#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TNFRSF25	8718	broad.mit.edu	37	1	6526149	6526149	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:6526149C>A	ENST00000356876.3	-	1	106	c.19G>T	c.(19-21)Ggc>Tgc	p.G7C	TNFRSF25_ENST00000461703.2_5'UTR|TNFRSF25_ENST00000348333.3_Missense_Mutation_p.G7C|TNFRSF25_ENST00000351959.5_Missense_Mutation_p.G7C|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.G7C|TNFRSF25_ENST00000351748.3_Missense_Mutation_p.G7C	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	7					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		GCCGCGCAGCCCCGCGGCCGC	0.746																																							uc001ane.2		NA																	0				central_nervous_system(2)|breast(1)	3						c.(19-21)GGC>TGC		tumor necrosis factor receptor superfamily,							5.0	6.0	6.0					1																	6526149		2066	4090	6156	SO:0001583	missense	8718				apoptosis|induction of apoptosis by extracellular signals	cytosol|extracellular region|integral to plasma membrane	tumor necrosis factor receptor activity	g.chr1:6526149C>A	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.19G>T	1.37:g.6526149C>A	ENSP00000349341:p.Gly7Cys		Somatic				TNFRSF25_uc001ana.2_Missense_Mutation_p.G7C|TNFRSF25_uc001anb.2_RNA|TNFRSF25_uc001anc.2_RNA|TNFRSF25_uc001and.2_5'UTR|TNFRSF25_uc009vlz.2_RNA|TNFRSF25_uc001anf.2_Missense_Mutation_p.G7C|TNFRSF25_uc001ang.2_Missense_Mutation_p.G7C|TNFRSF25_uc001anh.2_Missense_Mutation_p.G7C|TNFRSF25_uc001ani.1_Missense_Mutation_p.G7C	p.G7C	NM_003790	NP_003781	WXS	Illumina HiSeq	Unspecified	Q93038	TNR25_HUMAN		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)	1	107	-	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)	7					B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	ENST00000356876.3	37	c.19G>T	CCDS71.1	.	.	.	.	.	.	.	.	.	.	c	16.60	3.168011	0.57476	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000351748;ENST00000348333	D;D;D;T;D	0.92495	-2.91;-3.05;-3.02;2.24;-2.24	4.46	-0.53	0.11898	.	8.921220	0.00397	N	0.000050	D	0.92126	0.7504	L	0.27053	0.805	0.09310	N	1	D;D;D;D;D	0.89917	1.0;0.986;0.986;0.977;0.986	D;P;P;P;P	0.97110	1.0;0.712;0.712;0.519;0.712	T	0.80930	-0.1162	10	0.51188	T	0.08	-3.1285	3.7243	0.08469	0.0:0.3893:0.2181:0.3926	.	7;7;7;7;7	Q93038-11;Q93038-9;Q93038-10;Q93038;Q93038-8	.;.;.;TNR25_HUMAN;.	C	7	ENSP00000349341:G7C;ENSP00000367013:G7C;ENSP00000337713:G7C;ENSP00000326762:G7C;ENSP00000314451:G7C	ENSP00000314451:G7C	G	-	1	0	TNFRSF25	6448736	0.000000	0.05858	0.057000	0.19452	0.028000	0.11728	-1.388000	0.02533	0.069000	0.16605	0.450000	0.29827	GGC		0.746	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965		6	7	1	0	5.4927e-09	0.004482	7.7003e-09	6	7				
CAMTA1	23261	broad.mit.edu	37	1	7527940	7527940	+	Silent	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:7527940G>C	ENST00000303635.7	+	6	696	c.489G>C	c.(487-489)cgG>cgC	p.R163R	CAMTA1_ENST00000439411.2_Silent_p.R163R	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCTTCCACCGGAGGTGCTACT	0.567			T	WWTR1	epitheliod hemangioendothelioma																																		uc001aoi.2		NA		Dom	yes		1	1p36.31-p36.23	611501		calmodulin binding transcription activator 1			M					0				ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(487-489)CGG>CGC		calmodulin-binding transcription activator 1							229.0	213.0	218.0					1																	7527940		2203	4300	6503	SO:0001819	synonymous_variant	23261				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding	g.chr1:7527940G>C	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.489G>C	1.37:g.7527940G>C			Somatic					p.R163R	NM_015215	NP_056030	WXS	Illumina HiSeq	Unspecified	Q9Y6Y1	CMTA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)	6	696	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	163			CG-1.		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	37	c.489G>C	CCDS30576.1																																																																																				0.567	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215		46	140	0	0	0	0.01441	0	46	140				
PRAMEF20	645425	broad.mit.edu	37	1	13743067	13743067	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:13743067G>C	ENST00000602960.1	+	1	260	c.256G>C	c.(256-258)Gat>Cat	p.D86H	PRAMEF20_ENST00000316412.5_Missense_Mutation_p.D86H			Q5VT98	PRA20_HUMAN	PRAME family member 20	86					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.5e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000156)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CGATGGGCTTGATGCACTGCT	0.602																																							uc009voa.1		NA																	0				ovary(1)	1						c.(256-258)GAT>CAT		PRAME family member 20							60.0	60.0	60.0					1																	13743067		2190	4266	6456	SO:0001583	missense	645425							g.chr1:13743067G>C		CCDS41265.1	1p36.21	2014-07-15			ENSG00000204478	ENSG00000204478		"""-"""	25224	protein-coding gene	gene with protein product			"""PRAME family member 21"""	PRAMEF21			Standard	NM_001099852		Approved	OTTHUMG00000007911, OTTHUMT00000008157	uc009vnv.1	Q5VT98	OTTHUMG00000007911	ENST00000602960.1:c.256G>C	1.37:g.13743067G>C	ENSP00000473584:p.Asp86His		Somatic					p.D86H	NM_001099852	NP_001093322	WXS	Illumina HiSeq	Unspecified	Q5VT98	PRA20_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.5e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000156)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	2	355	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	86						Missense_Mutation	SNP	ENST00000602960.1	37	c.256G>C	CCDS41265.1	.	.	.	.	.	.	.	.	.	.	.	11.81	1.750248	0.30955	.	.	ENSG00000204478	ENST00000316412	T	0.06608	3.28	1.51	1.51	0.23008	.	0.314197	0.29152	N	0.012995	T	0.14442	0.0349	M	0.82517	2.595	0.09310	N	1	.	.	.	.	.	.	T	0.02087	-1.1216	8	0.49607	T	0.09	.	6.5123	0.22228	0.0:0.0:1.0:0.0	.	.	.	.	H	86	ENSP00000346275:D86H	ENSP00000346275:D86H	D	+	1	0	PRAMEF20	13615654	0.000000	0.05858	0.005000	0.12908	0.310000	0.27922	-0.099000	0.11007	1.176000	0.42840	0.306000	0.20318	GAT		0.602	PRAMEF20-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021782.1	NM_001099852		7	43	0	0	0	0.008291	0	7	43				
PADI3	51702	broad.mit.edu	37	1	17597416	17597417	+	Missense_Mutation	DNP	CG	CG	GA	rs568276808		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:17597416_17597417CG>GA	ENST00000375460.3	+	8	914_915	c.874_875CG>GA	c.(874-876)CGa>GAa	p.R292E		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	292					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGTGGTGTTCCGAGTGGCACCC	0.624																																							uc001bai.2		NA																	0				ovary(1)|breast(1)	2						c.(874-876)CGA>GAA		peptidyl arginine deiminase, type III	L-Citrulline(DB00155)																																			SO:0001583	missense	51702				peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity	g.chr1:17597416_17597417CG>GA	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	Exception_encountered	1.37:g.17597416_17597417delinsGA	ENSP00000364609:p.Arg292Glu		Somatic					p.R292E	NM_016233	NP_057317	WXS	Illumina HiSeq	Unspecified	Q9ULW8	PADI3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	8	914_915	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	292					Q58EY7|Q70SX5	Missense_Mutation	DNP	ENST00000375460.3	37	c.874_875CG>GA	CCDS179.1																																																																																				0.624	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1			21	37	0	0	0	0.004672	0	21	37				
TAS1R2	80834	broad.mit.edu	37	1	19181170	19181170	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:19181170T>A	ENST00000375371.3	-	3	815	c.794A>T	c.(793-795)cAg>cTg	p.Q265L	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	265					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGTGCTCTGCTGCAGCTTGTC	0.617																																							uc001bba.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(793-795)CAG>CTG		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						71.0	61.0	64.0					1																	19181170		2203	4300	6503	SO:0001583	missense	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19181170T>A		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.794A>T	1.37:g.19181170T>A	ENSP00000364520:p.Gln265Leu		Somatic					p.Q265L	NM_152232	NP_689418	WXS	Illumina HiSeq	Unspecified	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	3	795	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	265			Extracellular (Potential).		Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	c.794A>T	CCDS187.1	.	.	.	.	.	.	.	.	.	.	T	9.442	1.088336	0.20390	.	.	ENSG00000179002	ENST00000375371	D	0.85484	-1.99	4.99	-5.55	0.02536	Extracellular ligand-binding receptor (1);	0.753997	0.11320	N	0.576152	T	0.71204	0.3312	N	0.16130	0.375	0.09310	N	1	P	0.44521	0.837	B	0.40285	0.325	T	0.63171	-0.6697	10	0.31617	T	0.26	.	15.9489	0.79817	0.0:0.693:0.0:0.307	.	265	Q8TE23	TS1R2_HUMAN	L	265	ENSP00000364520:Q265L	ENSP00000364520:Q265L	Q	-	2	0	TAS1R2	19053757	0.000000	0.05858	0.452000	0.26994	0.509000	0.34042	-0.978000	0.03778	-0.968000	0.03578	0.459000	0.35465	CAG		0.617	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			13	22	0	0	0	0.004007	0	13	22				
EPHA8	2046	broad.mit.edu	37	1	22903141	22903141	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:22903141C>A	ENST00000166244.3	+	3	663	c.591C>A	c.(589-591)ctC>ctA	p.L197L	EPHA8_ENST00000374644.4_Silent_p.L197L|EPHA8_ENST00000538803.1_Silent_p.L197L	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	197	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCCTCTCTCTCCGCATCTACT	0.622																																							uc001bfx.1		NA																	0				central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13						c.(589-591)CTC>CTA		ephrin receptor EphA8 isoform 1 precursor							59.0	56.0	57.0					1																	22903141		2203	4300	6503	SO:0001819	synonymous_variant	2046					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr1:22903141C>A	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.591C>A	1.37:g.22903141C>A			Somatic				EPHA8_uc001bfw.2_Silent_p.L197L	p.L197L	NM_020526	NP_065387	WXS	Illumina HiSeq	Unspecified	P29322	EPHA8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	3	716	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	197			Extracellular (Potential).|Cys-rich.		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	37	c.591C>A	CCDS225.1																																																																																				0.622	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		14	28	1	0	9.16793e-09	0.00499	1.27308e-08	14	28				
C1QC	714	broad.mit.edu	37	1	22974075	22974075	+	Silent	SNP	C	C	T	rs150732699		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:22974075C>T	ENST00000374639.3	+	3	655	c.537C>T	c.(535-537)tgC>tgT	p.C179C	C1QC_ENST00000374637.1_Silent_p.C179C|C1QC_ENST00000374640.4_Silent_p.C179C	NM_001114101.1	NP_001107573.1	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	179	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCAACCTGTGCGTGCTGCTGT	0.582																																					Ovarian(26;671 750 8290 29071 43278)	Ovarian(26;671 750 8290 29071 43278)	uc001bgc.3		NA																	0					0						c.(535-537)TGC>TGT		complement component 1, q subcomponent, C chain	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	C	,	2,4404	4.2+/-10.8	0,2,2201	106.0	94.0	98.0		537,537	4.6	1.0	1	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	C1QC	NM_001114101.1,NM_172369.3	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	179/246,179/246	22974075	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	714				complement activation, classical pathway|innate immune response|negative regulation of granulocyte differentiation|negative regulation of macrophage differentiation	collagen		g.chr1:22974075C>T	AK057792	CCDS227.1	1p36.11	2014-09-17	2006-02-09	2006-02-09	ENSG00000159189	ENSG00000159189		"""Complement system"""	1245	protein-coding gene	gene with protein product		120575	"""complement component 1, q subcomponent, gamma polypeptide"""	C1QG		1706597	Standard	NM_001114101		Approved		uc001bga.4	P02747	OTTHUMG00000002891	ENST00000374639.3:c.537C>T	1.37:g.22974075C>T			Somatic				C1QC_uc001bga.3_Silent_p.C179C|C1QC_uc001bgb.2_Silent_p.C179C	p.C179C	NM_172369	NP_758957	WXS	Illumina HiSeq	Unspecified	P02747	C1QC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	3	640	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	179			C1q.		Q7Z502|Q96DL2|Q96H05	Silent	SNP	ENST00000374639.3	37	c.537C>T	CCDS227.1																																																																																				0.582	C1QC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008083.1	NM_172369		6	73	0	0	0	0.001168	0	6	73				
KDM1A	23028	broad.mit.edu	37	1	23405646	23405646	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:23405646G>A	ENST00000356634.3	+	15	2108	c.1959G>A	c.(1957-1959)agG>agA	p.R653R	KDM1A_ENST00000400181.4_Silent_p.R677R|RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000542151.1_Silent_p.R677R	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	653	Demethylase activity.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CAGTCCAAAGGATGGGATTTG	0.507																																							uc001bgi.2		NA																	0				ovary(1)|lung(1)	2						c.(1957-1959)AGG>AGA		lysine-specific histone demethylase 1 isoform b							90.0	86.0	88.0					1																	23405646		2203	4300	6503	SO:0001819	synonymous_variant	23028				blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding	g.chr1:23405646G>A	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.1959G>A	1.37:g.23405646G>A			Somatic				KDM1A_uc001bgj.2_Silent_p.R677R	p.R653R	NM_015013	NP_055828	WXS	Illumina HiSeq	Unspecified	O60341	KDM1A_HUMAN			15	2108	+			653			Demethylase activity.		A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Silent	SNP	ENST00000356634.3	37	c.1959G>A	CCDS30627.1																																																																																				0.507	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013		14	90	0	0	0	0.006122	0	14	90				
NCDN	23154	broad.mit.edu	37	1	36026262	36026262	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:36026262G>A	ENST00000373243.2	+	3	893	c.510G>A	c.(508-510)cgG>cgA	p.R170R	NCDN_ENST00000459931.1_3'UTR|NCDN_ENST00000373253.3_Silent_p.R153R|NCDN_ENST00000356090.4_Silent_p.R170R	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	170					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAGGGCCTCGGCACCTCATTG	0.662																																							uc001bza.2		NA																	0				large_intestine(2)|pancreas(1)	3						c.(508-510)CGG>CGA		neurochondrin isoform 1							60.0	59.0	59.0					1																	36026262		2203	4300	6503	SO:0001819	synonymous_variant	23154				neuron projection development	cytosol|dendrite|neuronal cell body		g.chr1:36026262G>A	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.510G>A	1.37:g.36026262G>A			Somatic				KIAA0319L_uc010ohw.1_5'Flank|NCDN_uc001bzb.2_Silent_p.R170R|NCDN_uc001bzc.2_Silent_p.R153R	p.R170R	NM_001014839	NP_001014839	WXS	Illumina HiSeq	Unspecified	Q9UBB6	NCDN_HUMAN			4	637	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	170					D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Silent	SNP	ENST00000373243.2	37	c.510G>A	CCDS392.1																																																																																				0.662	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284		3	33	0	0	0	0.004672	0	3	33				
MFSD2A	84879	broad.mit.edu	37	1	40432551	40432551	+	Missense_Mutation	SNP	G	G	T	rs201045061		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:40432551G>T	ENST00000372809.5	+	8	1056	c.913G>T	c.(913-915)Ggc>Tgc	p.G305C	MFSD2A_ENST00000420632.2_Missense_Mutation_p.G136C|MFSD2A_ENST00000480630.1_Intron|MFSD2A_ENST00000372811.5_Missense_Mutation_p.G292C	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	305					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)	p.G292C(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CATGAGCCACGGCCCATACAT	0.562																																							uc001cev.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(913-915)GGC>TGC		major facilitator superfamily domain containing							113.0	106.0	108.0					1																	40432551		2203	4300	6503	SO:0001583	missense	84879				transmembrane transport	endoplasmic reticulum membrane|integral to membrane		g.chr1:40432551G>T	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.913G>T	1.37:g.40432551G>T	ENSP00000361895:p.Gly305Cys		Somatic				MFSD2A_uc010ojb.1_Missense_Mutation_p.G253C|MFSD2A_uc001ceu.2_Missense_Mutation_p.G292C|MFSD2A_uc010ojc.1_Missense_Mutation_p.G136C|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cex.2_5'Flank	p.G305C	NM_001136493	NP_001129965	WXS	Illumina HiSeq	Unspecified	Q8NA29	MFS2A_HUMAN			8	1094	+			305					A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	ENST00000372809.5	37	c.913G>T	CCDS44118.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260082	0.59321	.	.	ENSG00000168389	ENST00000372811;ENST00000420632;ENST00000372809	T;T;T	0.81078	-1.45;-1.45;-1.45	5.64	5.64	0.86602	Major facilitator superfamily domain, general substrate transporter (1);	0.145914	0.64402	D	0.000006	D	0.88440	0.6437	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.998;0.992;0.959	D	0.88441	0.3042	10	0.59425	D	0.04	-18.7761	12.3892	0.55348	0.0767:0.0:0.9233:0.0	.	253;305;292	B4DNN7;Q8NA29;Q8NA29-2	.;MFS2A_HUMAN;.	C	292;136;305	ENSP00000361898:G292C;ENSP00000391261:G136C;ENSP00000361895:G305C	ENSP00000361895:G305C	G	+	1	0	MFSD2A	40205138	1.000000	0.71417	0.992000	0.48379	0.551000	0.35334	6.436000	0.73417	2.816000	0.96949	0.563000	0.77884	GGC		0.562	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	NM_032793		39	69	1	0	4.14481e-20	0.00623	7.12275e-20	39	69				
ATP6V0B	533	broad.mit.edu	37	1	44441782	44441782	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:44441782C>G	ENST00000472174.2	+	3	530	c.137C>G	c.(136-138)cCc>cGc	p.P46R	ATP6V0B_ENST00000498664.1_5'UTR|ATP6V0B_ENST00000532642.1_Missense_Mutation_p.P46R|ATP6V0B_ENST00000472277.1_3'UTR|ATP6V0B_ENST00000471859.2_Missense_Mutation_p.P93R|ATP6V0B_ENST00000236067.4_5'UTR	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b	46					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GAGACTTCGCCCTTCATGTGG	0.572																																							uc001cld.2		NA																	0				breast(1)	1						c.(136-138)CCC>CGC		ATPase, H+ transporting, lysosomal 21kDa, V0							157.0	137.0	144.0					1																	44441782		2203	4300	6503	SO:0001583	missense	533				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|proton-transporting V-type ATPase, V0 domain|vacuolar membrane	hydrogen ion transmembrane transporter activity	g.chr1:44441782C>G	BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.137C>G	1.37:g.44441782C>G	ENSP00000431605:p.Pro46Arg		Somatic				ATP6V0B_uc001clc.2_Missense_Mutation_p.P46R|ATP6V0B_uc001cle.2_5'UTR|ATP6V0B_uc001clf.2_5'UTR	p.P46R	NM_004047	NP_004038	WXS	Illumina HiSeq	Unspecified	Q99437	VATO_HUMAN			3	248	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	46			Cytoplasmic (Potential).		D3DPY5|Q6IB32	Missense_Mutation	SNP	ENST00000472174.2	37	c.137C>G	CCDS505.1	.	.	.	.	.	.	.	.	.	.	C	33	5.193911	0.94960	.	.	ENSG00000117410	ENST00000472174;ENST00000532642;ENST00000471859	T;T;T	0.42513	0.97;0.97;0.97	5.08	5.08	0.68730	ATPase, F0/V0 complex, subunit C (1);	0.111909	0.64402	D	0.000008	T	0.69575	0.3126	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.74621	-0.3604	10	0.56958	D	0.05	-12.0934	18.4423	0.90671	0.0:1.0:0.0:0.0	.	46;46	Q99437;E9PNL3	VATO_HUMAN;.	R	46;46;93	ENSP00000431605:P46R;ENSP00000434729:P46R;ENSP00000432754:P93R	ENSP00000432754:P93R	P	+	2	0	ATP6V0B	44214369	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.390000	0.79816	2.342000	0.79632	0.471000	0.43371	CCC		0.572	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022854.2	NM_004047		33	113	0	0	0	0.005524	0	33	113				
CYP4A22	284541	broad.mit.edu	37	1	47611765	47611765	+	Missense_Mutation	SNP	G	G	T	rs150794228	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:47611765G>T	ENST00000371891.3	+	11	1335	c.1304G>T	c.(1303-1305)cGt>cTt	p.R435L	CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.R337L|CYP4A22_ENST00000294337.3_Missense_Mutation_p.R435L|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	435						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GACCCTTCCCGTTTTGCACCG	0.537																																					Pancreas(88;1240 1470 2099 14214 37557)	Pancreas(88;1240 1470 2099 14214 37557)	uc001cqv.1		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(1303-1305)CGT>CTT		cytochrome P450, family 4, subfamily A,							327.0	310.0	316.0					1																	47611765		2203	4300	6503	SO:0001583	missense	284541					endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding	g.chr1:47611765G>T		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1304G>T	1.37:g.47611765G>T	ENSP00000360958:p.Arg435Leu		Somatic				CYP4A22_uc009vyo.2_Missense_Mutation_p.R435L|CYP4A22_uc009vyp.2_Missense_Mutation_p.R337L	p.R435L	NM_001010969	NP_001010969	WXS	Illumina HiSeq	Unspecified	Q5TCH4	CP4AM_HUMAN			11	1355	+			435					Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	c.1304G>T	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	g	23.1	4.380853	0.82792	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	D;D;D	0.90504	-1.55;-2.68;-2.68	1.44	1.44	0.22558	.	0.000000	0.85682	D	0.000000	D	0.96346	0.8808	H	0.97340	3.985	0.49051	D	0.999743	D;D	0.71674	0.998;0.995	D;D	0.78314	0.991;0.961	D	0.95876	0.8895	10	0.87932	D	0	.	10.3471	0.43911	0.0:0.0:1.0:0.0	.	337;435	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	L	337;435;435	ENSP00000360957:R337L;ENSP00000360958:R435L;ENSP00000294337:R435L	ENSP00000294337:R435L	R	+	2	0	CYP4A22	47384352	0.782000	0.28689	0.761000	0.31378	0.712000	0.41017	5.184000	0.65070	1.104000	0.41587	0.194000	0.17425	CGT		0.537	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213		73	248	1	0	1.3009e-50	0.01441	2.45122e-50	73	248				
