.000005	T	0.81917	0.4924	M	0.65975	2.015	0.58432	D	0.999997	D;D;D	0.71674	0.995;0.998;0.996	D;D;D	0.66979	0.913;0.948;0.936	D	0.84259	0.0482	10	0.87932	D	0	.	15.3221	0.74129	0.0:0.0:0.0:1.0	.	255;287;255	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	N	255;255;254	ENSP00000379228:I255N;ENSP00000407774:I255N	ENSP00000265522:I254N	I	+	2	0	HECW1	43413818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.608000	0.82898	2.013000	0.59113	0.460000	0.39030	ATC		0.527	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		18	35	0	0	0	0.002299	0	18	35				
HECW1	23072	broad.mit.edu	37	7	43484732	43484732	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:43484732C>A	ENST00000395891.2	+	11	2566	c.1961C>A	c.(1960-1962)aCc>aAc	p.T654N	HECW1_ENST00000453890.1_Missense_Mutation_p.T654N	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	654					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CACCCCAGCACCGGGAGCGAG	0.721																																							uc003tid.1		NA																	0				ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(1960-1962)ACC>AAC		NEDD4-like ubiquitin-protein ligase 1							17.0	23.0	21.0					7																	43484732		2138	4223	6361	SO:0001583	missense	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43484732C>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1961C>A	7.37:g.43484732C>A	ENSP00000379228:p.Thr654Asn		Somatic				HECW1_uc011kbi.1_Missense_Mutation_p.T654N	p.T654N	NM_015052	NP_055867	WXS	Illumina HiSeq	Unspecified	Q76N89	HECW1_HUMAN			11	2566	+			654					A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	c.1961C>A	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902686	0.52227	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.32988	1.43;1.46	4.63	4.63	0.57726	.	1.069000	0.07317	U	0.876967	T	0.41236	0.1150	L	0.55481	1.735	0.40166	D	0.977126	P;P	0.50443	0.935;0.93	P;B	0.45829	0.494;0.36	T	0.41034	-0.9531	10	0.44086	T	0.13	.	17.4805	0.87672	0.0:1.0:0.0:0.0	.	654;654	B4DH42;Q76N89	.;HECW1_HUMAN	N	654	ENSP00000379228:T654N;ENSP00000407774:T654N	ENSP00000265522:T654N	T	+	2	0	HECW1	43451257	0.981000	0.34729	0.926000	0.36857	0.567000	0.35839	2.779000	0.47734	2.109000	0.64355	0.563000	0.77884	ACC		0.721	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		20	30	1	0	4.96729e-08	0.008871	6.65874e-08	20	30				
NPC1L1	29881	broad.mit.edu	37	7	44560608	44560608	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:44560608G>A	ENST00000289547.4	-	13	3118	c.3063C>T	c.(3061-3063)aaC>aaT	p.N1021N	NPC1L1_ENST00000546276.1_Silent_p.N975N|NPC1L1_ENST00000381160.3_Silent_p.N1021N	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1021					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GACATTTGATGTTGGGCCGGT	0.552																																							uc003tlb.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(3061-3063)AAC>AAT		Niemann-Pick C1-like protein 1 isoform 1	Ezetimibe(DB00973)						156.0	162.0	160.0					7																	44560608		2203	4300	6503	SO:0001819	synonymous_variant	29881				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding	g.chr7:44560608G>A		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3063C>T	7.37:g.44560608G>A			Somatic				NPC1L1_uc003tlc.2_Silent_p.N1021N|NPC1L1_uc011kbw.1_Silent_p.N975N|NPC1L1_uc003tla.2_Silent_p.N24N	p.N1021N	NM_013389	NP_037521	WXS	Illumina HiSeq	Unspecified	Q9UHC9	NPCL1_HUMAN			13	3119	-			1021			Cytoplasmic (Potential).		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	c.3063C>T	CCDS5491.1																																																																																				0.552	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		68	183	0	0	0	0.00361	0	68	183				
ADCY1	107	broad.mit.edu	37	7	45650033	45650033	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:45650033A>G	ENST00000297323.7	+	3	867	c.845A>G	c.(844-846)gAc>gGc	p.D282G	ADCY1_ENST00000432715.1_Missense_Mutation_p.D57G	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	282					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATGAAGGAGGACTTCCTGAAG	0.612																																							uc003tne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(844-846)GAC>GGC		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						88.0	91.0	90.0					7																	45650033		2203	4300	6503	SO:0001583	missense	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45650033A>G	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.845A>G	7.37:g.45650033A>G	ENSP00000297323:p.Asp282Gly		Somatic				ADCY1_uc003tnd.2_Missense_Mutation_p.D57G	p.D282G	NM_021116	NP_066939	WXS	Illumina HiSeq	Unspecified	Q08828	ADCY1_HUMAN			3	863	+			282			Cytoplasmic (Potential).		A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	c.845A>G	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	a	17.25	3.342940	0.61073	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;T	0.81499	-1.5;-1.44	4.88	4.88	0.63580	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.125201	0.52532	N	0.000068	T	0.81009	0.4734	M	0.81239	2.535	0.58432	D	0.999999	B;B	0.21452	0.012;0.056	B;B	0.19666	0.01;0.026	T	0.80381	-0.1406	10	0.72032	D	0.01	.	12.4522	0.55682	1.0:0.0:0.0:0.0	.	282;57	Q08828;C9J1J0	ADCY1_HUMAN;.	G	57;282;282	ENSP00000392721:D57G;ENSP00000297323:D282G	ENSP00000297323:D282G	D	+	2	0	ADCY1	45616558	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.433000	0.90291	1.814000	0.52955	0.409000	0.27619	GAC		0.612	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		43	117	0	0	0	0.00361	0	43	117				
ZPBP	11055	broad.mit.edu	37	7	50023026	50023026	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:50023026T>C	ENST00000046087.2	-	7	942	c.873A>G	c.(871-873)gaA>gaG	p.E291E	ZPBP_ENST00000491129.1_5'UTR|ZPBP_ENST00000419417.1_Silent_p.E290E	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	291					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					GGAGAGTACCTTCAATATAGT	0.353																																							uc003tou.2		NA																	0					0						c.(871-873)GAA>GAG		zona pellucida binding protein isoform 1							79.0	77.0	78.0					7																	50023026		2203	4300	6503	SO:0001819	synonymous_variant	11055				binding of sperm to zona pellucida	extracellular region		g.chr7:50023026T>C	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.873A>G	7.37:g.50023026T>C			Somatic				ZPBP_uc011kci.1_Silent_p.E217E|ZPBP_uc010kyw.2_Silent_p.E290E	p.E291E	NM_007009	NP_008940	WXS	Illumina HiSeq	Unspecified	Q9BS86	ZPBP1_HUMAN			7	943	-	Glioma(55;0.08)|all_neural(89;0.245)		291					A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Silent	SNP	ENST00000046087.2	37	c.873A>G	CCDS5509.1																																																																																				0.353	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009		11	26	0	0	0	0.010729	0	11	26				
AUTS2	26053	broad.mit.edu	37	7	70255379	70255379	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:70255379G>T	ENST00000342771.4	+	19	3498	c.3177G>T	c.(3175-3177)gaG>gaT	p.E1059D	AUTS2_ENST00000406775.2_Missense_Mutation_p.E1035D	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1059										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGGGCGGAGAGCGCTTCCCGT	0.632																																							uc003tvw.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3175-3177)GAG>GAT		autism susceptibility candidate 2 isoform 1							27.0	31.0	30.0					7																	70255379		2203	4300	6503	SO:0001583	missense	26053							g.chr7:70255379G>T	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3177G>T	7.37:g.70255379G>T	ENSP00000344087:p.Glu1059Asp		Somatic				AUTS2_uc003tvx.3_Missense_Mutation_p.E1035D|AUTS2_uc011keg.1_Missense_Mutation_p.E511D	p.E1059D	NM_015570	NP_056385	WXS	Illumina HiSeq	Unspecified	Q8WXX7	AUTS2_HUMAN		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)	19	3920	+		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)	1059					A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	c.3177G>T	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	g	12.28	1.889250	0.33348	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.39229	1.09;1.12	4.79	1.89	0.25635	.	0.153741	0.56097	D	0.000023	T	0.26412	0.0645	L	0.38175	1.15	0.80722	D	1	B;B;B	0.27625	0.009;0.034;0.183	B;B;B	0.26416	0.013;0.023;0.069	T	0.04178	-1.0971	9	.	.	.	-16.7488	4.954	0.14029	0.3081:0.0:0.5497:0.1422	.	511;1035;1059	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	D	1035;1059	ENSP00000385263:E1035D;ENSP00000344087:E1059D	.	E	+	3	2	AUTS2	69893315	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	1.395000	0.34520	0.425000	0.26087	0.651000	0.88453	GAG		0.632	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			7	27	1	0	5.18039e-06	0.00308	6.35543e-06	7	27				
ABCB1	5243	broad.mit.edu	37	7	87160794	87160794	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:87160794G>A	ENST00000265724.3	-	22	2918	c.2501C>T	c.(2500-2502)gCt>gTt	p.A834V	ABCB1_ENST00000543898.1_Missense_Mutation_p.A770V|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	834	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GGTAATTACAGCAAGCCTGGA	0.343																																							uc003uiz.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(2500-2502)GCT>GTT		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						78.0	78.0	78.0					7																	87160794		2203	4300	6503	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87160794G>A	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2501C>T	7.37:g.87160794G>A	ENSP00000265724:p.Ala834Val		Somatic				ABCB1_uc011khc.1_Missense_Mutation_p.A770V	p.A834V	NM_000927	NP_000918	WXS	Illumina HiSeq	Unspecified	P08183	MDR1_HUMAN			22	2919	-	Esophageal squamous(14;0.00164)		834			Helical; (Potential).|ABC transmembrane type-1 2.		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.2501C>T	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.823364	0.90873	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.88975	-2.45;-2.45	5.43	5.43	0.79202	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.050533	0.85682	D	0.000000	D	0.95604	0.8571	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.968;1.0	D	0.95911	0.8923	10	0.87932	D	0	-10.9052	19.5966	0.95541	0.0:0.0:1.0:0.0	.	770;834	B5AK60;P08183	.;MDR1_HUMAN	V	615;834;770	ENSP00000265724:A834V;ENSP00000444095:A770V	ENSP00000265724:A834V	A	-	2	0	ABCB1	86998730	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.825000	0.75293	2.710000	0.92621	0.491000	0.48974	GCT		0.343	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		15	29	0	0	0	0.00245	0	15	29				
GTPBP10	85865	broad.mit.edu	37	7	89982211	89982211	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:89982211G>T	ENST00000222511.6	+	2	181	c.115G>T	c.(115-117)Ggt>Tgt	p.G39C	GTPBP10_ENST00000257659.8_Missense_Mutation_p.G39C	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	39					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						AGGTGGAGAAGGTGGAAAAGG	0.433																																							uc003ukm.1		NA																	0					0						c.(115-117)GGT>TGT		GTP-binding protein 10 isoform 2							186.0	181.0	182.0					7																	89982211		2203	4300	6503	SO:0001583	missense	85865				ribosome biogenesis	chromosome|nucleolus	GTP binding|GTPase activity|magnesium ion binding	g.chr7:89982211G>T		CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.115G>T	7.37:g.89982211G>T	ENSP00000222511:p.Gly39Cys		Somatic				GTPBP10_uc003uki.1_Missense_Mutation_p.G56C|GTPBP10_uc003ukj.1_Missense_Mutation_p.G30C|GTPBP10_uc003ukk.1_RNA|GTPBP10_uc003ukl.1_RNA|GTPBP10_uc003ukn.1_Missense_Mutation_p.G39C|GTPBP10_uc003uko.1_Translation_Start_Site	p.G39C	NM_033107	NP_149098	WXS	Illumina HiSeq	Unspecified	A4D1E9	GTPBA_HUMAN			2	181	+			39					B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	37	c.115G>T	CCDS5617.1	.	.	.	.	.	.	.	.	.	.	G	32	5.117634	0.94385	.	.	ENSG00000105793	ENST00000426366;ENST00000450619;ENST00000257659;ENST00000222511;ENST00000417207	T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08	6.07	6.07	0.98685	GTP1/OBG subdomain (3);	0.049416	0.85682	D	0.000000	D	0.87261	0.6133	H	0.98936	4.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.91409	0.5149	9	.	.	.	-8.5243	20.6525	0.99598	0.0:0.0:1.0:0.0	.	39;39;30;56	A4D1E9-2;A4D1E9;C9J8R7;C9JNI1	.;GTPBA_HUMAN;.;.	C	30;56;39;39;39	ENSP00000405697:G30C;ENSP00000389510:G56C;ENSP00000257659:G39C;ENSP00000222511:G39C;ENSP00000416596:G39C	.	G	+	1	0	GTPBP10	89820147	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.145000	0.94634	2.890000	0.99128	0.585000	0.79938	GGT		0.433	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107		16	28	1	0	6.94344e-10	0.006122	1.00438e-09	16	28				
DYNC1I1	1780	broad.mit.edu	37	7	95726882	95726882	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:95726882G>T	ENST00000324972.6	+	17	2108	c.1915G>T	c.(1915-1917)Ggc>Tgc	p.G639C	DYNC1I1_ENST00000359388.4_Missense_Mutation_p.G602C|DYNC1I1_ENST00000537881.1_Intron|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.G619C|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.G622C|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.G622C	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	639					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CGAGGAGGAAGGCACTGTTGA	0.512																																							uc003uoc.3		NA																	0				ovary(3)|kidney(1)	4						c.(1915-1917)GGC>TGC		dynein, cytoplasmic 1, intermediate chain 1							138.0	124.0	129.0					7																	95726882		2203	4300	6503	SO:0001583	missense	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95726882G>T	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1915G>T	7.37:g.95726882G>T	ENSP00000320130:p.Gly639Cys		Somatic				DYNC1I1_uc003uod.3_Missense_Mutation_p.G622C|DYNC1I1_uc003uob.2_Missense_Mutation_p.G602C|DYNC1I1_uc003uoe.3_Missense_Mutation_p.G619C|DYNC1I1_uc010lfl.2_Missense_Mutation_p.G628C	p.G639C	NM_004411	NP_004402	WXS	Illumina HiSeq	Unspecified	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		17	2192	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		639					B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	c.1915G>T	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302099	0.60195	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.32	4.44	0.53790	.	0.049333	0.85682	D	0.000000	T	0.75049	0.3797	L	0.44542	1.39	0.80722	D	1	D;P;P;D;D	0.58970	0.973;0.949;0.879;0.973;0.984	P;P;P;P;P	0.58013	0.682;0.769;0.669;0.682;0.831	T	0.77125	-0.2703	10	0.54805	T	0.06	-8.1345	14.3599	0.66764	0.0709:0.0:0.9291:0.0	.	622;619;622;639;602	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	C	622;639;619;602;622	ENSP00000392337:G622C;ENSP00000320130:G639C;ENSP00000398118:G619C;ENSP00000352348:G602C;ENSP00000412444:G622C	ENSP00000320130:G639C	G	+	1	0	DYNC1I1	95564818	1.000000	0.71417	0.945000	0.38365	0.229000	0.25112	6.068000	0.71201	1.621000	0.50320	0.655000	0.94253	GGC		0.512	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		14	47	1	0	1.49906e-05	0.00245	1.80003e-05	14	47				
STAG3	10734	broad.mit.edu	37	7	99809090	99809090	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:99809090G>T	ENST00000426455.1	+	31	3850	c.3443G>T	c.(3442-3444)aGg>aTg	p.R1148M	GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000394018.2_Missense_Mutation_p.R1090M|STAG3_ENST00000317296.5_Missense_Mutation_p.R1148M	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	1148					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGAGGTCAAGGTTCTTGGGT	0.517																																							uc003utx.1		NA																	0				ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(3442-3444)AGG>ATG		stromal antigen 3							170.0	153.0	159.0					7																	99809090		2203	4300	6503	SO:0001583	missense	10734				chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding	g.chr7:99809090G>T	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.3443G>T	7.37:g.99809090G>T	ENSP00000400359:p.Arg1148Met		Somatic				STAG3_uc011kjk.1_Missense_Mutation_p.R1090M|GATS_uc003uty.3_RNA|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Missense_Mutation_p.R373M|GATS_uc011kjl.1_RNA|GATS_uc010lgu.2_RNA	p.R1148M	NM_012447	NP_036579	WXS	Illumina HiSeq	Unspecified	Q9UJ98	STAG3_HUMAN			31	3598	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		1148					A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	c.3443G>T	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	g	18.43	3.622468	0.66787	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000379577;ENST00000317296;ENST00000412190	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.22	-0.0145	0.13980	.	2.174960	0.01958	N	0.043127	T	0.29190	0.0726	L	0.54323	1.7	0.09310	N	0.999994	B;P;P	0.49447	0.007;0.924;0.924	B;P;P	0.46362	0.007;0.514;0.514	T	0.14172	-1.0482	10	0.34782	T	0.22	-0.1337	4.2725	0.10794	0.3714:0.0:0.4744:0.1542	.	1090;1149;1148	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	M	1148;1090;811;169;1148;107	ENSP00000400359:R1148M;ENSP00000377586:R1090M;ENSP00000319318:R1148M;ENSP00000395039:R107M	ENSP00000319318:R1148M	R	+	2	0	STAG3	99647026	0.000000	0.05858	0.000000	0.03702	0.531000	0.34715	0.280000	0.18790	0.014000	0.14944	0.561000	0.74099	AGG		0.517	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447		48	135	1	0	3.10996e-30	0.00361	5.8441e-30	48	135				
ZAN	7455	broad.mit.edu	37	7	100361433	100361433	+	RNA	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:100361433C>G	ENST00000348028.3	+	0	4156				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TTGCAGGTGTCAGAAGTACCA	0.597																																							uc003uwj.2		NA																	0				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(3991-3993)CAG>GAG		zonadhesin isoform 3							118.0	115.0	116.0					7																	100361433		1980	4178	6158			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100361433C>G	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100361433C>G			Somatic				ZAN_uc003uwk.2_Missense_Mutation_p.Q1331E|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Intron	p.Q1331E	NM_003386	NP_003377	WXS	Illumina HiSeq	Unspecified	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		21	4156	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		1331			VWFD 1.|Extracellular (Potential).		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37	c.3991C>G		.	.	.	.	.	.	.	.	.	.	C	13.15	2.150817	0.37923	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.14144	2.56;2.56;2.53	4.33	1.21	0.21127	von Willebrand factor, type D domain (1);	1.065190	0.07473	N	0.902577	T	0.11410	0.0278	L	0.28649	0.875	0.09310	N	0.999997	B;B	0.14012	0.009;0.005	B;B	0.16289	0.015;0.007	T	0.41197	-0.9522	10	0.20046	T	0.44	.	12.2175	0.54414	0.0:0.4968:0.5032:0.0	.	1331;1331	F5H0T8;Q9Y493	.;ZAN_HUMAN	E	1331	ENSP00000445943:Q1331E;ENSP00000445091:Q1331E;ENSP00000444427:Q1331E	ENSP00000423579:Q1331E	Q	+	1	0	ZAN	100199369	0.006000	0.16342	0.010000	0.14722	0.406000	0.30931	0.068000	0.14531	0.105000	0.17753	0.555000	0.69702	CAG		0.597	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		6	117	0	0	0	0.001984	0	6	117				
MUC17	140453	broad.mit.edu	37	7	100696348	100696348	+	Silent	SNP	G	G	A	rs200413820		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:100696348G>A	ENST00000306151.4	+	10	13249	c.13185G>A	c.(13183-13185)gtG>gtA	p.V4395V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4395					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACGGCCTCGTGGGGGCAGGGG	0.597																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(13183-13185)GTG>GTA		mucin 17 precursor							91.0	77.0	82.0					7																	100696348		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100696348G>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13185G>A	7.37:g.100696348G>A			Somatic				MUC17_uc010lho.1_RNA	p.V4395V	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			10	13238	+	Lung NSC(181;0.136)|all_lung(186;0.182)		4395			Helical; (Potential).		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.13185G>A	CCDS34711.1																																																																																				0.597	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		13	64	0	0	0	0.001368	0	13	64				
LRWD1	222229	broad.mit.edu	37	7	102108574	102108574	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:102108574G>T	ENST00000292616.5	+	6	896	c.744G>T	c.(742-744)gcG>gcT	p.A248A	MIR5090_ENST00000582533.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	248					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						GCAAGCGGGCGTGTGCCTCCC	0.682																																							uc003uzn.2		NA																	0				skin(1)	1						c.(742-744)GCG>GCT		leucine-rich repeats and WD repeat domain							52.0	53.0	53.0					7																	102108574		2197	4297	6494	SO:0001819	synonymous_variant	222229				chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding	g.chr7:102108574G>T	AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.744G>T	7.37:g.102108574G>T			Somatic				LRWD1_uc003uzo.2_Silent_p.A96A	p.A248A	NM_152892	NP_690852	WXS	Illumina HiSeq	Unspecified	Q9UFC0	LRWD1_HUMAN			6	882	+			248					A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Silent	SNP	ENST00000292616.5	37	c.744G>T	CCDS34715.1																																																																																				0.682	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349493.1	NM_152892		3	18	1	0	0.004672	0.004672	0.00502765	3	18				
RELN	5649	broad.mit.edu	37	7	103205900	103205900	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:103205900A>T	ENST00000428762.1	-	34	5194	c.5035T>A	c.(5035-5037)Tcc>Acc	p.S1679T	RELN_ENST00000343529.5_Missense_Mutation_p.S1679T|RELN_ENST00000424685.2_Missense_Mutation_p.S1679T	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1679					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACACTGTGGGAGTTGCTGAAG	0.478																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(5035-5037)TCC>ACC		reelin isoform a							104.0	91.0	95.0					7																	103205900		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103205900A>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5035T>A	7.37:g.103205900A>T	ENSP00000392423:p.Ser1679Thr		Somatic				RELN_uc010liz.2_Missense_Mutation_p.S1679T	p.S1679T	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	34	5195	-			1679					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.5035T>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	4.220	0.039725	0.08148	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.23147	1.92;1.92;1.92	6.17	0.823	0.18812	.	0.302890	0.37955	N	0.001864	T	0.13072	0.0317	L	0.29908	0.895	0.33148	D	0.545354	B;B	0.09022	0.001;0.002	B;B	0.11329	0.003;0.006	T	0.42481	-0.9449	10	0.02654	T	1	.	8.1454	0.31108	0.5154:0.2963:0.0:0.1883	.	1679;1679	P78509-2;P78509	.;RELN_HUMAN	T	1679	ENSP00000392423:S1679T;ENSP00000345694:S1679T;ENSP00000388446:S1679T	ENSP00000345694:S1679T	S	-	1	0	RELN	102993136	0.005000	0.15991	0.111000	0.21465	0.935000	0.57460	0.196000	0.17176	-0.095000	0.12351	0.533000	0.62120	TCC		0.478	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		7	22	0	0	0	0.001984	0	7	22				
COG5	10466	broad.mit.edu	37	7	107204403	107204403	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:107204403G>T	ENST00000347053.3	-	1	82	c.32C>A	c.(31-33)tCt>tAt	p.S11Y	COG5_ENST00000393603.2_Missense_Mutation_p.S11Y|DUS4L_ENST00000265720.3_5'UTR|COG5_ENST00000297135.3_Missense_Mutation_p.S11Y|DUS4L_ENST00000402620.1_5'Flank|DUS4L_ENST00000498786.1_Intron	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	11					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						TGGTGACGCAGAATCCCGGCG	0.701																																							uc003ved.2		NA																	0				central_nervous_system(2)|skin(2)	4						c.(31-33)TCT>TAT		component of oligomeric golgi complex 5 isoform							9.0	9.0	9.0					7																	107204403		2176	4272	6448	SO:0001583	missense	10466				intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding	g.chr7:107204403G>T	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.32C>A	7.37:g.107204403G>T	ENSP00000334703:p.Ser11Tyr		Somatic				COG5_uc003vec.2_Missense_Mutation_p.S11Y|COG5_uc003vee.2_Missense_Mutation_p.S11Y|DUS4L_uc003veg.2_5'Flank|DUS4L_uc003veh.2_5'Flank|DUS4L_uc011klw.1_5'Flank|DUS4L_uc011klx.1_5'Flank	p.S11Y	NM_181733	NP_859422	WXS	Illumina HiSeq	Unspecified	Q9UP83	COG5_HUMAN			1	557	-			11					A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	37	c.32C>A	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266521	0.80358	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.19669	2.14;2.13;2.13	5.3	-6.46	0.01908	.	1.229330	0.05918	N	0.632967	T	0.07999	0.0200	N	0.08118	0	0.24725	N	0.993122	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.31024	-0.9958	10	0.51188	T	0.08	1.1276	1.8664	0.03199	0.3548:0.3524:0.1582:0.1346	.	11;11	Q9UP83;Q9UP83-2	COG5_HUMAN;.	Y	11	ENSP00000334703:S11Y;ENSP00000297135:S11Y;ENSP00000377228:S11Y	ENSP00000297135:S11Y	S	-	2	0	COG5	106991639	0.000000	0.05858	0.011000	0.14972	0.501000	0.33797	-1.107000	0.03316	-1.004000	0.03421	0.591000	0.81541	TCT		0.701	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4			7	14	1	0	3.09899e-07	0.004482	3.99083e-07	7	14				