TTLL7	79739	broad.mit.edu	37	1	84373287	84373287	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:84373287C>A	ENST00000260505.8	-	16	2221	c.1844G>T	c.(1843-1845)aGt>aTt	p.S615I	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	615					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GGTGTCCCCACTGGAAGGTGA	0.493																																							uc001djc.2		NA																	0				ovary(1)	1						c.(1843-1845)AGT>ATT		tubulin tyrosine ligase-like family, member 7							92.0	78.0	83.0					1																	84373287		2203	4300	6503	SO:0001583	missense	79739				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity	g.chr1:84373287C>A	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.1844G>T	1.37:g.84373287C>A	ENSP00000260505:p.Ser615Ile		Somatic				TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_RNA|TTLL7_uc001djg.2_RNA	p.S615I	NM_024686	NP_078962	WXS	Illumina HiSeq	Unspecified	Q6ZT98	TTLL7_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	16	2240	-			615					Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	c.1844G>T	CCDS690.2	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855422	0.32791	.	.	ENSG00000137941	ENST00000260505;ENST00000370704;ENST00000370703	T	0.03951	3.75	4.81	1.53	0.23141	.	0.353847	0.32416	N	0.006134	T	0.00967	0.0032	N	0.14661	0.345	0.22142	N	0.999339	B	0.19331	0.035	B	0.18263	0.021	T	0.48340	-0.9044	10	0.34782	T	0.22	.	9.2781	0.37711	0.1866:0.4764:0.337:0.0	.	615	Q6ZT98	TTLL7_HUMAN	I	615;392;615	ENSP00000260505:S615I	ENSP00000260505:S615I	S	-	2	0	TTLL7	84145875	0.001000	0.12720	0.986000	0.45419	0.914000	0.54420	-0.526000	0.06207	0.593000	0.29745	0.460000	0.39030	AGT		0.493	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686		16	24	1	0	0.000132079	0.008871	0.000151761	16	24				
BRDT	676	broad.mit.edu	37	1	92442881	92442881	+	Missense_Mutation	SNP	C	C	A	rs568198534		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:92442881C>A	ENST00000362005.3	+	7	1318	c.900C>A	c.(898-900)gaC>gaA	p.D300E	BRDT_ENST00000370389.2_Missense_Mutation_p.D227E|BRDT_ENST00000399546.2_Missense_Mutation_p.D300E|BRDT_ENST00000394530.3_Missense_Mutation_p.D254E|BRDT_ENST00000402388.1_Missense_Mutation_p.D300E|BRDT_ENST00000484781.1_3'UTR	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	300	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		ATCCTGTTGACGTTAATGCTT	0.343																																							uc001dok.3		NA																	0				stomach(2)|ovary(1)|lung(1)	4						c.(898-900)GAC>GAA		testis-specific bromodomain protein							76.0	77.0	77.0					1																	92442881		2203	4300	6503	SO:0001583	missense	676				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity	g.chr1:92442881C>A	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.900C>A	1.37:g.92442881C>A	ENSP00000354568:p.Asp300Glu		Somatic				BRDT_uc001dol.3_Missense_Mutation_p.D300E|BRDT_uc010osz.1_Missense_Mutation_p.D304E|BRDT_uc009wdf.2_Missense_Mutation_p.D227E|BRDT_uc010ota.1_Missense_Mutation_p.D254E|BRDT_uc010otb.1_Missense_Mutation_p.D254E|BRDT_uc001dom.3_Missense_Mutation_p.D300E	p.D300E	NM_207189	NP_997072	WXS	Illumina HiSeq	Unspecified	Q58F21	BRDT_HUMAN		all cancers(265;0.0228)|Epithelial(280;0.133)	6	1249	+		all_lung(203;0.00531)|Lung NSC(277;0.0194)	300			Bromo 2.		A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	37	c.900C>A	CCDS735.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007537	0.75046	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000394530;ENST00000426141;ENST00000402388	T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82	5.88	-0.85	0.10720	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000010	T	0.41511	0.1162	M	0.92784	3.345	0.40623	D	0.981787	D;D;D;P	0.71674	0.963;0.963;0.998;0.901	P;P;D;B	0.63957	0.577;0.577;0.92;0.438	T	0.54931	-0.8219	10	0.87932	D	0	-25.613	10.8375	0.46696	0.0:0.3527:0.0:0.6473	.	254;254;304;300	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	E	300;227;300;300;254;300;300	ENSP00000354568:D300E;ENSP00000359416:D227E;ENSP00000387822:D300E;ENSP00000378038:D254E;ENSP00000404969:D300E;ENSP00000384051:D300E	ENSP00000354568:D300E	D	+	3	2	BRDT	92215469	0.978000	0.34361	0.135000	0.22099	0.989000	0.77384	0.431000	0.21444	-0.343000	0.08351	-0.290000	0.09829	GAC		0.343	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189		17	42	1	0	7.45023e-12	0.010504	1.12812e-11	17	42				
AGL	178	broad.mit.edu	37	1	100350258	100350258	+	Splice_Site	SNP	T	T	G	rs200856850		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:100350258T>G	ENST00000294724.4	+	20	3158	c.2680T>G	c.(2680-2682)Tct>Gct	p.S894A	AGL_ENST00000361915.3_Splice_Site_p.S894A|AGL_ENST00000370161.2_Splice_Site_p.S878A|AGL_ENST00000370165.3_Splice_Site_p.S894A|AGL_ENST00000361302.3_Splice_Site_p.S878A|AGL_ENST00000361522.4_Splice_Site_p.S877A|AGL_ENST00000370163.3_Splice_Site_p.S894A	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	894					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TCCTTTTGCTTCGTAAGTATG	0.373																																							uc001dsi.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2680-2682)TCT>GCT		amylo-1,6-glucosidase,							79.0	77.0	78.0					1																	100350258		2202	4299	6501	SO:0001630	splice_region_variant	178				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding	g.chr1:100350258T>G	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2681+1T>G	1.37:g.100350258T>G			Somatic				AGL_uc001dsj.1_Missense_Mutation_p.S894A|AGL_uc001dsk.1_Missense_Mutation_p.S894A|AGL_uc001dsl.1_Missense_Mutation_p.S894A|AGL_uc001dsm.1_Missense_Mutation_p.S878A|AGL_uc001dsn.1_Missense_Mutation_p.S877A	p.S894A	NM_000642	NP_000633	WXS	Illumina HiSeq	Unspecified	P35573	GDE_HUMAN		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)	20	3080	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	894			4-alpha-glucanotransferase.		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	c.2680T>G	CCDS759.1	.	.	.	.	.	.	.	.	.	.	T	7.326	0.617868	0.14129	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58	5.67	5.67	0.87782	.	0.241708	0.44285	D	0.000468	T	0.07593	0.0191	N	0.21097	0.63	0.35165	D	0.771065	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.13407	0.009;0.009;0.002	T	0.10753	-1.0616	10	0.07325	T	0.83	.	11.6309	0.51173	0.133:0.0:0.0:0.867	.	877;878;894	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	A	894;894;894;894;878;878;877	ENSP00000355106:S894A;ENSP00000359184:S894A;ENSP00000359182:S894A;ENSP00000294724:S894A;ENSP00000354971:S878A;ENSP00000359180:S878A;ENSP00000354635:S877A	ENSP00000294724:S894A	S	+	1	0	AGL	100122846	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.921000	0.56454	2.161000	0.67846	0.455000	0.32223	TCT		0.373	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	Missense_Mutation	7	21	0	0	0	0.004482	0	7	21				
COL11A1	1301	broad.mit.edu	37	1	103444427	103444427	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:103444427G>T	ENST00000370096.3	-	34	3010	c.2698C>A	c.(2698-2700)Cct>Act	p.P900T	COL11A1_ENST00000353414.4_Missense_Mutation_p.P861T|COL11A1_ENST00000358392.2_Missense_Mutation_p.P912T|COL11A1_ENST00000512756.1_Missense_Mutation_p.P784T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	900	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTGGCCCAGGTTTCCCAGTG	0.418																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(2698-2700)CCT>ACT		alpha 1 type XI collagen isoform A							82.0	88.0	86.0					1																	103444427		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103444427G>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2698C>A	1.37:g.103444427G>T	ENSP00000359114:p.Pro900Thr		Somatic				COL11A1_uc001duk.2_Missense_Mutation_p.P96T|COL11A1_uc001dum.2_Missense_Mutation_p.P912T|COL11A1_uc001dun.2_Missense_Mutation_p.P861T|COL11A1_uc009weh.2_Missense_Mutation_p.P784T	p.P900T	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	34	3016	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	900			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.2698C>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574179	0.86542	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;D	0.96651	1.05;1.05;1.05;-4.08	5.35	5.35	0.76521	.	0.059272	0.64402	D	0.000001	D	0.96207	0.8763	N	0.25332	0.735	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.987;0.998;0.998;0.994;0.994	D	0.97121	0.9811	10	0.59425	D	0.04	.	19.0619	0.93096	0.0:0.0:1.0:0.0	.	784;861;912;900;120	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	900;912;861;120;784	ENSP00000359114:P900T;ENSP00000351163:P912T;ENSP00000302551:P861T;ENSP00000426533:P784T	ENSP00000302551:P861T	P	-	1	0	COL11A1	103217015	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	6.006000	0.70724	2.506000	0.84524	0.655000	0.94253	CCT		0.418	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		32	37	1	0	3.38236e-24	0.006999	5.97006e-24	32	37				
NTNG1	22854	broad.mit.edu	37	1	107867328	107867328	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:107867328A>T	ENST00000370068.1	+	3	1517	c.671A>T	c.(670-672)gAa>gTa	p.E224V	NTNG1_ENST00000370066.1_Missense_Mutation_p.E224V|NTNG1_ENST00000370070.2_Missense_Mutation_p.E224V|NTNG1_ENST00000370071.2_Missense_Mutation_p.E224V|NTNG1_ENST00000370074.4_Missense_Mutation_p.E224V|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370065.1_Missense_Mutation_p.E224V|NTNG1_ENST00000370067.1_Missense_Mutation_p.E224V|NTNG1_ENST00000370072.3_Missense_Mutation_p.E224V|NTNG1_ENST00000370073.2_Missense_Mutation_p.E224V|NTNG1_ENST00000370061.3_Missense_Mutation_p.E224V|NTNG1_ENST00000542803.1_Missense_Mutation_p.E224V			Q9Y2I2	NTNG1_HUMAN	netrin G1	224	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		ATCCACTTTGAAATCAAAGAC	0.408																																							uc001dvh.3		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(670-672)GAA>GTA		netrin G1 isoform 1							104.0	100.0	101.0					1																	107867328		2203	4300	6503	SO:0001583	missense	22854				axonogenesis	anchored to plasma membrane	protein binding	g.chr1:107867328A>T	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.671A>T	1.37:g.107867328A>T	ENSP00000359085:p.Glu224Val		Somatic				NTNG1_uc001dvf.3_Missense_Mutation_p.E224V|NTNG1_uc010out.1_Missense_Mutation_p.E224V|NTNG1_uc001dvc.3_Missense_Mutation_p.E224V|NTNG1_uc001dvd.1_Missense_Mutation_p.E224V	p.E224V	NM_001113226	NP_001106697	WXS	Illumina HiSeq	Unspecified	Q9Y2I2	NTNG1_HUMAN		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)	3	1389	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	224			Laminin N-terminal.		Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	c.671A>T	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388603	0.82902	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	6.05	6.05	0.98169	Laminin, N-terminal (3);	0.000000	0.64402	D	0.000007	T	0.81555	0.4847	L	0.59912	1.85	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.989;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.938;1.0;0.997	D	0.83841	0.0257	10	0.87932	D	0	.	16.6	0.84812	1.0:0.0:0.0:0.0	.	224;224;224;224;224	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	V	224	ENSP00000359090:E224V;ENSP00000359088:E224V;ENSP00000440561:E224V;ENSP00000359078:E224V;ENSP00000359089:E224V;ENSP00000359087:E224V;ENSP00000359091:E224V;ENSP00000359085:E224V;ENSP00000359084:E224V;ENSP00000359083:E224V;ENSP00000359082:E224V	ENSP00000294649:E224V	E	+	2	0	NTNG1	107668851	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.323000	0.78572	0.533000	0.62120	GAA		0.408	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917		9	19	0	0	0	0.006214	0	9	19				
FNDC7	163479	broad.mit.edu	37	1	109265024	109265024	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:109265024G>T	ENST00000370017.3	+	5	943	c.666G>T	c.(664-666)tgG>tgT	p.W222C	FNDC7_ENST00000271311.2_Missense_Mutation_p.W223C	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	222	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		CTTTTTCCTGGGCACGGGCAG	0.468																																							uc001dvx.2		NA																	0				ovary(1)|skin(1)	2						c.(664-666)TGG>TGT		fibronectin type III domain containing 7							67.0	65.0	65.0					1																	109265024		2203	4300	6503	SO:0001583	missense	163479					extracellular region		g.chr1:109265024G>T		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.666G>T	1.37:g.109265024G>T	ENSP00000359034:p.Trp222Cys		Somatic				FNDC7_uc010ova.1_5'UTR	p.W222C	NM_001144937	NP_001138409	WXS	Illumina HiSeq	Unspecified	Q5VTL7	FNDC7_HUMAN		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)	5	666	+		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)	223			Fibronectin type-III 3.		A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	c.666G>T	CCDS44185.1	.	.	.	.	.	.	.	.	.	.	G	9.420	1.082830	0.20309	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	D;D	0.84223	-1.82;-1.82	5.63	4.72	0.59763	.	0.113287	0.64402	D	0.000004	T	0.74152	0.3679	M	0.71581	2.175	0.80722	D	1	B	0.16166	0.016	B	0.16289	0.015	T	0.76214	-0.3041	10	0.72032	D	0.01	-10.7535	7.1751	0.25740	0.1472:0.1414:0.7114:0.0	.	222	E9PAZ5	.	C	222;223	ENSP00000359034:W222C;ENSP00000271311:W223C	ENSP00000271311:W223C	W	+	3	0	FNDC7	109066547	1.000000	0.71417	0.766000	0.31476	0.354000	0.29330	4.960000	0.63673	1.391000	0.46566	0.455000	0.32223	TGG		0.468	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532		9	23	1	0	0.000673444	0.008291	0.000740409	9	23				
AKNAD1	254268	broad.mit.edu	37	1	109369904	109369904	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:109369904T>C	ENST00000370001.3	-	11	2127	c.1859A>G	c.(1858-1860)aAg>aGg	p.K620R	AKNAD1_ENST00000369995.3_Missense_Mutation_p.K620R|AKNAD1_ENST00000357393.4_Missense_Mutation_p.K327R|AKNAD1_ENST00000369994.1_Missense_Mutation_p.K590R	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	620						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TCCGTGGCCCTTTTTCTCCAC	0.413																																							uc001dwa.2		NA																	0				ovary(3)	3						c.(1858-1860)AAG>AGG		hypothetical protein LOC254268							183.0	188.0	186.0					1																	109369904		2203	4299	6502	SO:0001583	missense	254268							g.chr1:109369904T>C	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1859A>G	1.37:g.109369904T>C	ENSP00000359018:p.Lys620Arg		Somatic				AKNAD1_uc010ovb.1_Missense_Mutation_p.K327R|AKNAD1_uc001dwb.2_RNA	p.K620R	NM_152763	NP_689976	WXS	Illumina HiSeq	Unspecified	Q5T1N1	AKND1_HUMAN			11	2128	-			620					B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	ENST00000370001.3	37	c.1859A>G	CCDS791.2	.	.	.	.	.	.	.	.	.	.	T	11.26	1.586061	0.28268	.	.	ENSG00000162641	ENST00000370001;ENST00000357393;ENST00000369994;ENST00000369995	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	4.87	1.29	0.21616	.	1.029790	0.07724	N	0.944149	T	0.06962	0.0177	L	0.36672	1.1	0.09310	N	1	B;B	0.15719	0.014;0.005	B;B	0.12156	0.007;0.004	T	0.40496	-0.9560	10	0.35671	T	0.21	-2.1788	6.0331	0.19690	0.0:0.3909:0.0:0.6091	.	327;620	B4DET8;Q5T1N1	.;AKND1_HUMAN	R	620;327;590;620	ENSP00000359018:K620R;ENSP00000349968:K327R;ENSP00000359011:K590R;ENSP00000359012:K620R	ENSP00000349968:K327R	K	-	2	0	AKNAD1	109171427	0.001000	0.12720	0.001000	0.08648	0.119000	0.20118	0.136000	0.15974	0.125000	0.18397	0.379000	0.24179	AAG		0.413	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763		3	124	0	0	0	0.004672	0	3	124				
GPR61	83873	broad.mit.edu	37	1	110086448	110086448	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:110086448C>A	ENST00000527748.1	+	2	1487	c.804C>A	c.(802-804)agC>agA	p.S268R	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGGTCACCAGCTCGGGGGCCC	0.677																																							uc001dxy.2		NA																	0				central_nervous_system(2)	2						c.(802-804)AGC>AGA		G protein-coupled receptor 61							37.0	45.0	42.0					1																	110086448		2203	4300	6503	SO:0001583	missense	83873					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:110086448C>A	AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.804C>A	1.37:g.110086448C>A	ENSP00000432456:p.Ser268Arg		Somatic					p.S268R	NM_031936	NP_114142	WXS	Illumina HiSeq	Unspecified	Q9BZJ8	GPR61_HUMAN		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)	2	1487	+		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	268			Cytoplasmic (Potential).		A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	ENST00000527748.1	37	c.804C>A	CCDS801.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578511	0.46006	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.71341	-0.56	5.21	2.36	0.29203	GPCR, rhodopsin-like superfamily (1);	0.048409	0.85682	D	0.000000	T	0.63355	0.2504	M	0.73598	2.24	0.41774	D	0.989781	P	0.48589	0.912	P	0.49451	0.611	T	0.64863	-0.6307	10	0.56958	D	0.05	-13.5542	8.2045	0.31446	0.0:0.6917:0.0:0.3083	.	268	Q9BZJ8	GPR61_HUMAN	R	268;396	ENSP00000432456:S268R	ENSP00000286603:S396R	S	+	3	2	GPR61	109887971	0.856000	0.29760	0.997000	0.53966	0.987000	0.75469	0.418000	0.21230	0.367000	0.24454	0.650000	0.86243	AGC		0.677	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1			9	39	1	0	2.17888e-05	0.006214	2.56906e-05	9	39				
AMPD2	271	broad.mit.edu	37	1	110168042	110168042	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:110168042A>T	ENST00000256578.3	+	2	731	c.371A>T	c.(370-372)aAg>aTg	p.K124M	AMPD2_ENST00000528667.1_Missense_Mutation_p.K124M|AMPD2_ENST00000528454.1_Missense_Mutation_p.K6M|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.K43M|AMPD2_ENST00000358729.4_Intron|AMPD2_ENST00000393688.3_5'Flank	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	124					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGCAAATGCAAGGAGATCGCC	0.682																																							uc009wfh.1		NA																	0				ovary(2)|breast(1)	3						c.(370-372)AAG>ATG		adenosine monophosphate deaminase 2 (isoform L)							84.0	83.0	83.0					1																	110168042		2203	4300	6503	SO:0001583	missense	271				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:110168042A>T	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.371A>T	1.37:g.110168042A>T	ENSP00000256578:p.Lys124Met		Somatic				AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.K43M|AMPD2_uc001dyc.1_Missense_Mutation_p.K124M|AMPD2_uc010ovr.1_Intron|AMPD2_uc010ovs.1_Missense_Mutation_p.K6M|AMPD2_uc001dyd.1_5'Flank	p.K124M	NM_004037	NP_004028	WXS	Illumina HiSeq	Unspecified	Q01433	AMPD2_HUMAN		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)	3	913	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	124					B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	c.371A>T	CCDS805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.70|19.70	3.877024|3.877024	0.72180|0.72180	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000531734;ENST00000342115;ENST00000528667;ENST00000531203;ENST00000256578;ENST00000527846;ENST00000528454|ENST00000369840	T;T;T;T;T;T|.	0.38887|.	1.14;1.14;1.14;1.14;1.14;1.11|.	4.62|4.62	3.49|3.49	0.39957|0.39957	.|.	0.386281|.	0.27659|.	N|.	0.018381|.	T|T	0.46908|0.46908	0.1417|0.1417	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.998|.	P;P|.	0.59889|.	0.839;0.865|.	T|T	0.42799|0.42799	-0.9430|-0.9430	10|5	0.72032|.	D|.	0.01|.	-45.8522|-45.8522	10.6574|10.6574	0.45684|0.45684	0.8388:0.1612:0.0:0.0|0.8388:0.1612:0.0:0.0	.|.	124;43|.	Q01433;Q01433-2|.	AMPD2_HUMAN;.|.	M|H	43;43;124;6;124;91;6|94	ENSP00000433739:K43M;ENSP00000345498:K43M;ENSP00000436541:K124M;ENSP00000256578:K124M;ENSP00000431904:K91M;ENSP00000437164:K6M|.	ENSP00000256578:K124M|.	K|Q	+|+	2|3	0|2	AMPD2|AMPD2	109969565|109969565	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	6.391000|6.391000	0.73208|0.73208	0.781000|0.781000	0.33589|0.33589	-0.429000|-0.429000	0.05907|0.05907	AAG|CAA		0.682	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			42	117	0	0	0	0.01441	0	42	117				
SLC6A17	388662	broad.mit.edu	37	1	110734689	110734689	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:110734689C>A	ENST00000331565.4	+	7	1445	c.960C>A	c.(958-960)tcC>tcA	p.S320S		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	320					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TTGCCTTCTCCAGCTACAATA	0.567																																							uc009wfq.2		NA																	0				ovary(1)|pancreas(1)	2						c.(958-960)TCC>TCA		solute carrier family 6, member 17							159.0	140.0	146.0					1																	110734689		2203	4300	6503	SO:0001819	synonymous_variant	388662				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity	g.chr1:110734689C>A		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.960C>A	1.37:g.110734689C>A			Somatic				SLC6A17_uc001dze.1_5'Flank	p.S320S	NM_001010898	NP_001010898	WXS	Illumina HiSeq	Unspecified	Q9H1V8	S6A17_HUMAN		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)	7	1421	+		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	320			Helical; Name=6; (Potential).		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Silent	SNP	ENST00000331565.4	37	c.960C>A	CCDS30799.1																																																																																				0.567	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280		9	45	1	0	1.58986e-06	0.008291	1.97386e-06	9	45				
KCNA10	3744	broad.mit.edu	37	1	111061202	111061202	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:111061202A>G	ENST00000369771.2	-	1	595	c.208T>C	c.(208-210)Tat>Cat	p.Y70H		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	70					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	GGGTCAGCATAGTCTCCCGGA	0.577																																							uc001dzt.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(208-210)TAT>CAT		potassium voltage-gated channel, shaker-related							82.0	90.0	87.0					1																	111061202		2203	4300	6503	SO:0001583	missense	3744					voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity	g.chr1:111061202A>G	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.208T>C	1.37:g.111061202A>G	ENSP00000358786:p.Tyr70His		Somatic					p.Y70H	NM_005549	NP_005540	WXS	Illumina HiSeq	Unspecified	Q16322	KCA10_HUMAN		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	1	596	-		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)	70						Missense_Mutation	SNP	ENST00000369771.2	37	c.208T>C	CCDS826.1	.	.	.	.	.	.	.	.	.	.	A	0.190	-1.054516	0.01965	.	.	ENSG00000143105	ENST00000369771	D	0.96685	-4.09	5.45	4.29	0.51040	.	1.269830	0.06095	U	0.664274	D	0.88070	0.6338	L	0.51422	1.61	0.26461	N	0.975443	B	0.32425	0.371	B	0.30855	0.121	T	0.80118	-0.1516	10	0.15952	T	0.53	.	6.4331	0.21809	0.7613:0.1595:0.0792:0.0	.	70	Q16322	KCA10_HUMAN	H	70	ENSP00000358786:Y70H	ENSP00000358786:Y70H	Y	-	1	0	KCNA10	110862725	1.000000	0.71417	0.415000	0.26534	0.040000	0.13550	4.950000	0.63603	0.847000	0.35167	0.533000	0.62120	TAT		0.577	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549		10	42	0	0	0	0.013537	0	10	42				
KCND3	3752	broad.mit.edu	37	1	112524243	112524243	+	Splice_Site	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:112524243C>A	ENST00000315987.2	-	2	1585	c.1106G>T	c.(1105-1107)gGa>gTa	p.G369V	KCND3_ENST00000302127.4_Splice_Site_p.G369V|KCND3_ENST00000369697.1_Splice_Site_p.G369V	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	369					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GCTGACTTACCCCAGTGTGGT	0.557																																							uc001ebu.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(1105-1107)GGG>GTG		potassium voltage-gated channel, Shal-related							84.0	72.0	76.0					1																	112524243		2203	4300	6503	SO:0001630	splice_region_variant	3752					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding	g.chr1:112524243C>A	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1106+1G>T	1.37:g.112524243C>A			Somatic				KCND3_uc001ebv.1_Missense_Mutation_p.G369V	p.G369V	NM_004980	NP_004971	WXS	Illumina HiSeq	Unspecified	Q9UK17	KCND3_HUMAN		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	2	1586	-		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)	369			Selectivity filter (By similarity).		O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	c.1106G>T	CCDS843.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046940	0.75846	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.99888	-7.54;-7.54;-7.54	5.59	5.59	0.84812	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99953	0.9980	H	0.99705	4.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95961	0.8962	9	.	.	.	.	19.1956	0.93686	0.0:1.0:0.0:0.0	.	369;369	Q14D71;Q9UK17	.;KCND3_HUMAN	V	369	ENSP00000358711:G369V;ENSP00000319591:G369V;ENSP00000306923:G369V	.	G	-	2	0	KCND3	112325766	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.636000	0.89361	0.655000	0.94253	GGA		0.557	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	Missense_Mutation	13	46	1	0	0.000566183	0.00499	0.000628378	13	46				
HAO2	51179	broad.mit.edu	37	1	119923274	119923274	+	Intron	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:119923274G>T	ENST00000325945.3	+	2	65				HAO2_ENST00000361035.4_5'UTR	NM_001005783.1|NM_016527.2	NP_001005783.1|NP_057611.1	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2 (long chain)						fatty acid oxidation (GO:0019395)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		ACAAGAGGCAGGCATGATCAG	0.448																																							uc001ehq.1		NA																	0				ovary(2)|skin(2)	4						c.(-82--78)CAGGC>CATGC		hydroxyacid oxidase 2							65.0	59.0	61.0					1																	119923274		876	1991	2867	SO:0001627	intron_variant	51179				fatty acid alpha-oxidation	peroxisome	(S)-2-hydroxy-acid oxidase activity	g.chr1:119923274G>T	AF231917	CCDS901.1	1p13.3-p13.1	2008-07-18			ENSG00000116882	ENSG00000116882	1.1.3.15		4810	protein-coding gene	gene with protein product	"""(S)-2-hydroxy-acid oxidase"", ""glycolate oxidase"", ""long-chain L-2-hydroxy acid oxidase"", ""growth-inhibiting protein 16"""	605176				10777549	Standard	XM_005270913		Approved	HAOX2, GIG16	uc001ehr.1	Q9NYQ3	OTTHUMG00000012410	ENST00000325945.3:c.-8-427G>T	1.37:g.119923274G>T			Somatic				HAO2_uc001ehr.1_Intron		NM_001005783	NP_001005783	WXS	Illumina HiSeq	Unspecified	Q9NYQ3	HAOX2_HUMAN		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)	2	272	+	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)						Q2TU86|Q5QP00|Q9UJS6	Translation_Start_Site	SNP	ENST00000325945.3	37	c.-80G>T	CCDS901.1																																																																																				0.448	HAO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034984.1	NM_001005783		6	20	1	0	0.000157383	0.00308	0.000179081	6	20				
TCHH	7062	broad.mit.edu	37	1	152083804	152083804	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:152083804C>A	ENST00000368804.1	-	2	1888	c.1889G>T	c.(1888-1890)cGc>cTc	p.R630L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	630	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCTGCTGGCGCCTCTCTTC	0.677																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(1888-1890)CGC>CTC		trichohyalin							34.0	40.0	38.0					1																	152083804		1999	4175	6174	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152083804C>A	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1889G>T	1.37:g.152083804C>A	ENSP00000357794:p.Arg630Leu		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.R630L	p.R630L	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1889	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		630			9 X 28 AA approximate tandem repeats.		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.1889G>T	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	8.583	0.882831	0.17467	.	.	ENSG00000159450	ENST00000368804	T	0.07114	3.22	3.74	-0.757	0.11054	.	.	.	.	.	T	0.01454	0.0047	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.47289	-0.9129	9	0.32370	T	0.25	.	6.4125	0.21698	0.3887:0.4951:0.0:0.1161	.	630	Q07283	TRHY_HUMAN	L	630	ENSP00000357794:R630L	ENSP00000357794:R630L	R	-	2	0	TCHH	150350428	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-2.458000	0.01000	0.028000	0.15324	-0.811000	0.03165	CGC		0.677	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		3	57	1	0	0.00909568	0.009096	0.00967345	3	57				
HRNR	388697	broad.mit.edu	37	1	152187608	152187608	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:152187608G>T	ENST00000368801.2	-	3	6572	c.6497C>A	c.(6496-6498)tCc>tAc	p.S2166Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2166					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACTGACGGGAGCCAGACCC	0.627																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(6496-6498)TCC>TAC		hornerin							207.0	248.0	234.0					1																	152187608		2197	4277	6474	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152187608G>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6497C>A	1.37:g.152187608G>T	ENSP00000357791:p.Ser2166Tyr		Somatic					p.S2166Y	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6573	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2166			24.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.6497C>A	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	5.641	0.302921	0.10678	.	.	ENSG00000197915	ENST00000368801	T	0.05925	3.37	2.68	1.75	0.24633	.	.	.	.	.	T	0.06142	0.0159	L	0.50333	1.59	0.09310	N	1	D	0.64830	0.994	P	0.61328	0.887	T	0.31280	-0.9949	9	0.37606	T	0.19	.	7.7971	0.29154	0.1348:0.0:0.8652:0.0	.	2166	Q86YZ3	HORN_HUMAN	Y	2166	ENSP00000357791:S2166Y	ENSP00000357791:S2166Y	S	-	2	0	HRNR	150454232	0.000000	0.05858	0.004000	0.12327	0.011000	0.07611	0.104000	0.15313	0.708000	0.31955	0.644000	0.83932	TCC		0.627	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		29	715	1	0	5.59293e-11	0.006999	8.21417e-11	29	715				
HRNR	388697	broad.mit.edu	37	1	152192921	152192921	+	Missense_Mutation	SNP	C	C	G	rs545053892		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:152192921C>G	ENST00000368801.2	-	3	1259	c.1184G>C	c.(1183-1185)cGt>cCt	p.R395P	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	395					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAAGACTGACGTGAGCTGGA	0.592																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(1183-1185)CGT>CCT		hornerin							158.0	135.0	143.0					1																	152192921		2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152192921C>G	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1184G>C	1.37:g.152192921C>G	ENSP00000357791:p.Arg395Pro		Somatic					p.R395P	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1260	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		395			4.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.1184G>C	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	T	5.977	0.364244	0.11296	.	.	ENSG00000197915	ENST00000368801	T	0.03801	3.8	3.48	1.54	0.23209	.	.	.	.	.	T	0.00608	0.0020	N	0.08118	0	0.09310	N	1	P	0.44429	0.835	B	0.27170	0.077	T	0.48801	-0.9003	9	0.29301	T	0.29	.	7.1602	0.25659	0.0:0.7663:0.0:0.2337	.	395	Q86YZ3	HORN_HUMAN	P	395	ENSP00000357791:R395P	ENSP00000357791:R395P	R	-	2	0	HRNR	150459545	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.169000	0.09911	0.289000	0.22422	0.644000	0.83932	CGT		0.592	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		6	98	0	0	0	0.001168	0	6	98				
FLG	2312	broad.mit.edu	37	1	152284538	152284538	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:152284538G>T	ENST00000368799.1	-	3	2859	c.2824C>A	c.(2824-2826)Cag>Aag	p.Q942K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	942	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGATCCCTGGCGCCTGCTT	0.562									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(2824-2826)CAG>AAG		filaggrin							327.0	298.0	308.0					1																	152284538		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152284538G>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2824C>A	1.37:g.152284538G>T	ENSP00000357789:p.Gln942Lys		Somatic				uc001ezv.2_5'Flank	p.Q942K	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2860	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		942			Ser-rich.|Filaggrin 5.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.2824C>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	7.411	0.634726	0.14322	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04015	3.73	4.22	1.03	0.20045	.	.	.	.	.	T	0.01489	0.0048	M	0.68317	2.08	0.09310	N	1	B	0.21688	0.059	B	0.22753	0.041	T	0.49532	-0.8930	9	0.08599	T	0.76	.	6.6526	0.22971	0.0:0.174:0.471:0.355	.	942	P20930	FILA_HUMAN	K	942;149	ENSP00000357789:Q942K	ENSP00000357789:Q942K	Q	-	1	0	FLG	150551162	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.256000	0.18351	-0.070000	0.12908	0.473000	0.43528	CAG		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		88	356	1	0	1.43847e-43	0.01441	2.68452e-43	88	356				
LCE1C	353133	broad.mit.edu	37	1	152777857	152777857	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:152777857C>A	ENST00000607093.1	-	1	97	c.98G>T	c.(97-99)tGt>tTt	p.C33F	LCE1C_ENST00000368768.1_Missense_Mutation_p.C33F			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	33	Pro-rich.				keratinization (GO:0031424)			p.C33F(1)		NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cttagggggacactttggggg	0.652																																							uc001fap.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(97-99)TGT>TTT		late cornified envelope 1C							53.0	53.0	53.0					1																	152777857		2203	4300	6503	SO:0001583	missense	353133				keratinization			g.chr1:152777857C>A		CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.98G>T	1.37:g.152777857C>A	ENSP00000475270:p.Cys33Phe		Somatic					p.C33F	NM_178351	NP_848128	WXS	Illumina HiSeq	Unspecified	Q5T751	LCE1C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	149	-	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		33			Pro-rich.			Missense_Mutation	SNP	ENST00000607093.1	37	c.98G>T	CCDS1026.1	.	.	.	.	.	.	.	.	.	.	C	6.135	0.393211	0.11638	.	.	ENSG00000197084	ENST00000368768	T	0.11385	2.78	2.82	2.82	0.32997	.	0.208954	0.24370	N	0.039104	T	0.19604	0.0471	M	0.81341	2.54	0.28638	N	0.907314	D	0.62365	0.991	D	0.78314	0.991	T	0.00632	-1.1635	10	0.87932	D	0	.	9.3186	0.37950	0.0:1.0:0.0:0.0	.	33	Q5T751	LCE1C_HUMAN	F	33	ENSP00000357757:C33F	ENSP00000357757:C33F	C	-	2	0	LCE1C	151044481	0.851000	0.29673	0.951000	0.38953	0.692000	0.40212	0.000000	0.12993	1.883000	0.54544	0.655000	0.94253	TGT		0.652	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034658.2	NM_178351		19	87	1	0	8.34094e-07	0.008871	1.04217e-06	19	87				
INSRR	3645	broad.mit.edu	37	1	156811930	156811930	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:156811930G>T	ENST00000368195.3	-	19	3767	c.3371C>A	c.(3370-3372)tCc>tAc	p.S1124Y	NTRK1_ENST00000392302.2_Missense_Mutation_p.D23Y	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1124	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GAAGTCCTGGGACACCATGCA	0.557																																							uc010pht.1		NA																	0				lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(3370-3372)TCC>TAC		insulin receptor-related receptor precursor							105.0	93.0	97.0					1																	156811930		2203	4300	6503	SO:0001583	missense	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156811930G>T	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3371C>A	1.37:g.156811930G>T	ENSP00000357178:p.Ser1124Tyr		Somatic				NTRK1_uc001fqf.1_Missense_Mutation_p.D23Y|NTRK1_uc009wsi.1_5'UTR	p.S1124Y	NM_014215	NP_055030	WXS	Illumina HiSeq	Unspecified	P14616	INSRR_HUMAN			19	3625	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1124			Cytoplasmic (Potential).|Protein kinase.		O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	c.3371C>A	CCDS1160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.446737|4.446737	0.84101|0.84101	.|.	.|.	ENSG00000198400|ENSG00000027644	ENST00000392302|ENST00000368195	T|D	0.77098|0.89939	-1.07|-2.59	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.45867	.|D	.|0.000326	D|D	0.93858|0.93858	0.8035|0.8035	M|M	0.83223|0.83223	2.63|2.63	0.58432|0.58432	D|D	0.999998|0.999998	D|D	0.71674|0.76494	0.998|0.999	D|D	0.64042|0.71184	0.921|0.972	D|D	0.94530|0.94530	0.7735|0.7735	9|10	0.59425|0.87932	D|D	0.04|0	.|.	16.6498|16.6498	0.85186|0.85186	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	23|1124	A6NF12|P14616	.|INSRR_HUMAN	Y|Y	23|1124	ENSP00000376120:D23Y|ENSP00000357178:S1124Y	ENSP00000376120:D23Y|ENSP00000357178:S1124Y	D|S	+|-	1|2	0|0	NTRK1|INSRR	155078554|155078554	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.657000|9.657000	0.98554|0.98554	2.523000|2.523000	0.85059|0.85059	0.561000|0.561000	0.74099|0.74099	GAC|TCC		0.557	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		28	26	1	0	1.61788e-16	0.012213	2.64826e-16	28	26				
INSRR	3645	broad.mit.edu	37	1	156821946	156821946	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:156821946C>A	ENST00000368195.3	-	3	1071	c.675G>T	c.(673-675)agG>agT	p.R225S	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	225					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGCACTCGCCCCTCGCTGTGC	0.647																																							uc010pht.1		NA																	0				lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(673-675)AGG>AGT		insulin receptor-related receptor precursor							27.0	28.0	28.0					1																	156821946		2186	4276	6462	SO:0001583	missense	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156821946C>A	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.675G>T	1.37:g.156821946C>A	ENSP00000357178:p.Arg225Ser		Somatic				NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|INSRR_uc009wsj.1_Missense_Mutation_p.R225S	p.R225S	NM_014215	NP_055030	WXS	Illumina HiSeq	Unspecified	P14616	INSRR_HUMAN			3	929	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		225					O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	c.675G>T	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	1.277	-0.611459	0.03690	.	.	ENSG00000027644	ENST00000368195	T	0.28666	1.6	4.44	-6.49	0.01890	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	1.762480	0.03218	N	0.177064	T	0.03011	0.0089	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.21109	-1.0255	9	0.15066	T	0.55	.	0.6852	0.00882	0.2075:0.2077:0.3036:0.2813	.	225	P14616	INSRR_HUMAN	S	225	ENSP00000357178:R225S	ENSP00000357178:R225S	R	-	3	2	INSRR	155088570	0.000000	0.05858	0.000000	0.03702	0.799000	0.45148	-4.584000	0.00212	-1.725000	0.01371	0.297000	0.19635	AGG		0.647	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		41	36	1	0	3.16986e-14	0.01441	4.99339e-14	41	36				
NTRK1	4914	broad.mit.edu	37	1	156846278	156846278	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:156846278G>T	ENST00000524377.1	+	14	1760	c.1719G>T	c.(1717-1719)gtG>gtT	p.V573V	NTRK1_ENST00000368196.3_Silent_p.V567V|NTRK1_ENST00000358660.3_Silent_p.V570V|NTRK1_ENST00000392302.2_Silent_p.V537V	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	573	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	AGCACATCGTGCGCTTCTTCG	0.642			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													uc001fqh.1		NA		Dom	yes		1	1q21-q22	4914	T	"""neurotrophic tyrosine kinase, receptor, type 1"""			E	TPM3|TPR|TFG		papillary thyroid		0				lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17						c.(1717-1719)GTG>GTT		neurotrophic tyrosine kinase, receptor, type 1	Imatinib(DB00619)						47.0	42.0	43.0					1																	156846278		2203	4300	6503	SO:0001819	synonymous_variant	4914				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr1:156846278G>T	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1719G>T	1.37:g.156846278G>T		TSP Lung(10;0.080)	Somatic				NTRK1_uc001fqf.1_Silent_p.V537V|NTRK1_uc009wsi.1_Silent_p.V272V|NTRK1_uc001fqi.1_Silent_p.V567V|NTRK1_uc009wsk.1_Silent_p.V570V	p.V573V	NM_002529	NP_002520	WXS	Illumina HiSeq	Unspecified	P04629	NTRK1_HUMAN			14	1775	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		573			Cytoplasmic (Potential).|Protein kinase.		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	ENST00000524377.1	37	c.1719G>T	CCDS1161.1																																																																																				0.642	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529		15	14	1	0	2.23348e-06	0.004007	2.74386e-06	15	14				
ATP1A2	477	broad.mit.edu	37	1	160091019	160091019	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:160091019A>T	ENST00000361216.3	+	3	244	c.155A>T	c.(154-156)aAa>aTa	p.K52I	ATP1A2_ENST00000392233.3_Missense_Mutation_p.K52I	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	52					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CTGGGCCGCAAATACCAAGTG	0.522																																							uc001fvc.2		NA																	0				central_nervous_system(3)|ovary(2)|skin(2)	7						c.(154-156)AAA>ATA		Na+/K+ -ATPase alpha 2 subunit proprotein							189.0	190.0	190.0					1																	160091019		2203	4300	6503	SO:0001583	missense	477				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160091019A>T	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.155A>T	1.37:g.160091019A>T	ENSP00000354490:p.Lys52Ile		Somatic				ATP1A2_uc001fvb.2_Missense_Mutation_p.K52I|ATP1A2_uc010piz.1_5'Flank	p.K52I	NM_000702	NP_000693	WXS	Illumina HiSeq	Unspecified	P50993	AT1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		3	287	+	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		52			Cytoplasmic (Potential).		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	c.155A>T	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.684367	0.88639	.	.	ENSG00000018625	ENST00000361216;ENST00000392233	T;T	0.80033	-1.33;-1.33	4.56	4.56	0.56223	ATPase, P-type cation-transporter, N-terminal (2);	0.135484	0.41938	D	0.000794	D	0.86657	0.5985	M	0.78344	2.41	0.53005	D	0.999968	P	0.52577	0.954	D	0.72075	0.976	D	0.88703	0.3217	10	0.87932	D	0	.	13.0301	0.58837	1.0:0.0:0.0:0.0	.	52	P50993	AT1A2_HUMAN	I	52	ENSP00000354490:K52I;ENSP00000376066:K52I	ENSP00000354490:K52I	K	+	2	0	ATP1A2	158357643	1.000000	0.71417	0.977000	0.42913	0.984000	0.73092	5.871000	0.69628	1.915000	0.55452	0.533000	0.62120	AAA		0.522	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702		71	228	0	0	0	0.01441	0	71	228				
TNR	7143	broad.mit.edu	37	1	175304922	175304922	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:175304922C>A	ENST00000367674.2	-	20	4264	c.3556G>T	c.(3556-3558)Ggc>Tgc	p.G1186C	TNR_ENST00000263525.2_Missense_Mutation_p.G1186C|RP3-518E13.2_ENST00000569593.1_RNA			Q92752	TENR_HUMAN	tenascin R	1186	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCAGTTTGGCCATTCTGCCGC	0.408																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(3556-3558)GGC>TGC		tenascin R precursor							127.0	125.0	126.0					1																	175304922		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175304922C>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3556G>T	1.37:g.175304922C>A	ENSP00000356646:p.Gly1186Cys		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.G1186C	p.G1186C	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			18	3637	-	Renal(580;0.146)		1186			Fibrinogen C-terminal.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.3556G>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986849	0.93106	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	D;D	0.89617	-2.54;-2.54	5.76	5.76	0.90799	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.97232	0.9095	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98470	1.0600	10	0.87932	D	0	.	19.571	0.95419	0.0:1.0:0.0:0.0	.	1186	Q92752	TENR_HUMAN	C	1186;1186;1096	ENSP00000356646:G1186C;ENSP00000263525:G1186C	ENSP00000263525:G1186C	G	-	1	0	TNR	173571545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.293000	0.78740	2.713000	0.92767	0.655000	0.94253	GGC		0.408	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		45	47	1	0	2.52991e-16	0.01441	4.11813e-16	45	47				
PAPPA2	60676	broad.mit.edu	37	1	176668241	176668241	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:176668241C>T	ENST00000367662.3	+	8	3916	c.2752C>T	c.(2752-2754)Cct>Tct	p.P918S		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	918					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCAGGGCCTCCTGATGTGGA	0.542																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(2752-2754)CCT>TCT		pappalysin 2 isoform 1							67.0	68.0	68.0					1																	176668241		1891	4105	5996	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176668241C>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2752C>T	1.37:g.176668241C>T	ENSP00000356634:p.Pro918Ser		Somatic				PAPPA2_uc009www.2_RNA	p.P918S	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			8	3916	+			918					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.2752C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992063	0.74703	.	.	ENSG00000116183	ENST00000367662	T	0.11930	2.73	5.14	5.14	0.70334	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.42359	0.1199	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.39563	-0.9608	10	0.87932	D	0	-13.5707	18.3931	0.90490	0.0:1.0:0.0:0.0	.	918	Q9BXP8	PAPP2_HUMAN	S	918	ENSP00000356634:P918S	ENSP00000356634:P918S	P	+	1	0	PAPPA2	174934864	1.000000	0.71417	0.995000	0.50966	0.361000	0.29550	7.179000	0.77665	2.649000	0.89929	0.655000	0.94253	CCT		0.542	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			19	79	0	0	0	0.010504	0	19	79				