DOCK4	9732	broad.mit.edu	37	7	111430661	111430661	+	Splice_Site	SNP	C	C	A	rs200903684		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:111430661C>A	ENST00000437633.1	-	31	3423	c.3167G>T	c.(3166-3168)gGa>gTa	p.G1056V	DOCK4_ENST00000428084.1_Splice_Site_p.G1056V	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1056					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CTTGTGCTCTCCTAAAGTGAG	0.323																																							uc003vfx.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(3166-3168)GGA>GTA		dedicator of cytokinesis 4							50.0	49.0	49.0					7																	111430661		1825	4067	5892	SO:0001630	splice_region_variant	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111430661C>A		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.3167-1G>T	7.37:g.111430661C>A			Somatic				DOCK4_uc011kmm.1_5'Flank|DOCK4_uc003vfw.2_Missense_Mutation_p.G497V|DOCK4_uc003vfy.2_Missense_Mutation_p.G1092V	p.G1056V	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			31	3436	-		Acute lymphoblastic leukemia(1;0.0441)	1056					O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	c.3167G>T	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.546063|4.546063	0.86022|0.86022	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000423057;ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.61040	.|0.14;0.14	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.81064	.|0.4745	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.996;0.998;0.998	.|D	.|0.83829	.|0.0251	.|10	.|0.87932	.|D	.|0	.|.	19.469|19.469	0.94954|0.94954	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1092;1056;1056	.|Q149N5;Q8N1I0;Q8N1I0-2	.|.;DOCK4_HUMAN;.	X|V	508;1080|1044;1056;1056;1044;1055	.|ENSP00000410746:G1056V;ENSP00000404179:G1056V	.|ENSP00000345432:G1044V	E|G	-|-	1|2	0|0	DOCK4|DOCK4	111217897|111217897	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.853000|0.853000	0.48598|0.48598	7.515000|7.515000	0.81761|0.81761	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.323	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	Missense_Mutation	7	17	1	0	8.12818e-05	0.001984	9.34516e-05	7	17				
CPED1	79974	broad.mit.edu	37	7	120884330	120884330	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:120884330C>A	ENST00000310396.5	+	18	2715	c.2248C>A	c.(2248-2250)Cac>Aac	p.H750N	CPED1_ENST00000423795.1_Missense_Mutation_p.H530N|CPED1_ENST00000450913.2_Missense_Mutation_p.H750N	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	750						endoplasmic reticulum (GO:0005783)											CTGGCAGCCCCACAACTGCCA	0.493																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(2248-2250)CAC>AAC		hypothetical protein LOC79974 isoform 1							124.0	113.0	117.0					7																	120884330		2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120884330C>A		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2248C>A	7.37:g.120884330C>A	ENSP00000309772:p.His750Asn		Somatic				C7orf58_uc003vjs.3_Missense_Mutation_p.H750N|C7orf58_uc003vjt.3_Missense_Mutation_p.H530N	p.H750N	NM_024913	NP_079189	WXS	Illumina HiSeq	Unspecified	A4D0V7	CG058_HUMAN			18	2695	+	all_neural(327;0.117)		750					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.2248C>A	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.221403	0.39300	.	.	ENSG00000106034	ENST00000310396;ENST00000450913;ENST00000423795	T;T;T	0.23754	2.19;1.89;1.89	5.3	4.42	0.53409	.	0.487517	0.22384	N	0.060769	T	0.27241	0.0668	L	0.51422	1.61	0.80722	D	1	P;P;P	0.42409	0.779;0.745;0.546	B;B;B	0.43082	0.275;0.407;0.261	T	0.02385	-1.1167	10	0.49607	T	0.09	.	10.3808	0.44110	0.0:0.8484:0.0:0.1516	.	530;750;750	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	N	750;750;530	ENSP00000309772:H750N;ENSP00000406122:H750N;ENSP00000415573:H530N	ENSP00000309772:H750N	H	+	1	0	C7orf58	120671566	0.971000	0.33674	0.990000	0.47175	0.933000	0.57130	1.602000	0.36783	1.218000	0.43458	0.460000	0.39030	CAC		0.493	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		22	60	1	0	7.45023e-12	0.010504	1.13858e-11	22	60				
PTPRZ1	5803	broad.mit.edu	37	7	121651931	121651931	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:121651931A>G	ENST00000393386.2	+	12	3242	c.2831A>G	c.(2830-2832)tAc>tGc	p.Y944C	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	944					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACTGTTTCTTACAGTTCTGCA	0.453																																							uc003vjy.2		NA																	0				ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(2830-2832)TAC>TGC		protein tyrosine phosphatase, receptor-type,							163.0	140.0	148.0					7																	121651931		2203	4300	6503	SO:0001583	missense	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121651931A>G	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2831A>G	7.37:g.121651931A>G	ENSP00000377047:p.Tyr944Cys		Somatic				PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.Y944C	NM_002851	NP_002842	WXS	Illumina HiSeq	Unspecified	P23471	PTPRZ_HUMAN			12	3226	+			944			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	c.2831A>G	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374526	0.42105	.	.	ENSG00000106278	ENST00000393386	T	0.50277	0.75	5.68	-4.34	0.03666	.	0.950718	0.08814	N	0.889746	T	0.49355	0.1552	L	0.53249	1.67	0.58432	D	0.999992	P	0.51791	0.948	P	0.46362	0.514	T	0.66712	-0.5854	10	0.72032	D	0.01	.	18.1845	0.89789	0.3486:0.6514:0.0:0.0	.	944	P23471	PTPRZ_HUMAN	C	944	ENSP00000377047:Y944C	ENSP00000377047:Y944C	Y	+	2	0	PTPRZ1	121439167	0.314000	0.24563	0.021000	0.16686	0.988000	0.76386	0.144000	0.16135	-0.568000	0.06038	-0.323000	0.08544	TAC		0.453	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		32	89	0	0	0	0.012213	0	32	89				
IMPDH1	3614	broad.mit.edu	37	7	128034398	128034398	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:128034398C>T	ENST00000480861.1	-	13	1519	c.1442G>A	c.(1441-1443)gGa>gAa	p.G481E	IMPDH1_ENST00000419067.2_Missense_Mutation_p.G538E|IMPDH1_ENST00000348127.6_Missense_Mutation_p.G535E|IMPDH1_ENST00000470772.1_Missense_Mutation_p.G485E|IMPDH1_ENST00000354269.5_Missense_Mutation_p.G561E|IMPDH1_ENST00000496200.1_Missense_Mutation_p.G461E|IMPDH1_ENST00000343214.4_Missense_Mutation_p.G461E|IMPDH1_ENST00000378717.4_Missense_Mutation_p.G502E|IMPDH1_ENST00000338791.6_Missense_Mutation_p.G571E	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						CTTGAGCTCTCCTGAGTACAT	0.577																																							uc011kol.1		NA																	0				skin(2)|lung(1)|central_nervous_system(1)	4						c.(1456-1458)GGA>GAA		inosine monophosphate dehydrogenase 1 isoform e	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)						102.0	86.0	91.0					7																	128034398		2203	4300	6503	SO:0001583	missense	3614				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding	g.chr7:128034398C>T		CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.1442G>A	7.37:g.128034398C>T	ENSP00000420185:p.Gly481Glu		Somatic				IMPDH1_uc011kom.1_Missense_Mutation_p.G481E|IMPDH1_uc003vmt.2_Missense_Mutation_p.G461E|IMPDH1_uc003vmu.2_Missense_Mutation_p.G571E|IMPDH1_uc003vmw.2_Missense_Mutation_p.G561E|IMPDH1_uc011kon.1_Missense_Mutation_p.G538E|IMPDH1_uc003vmv.2_Missense_Mutation_p.G535E|IMPDH1_uc003vmx.2_Missense_Mutation_p.G494E|IMPDH1_uc003vmy.2_Missense_Mutation_p.G502E|uc011koo.1_5'Flank	p.G486E	NM_001142573	NP_001136045	WXS	Illumina HiSeq	Unspecified	P20839	IMDH1_HUMAN			13	1563	-			486						Missense_Mutation	SNP	ENST00000480861.1	37	c.1457G>A	CCDS55161.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374779	0.82573	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861	T;T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.14	5.14	0.70334	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.85969	0.5821	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.993;0.996;0.999;0.999;0.996;0.996;0.991	D;P;P;D;D;P;P;P	0.97110	1.0;0.892;0.892;0.962;0.962;0.803;0.875;0.827	D	0.87233	0.2261	10	0.72032	D	0.01	-5.6824	16.1251	0.81386	0.0:1.0:0.0:0.0	.	538;481;486;502;561;535;571;461	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	E	538;571;461;561;502;535;461;485;481	ENSP00000399400:G538E;ENSP00000345096:G571E;ENSP00000420803:G461E;ENSP00000346219:G561E;ENSP00000367989:G502E;ENSP00000265385:G535E;ENSP00000342438:G461E;ENSP00000417296:G485E;ENSP00000420185:G481E	ENSP00000345096:G571E	G	-	2	0	IMPDH1	127821634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.388000	0.81334	0.561000	0.74099	GGA		0.577	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883		8	81	0	0	0	0.004482	0	8	81				
FLNC	2318	broad.mit.edu	37	7	128488078	128488078	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:128488078C>T	ENST00000325888.8	+	26	4797	c.4536C>T	c.(4534-4536)ccC>ccT	p.P1512P	FLNC_ENST00000346177.6_Silent_p.P1512P|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1512					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CTGACGGGCCCTACACGGTAG	0.662																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(4534-4536)CCC>CCT		gamma filamin isoform a							26.0	34.0	31.0					7																	128488078		2144	4237	6381	SO:0001819	synonymous_variant	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128488078C>T	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4536C>T	7.37:g.128488078C>T			Somatic				FLNC_uc003voa.3_Silent_p.P1512P	p.P1512P	NM_001458	NP_001449	WXS	Illumina HiSeq	Unspecified	Q14315	FLNC_HUMAN			26	4745	+			1512			Filamin 13.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	c.4536C>T	CCDS43644.1																																																																																				0.662	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			6	12	0	0	0	0.001168	0	6	12				
PRSS58	136541	broad.mit.edu	37	7	141952344	141952344	+	Missense_Mutation	SNP	G	G	T	rs376943400		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:141952344G>T	ENST00000552471.1	-	4	843	c.524C>A	c.(523-525)aCg>aAg	p.T175K	PRSS58_ENST00000547058.2_Missense_Mutation_p.T175K			Q8IYP2	PRS58_HUMAN	protease, serine, 58	175	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						CATATTTTCCGTGATGTTGTA	0.433																																							uc003vxb.2		NA																	0					0						c.(523-525)ACG>AAG		trypsin X3 precursor							180.0	163.0	169.0					7																	141952344		2203	4300	6503	SO:0001583	missense	136541				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr7:141952344G>T		CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.524C>A	7.37:g.141952344G>T	ENSP00000446916:p.Thr175Lys		Somatic				TRYX3_uc003vxc.3_Missense_Mutation_p.T175K	p.T175K	NM_001001317	NP_001001317	WXS	Illumina HiSeq	Unspecified	Q8IYP2	PRS58_HUMAN			4	844	-	Melanoma(164;0.0272)		175			Peptidase S1.		B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	37	c.524C>A	CCDS5871.1	.	.	.	.	.	.	.	.	.	.	G	9.176	1.022473	0.19433	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.90444	-2.67;-2.67	4.35	-8.69	0.00855	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.83575	0.5284	L	0.35644	1.08	0.09310	N	1	B	0.19706	0.038	B	0.27076	0.076	T	0.70281	-0.4915	9	0.54805	T	0.06	.	10.0857	0.42417	0.0:0.4278:0.3646:0.2076	.	175	Q8IYP2	PRS58_HUMAN	K	175	ENSP00000447588:T175K;ENSP00000446916:T175K	ENSP00000307206:T175K	T	-	2	0	PRSS58	141598822	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	-0.814000	0.04486	-3.278000	0.00198	-3.322000	0.00044	ACG		0.433	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317		28	75	1	0	1.88708e-17	0.008361	3.23352e-17	28	75				
TRPV5	56302	broad.mit.edu	37	7	142627152	142627152	+	Splice_Site	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:142627152C>A	ENST00000265310.1	-	3	698		c.e3+1		TRPV5_ENST00000442623.1_Splice_Site	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					AGGCTCCTTACCTGCAAAAGC	0.537																																							uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.e3+1		transient receptor potential cation channel,							105.0	103.0	104.0					7																	142627152		2203	4300	6503	SO:0001630	splice_region_variant	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142627152C>A	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.349+1G>T	7.37:g.142627152C>A			Somatic				TRPV5_uc003wbz.2_Splice_Site_p.G117_splice	p.G117_splice	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			3	613	-	Melanoma(164;0.059)							A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Splice_Site	SNP	ENST00000265310.1	37	c.349_splice	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392179	0.25118	.	.	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6971	0.77509	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPV5	142337274	1.000000	0.71417	1.000000	0.80357	0.047000	0.14425	6.206000	0.72154	2.343000	0.79666	0.462000	0.41574	.		0.537	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	Intron	35	86	1	0	1.36161e-19	0.004289	2.43369e-19	35	86				
OR6B1	135946	broad.mit.edu	37	7	143701161	143701161	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:143701161G>T	ENST00000408922.2	+	1	140	c.72G>T	c.(70-72)cgG>cgT	p.R24R		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					TGAGTATGCGGGCAGCCATGT	0.502																																							uc003wdt.1		NA																	0				ovary(1)	1						c.(70-72)CGG>CGT		olfactory receptor, family 6, subfamily B,							113.0	107.0	109.0					7																	143701161		1994	4178	6172	SO:0001819	synonymous_variant	135946				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143701161G>T		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.72G>T	7.37:g.143701161G>T			Somatic					p.R24R	NM_001005281	NP_001005281	WXS	Illumina HiSeq	Unspecified	O95007	OR6B1_HUMAN			1	72	+	Melanoma(164;0.0783)		24			Extracellular (Potential).		A4D2G2|B9EH47|Q6IFP6|Q96R38	Silent	SNP	ENST00000408922.2	37	c.72G>T	CCDS43667.1																																																																																				0.502	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1			19	41	1	0	3.8784e-16	0.012319	6.51991e-16	19	41				
OR2A5	393046	broad.mit.edu	37	7	143748127	143748127	+	Silent	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:143748127C>G	ENST00000408906.2	+	1	667	c.633C>G	c.(631-633)ctC>ctG	p.L211L		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TGGGGCCGCTCTGCCTGGTGC	0.602																																							uc011ktw.1		NA																	0				ovary(3)	3						c.(631-633)CTC>CTG		olfactory receptor, family 2, subfamily A,							126.0	129.0	128.0					7																	143748127		2012	4172	6184	SO:0001819	synonymous_variant	393046				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143748127C>G	U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.633C>G	7.37:g.143748127C>G			Somatic					p.L211L	NM_012365	NP_036497	WXS	Illumina HiSeq	Unspecified	Q96R48	OR2A5_HUMAN			1	633	+	Melanoma(164;0.0783)		211			Helical; Name=5; (Potential).		B9EGX2|O43885|O43888	Silent	SNP	ENST00000408906.2	37	c.633C>G	CCDS43668.1																																																																																				0.602	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1			69	172	0	0	0	0.00361	0	69	172				
EZH2	2146	broad.mit.edu	37	7	148515173	148515173	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:148515173C>T	ENST00000460911.1	-	10	1109	c.1021G>A	c.(1021-1023)Gag>Aag	p.E341K	EZH2_ENST00000483967.1_Missense_Mutation_p.E332K|EZH2_ENST00000320356.2_Missense_Mutation_p.E346K|EZH2_ENST00000476773.1_Missense_Mutation_p.E332K|EZH2_ENST00000478654.1_Missense_Mutation_p.E332K|EZH2_ENST00000541220.1_Missense_Mutation_p.E332K|RNU7-20P_ENST00000515903.1_RNA|EZH2_ENST00000536783.1_3'UTR|EZH2_ENST00000350995.2_Missense_Mutation_p.E302K			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	341	Interaction with CDYL.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TTTATCCGCTCAGCGGTGAGA	0.498			Mis		DLBCL																																		uc003wfd.1		NA		Rec?	yes		7	7q35-q36	2146	Mis	enhancer of zeste homolog 2			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183						c.(1021-1023)GAG>AAG		enhancer of zeste 2 isoform a							116.0	114.0	115.0					7																	148515173		2203	4300	6503	SO:0001583	missense	2146				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding	g.chr7:148515173C>T		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1021G>A	7.37:g.148515173C>T	ENSP00000419711:p.Glu341Lys		Somatic				EZH2_uc011kug.1_Missense_Mutation_p.E332K|EZH2_uc003wfb.1_Missense_Mutation_p.E346K|EZH2_uc003wfc.1_Missense_Mutation_p.E302K|EZH2_uc011kuh.1_Missense_Mutation_p.E332K|EZH2_uc011kui.1_Missense_Mutation_p.E341K|EZH2_uc011kuj.1_RNA	p.E341K	NM_004456	NP_004447	WXS	Illumina HiSeq	Unspecified	Q15910	EZH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00239)		10	1187	-	Melanoma(164;0.15)		341					B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	c.1021G>A	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	c	37	6.119794	0.97300	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	T;T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	L	0.40543	1.245	0.80722	D	1	D;D;B;D;B;D	0.76494	0.998;0.962;0.136;0.986;0.374;0.999	D;P;B;D;B;D	0.83275	0.986;0.676;0.028;0.965;0.148;0.996	T	0.81351	-0.0972	10	0.32370	T	0.25	.	20.0139	0.97470	0.0:1.0:0.0:0.0	.	341;332;332;341;302;346	B7Z8K5;Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;.;EZH2_HUMAN;.;.	K	332;346;341;302;332;332;332	ENSP00000417062:E332K;ENSP00000320147:E346K;ENSP00000419711:E341K;ENSP00000223193:E302K;ENSP00000443219:E332K;ENSP00000419050:E332K;ENSP00000419856:E332K	ENSP00000320147:E346K	E	-	1	0	EZH2	148146106	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.007000	0.76335	2.724000	0.93272	0.563000	0.77884	GAG		0.498	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456		15	149	0	0	0	0.00245	0	15	149				
SSPO	23145	broad.mit.edu	37	7	149491894	149491894	+	RNA	SNP	C	C	A	rs557319651		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:149491894C>A	ENST00000378016.2	+	0	6095							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GAGAACCAGACGGTCCAGCCC	0.617																																							uc010lpk.2		NA																	0					0						c.(6094-6096)ACG>AAG		SCO-spondin precursor							43.0	53.0	50.0					7																	149491894		2050	4214	6264			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149491894C>A	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149491894C>A			Somatic					p.T2032K	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		42	6095	+	Melanoma(164;0.165)|Ovarian(565;0.177)		2032					Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.6095C>A																																																																																					0.617	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				13	72	1	0	2.68362e-12	0.001368	4.12151e-12	13	72				
DPP6	1804	broad.mit.edu	37	7	154172070	154172070	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:154172070T>C	ENST00000377770.3	+	3	546	c.405T>C	c.(403-405)gaT>gaC	p.D135D	DPP6_ENST00000404039.1_Silent_p.D71D|DPP6_ENST00000427557.1_Silent_p.D73D|DPP6_ENST00000406326.1_Silent_p.D135D|DPP6_ENST00000496611.1_3'UTR|DPP6_ENST00000332007.3_Silent_p.D73D			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	135					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTGTAGAAGATCTCTTCAGTG	0.403																																					NSCLC(125;1384 1783 2490 7422 34254)	NSCLC(125;1384 1783 2490 7422 34254)	uc003wlk.2		NA																	0				pancreas(3)|breast(1)	4						c.(403-405)GAT>GAC		dipeptidyl-peptidase 6 isoform 1							95.0	92.0	93.0					7																	154172070		1912	4124	6036	SO:0001819	synonymous_variant	1804				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr7:154172070T>C	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.405T>C	7.37:g.154172070T>C			Somatic				DPP6_uc003wli.2_Silent_p.D71D|DPP6_uc003wlj.2_Silent_p.D135D|DPP6_uc010lqh.1_Silent_p.D73D|DPP6_uc003wlm.2_Silent_p.D73D|DPP6_uc011kvq.1_Silent_p.D73D	p.D135D	NM_130797	NP_570629	WXS	Illumina HiSeq	Unspecified	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)		3	534	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	135			Extracellular (Potential).			Silent	SNP	ENST00000377770.3	37	c.405T>C																																																																																					0.403	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797		7	60	0	0	0	0.001984	0	7	60				
MYOM2	9172	broad.mit.edu	37	8	2046747	2046747	+	Missense_Mutation	SNP	G	G	T	rs34863717	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:2046747G>T	ENST00000262113.4	+	19	2515	c.2374G>T	c.(2374-2376)Ggc>Tgc	p.G792C	MYOM2_ENST00000523438.1_Missense_Mutation_p.G217C	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	792	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CAACCTGGCCGGCATCGGGGA	0.562																																							uc003wpx.3		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2374-2376)GGC>TGC		myomesin 2							31.0	29.0	30.0					8																	2046747		2203	4300	6503	SO:0001583	missense	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2046747G>T		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2374G>T	8.37:g.2046747G>T	ENSP00000262113:p.Gly792Cys		Somatic				MYOM2_uc011kwi.1_Missense_Mutation_p.G217C	p.G792C	NM_003970	NP_003961	WXS	Illumina HiSeq	Unspecified	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	19	2512	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	792			Fibronectin type-III 4.		Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	c.2374G>T	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.348558	0.61183	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.65178	-0.14;-0.14	5.5	5.5	0.81552	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88175	0.6366	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92612	0.6100	10	0.87932	D	0	.	19.3978	0.94614	0.0:0.0:1.0:0.0	.	792	P54296	MYOM2_HUMAN	C	792;217	ENSP00000262113:G792C;ENSP00000428396:G217C	ENSP00000262113:G792C	G	+	1	0	MYOM2	2034154	1.000000	0.71417	0.111000	0.21465	0.038000	0.13279	9.119000	0.94362	2.583000	0.87209	0.561000	0.74099	GGC		0.562	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		5	13	1	0	0.000602214	0.000602	0.000670085	5	13				
CSMD1	64478	broad.mit.edu	37	8	3443742	3443742	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:3443742C>A	ENST00000520002.1	-	10	1696	c.1141G>T	c.(1141-1143)Gtg>Ttg	p.V381L	CSMD1_ENST00000537824.1_Missense_Mutation_p.V380L|CSMD1_ENST00000400186.3_Missense_Mutation_p.V381L|CSMD1_ENST00000602723.1_Missense_Mutation_p.V381L|CSMD1_ENST00000602557.1_Missense_Mutation_p.V381L|CSMD1_ENST00000539096.1_Missense_Mutation_p.V380L|CSMD1_ENST00000542608.1_Missense_Mutation_p.V380L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	381	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCCTGGAGCACGTAATTGTCC	0.448																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(1141-1143)GTG>TTG		CUB and Sushi multiple domains 1 precursor							53.0	50.0	51.0					8																	3443742		1914	4127	6041	SO:0001583	missense	64478					integral to membrane		g.chr8:3443742C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1141G>T	8.37:g.3443742C>A	ENSP00000430733:p.Val381Leu		Somatic					p.V381L	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	9	1531	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	381			Extracellular (Potential).|Sushi 2.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.1141G>T		.	.	.	.	.	.	.	.	.	.	C	18.59	3.656692	0.67586	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.77	5.77	0.91146	.	.	.	.	.	T	0.73791	0.3632	L	0.52126	1.63	0.50813	D	0.999893	P	0.50710	0.938	P	0.62298	0.9	T	0.67569	-0.5637	9	0.28530	T	0.3	.	19.9915	0.97366	0.0:1.0:0.0:0.0	.	381	E5RIG2	.	L	381;381;243;380;380;380	ENSP00000383047:V381L;ENSP00000430733:V381L;ENSP00000441462:V380L;ENSP00000446243:V380L;ENSP00000441675:V380L	ENSP00000320445:V243L	V	-	1	0	CSMD1	3431150	1.000000	0.71417	0.988000	0.46212	0.266000	0.26442	7.597000	0.82733	2.723000	0.93209	0.655000	0.94253	GTG		0.448	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		3	12	1	0	0.004672	0.004672	0.00502765	3	12				
CHRNB3	1142	broad.mit.edu	37	8	42586918	42586918	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:42586918C>G	ENST00000289957.2	+	5	596	c.468C>G	c.(466-468)gaC>gaG	p.D156E		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	156					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	GCACCATGGACGTCACGTTTT	0.507																																							uc003xpi.1		NA																	0				ovary(1)	1						c.(466-468)GAC>GAG		cholinergic receptor, nicotinic, beta							66.0	52.0	57.0					8																	42586918		2203	4300	6503	SO:0001583	missense	1142				synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr8:42586918C>G	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.468C>G	8.37:g.42586918C>G	ENSP00000289957:p.Asp156Glu		Somatic					p.D156E	NM_000749	NP_000740	WXS	Illumina HiSeq	Unspecified	Q05901	ACHB3_HUMAN	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		5	596	+	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	156			Extracellular (Potential).		Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	c.468C>G	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	c	18.49	3.635814	0.67130	.	.	ENSG00000147432	ENST00000289957	T	0.80653	-1.4	5.58	-4.53	0.03462	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.78972	0.4368	M	0.75447	2.3	0.51012	D	0.999908	B	0.25904	0.137	B	0.36959	0.237	T	0.67681	-0.5608	10	0.40728	T	0.16	.	12.9034	0.58139	0.0:0.3223:0.0:0.6777	.	156	Q05901	ACHB3_HUMAN	E	156	ENSP00000289957:D156E	ENSP00000289957:D156E	D	+	3	2	CHRNB3	42706075	0.965000	0.33210	0.973000	0.42090	0.936000	0.57629	0.082000	0.14847	-0.692000	0.05128	-0.806000	0.03193	GAC		0.507	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1			8	46	0	0	0	0.00308	0	8	46				
CPA6	57094	broad.mit.edu	37	8	68421816	68421816	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:68421816G>A	ENST00000297770.4	-	5	685	c.470C>T	c.(469-471)tCa>tTa	p.S157L	CPA6_ENST00000518549.1_Missense_Mutation_p.S157L|CPA6_ENST00000297769.4_Missense_Mutation_p.S9L	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	157						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			AATGAGGCCTGAGTGAGTTTT	0.303																																							uc003xxq.3		NA																	0				ovary(2)	2						c.(469-471)TCA>TTA		carboxypeptidase A6 isoform 1 precursor							79.0	78.0	78.0					8																	68421816		2203	4298	6501	SO:0001583	missense	57094				proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding	g.chr8:68421816G>A	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.470C>T	8.37:g.68421816G>A	ENSP00000297770:p.Ser157Leu		Somatic				CPA6_uc003xxr.3_Missense_Mutation_p.S9L|CPA6_uc003xxs.2_Missense_Mutation_p.S157L	p.S157L	NM_020361	NP_065094	WXS	Illumina HiSeq	Unspecified	Q8N4T0	CBPA6_HUMAN	Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)		5	726	-			157					Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	c.470C>T	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941152	0.92526	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.33216	1.42;1.42;3.82	5.49	5.49	0.81192	Peptidase M14, carboxypeptidase A (2);	0.332680	0.33127	N	0.005243	T	0.51381	0.1671	M	0.75150	2.29	0.44694	D	0.99768	P;P;P	0.47910	0.804;0.902;0.87	P;B;P	0.53360	0.462;0.415;0.724	T	0.54964	-0.8214	10	0.87932	D	0	.	18.9697	0.92709	0.0:0.0:1.0:0.0	.	157;9;157	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	L	9;157;157	ENSP00000297769:S9L;ENSP00000297770:S157L;ENSP00000431112:S157L	ENSP00000297769:S9L	S	-	2	0	CPA6	68584370	1.000000	0.71417	0.957000	0.39632	0.962000	0.63368	8.236000	0.89805	2.582000	0.87167	0.650000	0.86243	TCA		0.303	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361		11	42	0	0	0	0.001368	0	11	42				
PRDM14	63978	broad.mit.edu	37	8	70981566	70981566	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:70981566T>A	ENST00000276594.2	-	2	731	c.530A>T	c.(529-531)cAg>cTg	p.Q177L		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	177					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			ATCCTCTGACTGCTTGCTGGG	0.567																																					NSCLC(129;99 1813 5906 40656 46114)	NSCLC(129;99 1813 5906 40656 46114)	uc003xym.2		NA																	0				ovary(3)	3						c.(529-531)CAG>CTG		PR domain containing 14							81.0	81.0	81.0					8																	70981566		2203	4300	6503	SO:0001583	missense	63978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:70981566T>A	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.530A>T	8.37:g.70981566T>A	ENSP00000276594:p.Gln177Leu		Somatic					p.Q177L	NM_024504	NP_078780	WXS	Illumina HiSeq	Unspecified	Q9GZV8	PRD14_HUMAN	Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)		2	732	-	Breast(64;0.193)		177					Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	c.530A>T	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833714	0.32421	.	.	ENSG00000147596	ENST00000276594	T	0.11604	2.76	4.66	-5.53	0.02552	.	1.597030	0.03463	N	0.212430	T	0.04998	0.0134	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	10	0.33141	T	0.24	-0.0252	0.7449	0.00980	0.2128:0.1719:0.2107:0.4046	.	177	Q9GZV8	PRD14_HUMAN	L	177	ENSP00000276594:Q177L	ENSP00000276594:Q177L	Q	-	2	0	PRDM14	71144120	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.523000	0.00949	-1.169000	0.02772	-2.103000	0.00360	CAG		0.567	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			17	42	0	0	0	0.004007	0	17	42				
ZFHX4	79776	broad.mit.edu	37	8	77766126	77766126	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:77766126G>A	ENST00000521891.2	+	10	7417	c.6969G>A	c.(6967-6969)agG>agA	p.R2323R	ZFHX4_ENST00000455469.2_Silent_p.R2278R|ZFHX4_ENST00000518282.1_Silent_p.R2297R|ZFHX4_ENST00000050961.6_Silent_p.R2278R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTTTCCCCAGGATCTTTGACT	0.398										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6832-6834)AGG>AGA		zinc finger homeodomain 4							113.0	109.0	110.0					8																	77766126		1972	4165	6137	SO:0001819	synonymous_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766126G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6969G>A	8.37:g.77766126G>A		HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Silent_p.R2323R|ZFHX4_uc003yaw.1_Silent_p.R2278R	p.R2278R	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7221	+			2278			C2H2-type 15; degenerate.		G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	c.6834G>A	CCDS47878.2																																																																																				0.398	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		24	95	0	0	0	0.002299	0	24	95				
PEX2	5828	broad.mit.edu	37	8	77895700	77895700	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:77895700T>A	ENST00000419564.2	-	4	1179	c.715A>T	c.(715-717)Acc>Tcc	p.T239S	PEX2_ENST00000522527.1_Missense_Mutation_p.T239S|PEX2_ENST00000357039.4_Missense_Mutation_p.T239S|PEX2_ENST00000520103.1_Missense_Mutation_p.T239S	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	239					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						TTGCCACTGGTGGCTAATGTA	0.428																																							uc003yax.2		NA																	0				ovary(1)	1						c.(715-717)ACC>TCC		peroxin 2							97.0	88.0	91.0					8																	77895700		2203	4300	6503	SO:0001583	missense	5828				peroxisome organization	integral to peroxisomal membrane	protein binding|zinc ion binding	g.chr8:77895700T>A	M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.715A>T	8.37:g.77895700T>A	ENSP00000400984:p.Thr239Ser		Somatic				PEX2_uc003yay.2_Missense_Mutation_p.T239S|PEX2_uc003yaz.2_Missense_Mutation_p.T239S	p.T239S	NM_000318	NP_000309	WXS	Illumina HiSeq	Unspecified	P28328	PEX2_HUMAN			4	1173	-			239					Q567S6|Q9BW41	Missense_Mutation	SNP	ENST00000419564.2	37	c.715A>T	CCDS6221.1	.	.	.	.	.	.	.	.	.	.	T	0.794	-0.757717	0.03019	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.24	2.86	0.33363	.	0.604659	0.17914	N	0.157758	T	0.48822	0.1521	L	0.38838	1.175	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29912	-0.9996	10	0.06891	T	0.86	-4.2764	8.3876	0.32510	0.0:0.3605:0.0:0.6395	.	239	P28328	PEX2_HUMAN	S	239	ENSP00000349543:T239S;ENSP00000400984:T239S;ENSP00000428590:T239S;ENSP00000428638:T239S	ENSP00000349543:T239S	T	-	1	0	PEX2	78058255	0.000000	0.05858	0.232000	0.24009	0.559000	0.35586	0.228000	0.17814	0.453000	0.26858	0.455000	0.32223	ACC		0.428	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318		7	78	0	0	0	0.001984	0	7	78				
CNGB3	54714	broad.mit.edu	37	8	87679339	87679339	+	Silent	SNP	G	G	T	rs371758459		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:87679339G>T	ENST00000320005.5	-	6	713	c.666C>A	c.(664-666)ctC>ctA	p.L222L		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	222					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TGACAAGCAAGAGCCACAGGA	0.438																																							uc003ydx.2		NA																	0				ovary(2)|pancreas(1)	3						c.(664-666)CTC>CTA		cyclic nucleotide gated channel beta 3							85.0	78.0	80.0					8																	87679339		2203	4300	6503	SO:0001819	synonymous_variant	54714				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr8:87679339G>T	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.666C>A	8.37:g.87679339G>T			Somatic				CNGB3_uc010maj.2_Silent_p.L84L	p.L222L	NM_019098	NP_061971	WXS	Illumina HiSeq	Unspecified	Q9NQW8	CNGB3_HUMAN			6	712	-			222			Helical; Name=H1; (Potential).		C9JA51|Q9NRE9	Silent	SNP	ENST00000320005.5	37	c.666C>A	CCDS6244.1																																																																																				0.438	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098		11	34	1	0	5.50884e-06	0.001368	6.74507e-06	11	34				
CDH17	1015	broad.mit.edu	37	8	95189922	95189922	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:95189922A>C	ENST00000027335.3	-	4	302	c.178T>G	c.(178-180)Ttt>Gtt	p.F60V	CDH17_ENST00000450165.2_Missense_Mutation_p.F60V|CDH17_ENST00000441892.2_Missense_Mutation_p.F60V	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			GTTAGTTCAAAAGTCACAGCA	0.403																																							uc003ygh.2		NA																	0				ovary(5)|skin(1)	6						c.(178-180)TTT>GTT		cadherin 17 precursor							111.0	105.0	107.0					8																	95189922		2203	4300	6503	SO:0001583	missense	1015					integral to membrane	calcium ion binding	g.chr8:95189922A>C	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.178T>G	8.37:g.95189922A>C	ENSP00000027335:p.Phe60Val		Somatic				CDH17_uc011lgo.1_Missense_Mutation_p.F60V|CDH17_uc011lgp.1_Missense_Mutation_p.F60V	p.F60V	NM_004063	NP_004054	WXS	Illumina HiSeq	Unspecified	Q12864	CAD17_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)		4	303	-	Breast(36;4.65e-06)		60			Extracellular (Potential).|Cadherin 1.		Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	c.178T>G	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.738437	0.49045	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165;ENST00000521491	T;T;T;T	0.65178	-0.14;-0.14;-0.14;0.68	5.85	4.63	0.57726	Cadherin (3);Cadherin-like (1);	0.000000	0.56097	D	0.000025	T	0.77164	0.4090	M	0.87456	2.885	0.47441	D	0.999429	B;D	0.67145	0.147;0.996	B;P	0.60173	0.045;0.87	T	0.81026	-0.1119	10	0.72032	D	0.01	-20.0109	10.5942	0.45327	0.8389:0.1611:0.0:0.0	.	60;60	E7EN24;Q12864	.;CAD17_HUMAN	V	60	ENSP00000027335:F60V;ENSP00000392811:F60V;ENSP00000401468:F60V;ENSP00000428189:F60V	ENSP00000027335:F60V	F	-	1	0	CDH17	95259098	0.953000	0.32496	0.993000	0.49108	0.813000	0.45954	2.768000	0.47645	2.238000	0.73509	0.460000	0.39030	TTT		0.403	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		22	43	0	0	0	0.010504	0	22	43				
DCSTAMP	81501	broad.mit.edu	37	8	105361457	105361457	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:105361457G>T	ENST00000297581.2	+	2	726	c.677G>T	c.(676-678)gGc>gTc	p.G226V	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Missense_Mutation_p.G226V	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	226					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GTCCTGCTTGGCACTGGCCTC	0.498																																							uc003ylx.1		NA																	0				pancreas(2)|large_intestine(1)|ovary(1)	4						c.(676-678)GGC>GTC		dendritic cell-specific transmembrane protein							101.0	92.0	95.0					8																	105361457		2203	4300	6503	SO:0001583	missense	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105361457G>T	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.677G>T	8.37:g.105361457G>T	ENSP00000297581:p.Gly226Val		Somatic					p.G226V	NM_030788	NP_110415	WXS	Illumina HiSeq	Unspecified	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	726	+			226			Helical; (Potential).		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	c.677G>T	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639998	0.47153	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.31510	1.49	5.52	5.52	0.82312	.	0.335511	0.35936	N	0.002892	T	0.34395	0.0896	L	0.50333	1.59	0.58432	D	0.99999	D	0.53619	0.961	P	0.44597	0.454	T	0.04427	-1.0952	9	.	.	.	-6.754	17.6314	0.88109	0.0:0.0:1.0:0.0	.	226	Q9H295	TM7S4_HUMAN	V	226	ENSP00000297581:G226V	.	G	+	2	0	TM7SF4	105430633	0.999000	0.42202	0.944000	0.38274	0.872000	0.50106	4.649000	0.61433	2.624000	0.88883	0.555000	0.69702	GGC		0.498	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		20	78	1	0	1.37522e-17	0.007413	2.3695e-17	20	78				
CSMD3	114788	broad.mit.edu	37	8	113253949	113253949	+	Splice_Site	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:113253949C>A	ENST00000297405.5	-	66	10712	c.10468G>T	c.(10468-10470)Gtt>Ttt	p.V3490F	CSMD3_ENST00000343508.3_Splice_Site_p.V3450F|CSMD3_ENST00000455883.2_Splice_Site_p.V3321F|CSMD3_ENST00000352409.3_Splice_Site_p.V3420F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3490						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CATTACTAACCACTTAGCTTT	0.313										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(10468-10470)GTT>TTT		CUB and Sushi multiple domains 3 isoform 1							115.0	124.0	121.0					8																	113253949		2203	4300	6503	SO:0001630	splice_region_variant	114788					integral to membrane|plasma membrane		g.chr8:113253949C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10468+1G>T	8.37:g.113253949C>A		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.V2692F|CSMD3_uc003ynt.2_Missense_Mutation_p.V3450F|CSMD3_uc011lhx.1_Missense_Mutation_p.V3321F	p.V3490F	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			66	10627	-			3490			Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.10468G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.151147	0.78001	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.34859	1.66;1.65;1.72;1.34;1.72	5.21	5.21	0.72293	.	0.088428	0.45126	D	0.000386	T	0.60248	0.2254	M	0.71206	2.165	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.996	D;D;P	0.83275	0.988;0.996;0.899	T	0.59484	-0.7446	9	.	.	.	.	17.29	0.87153	0.0:1.0:0.0:0.0	.	3321;3490;3450	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	F	3450;3490;2760;3321;3420	ENSP00000345799:V3450F;ENSP00000297405:V3490F;ENSP00000341558:V2760F;ENSP00000412263:V3321F;ENSP00000343124:V3420F	.	V	-	1	0	CSMD3	113323125	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	6.884000	0.75600	2.595000	0.87683	0.591000	0.81541	GTT		0.313	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Missense_Mutation	36	87	1	0	2.59497e-14	0.007835	4.20331e-14	36	87				
ZHX1	11244	broad.mit.edu	37	8	124266145	124266145	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:124266145C>A	ENST00000522655.1	-	3	2582	c.2042G>T	c.(2041-2043)cGg>cTg	p.R681L	ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Missense_Mutation_p.R681L|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Missense_Mutation_p.R681L			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	681					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CCACTGTGTCCGGACAAATGC	0.478																																							uc003yqe.2		NA																	0				ovary(1)	1						c.(2041-2043)CGG>CTG		zinc fingers and homeoboxes 1							124.0	110.0	115.0					8																	124266145		2203	4300	6503	SO:0001583	missense	11244				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:124266145C>A	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.2042G>T	8.37:g.124266145C>A	ENSP00000428821:p.Arg681Leu		Somatic				C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Missense_Mutation_p.R681L|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Missense_Mutation_p.R681L	p.R681L	NM_007222	NP_009153	WXS	Illumina HiSeq	Unspecified	Q9UKY1	ZHX1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	2472	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		681			Homeobox 4.		Q8IWD8	Missense_Mutation	SNP	ENST00000522655.1	37	c.2042G>T	CCDS6342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.307545|4.307545	0.81247|0.81247	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000520474|ENST00000297857;ENST00000395571;ENST00000522655	.|D;D;D	.|0.96232	.|-3.95;-3.95;-3.95	6.03|6.03	6.03|6.03	0.97812|0.97812	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.|0.060697	.|0.64402	.|D	.|0.000003	.|D	.|0.96399	.|0.8825	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.53312	.|0.959	.|P	.|0.53266	.|0.722	.|D	.|0.95459	.|0.8541	.|9	.|0.54805	.|T	.|0.06	-3.335|-3.335	10.8187|10.8187	0.46591|0.46591	0.0:0.8607:0.0:0.1393|0.0:0.8607:0.0:0.1393	.|.	.|681	.|Q9UKY1	.|ZHX1_HUMAN	X|L	366|681	.|ENSP00000297857:R681L;ENSP00000378938:R681L;ENSP00000428821:R681L	.|ENSP00000297857:R681L	G|R	-|-	1|2	0|0	ZHX1|ZHX1	124335326|124335326	0.995000|0.995000	0.38212|0.38212	0.906000|0.906000	0.35671|0.35671	0.963000|0.963000	0.63663|0.63663	3.254000|3.254000	0.51477|0.51477	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	GGA|CGG		0.478	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1			29	52	1	0	5.77227e-19	0.008361	1.0171e-18	29	52				
CYP11B2	1585	broad.mit.edu	37	8	143994821	143994821	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:143994821G>T	ENST00000323110.2	-	6	1003	c.1001C>A	c.(1000-1002)cCc>cAc	p.P334H		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	334					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CTGCACGTCGGGGTTCCGAGC	0.637									Familial Hyperaldosteronism type I																														uc003yxk.1		NA																	0					0						c.(1000-1002)CCC>CAC		cytochrome P450, family 11, subfamily B,	Candesartan(DB00796)|Metyrapone(DB01011)						74.0	74.0	74.0					8																	143994821		2203	4300	6503	SO:0001583	missense	1585	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143994821G>T	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1001C>A	8.37:g.143994821G>T	ENSP00000325822:p.Pro334His		Somatic					p.P334H	NM_000498	NP_000489	WXS	Illumina HiSeq	Unspecified	P19099	C11B2_HUMAN			6	1004	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		334					B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	c.1001C>A	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	11.99	1.803076	0.31869	.	.	ENSG00000179142	ENST00000323110	D	0.84660	-1.88	3.88	1.83	0.25207	.	0.146915	0.31636	N	0.007304	D	0.92573	0.7641	H	0.94734	3.575	0.40268	D	0.978254	D	0.89917	1.0	D	0.79108	0.992	D	0.91151	0.4953	10	0.87932	D	0	.	6.228	0.20718	0.1123:0.0:0.6927:0.195	.	334	P19099	C11B2_HUMAN	H	334	ENSP00000325822:P334H	ENSP00000325822:P334H	P	-	2	0	CYP11B2	143991823	1.000000	0.71417	0.641000	0.29422	0.069000	0.16628	5.495000	0.66912	0.835000	0.34877	0.558000	0.71614	CCC		0.637	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			33	86	1	0	1.36161e-19	0.004289	2.43369e-19	33	86				
OPLAH	26873	broad.mit.edu	37	8	145108265	145108265	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:145108265C>A	ENST00000426825.1	-	20	2799	c.2718G>T	c.(2716-2718)aaG>aaT	p.K906N	CTD-3065J16.6_ENST00000528912.1_RNA|OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000561181.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	906					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGTTGGGGACCTTGCCTGGCG	0.657																																							uc003zar.3		NA																	0					0						c.(2716-2718)AAG>AAT		5-oxoprolinase (ATP-hydrolysing)	L-Glutamic Acid(DB00142)						53.0	62.0	59.0					8																	145108265		2102	4223	6325	SO:0001583	missense	26873						5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding	g.chr8:145108265C>A	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2718G>T	8.37:g.145108265C>A	ENSP00000475943:p.Lys906Asn		Somatic				OPLAH_uc003zas.1_Missense_Mutation_p.G181C	p.K906N	NM_017570	NP_060040	WXS	Illumina HiSeq	Unspecified	O14841	OPLA_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		20	2800	-	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		906					A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37	c.2718G>T		.	.	.	.	.	.	.	.	.	.	C	9.978	1.227470	0.22542	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.56	2.59	0.31030	.	0.206543	0.42964	D	0.000640	T	0.47637	0.1456	.	.	.	0.34261	D	0.679859	B	0.23990	0.095	B	0.25884	0.064	T	0.58685	-0.7593	7	0.51188	T	0.08	.	12.0693	0.53607	0.0:0.6676:0.3324:0.0	.	906	O14841	OPLA_HUMAN	N	906	.	ENSP00000412071:K906N	K	-	3	2	OPLAH	145180253	1.000000	0.71417	0.992000	0.48379	0.356000	0.29392	0.715000	0.25822	0.892000	0.36259	0.448000	0.29417	AAG		0.657	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570		14	64	1	0	6.31663e-08	0.003163	8.43121e-08	14	64				
FREM1	158326	broad.mit.edu	37	9	14737474	14737474	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:14737474C>A	ENST00000380880.3	-	37	7243	c.6460G>T	c.(6460-6462)Gtt>Ttt	p.V2154F	FREM1_ENST00000380894.1_Missense_Mutation_p.V690F|FREM1_ENST00000422223.2_Missense_Mutation_p.V2154F|FREM1_ENST00000380881.4_Missense_Mutation_p.V2155F			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	2154	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TGTCTTTGAACCAAAACACAG	0.478																																							uc003zlm.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(6460-6462)GTT>TTT		FRAS1 related extracellular matrix 1 precursor							81.0	81.0	81.0					9																	14737474		1877	4115	5992	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14737474C>A	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.6460G>T	9.37:g.14737474C>A	ENSP00000370262:p.Val2154Phe		Somatic				FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_RNA|FREM1_uc003zll.2_Missense_Mutation_p.V690F	p.V2154F	NM_144966	NP_659403	WXS	Illumina HiSeq	Unspecified	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	37	7050	-			2154			C-type lectin.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.6460G>T	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882903	0.91740	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.97	5.97	0.96955	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.113957	0.64402	D	0.000014	T	0.40815	0.1132	L	0.53729	1.69	0.52501	D	0.999957	D;D	0.65815	0.991;0.995	D;D	0.70227	0.968;0.964	T	0.03795	-1.1003	10	0.72032	D	0.01	-11.857	20.4209	0.99038	0.0:1.0:0.0:0.0	.	2154;690	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	F	2155;2154;690;2154	ENSP00000370263:V2155F;ENSP00000412940:V2154F;ENSP00000370278:V690F;ENSP00000370262:V2154F	ENSP00000370262:V2154F	V	-	1	0	FREM1	14727474	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	4.136000	0.58004	2.823000	0.97156	0.591000	0.81541	GTT		0.478	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		7	24	1	0	2.0095e-06	0.001984	2.49483e-06	7	24				
FRMPD1	22844	broad.mit.edu	37	9	37707468	37707468	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:37707468C>A	ENST00000539465.1	+	3	750	c.157C>A	c.(157-159)Cct>Act	p.P53T	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.P53T			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	53						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GACCCTCATCCCTGTGCGACA	0.502																																							uc004aag.1		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(157-159)CCT>ACT		FERM and PDZ domain containing 1							107.0	109.0	108.0					9																	37707468		2203	4300	6503	SO:0001583	missense	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37707468C>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.157C>A	9.37:g.37707468C>A	ENSP00000444411:p.Pro53Thr		Somatic				FRMPD1_uc004aah.1_Missense_Mutation_p.P53T	p.P53T	NM_014907	NP_055722	WXS	Illumina HiSeq	Unspecified	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	3	201	+			53					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	c.157C>A	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366571	0.41902	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000359927	T;T;T	0.38560	1.13;1.13;1.78	5.97	1.4	0.22301	PDZ/DHR/GLGF (1);	0.425407	0.25753	N	0.028532	T	0.27384	0.0672	L	0.47716	1.5	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06716	-1.0811	10	0.22109	T	0.4	-4.1521	2.7469	0.05270	0.1794:0.3641:0.35:0.1065	.	53	Q5SYB0	FRPD1_HUMAN	T	53	ENSP00000366995:P53T;ENSP00000444411:P53T;ENSP00000439868:P53T	ENSP00000439868:P53T	P	+	1	0	FRMPD1	37697468	0.376000	0.25098	0.990000	0.47175	0.987000	0.75469	-0.068000	0.11561	0.379000	0.24794	0.655000	0.94253	CCT		0.502	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		41	86	1	0	8.69298e-16	0.006999	1.4535e-15	41	86				
SPATA31A6	389730	broad.mit.edu	37	9	43627644	43627645	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:43627644_43627645CC>AA	ENST00000332857.6	-	4	1070_1071	c.1042_1043GG>TT	c.(1042-1044)GGa>TTa	p.G348L	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	348					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGTAAATGATCCAACATTTTCT	0.426																																							uc011lrb.1		NA																	0					0						c.(1042-1044)GGA>TTA		hypothetical protein LOC389730																																				SO:0001583	missense	389730					integral to membrane		g.chr9:43627644_43627645CC>AA		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1042_1043delinsAA	9.37:g.43627644_43627645delinsAA	ENSP00000329825:p.Gly348Leu		Somatic					p.G348L	NM_001145196	NP_001138668	WXS	Illumina HiSeq	Unspecified	Q5VVP1	F75A6_HUMAN			4	1071_1072	-			348						Missense_Mutation	DNP	ENST00000332857.6	37	c.1042_1043GG>TT	CCDS47973.1																																																																																				0.426	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		104	72	0	0	0	0.004672	0	104	72				
SPATA31A6	389730	broad.mit.edu	37	9	43630516	43630516	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:43630516T>C	ENST00000332857.6	-	1	214	c.186A>G	c.(184-186)agA>agG	p.R62R	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	62					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCTTACCTTTCTCTTCCCAG	0.468																																							uc011lrb.1		NA																	0					0						c.(184-186)AGA>AGG		hypothetical protein LOC389730																																				SO:0001819	synonymous_variant	389730					integral to membrane		g.chr9:43630516T>C		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.186A>G	9.37:g.43630516T>C			Somatic					p.R62R	NM_001145196	NP_001138668	WXS	Illumina HiSeq	Unspecified	Q5VVP1	F75A6_HUMAN			1	215	-			62						Silent	SNP	ENST00000332857.6	37	c.186A>G	CCDS47973.1																																																																																				0.468	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		61	40	0	0	0	0.00361	0	61	40				
Unknown	0	broad.mit.edu	37	9	66499722	66499722	+	IGR	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:66499722C>T								RP11-262H14.1 (30412 upstream) : RP11-262H14.7 (17483 downstream)																							GCCCAATCTGCTGGACAGCCT	0.597																																							uc004aee.1		NA																	0					0						c.(532-534)CTG>TTG		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499722C>T																													9.37:g.66499722C>T			Somatic				LOC442421_uc004aed.1_RNA	p.L178L			WXS	Illumina HiSeq	Unspecified					1	532	+									Silent	SNP		37	c.532C>T																																																																																				0	0.597									8	102	0	0	0	0.008291	0	8	102				
Unknown	0	broad.mit.edu	37	9	69067929	69067929	+	IGR	SNP	G	G	A	rs113676670		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:69067929G>A								MIR1299 (65608 upstream) : PGM5P2 (12310 downstream)																							TGATATGTTGGTGAGTCAGTT	0.279																																							uc004afe.1		NA																	0					NA						c.e3+1		Homo sapiens cDNA, FLJ18209.																																				SO:0001628	intergenic_variant	0							g.chr9:69067929G>A																													9.37:g.69067929G>A			Somatic				uc010mnq.1_Splice_Site				WXS	Illumina HiSeq	Unspecified					3		+									Splice_Site	SNP		37	c.744_splice																																																																																				0	0.279									10	20	0	0	0	0.003163	0	10	20				