PAPPA2	60676	broad.mit.edu	37	1	176740297	176740297	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:176740297G>A	ENST00000367662.3	+	17	5860	c.4696G>A	c.(4696-4698)Gca>Aca	p.A1566T		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1566	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCAGAAAGTGCAGAGGGTAA	0.458																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(4696-4698)GCA>ACA		pappalysin 2 isoform 1							81.0	76.0	77.0					1																	176740297		1983	4179	6162	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176740297G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4696G>A	1.37:g.176740297G>A	ENSP00000356634:p.Ala1566Thr		Somatic				PAPPA2_uc009www.2_RNA	p.A1566T	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			17	5860	+			1566			Sushi 3.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.4696G>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	4.663	0.123271	0.08931	.	.	ENSG00000116183	ENST00000367662	T	0.76578	-1.03	5.26	-6.84	0.01687	Complement control module (2);Sushi/SCR/CCP (3);	0.976607	0.08452	N	0.943827	T	0.43366	0.1244	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.43196	-0.9406	10	0.11485	T	0.65	3.5129	7.7093	0.28669	0.595:0.0:0.2085:0.1965	.	1566	Q9BXP8	PAPP2_HUMAN	T	1566	ENSP00000356634:A1566T	ENSP00000356634:A1566T	A	+	1	0	PAPPA2	175006920	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.800000	0.04555	-1.427000	0.01992	-0.890000	0.02929	GCA		0.458	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			3	71	0	0	0	0.004672	0	3	71				
NCF2	4688	broad.mit.edu	37	1	183556105	183556105	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:183556105G>A	ENST00000367535.3	-	2	433	c.182C>T	c.(181-183)aCc>aTc	p.T61I	NCF2_ENST00000367536.1_Missense_Mutation_p.T61I|NCF2_ENST00000413720.1_Missense_Mutation_p.T61I|NCF2_ENST00000418089.1_Missense_Mutation_p.T61I	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	61					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	AATGCTTCTGGTAAAGGCCTG	0.532																																							uc001gqj.3		NA																	0				ovary(3)	3						c.(181-183)ACC>ATC		neutrophil cytosolic factor 2							183.0	149.0	160.0					1																	183556105		2203	4300	6503	SO:0001583	missense	4688				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding	g.chr1:183556105G>A	BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.182C>T	1.37:g.183556105G>A	ENSP00000356505:p.Thr61Ile		Somatic				NCF2_uc010pod.1_Missense_Mutation_p.T61I|NCF2_uc010poe.1_Missense_Mutation_p.T61I|NCF2_uc001gqk.3_Missense_Mutation_p.T61I	p.T61I	NM_000433	NP_000424	WXS	Illumina HiSeq	Unspecified	P19878	NCF2_HUMAN			2	457	-			61			TPR 1.		B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	ENST00000367535.3	37	c.182C>T	CCDS1356.1	.	.	.	.	.	.	.	.	.	.	G	5.694	0.312511	0.10789	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	5.17	4.26	0.50523	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.365155	0.34555	N	0.003873	T	0.65943	0.2740	M	0.77820	2.39	0.19775	N	0.999951	B;P;B	0.47106	0.208;0.89;0.094	B;P;B	0.51582	0.057;0.674;0.063	T	0.59658	-0.7413	10	0.42905	T	0.14	-10.4145	10.0628	0.42286	0.1647:0.0:0.8353:0.0	.	61;61;61	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	I	61;89;61;61;61	ENSP00000356506:T61I;ENSP00000399294:T61I;ENSP00000407217:T61I;ENSP00000356505:T61I	ENSP00000356505:T61I	T	-	2	0	NCF2	181822728	1.000000	0.71417	0.119000	0.21687	0.010000	0.07245	3.877000	0.56123	1.309000	0.44985	-0.258000	0.10820	ACC		0.532	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085483.1	NM_000433		60	52	0	0	0	0.01441	0	60	52				
BRINP3	339479	broad.mit.edu	37	1	190423851	190423851	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:190423851G>T	ENST00000367462.3	-	2	401	c.170C>A	c.(169-171)tCa>tAa	p.S57*	BRINP3_ENST00000534846.1_Missense_Mutation_p.H19N	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	57					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GTATTCCTGTGAGCGATGGAA	0.468																																							uc001gse.1		NA																	0				lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(169-171)TCA>TAA		family with sequence similarity 5, member C							88.0	87.0	87.0					1																	190423851		2203	4300	6503	SO:0001587	stop_gained	339479					extracellular region		g.chr1:190423851G>T	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.170C>A	1.37:g.190423851G>T	ENSP00000356432:p.Ser57*		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.H19N	p.S57*	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			2	402	-	Prostate(682;0.198)		57					B3KVP1|B7Z260|O95726|Q2M330	Nonsense_Mutation	SNP	ENST00000367462.3	37	c.170C>A	CCDS1373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.372221|8.372221	0.98781|0.98781	.|.	.|.	ENSG00000162670|ENSG00000162670	ENST00000534846|ENST00000367462;ENST00000445957	T|.	0.16324|.	2.35|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.24122|.	0.0584|.	.|.	.|.	.|.	0.24368|0.24368	N|N	0.994847|0.994847	P|.	0.35982|.	0.531|.	B|.	0.32289|.	0.143|.	T|.	0.11567|.	-1.0582|.	8|.	0.87932|0.02654	D|T	0|1	.|.	16.7242|16.7242	0.85417|0.85417	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	19|.	B7Z260|.	.|.	N|X	19|57	ENSP00000438022:H19N|.	ENSP00000438022:H19N|ENSP00000356432:S57X	H|S	-|-	1|2	0|0	FAM5C|FAM5C	188690474|188690474	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.481000|7.481000	0.81124|0.81124	2.540000|2.540000	0.85666|0.85666	0.655000|0.655000	0.94253|0.94253	CAC|TCA		0.468	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		9	36	1	0	2.17888e-05	0.006214	2.56906e-05	9	36				
CFH	3075	broad.mit.edu	37	1	196659293	196659293	+	Nonsense_Mutation	SNP	C	C	A	rs377222601		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:196659293C>A	ENST00000359637.2	+	8	1130	c.1068C>A	c.(1066-1068)taC>taA	p.Y356*	CFH_ENST00000367429.4_Nonsense_Mutation_p.Y420*|CFH_ENST00000439155.2_Nonsense_Mutation_p.Y420*			P08603	CFAH_HUMAN	complement factor H	420	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.Y420Y(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ATCCTGGCTACGCTCTTCCAA	0.413																																							uc001gtj.3		NA																	1	Substitution - coding silent(1)		breast(1)	skin(4)|ovary(1)|breast(1)	6						c.(1258-1260)TAC>TAA		complement factor H isoform a precursor							104.0	88.0	93.0					1																	196659293		2203	4300	6503	SO:0001587	stop_gained	3075				complement activation, alternative pathway	extracellular space		g.chr1:196659293C>A	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.1068C>A	1.37:g.196659293C>A	ENSP00000352658:p.Tyr356*		Somatic				CFH_uc001gti.3_Nonsense_Mutation_p.Y420*|CFH_uc009wyw.2_Nonsense_Mutation_p.Y395*|CFH_uc009wyx.2_Nonsense_Mutation_p.Y356*	p.Y420*	NM_000186	NP_000177	WXS	Illumina HiSeq	Unspecified	P08603	CFAH_HUMAN			9	1500	+			420			Sushi 7.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Nonsense_Mutation	SNP	ENST00000359637.2	37	c.1260C>A		.	.	.	.	.	.	.	.	.	.	C	12.97	2.098352	0.37048	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	.	.	.	4.69	-1.18	0.09617	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1562	0.31171	0.0:0.4118:0.0:0.5882	.	.	.	.	X	420;420;420;356	.	ENSP00000352658:Y356X	Y	+	3	2	CFH	194925916	0.002000	0.14202	0.434000	0.26772	0.016000	0.09150	-0.710000	0.05024	-0.186000	0.10533	0.655000	0.94253	TAC		0.413	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186		16	56	1	0	2.94398e-08	0.007413	3.92978e-08	16	56				
CFHR1	3078	broad.mit.edu	37	1	196801041	196801041	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:196801041G>A	ENST00000320493.5	+	6	993	c.905G>A	c.(904-906)cGg>cAg	p.R302Q	CFHR2_ENST00000367421.3_Intron|CFHR1_ENST00000367424.4_Missense_Mutation_p.R243Q	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	302	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						GTGTGTAAACGGGGATATCGT	0.383																																							uc001gtn.2		NA																	0					0						c.(904-906)CGG>CAG		complement factor H-related 1 precursor							117.0	132.0	127.0					1																	196801041		1887	4132	6019	SO:0001583	missense	3078				complement activation	extracellular space		g.chr1:196801041G>A	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.905G>A	1.37:g.196801041G>A	ENSP00000314299:p.Arg302Gln		Somatic				CFHR1_uc001gtm.2_Missense_Mutation_p.R206Q	p.R302Q	NM_002113	NP_002104	WXS	Illumina HiSeq	Unspecified	Q03591	FHR1_HUMAN			6	1019	+			302			Sushi 5.		A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	ENST00000320493.5	37	c.905G>A	CCDS1386.1	.	.	.	.	.	.	.	.	.	.	.	2.311	-0.357904	0.05138	.	.	ENSG00000244414	ENST00000367424;ENST00000320493	T;T	0.64438	-0.1;-0.1	2.59	-5.18	0.02840	Complement control module (1);Sushi/SCR/CCP (3);	.	.	.	.	T	0.35422	0.0931	N	0.25332	0.735	0.09310	N	1	P;B	0.44877	0.845;0.046	B;B	0.32677	0.15;0.047	T	0.32428	-0.9907	9	0.25106	T	0.35	.	6.3816	0.21538	0.2259:0.4081:0.366:0.0	.	302;1203	Q03591;A8K5T0	FHR1_HUMAN;.	Q	243;302	ENSP00000356394:R243Q;ENSP00000314299:R302Q	ENSP00000314299:R302Q	R	+	2	0	CFHR1	195067664	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-8.561000	0.00019	-4.492000	0.00046	-3.985000	0.00014	CGG		0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113		33	82	0	0	0	0.007835	0	33	82				
C1orf106	55765	broad.mit.edu	37	1	200880740	200880740	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:200880740C>T	ENST00000367342.4	+	9	1574	c.1374C>T	c.(1372-1374)ggC>ggT	p.G458G	C1orf106_ENST00000413687.2_Silent_p.G373G	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	458										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						AAGACAGTGGCTCTGACGTCT	0.652																																							uc001gvo.2		NA																	0				skin(2)|ovary(1)	3						c.(1372-1374)GGC>GGT		hypothetical protein LOC55765 isoform 1							89.0	100.0	96.0					1																	200880740		2203	4300	6503	SO:0001819	synonymous_variant	55765							g.chr1:200880740C>T	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1374C>T	1.37:g.200880740C>T			Somatic				C1orf106_uc010ppm.1_Silent_p.G373G	p.G458G	NM_018265	NP_060735	WXS	Illumina HiSeq	Unspecified	Q3KP66	CA106_HUMAN			9	1404	+			458					B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	ENST00000367342.4	37	c.1374C>T																																																																																					0.652	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265		95	74	0	0	0	0.01441	0	95	74				
KIF21B	23046	broad.mit.edu	37	1	200943242	200943242	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:200943242C>T	ENST00000422435.2	-	35	5211	c.4895G>A	c.(4894-4896)cGc>cAc	p.R1632H	KIF21B_ENST00000360529.5_Intron|KIF21B_ENST00000332129.2_Missense_Mutation_p.R1619H|KIF21B_ENST00000461742.2_Intron	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1632					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GGTGGTGGCGCGGCCCTTTAT	0.592																																							uc001gvs.1		NA																	0				ovary(3)|skin(3)	6						c.(4894-4896)CGC>CAC		kinesin family member 21B							62.0	67.0	66.0					1																	200943242		2203	4300	6503	SO:0001583	missense	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200943242C>T	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4895G>A	1.37:g.200943242C>T	ENSP00000411831:p.Arg1632His		Somatic				KIF21B_uc001gvr.1_Missense_Mutation_p.R1619H|KIF21B_uc009wzl.1_Intron|KIF21B_uc010ppn.1_Intron	p.R1632H	NM_017596	NP_060066	WXS	Illumina HiSeq	Unspecified	O75037	KI21B_HUMAN			35	5212	-			1632					B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	c.4895G>A	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	31	5.100737	0.94245	.	.	ENSG00000116852	ENST00000332129;ENST00000422435;ENST00000539858	T;T	0.68765	-0.31;-0.35	4.64	4.64	0.57946	.	0.000000	0.64402	U	0.000011	T	0.72366	0.3451	N	0.22421	0.69	0.58432	D	0.999992	D;D	0.76494	0.999;0.999	D;D	0.80764	0.987;0.994	T	0.77694	-0.2492	10	0.87932	D	0	.	17.5095	0.87756	0.0:1.0:0.0:0.0	.	1632;1619	O75037;O75037-2	KI21B_HUMAN;.	H	1619;1632;1632	ENSP00000328494:R1619H;ENSP00000411831:R1632H	ENSP00000328494:R1619H	R	-	2	0	KIF21B	199209865	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.276000	0.78559	2.108000	0.64289	0.462000	0.41574	CGC		0.592	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		13	17	0	0	0	0.001855	0	13	17				
IGFN1	91156	broad.mit.edu	37	1	201196064	201196064	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:201196064C>A	ENST00000335211.4	+	23	10971	c.10841C>A	c.(10840-10842)cCc>cAc	p.P3614H	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1157						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						AGCCAGAAGCCCCGGTTCCTG	0.672																																							uc001gwc.2		NA																	0				ovary(2)|pancreas(1)	3						c.(2320-2322)CCC>CAC		RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;							59.0	71.0	67.0					1																	201196064		2203	4294	6497	SO:0001583	missense	91156							g.chr1:201196064C>A	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10841C>A	1.37:g.201196064C>A	ENSP00000334714:p.Pro3614His		Somatic				IGFN1_uc001gwb.2_RNA	p.P774H	NM_178275	NP_840059	WXS	Illumina HiSeq	Unspecified					12	3093	+								F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	c.2321C>A	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034433	0.75617	.	.	ENSG00000163395	ENST00000335211	D	0.92446	-3.04	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.97729	0.9255	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99226	1.0880	10	0.87932	D	0	.	15.5631	0.76266	0.0:1.0:0.0:0.0	.	3614	F8WAI1	.	H	3614	ENSP00000334714:P3614H	ENSP00000334714:P3614H	P	+	2	0	IGFN1	199462687	0.965000	0.33210	0.997000	0.53966	0.979000	0.70002	2.138000	0.42140	2.363000	0.80096	0.561000	0.74099	CCC		0.672	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275		31	79	1	0	1.62565e-12	0.012213	2.47436e-12	31	79				
CR1L	1379	broad.mit.edu	37	1	207867838	207867838	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:207867838G>A	ENST00000508064.2	+	5	664	c.604G>A	c.(604-606)Gag>Aag	p.E202K	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	202	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCTTGTGGGTGAGCCCTCCAT	0.483																																							uc001hga.3		NA																	0					0						c.(604-606)GAG>AAG		complement component (3b/4b) receptor 1-like							218.0	203.0	208.0					1																	207867838		1935	4148	6083	SO:0001583	missense	1379					cytoplasm|extracellular region|membrane		g.chr1:207867838G>A	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.604G>A	1.37:g.207867838G>A	ENSP00000421736:p.Glu202Lys		Somatic				CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	p.E202K	NM_175710	NP_783641	WXS	Illumina HiSeq	Unspecified	Q2VPA4	CR1L_HUMAN			5	725	+			202			Sushi 3.		Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	37	c.604G>A	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816005	0.50527	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.64260	-0.09	2.38	-3.39	0.04868	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.68091	0.2963	M	0.69185	2.1	0.09310	N	1	D	0.53151	0.958	P	0.61940	0.896	T	0.59974	-0.7353	9	0.49607	T	0.09	.	5.6777	0.17757	0.1464:0.5473:0.3063:0.0	.	202	Q2VPA4	CR1L_HUMAN	K	202	ENSP00000421736:E202K	ENSP00000434864:E146K	E	+	1	0	CR1L	205934461	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.360000	0.02600	-0.465000	0.06953	0.298000	0.19748	GAG		0.483	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735		44	168	0	0	0	0.01441	0	44	168				
OBSCN	84033	broad.mit.edu	37	1	228479795	228479795	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:228479795G>T	ENST00000422127.1	+	39	10580	c.10536G>T	c.(10534-10536)atG>atT	p.M3512I	OBSCN_ENST00000366707.4_Missense_Mutation_p.M631I|OBSCN_ENST00000359599.6_Missense_Mutation_p.M2359I|OBSCN_ENST00000570156.2_Missense_Mutation_p.M3941I|OBSCN_ENST00000366709.4_Missense_Mutation_p.M631I|OBSCN_ENST00000284548.11_Missense_Mutation_p.M3512I	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3512	Ig-like 35.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCTGGCCATGGCGGACGCCG	0.622																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(10534-10536)ATG>ATT		obscurin, cytoskeletal calmodulin and							106.0	113.0	111.0					1																	228479795		2105	4213	6318	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228479795G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.10536G>T	1.37:g.228479795G>T	ENSP00000409493:p.Met3512Ile		Somatic				OBSCN_uc001hsn.2_Missense_Mutation_p.M3512I|OBSCN_uc001hsq.1_Missense_Mutation_p.M768I	p.M3512I	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			39	10580	+		Prostate(94;0.0405)	3512			Ig-like 35.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.10536G>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	9.797	1.179562	0.21787	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.04454	3.62;3.62;3.62;3.62;3.62	5.1	3.17	0.36434	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.052130	0.07386	N	0.888211	T	0.05273	0.0140	L	0.33245	0.995	0.09310	N	1	B;B	0.12013	0.005;0.004	B;B	0.16289	0.013;0.015	T	0.42068	-0.9473	10	0.16420	T	0.52	.	11.4777	0.50308	0.2062:0.0:0.7938:0.0	.	3512;3512	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	I	3512;3512;631;631;2359	ENSP00000284548:M3512I;ENSP00000409493:M3512I;ENSP00000355668:M631I;ENSP00000355670:M631I;ENSP00000352613:M2359I	ENSP00000284548:M3512I	M	+	3	0	OBSCN	226546418	0.000000	0.05858	0.051000	0.19133	0.055000	0.15305	-0.302000	0.08221	1.346000	0.45694	0.511000	0.50034	ATG		0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		27	91	1	0	5.90632e-09	0.012213	8.26039e-09	27	91				
KIAA1804	84451	broad.mit.edu	37	1	233489594	233489594	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:233489594C>A	ENST00000366624.3	+	3	1289	c.1028C>A	c.(1027-1029)cCc>cAc	p.P343H	MLK4_ENST00000366623.3_Missense_Mutation_p.P343H	NM_032435.2	NP_115811.2																					GGAGAAGTCCCCTATCGGGGC	0.517																																							uc001hvt.3		NA																	0				lung(5)|central_nervous_system(2)|skin(1)	8						c.(1027-1029)CCC>CAC		mixed lineage kinase 4							105.0	101.0	102.0					1																	233489594		2203	4300	6503	SO:0001583	missense	84451				activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity	g.chr1:233489594C>A																												ENST00000366624.3:c.1028C>A	1.37:g.233489594C>A	ENSP00000355583:p.Pro343His		Somatic				KIAA1804_uc001hvs.1_Missense_Mutation_p.P343H	p.P343H	NM_032435	NP_115811	WXS	Illumina HiSeq	Unspecified	Q5TCX8	M3KL4_HUMAN			3	1289	+		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)	343			Protein kinase.			Missense_Mutation	SNP	ENST00000366624.3	37	c.1028C>A	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761183	0.89932	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	D;D	0.88277	-2.36;-2.36	4.91	4.91	0.64330	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96599	0.8890	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97962	1.0338	10	0.87932	D	0	.	18.301	0.90163	0.0:1.0:0.0:0.0	.	343;343	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	H	343	ENSP00000355582:P343H;ENSP00000355583:P343H	ENSP00000355582:P343H	P	+	2	0	RP5-862P8.2	231556217	1.000000	0.71417	0.865000	0.33974	0.976000	0.68499	7.645000	0.83430	2.538000	0.85594	0.563000	0.77884	CCC		0.517	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1			3	85	1	0	0.00909568	0.009096	0.00967345	3	85				
TBCE	6905	broad.mit.edu	37	1	235600748	235600748	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:235600748A>T	ENST00000366601.3	+	12	1251	c.1075A>T	c.(1075-1077)Atc>Ttc	p.I359F	TBCE_ENST00000543662.1_Missense_Mutation_p.I410F|TBCE_ENST00000406207.1_Missense_Mutation_p.I359F|TBCE_ENST00000472011.1_3'UTR			Q15813	TBCE_HUMAN	tubulin folding cofactor E	359	LRRCT.				'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			ACTACTCATTATCGCCAGCAT	0.463																																							uc001hwz.1		NA																	0					0						c.(1075-1077)ATC>TTC		beta-tubulin cofactor E							87.0	81.0	83.0					1																	235600748		2203	4300	6503	SO:0001583	missense	6905				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding	g.chr1:235600748A>T	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.1075A>T	1.37:g.235600748A>T	ENSP00000355560:p.Ile359Phe		Somatic				TBCE_uc010pxq.1_RNA|TBCE_uc001hxa.1_Missense_Mutation_p.I359F|TBCE_uc010pxr.1_Missense_Mutation_p.I410F|TBCE_uc001hxb.1_Missense_Mutation_p.I246F	p.I359F	NM_003193	NP_003184	WXS	Illumina HiSeq	Unspecified	Q15813	TBCE_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)		12	1198	+	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	359			LRRCT.		A8K8C2|B7Z3P1	Missense_Mutation	SNP	ENST00000366601.3	37	c.1075A>T	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	A	14.94	2.686679	0.48097	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	T;T;T	0.08984	3.03;3.03;3.03	4.85	4.85	0.62838	.	0.097202	0.64402	D	0.000001	T	0.29749	0.0743	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.981;0.985	T	0.03969	-1.0988	10	0.72032	D	0.01	-15.6691	13.159	0.59535	1.0:0.0:0.0:0.0	.	410;359;359	B7Z3P1;A8K8C2;Q15813	.;.;TBCE_HUMAN	F	359;359;410	ENSP00000355560:I359F;ENSP00000384571:I359F;ENSP00000439170:I410F	ENSP00000355560:I359F	I	+	1	0	TBCE	233667371	1.000000	0.71417	0.291000	0.24904	0.002000	0.02628	6.528000	0.73807	2.053000	0.61076	0.533000	0.62120	ATC		0.463	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193		26	27	0	0	0	0.013726	0	26	27				
ACTN2	88	broad.mit.edu	37	1	236902629	236902629	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:236902629C>T	ENST00000366578.4	+	10	1070	c.904C>T	c.(904-906)Ccc>Tcc	p.P302S	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.P302S|ACTN2_ENST00000546208.1_Intron	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	302					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TCGCACGATCCCCTGGCTGGA	0.532																																							uc001hyf.2		NA																	0				ovary(4)|skin(1)	5						c.(904-906)CCC>TCC		actinin, alpha 2							106.0	110.0	109.0					1																	236902629		2203	4300	6503	SO:0001583	missense	88				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding	g.chr1:236902629C>T	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.904C>T	1.37:g.236902629C>T	ENSP00000355537:p.Pro302Ser		Somatic				ACTN2_uc001hyg.2_Missense_Mutation_p.P94S|ACTN2_uc009xgi.1_Missense_Mutation_p.P302S|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_5'UTR	p.P302S	NM_001103	NP_001094	WXS	Illumina HiSeq	Unspecified	P35609	ACTN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00168)		10	1108	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	302			Spectrin 1.		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	c.904C>T	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871846	0.91587	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.50001	0.76;0.76	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.66597	0.2805	L	0.54323	1.7	0.80722	D	1	B;D;D	0.71674	0.238;0.998;0.98	B;D;D	0.77557	0.186;0.99;0.99	T	0.65796	-0.6081	10	0.56958	D	0.05	.	19.7954	0.96478	0.0:1.0:0.0:0.0	.	302;72;302	B2RCS5;Q59FD9;P35609	.;.;ACTN2_HUMAN	S	302;302;71	ENSP00000443495:P302S;ENSP00000355537:P302S	ENSP00000355537:P302S	P	+	1	0	ACTN2	234969252	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.811000	0.86092	2.677000	0.91161	0.555000	0.69702	CCC		0.532	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		61	87	0	0	0	0.01441	0	61	87				