FOXB2	442425	broad.mit.edu	37	9	79635314	79635314	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:79635314G>T	ENST00000376708.1	+	1	744	c.744G>T	c.(742-744)ggG>ggT	p.G248G		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	248					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(8)|ovary(1)	10						CACCCTACGGGCTGGGCTCGg	0.736																																							uc004ako.1		NA																	0					0						c.(742-744)GGG>GGT		forkhead box B2							7.0	9.0	8.0					9																	79635314		2065	4037	6102	SO:0001819	synonymous_variant	442425				brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr9:79635314G>T		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.744G>T	9.37:g.79635314G>T			Somatic					p.G248G	NM_001013735	NP_001013757	WXS	Illumina HiSeq	Unspecified	Q5VYV0	FOXB2_HUMAN			1	744	+			248						Silent	SNP	ENST00000376708.1	37	c.744G>T	CCDS35045.1																																																																																				0.736	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735		15	16	1	0	7.93312e-07	0.00245	1.00908e-06	15	16				
NTRK2	4915	broad.mit.edu	37	9	87570366	87570366	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:87570366G>C	ENST00000323115.4	+	15	2411	c.2058G>C	c.(2056-2058)gaG>gaC	p.E686D	NTRK2_ENST00000376213.1_Missense_Mutation_p.E686D|NTRK2_ENST00000376214.1_Missense_Mutation_p.E702D|NTRK2_ENST00000277120.3_Missense_Mutation_p.E702D			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	686	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TGGTCGGGGAGAACTTGCTGG	0.597										TSP Lung(25;0.17)																													uc004aoa.1		NA																	0				lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						c.(2056-2058)GAG>GAC		neurotrophic tyrosine kinase, receptor, type 2							60.0	61.0	61.0					9																	87570366		2203	4300	6503	SO:0001583	missense	4915				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity	g.chr9:87570366G>C	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.2058G>C	9.37:g.87570366G>C	ENSP00000314586:p.Glu686Asp	TSP Lung(25;0.17)	Somatic				NTRK2_uc004any.1_Missense_Mutation_p.E686D|NTRK2_uc004anz.1_Missense_Mutation_p.E702D	p.E686D	NM_001018064	NP_001018074	WXS	Illumina HiSeq	Unspecified	Q16620	NTRK2_HUMAN			18	2996	+			686			Protein kinase.|Cytoplasmic (Potential).		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	c.2058G>C	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266776	0.59540	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	4.98	4.98	0.66077	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82568	0.5065	N	0.21282	0.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.97	D;D;P	0.76071	0.985;0.987;0.775	T	0.81086	-0.1092	10	0.37606	T	0.19	.	8.6084	0.33786	0.2161:0.0:0.7839:0.0	.	686;702;732	Q16620;Q16620-4;Q59GJ1	NTRK2_HUMAN;.;.	D	702;686;702;686	ENSP00000365387:E702D;ENSP00000365386:E686D;ENSP00000277120:E702D;ENSP00000314586:E686D	ENSP00000277120:E702D	E	+	3	2	NTRK2	86760186	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.584000	0.46102	2.320000	0.78422	0.655000	0.94253	GAG		0.597	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1			6	34	0	0	0	0.00308	0	6	34				
SPATA31C2	645961	broad.mit.edu	37	9	90744655	90744655	+	IGR	SNP	C	C	A	rs372717598		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:90744655C>A								U6 (131405 upstream) : U3 (244528 downstream)																							CTGAGTAGAACGGGTGTCTGT	0.517																																							uc011lti.1		NA																	0					NA						c.(3295-3297)CCG>CCT		SubName: Full=cDNA FLJ59639;							122.0	95.0	103.0					9																	90744655		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90744655C>A																													9.37:g.90744655C>A			Somatic				uc004apx.1_5'Flank	p.P1099P			WXS	Illumina HiSeq	Unspecified					4	3326	-									Silent	SNP		37	c.3297G>T																																																																																				0	0.517									97	120	1	0	4.01927e-73	0.00361	7.73989e-73	97	120				
COL15A1	1306	broad.mit.edu	37	9	101749627	101749627	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:101749627C>A	ENST00000375001.3	+	4	1123	c.700C>A	c.(700-702)Ctg>Atg	p.L234M		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	234	Laminin G-like.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TCCCGAGGAGCTGTGTGACCC	0.642																																							uc004azb.1		NA																	0				ovary(6)	6						c.(700-702)CTG>ATG		alpha 1 type XV collagen precursor							125.0	119.0	121.0					9																	101749627		2203	4300	6503	SO:0001583	missense	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101749627C>A	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.700C>A	9.37:g.101749627C>A	ENSP00000364140:p.Leu234Met		Somatic					p.L234M	NM_001855	NP_001846	WXS	Illumina HiSeq	Unspecified	P39059	COFA1_HUMAN			4	906	+		Acute lymphoblastic leukemia(62;0.0562)	234			Nonhelical region 1 (NC1).		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	c.700C>A	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	6.168	0.399173	0.11696	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	T	0.74526	-0.85	5.1	2.15	0.27550	Concanavalin A-like lectin/glucanase (1);	0.665977	0.14807	N	0.297253	T	0.49218	0.1544	N	0.03115	-0.41	0.27134	N	0.96182	B	0.21452	0.056	B	0.24394	0.053	T	0.39522	-0.9610	10	0.33141	T	0.24	8.0E-4	8.1468	0.31117	0.3208:0.5242:0.155:0.0	.	234	P39059	COFA1_HUMAN	M	234;204	ENSP00000364140:L234M	ENSP00000364140:L234M	L	+	1	2	COL15A1	100789448	1.000000	0.71417	0.994000	0.49952	0.185000	0.23345	1.929000	0.40114	0.224000	0.20940	0.650000	0.86243	CTG		0.642	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		15	160	1	0	1.3612e-06	0.003163	1.72438e-06	15	160				
PTGR1	22949	broad.mit.edu	37	9	114348369	114348369	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:114348369T>C	ENST00000407693.2	-	5	548	c.286A>G	c.(286-288)Att>Gtt	p.I96V	PTGR1_ENST00000238248.3_5'UTR|PTGR1_ENST00000538962.1_Missense_Mutation_p.I96V|PTGR1_ENST00000309195.5_Missense_Mutation_p.I96V	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	96					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						CCATCAGAAATGGAGTGCGTT	0.473																																					Ovarian(200;132 2151 7551 19220 46064)	Ovarian(200;132 2151 7551 19220 46064)	uc004bfh.2		NA																	0					0						c.(286-288)ATT>GTT		prostaglandin reductase 1 isoform 1							156.0	125.0	135.0					9																	114348369		2203	4300	6503	SO:0001583	missense	22949				leukotriene metabolic process	cytoplasm	15-oxoprostaglandin 13-oxidase activity|2-alkenal reductase activity|alcohol dehydrogenase (NAD) activity|zinc ion binding	g.chr9:114348369T>C	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.286A>G	9.37:g.114348369T>C	ENSP00000385763:p.Ile96Val		Somatic				PTGR1_uc011lwr.1_Missense_Mutation_p.I96V|PTGR1_uc004bfi.3_Missense_Mutation_p.I96V|PTGR1_uc004bfj.3_5'UTR|PTGR1_uc010mue.2_Missense_Mutation_p.I96V	p.I96V	NM_012212	NP_036344	WXS	Illumina HiSeq	Unspecified	Q14914	PTGR1_HUMAN			5	389	-			96					A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	37	c.286A>G	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	T	5.725	0.318183	0.10845	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	4.74	3.59	0.41128	GroES-like (1);	0.166803	0.53938	D	0.000043	T	0.23410	0.0566	L	0.31294	0.92	0.80722	D	1	B;B;B	0.10296	0.003;0.002;0.0	B;B;B	0.14578	0.011;0.002;0.001	T	0.05007	-1.0912	10	0.14252	T	0.57	-0.2614	9.8209	0.40883	0.0:0.0851:0.0:0.9149	.	96;96;96	F5GY50;B4DPK3;Q14914	.;.;PTGR1_HUMAN	V	96;96;96;77;77	ENSP00000440281:I96V;ENSP00000311572:I96V;ENSP00000385763:I96V;ENSP00000395965:I77V	ENSP00000311572:I96V	I	-	1	0	PTGR1	113388190	0.996000	0.38824	0.997000	0.53966	0.752000	0.42762	0.828000	0.27435	0.911000	0.36747	0.459000	0.35465	ATT		0.473	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2			28	53	0	0	0	0.005443	0	28	53				
PAPPA	5069	broad.mit.edu	37	9	119106938	119106938	+	Missense_Mutation	SNP	G	G	T	rs142176678		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:119106938G>T	ENST00000328252.3	+	14	4097	c.3728G>T	c.(3727-3729)cGg>cTg	p.R1243L	PAPPA_ENST00000534838.1_Missense_Mutation_p.R281L	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1243	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GTGAGCTGCCGGACAGGCTAC	0.582																																							uc004bjn.2		NA																	0				ovary(4)|skin(4)|pancreas(1)	9						c.(3727-3729)CGG>CTG		pregnancy-associated plasma protein A							90.0	76.0	80.0					9																	119106938		2203	4300	6503	SO:0001583	missense	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:119106938G>T		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3728G>T	9.37:g.119106938G>T	ENSP00000330658:p.Arg1243Leu		Somatic				PAPPA_uc011lxq.1_Missense_Mutation_p.R618L	p.R1243L	NM_002581	NP_002572	WXS	Illumina HiSeq	Unspecified	Q13219	PAPP1_HUMAN			14	4109	+			1243			Sushi 1.		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	c.3728G>T	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.566553	0.28003	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.76186	-1.0;-1.0	5.36	-3.52	0.04682	Complement control module (2);Sushi/SCR/CCP (2);	0.912829	0.09538	N	0.788681	T	0.63426	0.2510	L	0.40543	1.245	0.18873	N	0.999986	B;B	0.15719	0.014;0.0	B;B	0.19391	0.025;0.001	T	0.50127	-0.8864	10	0.25751	T	0.34	-3.9131	13.4567	0.61204	0.7421:0.0:0.2579:0.0	.	281;1243	F5GZ19;Q13219	.;PAPP1_HUMAN	L	1243;281	ENSP00000330658:R1243L;ENSP00000441461:R281L	ENSP00000330658:R1243L	R	+	2	0	PAPPA	118146759	0.735000	0.28153	0.371000	0.25978	0.611000	0.37282	0.423000	0.21313	-0.483000	0.06772	-0.768000	0.03414	CGG		0.582	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		33	45	1	0	2.80507e-11	0.012213	4.19412e-11	33	45				
TLR4	7099	broad.mit.edu	37	9	120476646	120476646	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:120476646G>T	ENST00000355622.6	+	3	2341	c.2240G>T	c.(2239-2241)tGt>tTt	p.C747F	TLR4_ENST00000394487.4_Missense_Mutation_p.C707F|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	747	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AGCCGCTGGTGTATCTTTGAA	0.507																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(2239-2241)TGT>TTT		toll-like receptor 4 precursor							73.0	74.0	74.0					9																	120476646		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476646G>T	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2240G>T	9.37:g.120476646G>T	ENSP00000363089:p.Cys747Phe		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.C707F|TLR4_uc004bkb.2_Missense_Mutation_p.C547F	p.C747F	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	2531	+			747			Cytoplasmic (Potential).|TIR.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.2240G>T	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612609	0.87258	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.03524	3.9;3.9	6.03	6.03	0.97812	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.17195	0.0413	L	0.59967	1.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00039	-1.2240	10	0.40728	T	0.16	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	747	O00206	TLR4_HUMAN	F	707;747	ENSP00000377997:C707F;ENSP00000363089:C747F	ENSP00000363089:C747F	C	+	2	0	TLR4	119516467	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.529000	0.98049	2.861000	0.98227	0.655000	0.94253	TGT		0.507	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		4	68	1	0	0.00024832	0.009096	0.000280318	4	68				
AK1	203	broad.mit.edu	37	9	130635071	130635071	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:130635071G>A	ENST00000373176.1	-	4	257	c.105C>T	c.(103-105)acC>acT	p.T35T	RP11-203J24.9_ENST00000476274.2_RNA|AK1_ENST00000223836.10_Silent_p.T51T|AK1_ENST00000373156.1_Silent_p.T35T	NM_000476.2	NP_000467.1			adenylate kinase 1											endometrium(1)|prostate(1)	2						TGGAGAGGTGGGTGTAGCCAT	0.617																																							uc004bsm.3		NA																	0					0						c.(103-105)ACC>ACT		adenylate kinase 1							70.0	58.0	62.0					9																	130635071		2203	4300	6503	SO:0001819	synonymous_variant	203				ATP metabolic process|nucleobase, nucleoside and nucleotide interconversion	cytosol	adenylate kinase activity|ATP binding|protein binding	g.chr9:130635071G>A	J04809	CCDS6881.1	9q34.1	2008-02-05			ENSG00000106992	ENSG00000106992	2.7.4.3	"""Adenylate kinases"""	361	protein-coding gene	gene with protein product		103000					Standard	NM_000476		Approved		uc004bsm.4	P00568	OTTHUMG00000020722	ENST00000373176.1:c.105C>T	9.37:g.130635071G>A			Somatic					p.T35T	NM_000476	NP_000467	WXS	Illumina HiSeq	Unspecified	P00568	KAD1_HUMAN			4	258	-			35						Silent	SNP	ENST00000373176.1	37	c.105C>T	CCDS6881.1																																																																																				0.617	AK1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054307.1			5	41	0	0	0	0.000602	0	5	41				
ADAMTSL2	9719	broad.mit.edu	37	9	136405847	136405847	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:136405847C>A	ENST00000354484.4	+	6	1097	c.540C>A	c.(538-540)tgC>tgA	p.C180*	ADAMTSL2_ENST00000393060.1_Nonsense_Mutation_p.C180*|ADAMTSL2_ENST00000393061.3_Nonsense_Mutation_p.C289*	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	180					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GAGGGGTTTGCGTGTCTGGAA	0.637																																							uc011mdl.1		NA																	0				ovary(1)	1						c.(538-540)TGC>TGA		ADAMTS-like 2 precursor							81.0	70.0	73.0					9																	136405847		2203	4300	6503	SO:0001587	stop_gained	9719				negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding	g.chr9:136405847C>A	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.540C>A	9.37:g.136405847C>A	ENSP00000346478:p.Cys180*		Somatic				ADAMTSL2_uc004cei.2_Nonsense_Mutation_p.C180*	p.C180*	NM_001145320	NP_001138792	WXS	Illumina HiSeq	Unspecified	Q86TH1	ATL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)	6	1097	+			180					B1B0D5|O60345	Nonsense_Mutation	SNP	ENST00000354484.4	37	c.540C>A	CCDS6976.1	.	.	.	.	.	.	.	.	.	.	C	43	10.031830	0.99321	.	.	ENSG00000197859	ENST00000354484;ENST00000393061;ENST00000393060	.	.	.	4.58	4.58	0.56647	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9762	0.47467	0.0:0.9133:0.0:0.0867	.	.	.	.	X	180;289;180	.	ENSP00000346478:C180X	C	+	3	2	ADAMTSL2	135395668	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.278000	0.43426	2.093000	0.63338	0.462000	0.41574	TGC		0.637	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694		16	26	1	0	3.52763e-06	0.00499	4.33634e-06	16	26				
COL5A1	1289	broad.mit.edu	37	9	137630345	137630345	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:137630345G>T	ENST00000371817.3	+	10	1829	c.1415G>T	c.(1414-1416)gGc>gTc	p.G472V		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	472	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGCCCGCCTGGCCCAGAAGGC	0.642																																							uc004cfe.2		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(1414-1416)GGC>GTC		alpha 1 type V collagen preproprotein							44.0	47.0	46.0					9																	137630345		2203	4300	6503	SO:0001583	missense	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137630345G>T	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1415G>T	9.37:g.137630345G>T	ENSP00000360882:p.Gly472Val		Somatic					p.G472V	NM_000093	NP_000084	WXS	Illumina HiSeq	Unspecified	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	10	1797	+		Myeloproliferative disorder(178;0.0341)	472			Interrupted collagenous region.		Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	c.1415G>T	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875983	0.33162	.	.	ENSG00000130635	ENST00000371817	D	0.99353	-5.77	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.99697	0.9885	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97039	0.9756	10	0.87932	D	0	.	16.3829	0.83481	0.0:0.0:1.0:0.0	.	472	P20908	CO5A1_HUMAN	V	472	ENSP00000360882:G472V	ENSP00000360882:G472V	G	+	2	0	COL5A1	136770166	1.000000	0.71417	0.881000	0.34555	0.028000	0.11728	5.554000	0.67294	2.166000	0.68216	0.491000	0.48974	GGC		0.642	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		7	76	1	0	1.58986e-06	0.008291	1.99374e-06	7	76				
SOHLH1	402381	broad.mit.edu	37	9	138588531	138588531	+	Silent	SNP	C	C	G	rs546290088		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:138588531C>G	ENST00000298466.5	-	5	648	c.588G>C	c.(586-588)acG>acC	p.T196T	SOHLH1_ENST00000425225.1_Silent_p.T196T	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	196					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		TGCCCAGGGACGTGCAGCTCG	0.667																																							uc004cgl.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(586-588)ACG>ACC		spermatogenesis and oogenesis specific basic							54.0	50.0	51.0					9																	138588531		2203	4299	6502	SO:0001819	synonymous_variant	402381				cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr9:138588531C>G	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.588G>C	9.37:g.138588531C>G			Somatic				SOHLH1_uc010nbe.2_Silent_p.T196T	p.T196T	NM_001012415	NP_001012415	WXS	Illumina HiSeq	Unspecified	Q5JUK2	SOLH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)	5	649	-		Myeloproliferative disorder(178;0.0511)	196					C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Silent	SNP	ENST00000298466.5	37	c.588G>C	CCDS35174.1																																																																																				0.667	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415		17	26	0	0	0	0.00499	0	17	26				
PHPT1	29085	broad.mit.edu	37	9	139747556	139747556	+	IGR	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:139747556G>T	ENST00000247665.10	+	0	890				MAMDC4_ENST00000485732.1_Intron|MAMDC4_ENST00000445819.1_Missense_Mutation_p.G17W|MAMDC4_ENST00000317446.2_Missense_Mutation_p.G17W	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1						negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CCCAGCAGCAGGGTCCTCAGG	0.622																																							uc004cjs.2		NA																	0				breast(4)|upper_aerodigestive_tract(2)|central_nervous_system(1)	7						c.(49-51)GGG>TGG		apical early endosomal glycoprotein precursor							30.0	31.0	30.0					9																	139747556		2197	4296	6493	SO:0001628	intergenic_variant	158056				protein transport	integral to membrane		g.chr9:139747556G>T	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950		9.37:g.139747556G>T			Somatic				MAMDC4_uc011mej.1_Translation_Start_Site	p.G17W	NM_206920	NP_996803	WXS	Illumina HiSeq	Unspecified	Q6UXC1	AEGP_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)	2	99	+	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)	17					B1AMX0|B1AMX1|Q9H0Y3	Missense_Mutation	SNP	ENST00000247665.10	37	c.49G>T	CCDS7009.1	.	.	.	.	.	.	.	.	.	.	.	3.868	-0.028408	0.07589	.	.	ENSG00000177943	ENST00000317446;ENST00000445819	T;T	0.02301	4.41;4.35	3.95	-2.23	0.06930	.	1.467820	0.04652	N	0.407374	T	0.03477	0.0100	M	0.62723	1.935	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.45775	-0.9238	10	0.87932	D	0	-2.603	4.4028	0.11395	0.1632:0.1708:0.5578:0.1083	.	17	Q6UXC1-2	.	W	17	ENSP00000319388:G17W;ENSP00000411339:G17W	ENSP00000319388:G17W	G	+	1	0	MAMDC4	138867377	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.386000	0.07370	-0.967000	0.03582	-1.598000	0.00824	GGG		0.622	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055150.1	NM_014172		18	12	1	0	1.67942e-08	0.006122	2.30087e-08	18	12				
TUBBP5	643224	broad.mit.edu	37	9	141071111	141071111	+	RNA	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr9:141071111G>T	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		GCGCTTCCCAGGCCAGCTGAA	0.602																																							uc004com.2		NA																	0					0						c.(514-516)GGC>TGC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071111G>T	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071111G>T			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.G172C			WXS	Illumina HiSeq	Unspecified					4	775	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.514G>T																																																																																					0.602	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		4	75	1	0	1.23904e-05	0.000602	1.49647e-05	4	75				
TLR7	51284	broad.mit.edu	37	X	12906090	12906090	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:12906090G>A	ENST00000380659.3	+	3	2602	c.2463G>A	c.(2461-2463)aaG>aaA	p.K821K		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	821					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GAGCACACAAGGGCCAAAGTG	0.488																																							uc004cvc.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(2461-2463)AAG>AAA		toll-like receptor 7 precursor	Imiquimod(DB00724)						167.0	135.0	146.0					X																	12906090		2203	4300	6503	SO:0001819	synonymous_variant	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12906090G>A	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2463G>A	X.37:g.12906090G>A			Somatic					p.K821K	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	2602	+			821			Extracellular (Potential).		D1CS69|Q9NR98	Silent	SNP	ENST00000380659.3	37	c.2463G>A	CCDS14151.1																																																																																				0.488	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		13	74	0	0	0	0.001855	0	13	74				
ATXN3L	92552	broad.mit.edu	37	X	13337276	13337276	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:13337276C>A	ENST00000380622.2	-	1	1242	c.778G>T	c.(778-780)Gga>Tga	p.G260*	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	260					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GATGTGTTTCCGGAACTACCT	0.428																																							uc010ned.2		NA																	0				lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(778-780)GGA>TGA		ataxin 3-like							352.0	303.0	318.0					X																	13337276		1568	3582	5150	SO:0001587	stop_gained	92552				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity	g.chrX:13337276C>A		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.778G>T	X.37:g.13337276C>A	ENSP00000369996:p.Gly260*		Somatic					p.G260*	NM_001135995	NP_001129467	WXS	Illumina HiSeq	Unspecified	Q9H3M9	ATX3L_HUMAN			1	1243	-			260					B2RNY8	Nonsense_Mutation	SNP	ENST00000380622.2	37	c.778G>T	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	c	20.9	4.070131	0.76301	.	.	ENSG00000123594	ENST00000380622	.	.	.	0.793	-1.59	0.08453	.	0.545445	0.20910	N	0.083485	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1383	0.14947	0.0:0.4309:0.0:0.5691	.	.	.	.	X	260	.	ENSP00000369996:G260X	G	-	1	0	ATXN3L	13247197	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.990000	0.03481	-1.726000	0.00704	GGA		0.428	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995		10	330	1	0	1.58986e-06	0.008291	1.99374e-06	10	330				
RAI2	10742	broad.mit.edu	37	X	17818712	17818712	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:17818712G>T	ENST00000545871.1	-	3	1879	c.1419C>A	c.(1417-1419)tcC>tcA	p.S473S	RAI2_ENST00000331511.1_Silent_p.S473S|RAI2_ENST00000451717.1_Silent_p.S473S|RAI2_ENST00000415486.3_Silent_p.S423S|RAI2_ENST00000360011.1_Silent_p.S473S	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	473					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					CCTGAAGCACGGAGTCTTCTC	0.478																																							uc004cyf.2		NA																	0				ovary(1)|breast(1)	2						c.(1417-1419)TCC>TCA		retinoic acid induced 2							227.0	232.0	230.0					X																	17818712		2203	4300	6503	SO:0001819	synonymous_variant	10742				embryo development			g.chrX:17818712G>T	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1419C>A	X.37:g.17818712G>T			Somatic				RAI2_uc004cyg.2_Silent_p.S473S|RAI2_uc010nfa.2_Silent_p.S473S|RAI2_uc004cyh.3_Silent_p.S473S|RAI2_uc011miy.1_Silent_p.S423S	p.S473S	NM_021785	NP_068557	WXS	Illumina HiSeq	Unspecified	Q9Y5P3	RAI2_HUMAN			3	1989	-	Hepatocellular(33;0.183)		473					B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Silent	SNP	ENST00000545871.1	37	c.1419C>A	CCDS14183.1																																																																																				0.478	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785		38	276	1	0	1.69901e-12	0.005524	2.64858e-12	38	276				
BEND2	139105	broad.mit.edu	37	X	18230737	18230737	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:18230737T>C	ENST00000380033.4	-	4	572	c.440A>G	c.(439-441)tAc>tGc	p.Y147C	BEND2_ENST00000380030.3_Missense_Mutation_p.Y147C	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	147										NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						CTCTGAGTTGTAACTGTATCT	0.338																																							uc004cyj.3		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(439-441)TAC>TGC		BEN domain containing 2							185.0	169.0	174.0					X																	18230737		2203	4300	6503	SO:0001583	missense	139105							g.chrX:18230737T>C	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.440A>G	X.37:g.18230737T>C	ENSP00000369372:p.Tyr147Cys		Somatic				BEND2_uc010nfb.2_Missense_Mutation_p.Y147C	p.Y147C	NM_153346	NP_699177	WXS	Illumina HiSeq	Unspecified	Q8NDZ0	BEND2_HUMAN			4	594	-			147					E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	c.440A>G	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	T	11.36	1.614518	0.28712	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.30182	1.62;1.54	3.14	-1.65	0.08291	.	1.235140	0.06133	U	0.670955	T	0.20981	0.0505	N	0.19112	0.55	0.09310	N	1	D;D	0.53462	0.96;0.96	P;P	0.46076	0.503;0.503	T	0.16928	-1.0386	10	0.48119	T	0.1	.	4.3646	0.11218	0.1349:0.0:0.2756:0.5895	.	147;147	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	C	147	ENSP00000369372:Y147C;ENSP00000369369:Y147C	ENSP00000369369:Y147C	Y	-	2	0	BEND2	18140658	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.227000	0.17795	-0.255000	0.09486	-0.716000	0.03619	TAC		0.338	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346		10	71	0	0	0	0.001855	0	10	71				
CNKSR2	22866	broad.mit.edu	37	X	21444616	21444616	+	Splice_Site	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:21444616T>C	ENST00000379510.3	+	2	102	c.66T>C	c.(64-66)ggT>ggC	p.G22G	CNKSR2_ENST00000425654.2_Splice_Site_p.G22G|CNKSR2_ENST00000543067.1_Splice_Site_p.G22G|CNKSR2_ENST00000279451.4_Splice_Site_p.G22G	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	22	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ATTTTGTAGGTCTTGATGACT	0.413																																							uc004czx.1		NA																	0				large_intestine(1)|lung(1)	2						c.(64-66)GGT>GGC		connector enhancer of kinase suppressor of Ras							58.0	55.0	56.0					X																	21444616		2203	4300	6503	SO:0001630	splice_region_variant	22866				regulation of signal transduction	cytoplasm|membrane	protein binding	g.chrX:21444616T>C	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.65-1T>C	X.37:g.21444616T>C			Somatic				CNKSR2_uc004czw.2_Silent_p.G22G|CNKSR2_uc011mjn.1_Silent_p.G22G|CNKSR2_uc011mjo.1_Silent_p.G22G	p.G22G	NM_014927	NP_055742	WXS	Illumina HiSeq	Unspecified	Q8WXI2	CNKR2_HUMAN			2	102	+			22			SAM.		B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	ENST00000379510.3	37	c.66T>C	CCDS14198.1																																																																																				0.413	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	Silent	4	40	0	0	0	0.009096	0	4	40				
MAGEB6	158809	broad.mit.edu	37	X	26212219	26212219	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:26212219G>T	ENST00000379034.1	+	2	405	c.256G>T	c.(256-258)Gcc>Tcc	p.A86S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	86	Ser-rich.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						CGATGTGGCTGCCAACGGCCA	0.542																																							uc004dbr.2		NA																	0				ovary(3)	3						c.(256-258)GCC>TCC		melanoma antigen family B, 6							91.0	84.0	86.0					X																	26212219		2202	4300	6502	SO:0001583	missense	158809							g.chrX:26212219G>T	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.256G>T	X.37:g.26212219G>T	ENSP00000368320:p.Ala86Ser		Somatic				MAGEB6_uc010ngc.1_5'UTR	p.A86S	NM_173523	NP_775794	WXS	Illumina HiSeq	Unspecified	Q8N7X4	MAGB6_HUMAN			2	405	+			86			Ser-rich.		Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	c.256G>T	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	G	9.475	1.096704	0.20552	.	.	ENSG00000176746	ENST00000379034	T	0.02916	4.11	1.86	0.904	0.19302	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.02304	0.0071	L	0.41632	1.29	0.09310	N	1	P	0.40534	0.72	B	0.32864	0.154	T	0.46247	-0.9205	9	0.44086	T	0.13	.	4.8599	0.13579	0.0:0.0:0.6414:0.3586	.	86	Q8N7X4	MAGB6_HUMAN	S	86	ENSP00000368320:A86S	ENSP00000368320:A86S	A	+	1	0	MAGEB6	26122140	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.329000	0.19698	0.205000	0.20568	0.429000	0.28392	GCC		0.542	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		10	52	1	0	1.33987e-11	0.008291	2.03268e-11	10	52				
MAGEB4	4115	broad.mit.edu	37	X	30261111	30261111	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:30261111G>T	ENST00000378982.2	+	1	1055	c.859G>T	c.(859-861)Gag>Tag	p.E287*	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	287	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GAAAGTCCTGGAGTTTTTGGC	0.512																																							uc004dcb.2		NA																	0				ovary(1)	1						c.(859-861)GAG>TAG		melanoma antigen family B, 4							75.0	74.0	74.0					X																	30261111		2202	4300	6502	SO:0001587	stop_gained	4115							g.chrX:30261111G>T		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.859G>T	X.37:g.30261111G>T	ENSP00000368266:p.Glu287*		Somatic				MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	p.E287*	NM_002367	NP_002358	WXS	Illumina HiSeq	Unspecified	O15481	MAGB4_HUMAN			1	943	+			287			MAGE.		B2R9G0|Q6FHH4|Q8IZ00	Nonsense_Mutation	SNP	ENST00000378982.2	37	c.859G>T	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	G	37	6.164603	0.97338	.	.	ENSG00000120289	ENST00000378982	.	.	.	3.16	2.29	0.28610	.	0.381530	0.21913	U	0.067278	.	.	.	.	.	.	0.54753	D	0.999989	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	5.176	0.15135	0.1654:0.0:0.8346:0.0	.	.	.	.	X	287	.	ENSP00000368266:E287X	E	+	1	0	MAGEB4	30171032	0.016000	0.18221	0.009000	0.14445	0.845000	0.48019	0.504000	0.22626	0.717000	0.32145	0.600000	0.82982	GAG		0.512	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367		26	59	1	0	6.32553e-13	0.004656	9.93556e-13	26	59				
FAM47C	442444	broad.mit.edu	37	X	37027649	37027649	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:37027649C>T	ENST00000358047.3	+	1	1218	c.1166C>T	c.(1165-1167)cCt>cTt	p.P389L		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	389										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CGCGTACCTCCTCTCCGCCCA	0.617																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(1165-1167)CCT>CTT		hypothetical protein LOC442444							58.0	59.0	58.0					X																	37027649		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37027649C>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1166C>T	X.37:g.37027649C>T	ENSP00000367913:p.Pro389Leu		Somatic					p.P389L	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	1180	+			389					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.1166C>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	g	10.73	1.431919	0.25813	.	.	ENSG00000198173	ENST00000358047	T	0.13307	2.6	1.23	-2.47	0.06442	.	.	.	.	.	T	0.08670	0.0215	N	0.22421	0.69	0.09310	N	1	P	0.46512	0.879	P	0.45276	0.475	T	0.08310	-1.0728	9	0.33940	T	0.23	.	3.2053	0.06663	0.3659:0.2242:0.4099:0.0	.	389	Q5HY64	FA47C_HUMAN	L	389	ENSP00000367913:P389L	ENSP00000367913:P389L	P	+	2	0	FAM47C	36937570	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.076000	0.00616	-2.415000	0.00568	-2.832000	0.00106	CCT		0.617	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		35	85	0	0	0	0.003755	0	35	85				
MAOB	4129	broad.mit.edu	37	X	43662545	43662545	+	Splice_Site	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:43662545A>T	ENST00000378069.4	-	4	532		c.e4+1		MAOB_ENST00000538942.1_Splice_Site|MAOB_ENST00000487544.1_Splice_Site|MAOB_ENST00000536181.1_Splice_Site	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B						negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	AAGAAGCTTTACCTCTCGCCC	0.378																																							uc004dfz.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.e4+1		monoamine oxidase B	Amantadine(DB00915)|Bupropion(DB01156)|Carbidopa(DB00190)|Citalopram(DB00215)|Dopamine(DB00988)|Entacapone(DB00494)|Furazolidone(DB00614)|Ginkgo biloba(DB01381)|Ibuprofen(DB01050)|Imipramine(DB00458)|Iproniazid(DB04818)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Maprotiline(DB00934)|Meclizine(DB00737)|Moclobemide(DB01171)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Rasagiline(DB01367)|Selegiline(DB01037)|Tranylcypromine(DB00752)						70.0	67.0	68.0					X																	43662545		2203	4299	6502	SO:0001630	splice_region_variant	4129				xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	electron carrier activity|primary amine oxidase activity	g.chrX:43662545A>T		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.384+1T>A	X.37:g.43662545A>T			Somatic				MAOB_uc011mkx.1_Splice_Site_p.E112_splice|MAOB_uc011mky.1_Splice_Site_p.E112_splice	p.E128_splice	NM_000898	NP_000889	WXS	Illumina HiSeq	Unspecified	P27338	AOFB_HUMAN			4	560	-								B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Splice_Site	SNP	ENST00000378069.4	37	c.384_splice	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.107846	0.37242	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9046	0.70709	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAOB	43547489	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	8.536000	0.90627	1.970000	0.57323	0.345000	0.21793	.		0.378	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	Intron	4	45	0	0	0	0.009096	0	4	45				
JADE3	9767	broad.mit.edu	37	X	46917891	46917891	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:46917891G>T	ENST00000218343.4	+	11	2182	c.1884G>T	c.(1882-1884)tcG>tcT	p.S628S	PHF16_ENST00000397189.1_Silent_p.S628S	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						CCCCGTCCTCGGAGTGCTATC	0.537																																							uc004dgx.2		NA																	0					0						c.(1882-1884)TCG>TCT		PHD finger protein 16							55.0	51.0	52.0					X																	46917891		2203	4300	6503	SO:0001819	synonymous_variant	9767				histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding	g.chrX:46917891G>T																												ENST00000218343.4:c.1884G>T	X.37:g.46917891G>T			Somatic				PHF16_uc004dgy.2_Silent_p.S628S	p.S628S	NM_001077445	NP_001070913	WXS	Illumina HiSeq	Unspecified	Q92613	JADE3_HUMAN			11	1935	+			628						Silent	SNP	ENST00000218343.4	37	c.1884G>T	CCDS14271.1																																																																																				0.537	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1			9	62	1	0	1.76689e-08	0.006214	2.4101e-08	9	62				
NDUFB11	54539	broad.mit.edu	37	X	47002067	47002067	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:47002067A>T	ENST00000377811.3	-	2	1108	c.284T>A	c.(283-285)gTc>gAc	p.V95D	RBM10_ENST00000377604.3_5'Flank|RBM10_ENST00000345781.6_5'Flank|NDUFB11_ENST00000276062.8_Missense_Mutation_p.V95D|RBM10_ENST00000329236.7_5'Flank	NM_001135998.2	NP_001129470.1	Q9NX14	NDUBB_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa	95					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7						GATGATGGAGACGCCAAAGAA	0.532																																					Ovarian(77;454 1296 7908 21551 37072)	Ovarian(77;454 1296 7908 21551 37072)	uc004dhd.2		NA																	0					0						c.(283-285)GTC>GAC		NADH dehydrogenase (ubiquinone) 1 beta							181.0	140.0	154.0					X																	47002067		2203	4300	6503	SO:0001583	missense	54539				respiratory electron transport chain|transport	integral to membrane|mitochondrial respiratory chain complex I		g.chrX:47002067A>T	AF044213	CCDS14273.1, CCDS48100.1	Xp11.3	2011-07-04			ENSG00000147123	ENSG00000147123		"""Mitochondrial respiratory chain complex / Complex I"""	20372	protein-coding gene	gene with protein product	"""complex I NP17.3 subunit"""	300403				10544803, 12381726	Standard	NM_019056		Approved	ESSS, NP17.3, Np15	uc004dhc.3	Q9NX14	OTTHUMG00000021433	ENST00000377811.3:c.284T>A	X.37:g.47002067A>T	ENSP00000367042:p.Val95Asp		Somatic				NDUFB11_uc004dhc.2_Missense_Mutation_p.V95D|RBM10_uc004dhe.1_5'Flank|RBM10_uc004dhf.2_5'Flank|RBM10_uc004dhg.2_5'Flank|RBM10_uc004dhh.2_5'Flank|RBM10_uc010nhq.2_5'Flank|RBM10_uc004dhi.2_5'Flank	p.V95D	NM_001135998	NP_001129470	WXS	Illumina HiSeq	Unspecified	Q9NX14	NDUBB_HUMAN			2	815	-			95			Helical; (Potential).		Q5JRR3|Q5JRR4|Q6IAB6|Q8WZ96|Q9BXX9	Missense_Mutation	SNP	ENST00000377811.3	37	c.284T>A	CCDS48100.1	.	.	.	.	.	.	.	.	.	.	a	14.09	2.430945	0.43122	.	.	ENSG00000147123	ENST00000377811;ENST00000447793;ENST00000276062	.	.	.	4.12	4.12	0.48240	.	0.222936	0.36893	N	0.002355	T	0.60209	0.2251	L	0.54323	1.7	0.52501	D	0.999953	D;D	0.56287	0.975;0.975	P;P	0.51974	0.686;0.658	T	0.64015	-0.6506	9	0.87932	D	0	-10.6103	9.0876	0.36590	1.0:0.0:0.0:0.0	.	95;95	Q9NX14;Q9NX14-2	NDUBB_HUMAN;.	D	95;99;95	.	ENSP00000276062:V95D	V	-	2	0	NDUFB11	46887011	1.000000	0.71417	0.997000	0.53966	0.047000	0.14425	6.658000	0.74407	1.599000	0.50093	0.437000	0.28790	GTC		0.532	NDUFB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056382.1	NM_019056		23	67	0	0	0	0.00333	0	23	67				
SLC35A2	7355	broad.mit.edu	37	X	48767203	48767203	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:48767203G>A	ENST00000247138.5	-	2	165	c.162C>T	c.(160-162)atC>atT	p.I54I	SLC35A2_ENST00000452555.2_Silent_p.I82I|SLC35A2_ENST00000413561.2_Intron|SLC35A2_ENST00000376515.3_Silent_p.I30I|SLC35A2_ENST00000376521.1_Silent_p.I54I|SLC35A2_ENST00000376512.1_Silent_p.I54I|SLC35A2_ENST00000445167.2_Silent_p.I54I|SLC35A2_ENST00000376529.3_Silent_p.I54I	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	54					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						GGGCGTAGCGGATGCTGAGGA	0.612																																							uc004dlo.1		NA																	0				breast(1)	1						c.(160-162)ATC>ATT		solute carrier family 35, member A2 isoform a							97.0	67.0	77.0					X																	48767203		2203	4300	6503	SO:0001819	synonymous_variant	7355				galactose metabolic process	Golgi membrane|integral to membrane|nucleus	sugar:hydrogen symporter activity|UDP-galactose transmembrane transporter activity	g.chrX:48767203G>A	D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.162C>T	X.37:g.48767203G>A			Somatic				SLC35A2_uc011mml.1_Silent_p.I67I|SLC35A2_uc004dlp.1_Silent_p.I54I|SLC35A2_uc011mmm.1_Silent_p.I82I|SLC35A2_uc011mmn.1_Intron|SLC35A2_uc004dlr.1_5'UTR|SLC35A2_uc004dlq.2_Silent_p.I54I|SLC35A2_uc011mmo.1_Silent_p.I67I	p.I54I	NM_005660	NP_005651	WXS	Illumina HiSeq	Unspecified	P78381	S35A2_HUMAN			2	166	-			54			Helical; (Potential).		A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Silent	SNP	ENST00000247138.5	37	c.162C>T	CCDS14311.1																																																																																				0.612	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060790.1	NM_005660		7	32	0	0	0	0.001984	0	7	32				
MAGIX	79917	broad.mit.edu	37	X	49022560	49022560	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:49022560C>A	ENST00000412696.2	+	6	827	c.827C>A	c.(826-828)gCc>gAc	p.A276D	MAGIX_ENST00000425661.2_Missense_Mutation_p.A200D|MAGIX_ENST00000376339.1_Missense_Mutation_p.A212D|MAGIX_ENST00000376338.3_Missense_Mutation_p.A217D|MAGIX_ENST00000498742.1_3'UTR	NM_024859.2	NP_079135.3	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked	276																	CCAGAGGCGGCCGCCGATGGC	0.687																																							uc010nin.1		NA																	0					0						c.(826-828)GCC>GAC		MAGI family member, X-linked isoform a							9.0	13.0	12.0					X																	49022560		1856	4028	5884	SO:0001583	missense	79917							g.chrX:49022560C>A	AK025340	CCDS48106.1, CCDS48107.1, CCDS75976.1	Xp11.23	2014-05-06			ENSG00000017621	ENSG00000269313			30006	protein-coding gene	gene with protein product							Standard	XM_005278065		Approved	PDZX, JM10, FLJ21687	uc010nin.1	Q9H6Y5	OTTHUMG00000188218	ENST00000412696.2:c.827C>A	X.37:g.49022560C>A	ENSP00000387928:p.Ala276Asp		Somatic				MAGIX_uc010nio.1_Missense_Mutation_p.A200D|MAGIX_uc004dmt.2_Missense_Mutation_p.A195D|MAGIX_uc004dmu.2_Missense_Mutation_p.A217D|MAGIX_uc004dmw.2_Missense_Mutation_p.A204D	p.A276D	NM_024859	NP_079135	WXS	Illumina HiSeq	Unspecified	Q9H6Y5	MAGIX_HUMAN			6	874	+			276					A6XND4|A8MSX9|B7WP26|Q14C81	Missense_Mutation	SNP	ENST00000412696.2	37	c.827C>A	CCDS48106.1	.	.	.	.	.	.	.	.	.	.	.	13.79	2.342109	0.41498	.	.	ENSG00000017621	ENST00000376339;ENST00000425661;ENST00000412696;ENST00000376338;ENST00000454342	T;T;T;T;T	0.40225	1.77;2.11;1.55;1.51;1.04	3.86	-1.93	0.07594	.	0.986398	0.08214	N	0.980294	T	0.37919	0.1021	N	0.24115	0.695	0.09310	N	1	P;P;D;D;P	0.60575	0.731;0.771;0.969;0.988;0.567	B;B;P;P;B	0.56700	0.326;0.305;0.735;0.804;0.165	T	0.33292	-0.9874	10	0.37606	T	0.19	-1.3727	6.4637	0.21970	0.0:0.6503:0.1649:0.1847	.	200;276;212;217;143	F8WCY7;Q9H6Y5;Q9H6Y5-3;Q9H6Y5-2;C9J123	.;MAGIX_HUMAN;.;.;.	D	212;200;276;217;143	ENSP00000365517:A212D;ENSP00000403515:A200D;ENSP00000387928:A276D;ENSP00000365516:A217D;ENSP00000400147:A143D	ENSP00000365516:A217D	A	+	2	0	MAGIX	48909504	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.496000	0.06436	-0.524000	0.06400	-2.146000	0.00336	GCC		0.687	MAGIX-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378832.1	NM_024859		7	12	1	0	0.000157383	0.00308	0.000179949	7	12				
AMER1	139285	broad.mit.edu	37	X	63411318	63411318	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:63411318C>A	ENST00000330258.3	-	2	2121	c.1849G>T	c.(1849-1851)Gaa>Taa	p.E617*	AMER1_ENST00000374869.3_Nonsense_Mutation_p.E617*|AMER1_ENST00000403336.1_Nonsense_Mutation_p.E617*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	617					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.E617*(2)									CCATGAGCTTCCCAAGTGTGG	0.637																																							uc004dvo.2		NA																	69	Whole gene deletion(67)|Substitution - Nonsense(2)	p.0?(40)	kidney(65)|large_intestine(3)|ovary(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(1849-1851)GAA>TAA		family with sequence similarity 123B							29.0	25.0	27.0					X																	63411318		2203	4300	6503	SO:0001587	stop_gained	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63411318C>A	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1849G>T	X.37:g.63411318C>A	ENSP00000329117:p.Glu617*		Somatic					p.E617*	NM_152424	NP_689637	WXS	Illumina HiSeq	Unspecified	Q5JTC6	F123B_HUMAN			2	2122	-			617					A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	c.1849G>T	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706247	0.89018	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	3.91	3.04	0.35103	.	0.430791	0.19818	N	0.105369	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-6.2044	6.683	0.23131	0.0:0.7105:0.18:0.1096	.	.	.	.	X	617	.	ENSP00000329117:E617X	E	-	1	0	FAM123B	63328043	0.172000	0.23043	0.009000	0.14445	0.056000	0.15407	0.982000	0.29539	0.998000	0.38996	0.600000	0.82982	GAA		0.637	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		5	39	1	0	0.000602214	0.000602	0.000670085	5	39				
CXCR3	2833	broad.mit.edu	37	X	70837092	70837092	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:70837092A>T	ENST00000373693.3	-	2	297	c.230T>A	c.(229-231)gTg>gAg	p.V77E	CXCR3_ENST00000373691.4_Missense_Mutation_p.V124E	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	77					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					GCTCAGCAGCACGGCTGCCAC	0.662																																							uc004eaf.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(229-231)GTG>GAG		chemokine (C-X-C motif) receptor 3 isoform A							20.0	18.0	19.0					X																	70837092		2198	4293	6491	SO:0001583	missense	2833				cell adhesion|cellular component movement|chemotaxis|elevation of cytosolic calcium ion concentration	cytoplasm|integral to plasma membrane	C-X-C chemokine receptor activity	g.chrX:70837092A>T	U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.230T>A	X.37:g.70837092A>T	ENSP00000362797:p.Val77Glu		Somatic				BCYRN1_uc011mpt.1_Intron|CXCR3_uc011mpx.1_Missense_Mutation_p.V124E	p.V77E	NM_001504	NP_001495	WXS	Illumina HiSeq	Unspecified	P49682	CXCR3_HUMAN			2	298	-	Renal(35;0.156)		77			Helical; Name=1; (Potential).		B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	ENST00000373693.3	37	c.230T>A	CCDS14416.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451492	0.43531	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.46819	0.86;0.86	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.071089	0.53938	D	0.000042	T	0.70369	0.3216	M	0.86178	2.8	0.45930	D	0.998763	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.972	T	0.75725	-0.3217	10	0.87932	D	0	.	12.1933	0.54282	1.0:0.0:0.0:0.0	.	124;77	P49682-2;P49682	.;CXCR3_HUMAN	E	124;77;77	ENSP00000362795:V124E;ENSP00000362797:V77E	ENSP00000362791:V77E	V	-	2	0	CXCR3	70753817	0.224000	0.23674	0.947000	0.38551	0.001000	0.01503	4.128000	0.57951	2.009000	0.58944	0.486000	0.48141	GTG		0.662	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144141.1			3	8	0	0	0	0.004672	0	3	8				
MAGEE1	57692	broad.mit.edu	37	X	75649518	75649518	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:75649518G>C	ENST00000361470.2	+	1	1473	c.1195G>C	c.(1195-1197)Gga>Cga	p.G399R		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	399	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CGCCCCTGACGGACCGGGAAG	0.642																																							uc004ecm.1		NA																	0				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						c.(1195-1197)GGA>CGA		melanoma antigen family E, 1							53.0	33.0	40.0					X																	75649518		2203	4299	6502	SO:0001583	missense	57692					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane		g.chrX:75649518G>C	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1195G>C	X.37:g.75649518G>C	ENSP00000354912:p.Gly399Arg		Somatic					p.G399R	NM_020932	NP_065983	WXS	Illumina HiSeq	Unspecified	Q9HCI5	MAGE1_HUMAN			1	1402	+			399			Pro-rich.		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	c.1195G>C	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	G	5.282	0.237467	0.10023	.	.	ENSG00000198934	ENST00000361470	T	0.09538	2.97	0.936	-0.0945	0.13644	.	.	.	.	.	T	0.13970	0.0338	N	0.19112	0.55	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.25187	-1.0139	9	0.30078	T	0.28	.	5.8073	0.18448	0.4096:0.0:0.5904:0.0	.	399	Q9HCI5	MAGE1_HUMAN	R	399	ENSP00000354912:G399R	ENSP00000354912:G399R	G	+	1	0	MAGEE1	75565922	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	-0.233000	0.09041	-0.729000	0.04875	-1.266000	0.01441	GGA		0.642	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932		8	20	0	0	0	0.00308	0	8	20				
FGF16	8823	broad.mit.edu	37	X	76711990	76711990	+	Silent	SNP	A	A	G			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:76711990A>G	ENST00000439435.1	+	2	327	c.327A>G	c.(325-327)ccA>ccG	p.P109P				O43320	FGF16_HUMAN	fibroblast growth factor 16	0					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of brown fat cell proliferation (GO:0070349)|response to temperature stimulus (GO:0009266)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(1)|lung(2)	4						CTCCATGTCCAGAGACCTCTT	0.502																																							uc011mqp.1		NA																	0				lung(1)	1						c.(328-330)AGA>GGA		fibroblast growth factor 16							110.0	104.0	106.0					X																	76711990		1896	4104	6000	SO:0001819	synonymous_variant	8823				cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|metabolic process|organ morphogenesis|response to temperature stimulus	extracellular space	growth factor activity	g.chrX:76711990A>G	AB009391	CCDS75996.1	Xq21.1	2014-01-31			ENSG00000196468	ENSG00000196468			3672	protein-coding gene	gene with protein product		300827	"""metacarpal 4-5 fusion"""	MF4		9473496, 11474196, 23709756	Standard	NM_003868		Approved		uc011mqp.2	O43320	OTTHUMG00000013133	ENST00000439435.1:c.327A>G	X.37:g.76711990A>G			Somatic					p.R110G	NM_003868	NP_003859	WXS	Illumina HiSeq	Unspecified	O43320	FGF16_HUMAN			2	601	+			201						Missense_Mutation	SNP	ENST00000439435.1	37	c.328A>G																																																																																					0.502	FGF16-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036814.1	NM_003868		10	79	0	0	0	0.008291	0	10	79				
PCDH11X	27328	broad.mit.edu	37	X	91873704	91873704	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:91873704G>C	ENST00000373094.1	+	7	4654	c.3809G>C	c.(3808-3810)aGt>aCt	p.S1270T	PCDH11X_ENST00000406881.1_Missense_Mutation_p.S1262T|PCDH11X_ENST00000373088.1_Missense_Mutation_p.S1233T|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000361655.2_Missense_Mutation_p.S1252T|PCDH11X_ENST00000373097.1_Missense_Mutation_p.S1260T|PCDH11X_ENST00000298274.8_Missense_Mutation_p.S1233T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1270					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTCCATCGTAGTCAGGCCCAA	0.552																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(3808-3810)AGT>ACT		protocadherin 11 X-linked isoform c							231.0	206.0	214.0					X																	91873704		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91873704G>C	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3809G>C	X.37:g.91873704G>C	ENSP00000362186:p.Ser1270Thr		Somatic				PCDH11X_uc004efl.1_Missense_Mutation_p.S1260T|PCDH11X_uc004efo.1_Missense_Mutation_p.S1233T|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.S1262T|PCDH11X_uc004efn.1_Missense_Mutation_p.S1252T	p.S1270T	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			7	4654	+			1270			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.3809G>C	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	0.092	-1.166012	0.01673	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.55052	0.57;0.57;0.63;0.54;0.57;0.63	4.28	0.228	0.15364	.	.	.	.	.	T	0.27900	0.0687	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0	T	0.15694	-1.0428	9	0.27082	T	0.32	.	3.9083	0.09191	0.4542:0.1926:0.3532:0.0	.	1233;1252;1262;1260;1270	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	T	1270;1260;1233;1252;1262;1270;1233	ENSP00000362186:S1270T;ENSP00000362189:S1260T;ENSP00000362180:S1233T;ENSP00000355105:S1252T;ENSP00000384758:S1262T;ENSP00000298274:S1233T	ENSP00000298274:S1233T	S	+	2	0	PCDH11X	91760360	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.622000	0.05553	-0.061000	0.13110	0.466000	0.42574	AGT		0.552	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		34	182	0	0	0	0.003755	0	34	182				