RYR2	6262	broad.mit.edu	37	1	237732488	237732489	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:237732488_237732489GG>AT	ENST00000366574.2	+	29	3784_3785	c.3467_3468GG>AT	c.(3466-3468)tGG>tAT	p.W1156Y	RYR2_ENST00000542537.1_Missense_Mutation_p.W1140Y|RYR2_ENST00000360064.6_Missense_Mutation_p.W1154Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1156	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.W1154C(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGGCGCTCTTGGCAAGCAGGCG	0.505																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(3466-3468)TGG>TAT		cardiac muscle ryanodine receptor																																				SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237732488_237732489GG>AT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	Exception_encountered	1.37:g.237732488_237732489delinsAT	ENSP00000355533:p.Trp1156Tyr		Somatic					p.W1156Y	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		29	3587_3588	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1156			Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	DNP	ENST00000366574.2	37	c.3467_3468GG>AT	CCDS55691.1																																																																																				0.505	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		19	33	0	0	0	0.004672	0	19	33				
VN1R5	317705	broad.mit.edu	37	1	247420193	247420193	+	IGR	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:247420193C>T								RP11-488L18.8 (15068 upstream) : Y_RNA (37943 downstream)																							TATCTTACTGCTGGTGAGTTT	0.458																																						GBM(98;63 1399 4825 21305 33017)	uc010pyu.1		NA																	0					0						c.(820-822)CTG>TTG		vomeronasal 1 receptor 5							161.0	156.0	157.0					1																	247420193		1932	4134	6066	SO:0001628	intergenic_variant	317705				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr1:247420193C>T																													1.37:g.247420193C>T			Somatic					p.L274L	NM_173858	NP_776257	WXS	Illumina HiSeq	Unspecified	Q7Z5H4	VN1R5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00854)		2	820	+	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	274			Helical; Name=6; (Potential).			Silent	SNP		37	c.820C>T																																																																																				0	0.458									80	97	0	0	0	0.01441	0	80	97				
OR13G1	441933	broad.mit.edu	37	1	247836166	247836166	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:247836166G>T	ENST00000359688.2	-	1	199	c.178C>A	c.(178-180)Ctt>Att	p.L60I	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGTGTCAGAAGGAAAACATAC	0.423																																							uc001idi.1		NA																	0				skin(1)	1						c.(178-180)CTT>ATT		olfactory receptor, family 13, subfamily G,							89.0	68.0	75.0					1																	247836166		2203	4300	6503	SO:0001583	missense	441933				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247836166G>T	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.178C>A	1.37:g.247836166G>T	ENSP00000352717:p.Leu60Ile		Somatic					p.L60I	NM_001005487	NP_001005487	WXS	Illumina HiSeq	Unspecified	Q8NGZ3	O13G1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	178	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		60			Helical; Name=2; (Potential).		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	ENST00000359688.2	37	c.178C>A	CCDS31094.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098706	0.56183	.	.	ENSG00000197437	ENST00000359688	T	0.13778	2.56	4.16	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37393	N	0.002118	T	0.37785	0.1016	M	0.84082	2.675	0.24869	N	0.992291	D	0.89917	1.0	D	0.91635	0.999	T	0.15037	-1.0451	10	0.72032	D	0.01	-28.6009	11.3174	0.49401	0.0:0.0:0.8163:0.1837	.	60	Q8NGZ3	O13G1_HUMAN	I	60	ENSP00000352717:L60I	ENSP00000352717:L60I	L	-	1	0	OR13G1	245902789	0.891000	0.30450	0.019000	0.16419	0.105000	0.19272	0.332000	0.19751	1.093000	0.41377	0.558000	0.71614	CTT		0.423	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487		16	20	1	0	1.00905e-13	0.008871	1.56844e-13	16	20				
OR2T27	403239	broad.mit.edu	37	1	248814116	248814116	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:248814116G>A	ENST00000344889.3	-	1	69	c.70C>T	c.(70-72)Ccc>Tcc	p.P24S		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P24S(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAAGCCAGGGGAAACGGGCG	0.493																																							uc010pzo.1		NA																	1	Substitution - Missense(1)		skin(1)	skin(1)	1						c.(70-72)CCC>TCC		olfactory receptor, family 2, subfamily T,							109.0	98.0	101.0					1																	248814116		2203	4300	6503	SO:0001583	missense	403239				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248814116G>A		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.70C>T	1.37:g.248814116G>A	ENSP00000342008:p.Pro24Ser		Somatic					p.P24S	NM_001001824	NP_001001824	WXS	Illumina HiSeq	Unspecified	Q8NH04	O2T27_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	70	-	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	24			Helical; Name=1; (Potential).			Missense_Mutation	SNP	ENST00000344889.3	37	c.70C>T	CCDS31124.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.128539	0.00342	.	.	ENSG00000187701	ENST00000344889	T	0.00314	8.14	3.3	2.35	0.29111	.	0.000000	0.39341	N	0.001397	T	0.00109	0.0003	N	0.12471	0.22	0.09310	N	1	B	0.16802	0.019	B	0.17979	0.02	T	0.10613	-1.0622	10	0.09084	T	0.74	.	7.1833	0.25784	0.0:0.1887:0.6172:0.1941	.	24	Q8NH04	O2T27_HUMAN	S	24	ENSP00000342008:P24S	ENSP00000342008:P24S	P	-	1	0	OR2T27	246880739	0.005000	0.15991	0.280000	0.24747	0.114000	0.19823	1.126000	0.31344	0.699000	0.31761	0.194000	0.17425	CCC		0.493	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824		13	69	0	0	0	0.014323	0	13	69				
PGBD2	267002	broad.mit.edu	37	1	249211545	249211545	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:249211545C>A	ENST00000329291.5	+	3	909	c.762C>A	c.(760-762)tgC>tgA	p.C254*	PGBD2_ENST00000539153.1_Nonsense_Mutation_p.C251*|PGBD2_ENST00000355360.4_Nonsense_Mutation_p.C3*|PGBD2_ENST00000462488.1_3'UTR	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	254										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGATGAACTGCAATTTCCAGA	0.473																																							uc001ifh.2		NA																	0				ovary(1)	1						c.(760-762)TGC>TGA		hypothetical protein LOC267002 isoform a							101.0	106.0	104.0					1																	249211545		2203	4300	6503	SO:0001587	stop_gained	267002							g.chr1:249211545C>A	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.762C>A	1.37:g.249211545C>A	ENSP00000331643:p.Cys254*		Somatic				PGBD2_uc001ifg.2_Nonsense_Mutation_p.C3*|PGBD2_uc009xhd.2_Nonsense_Mutation_p.C251*	p.C254*	NM_170725	NP_733843	WXS	Illumina HiSeq	Unspecified	Q6P3X8	PGBD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		3	909	+	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	254					B3KVR8|Q6MZF8	Nonsense_Mutation	SNP	ENST00000329291.5	37	c.762C>A	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026331	0.93518	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	.	.	.	3.76	1.61	0.23674	.	1.162390	0.06623	N	0.757800	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-18.7954	5.8676	0.18783	0.2227:0.5609:0.2164:0.0	.	.	.	.	X	3;254;251	.	ENSP00000331643:C254X	C	+	3	2	PGBD2	247178168	0.701000	0.27806	0.939000	0.37840	0.991000	0.79684	0.611000	0.24268	0.874000	0.35823	0.563000	0.77884	TGC		0.473	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1			9	126	1	0	1.76689e-08	0.006214	2.40791e-08	9	126				
ANKRD16	54522	broad.mit.edu	37	10	5930007	5930007	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:5930007G>C	ENST00000380094.5	-	2	881	c.338C>G	c.(337-339)aCa>aGa	p.T113R	ANKRD16_ENST00000191063.8_Missense_Mutation_p.T113R|ANKRD16_ENST00000380092.4_Missense_Mutation_p.T113R|FBXO18_ENST00000362091.4_5'Flank|FBXO18_ENST00000397269.3_5'Flank	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	113										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						GTTCTTCCTTGTGCAGGCCAT	0.537																																							uc010qat.1		NA																	0					0						c.(337-339)ACA>AGA		ankyrin repeat domain 16 isoform a							107.0	109.0	108.0					10																	5930007		2203	4300	6503	SO:0001583	missense	54522							g.chr10:5930007G>C	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.338C>G	10.37:g.5930007G>C	ENSP00000369436:p.Thr113Arg		Somatic				ANKRD16_uc009xie.2_Missense_Mutation_p.T113R|ANKRD16_uc009xif.2_Missense_Mutation_p.T113R|ANKRD16_uc001iiq.2_Missense_Mutation_p.T113R|FBXO18_uc001iir.2_5'Flank|FBXO18_uc001iis.2_5'Flank|FBXO18_uc009xig.2_5'Flank	p.T113R	NM_019046	NP_061919	WXS	Illumina HiSeq	Unspecified	Q6P6B7	ANR16_HUMAN			2	881	-			113			ANK 3.		A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	c.338C>G	CCDS31136.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925045	0.73213	.	.	ENSG00000134461	ENST00000380094;ENST00000380092;ENST00000191063	T;T;T	0.61980	0.06;0.06;0.06	5.0	4.05	0.47172	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.54287	0.1849	N	0.02708	-0.52	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.991;0.992	T	0.56329	-0.7997	10	0.23302	T	0.38	-11.4692	11.9707	0.53062	0.0908:0.0:0.9092:0.0	.	113;113;113	Q6P6B7;C9JP28;F8WEI4	ANR16_HUMAN;.;.	R	113	ENSP00000369436:T113R;ENSP00000369434:T113R;ENSP00000352361:T113R	ENSP00000352361:T113R	T	-	2	0	ANKRD16	5970013	1.000000	0.71417	0.719000	0.30619	0.953000	0.61014	7.543000	0.82106	1.169000	0.42739	0.558000	0.71614	ACA		0.537	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138		11	95	0	0	0	0.001855	0	11	95				
ITIH5	80760	broad.mit.edu	37	10	7708784	7708784	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:7708784C>A	ENST00000256861.6	-	1	150	c.72G>T	c.(70-72)tgG>tgT	p.W24C	ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397146.2_Missense_Mutation_p.W24C|ITIH5_ENST00000397145.2_Missense_Mutation_p.W24C	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	24					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						AAGAGTGGCCCCAGCTCTGCG	0.766																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(70-72)TGG>TGT		inter-alpha trypsin inhibitor heavy chain							20.0	23.0	22.0					10																	7708784		2200	4295	6495	SO:0001583	missense	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7708784C>A			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.72G>T	10.37:g.7708784C>A	ENSP00000256861:p.Trp24Cys		Somatic				ITIH5_uc001ijr.1_Missense_Mutation_p.W24C	p.W24C	NM_030569	NP_085046	WXS	Illumina HiSeq	Unspecified	Q86UX2	ITIH5_HUMAN			1	151	-			24					Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37	c.72G>T		.	.	.	.	.	.	.	.	.	.	C	10.58	1.390285	0.25118	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.02525	4.82;4.26;4.27	3.46	3.46	0.39613	.	0.968352	0.08466	N	0.941676	T	0.06096	0.0158	.	.	.	0.50813	D	0.999894	P;P	0.49447	0.924;0.79	P;B	0.47015	0.534;0.253	T	0.43393	-0.9394	9	0.56958	D	0.05	-12.5804	10.5667	0.45177	0.0:1.0:0.0:0.0	.	24;24	G5E9D8;Q86UX2	.;ITIH5_HUMAN	C	24	ENSP00000256861:W24C;ENSP00000380333:W24C;ENSP00000380332:W24C	ENSP00000256861:W24C	W	-	3	0	ITIH5	7748790	0.286000	0.24305	0.869000	0.34112	0.029000	0.11900	1.059000	0.30517	1.899000	0.54978	0.484000	0.47621	TGG		0.766	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		27	15	1	0	4.3181e-19	0.013726	7.37728e-19	27	15				
FAM171A1	221061	broad.mit.edu	37	10	15255026	15255026	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:15255026C>A	ENST00000378116.4	-	8	2567	c.2561G>T	c.(2560-2562)aGa>aTa	p.R854I	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	854						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GTGGGCAGATCTTCTCTGGTG	0.612																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(2560-2562)AGA>ATA		hypothetical protein LOC221061 precursor							131.0	135.0	134.0					10																	15255026		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15255026C>A	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2561G>T	10.37:g.15255026C>A	ENSP00000367356:p.Arg854Ile		Somatic					p.R854I	NM_001010924	NP_001010924	WXS	Illumina HiSeq	Unspecified	Q5VUB5	F1711_HUMAN			8	2568	-			854			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.2561G>T	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	C	1.677	-0.507612	0.04231	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.31247	1.5	4.84	4.84	0.62591	.	0.761679	0.12783	N	0.439540	T	0.26557	0.0649	L	0.40543	1.245	0.09310	N	0.999999	B	0.24043	0.096	B	0.25506	0.061	T	0.08269	-1.0730	10	0.37606	T	0.19	-8.5552	10.336	0.43850	0.1401:0.7058:0.154:0.0	.	854	Q5VUB5	F1711_HUMAN	I	854;853	ENSP00000367356:R854I	ENSP00000367356:R854I	R	-	2	0	FAM171A1	15295032	0.016000	0.18221	0.024000	0.17045	0.596000	0.36781	1.786000	0.38694	2.514000	0.84764	0.563000	0.77884	AGA		0.612	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		25	152	1	0	1.69901e-12	0.005524	2.57933e-12	25	152				
CUBN	8029	broad.mit.edu	37	10	16961963	16961963	+	Splice_Site	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:16961963T>A	ENST00000377833.4	-	44	6885	c.6820A>T	c.(6820-6822)Aac>Tac	p.N2274Y		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2274	CUB 16. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTGACATACTTGGGTGTTACT	0.413																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(6820-6822)AAC>TAC		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						62.0	58.0	59.0					10																	16961963		2203	4300	6503	SO:0001630	splice_region_variant	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16961963T>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6821+1A>T	10.37:g.16961963T>A			Somatic					p.N2274Y	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			44	6872	-			2274			CUB 16.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.6820A>T	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.418258	0.42918	.	.	ENSG00000107611	ENST00000377833	T	0.36157	1.27	5.11	3.97	0.46021	CUB (5);	0.141093	0.32343	N	0.006223	T	0.53318	0.1789	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.53165	-0.8477	10	0.72032	D	0.01	.	9.3265	0.37997	0.0:0.0822:0.0:0.9178	.	2274	O60494	CUBN_HUMAN	Y	2274	ENSP00000367064:N2274Y	ENSP00000367064:N2274Y	N	-	1	0	CUBN	17001969	1.000000	0.71417	1.000000	0.80357	0.138000	0.21146	3.506000	0.53364	0.809000	0.34255	-0.447000	0.05616	AAC		0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	Missense_Mutation	27	19	0	0	0	0.012213	0	27	19				
MRC1	4360	broad.mit.edu	37	10	17891714	17891714	+	Missense_Mutation	SNP	G	G	C	rs2478577	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:17891714G>C	ENST00000331429.2	+	7	1298	c.1195G>C	c.(1195-1197)Gca>Cca	p.A399P	MRC1L1_ENST00000457317.1_Missense_Mutation_p.A399P																breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CAGTGACCTCGCAAGTATCCA	0.463																																						GBM(115;1153 1594 28187 28781 35884)	uc001ipk.2		NA																	0					0						c.(1195-1197)GCA>CCA		mannose receptor C type 1 precursor							169.0	190.0	183.0					10																	17891714		2156	4135	6291	SO:0001583	missense	4360				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity	g.chr10:17891714G>C																												ENST00000331429.2:c.1195G>C	10.37:g.17891714G>C	ENSP00000332124:p.Ala399Pro		Somatic					p.A399P	NM_002438	NP_002429	WXS	Illumina HiSeq	Unspecified	P22897	MRC1_HUMAN			7	1298	+			399			Extracellular (Potential).|C-type lectin 2.			Missense_Mutation	SNP	ENST00000331429.2	37	c.1195G>C		.	.	.	.	.	.	.	.	.	.	g	11.96	1.793602	0.31685	.	.	ENSG00000183748	ENST00000331429;ENST00000457317	T;T	0.22743	1.94;1.94	3.74	2.83	0.33086	.	0.000000	0.53938	U	0.000041	T	0.41259	0.1151	.	.	.	0.41837	P	0.009896000000000016	D	0.76494	0.999	D	0.76575	0.988	T	0.55140	-0.8187	8	0.52906	T	0.07	-15.9245	10.1001	0.42499	0.0958:0.0:0.9042:0.0	.	399	B9EJA8	.	P	399	ENSP00000332124:A399P;ENSP00000391843:A399P	ENSP00000332124:A399P	A	+	1	0	AL928580.1	17931720	1.000000	0.71417	0.284000	0.24805	0.034000	0.12701	5.376000	0.66178	0.922000	0.37019	-0.360000	0.07572	GCA		0.463	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1			39	229	0	0	0	0.01441	0	39	229				
MRC1	4360	broad.mit.edu	37	10	17949621	17949621	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:17949621C>T	ENST00000331429.2	+	28	4088	c.3985C>T	c.(3985-3987)Cgg>Tgg	p.R1329W																	breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CTCTGGTGAACGGAATGATTG	0.403																																						GBM(115;1153 1594 28187 28781 35884)	uc001ipk.2		NA																	0					0						c.(3985-3987)CGG>TGG		mannose receptor C type 1 precursor							91.0	98.0	95.0					10																	17949621		2183	4279	6462	SO:0001583	missense	4360				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity	g.chr10:17949621C>T																												ENST00000331429.2:c.3985C>T	10.37:g.17949621C>T	ENSP00000332124:p.Arg1329Trp		Somatic					p.R1329W	NM_002438	NP_002429	WXS	Illumina HiSeq	Unspecified	P22897	MRC1_HUMAN			28	4088	+			1329			Extracellular (Potential).|C-type lectin 8.			Missense_Mutation	SNP	ENST00000331429.2	37	c.3985C>T		.	.	.	.	.	.	.	.	.	.	.	10.63	1.403608	0.25291	.	.	ENSG00000183748	ENST00000331429	T	0.19669	2.13	4.04	3.11	0.35812	.	1.008970	0.07970	U	0.983919	T	0.43678	0.1258	.	.	.	0.38725	D	0.953541	D	0.89917	1.0	D	0.77004	0.989	T	0.38134	-0.9675	8	0.66056	D	0.02	-20.0799	8.413	0.32655	0.4049:0.4607:0.1344:0.0	.	1329	B9EJA8	.	W	1329	ENSP00000332124:R1329W	ENSP00000332124:R1329W	R	+	1	2	AL928580.1	17989627	0.000000	0.05858	0.998000	0.56505	0.050000	0.14768	-0.095000	0.11077	0.877000	0.35895	0.508000	0.49915	CGG		0.403	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1			14	96	0	0	0	0.00278	0	14	96				
SLC39A12	221074	broad.mit.edu	37	10	18289663	18289663	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:18289663C>A	ENST00000377369.2	+	11	1941	c.1668C>A	c.(1666-1668)ggC>ggA	p.G556G	SLC39A12-AS1_ENST00000439319.1_RNA|SLC39A12_ENST00000377374.4_Silent_p.G519G|SLC39A12_ENST00000377371.3_Silent_p.G555G|SLC39A12-AS1_ENST00000445287.1_RNA|SLC39A12_ENST00000539911.1_Silent_p.G422G	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	556					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TTGCAGATGGCCTAGCCATAG	0.433																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(1666-1668)GGC>GGA		solute carrier family 39 (zinc transporter),							157.0	138.0	144.0					10																	18289663		2203	4300	6503	SO:0001819	synonymous_variant	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18289663C>A		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1668C>A	10.37:g.18289663C>A			Somatic				SLC39A12_uc001ipn.2_Silent_p.G519G|SLC39A12_uc001ipp.2_Silent_p.G555G|SLC39A12_uc010qck.1_Silent_p.G422G	p.G556G	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			11	1941	+			556			Helical; (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Silent	SNP	ENST00000377369.2	37	c.1668C>A	CCDS44362.1																																																																																				0.433	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		56	37	1	0	7.50695e-29	0.01441	1.36194e-28	56	37				
CACNB2	783	broad.mit.edu	37	10	18789836	18789836	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:18789836G>T	ENST00000324631.7	+	5	612	c.552G>T	c.(550-552)ctG>ctT	p.L184L	CACNB2_ENST00000377331.2_Silent_p.L156L|CACNB2_ENST00000396576.2_Silent_p.L129L|CACNB2_ENST00000352115.6_Silent_p.L184L|CACNB2_ENST00000377329.4_Silent_p.L130L|CACNB2_ENST00000377315.4_Silent_p.L136L|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000282343.8_Silent_p.L156L|CACNB2_ENST00000377319.3_Silent_p.L129L	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	184					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACATGAGGCTGCAGCATGAAC	0.403																																							uc001ipr.2		NA																	0				large_intestine(1)|central_nervous_system(1)|skin(1)	3						c.(550-552)CTG>CTT		calcium channel, voltage-dependent, beta 2	Magnesium Sulfate(DB00653)|Verapamil(DB00661)						99.0	86.0	90.0					10																	18789836		2203	4300	6503	SO:0001819	synonymous_variant	783				axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chr10:18789836G>T	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.552G>T	10.37:g.18789836G>T			Somatic				CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Silent_p.L184L|CACNB2_uc001ipt.2_Silent_p.L184L|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Silent_p.L156L|CACNB2_uc001ipv.2_Silent_p.L156L|CACNB2_uc009xka.1_Silent_p.L156L|CACNB2_uc001ipw.2_Silent_p.L129L|CACNB2_uc001ipx.2_Silent_p.L129L|CACNB2_uc009xkb.1_Silent_p.L130L|CACNB2_uc010qcm.1_Silent_p.L130L|CACNB2_uc001ipz.2_Silent_p.L130L|CACNB2_uc001ipy.2_Silent_p.L130L|CACNB2_uc010qcn.1_Silent_p.L136L|CACNB2_uc010qco.1_Silent_p.L136L|CACNB2_uc001iqa.2_Silent_p.L136L	p.L184L	NM_201596	NP_963890	WXS	Illumina HiSeq	Unspecified	Q08289	CACB2_HUMAN			5	612	+			184					A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	ENST00000324631.7	37	c.552G>T	CCDS7125.1																																																																																				0.403	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724		19	40	1	0	5.03518e-11	0.007413	7.43229e-11	19	40				