TCEAL5	340543	broad.mit.edu	37	X	102529087	102529087	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:102529087T>C	ENST00000372680.1	-	3	699	c.405A>G	c.(403-405)ttA>ttG	p.L135L		NM_001012979.2	NP_001012997.1	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						GCCTTTCTTGTAAGTCCTCCT	0.512																																							uc004ejz.1		NA																	0				lung(1)|breast(1)	2						c.(403-405)TTA>TTG		transcription elongation factor A (SII)-like 5							198.0	171.0	180.0					X																	102529087		2203	4300	6503	SO:0001819	synonymous_variant	340543				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chrX:102529087T>C		CCDS35356.1	Xq22.2	2014-03-21			ENSG00000204065	ENSG00000204065			22282	protein-coding gene	gene with protein product						16221301	Standard	NM_001012979		Approved	WEX4	uc004ejz.2	Q5H9L2	OTTHUMG00000022092	ENST00000372680.1:c.405A>G	X.37:g.102529087T>C			Somatic					p.L135L	NM_001012979	NP_001012997	WXS	Illumina HiSeq	Unspecified	Q5H9L2	TCAL5_HUMAN			3	700	-			135					A2RUJ4	Silent	SNP	ENST00000372680.1	37	c.405A>G	CCDS35356.1																																																																																				0.512	TCEAL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057696.1	XM_291334		4	230	0	0	0	0.009096	0	4	230				
NRK	203447	broad.mit.edu	37	X	105152724	105152724	+	Missense_Mutation	SNP	C	C	A	rs372374321		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:105152724C>A	ENST00000243300.9	+	13	1394	c.1091C>A	c.(1090-1092)cCc>cAc	p.P364H	NRK_ENST00000428173.2_Missense_Mutation_p.P365H	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	364					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TTTAGAGGACCCTCTTGCACT	0.443										HNSCC(51;0.14)																													uc004emd.2		NA																	0				breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(1090-1092)CCC>CAC		Nik related kinase		C	HIS/PRO	0,3241		0,0,1336,569	34.0	32.0	33.0		1091	4.0	0.9	X		33	2,6457		0,2,2330,1795	no	missense	NRK	NM_198465.2	77	0,2,3666,2364	AA,AC,CC,C		0.031,0.0,0.0206	probably-damaging	364/1583	105152724	2,9698	1905	4127	6032	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105152724C>A	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1091C>A	X.37:g.105152724C>A	ENSP00000434830:p.Pro364His	HNSCC(51;0.14)	Somatic				NRK_uc010npc.1_Missense_Mutation_p.P32H	p.P364H	NM_198465	NP_940867	WXS	Illumina HiSeq	Unspecified	Q7Z2Y5	NRK_HUMAN			13	1394	+			364					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.1091C>A		.	.	.	.	.	.	.	.	.	.	C	15.23	2.772088	0.49680	0.0	3.1E-4	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.78246	1.82;-1.16	4.91	4.04	0.47022	Protein kinase-like domain (1);	0.323007	0.22787	N	0.055648	T	0.75968	0.3922	N	0.19112	0.55	0.80722	D	1	D;D	0.65815	0.995;0.957	P;P	0.61132	0.884;0.674	T	0.77747	-0.2472	10	0.87932	D	0	.	10.2946	0.43616	0.0:0.8058:0.1942:0.0	.	32;364	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	H	364;365	ENSP00000434830:P364H;ENSP00000438378:P365H	ENSP00000434830:P364H	P	+	2	0	NRK	105039380	0.973000	0.33851	0.937000	0.37676	0.945000	0.59286	1.178000	0.31981	1.184000	0.42957	0.600000	0.82982	CCC		0.443	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		9	52	1	0	2.17888e-05	0.006214	2.58145e-05	9	52				
CXorf57	55086	broad.mit.edu	37	X	105882817	105882817	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:105882817G>T	ENST00000372548.4	+	9	1743	c.1634G>T	c.(1633-1635)aGg>aTg	p.R545M	CXorf57_ENST00000372544.2_Intron|MIR548AN_ENST00000408286.2_RNA	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	545							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TTGCAGTATAGGGAACAAAAG	0.408																																							uc004emi.3		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(1633-1635)AGG>ATG		hypothetical protein LOC55086							132.0	121.0	125.0					X																	105882817		2203	4300	6503	SO:0001583	missense	55086							g.chrX:105882817G>T	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1634G>T	X.37:g.105882817G>T	ENSP00000361628:p.Arg545Met		Somatic				CXorf57_uc004emj.3_Intron	p.R545M	NM_018015	NP_060485	WXS	Illumina HiSeq	Unspecified	Q6NSI4	CX057_HUMAN			9	1785	+			545					H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	37	c.1634G>T	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060861	0.76074	.	.	ENSG00000147231	ENST00000372548	T	0.74737	-0.87	5.19	4.33	0.51752	.	0.050870	0.85682	D	0.000000	D	0.83128	0.5187	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84486	0.0608	10	0.87932	D	0	-16.4829	12.1363	0.53972	0.0876:0.0:0.9124:0.0	.	545	Q6NSI4	CX057_HUMAN	M	545	ENSP00000361628:R545M	ENSP00000361628:R545M	R	+	2	0	CXorf57	105769473	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.265000	0.72534	1.264000	0.44198	0.538000	0.68166	AGG		0.408	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015		15	118	1	0	2.23348e-06	0.004007	2.76738e-06	15	118				
TEX13B	56156	broad.mit.edu	37	X	107225222	107225222	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:107225222C>A	ENST00000302917.1	-	2	228	c.136G>T	c.(136-138)Gtg>Ttg	p.V46L		NM_031273.2	NP_112563.1	Q9BXU2	TX13B_HUMAN	testis expressed 13B	46										breast(1)|endometrium(5)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28						TTGTCTTCCACCTCCTCCCAG	0.597																																							uc004enn.1		NA																	0				ovary(1)	1						c.(136-138)GTG>TTG		testis expressed 13B							108.0	96.0	100.0					X																	107225222		2199	4300	6499	SO:0001583	missense	56156							g.chrX:107225222C>A	AF285598	CCDS14534.1	Xq23	2008-02-05	2007-03-13		ENSG00000170925	ENSG00000170925			11736	protein-coding gene	gene with protein product		300313	"""testis expressed sequence 13B"""			11279525	Standard	NM_031273		Approved	TSGA5, TGC3B	uc004enn.1	Q9BXU2	OTTHUMG00000022174	ENST00000302917.1:c.136G>T	X.37:g.107225222C>A	ENSP00000303777:p.Val46Leu		Somatic					p.V46L	NM_031273	NP_112563	WXS	Illumina HiSeq	Unspecified	Q9BXU2	TX13B_HUMAN			2	229	-			46					Q5JYF6	Missense_Mutation	SNP	ENST00000302917.1	37	c.136G>T	CCDS14534.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881391	0.51801	.	.	ENSG00000170925	ENST00000302917	.	.	.	2.92	0.133	0.14766	.	.	.	.	.	T	0.46756	0.1409	L	0.55213	1.73	0.09310	N	1	D	0.56521	0.976	P	0.56163	0.793	T	0.33854	-0.9852	8	0.72032	D	0.01	.	5.1963	0.15239	0.0:0.558:0.0:0.442	.	46	Q9BXU2	TX13B_HUMAN	L	46	.	ENSP00000303777:V46L	V	-	1	0	TEX13B	107111878	0.009000	0.17119	0.002000	0.10522	0.266000	0.26442	-0.016000	0.12613	-0.088000	0.12506	0.519000	0.50382	GTG		0.597	TEX13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057857.1			15	176	1	0	6.31663e-08	0.003163	8.43121e-08	15	176				
IRS4	8471	broad.mit.edu	37	X	107977374	107977374	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:107977374C>A	ENST00000372129.2	-	1	2277	c.2201G>T	c.(2200-2202)cGa>cTa	p.R734L	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	734	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AAAAGGGGATCGAGAGTGGCG	0.498																																							uc004eoc.2		NA																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(2200-2202)CGA>CTA		insulin receptor substrate 4							71.0	71.0	71.0					X																	107977374		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977374C>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2201G>T	X.37:g.107977374C>A	ENSP00000361202:p.Arg734Leu		Somatic					p.R734L	NM_003604	NP_003595	WXS	Illumina HiSeq	Unspecified	O14654	IRS4_HUMAN			1	2234	-			734			CRK-binding.			Missense_Mutation	SNP	ENST00000372129.2	37	c.2201G>T	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022739	0.54683	.	.	ENSG00000133124	ENST00000372129	T	0.18502	2.21	5.33	2.47	0.30058	.	0.336388	0.22830	N	0.055115	T	0.13329	0.0323	L	0.57536	1.79	0.27961	N	0.936789	P	0.44090	0.826	B	0.35039	0.194	T	0.13656	-1.0501	10	0.27082	T	0.32	-5.4439	8.4286	0.32744	0.0:0.7335:0.123:0.1436	.	734	O14654	IRS4_HUMAN	L	734	ENSP00000361202:R734L	ENSP00000361202:R734L	R	-	2	0	IRS4	107864030	0.866000	0.29940	0.993000	0.49108	0.978000	0.69477	1.182000	0.32029	0.593000	0.29745	0.600000	0.82982	CGA		0.498	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		20	170	1	0	5.35267e-07	0.007413	6.87884e-07	20	170				
LHFPL1	340596	broad.mit.edu	37	X	111914478	111914478	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:111914478G>A	ENST00000371968.3	-	2	380	c.141C>T	c.(139-141)ttC>ttT	p.F47F	LHFPL1_ENST00000478229.1_Intron|LHFPL1_ENST00000536453.1_Silent_p.F47F	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	47						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						TGCACCTCCGGAATGTGCTGA	0.542																																							uc004epq.2		NA																	0					0						c.(139-141)TTC>TTT		lipoma HMGIC fusion partner-like 1 precursor							168.0	152.0	158.0					X																	111914478		2203	4300	6503	SO:0001819	synonymous_variant	340596					integral to membrane		g.chrX:111914478G>A	AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.141C>T	X.37:g.111914478G>A			Somatic				LHFPL1_uc004epp.2_Silent_p.F70F|LHFPL1_uc010nqa.2_Intron|LHFPL1_uc010nqb.2_Silent_p.F47F	p.F47F	NM_178175	NP_835469	WXS	Illumina HiSeq	Unspecified	Q86WI0	LHPL1_HUMAN			2	474	-			47					A8K1N1|Q496M9|Q496N0|Q6UXU2	Silent	SNP	ENST00000371968.3	37	c.141C>T	CCDS14562.1																																																																																				0.542	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057947.1	NM_178175		14	233	0	0	0	0.00245	0	14	233				
KIAA1210	57481	broad.mit.edu	37	X	118221651	118221651	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:118221651C>A	ENST00000402510.2	-	11	3541	c.3542G>T	c.(3541-3543)gGc>gTc	p.G1181V		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1181										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GTTAGAAGTGCCTTCAACAGC	0.463																																							uc004era.3		NA																	0				ovary(4)|skin(1)	5						c.(3541-3543)GGC>GTC		hypothetical protein LOC57481							60.0	53.0	55.0					X																	118221651		1863	4103	5966	SO:0001583	missense	57481							g.chrX:118221651C>A	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3542G>T	X.37:g.118221651C>A	ENSP00000384670:p.Gly1181Val		Somatic					p.G1181V	NM_020721	NP_065772	WXS	Illumina HiSeq	Unspecified	Q9ULL0	K1210_HUMAN			11	3542	-			1181					B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	c.3542G>T	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.878|7.878	0.729523|0.729523	0.15507|0.15507	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.11495|.	2.77|.	4.31|4.31	-6.97|-6.97	0.01616|0.01616	.|.	.|.	.|.	.|.	.|.	T|T	0.27765|0.27765	0.0683|0.0683	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	D|.	0.57899|.	0.981|.	P|.	0.57101|.	0.813|.	T|T	0.32955|0.32955	-0.9887|-0.9887	9|5	0.18276|.	T|.	0.48|.	.|.	10.6757|10.6757	0.45785|0.45785	0.0:0.6862:0.1326:0.1812|0.0:0.6862:0.1326:0.1812	.|.	1181|.	Q9ULL0|.	K1210_HUMAN|.	V|S	1181|587	ENSP00000384670:G1181V|.	ENSP00000384670:G1181V|.	G|R	-|-	2|3	0|2	RP13-347D8.6|KIAA1210	118105679|118105679	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-3.510000|-3.510000	0.00447|0.00447	-1.741000|-1.741000	0.01344|0.01344	-0.340000|-0.340000	0.08031|0.08031	GGC|AGG		0.463	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		7	53	1	0	1.26484e-09	0.00308	1.81694e-09	7	53				
UBE2A	7319	broad.mit.edu	37	X	118709339	118709339	+	Splice_Site	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:118709339C>A	ENST00000371558.2	+	3	301	c.127C>A	c.(127-129)Cct>Act	p.P43T	UBE2A_ENST00000469205.1_3'UTR|UBE2A_ENST00000346330.3_Splice_Site_p.P43T	NM_001282161.1|NM_003336.2|NM_181762.1	NP_001269090.1|NP_003327.2|NP_861427.1	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A	43					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|DNA repair (GO:0006281)|histone H2A ubiquitination (GO:0033522)|in utero embryonic development (GO:0001701)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of cell proliferation (GO:0008284)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|response to UV (GO:0009411)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|cytosol (GO:0005829)|HULC complex (GO:0033503)|nuclear chromatin (GO:0000790)|XY body (GO:0001741)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			haematopoietic_and_lymphoid_tissue(1)|lung(7)	8						GTGTTGCAGGCCTGAAGGGAC	0.542								Rad6 pathway																															uc004erl.2		NA																	0					0						c.(127-129)CCT>ACT	Direct_reversal_of_damage|Rad6_pathway	ubiquitin-conjugating enzyme E2A isoform 1							134.0	125.0	128.0					X																	118709339		2203	4300	6503	SO:0001630	splice_region_variant	7319				histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity	g.chrX:118709339C>A	AK223045	CCDS14580.1, CCDS14581.1	Xq24	2011-05-19	2011-05-19		ENSG00000077721	ENSG00000077721		"""Ubiquitin-conjugating enzymes E2"""	12472	protein-coding gene	gene with protein product		312180	"""ubiquitin-conjugating enzyme E2A (RAD6 homolog)"""			1559696	Standard	NM_003336		Approved	UBC2, HHR6A, RAD6A	uc004erl.3	P49459	OTTHUMG00000022275	ENST00000371558.2:c.126-1C>A	X.37:g.118709339C>A			Somatic				UBE2A_uc004erm.2_Missense_Mutation_p.P43T|UBE2A_uc004ern.2_RNA|UBE2A_uc004ero.2_RNA	p.P43T	NM_003336	NP_003327	WXS	Illumina HiSeq	Unspecified	P49459	UBE2A_HUMAN			3	303	+			43					A6NFE9|A6NGR2|A6NMF5|B2R7R9|D3DWI1|Q4TTG1|Q96FX4	Missense_Mutation	SNP	ENST00000371558.2	37	c.127C>A	CCDS14580.1	.	.	.	.	.	.	.	.	.	.	C	32	5.170288	0.94768	.	.	ENSG00000077721	ENST00000371558;ENST00000346330	T;T	0.77620	-1.11;-1.11	5.67	5.67	0.87782	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.048137	0.85682	D	0.000000	D	0.91482	0.7311	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93584	0.6915	10	0.66056	D	0.02	-13.0842	15.3561	0.74428	0.0:1.0:0.0:0.0	.	43;43	A6NGR2;P49459	.;UBE2A_HUMAN	T	43	ENSP00000360613:P43T;ENSP00000335027:P43T	ENSP00000335027:P43T	P	+	1	0	UBE2A	118593367	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.060000	0.76692	2.387000	0.81309	0.594000	0.82650	CCT		0.542	UBE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058036.1	NM_003336	Missense_Mutation	24	119	1	0	7.92952e-12	0.003954	1.20886e-11	24	119				
RNF113A	7737	broad.mit.edu	37	X	119005497	119005497	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:119005497G>T	ENST00000371442.2	-	1	294	c.80C>A	c.(79-81)gCt>gAt	p.A27D	NDUFA1_ENST00000371437.4_5'UTR	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	27							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						GCGTCCAGCAGCCCCTTTCCG	0.597																																							uc004esb.2		NA																	0				breast(2)	2						c.(79-81)GCT>GAT		ring finger protein 113A							61.0	63.0	62.0					X																	119005497		2203	4300	6503	SO:0001583	missense	7737						nucleic acid binding|zinc ion binding	g.chrX:119005497G>T	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.80C>A	X.37:g.119005497G>T	ENSP00000360497:p.Ala27Asp		Somatic				NDUFA1_uc004esc.3_5'Flank	p.A27D	NM_006978	NP_008909	WXS	Illumina HiSeq	Unspecified	O15541	R113A_HUMAN			1	295	-			27					B2RBR7	Missense_Mutation	SNP	ENST00000371442.2	37	c.80C>A	CCDS14589.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187179	0.38609	.	.	ENSG00000125352	ENST00000371442	T	0.31247	1.5	5.49	5.49	0.81192	.	0.442362	0.23046	N	0.052556	T	0.30198	0.0757	M	0.64170	1.965	0.80722	D	1	B	0.27559	0.181	B	0.24006	0.05	T	0.07028	-1.0794	10	0.15066	T	0.55	-2.8913	13.7609	0.62966	0.0:0.0:1.0:0.0	.	27	O15541	R113A_HUMAN	D	27	ENSP00000360497:A27D	ENSP00000360497:A27D	A	-	2	0	RNF113A	118889525	0.237000	0.23815	0.131000	0.22000	0.946000	0.59487	2.521000	0.45563	2.318000	0.78349	0.600000	0.82982	GCT		0.597	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978		28	130	1	0	4.59853e-10	0.005443	6.66733e-10	28	130				
SH2D1A	4068	broad.mit.edu	37	X	123480538	123480538	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:123480538G>T	ENST00000371139.4	+	1	345	c.46G>T	c.(46-48)Ggc>Tgc	p.G16C	SH2D1A_ENST00000360027.4_Missense_Mutation_p.G16C|SH2D1A_ENST00000477673.2_Missense_Mutation_p.G16C|STAG2_ENST00000469481.1_Intron|SH2D1A_ENST00000491950.1_3'UTR	NM_001114937.2|NM_002351.4	NP_001108409.1|NP_002342.1	O60880	SH21A_HUMAN	SH2 domain containing 1A	16	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.		G -> D (in XLP1; abolishes interaction with SLAMF1). {ECO:0000269|PubMed:15841490}.		cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|humoral immune response (GO:0006959)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						CAGGGAAACCGGCGAGAAGCT	0.592																																							uc004euf.3		NA																	0					0						c.(46-48)GGC>TGC		SH2 domain protein 1A isoform 1							128.0	99.0	109.0					X																	123480538		2203	4300	6503	SO:0001583	missense	4068	X-linked_Lymphoproliferative_syndrome			cell-cell signaling|cellular defense response	cytoplasm	SH3/SH2 adaptor activity	g.chrX:123480538G>T	AL023657	CCDS14608.1, CCDS48162.1	Xq25	2014-09-17	2010-04-21		ENSG00000183918	ENSG00000183918		"""SH2 domain containing"""	10820	protein-coding gene	gene with protein product	"""Duncan's disease"""	300490	"""lymphoproliferative syndrome"", ""SH2 domain protein 1A"""	IMD5, LYP		9771704, 9774102	Standard	NM_001114937		Approved	XLP, MTCP1, DSHP, XLPD, EBVS, SAP	uc004euf.4	O60880	OTTHUMG00000022344	ENST00000371139.4:c.46G>T	X.37:g.123480538G>T	ENSP00000360181:p.Gly16Cys		Somatic				SH2D1A_uc004euh.3_Missense_Mutation_p.G16C|SH2D1A_uc004eug.3_RNA|SH2D1A_uc010nqw.2_RNA|SH2D1A_uc004eui.3_RNA|SH2D1A_uc010nqx.2_Intron	p.G16C	NM_002351	NP_002342	WXS	Illumina HiSeq	Unspecified	O60880	SH21A_HUMAN			1	391	+			16		G -> D (in XLP1; abolishes interaction with SLAMF1).	SH2.		A8MSW0|O95383|O95384|O95385|O95386|Q6FGS6|Q9UNR0	Missense_Mutation	SNP	ENST00000371139.4	37	c.46G>T	CCDS14608.1	.	.	.	.	.	.	.	.	.	.	G	6.541	0.468006	0.12461	.	.	ENSG00000183918	ENST00000371139;ENST00000360027;ENST00000394475	D;D	0.98617	-5.03;-5.03	5.51	4.63	0.57726	SH2 motif (5);	0.108239	0.64402	D	0.000006	D	0.95395	0.8505	N	0.04320	-0.23	0.48571	D	0.999673	P;D	0.62365	0.55;0.991	B;P	0.49012	0.115;0.598	D	0.94263	0.7504	10	0.30078	T	0.28	-3.3874	12.8145	0.57657	0.0:0.1614:0.8386:0.0	.	16;16	O60880-4;O60880	.;SH21A_HUMAN	C	16	ENSP00000360181:G16C;ENSP00000353126:G16C	ENSP00000353126:G16C	G	+	1	0	SH2D1A	123308219	1.000000	0.71417	0.558000	0.28319	0.257000	0.26127	4.336000	0.59304	1.045000	0.40225	0.513000	0.50165	GGC		0.592	SH2D1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058174.1	NM_002351		22	61	1	0	1.87028e-06	0.012319	2.33597e-06	22	61				
XPNPEP2	7512	broad.mit.edu	37	X	128873207	128873207	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:128873207G>T	ENST00000371106.3	+	1	210	c.18G>T	c.(16-18)tgG>tgT	p.W6C	XPNPEP2_ENST00000371105.3_Missense_Mutation_p.W6C	NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	6						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GGGCTCACTGGGGCTGCTGCC	0.637																																							uc004eut.1		NA																	0					0						c.(16-18)TGG>TGT		X-prolyl aminopeptidase 2, membrane-bound							66.0	68.0	68.0					X																	128873207		2203	4300	6503	SO:0001583	missense	7512				cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity	g.chrX:128873207G>T	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.18G>T	X.37:g.128873207G>T	ENSP00000360147:p.Trp6Cys		Somatic				XPNPEP2_uc011mum.1_Missense_Mutation_p.W6C	p.W6C	NM_003399	NP_003390	WXS	Illumina HiSeq	Unspecified	O43895	XPP2_HUMAN			1	262	+			6					A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	c.18G>T	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681326	0.29872	.	.	ENSG00000122121	ENST00000371105;ENST00000371106	T	0.74106	-0.81	4.35	3.49	0.39957	.	0.500913	0.22716	N	0.056520	T	0.60104	0.2243	L	0.27053	0.805	0.41238	D	0.98662	B;B	0.15473	0.013;0.001	B;B	0.12156	0.007;0.003	T	0.59316	-0.7477	10	0.72032	D	0.01	-9.2372	8.6985	0.34312	0.0:0.0:0.7749:0.2251	.	6;6	B4DV70;O43895	.;XPP2_HUMAN	C	6	ENSP00000360147:W6C	ENSP00000360146:W6C	W	+	3	0	XPNPEP2	128700888	1.000000	0.71417	0.793000	0.32043	0.985000	0.73830	2.737000	0.47393	1.180000	0.42898	0.513000	0.50165	TGG		0.637	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399		8	251	1	0	2.17888e-05	0.006214	2.58145e-05	8	251				
BCORL1	63035	broad.mit.edu	37	X	129149581	129149581	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:129149581C>T	ENST00000218147.7	+	4	3030	c.2833C>T	c.(2833-2835)Cga>Tga	p.R945*	BCORL1_ENST00000359304.2_Nonsense_Mutation_p.R945*|BCORL1_ENST00000540052.1_Nonsense_Mutation_p.R945*|BCORL1_ENST00000303743.5_Nonsense_Mutation_p.R945*			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	945					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TGGGGACATTCGAATGAATCA	0.577																																							uc004evb.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(2833-2835)CGA>TGA		BCL6 co-repressor-like 1							65.0	58.0	61.0					X																	129149581		2203	4300	6503	SO:0001587	stop_gained	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129149581C>T	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2833C>T	X.37:g.129149581C>T	ENSP00000218147:p.Arg945*		Somatic				BCORL1_uc010nrd.1_Nonsense_Mutation_p.R847*	p.R945*	NM_021946	NP_068765	WXS	Illumina HiSeq	Unspecified	Q5H9F3	BCORL_HUMAN			4	2947	+			945					B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Nonsense_Mutation	SNP	ENST00000218147.7	37	c.2833C>T	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.53|17.53	3.411772|3.411772	0.62399|0.62399	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	.|.	.|.	.|.	4.64|4.64	-0.582|-0.582	0.11709|0.11709	.|.	0.478840|.	0.15042|.	N|.	0.283810|.	.|T	.|0.49440	.|0.1557	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.55988	.|-0.8053	.|3	0.23302|.	T|.	0.38|.	-2.4108|-2.4108	10.6651|10.6651	0.45726|0.45726	0.2932:0.6235:0.0833:0.0|0.2932:0.6235:0.0833:0.0	.|.	.|.	.|.	.|.	X|L	945;945;945;945;545|380	.|.	ENSP00000218147:R945X|.	R|S	+|+	1|2	2|0	BCORL1|BCORL1	128977262|128977262	0.001000|0.001000	0.12720|0.12720	0.005000|0.005000	0.12908|0.12908	0.342000|0.342000	0.28953|0.28953	-0.269000|-0.269000	0.08596|0.08596	-0.398000|-0.398000	0.07679|0.07679	0.529000|0.529000	0.55759|0.55759	CGA|TCG		0.577	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		16	130	0	0	0	0.004007	0	16	130				
ARHGAP36	158763	broad.mit.edu	37	X	130218253	130218253	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:130218253A>T	ENST00000276211.5	+	5	965	c.620A>T	c.(619-621)cAg>cTg	p.Q207L	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.Q195L|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.Q71L	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	207					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CAGACCCTGCAGCTTTCAAAA	0.478																																							uc004evz.2		NA																	0				ovary(3)	3						c.(619-621)CAG>CTG		hypothetical protein LOC158763 precursor							40.0	40.0	40.0					X																	130218253		2203	4300	6503	SO:0001583	missense	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130218253A>T		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.620A>T	X.37:g.130218253A>T	ENSP00000276211:p.Gln207Leu		Somatic				ARHGAP36_uc004ewa.2_Missense_Mutation_p.Q195L|ARHGAP36_uc004ewb.2_Missense_Mutation_p.Q176L|ARHGAP36_uc004ewc.2_Missense_Mutation_p.Q71L	p.Q207L	NM_144967	NP_659404	WXS	Illumina HiSeq	Unspecified	Q6ZRI8	RHG36_HUMAN			5	965	+			207					B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	c.620A>T	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.131005	0.37630	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T	0.12361	2.69;2.69;2.7;2.81	4.99	4.99	0.66335	.	0.135771	0.34156	N	0.004206	T	0.09862	0.0242	N	0.08118	0	0.53688	D	0.999977	P;P;P	0.39480	0.675;0.675;0.546	B;P;B	0.46076	0.426;0.503;0.244	T	0.37430	-0.9706	10	0.28530	T	0.3	.	9.9763	0.41786	1.0:0.0:0.0:0.0	.	176;195;207	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	L	207;195;159;176;71	ENSP00000276211:Q207L;ENSP00000359960:Q195L;ENSP00000408515:Q176L;ENSP00000359959:Q71L	ENSP00000276211:Q207L	Q	+	2	0	ARHGAP36	130045934	1.000000	0.71417	0.982000	0.44146	0.151000	0.21798	7.577000	0.82486	1.958000	0.56883	0.430000	0.28490	CAG		0.478	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		54	35	0	0	0	0.00361	0	54	35				
MBNL3	55796	broad.mit.edu	37	X	131540343	131540343	+	Silent	SNP	C	C	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:131540343C>T	ENST00000370853.3	-	2	333	c.255G>A	c.(253-255)cgG>cgA	p.R85R	MBNL3_ENST00000370839.3_Silent_p.R85R|MBNL3_ENST00000394311.2_5'UTR|RAP2C-AS1_ENST00000441399.2_RNA|MBNL3_ENST00000370849.3_Silent_p.R35R|MBNL3_ENST00000538204.1_Silent_p.R35R|RAP2C-AS1_ENST00000421483.2_RNA|MBNL3_ENST00000473364.1_5'UTR|MBNL3_ENST00000370857.3_Silent_p.R85R|MBNL3_ENST00000370844.1_5'UTR	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	85					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					TCAGATTGTTCCGCCCATTAA	0.488																																							uc004ewv.3		NA																	0					0						c.(253-255)CGG>CGA		muscleblind-like 3 isoform G							156.0	112.0	127.0					X																	131540343		2203	4300	6503	SO:0001819	synonymous_variant	55796				mRNA processing|multicellular organismal development|regulation of RNA splicing|RNA splicing	Golgi apparatus|nucleus	nucleic acid binding|zinc ion binding	g.chrX:131540343C>T	AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.255G>A	X.37:g.131540343C>T			Somatic				uc004ewr.1_Intron|MBNL3_uc004eww.2_5'UTR|MBNL3_uc010nrl.1_RNA|MBNL3_uc004ews.2_5'UTR|MBNL3_uc004ewt.2_Silent_p.R35R|MBNL3_uc011muz.1_5'UTR|MBNL3_uc004ewu.3_Silent_p.R85R|MBNL3_uc004ewx.1_Silent_p.R35R	p.R85R	NM_018388	NP_060858	WXS	Illumina HiSeq	Unspecified	Q9NUK0	MBNL3_HUMAN			2	334	-	Acute lymphoblastic leukemia(192;0.000127)		85					Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Silent	SNP	ENST00000370853.3	37	c.255G>A	CCDS14633.1																																																																																				0.488	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058319.1	NM_018388		15	114	0	0	0	0.00245	0	15	114				