ARHGAP21	57584	broad.mit.edu	37	10	24885806	24885806	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:24885806T>C	ENST00000396432.2	-	17	3826	c.3340A>G	c.(3340-3342)Acc>Gcc	p.T1114A	ARHGAP21_ENST00000493154.1_5'Flank|ARHGAP21_ENST00000320481.6_Missense_Mutation_p.T901A	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1113					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GGGGGACTGGTATCATCTTTT	0.343																																							uc001isb.2		NA																	0				ovary(7)|pancreas(1)	8						c.(3340-3342)ACC>GCC		Rho GTPase activating protein 21							74.0	66.0	68.0					10																	24885806		2203	4300	6503	SO:0001583	missense	57584				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding	g.chr10:24885806T>C	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3340A>G	10.37:g.24885806T>C	ENSP00000379709:p.Thr1114Ala		Somatic				ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.T1114A	p.T1114A	NM_020824	NP_065875	WXS	Illumina HiSeq	Unspecified	Q5T5U3	RHG21_HUMAN			17	3827	-			1113					Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	c.3340A>G	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	T	17.14	3.312626	0.60414	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003	T;T;T;T	0.50277	2.74;2.88;0.78;0.75	5.78	5.78	0.91487	.	0.146747	0.64402	D	0.000009	T	0.51432	0.1674	N	0.19112	0.55	0.40918	D	0.984284	D;B	0.67145	0.996;0.41	P;B	0.62813	0.907;0.064	T	0.50508	-0.8820	10	0.30078	T	0.28	.	16.4053	0.83662	0.0:0.0:0.0:1.0	.	1104;1113	F8W9U9;Q5T5U3	.;RHG21_HUMAN	A	1114;901;1104;1114	ENSP00000379709:T1114A;ENSP00000365604:T901A;ENSP00000365592:T1104A;ENSP00000405018:T1114A	ENSP00000365604:T901A	T	-	1	0	ARHGAP21	24925812	0.997000	0.39634	0.998000	0.56505	0.966000	0.64601	2.553000	0.45837	2.333000	0.79357	0.482000	0.46254	ACC		0.343	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824		20	15	0	0	0	0.003954	0	20	15				
ZEB1	6935	broad.mit.edu	37	10	31812883	31812883	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:31812883C>A	ENST00000320985.10	+	8	2734	c.2624C>A	c.(2623-2625)tCa>tAa	p.S875*	ZEB1_ENST00000361642.5_Nonsense_Mutation_p.S876*|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000560721.2_Nonsense_Mutation_p.S855*|ZEB1_ENST00000446923.2_Nonsense_Mutation_p.S859*|ZEB1_ENST00000542815.3_Nonsense_Mutation_p.S808*			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	875					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GATACTAGCTCAGAAGGAGTA	0.348																																					Ovarian(40;423 959 14296 36701 49589)	Ovarian(40;423 959 14296 36701 49589)	uc001ivs.3		NA																	0				ovary(3)|central_nervous_system(2)	5						c.(2623-2625)TCA>TAA		zinc finger E-box binding homeobox 1 isoform b							74.0	74.0	74.0					10																	31812883		2203	4300	6503	SO:0001587	stop_gained	6935				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr10:31812883C>A	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2624C>A	10.37:g.31812883C>A	ENSP00000319248:p.Ser875*		Somatic				ZEB1_uc001ivr.3_Nonsense_Mutation_p.S657*|ZEB1_uc010qee.1_Nonsense_Mutation_p.S657*|ZEB1_uc010qef.1_Nonsense_Mutation_p.S657*|ZEB1_uc009xlk.1_Nonsense_Mutation_p.S657*|ZEB1_uc001ivt.3_Nonsense_Mutation_p.S657*|ZEB1_uc001ivu.3_Nonsense_Mutation_p.S876*|ZEB1_uc001ivv.3_Nonsense_Mutation_p.S855*|ZEB1_uc010qeh.1_Nonsense_Mutation_p.S808*|ZEB1_uc009xlp.2_Nonsense_Mutation_p.S859*	p.S875*	NM_030751	NP_110378	WXS	Illumina HiSeq	Unspecified	P37275	ZEB1_HUMAN			8	2687	+		Prostate(175;0.0156)	875					B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Nonsense_Mutation	SNP	ENST00000320985.10	37	c.2624C>A	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	C	38	6.681172	0.97759	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	.	.	.	5.57	5.57	0.84162	.	1.666050	0.03528	N	0.222009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.8996	19.5459	0.95297	0.0:1.0:0.0:0.0	.	.	.	.	X	657;875;876;870;808;875;855;766;859	.	ENSP00000319248:S875X	S	+	2	0	ZEB1	31852889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.294000	0.78760	2.635000	0.89317	0.585000	0.79938	TCA		0.348	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		6	58	1	0	0.000157383	0.00308	0.000179081	6	58				
BMS1	9790	broad.mit.edu	37	10	43279882	43279882	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:43279882A>T	ENST00000374518.5	+	2	103	c.40A>T	c.(40-42)Agt>Tgt	p.S14C		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	14					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AAAGAAAAACAGTGGACCCAA	0.453																																							uc001jaj.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(40-42)AGT>TGT		BMS1-like, ribosome assembly protein							56.0	62.0	60.0					10																	43279882		2203	4300	6503	SO:0001583	missense	9790				ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity	g.chr10:43279882A>T	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.40A>T	10.37:g.43279882A>T	ENSP00000363642:p.Ser14Cys		Somatic					p.S14C	NM_014753	NP_055568	WXS	Illumina HiSeq	Unspecified	Q14692	BMS1_HUMAN			2	398	+			14					Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	c.40A>T	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937860	0.73557	.	.	ENSG00000165733	ENST00000374518	T	0.10192	2.9	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	M	0.89287	3.02	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	T	0.47598	-0.9105	10	0.72032	D	0.01	.	13.9576	0.64160	1.0:0.0:0.0:0.0	.	14	Q14692	BMS1_HUMAN	C	14	ENSP00000363642:S14C	ENSP00000363642:S14C	S	+	1	0	BMS1	42599888	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.931000	0.75863	1.703000	0.51240	0.411000	0.27672	AGT		0.453	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753		20	27	0	0	0	0.007413	0	20	27				
GPRIN2	9721	broad.mit.edu	37	10	47000090	47000090	+	Missense_Mutation	SNP	G	G	A	rs555801030	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:47000090G>A	ENST00000374317.1	+	3	1483	c.1210G>A	c.(1210-1212)Ggt>Agt	p.G404S	GPRIN2_ENST00000374314.4_Missense_Mutation_p.G404S	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	404										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GGAGGTGCTCGGTGTGGCCAT	0.672													G|||	2	0.000399361	0.0008	0.0	5008	,	,		33770	0.0		0.001	False		,,,				2504	0.0						uc001jec.2		NA																	0					0						c.(1210-1212)GGT>AGT		G protein-regulated inducer of neurite outgrowth							140.0	113.0	122.0					10																	47000090		2203	4300	6503	SO:0001583	missense	9721							g.chr10:47000090G>A	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1210G>A	10.37:g.47000090G>A	ENSP00000363436:p.Gly404Ser		Somatic				GPRIN2_uc010qfq.1_Missense_Mutation_p.G167S	p.G404S	NM_014696	NP_055511	WXS	Illumina HiSeq	Unspecified	O60269	GRIN2_HUMAN			3	1345	+			404					Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	c.1210G>A	CCDS31192.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235708	0.79800	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.63255	-0.03;-0.03	4.65	4.65	0.58169	.	0.000000	0.42964	D	0.000626	T	0.79759	0.4501	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83154	-0.0102	10	0.87932	D	0	-20.7226	15.391	0.74744	0.0:0.0:1.0:0.0	.	404	O60269	GRIN2_HUMAN	S	404	ENSP00000363436:G404S;ENSP00000363433:G404S	ENSP00000363433:G404S	G	+	1	0	GPRIN2	46420096	1.000000	0.71417	0.420000	0.26596	0.468000	0.32798	7.924000	0.87555	2.308000	0.77769	0.313000	0.20887	GGT		0.672	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696		3	32	0	0	0	0.009096	0	3	32				
VSTM4	196740	broad.mit.edu	37	10	50227749	50227749	+	Silent	SNP	G	G	A	rs561518432		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:50227749G>A	ENST00000332853.4	-	8	932	c.909C>T	c.(907-909)ggC>ggT	p.G303G	RP11-523O18.1_ENST00000422966.1_RNA	NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						TGGTGGGGGCGCCTTTGGCAG	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16229	0.0		0.0	False		,,,				2504	0.0						uc001jhf.2		NA																	0					0						c.(907-909)GGC>GGT		hypothetical protein LOC196740 isoform 1							71.0	71.0	71.0					10																	50227749		2203	4300	6503	SO:0001819	synonymous_variant	196740					integral to membrane|plasma membrane		g.chr10:50227749G>A	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.909C>T	10.37:g.50227749G>A			Somatic					p.G303G	NM_001031746	NP_001026916	WXS	Illumina HiSeq	Unspecified	Q8IW00	CJ072_HUMAN			8	938	-			303			Cytoplasmic (Potential).		B4DNI6|Q96MX7	Silent	SNP	ENST00000332853.4	37	c.909C>T	CCDS31198.1																																																																																				0.493	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984		2	34	0	0	0	0.004672	0	2	34				
MBL2	4153	broad.mit.edu	37	10	54527994	54527994	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:54527994C>T	ENST00000373968.3	-	4	714	c.650G>A	c.(649-651)gGt>gAt	p.G217D		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	217	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTCATCAGAACCAGCATTGTT	0.498																																							uc001jjt.2		NA																	0				ovary(1)	1						c.(649-651)GGT>GAT		soluble mannose-binding lectin precursor							398.0	356.0	370.0					10																	54527994		2202	4300	6502	SO:0001583	missense	4153				acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding	g.chr10:54527994C>T	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.650G>A	10.37:g.54527994C>T	ENSP00000363079:p.Gly217Asp		Somatic					p.G217D	NM_000242	NP_000233	WXS	Illumina HiSeq	Unspecified	P11226	MBL2_HUMAN			4	715	-			217			C-type lectin.		Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	ENST00000373968.3	37	c.650G>A	CCDS7247.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582939	0.28268	.	.	ENSG00000165471	ENST00000373968	T	0.19250	2.16	5.13	-8.82	0.00810	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.562920	0.03391	N	0.201954	T	0.20373	0.0490	L	0.56340	1.77	0.09310	N	1	B	0.10296	0.003	B	0.20955	0.032	T	0.16012	-1.0417	10	0.40728	T	0.16	0.0033	11.7756	0.51983	0.0:0.1942:0.0994:0.7064	.	217	P11226	MBL2_HUMAN	D	217	ENSP00000363079:G217D	ENSP00000363079:G217D	G	-	2	0	MBL2	54198000	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.329000	0.00252	-2.341000	0.00625	-0.216000	0.12614	GGT		0.498	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242		158	112	0	0	0	0.01441	0	158	112				
MBL2	4153	broad.mit.edu	37	10	54528149	54528149	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:54528149G>T	ENST00000373968.3	-	4	559	c.495C>A	c.(493-495)ccC>ccA	p.P165P		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	165	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)	p.P165P(1)		breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						CAGCATTCCTGGGGGTGGCCA	0.483																																							uc001jjt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(493-495)CCC>CCA		soluble mannose-binding lectin precursor							143.0	146.0	145.0					10																	54528149		2202	4300	6502	SO:0001819	synonymous_variant	4153				acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding	g.chr10:54528149G>T	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.495C>A	10.37:g.54528149G>T			Somatic					p.P165P	NM_000242	NP_000233	WXS	Illumina HiSeq	Unspecified	P11226	MBL2_HUMAN			4	560	-			165			C-type lectin.		Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Silent	SNP	ENST00000373968.3	37	c.495C>A	CCDS7247.1																																																																																				0.483	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242		42	44	1	0	6.08268e-21	0.01441	1.04837e-20	42	44				
OIT3	170392	broad.mit.edu	37	10	74671501	74671501	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:74671501G>A	ENST00000334011.5	+	5	912	c.694G>A	c.(694-696)Ggt>Agt	p.G232S		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	232						nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					CAATAACAATGGTGGCTGCAG	0.502																																					Colon(7;19 345 13446 17537)	Colon(7;19 345 13446 17537)	uc001jte.1		NA																	0				ovary(2)	2						c.(694-696)GGT>AGT		oncoprotein-induced transcript 3 precursor							110.0	102.0	105.0					10																	74671501		2203	4300	6503	SO:0001583	missense	170392					nuclear envelope	calcium ion binding	g.chr10:74671501G>A		CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.694G>A	10.37:g.74671501G>A	ENSP00000333900:p.Gly232Ser		Somatic				OIT3_uc009xqs.1_RNA	p.G232S	NM_152635	NP_689848	WXS	Illumina HiSeq	Unspecified	Q8WWZ8	OIT3_HUMAN			5	912	+	Prostate(51;0.0198)		232					A0AVP3|Q8N1M8	Missense_Mutation	SNP	ENST00000334011.5	37	c.694G>A	CCDS7318.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750502	0.69533	.	.	ENSG00000138315	ENST00000334011;ENST00000415725	D	0.98419	-4.92	5.88	5.88	0.94601	Epidermal growth factor-like (1);	0.000000	0.64402	D	0.000015	D	0.97402	0.9150	L	0.47716	1.5	0.80722	D	1	P	0.52463	0.953	P	0.48030	0.564	D	0.96702	0.9519	10	0.35671	T	0.21	-12.5876	20.2375	0.98362	0.0:0.0:1.0:0.0	.	232	Q8WWZ8	OIT3_HUMAN	S	232	ENSP00000333900:G232S	ENSP00000333900:G232S	G	+	1	0	OIT3	74341507	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.972000	0.93424	2.790000	0.95986	0.655000	0.94253	GGT		0.502	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048596.1	NM_152635		21	63	0	0	0	0.00278	0	21	63				
SORCS3	22986	broad.mit.edu	37	10	106960951	106960951	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:106960951G>A	ENST00000369701.3	+	16	2428	c.2201G>A	c.(2200-2202)cGa>cAa	p.R734Q	SORCS3_ENST00000369699.4_Missense_Mutation_p.R20Q	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	734					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.R734Q(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCCCTGGGCCGAGACCACTCA	0.488																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|central_nervous_system(1)	10						c.(2200-2202)CGA>CAA		VPS10 domain receptor protein SORCS 3 precursor							124.0	108.0	113.0					10																	106960951		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106960951G>A	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2201G>A	10.37:g.106960951G>A	ENSP00000358715:p.Arg734Gln		Somatic				SORCS3_uc010qqz.1_RNA	p.R734Q	NM_014978	NP_055793	WXS	Illumina HiSeq	Unspecified	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	16	2428	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	734			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.2201G>A	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975681	0.53720	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.31247	1.59;1.5	5.78	3.93	0.45458	VPS10 (1);	0.254621	0.34879	N	0.003602	T	0.17959	0.0431	L	0.41236	1.265	0.35857	D	0.82719	P	0.43607	0.812	B	0.26693	0.072	T	0.20706	-1.0267	9	.	.	.	.	9.8056	0.40791	0.2092:0.0:0.7908:0.0	.	734	Q9UPU3	SORC3_HUMAN	Q	734;20	ENSP00000358715:R734Q;ENSP00000358713:R20Q	.	R	+	2	0	SORCS3	106950941	0.869000	0.29996	0.992000	0.48379	0.914000	0.54420	2.783000	0.47766	0.792000	0.33850	0.650000	0.86243	CGA		0.488	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		31	56	0	0	0	0.009535	0	31	56				
SORCS1	114815	broad.mit.edu	37	10	108380255	108380255	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:108380255C>T	ENST00000263054.6	-	20	2734	c.2727G>A	c.(2725-2727)gcG>gcA	p.A909A	SORCS1_ENST00000369698.1_Silent_p.A444A|SORCS1_ENST00000344440.6_Silent_p.A909A|SORCS1_ENST00000478809.2_5'Flank	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	909					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCACTGCCGTCGCATTGACCT	0.562																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(2725-2727)GCG>GCA		SORCS receptor 1 isoform a							167.0	135.0	146.0					10																	108380255		2203	4300	6503	SO:0001819	synonymous_variant	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108380255C>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2727G>A	10.37:g.108380255C>T			Somatic				SORCS1_uc001kyl.2_Silent_p.A909A|SORCS1_uc009xxs.2_Silent_p.A909A|SORCS1_uc001kyn.1_Silent_p.A909A|SORCS1_uc001kyo.2_Silent_p.A909A	p.A909A	NM_052918	NP_443150	WXS	Illumina HiSeq	Unspecified	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	20	2735	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	909			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	c.2727G>A	CCDS7559.1																																																																																				0.562	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		20	88	0	0	0	0.00278	0	20	88				
PRLHR	2834	broad.mit.edu	37	10	120353836	120353837	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr10:120353836_120353837GG>TT	ENST00000369169.1	-	1	919_920	c.920_921CC>AA	c.(919-921)gCC>gAA	p.A307E	PRLHR_ENST00000239032.2_Missense_Mutation_p.A307E			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	307					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)	p.A307V(1)		large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		AAGGGTCGATGGCGTGGGGGTC	0.644																																							uc001ldp.1		NA																	1	Substitution - Missense(1)		skin(1)		0						c.(919-921)GCC>GAA		G protein-coupled receptor 10																																				SO:0001583	missense	2834				female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity	g.chr10:120353836_120353837GG>TT	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.920_921delinsTT	10.37:g.120353836_120353837delinsTT	ENSP00000358167:p.Ala307Glu		Somatic					p.A307E	NM_004248	NP_004239	WXS	Illumina HiSeq	Unspecified	P49683	PRLHR_HUMAN		all cancers(201;0.0166)	2	1059_1060	-		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)	307			Extracellular (Potential).		O75194|Q502U8|Q5VXR9	Missense_Mutation	DNP	ENST00000369169.1	37	c.920_921CC>AA	CCDS7606.1																																																																																				0.644	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1	NM_004248		11	47	0	0	0	0.004672	0	11	47				
AP2A2	161	broad.mit.edu	37	11	970255	970255	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:970255G>A	ENST00000448903.2	+	3	364	c.223G>A	c.(223-225)Gga>Aga	p.G75R	AP2A2_ENST00000534328.1_Missense_Mutation_p.G75R|AP2A2_ENST00000332231.5_Missense_Mutation_p.G75R	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	75	Lipid-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGACTTTGGACACATGGA	0.483																																							uc001lss.2		NA																	0					0						c.(223-225)GGA>AGA		adaptor-related protein complex 2, alpha 2							110.0	112.0	111.0					11																	970255		2028	4199	6227	SO:0001583	missense	161				axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity	g.chr11:970255G>A	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.223G>A	11.37:g.970255G>A	ENSP00000413234:p.Gly75Arg		Somatic				AP2A2_uc001lst.1_Missense_Mutation_p.G75R|AP2A2_uc009yco.1_RNA|AP2A2_uc001lsu.1_5'Flank	p.G75R	NM_012305	NP_036437	WXS	Illumina HiSeq	Unspecified	O94973	AP2A2_HUMAN		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)	3	404	+		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	75			Lipid-binding.		O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	37	c.223G>A	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457546	0.84317	.	.	ENSG00000183020	ENST00000534328;ENST00000417081;ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310;ENST00000531548;ENST00000534485;ENST00000527024	T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59	3.26	3.26	0.37387	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79974	-0.1577	10	0.87932	D	0	-34.7635	15.8141	0.78586	0.0:0.0:1.0:0.0	.	75;75	O94973-2;O94973	.;AP2A2_HUMAN	R	75;75;75;75;75;75;75;81;65;69	ENSP00000436059:G75R;ENSP00000413234:G75R;ENSP00000327694:G75R;ENSP00000433498:G81R;ENSP00000435756:G65R;ENSP00000434563:G69R	ENSP00000327694:G75R	G	+	1	0	AP2A2	960255	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	9.550000	0.98110	2.134000	0.65973	0.563000	0.77884	GGA		0.483	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305		20	47	0	0	0	0.010504	0	20	47				
MUC5B	727897	broad.mit.edu	37	11	1263424	1263424	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:1263424T>C	ENST00000529681.1	+	31	5372	c.5314T>C	c.(5314-5316)Ttg>Ctg	p.L1772L	MUC5B_ENST00000447027.1_Silent_p.L1775L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1772	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AATGAGCCCCTTGACTAACAC	0.622																																							uc009ycr.1		NA																	0					0						c.(7393-7395)TTG>CTG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							45.0	54.0	51.0					11																	1263424		2186	4257	6443	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1263424T>C	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5314T>C	11.37:g.1263424T>C			Somatic				MUC5B_uc001ltb.2_Silent_p.L1775L	p.L2465L	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	47	7519	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	1772			7 X Cys-rich subdomain repeats.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.7393T>C	CCDS44515.2																																																																																				0.622	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		26	33	0	0	0	0.010818	0	26	33				
ZNF195	7748	broad.mit.edu	37	11	3380678	3380678	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:3380678C>T	ENST00000399602.4	-	6	1686	c.1560G>A	c.(1558-1560)aaG>aaA	p.K520K	ZNF195_ENST00000429541.2_Silent_p.K452K|ZNF195_ENST00000005082.9_Silent_p.K497K|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000343338.7_Silent_p.K452K|ZNF195_ENST00000354599.6_Silent_p.K448K|ZNF195_ENST00000526601.1_Silent_p.K501K	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATTTGTAGGGCTTCTCTCCAG	0.403																																							uc001lxt.2		NA																	0					0						c.(1558-1560)AAG>AAA		zinc finger protein 195 isoform 1							168.0	171.0	170.0					11																	3380678		2064	4218	6282	SO:0001819	synonymous_variant	7748				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:3380678C>T		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1560G>A	11.37:g.3380678C>T			Somatic				uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Silent_p.K497K|ZNF195_uc001lxs.2_Silent_p.K448K|ZNF195_uc010qxr.1_Silent_p.K501K|ZNF195_uc009ydz.2_Silent_p.K475K|ZNF195_uc001lxu.2_Silent_p.K452K	p.K520K	NM_001130520	NP_001123992	WXS	Illumina HiSeq	Unspecified	O14628	ZN195_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	6	1738	-		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)	520					A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	37	c.1560G>A	CCDS44522.1																																																																																				0.403	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			4	126	0	0	0	0.000602	0	4	126				
OR51F2	119694	broad.mit.edu	37	11	4843021	4843021	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:4843021C>T	ENST00000322110.5	+	1	471	c.406C>T	c.(406-408)Cgt>Tgt	p.R136C	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCCTTTGATCGTTTTGTGGC	0.463																																							uc010qyn.1		NA																	0				ovary(1)|pancreas(1)	2						c.(406-408)CGT>TGT		olfactory receptor, family 51, subfamily F,							233.0	200.0	211.0					11																	4843021		2201	4298	6499	SO:0001583	missense	119694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4843021C>T	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.406C>T	11.37:g.4843021C>T	ENSP00000323952:p.Arg136Cys		Somatic					p.R136C	NM_001004753	NP_001004753	WXS	Illumina HiSeq	Unspecified	Q8NH61	O51F2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	406	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	136			Cytoplasmic (Potential).		Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	37	c.406C>T	CCDS31361.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380963	0.42207	.	.	ENSG00000176925	ENST00000322110	T	0.77358	-1.09	4.43	3.51	0.40186	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41605	U	0.000842	T	0.78007	0.4216	M	0.93106	3.38	0.44611	D	0.99758	P	0.41498	0.752	B	0.34779	0.189	T	0.79945	-0.1589	10	0.72032	D	0.01	.	6.712	0.23282	0.1758:0.7311:0.0:0.0931	.	136	Q8NH61	O51F2_HUMAN	C	136	ENSP00000323952:R136C	ENSP00000323952:R136C	R	+	1	0	OR51F2	4799597	0.991000	0.36638	1.000000	0.80357	0.963000	0.63663	1.026000	0.30103	1.215000	0.43411	0.561000	0.74099	CGT		0.463	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		60	100	0	0	0	0.01441	0	60	100				
MMP26	56547	broad.mit.edu	37	11	5011057	5011057	+	Silent	SNP	G	G	A	rs149405690	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:5011057G>A	ENST00000380390.1	+	3	495	c.279G>A	c.(277-279)tcG>tcA	p.S93S	MMP26_ENST00000300762.1_Silent_p.S93S|MMP26_ENST00000477339.1_3'UTR			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	93					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	CCTCCATCTCGCCAGGAAGAT	0.512																																							uc001lzv.2		NA																	0					0						c.(277-279)TCG>TCA		matrix metalloproteinase 26 preproprotein		G		1,4401	2.1+/-5.4	0,1,2200	70.0	58.0	62.0		279	-3.3	0.0	11	dbSNP_134	62	0,8596		0,0,4298	no	coding-synonymous	MMP26	NM_021801.3		0,1,6498	AA,AG,GG		0.0,0.0227,0.0077		93/262	5011057	1,12997	2201	4298	6499	SO:0001819	synonymous_variant	56547				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:5011057G>A	AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.279G>A	11.37:g.5011057G>A			Somatic					p.S93S	NM_021801	NP_068573	WXS	Illumina HiSeq	Unspecified	Q9NRE1	MMP26_HUMAN		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	2	297	+		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)	93					Q3MJ78|Q9GZS2|Q9NR87	Silent	SNP	ENST00000380390.1	37	c.279G>A	CCDS7752.1																																																																																				0.512	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142058.3	NM_021801		11	47	0	0	0	0.006122	0	11	47				
HBD	3045	broad.mit.edu	37	11	5255342	5255342	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:5255342C>A	ENST00000380299.3	-	2	408	c.194G>T	c.(193-195)gGc>gTc	p.G65V	HBD_ENST00000292901.3_Missense_Mutation_p.G65V	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	65					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACCTTCTTGCCATGAGCCTT	0.532																																							uc001maf.1		NA																	0				ovary(1)	1						c.(193-195)GGC>GTC		delta globin							159.0	138.0	145.0					11																	5255342		2201	4298	6499	SO:0001583	missense	3045				blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity	g.chr11:5255342C>A	AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.194G>T	11.37:g.5255342C>A	ENSP00000369654:p.Gly65Val		Somatic					p.G65V	NM_000519	NP_000510	WXS	Illumina HiSeq	Unspecified	P02042	HBD_HUMAN		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	389	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	65					Q3Y5H3|Q8WXT7	Missense_Mutation	SNP	ENST00000380299.3	37	c.194G>T	CCDS31376.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385061	0.82792	.	.	ENSG00000223609	ENST00000292901;ENST00000380299;ENST00000429817	D;D;D	0.94457	-3.43;-3.43;-3.43	4.33	4.33	0.51752	Globin-like (1);Globin, structural domain (1);	0.048893	0.85682	D	0.000000	D	0.98333	0.9447	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99461	1.0943	10	0.87932	D	0	-0.3237	15.9105	0.79470	0.0:1.0:0.0:0.0	.	65	P02042	HBD_HUMAN	V	65	ENSP00000292901:G65V;ENSP00000369654:G65V;ENSP00000393810:G65V	ENSP00000292901:G65V	G	-	2	0	HBD	5211918	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.376000	0.52417	2.403000	0.81681	0.585000	0.79938	GGC		0.532	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142970.1	NM_000519		25	55	1	0	1.2476e-16	0.00632	2.04788e-16	25	55				
Unknown	0	broad.mit.edu	37	11	5989392	5989392	+	IGR	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:5989392C>A								OR56A3 (19801 upstream) : OR52L1 (17729 downstream)																							ACTCCATAGTCAGAAAACTGT	0.493																																							uc010qzu.1		NA																	0					0						c.(331-333)CTG>CTT		olfactory receptor, family 56, subfamily A,							67.0	62.0	64.0					11																	5989392		692	1591	2283	SO:0001628	intergenic_variant	390084					integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5989392C>A																													11.37:g.5989392C>A			Somatic					p.L111L	NM_001146033	NP_001139505	WXS	Illumina HiSeq	Unspecified	P0C7T3	O56A5_HUMAN			1	333	-			111			Helical; Name=3; (Potential).			Silent	SNP		37	c.333G>T																																																																																				0	0.493									15	20	1	0	1.15088e-07	0.004007	1.49207e-07	15	20				
OR52W1	120787	broad.mit.edu	37	11	6220836	6220836	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:6220836C>A	ENST00000311352.2	+	1	461	c.383C>A	c.(382-384)gCt>gAt	p.A128D	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTGATCGTGCTGCGGCAATA	0.547																																							uc010qzz.1		NA																	0					0						c.(382-384)GCT>GAT		olfactory receptor, family 52, subfamily W,							142.0	98.0	113.0					11																	6220836		2201	4296	6497	SO:0001583	missense	120787				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6220836C>A	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.383C>A	11.37:g.6220836C>A	ENSP00000309673:p.Ala128Asp		Somatic					p.A128D	NM_001005178	NP_001005178	WXS	Illumina HiSeq	Unspecified	Q6IF63	O52W1_HUMAN		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	383	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	128			Cytoplasmic (Potential).		Q8NH78	Missense_Mutation	SNP	ENST00000311352.2	37	c.383C>A	CCDS31407.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778399	0.70107	.	.	ENSG00000175485	ENST00000311352	T	0.37915	1.17	5.85	3.86	0.44501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38381	N	0.001713	T	0.46268	0.1384	L	0.57536	1.79	0.41835	D	0.990098	D	0.67145	0.996	P	0.53649	0.731	T	0.52381	-0.8583	10	0.87932	D	0	.	12.4536	0.55691	0.4759:0.5241:0.0:0.0	.	128	Q6IF63	O52W1_HUMAN	D	128	ENSP00000309673:A128D	ENSP00000309673:A128D	A	+	2	0	OR52W1	6177412	0.985000	0.35326	0.998000	0.56505	0.580000	0.36256	2.710000	0.47169	1.451000	0.47736	0.655000	0.94253	GCT		0.547	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383758.1	NM_001005178		17	33	1	0	3.62473e-10	0.012319	5.24467e-10	17	33				
CCKBR	887	broad.mit.edu	37	11	6292607	6292607	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:6292607T>C	ENST00000334619.2	+	5	1371	c.1178T>C	c.(1177-1179)aTg>aCg	p.M393T	CCKBR_ENST00000532715.1_Missense_Mutation_p.M309T|CCKBR_ENST00000525462.1_Missense_Mutation_p.M462T	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	393					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TACTGCTTCATGCACCGTCGC	0.657																																							uc001mcp.2		NA																	0				lung(5)|ovary(2)|breast(1)	8						c.(1177-1179)ATG>ACG		cholecystokinin B receptor	Pentagastrin(DB00183)						109.0	94.0	99.0					11																	6292607		2201	4296	6497	SO:0001583	missense	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6292607T>C	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.1178T>C	11.37:g.6292607T>C	ENSP00000335544:p.Met393Thr		Somatic				CCKBR_uc001mcq.2_Missense_Mutation_p.M321T|CCKBR_uc001mcr.2_Intron|CCKBR_uc001mcs.2_Missense_Mutation_p.M462T	p.M393T	NM_176875	NP_795344	WXS	Illumina HiSeq	Unspecified	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	5	1371	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	393			Helical; Name=7; (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	c.1178T>C	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566632	0.65651	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.38401	1.14;1.14;1.14	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55146	0.1902	L	0.54323	1.7	0.53005	D	0.999966	D;D	0.89917	0.995;1.0	D;D	0.83275	0.991;0.996	T	0.58399	-0.7643	10	0.87932	D	0	.	13.9659	0.64209	0.0:0.0:0.0:1.0	.	462;393	P32239-2;P32239	.;GASR_HUMAN	T	393;309;462	ENSP00000335544:M393T;ENSP00000432079:M309T;ENSP00000435534:M462T	ENSP00000335544:M393T	M	+	2	0	CCKBR	6249183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.991000	0.88244	1.964000	0.57103	0.455000	0.32223	ATG		0.657	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		29	73	0	0	0	0.013726	0	29	73				
LDHC	3948	broad.mit.edu	37	11	18436732	18436732	+	Splice_Site	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:18436732A>T	ENST00000541669.1	+	3	239	c.128A>T	c.(127-129)gAt>gTt	p.D43V	LDHC_ENST00000535809.1_Splice_Site_p.D43V|LDHC_ENST00000280704.4_Splice_Site_p.D43V|LDHC_ENST00000536880.1_Splice_Site_p.D43V|LDHC_ENST00000546146.1_Splice_Site_p.D43V|LDHC_ENST00000544105.1_Splice_Site_p.D43V|LDHC_ENST00000537486.1_Splice_Site_p.D43V			P07864	LDHC_HUMAN	lactate dehydrogenase C	43					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATATTTTAGGATTTGGCTGAT	0.338																																							uc001mon.3		NA																	0					0						c.(127-129)GAT>GTT		L-lactate dehydrogenase C	NADH(DB00157)						92.0	86.0	88.0					11																	18436732		2199	4293	6492	SO:0001630	splice_region_variant	3948				glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity	g.chr11:18436732A>T	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.127-1A>T	11.37:g.18436732A>T			Somatic				LDHC_uc001mom.3_Missense_Mutation_p.D43V|LDHC_uc009yhp.2_Missense_Mutation_p.D43V|LDHC_uc001moo.3_Intron|LDHC_uc009yhq.2_Intron|LDHC_uc009yhr.2_Intron	p.D43V	NM_017448	NP_059144	WXS	Illumina HiSeq	Unspecified	P07864	LDHC_HUMAN			3	240	+			43			NAD (By similarity).		D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	ENST00000541669.1	37	c.128A>T	CCDS7840.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.367643	0.61513	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000546146;ENST00000536880;ENST00000537486;ENST00000544105;ENST00000535809	D;D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	4.73	2.38	0.29361	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.169062	0.50627	D	0.000114	D	0.92443	0.7601	M	0.84846	2.72	0.80722	D	1	P;P	0.51240	0.943;0.855	P;P	0.52823	0.71;0.546	D	0.91177	0.4973	10	0.66056	D	0.02	-10.3083	7.1593	0.25654	0.8:0.0:0.2:0.0	.	43;43	G3XAP5;P07864	.;LDHC_HUMAN	V	43	ENSP00000437783:D43V;ENSP00000280704:D43V;ENSP00000443414:D43V;ENSP00000439555:D43V;ENSP00000441478:D43V;ENSP00000439060:D43V;ENSP00000443997:D43V	ENSP00000280704:D43V	D	+	2	0	LDHC	18393308	0.995000	0.38212	0.997000	0.53966	0.792000	0.44763	2.620000	0.46410	0.849000	0.35215	0.379000	0.24179	GAT		0.338	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	Missense_Mutation	13	25	0	0	0	0.007413	0	13	25				
MRGPRX1	259249	broad.mit.edu	37	11	18955686	18955686	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:18955686C>A	ENST00000302797.3	-	1	870	c.646G>T	c.(646-648)Gtg>Ttg	p.V216L	MRGPRX1_ENST00000526914.1_5'Flank|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	216					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGGATGGTCACGTACAGCCTG	0.512																																							uc001mpg.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(646-648)GTG>TTG		MAS-related GPR, member X1							101.0	85.0	90.0					11																	18955686		2194	4286	6480	SO:0001583	missense	259249				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18955686C>A		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.646G>T	11.37:g.18955686C>A	ENSP00000305766:p.Val216Leu		Somatic					p.V216L	NM_147199	NP_671732	WXS	Illumina HiSeq	Unspecified	Q96LB2	MRGX1_HUMAN			1	864	-			216			Cytoplasmic (Potential).		Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	c.646G>T	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	13.65	2.300181	0.40694	.	.	ENSG00000170255	ENST00000302797	T	0.36878	1.23	2.28	-1.05	0.10036	GPCR, rhodopsin-like superfamily (1);	1.247870	0.05482	N	0.554946	T	0.36220	0.0959	L	0.45285	1.41	0.09310	N	1	P	0.47191	0.891	P	0.55455	0.776	T	0.31613	-0.9937	10	0.02654	T	1	.	4.4971	0.11842	0.0:0.5634:0.1849:0.2517	.	216	Q96LB2	MRGX1_HUMAN	L	216	ENSP00000305766:V216L	ENSP00000305766:V216L	V	-	1	0	MRGPRX1	18912262	0.000000	0.05858	0.003000	0.11579	0.324000	0.28378	-1.337000	0.02657	-0.235000	0.09767	-1.530000	0.00923	GTG		0.512	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199		7	44	1	0	8.12818e-05	0.001984	9.35779e-05	7	44				
NELL1	4745	broad.mit.edu	37	11	21392455	21392455	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:21392455G>T	ENST00000357134.5	+	15	1758	c.1606G>T	c.(1606-1608)Gtc>Ttc	p.V536F	NELL1_ENST00000532434.1_Missense_Mutation_p.V536F|NELL1_ENST00000298925.5_Missense_Mutation_p.V564F|NELL1_ENST00000325319.5_Missense_Mutation_p.V479F|NELL1_ENST00000529218.1_3'UTR	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	536	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CAACAAATGTGTCTGTCCATC	0.418																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1606-1608)GTC>TTC		nel-like 1 isoform 1 precursor							113.0	104.0	107.0					11																	21392455		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21392455G>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1606G>T	11.37:g.21392455G>T	ENSP00000349654:p.Val536Phe		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.V536F|NELL1_uc009yid.2_Missense_Mutation_p.V564F|NELL1_uc010rdo.1_Missense_Mutation_p.V479F|NELL1_uc010rdp.1_Missense_Mutation_p.V296F|NELL1_uc001mqg.2_RNA|NELL1_uc001mqh.2_Silent_p.V145V	p.V536F	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			15	1759	+			536			EGF-like 4.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.1606G>T	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842442	0.51057	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.59	1.39	0.22231	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.248556	0.32578	N	0.005910	T	0.42359	0.1199	L	0.39692	1.235	0.36561	D	0.872406	B;P;P;B	0.35745	0.207;0.457;0.518;0.04	B;B;B;B	0.43916	0.074;0.17;0.436;0.038	T	0.46233	-0.9206	10	0.49607	T	0.09	-2.0931	8.3399	0.32237	0.1622:0.3535:0.4843:0.0	.	479;564;536;536	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	F	564;536;479;536	ENSP00000298925:V564F;ENSP00000349654:V536F;ENSP00000317837:V479F;ENSP00000437170:V536F	ENSP00000298925:V564F	V	+	1	0	NELL1	21349031	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	0.924000	0.28777	0.304000	0.22809	0.650000	0.86243	GTC		0.418	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		8	23	1	0	0.000673444	0.008291	0.000740409	8	23				
LRRC4C	57689	broad.mit.edu	37	11	40137471	40137471	+	Silent	SNP	C	C	T	rs372663008		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:40137471C>T	ENST00000278198.2	-	2	2335	c.372G>A	c.(370-372)gcG>gcA	p.A124A	LRRC4C_ENST00000527150.1_Silent_p.A124A|LRRC4C_ENST00000528697.1_Silent_p.A124A|LRRC4C_ENST00000530763.1_Silent_p.A124A			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	124					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TGTTGAGGTTCGCCAGACCAT	0.433																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(370-372)GCG>GCA		netrin-G1 ligand precursor		C		2,4404	4.2+/-10.8	0,2,2201	70.0	70.0	70.0		372	-10.7	0.4	11		70	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LRRC4C	NM_020929.1		0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231		124/641	40137471	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40137471C>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.372G>A	11.37:g.40137471C>T			Somatic				LRRC4C_uc001mxc.1_Silent_p.A120A|LRRC4C_uc001mxd.1_Silent_p.A120A|LRRC4C_uc001mxb.1_Silent_p.A120A	p.A124A	NM_020929	NP_065980	WXS	Illumina HiSeq	Unspecified	Q9HCJ2	LRC4C_HUMAN			2	2336	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	124					A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	c.372G>A	CCDS31464.1																																																																																				0.433	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		4	22	0	0	0	0.009096	0	4	22				
CHRM4	1132	broad.mit.edu	37	11	46408006	46408006	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:46408006G>A	ENST00000433765.2	-	1	101	c.102C>T	c.(100-102)ttC>ttT	p.F34F		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	34					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CTGTGGCAATGAAGACCATTT	0.557																																					Esophageal Squamous(171;1020 1936 4566 30205 42542)	Esophageal Squamous(171;1020 1936 4566 30205 42542)	uc001nct.1		NA																	0					0						c.(100-102)TTC>TTT		cholinergic receptor, muscarinic 4	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)|Tropicamide(DB00809)						98.0	101.0	100.0					11																	46408006		2170	4276	6446	SO:0001819	synonymous_variant	1132				cell proliferation	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity	g.chr11:46408006G>A	M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.102C>T	11.37:g.46408006G>A			Somatic					p.F34F	NM_000741	NP_000732	WXS	Illumina HiSeq	Unspecified	P08173	ACM4_HUMAN		GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	1	102	-			34			Helical; Name=1; (By similarity).		B2RPP4|Q0VD60|Q4VBK7	Silent	SNP	ENST00000433765.2	37	c.102C>T	CCDS44581.1																																																																																				0.557	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334985.1	NM_000741		12	75	0	0	0	0.00245	0	12	75				
OR5L1	219437	broad.mit.edu	37	11	55579763	55579763	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:55579763C>A	ENST00000333973.2	+	1	910	c.821C>A	c.(820-822)gCc>gAc	p.A274D		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				GACAAAGTGGCCACCGTGTTC	0.473																																							uc001nhw.1		NA																	0				skin(3)|ovary(2)	5						c.(820-822)GCC>GAC		olfactory receptor, family 5, subfamily L,							85.0	76.0	79.0					11																	55579763		2200	4296	6496	SO:0001583	missense	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579763C>A	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.821C>A	11.37:g.55579763C>A	ENSP00000335529:p.Ala274Asp		Somatic					p.A274D	NM_001004738	NP_001004738	WXS	Illumina HiSeq	Unspecified	Q8NGL2	OR5L1_HUMAN			1	821	+		all_epithelial(135;0.208)	274			Helical; Name=7; (Potential).		B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	c.821C>A	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	c	17.87	3.494484	0.64186	.	.	ENSG00000186117	ENST00000333973	T	0.38887	1.11	4.12	4.12	0.48240	GPCR, rhodopsin-like superfamily (1);	0.124077	0.36778	N	0.002418	T	0.62368	0.2422	M	0.88105	2.93	0.09310	N	1	D	0.60575	0.988	P	0.62649	0.905	T	0.58177	-0.7682	10	0.72032	D	0.01	-15.6275	6.6599	0.23009	0.0:0.7928:0.0:0.2072	.	274	Q8NGL2	OR5L1_HUMAN	D	274	ENSP00000335529:A274D	ENSP00000335529:A274D	A	+	2	0	OR5L1	55336339	0.000000	0.05858	0.014000	0.15608	0.474000	0.32979	-0.128000	0.10531	1.875000	0.54330	0.428000	0.28381	GCC		0.473	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		23	36	1	0	3.85864e-22	0.00278	6.72965e-22	23	36				
OR5F1	338674	broad.mit.edu	37	11	55761239	55761239	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:55761239A>G	ENST00000278409.1	-	1	862	c.863T>C	c.(862-864)cTg>cCg	p.L288P		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	288					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GCTGTAGATCAGAGGATTCAA	0.428																																							uc010riv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(862-864)CTG>CCG		olfactory receptor, family 5, subfamily F,							73.0	73.0	73.0					11																	55761239		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761239A>G	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.863T>C	11.37:g.55761239A>G	ENSP00000278409:p.Leu288Pro		Somatic					p.L288P	NM_003697	NP_003688	WXS	Illumina HiSeq	Unspecified	O95221	OR5F1_HUMAN			1	863	-	Esophageal squamous(21;0.00448)		288			Helical; Name=7; (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.863T>C	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	A	13.61	2.287488	0.40494	.	.	ENSG00000149133	ENST00000278409	T	0.46451	0.87	2.99	2.99	0.34606	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.57504	0.2058	M	0.79475	2.455	0.49915	D	0.999838	D	0.67145	0.996	P	0.59056	0.851	T	0.62699	-0.6799	9	0.87932	D	0	.	10.2628	0.43436	1.0:0.0:0.0:0.0	.	288	O95221	OR5F1_HUMAN	P	288	ENSP00000278409:L288P	ENSP00000278409:L288P	L	-	2	0	OR5F1	55517815	0.926000	0.31397	0.981000	0.43875	0.316000	0.28119	5.236000	0.65354	1.163000	0.42636	0.241000	0.17934	CTG		0.428	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		9	39	0	0	0	0.00333	0	9	39				
OR8K3	219473	broad.mit.edu	37	11	56086160	56086160	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:56086160C>G	ENST00000312711.1	+	1	378	c.378C>G	c.(376-378)atC>atG	p.I126M		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					ATGTGGCCATCTGTAACCCTC	0.413																																							uc010rjf.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(376-378)ATC>ATG		olfactory receptor, family 8, subfamily K,							121.0	113.0	116.0					11																	56086160		2201	4296	6497	SO:0001583	missense	219473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56086160C>G	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.378C>G	11.37:g.56086160C>G	ENSP00000323555:p.Ile126Met		Somatic					p.I126M	NM_001005202	NP_001005202	WXS	Illumina HiSeq	Unspecified	Q8NH51	OR8K3_HUMAN			1	378	+	Esophageal squamous(21;0.00448)		126			Cytoplasmic (Potential).		Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	c.378C>G	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.124477	0.37533	.	.	ENSG00000181689	ENST00000312711	T	0.59083	0.29	4.56	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.82245	0.4995	H	0.98446	4.235	0.33203	D	0.55241	D	0.63880	0.993	P	0.55713	0.782	D	0.91836	0.5479	10	0.87932	D	0	.	16.8563	0.86007	0.0:1.0:0.0:0.0	.	126	Q8NH51	OR8K3_HUMAN	M	126	ENSP00000323555:I126M	ENSP00000323555:I126M	I	+	3	3	OR8K3	55842736	0.974000	0.33945	1.000000	0.80357	0.123000	0.20343	0.057000	0.14279	2.518000	0.84900	0.573000	0.79308	ATC		0.413	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202		32	64	0	0	0	0.003271	0	32	64				