MAGEC2	51438	broad.mit.edu	37	X	141291176	141291176	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:141291176C>A	ENST00000247452.3	-	3	945	c.598G>T	c.(598-600)Gtg>Ttg	p.V200L		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	200	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					TCAGGGCCCACTTCTATCAGG	0.478										HNSCC(46;0.14)																													uc004fbu.1		NA																	0				breast(2)	2						c.(598-600)GTG>TTG		melanoma antigen family C, 2							116.0	110.0	112.0					X																	141291176		2203	4300	6503	SO:0001583	missense	51438					cytoplasm|nucleus		g.chrX:141291176C>A	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.598G>T	X.37:g.141291176C>A	ENSP00000354660:p.Val200Leu	HNSCC(46;0.14)	Somatic					p.V200L	NM_016249	NP_057333	WXS	Illumina HiSeq	Unspecified	Q9UBF1	MAGC2_HUMAN			3	946	-	Acute lymphoblastic leukemia(192;6.56e-05)		200			MAGE.		Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	c.598G>T	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	11.56	1.674542	0.29693	.	.	ENSG00000046774	ENST00000247452	T	0.04706	3.57	0.988	-1.84	0.07809	.	0.281917	0.30185	U	0.010205	T	0.08313	0.0207	L	0.49455	1.56	0.09310	N	1	P	0.36974	0.576	P	0.53185	0.72	T	0.31641	-0.9936	10	0.66056	D	0.02	.	1.6446	0.02759	0.3277:0.3972:0.0:0.275	.	200	Q9UBF1	MAGC2_HUMAN	L	200	ENSP00000354660:V200L	ENSP00000354660:V200L	V	-	1	0	MAGEC2	141118842	0.000000	0.05858	0.001000	0.08648	0.185000	0.23345	-0.320000	0.08028	-0.756000	0.04703	0.284000	0.19432	GTG		0.478	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249		184	121	1	0	3.73429e-81	0.00361	7.25853e-81	184	121				
SLITRK2	84631	broad.mit.edu	37	X	144906475	144906475	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:144906475G>A	ENST00000370490.1	+	1	6787	c.2532G>A	c.(2530-2532)caG>caA	p.Q844Q	SLITRK2_ENST00000413937.2_Silent_p.Q844Q|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000434188.2_Silent_p.Q844Q|SLITRK2_ENST00000447897.2_Silent_p.Q844Q|SLITRK2_ENST00000428560.2_Silent_p.Q844Q			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	844					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CAATCAGTCAGCTGTGAAGGG	0.458																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(2530-2532)CAG>CAA		SLIT and NTRK-like family, member 2 precursor							48.0	45.0	46.0					X																	144906475		2203	4299	6502	SO:0001819	synonymous_variant	84631					integral to membrane		g.chrX:144906475G>A	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2532G>A	X.37:g.144906475G>A			Somatic				SLITRK2_uc010nsp.2_Silent_p.Q844Q|SLITRK2_uc010nso.2_Silent_p.Q844Q|SLITRK2_uc011mwq.1_Silent_p.Q844Q|SLITRK2_uc011mwr.1_Silent_p.Q844Q|SLITRK2_uc011mws.1_Silent_p.Q844Q|SLITRK2_uc004fcg.2_Silent_p.Q844Q|SLITRK2_uc011mwt.1_Silent_p.Q844Q|CXorf1_uc004fch.2_5'Flank	p.Q844Q	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	3522	+	Acute lymphoblastic leukemia(192;6.56e-05)		844			Cytoplasmic (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	c.2532G>A	CCDS14680.1																																																																																				0.458	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		72	51	0	0	0	0.00361	0	72	51				
AFF2	2334	broad.mit.edu	37	X	148039929	148039929	+	Silent	SNP	C	C	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:148039929C>A	ENST00000370460.2	+	12	3110	c.2631C>A	c.(2629-2631)atC>atA	p.I877I	AFF2_ENST00000286437.5_Silent_p.I518I|AFF2_ENST00000342251.3_Silent_p.I844I|AFF2_ENST00000370457.5_Silent_p.I844I	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	877					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CCACAACTATCTGCTTGCTCC	0.512																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(2629-2631)ATC>ATA		fragile X mental retardation 2							213.0	191.0	199.0					X																	148039929		2203	4300	6503	SO:0001819	synonymous_variant	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148039929C>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2631C>A	X.37:g.148039929C>A			Somatic				AFF2_uc004fcq.2_Silent_p.I867I|AFF2_uc004fcr.2_Silent_p.I838I|AFF2_uc011mxb.1_Silent_p.I842I|AFF2_uc004fcs.2_Silent_p.I844I|AFF2_uc011mxc.1_Silent_p.I518I	p.I877I	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			12	3110	+	Acute lymphoblastic leukemia(192;6.56e-05)		877					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	c.2631C>A	CCDS14684.1																																																																																				0.512	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		160	190	1	0	5.70634e-75	0.00361	1.10228e-74	160	190				
MAMLD1	10046	broad.mit.edu	37	X	149638377	149638377	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:149638377G>C	ENST00000370401.2	+	4	842	c.532G>C	c.(532-534)Gag>Cag	p.E178Q	MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000432680.2_Missense_Mutation_p.E153Q|MAMLD1_ENST00000262858.5_Missense_Mutation_p.E178Q|MAMLD1_ENST00000426613.2_Missense_Mutation_p.E153Q			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	178					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					GGAGCTTCAAGAGCTGCTAGA	0.478																																							uc004fee.1		NA																	0					0						c.(532-534)GAG>CAG		mastermind-like domain containing 1							72.0	69.0	70.0					X																	149638377		2203	4299	6502	SO:0001583	missense	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638377G>C	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.532G>C	X.37:g.149638377G>C	ENSP00000359428:p.Glu178Gln		Somatic				MAMLD1_uc011mxt.1_Missense_Mutation_p.E140Q|MAMLD1_uc011mxu.1_Missense_Mutation_p.E153Q|MAMLD1_uc011mxv.1_Missense_Mutation_p.E153Q|MAMLD1_uc011mxw.1_Missense_Mutation_p.E105Q	p.E178Q	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	608	+	Acute lymphoblastic leukemia(192;6.56e-05)		178					B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	c.532G>C	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938739	0.52972	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.69435	0.02;-0.4;0.02;0.03	5.36	5.36	0.76844	.	0.217996	0.39909	N	0.001231	T	0.48295	0.1492	N	0.08118	0	0.80722	D	1	P;P;P;P	0.42409	0.779;0.664;0.718;0.779	B;B;B;B	0.39258	0.215;0.215;0.283;0.295	T	0.50432	-0.8829	9	.	.	.	-3.9975	18.2098	0.89866	0.0:0.0:1.0:0.0	.	140;153;153;178	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	Q	140;178;153;178;153	ENSP00000359428:E178Q;ENSP00000414517:E153Q;ENSP00000262858:E178Q;ENSP00000397438:E153Q	.	E	+	1	0	MAMLD1	149389035	1.000000	0.71417	0.994000	0.49952	0.748000	0.42578	7.492000	0.81482	2.237000	0.73441	0.600000	0.82982	GAG		0.478	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		17	170	0	0	0	0.00499	0	17	170				
MAMLD1	10046	broad.mit.edu	37	X	149639648	149639648	+	Silent	SNP	G	G	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:149639648G>A	ENST00000370401.2	+	4	2113	c.1803G>A	c.(1801-1803)caG>caA	p.Q601Q	MAMLD1_ENST00000455522.2_Silent_p.Q82Q|MAMLD1_ENST00000432680.2_Silent_p.Q576Q|MAMLD1_ENST00000262858.5_Silent_p.Q601Q|MAMLD1_ENST00000426613.2_Silent_p.Q576Q			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	601	Poly-Gln.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					agcagcagcagcaacagcagc	0.607																																							uc004fee.1		NA																	0					0						c.(1801-1803)CAG>CAA		mastermind-like domain containing 1							74.0	65.0	68.0					X																	149639648		2203	4300	6503	SO:0001819	synonymous_variant	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149639648G>A	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1803G>A	X.37:g.149639648G>A			Somatic				MAMLD1_uc011mxt.1_Silent_p.Q563Q|MAMLD1_uc011mxu.1_Silent_p.Q576Q|MAMLD1_uc011mxv.1_Silent_p.Q576Q|MAMLD1_uc011mxw.1_Silent_p.Q528Q	p.Q601Q	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	1879	+	Acute lymphoblastic leukemia(192;6.56e-05)		601			Poly-Gln.		B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	c.1803G>A	CCDS14693.2																																																																																				0.607	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		5	216	0	0	0	0.001168	0	5	216				
HCFC1	3054	broad.mit.edu	37	X	153215033	153215033	+	Silent	SNP	G	G	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:153215033G>T	ENST00000310441.7	-	25	7005	c.6039C>A	c.(6037-6039)gcC>gcA	p.A2013A	HCFC1_ENST00000354233.3_Silent_p.A1944A|HCFC1_ENST00000369984.4_Silent_p.A2058A	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	2013					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCGCTTGTTGGCTGGCTTGG	0.547																																							uc004fjp.2		NA																	0				ovary(2)	2						c.(6037-6039)GCC>GCA		host cell factor 1							103.0	103.0	103.0					X																	153215033		2013	4147	6160	SO:0001819	synonymous_variant	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153215033G>T		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.6039C>A	X.37:g.153215033G>T			Somatic					p.A2013A	NM_005334	NP_005325	WXS	Illumina HiSeq	Unspecified	P51610	HCFC1_HUMAN			25	6567	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		2013					Q6P4G5	Silent	SNP	ENST00000310441.7	37	c.6039C>A	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	G	9.207	1.029861	0.19512	.	.	ENSG00000172534	ENST00000444191	.	.	.	5.43	3.52	0.40303	.	.	.	.	.	T	0.58991	0.2161	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55354	-0.8154	4	.	.	.	.	9.2755	0.37696	0.0843:0.1422:0.7735:0.0	.	.	.	.	K	589	.	.	Q	-	1	0	HCFC1	152868227	1.000000	0.71417	0.999000	0.59377	0.744000	0.42396	2.557000	0.45871	1.047000	0.40274	0.529000	0.55759	CAA		0.547	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		12	170	1	0	0.000219431	0.00245	0.000249975	12	170				
TMEM187	8269	broad.mit.edu	37	X	153247646	153247646	+	Missense_Mutation	SNP	G	G	A	rs372840875		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:153247646G>A	ENST00000369982.4	+	2	880	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	MIR3202-1_ENST00000580198.1_RNA	NM_003492.2	NP_003483.1	Q14656	TM187_HUMAN	transmembrane protein 187	45						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|large_intestine(1)|lung(1)|prostate(2)	5	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGAGGCGCCCGTGGCCGGCCT	0.662																																							uc004fjq.2		NA																	0					0						c.(133-135)GTG>ATG		transmembrane protein 187		G	MET/VAL	0,3835		0,0,0,1632,571	54.0	57.0	56.0		133	4.1	0.0	X		56	1,6727		0,0,1,2428,1871	no	missense	TMEM187	NM_003492.2	21	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	possibly-damaging	45/262	153247646	1,10562	2203	4300	6503	SO:0001583	missense	8269					integral to membrane|transport vesicle		g.chrX:153247646G>A	X92475	CCDS14739.1	Xq28	2007-03-14	2007-03-14	2007-03-14	ENSG00000177854	ENSG00000177854			13705	protein-coding gene	gene with protein product		300059	"""chromosome X open reading frame 12"""	CXorf12		8661027	Standard	NM_003492		Approved	ITBA1, DXS9878E	uc004fjq.2	Q14656	OTTHUMG00000024220	ENST00000369982.4:c.133G>A	X.37:g.153247646G>A	ENSP00000358999:p.Val45Met		Somatic				hsa-mir-3202-2|MI0014253_5'Flank	p.V45M	NM_003492	NP_003483	WXS	Illumina HiSeq	Unspecified	Q14656	TM187_HUMAN			2	667	+	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		45			Helical; (Potential).		B2RC47|Q6IAV7	Missense_Mutation	SNP	ENST00000369982.4	37	c.133G>A	CCDS14739.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624689	0.28889	0.0	1.49E-4	ENSG00000177854	ENST00000369982;ENST00000425274	T;T	0.24908	1.83;1.83	4.13	4.13	0.48395	.	0.000000	0.38326	U	0.001727	T	0.43389	0.1245	M	0.73598	2.24	0.09310	N	1	D	0.67145	0.996	P	0.59115	0.852	T	0.28364	-1.0046	10	0.41790	T	0.15	.	11.2554	0.49050	0.0:0.1825:0.8175:0.0	.	45	Q14656	TM187_HUMAN	M	45	ENSP00000358999:V45M;ENSP00000390108:V45M	ENSP00000358999:V45M	V	+	1	0	TMEM187	152900840	0.848000	0.29623	0.003000	0.11579	0.003000	0.03518	1.615000	0.36922	1.678000	0.50952	0.436000	0.28706	GTG		0.662	TMEM187-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061093.1	NM_003492		17	180	0	0	0	0.007413	0	17	180				
SLC10A3	8273	broad.mit.edu	37	X	153716440	153716440	+	Missense_Mutation	SNP	G	G	T	rs151043660		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:153716440G>T	ENST00000393587.4	-	3	1103	c.840C>A	c.(838-840)gaC>gaA	p.D280E	UBL4A_ENST00000369660.4_5'Flank|SLC10A3_ENST00000263512.4_Missense_Mutation_p.D280E|SLC10A3_ENST00000393586.1_Missense_Mutation_p.D335E|SLC10A3_ENST00000369649.4_Missense_Mutation_p.D251E|UBL4A_ENST00000477777.1_5'Flank|UBL4A_ENST00000369653.4_5'Flank	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	280					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAGGGTGACGTCCCCTCCAA	0.622																																							uc004flq.2		NA																	0		p.D280N(1)		ovary(1)|skin(1)	2						c.(838-840)GAC>GAA		solute carrier family 10, member 3 isoform 1							72.0	66.0	68.0					X																	153716440		2203	4300	6503	SO:0001583	missense	8273				organic anion transport	integral to membrane	bile acid:sodium symporter activity	g.chrX:153716440G>T	X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.840C>A	X.37:g.153716440G>T	ENSP00000377212:p.Asp280Glu		Somatic				UBL4A_uc004flo.2_5'Flank|SLC10A3_uc004flr.2_Missense_Mutation_p.D251E|SLC10A3_uc004flp.2_Missense_Mutation_p.D280E	p.D280E	NM_001142392	NP_001135864	WXS	Illumina HiSeq	Unspecified	P09131	P3_HUMAN			3	1104	-	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		280					Q5HY79|Q9BSL2	Missense_Mutation	SNP	ENST00000393587.4	37	c.840C>A	CCDS14755.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979518	0.53827	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.09	-6.85	0.01681	.	0.000000	0.85682	U	0.000000	T	0.42653	0.1212	M	0.89095	3.005	0.34720	D	0.728634	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60732	-0.7205	10	0.87932	D	0	-24.661	17.4335	0.87545	0.8019:0.0:0.1981:0.0	.	251;280	Q9BSL2;P09131	.;P3_HUMAN	E	251;335;280;280	ENSP00000358663:D251E;ENSP00000377211:D335E;ENSP00000263512:D280E;ENSP00000377212:D280E	ENSP00000263512:D280E	D	-	3	2	SLC10A3	153369634	0.043000	0.20138	0.707000	0.30419	0.667000	0.39255	-0.783000	0.04638	-1.836000	0.01190	-1.098000	0.02139	GAC		0.622	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037235.3	NM_019848		13	103	1	0	7.03913e-09	0.001368	9.75131e-09	13	103				
F8	2157	broad.mit.edu	37	X	154158987	154158987	+	Silent	SNP	T	T	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:154158987T>C	ENST00000360256.4	-	14	3278	c.3078A>G	c.(3076-3078)tcA>tcG	p.S1026S		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1026	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TATTAGTTGCTGAATTATTGG	0.333																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(3076-3078)TCA>TCG		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						80.0	78.0	79.0					X																	154158987		2203	4297	6500	SO:0001819	synonymous_variant	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154158987T>C	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3078A>G	X.37:g.154158987T>C			Somatic					p.S1026S	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			14	3249	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1026			B.		Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	c.3078A>G	CCDS35457.1																																																																																				0.333	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			60	57	0	0	0	0.00361	0	60	57				
NFASC	23114	broad.mit.edu	37	1	204978720	204978721	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr1:204978720_204978721insA	ENST00000401399.1	+	27	3524_3525	c.3325_3326insA	c.(3325-3327)ggcfs	p.G1109fs	NFASC_ENST00000404907.1_Frame_Shift_Ins_p.G1043fs|NFASC_ENST00000360049.4_Frame_Shift_Ins_p.G1038fs|NFASC_ENST00000367169.4_Frame_Shift_Ins_p.G940fs|NFASC_ENST00000513543.1_Frame_Shift_Ins_p.G1038fs|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000338515.6_Frame_Shift_Ins_p.G1126fs|NFASC_ENST00000404076.1_Frame_Shift_Ins_p.G1026fs|NFASC_ENST00000339876.6_Frame_Shift_Ins_p.G1109fs|NFASC_ENST00000367172.4_Frame_Shift_Ins_p.G1216fs|NFASC_ENST00000338586.6_Frame_Shift_Ins_p.G1093fs|NFASC_ENST00000367171.4_Frame_Shift_Ins_p.G1201fs|NFASC_ENST00000539706.1_Frame_Shift_Ins_p.G1043fs|NFASC_ENST00000367170.4_Frame_Shift_Ins_p.G1137fs			O94856	NFASC_HUMAN	neurofascin	1216					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CGCCACCCAGGGCTGGTTCATT	0.589																																							uc001hbj.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(3325-3327)GGCfs		neurofascin isoform 1 precursor																																				SO:0001589	frameshift_variant	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204978720_204978721insA	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	Exception_encountered	1.37:g.204978720_204978721insA	ENSP00000385637:p.Gly1109fs		Somatic				NFASC_uc010pra.1_Frame_Shift_Ins_p.G1043fs|NFASC_uc001hbi.2_Frame_Shift_Ins_p.G1038fs|NFASC_uc010prb.1_Frame_Shift_Ins_p.G1058fs|NFASC_uc010prc.1_Frame_Shift_Ins_p.G609fs|NFASC_uc001hbl.1_Frame_Shift_Ins_p.G185fs|NFASC_uc001hbm.1_Frame_Shift_Ins_p.G132fs|NFASC_uc009xbh.1_5'UTR	p.G1109fs	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		28	3653_3654	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		1216			Extracellular (Potential).		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Frame_Shift_Ins	INS	ENST00000401399.1	37	c.3325_3326insA	CCDS53460.1																																																																																				0.589	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		17	115	NA	NA	NA	NA	NA	17	115	---	---	---	---
OR51M1	390059	broad.mit.edu	37	11	5410741	5410741	+	Frame_Shift_Del	DEL	G	G	-	rs371536682		TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr11:5410741delG	ENST00000328611.3	+	1	135	c.113delG	c.(112-114)tggfs	p.W38fs	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	38					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCAAACACTGGATTTTCATC	0.423																																							uc010qzc.1		NA																	0					0						c.(112-114)TGGfs		olfactory receptor, family 51, subfamily M,							183.0	169.0	173.0					11																	5410741		1905	4117	6022	SO:0001589	frameshift_variant	390059					integral to membrane	olfactory receptor activity	g.chr11:5410741delG	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.113delG	11.37:g.5410741delG	ENSP00000333196:p.Trp38fs		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.W38fs	NM_001004756	NP_001004756	WXS	Illumina HiSeq	Unspecified	B2RNI9	B2RNI9_HUMAN		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	113	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	38					Q6IF80	Frame_Shift_Del	DEL	ENST00000328611.3	37	c.113delG	CCDS53596.1																																																																																				0.423	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756		12	175	NA	NA	NA	NA	NA	12	175	---	---	---	---
NDRG2	57447	broad.mit.edu	37	14	21486164	21486164	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr14:21486164delG	ENST00000556147.1	-	15	1871	c.931delC	c.(931-933)ctgfs	p.L311fs	NDRG2_ENST00000350792.3_Frame_Shift_Del_p.L297fs|NDRG2_ENST00000397844.2_Frame_Shift_Del_p.L281fs|NDRG2_ENST00000397855.3_Frame_Shift_Del_p.L268fs|NDRG2_ENST00000397853.3_Frame_Shift_Del_p.L311fs|NDRG2_ENST00000397847.2_Frame_Shift_Del_p.L300fs|NDRG2_ENST00000554104.1_Frame_Shift_Del_p.L224fs|NDRG2_ENST00000298684.5_Frame_Shift_Del_p.L268fs|NDRG2_ENST00000555158.1_Frame_Shift_Del_p.L297fs|NDRG2_ENST00000397851.2_Frame_Shift_Del_p.L311fs|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000554143.1_Frame_Shift_Del_p.L297fs|NDRG2_ENST00000397856.3_Frame_Shift_Del_p.L281fs|NDRG2_ENST00000553503.1_Frame_Shift_Del_p.L297fs|NDRG2_ENST00000403829.3_Frame_Shift_Del_p.L307fs|NDRG2_ENST00000298687.5_Frame_Shift_Del_p.L311fs|NDRG2_ENST00000360463.3_Frame_Shift_Del_p.L297fs|NDRG2_ENST00000397858.1_Frame_Shift_Del_p.L311fs			Q9UN36	NDRG2_HUMAN	NDRG family member 2	311					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ATGCCTTGCAGGAAGTACTTG	0.562																																							uc001vyy.2		NA																	0				ovary(1)|breast(1)	2						c.(931-933)CTGfs		N-myc downstream-regulated gene 2 isoform a							212.0	200.0	204.0					14																	21486164		2203	4300	6503	SO:0001589	frameshift_variant	57447				cell differentiation|nervous system development	centrosome|cytosol|Golgi apparatus|nucleus|perinuclear region of cytoplasm		g.chr14:21486164delG	AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.931delC	14.37:g.21486164delG	ENSP00000451712:p.Leu311fs		Somatic				NDRG2_uc010tll.1_Frame_Shift_Del_p.L307fs|NDRG2_uc001vyt.2_Frame_Shift_Del_p.L224fs|NDRG2_uc001vyu.2_Frame_Shift_Del_p.L268fs|NDRG2_uc001vyv.2_Frame_Shift_Del_p.L297fs|NDRG2_uc001vyw.2_Frame_Shift_Del_p.L297fs|NDRG2_uc001vzb.2_Frame_Shift_Del_p.L251fs|NDRG2_uc001vyx.2_Frame_Shift_Del_p.L311fs|NDRG2_uc001vza.2_Frame_Shift_Del_p.L297fs|NDRG2_uc001vyz.2_Frame_Shift_Del_p.L297fs|NDRG2_uc001vzc.2_Frame_Shift_Del_p.L281fs|NDRG2_uc001vze.2_Frame_Shift_Del_p.L311fs|NDRG2_uc001vzd.2_Frame_Shift_Del_p.L311fs|NDRG2_uc001vzg.2_Frame_Shift_Del_p.L297fs|NDRG2_uc001vzf.2_Frame_Shift_Del_p.L297fs|NDRG2_uc010aig.2_Frame_Shift_Del_p.L300fs	p.L311fs	NM_201540	NP_963834	WXS	Illumina HiSeq	Unspecified	Q9UN36	NDRG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)	16	1081	-	all_cancers(95;0.00185)		311					B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Frame_Shift_Del	DEL	ENST00000556147.1	37	c.931delC	CCDS9565.1																																																																																				0.562	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1			26	202	NA	NA	NA	NA	NA	26	202	---	---	---	---
LRP3	4037	broad.mit.edu	37	19	33698115	33698116	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:33698115_33698116insA	ENST00000253193.7	+	7	2149_2150	c.1947_1948insA	c.(1948-1950)cccfs	p.P650fs	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	650					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					CTGCCCCCGACCCCCCAGCACC	0.743																																							uc010edh.2		NA																	0				pancreas(2)|ovary(1)	3						c.(1945-1950)GACCCCfs		low density lipoprotein receptor-related protein																																				SO:0001589	frameshift_variant	4037				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity	g.chr19:33698115_33698116insA	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	Exception_encountered	19.37:g.33698115_33698116insA	ENSP00000253193:p.Pro650fs		Somatic				LRP3_uc002nuk.3_Frame_Shift_Ins_p.D523fs	p.D649fs	NM_002333	NP_002324	WXS	Illumina HiSeq	Unspecified	O75074	LRP3_HUMAN			7	2040_2041	+	Esophageal squamous(110;0.137)		649_650			Cytoplasmic (Potential).		B3KQD6|B4DKF2	Frame_Shift_Ins	INS	ENST00000253193.7	37	c.1947_1948insA	CCDS12430.1																																																																																				0.743	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4			5	6	NA	NA	NA	NA	NA	5	6	---	---	---	---
HKR1	284459	broad.mit.edu	37	19	37854204	37854204	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:37854204delG	ENST00000324411.4	+	6	1776	c.1507delG	c.(1507-1509)gggfs	p.G503fs	HKR1_ENST00000589392.1_Frame_Shift_Del_p.G485fs|HKR1_ENST00000392153.3_Frame_Shift_Del_p.G484fs|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000541583.2_Frame_Shift_Del_p.G442fs|HKR1_ENST00000591471.1_Frame_Shift_Del_p.G230fs|HKR1_ENST00000544914.1_Frame_Shift_Del_p.G230fs	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	503					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACGGAGTGTGGGCGAGGCTT	0.532																																							uc002ogb.2		NA																	0				ovary(2)	2						c.(1507-1509)GGGfs		GLI-Kruppel family member HKR1							84.0	80.0	82.0					19																	37854204		2203	4300	6503	SO:0001589	frameshift_variant	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854204delG	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1507delG	19.37:g.37854204delG	ENSP00000315505:p.Gly503fs		Somatic				HKR1_uc002ofx.2_Frame_Shift_Del_p.G219fs|HKR1_uc002ofy.2_Frame_Shift_Del_p.G219fs|HKR1_uc002oga.2_Frame_Shift_Del_p.G485fs|HKR1_uc010xto.1_Frame_Shift_Del_p.G485fs|HKR1_uc002ogc.2_Frame_Shift_Del_p.G484fs|HKR1_uc010xtp.1_Frame_Shift_Del_p.G442fs|HKR1_uc002ogd.2_Frame_Shift_Del_p.G442fs	p.G503fs	NM_181786	NP_861451	WXS	Illumina HiSeq	Unspecified	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1776	+			503			C2H2-type 8.		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Frame_Shift_Del	DEL	ENST00000324411.4	37	c.1507delG	CCDS12502.1																																																																																				0.532	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		14	78	NA	NA	NA	NA	NA	14	78	---	---	---	---
HNRNPUL1	11100	broad.mit.edu	37	19	41798236	41798237	+	Frame_Shift_Ins	INS	-	-	T			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr19:41798236_41798237insT	ENST00000392006.3	+	8	1259_1260	c.1086_1087insT	c.(1087-1089)ttgfs	p.L363fs	HNRNPUL1_ENST00000378215.4_Frame_Shift_Ins_p.L249fs|HNRNPUL1_ENST00000595018.1_Frame_Shift_Ins_p.L263fs|HNRNPUL1_ENST00000593587.1_Frame_Shift_Ins_p.L263fs|HNRNPUL1_ENST00000352456.3_Frame_Shift_Ins_p.L263fs|HNRNPUL1_ENST00000263367.3_Frame_Shift_Ins_p.L274fs|HNRNPUL1_ENST00000602130.1_Frame_Shift_Ins_p.L363fs	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	363	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AGAAGGAAGCCTTGGGGGGTCA	0.505																																							uc002oqb.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1084-1089)GCCTTGfs		heterogeneous nuclear ribonucleoprotein U-like 1																																				SO:0001589	frameshift_variant	11100				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding	g.chr19:41798236_41798237insT	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1088dupT	19.37:g.41798238_41798238dupT	ENSP00000375863:p.Leu363fs		Somatic				CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Frame_Shift_Ins_p.A262fs|HNRNPUL1_uc002oqa.3_Frame_Shift_Ins_p.A262fs|HNRNPUL1_uc010ehm.2_Frame_Shift_Ins_p.A362fs|HNRNPUL1_uc002oqc.3_Frame_Shift_Ins_p.A248fs|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Frame_Shift_Ins_p.A262fs|HNRNPUL1_uc010ehn.2_Frame_Shift_Ins_p.A262fs|HNRNPUL1_uc010eho.2_Frame_Shift_Ins_p.A262fs|HNRNPUL1_uc010xvy.1_Frame_Shift_Ins_p.A262fs|HNRNPUL1_uc010ehp.2_Frame_Shift_Ins_p.A218fs|HNRNPUL1_uc010ehl.1_Frame_Shift_Ins_p.A262fs	p.A362fs	NM_007040	NP_008971	WXS	Illumina HiSeq	Unspecified	Q9BUJ2	HNRL1_HUMAN			8	1375_1376	+			362_363			B30.2/SPRY.|Necessary for interaction with TP53.		B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Frame_Shift_Ins	INS	ENST00000392006.3	37	c.1086_1087insT	CCDS12576.1																																																																																				0.505	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040		23	142	NA	NA	NA	NA	NA	23	142	---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79878782	79878783	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:79878782_79878783insA	ENST00000402739.4	+	1	105_106	c.100_101insA	c.(100-102)cagfs	p.Q34fs	CTNNA2_ENST00000361291.4_Frame_Shift_Ins_p.Q68fs|CTNNA2_ENST00000540488.1_Frame_Shift_Ins_p.Q34fs|CTNNA2_ENST00000409266.1_Frame_Shift_Ins_p.Q34fs|CTNNA2_ENST00000466387.1_Frame_Shift_Ins_p.Q34fs|CTNNA2_ENST00000496558.1_Frame_Shift_Ins_p.Q34fs|CTNNA2_ENST00000541047.1_Frame_Shift_Ins_p.Q34fs|MIR4264_ENST00000583520.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	34					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						ACTTGTTACACAGGTAAGGGAT	0.391																																							uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(100-102)CAGfs		catenin, alpha 2 isoform 1																																				SO:0001589	frameshift_variant	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:79878782_79878783insA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.101dupA	2.37:g.79878783_79878783dupA	ENSP00000384638:p.Gln34fs		Somatic				CTNNA2_uc010yse.1_Frame_Shift_Ins_p.Q34fs|CTNNA2_uc010ysf.1_Frame_Shift_Ins_p.Q34fs|CTNNA2_uc010ysg.1_Frame_Shift_Ins_p.Q34fs|hsa-mir-4264|MI0015877_5'Flank	p.Q34fs	NM_004389	NP_004380	WXS	Illumina HiSeq	Unspecified	P26232	CTNA2_HUMAN			1	105_106	+			34					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Frame_Shift_Ins	INS	ENST00000402739.4	37	c.100_101insA																																																																																					0.391	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		18	53	NA	NA	NA	NA	NA	18	53	---	---	---	---
COL5A2	1290	broad.mit.edu	37	2	189904256	189904257	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr2:189904256_189904257insA	ENST00000374866.3	-	51	3940_3941	c.3666_3667insT	c.(3664-3669)cctccgfs	p.P1223fs		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1223					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GGGGGACCCGGAGGGCCAGGTG	0.49																																							uc002uqk.2		NA																	0				ovary(2)	2						c.(3664-3669)CCTCCGfs		alpha 2 type V collagen preproprotein																																				SO:0001589	frameshift_variant	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189904256_189904257insA	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3667dupT	2.37:g.189904257_189904257dupA	ENSP00000364000:p.Pro1223fs		Somatic				COL5A2_uc010frx.2_Frame_Shift_Ins_p.P798fs	p.P1222fs	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		51	3941_3942	-			1222_1223					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Frame_Shift_Ins	INS	ENST00000374866.3	37	c.3666_3667insT	CCDS33350.1																																																																																				0.490	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		8	48	NA	NA	NA	NA	NA	8	48	---	---	---	---
NCOA6	23054	broad.mit.edu	37	20	33330968	33330970	+	In_Frame_Del	DEL	TGC	TGC	-	rs140426729	byFrequency	TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	TGC	TGC	-	-	TGC	TGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:33330968_33330970delTGC	ENST00000374796.2	-	12	5660_5662	c.3090_3092delGCA	c.(3088-3093)cagcaa>caa	p.1030_1031QQ>Q	NCOA6_ENST00000359003.2_In_Frame_Del_p.1030_1031QQ>Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1030	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CATCATTtgttgctgctgctgct	0.576																																							uc002xav.2		NA																	0				ovary(3)|breast(3)|central_nervous_system(1)	7						c.(3088-3093)CAGCAA>CAA		nuclear receptor coactivator 6																																				SO:0001651	inframe_deletion	23054				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding	g.chr20:33330968_33330970delTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3090_3092delGCA	20.37:g.33330977_33330979delTGC	ENSP00000363929:p.Gln1032del		Somatic				NCOA6_uc002xaw.2_In_Frame_Del_p.1030_1031QQ>Q	p.1030_1031QQ>Q	NM_014071	NP_054790	WXS	Illumina HiSeq	Unspecified	Q14686	NCOA6_HUMAN			12	5661_5663	-			1030_1031			NCOA1-binding region.|Gln-rich.|CREBBP-binding region.		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	In_Frame_Del	DEL	ENST00000374796.2	37	c.3090_3092delGCA	CCDS13241.1																																																																																				0.576	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071		7	138	NA	NA	NA	NA	NA	7	138	---	---	---	---
CTCFL	140690	broad.mit.edu	37	20	56094353	56094353	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr20:56094353delG	ENST00000608263.1	-	3	1496	c.835delC	c.(835-837)cacfs	p.H279fs	CTCFL_ENST00000539382.1_Frame_Shift_Del_p.H74fs|CTCFL_ENST00000608425.1_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000608903.1_Frame_Shift_Del_p.H17fs|CTCFL_ENST00000608440.1_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000243914.3_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000502686.2_Frame_Shift_Del_p.H17fs|CTCFL_ENST00000432255.2_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000423479.3_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000433949.3_Frame_Shift_Del_p.H74fs|CTCFL_ENST00000609232.1_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000371196.2_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000608158.1_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000429804.3_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000422869.2_Frame_Shift_Del_p.H279fs|CTCFL_ENST00000481655.2_Frame_Shift_Del_p.H279fs	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	279					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			TCACTGGTGTGAGTTTTCATA	0.458																																							uc010gix.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(835-837)CACfs		CCCTC-binding factor-like protein							124.0	116.0	118.0					20																	56094353		2203	4300	6503	SO:0001589	frameshift_variant	140690				cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr20:56094353delG		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.835delC	20.37:g.56094353delG	ENSP00000476783:p.His279fs		Somatic				CTCFL_uc010giw.1_Frame_Shift_Del_p.H279fs|CTCFL_uc002xym.2_Frame_Shift_Del_p.H279fs|CTCFL_uc010giz.1_5'UTR|CTCFL_uc010giy.1_5'UTR|CTCFL_uc010gja.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gjb.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gjc.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gjd.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gje.2_Frame_Shift_Del_p.H279fs|CTCFL_uc010gjf.2_Frame_Shift_Del_p.H74fs|CTCFL_uc010gjg.2_Frame_Shift_Del_p.H11fs|CTCFL_uc010gjh.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gji.1_Frame_Shift_Del_p.H74fs|CTCFL_uc010gjj.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gjk.1_Frame_Shift_Del_p.H279fs|CTCFL_uc010gjl.1_Frame_Shift_Del_p.H279fs	p.H279fs	NM_080618	NP_542185	WXS	Illumina HiSeq	Unspecified	Q8NI51	CTCFL_HUMAN	BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)		3	1497	-	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		279			C2H2-type 1.		A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Frame_Shift_Del	DEL	ENST00000608263.1	37	c.835delC	CCDS13459.1																																																																																				0.458	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618		16	68	NA	NA	NA	NA	NA	16	68	---	---	---	---
LTN1	26046	broad.mit.edu	37	21	30313665	30313666	+	Frame_Shift_Ins	INS	-	-	A			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr21:30313665_30313666insA	ENST00000361371.5	-	25	4437_4438	c.4358_4359insT	c.(4357-4359)ttgfs	p.L1453fs	LTN1_ENST00000389194.2_Frame_Shift_Ins_p.L1499fs			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1453					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						GAATACACCCCAAAACATTTTC	0.366																																							uc002ymr.2		NA																	0					0						c.(4495-4497)TTGfs		zinc finger protein 294																																				SO:0001589	frameshift_variant	26046						ligase activity|zinc ion binding	g.chr21:30313665_30313666insA	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.4359dupT	21.37:g.30313669_30313669dupA	ENSP00000354977:p.Leu1453fs		Somatic					p.L1499fs	NM_015565	NP_056380	WXS	Illumina HiSeq	Unspecified	O94822	LTN1_HUMAN			25	4509_4510	-			1453					A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Frame_Shift_Ins	INS	ENST00000361371.5	37	c.4496_4497insT																																																																																					0.366	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565		64	47	NA	NA	NA	NA	NA	64	47	---	---	---	---
GAB4	128954	broad.mit.edu	37	22	17472833	17472833	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr22:17472833delG	ENST00000400588.1	-	2	515	c.408delC	c.(406-408)accfs	p.T136fs	GAB4_ENST00000523144.1_5'UTR	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	136	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TGTCCTCCCTGGTCTCAGCCA	0.502																																							uc002zlw.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(406-408)ACCfs		GRB2-associated binding protein family, member							260.0	266.0	264.0					22																	17472833		2203	4300	6503	SO:0001589	frameshift_variant	128954							g.chr22:17472833delG	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.408delC	22.37:g.17472833delG	ENSP00000383431:p.Thr136fs		Somatic				GAB4_uc010gqs.1_Frame_Shift_Del_p.T136fs	p.T136fs	NM_001037814	NP_001032903	WXS	Illumina HiSeq	Unspecified	Q2WGN9	GAB4_HUMAN			2	516	-		all_epithelial(15;0.112)|Lung NSC(13;0.248)	136			PH.			Frame_Shift_Del	DEL	ENST00000400588.1	37	c.408delC	CCDS42976.1																																																																																				0.502	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882		54	215	NA	NA	NA	NA	NA	54	215	---	---	---	---
COL25A1	84570	broad.mit.edu	37	4	109861693	109861694	+	Splice_Site	INS	-	-	C			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:109861693_109861694insC	ENST00000399132.1	-	10	1203		c.e10+1		COL25A1_ENST00000399126.1_Splice_Site|COL25A1_ENST00000399127.1_Splice_Site	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		AAAGCGACTCACGGGTACTCCT	0.599																																							uc003hze.1		NA																	0				ovary(2)	2						c.e9+1		collagen, type XXV, alpha 1 isoform 1																																				SO:0001630	splice_region_variant	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:109861693_109861694insC	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.672+1->G	4.37:g.109861694_109861694dupC			Somatic				COL25A1_uc003hzg.2_Splice_Site_p.P224_splice|COL25A1_uc003hzd.2_Intron|COL25A1_uc003hzf.2_Splice_Site_p.P5_splice	p.P224_splice	NM_198721	NP_942014	WXS	Illumina HiSeq	Unspecified	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	9	1203	-		Hepatocellular(203;0.217)							Splice_Site	INS	ENST00000399132.1	37	c.672_splice	CCDS43258.1																																																																																				0.599	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	Intron	25	112	NA	NA	NA	NA	NA	25	112	---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155241794	155241794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr4:155241794delG	ENST00000357232.4	-	14	3391	c.3392delC	c.(3391-3393)acafs	p.T1131fs		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1131	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGCTGTTACTGTCAGGATGAC	0.483																																							uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(3391-3393)ACAfs		dachsous 2 isoform 1							248.0	251.0	250.0					4																	155241794		2203	4300	6503	SO:0001589	frameshift_variant	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155241794delG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3392delC	4.37:g.155241794delG	ENSP00000349768:p.Thr1131fs		Somatic					p.T1131fs	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	14	3392	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1131			Cadherin 9.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Frame_Shift_Del	DEL	ENST00000357232.4	37	c.3392delC	CCDS3785.1																																																																																				0.483	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		39	150	NA	NA	NA	NA	NA	39	150	---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13766239	13766239	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:13766239delG	ENST00000265104.4	-	59	10051	c.9947delC	c.(9946-9948)cctfs	p.P3316fs	DNAH5_ENST00000504001.3_Intron	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3316	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GATGAGGTGAGGGGGGCGGCC	0.532									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(9946-9948)CCTfs		dynein, axonemal, heavy chain 5							108.0	106.0	107.0					5																	13766239		2203	4300	6503	SO:0001589	frameshift_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13766239delG	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9947delC	5.37:g.13766239delG	ENSP00000265104:p.Pro3316fs		Somatic				DNAH5_uc003jfc.2_5'UTR	p.P3316fs	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			59	9989	-	Lung NSC(4;0.00476)		3316			Stalk (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Frame_Shift_Del	DEL	ENST00000265104.4	37	c.9947delC	CCDS3882.1																																																																																				0.532	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		71	135	NA	NA	NA	NA	NA	71	135	---	---	---	---
THBS4	7060	broad.mit.edu	37	5	79372774	79372776	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	TGA	TGA	-	-	TGA	TGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:79372774_79372776delTGA	ENST00000350881.2	+	16	2179_2181	c.1989_1991delTGA	c.(1987-1992)tgtgat>tgt	p.D668del	THBS4_ENST00000511733.1_In_Frame_Del_p.D577del|CTD-2201I18.1_ENST00000514042.1_RNA|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	668					behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GTGACGAGTGTGATGATGATGAT	0.562																																							uc003kgh.2		NA																	0					0						c.(1987-1992)TGTGAT>TGT		thrombospondin 4 precursor																																				SO:0001651	inframe_deletion	7060				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity	g.chr5:79372774_79372776delTGA		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.1989_1991delTGA	5.37:g.79372783_79372785delTGA	ENSP00000339730:p.Asp668del		Somatic				uc003kgi.3_Intron	p.D668del	NM_003248	NP_003239	WXS	Illumina HiSeq	Unspecified	P35443	TSP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)	17	2312_2314	+		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)	668			TSP type-3 7.		B2R909|Q86TG2	In_Frame_Del	DEL	ENST00000350881.2	37	c.1989_1991delTGA	CCDS4049.1																																																																																				0.562	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1			8	322	NA	NA	NA	NA	NA	8	322	---	---	---	---
PCDHGA2	56113	broad.mit.edu	37	5	140719292	140719292	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr5:140719292delC	ENST00000394576.2	+	1	754	c.754delC	c.(754-756)ccgfs	p.P252fs	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	252	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATAAGCATTCCGGAGAATAC	0.552																																							uc003ljk.1		NA																	0				skin(2)|ovary(1)	3						c.(754-756)CCGfs		protocadherin gamma subfamily A, 2 isoform 1							75.0	78.0	77.0					5																	140719292		2203	4300	6503	SO:0001589	frameshift_variant	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140719292delC	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.754delC	5.37:g.140719292delC	ENSP00000378077:p.Pro252fs		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Frame_Shift_Del_p.P252fs	p.P252fs	NM_018915	NP_061738	WXS	Illumina HiSeq	Unspecified	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	939	+			252			Cadherin 3.|Extracellular (Potential).		Q52LL6|Q9Y5D5	Frame_Shift_Del	DEL	ENST00000394576.2	37	c.754delC	CCDS47289.1																																																																																				0.552	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		41	62	NA	NA	NA	NA	NA	41	62	---	---	---	---
BTN3A1	11119	broad.mit.edu	37	6	26411336	26411336	+	Splice_Site	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:26411336delG	ENST00000289361.6	+	8	1332		c.e8-1		BTN3A1_ENST00000476549.2_Splice_Site|BTN3A1_ENST00000425234.2_Splice_Site|BTN3A1_ENST00000414912.2_Splice_Site	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1						activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TTTCATTGTAGGGGGAGAGAG	0.393																																							uc003nhv.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.e8-1		butyrophilin, subfamily 3, member A1 isoform a							160.0	160.0	160.0					6																	26411336		2203	4300	6503	SO:0001630	splice_region_variant	11119				lipid metabolic process	integral to membrane		g.chr6:26411336delG	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.965-1G>-	6.37:g.26411336delG			Somatic				BTN3A1_uc011dkj.1_Splice_Site_p.R322_splice|BTN3A1_uc011dkk.1_Splice_Site_p.R270_splice|BTN3A1_uc010jqj.2_Splice_Site_p.R322_splice	p.R322_splice	NM_007048	NP_008979	WXS	Illumina HiSeq	Unspecified	O00481	BT3A1_HUMAN			8	1333	+								A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Splice_Site	DEL	ENST00000289361.6	37	c.965_splice	CCDS4608.1																																																																																				0.393	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		Intron	16	137	NA	NA	NA	NA	NA	16	137	---	---	---	---
TCP10	6953	broad.mit.edu	37	6	167791442	167791442	+	Splice_Site	DEL	C	C	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr6:167791442delC	ENST00000397829.4	-	4	585		c.e4+1		TCP10_ENST00000366827.2_Splice_Site	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10							cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		CGAAGGGTCACCTTTGGAGGA	0.527																																							uc003qvv.1		NA																	0				breast(1)	1						c.e4+1		t-complex 10							95.0	118.0	110.0					6																	167791442		2201	4296	6497	SO:0001630	splice_region_variant	6953					cytosol		g.chr6:167791442delC	U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.417+1G>-	6.37:g.167791442delC			Somatic				TCP10_uc003qvu.2_Splice_Site_p.K139_splice|TCP10_uc003qvw.2_Splice_Site_p.K115_splice	p.K139_splice	NM_004610	NP_004601	WXS	Illumina HiSeq	Unspecified	Q12799	TCP10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)	4	629	-		Breast(66;1.53e-05)|Ovarian(120;0.024)						Q5JR60|Q6P4F4	Splice_Site	DEL	ENST00000397829.4	37	c.417_splice	CCDS43527.1																																																																																				0.527	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	NM_004610	Intron	10	132	NA	NA	NA	NA	NA	10	132	---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43283514	43283514	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr7:43283514delC	ENST00000395891.2	+	3	615	c.10delC	c.(10-12)cacfs	p.H4fs	AC004692.4_ENST00000458590.1_RNA|AC004692.4_ENST00000458680.1_RNA|AC004692.4_ENST00000457315.1_RNA|HECW1_ENST00000453890.1_Frame_Shift_Del_p.H4fs	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	4					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TATGCTGCTGCACCTGTGTAG	0.448																																							uc003tid.1		NA																	0				ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(10-12)CACfs		NEDD4-like ubiquitin-protein ligase 1							232.0	231.0	232.0					7																	43283514		2083	4218	6301	SO:0001589	frameshift_variant	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43283514delC	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.10delC	7.37:g.43283514delC	ENSP00000379228:p.His4fs		Somatic				HECW1_uc011kbi.1_Frame_Shift_Del_p.H4fs|HECW1_uc003tie.1_Intron	p.H4fs	NM_015052	NP_055867	WXS	Illumina HiSeq	Unspecified	Q76N89	HECW1_HUMAN			3	615	+			4					A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Frame_Shift_Del	DEL	ENST00000395891.2	37	c.10delC	CCDS5469.2																																																																																				0.448	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		21	63	NA	NA	NA	NA	NA	21	63	---	---	---	---
ANK1	286	broad.mit.edu	37	8	41552150	41552150	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chr8:41552150delG	ENST00000347528.4	-	28	3370	c.3287delC	c.(3286-3288)ccgfs	p.P1096fs	ANK1_ENST00000289734.7_Frame_Shift_Del_p.P1096fs|ANK1_ENST00000352337.4_Frame_Shift_Del_p.P1096fs|ANK1_ENST00000396945.1_Frame_Shift_Del_p.P1096fs|ANK1_ENST00000379758.2_Frame_Shift_Del_p.P1096fs|ANK1_ENST00000265709.8_Frame_Shift_Del_p.P1137fs|ANK1_ENST00000396942.1_Frame_Shift_Del_p.P1096fs	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1096	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.P1096L(1)|p.P1137L(1)|p.P1137R(1)|p.P1096R(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GGCATTCTCCGGGAACGTTGC	0.632																																							uc003xok.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(3286-3288)CCGfs		ankyrin 1 isoform 1							76.0	69.0	72.0					8																	41552150		2203	4300	6503	SO:0001589	frameshift_variant	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41552150delG	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3287delC	8.37:g.41552150delG	ENSP00000339620:p.Pro1096fs		Somatic				NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Frame_Shift_Del_p.P412fs|ANK1_uc003xoi.2_Frame_Shift_Del_p.P1096fs|ANK1_uc003xoj.2_Frame_Shift_Del_p.P1096fs|ANK1_uc003xol.2_Frame_Shift_Del_p.P1096fs|ANK1_uc003xom.2_Frame_Shift_Del_p.P1137fs	p.P1096fs	NM_020476	NP_065209	WXS	Illumina HiSeq	Unspecified	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		28	3371	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	1096					A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Frame_Shift_Del	DEL	ENST00000347528.4	37	c.3287delC	CCDS6119.1																																																																																				0.632	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		7	24	NA	NA	NA	NA	NA	7	24	---	---	---	---
FANCB	2187	broad.mit.edu	37	X	14871289	14871289	+	Splice_Site	DEL	C	C	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:14871289delC	ENST00000324138.3	-	5	1351	c.1198delG	c.(1198-1200)gtt>tt	p.V400fs	FANCB_ENST00000398334.1_Splice_Site_p.V400fs	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	400					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					GAAAAACAAACCTGTAAAGTA	0.308								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc004cwg.1		NA																	0				lung(1)	1						c.(1198-1200)GTTfs	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B							43.0	45.0	44.0					X																	14871289		2202	4291	6493	SO:0001630	splice_region_variant	2187	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14871289delC	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1198-1G>-	X.37:g.14871289delC			Somatic				FANCB_uc004cwh.1_Frame_Shift_Del_p.V400fs	p.V400fs	NM_001018113	NP_001018123	WXS	Illumina HiSeq	Unspecified	Q8NB91	FANCB_HUMAN			6	1466	-	Hepatocellular(33;0.183)		400					B2RMZ4|Q7Z2U2|Q86XG1	Frame_Shift_Del	DEL	ENST00000324138.3	37	c.1198delG	CCDS14161.1																																																																																				0.308	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	Frame_Shift_Del	9	28	NA	NA	NA	NA	NA	9	28	---	---	---	---
MAGEA6	4105	broad.mit.edu	37	X	151870201	151870201	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7554-01A-11D-2036-08	TCGA-97-7554-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	1279b038-abe8-4ac4-accb-8a566da2b2fc	e05893e7-9426-44cc-8f63-c4e6e4daf500	g.chrX:151870201delT	ENST00000329342.5	+	3	1116	c.891delT	c.(889-891)cctfs	p.P297fs		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	297	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GTGGAGGACCTCGCATTTCCT	0.557																																							uc004ffq.1		NA																	0					0						c.(889-891)CCTfs		melanoma antigen family A, 6							140.0	135.0	137.0					X																	151870201		2202	4298	6500	SO:0001589	frameshift_variant	4105						protein binding	g.chrX:151870201delT		CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.891delT	X.37:g.151870201delT	ENSP00000329199:p.Pro297fs		Somatic				MAGEA6_uc004ffr.1_Frame_Shift_Del_p.P297fs|MAGEA2_uc010nto.2_Intron	p.P297fs	NM_005363	NP_005354	WXS	Illumina HiSeq	Unspecified	P43360	MAGA6_HUMAN			3	1085	+	Acute lymphoblastic leukemia(192;6.56e-05)		297			MAGE.		A8IF93|Q6NW44	Frame_Shift_Del	DEL	ENST00000329342.5	37	c.891delT	CCDS14708.1																																																																																				0.557	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058747.2	NM_005363		39	346	NA	NA	NA	NA	NA	39	346	---	---	---	---