OR8J1	219477	broad.mit.edu	37	11	56127775	56127775	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:56127775C>G	ENST00000303039.3	+	1	85	c.53C>G	c.(52-54)tCt>tGt	p.S18C		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S18F(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					ACAGGTGTCTCTAGCTGTCCA	0.478																																							uc010rjh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(52-54)TCT>TGT		olfactory receptor, family 8, subfamily J,							90.0	91.0	91.0					11																	56127775		2201	4296	6497	SO:0001583	missense	219477				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56127775C>G	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.53C>G	11.37:g.56127775C>G	ENSP00000304060:p.Ser18Cys		Somatic					p.S18C	NM_001005205	NP_001005205	WXS	Illumina HiSeq	Unspecified	Q8NGP2	OR8J1_HUMAN			1	53	+	Esophageal squamous(21;0.00448)		18			Extracellular (Potential).		B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	37	c.53C>G	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	C	8.954	0.968923	0.18659	.	.	ENSG00000172487	ENST00000303039	T	0.00015	9.17	4.68	3.77	0.43336	.	0.000000	0.51477	D	0.000087	T	0.00271	0.0008	M	0.81239	2.535	0.09310	N	0.999991	D	0.71674	0.998	D	0.64687	0.928	T	0.27606	-1.0069	10	0.87932	D	0	.	8.071	0.30689	0.0:0.7539:0.1586:0.0875	.	18	Q8NGP2	OR8J1_HUMAN	C	18	ENSP00000304060:S18C	ENSP00000304060:S18C	S	+	2	0	OR8J1	55884351	0.001000	0.12720	0.473000	0.27253	0.024000	0.10985	1.448000	0.35112	1.110000	0.41699	-0.134000	0.14843	TCT		0.478	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205		29	47	0	0	0	0.013726	0	29	47				
OR5B12	390191	broad.mit.edu	37	11	58207410	58207410	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:58207410G>A	ENST00000302572.2	-	1	236	c.215C>T	c.(214-216)tCc>tTc	p.S72F		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GACAGCTGAGGAATAACCAAA	0.458																																							uc010rkh.1		NA																	0					0						c.(214-216)TCC>TTC		olfactory receptor, family 5, subfamily B,							60.0	59.0	59.0					11																	58207410		2201	4295	6496	SO:0001583	missense	390191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58207410G>A	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.215C>T	11.37:g.58207410G>A	ENSP00000306657:p.Ser72Phe		Somatic					p.S72F	NM_001004733	NP_001004733	WXS	Illumina HiSeq	Unspecified	Q96R08	OR5BC_HUMAN			1	215	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	72			Helical; Name=2; (Potential).		B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	c.215C>T	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876175	0.51801	.	.	ENSG00000172362	ENST00000302572	T	0.00840	5.63	4.75	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000131	T	0.10680	0.0261	H	0.98295	4.195	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.27606	-1.0069	10	0.87932	D	0	-10.855	12.7538	0.57323	0.0831:0.0:0.9169:0.0	.	72	Q96R08	OR5BC_HUMAN	F	72	ENSP00000306657:S72F	ENSP00000306657:S72F	S	-	2	0	OR5B12	57963986	0.169000	0.23002	0.954000	0.39281	0.677000	0.39632	2.918000	0.48829	2.623000	0.88846	0.563000	0.77884	TCC		0.458	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733		12	27	0	0	0	0.00245	0	12	27				
GIF	2694	broad.mit.edu	37	11	59599163	59599163	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:59599163G>T	ENST00000257248.2	-	8	1227	c.1180C>A	c.(1180-1182)Cct>Act	p.P394T	GIF_ENST00000541311.1_Missense_Mutation_p.P369T	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	394	Cobalamin binding.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	TCATTCAAAGGTGTTACACCA	0.358																																					NSCLC(53;1139 1245 16872 38474 42853)	NSCLC(53;1139 1245 16872 38474 42853)	uc001noi.2		NA																	0				ovary(1)|liver(1)	2						c.(1180-1182)CCT>ACT		gastric intrinsic factor (vitamin B synthesis)							118.0	108.0	111.0					11																	59599163		2201	4295	6496	SO:0001583	missense	2694				cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding	g.chr11:59599163G>T	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.1180C>A	11.37:g.59599163G>T	ENSP00000257248:p.Pro394Thr		Somatic					p.P394T	NM_005142	NP_005133	WXS	Illumina HiSeq	Unspecified	P27352	IF_HUMAN			8	1228	-			394			Cobalamin binding.		B2RAN8|B4DVZ1	Missense_Mutation	SNP	ENST00000257248.2	37	c.1180C>A	CCDS7977.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.918212	0.52546	.	.	ENSG00000134812	ENST00000257248;ENST00000541311	T;T	0.44083	1.02;0.93	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000010	T	0.44664	0.1304	M	0.78456	2.415	0.48452	D	0.999656	P	0.40144	0.704	B	0.34242	0.178	T	0.54702	-0.8254	10	0.72032	D	0.01	-14.1983	14.7112	0.69232	0.0:0.0:1.0:0.0	.	394	P27352	IF_HUMAN	T	394;369	ENSP00000257248:P394T;ENSP00000440427:P369T	ENSP00000257248:P394T	P	-	1	0	GIF	59355739	1.000000	0.71417	0.992000	0.48379	0.960000	0.62799	4.916000	0.63362	2.532000	0.85374	0.655000	0.94253	CCT		0.358	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	NM_005142		31	66	1	0	9.39024e-22	0.009718	1.62801e-21	31	66				
MS4A14	84689	broad.mit.edu	37	11	60182930	60182930	+	Silent	SNP	G	G	T	rs371774895		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:60182930G>T	ENST00000300187.6	+	5	766	c.489G>T	c.(487-489)tcG>tcT	p.S163S	MS4A14_ENST00000531783.1_Silent_p.S196S|MS4A14_ENST00000531787.1_Silent_p.S51S|MS4A14_ENST00000395001.1_3'UTR|MS4A14_ENST00000395005.2_Silent_p.S146S	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	163						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						TCTTGCCTTCGGATGTTACTC	0.328																																							uc001npj.2		NA																	0				breast(1)	1						c.(487-489)TCG>TCT		membrane-spanning 4-domains, subfamily A, member							97.0	96.0	96.0					11																	60182930		2202	4299	6501	SO:0001819	synonymous_variant	84689					integral to membrane	receptor activity	g.chr11:60182930G>T	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.489G>T	11.37:g.60182930G>T			Somatic				MS4A14_uc001npi.2_Silent_p.S51S|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Silent_p.S146S|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	p.S163S	NM_032597	NP_115986	WXS	Illumina HiSeq	Unspecified	Q96JA4	M4A14_HUMAN			5	1054	+			163					E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Silent	SNP	ENST00000300187.6	37	c.489G>T	CCDS31569.1																																																																																				0.328	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2			19	36	1	0	2.89027e-11	0.014323	4.28784e-11	19	36				
MS4A1	931	broad.mit.edu	37	11	60233393	60233393	+	Splice_Site	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:60233393G>T	ENST00000534668.1	+	5	625		c.e5-1		MS4A1_ENST00000345732.4_Splice_Site|MS4A1_ENST00000528313.1_Intron|MS4A1_ENST00000532073.1_Splice_Site|MS4A1_ENST00000389939.2_Splice_Site	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1						B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	CTCCATTTCAGGTCAAAGGAA	0.353																																							uc001npp.2		NA																	0				ovary(3)|lung(2)	5						c.e6-1		membrane-spanning 4-domains, subfamily A, member	Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)						53.0	57.0	56.0					11																	60233393		2203	4300	6503	SO:0001630	splice_region_variant	931				B cell activation|immune response	integral to plasma membrane		g.chr11:60233393G>T	M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.337-1G>T	11.37:g.60233393G>T			Somatic				MS4A1_uc001npq.2_Splice_Site_p.V113_splice|MS4A1_uc009yna.2_Splice_Site_p.V113_splice|MS4A1_uc009ymz.2_Splice_Site_p.V113_splice|MS4A1_uc010rlc.1_Intron	p.V113_splice	NM_152866	NP_690605	WXS	Illumina HiSeq	Unspecified	P11836	CD20_HUMAN			6	753	+								A6NMS4|B4DT24|P08984|Q13963	Splice_Site	SNP	ENST00000534668.1	37	c.337_splice	CCDS31570.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.376047	0.61735	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000533306;ENST00000389939	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1509	0.72696	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MS4A1	59989969	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.431000	0.59915	2.721000	0.93114	0.655000	0.94253	.		0.353	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1		Intron	8	37	1	0	1.12685e-05	0.004482	1.35871e-05	8	37				
SCGB1D4	404552	broad.mit.edu	37	11	62065061	62065061	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:62065061A>G	ENST00000358585.1	-	2	178	c.125T>C	c.(124-126)gTa>gCa	p.V42A		NM_206998.1	NP_996881.1	Q6XE38	SG1D4_HUMAN	secretoglobin, family 1D, member 4	42						extracellular region (GO:0005576)				lung(1)|prostate(1)	2						TTGGAGGTTTACCGCAGCGTC	0.443																																							uc001ntd.1		NA																	0					0						c.(124-126)GTA>GCA		secretoglobin family 1D member 4 precursor							144.0	149.0	147.0					11																	62065061		2202	4299	6501	SO:0001583	missense	404552					extracellular region	binding	g.chr11:62065061A>G	AY236538	CCDS31583.1	11q12.3	2011-12-14			ENSG00000197745	ENSG00000197745		"""Secretoglobins"""	31748	protein-coding gene	gene with protein product		615062				15034037, 15340161, 22155607	Standard	NM_206998		Approved	IIS	uc001ntd.1	Q6XE38	OTTHUMG00000167510	ENST00000358585.1:c.125T>C	11.37:g.62065061A>G	ENSP00000351395:p.Val42Ala		Somatic					p.V42A	NM_206998	NP_996881	WXS	Illumina HiSeq	Unspecified	Q6XE38	SG1D4_HUMAN			2	179	-			42					A1L4Q8	Missense_Mutation	SNP	ENST00000358585.1	37	c.125T>C	CCDS31583.1	.	.	.	.	.	.	.	.	.	.	A	8.114	0.779404	0.16120	.	.	ENSG00000197745	ENST00000358585	T	0.13538	2.58	1.64	-2.9	0.05648	.	1.504550	0.04833	N	0.439061	T	0.09379	0.0231	.	.	.	0.09310	N	1	B	0.22414	0.069	B	0.19666	0.026	T	0.38824	-0.9643	9	0.52906	T	0.07	.	4.8764	0.13658	0.4007:0.0:0.0:0.5993	.	42	Q6XE38	SG1D4_HUMAN	A	42	ENSP00000351395:V42A	ENSP00000351395:V42A	V	-	2	0	SCGB1D4	61821637	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.602000	0.05680	-0.546000	0.06216	0.386000	0.25728	GTA		0.443	SCGB1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394862.1	NM_206998		11	103	0	0	0	0.001855	0	11	103				
CHRM1	1128	broad.mit.edu	37	11	62678015	62678015	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:62678015G>T	ENST00000306960.3	-	2	1099	c.558C>A	c.(556-558)ccC>ccA	p.P186P	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	186					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	AGGTGATGATGGGCTGGGAGA	0.597																																							uc001nwi.2		NA																	0					0						c.(556-558)CCC>CCA		cholinergic receptor, muscarinic 1	Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Benztropine(DB00245)|Bethanechol(DB01019)|Biperiden(DB00810)|Buclizine(DB00354)|Carbachol(DB00411)|Carbinoxamine(DB00748)|Cevimeline(DB00185)|Clidinium(DB00771)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Doxylamine(DB00366)|Ethopropazine(DB00392)|Flavoxate(DB01148)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quinacrine(DB01103)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trospium(DB00209)						100.0	73.0	82.0					11																	62678015		2201	4298	6499	SO:0001819	synonymous_variant	1128				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell proliferation|nervous system development|positive regulation of cell proliferation|protein modification process	cell junction|integral to plasma membrane|membrane fraction|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity|protein binding	g.chr11:62678015G>T	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.558C>A	11.37:g.62678015G>T			Somatic					p.P186P	NM_000738	NP_000729	WXS	Illumina HiSeq	Unspecified	P11229	ACM1_HUMAN			2	959	-			186			Extracellular (Potential).		Q96RH1	Silent	SNP	ENST00000306960.3	37	c.558C>A	CCDS8040.1																																																																																				0.597	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738		7	54	1	0	5.18039e-06	0.00308	6.29815e-06	7	54				
SLC22A24	283238	broad.mit.edu	37	11	62911077	62911077	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:62911077C>G	ENST00000417740.1	-	1	616	c.175G>C	c.(175-177)Gtg>Ctg	p.V59L	SLC22A10_ENST00000525620.1_Intron|SLC22A24_ENST00000326192.5_Missense_Mutation_p.V59L	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	59					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						TTGTCAGACACAGTGTCATTG	0.512																																							uc009yop.2		NA																	0					0						c.(175-177)GTG>CTG		solute carrier family 22, member 24							113.0	112.0	112.0					11																	62911077		692	1591	2283	SO:0001583	missense	283238							g.chr11:62911077C>G		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.175G>C	11.37:g.62911077C>G	ENSP00000396586:p.Val59Leu		Somatic					p.V59L	NM_001136506	NP_001129978	WXS	Illumina HiSeq	Unspecified					1	617	-									Missense_Mutation	SNP	ENST00000417740.1	37	c.175G>C		.	.	.	.	.	.	.	.	.	.	C	7.051	0.564465	0.13498	.	.	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	T;T	0.35605	1.3;1.3	2.29	1.35	0.21983	.	1.887240	0.02912	U	0.136768	T	0.28863	0.0716	L	0.43598	1.365	0.09310	N	1	B	0.32731	0.382	B	0.28553	0.091	T	0.13442	-1.0509	10	0.28530	T	0.3	.	4.5004	0.11862	0.0:0.6613:0.0:0.3387	.	59	C9JC66	.	L	59	ENSP00000396586:V59L;ENSP00000321549:V59L	ENSP00000321549:V59L	V	-	1	0	SLC22A24	62667653	0.000000	0.05858	0.260000	0.24451	0.738000	0.42128	-0.399000	0.07250	0.320000	0.23234	0.383000	0.25322	GTG		0.512	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000383747.1	NM_173586		11	17	0	0	0	0.010729	0	11	17				
NRXN2	9379	broad.mit.edu	37	11	64374729	64374729	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:64374729G>A	ENST00000377551.1	-	22	5289	c.5078C>T	c.(5077-5079)cCg>cTg	p.P1693L	NRXN2_ENST00000377559.3_Missense_Mutation_p.P1623L|NRXN2_ENST00000409571.1_Missense_Mutation_p.P1686L|NRXN2_ENST00000265459.6_Missense_Mutation_p.P1693L|NRXN2_ENST00000301894.2_Missense_Mutation_p.P647L			Q9P2S2	NRX2A_HUMAN	neurexin 2	1693					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GGGGGCAGCCGGGGCCTTCTC	0.607																																							uc001oap.2		NA																	0				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						c.(1939-1941)CCG>CTG		neurexin 2 isoform beta precursor							41.0	46.0	44.0					11																	64374729		2201	4297	6498	SO:0001583	missense	9379				cell adhesion	integral to membrane		g.chr11:64374729G>A		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.5078C>T	11.37:g.64374729G>A	ENSP00000366774:p.Pro1693Leu		Somatic				NRXN2_uc001oar.2_Missense_Mutation_p.P1693L|NRXN2_uc001oas.2_Missense_Mutation_p.P1623L|NRXN2_uc001oao.2_Missense_Mutation_p.P333L|NRXN2_uc001oaq.2_Missense_Mutation_p.P1360L	p.P647L	NM_138734	NP_620063	WXS	Illumina HiSeq	Unspecified	P58401	NRX2B_HUMAN			8	2451	-			647			Cytoplasmic (Potential).		A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	c.1940C>T	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290154	0.23478	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T;T	0.61742	0.56;0.08;0.11;0.08;0.18	4.46	2.5	0.30297	.	0.130592	0.27134	U	0.020766	T	0.46014	0.1371	L	0.59436	1.845	0.42411	D	0.992605	P;P;P;D	0.57571	0.923;0.898;0.776;0.98	B;B;B;B	0.40375	0.294;0.174;0.154;0.327	T	0.38373	-0.9664	10	0.30854	T	0.27	.	6.2367	0.20766	0.102:0.0:0.7108:0.1872	.	1623;1693;1439;647	Q9P2S2-2;Q9P2S2;E7EV67;P58401	.;NRX2A_HUMAN;.;NRX2B_HUMAN	L	647;1693;1623;1693;1623;1686	ENSP00000301894:P647L;ENSP00000366774:P1693L;ENSP00000366782:P1623L;ENSP00000265459:P1693L;ENSP00000386416:P1686L	ENSP00000265459:P1693L	P	-	2	0	NRXN2	64131305	0.998000	0.40836	0.946000	0.38457	0.612000	0.37316	2.697000	0.47060	0.824000	0.34613	0.313000	0.20887	CCG		0.607	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		8	24	0	0	0	0.006214	0	8	24				
TPCN2	219931	broad.mit.edu	37	11	68853220	68853220	+	Splice_Site	SNP	G	G	A	rs148607240	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:68853220G>A	ENST00000294309.3	+	21	2021	c.1920G>A	c.(1918-1920)gcG>gcA	p.A640A	TPCN2_ENST00000442692.2_3'UTR|TPCN2_ENST00000542467.1_Intron|MIR3164_ENST00000581178.1_RNA	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	640					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATGACTTTGCGGTGAGCCCTG	0.687																																							uc001oos.2		NA																	0					0						c.(1918-1920)GCG>GCA		two pore segment channel 2							88.0	91.0	90.0					11																	68853220		2200	4294	6494	SO:0001630	splice_region_variant	219931				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity	g.chr11:68853220G>A	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.1920+1G>A	11.37:g.68853220G>A			Somatic				TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_RNA	p.A640A	NM_139075	NP_620714	WXS	Illumina HiSeq	Unspecified	Q8NHX9	TPC2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		21	2036	+			640					Q9NT82	Silent	SNP	ENST00000294309.3	37	c.1920G>A	CCDS8189.1																																																																																				0.687	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	Silent	18	65	0	0	0	0.012319	0	18	65				
ANKRD42	338699	broad.mit.edu	37	11	82921358	82921358	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:82921358G>T	ENST00000393392.2	+	4	425	c.263G>T	c.(262-264)gGa>gTa	p.G88V	RP11-727A23.7_ENST00000531869.1_RNA|ANKRD42_ENST00000526731.1_Missense_Mutation_p.G116V|ANKRD42_ENST00000528722.1_Missense_Mutation_p.G3V|ANKRD42_ENST00000260047.6_Missense_Mutation_p.G116V|ANKRD42_ENST00000393389.3_Missense_Mutation_p.G116V|ANKRD42_ENST00000533342.1_Missense_Mutation_p.G116V|ANKRD42_ENST00000531895.1_Missense_Mutation_p.G116V	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	88					positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						ATAATGAATGGAGCAAATCTG	0.388																																							uc001ozz.1		NA																	0				skin(1)	1						c.(262-264)GGA>GTA		ankyrin repeat domain 42							105.0	106.0	105.0					11																	82921358		2203	4300	6503	SO:0001583	missense	338699							g.chr11:82921358G>T	AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.263G>T	11.37:g.82921358G>T	ENSP00000377051:p.Gly88Val		Somatic				ANKRD42_uc009yvi.1_Missense_Mutation_p.G116V|ANKRD42_uc010rsv.1_Missense_Mutation_p.G116V|ANKRD42_uc001paa.2_Missense_Mutation_p.G116V|ANKRD42_uc001pab.1_Missense_Mutation_p.G116V	p.G88V	NM_182603	NP_872409	WXS	Illumina HiSeq	Unspecified	Q8N9B4	ANR42_HUMAN			4	685	+			88			ANK 2.		Q49A49	Missense_Mutation	SNP	ENST00000393392.2	37	c.263G>T	CCDS8265.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365893	0.82463	.	.	ENSG00000137494	ENST00000545672;ENST00000393389;ENST00000528722;ENST00000260047;ENST00000526731;ENST00000531895;ENST00000393392;ENST00000533342	T;D;T;T;T;T;T	0.86865	-0.72;-2.18;-0.72;-0.72;-0.72;-0.72;-0.72	5.89	5.89	0.94794	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000006	D	0.96144	0.8743	H	0.96777	3.88	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97028	0.9748	9	.	.	.	-8.9873	19.0291	0.92948	0.0:0.0:1.0:0.0	.	116;116;381;207;88	E9PIL2;Q8N9B4-2;A1DRY3;A1XPJ0;Q8N9B4	.;.;.;.;ANR42_HUMAN	V	435;116;3;116;116;116;88;116	ENSP00000377049:G116V;ENSP00000432375:G3V;ENSP00000260047:G116V;ENSP00000433585:G116V;ENSP00000434666:G116V;ENSP00000377051:G88V;ENSP00000435790:G116V	.	G	+	2	0	ANKRD42	82599006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.449000	0.73473	2.783000	0.95769	0.655000	0.94253	GGA		0.388	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000392934.1	NM_182603		19	46	1	0	6.44725e-10	0.014323	9.28278e-10	19	46				
GRM5	2915	broad.mit.edu	37	11	88323889	88323889	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:88323889G>T	ENST00000305447.4	-	6	1719	c.1570C>A	c.(1570-1572)Cga>Aga	p.R524R	GRM5_ENST00000393297.1_Silent_p.R524R|GRM5_ENST00000455756.2_Silent_p.R524R|GRM5_ENST00000418177.2_Silent_p.R524R|GRM5_ENST00000305432.5_Silent_p.R524R	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	524					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	TCTCCCTTTCGGATCACCTAA	0.388																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(1570-1572)CGA>AGA		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						108.0	93.0	98.0					11																	88323889		2201	4299	6500	SO:0001819	synonymous_variant	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88323889G>T	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1570C>A	11.37:g.88323889G>T			Somatic				GRM5_uc009yvm.2_Silent_p.R524R	p.R524R	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			6	1770	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	524			Extracellular (Potential).		Q6J164	Silent	SNP	ENST00000305447.4	37	c.1570C>A	CCDS44694.1																																																																																				0.388	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		21	59	1	0	9.86323e-18	0.003954	1.64668e-17	21	59				
FAT3	120114	broad.mit.edu	37	11	92087123	92087123	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:92087123C>T	ENST00000298047.6	+	1	1862	c.1845C>T	c.(1843-1845)atC>atT	p.I615I	FAT3_ENST00000525166.1_Silent_p.I465I|FAT3_ENST00000409404.2_Silent_p.I615I|FAT3_ENST00000541502.1_Silent_p.I615I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	615	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTACAAAATCATTTCTGGAA	0.363										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(1843-1845)ATC>ATT		FAT tumor suppressor homolog 3							40.0	41.0	41.0					11																	92087123		1846	4086	5932	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92087123C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1845C>T	11.37:g.92087123C>T		TCGA Ovarian(4;0.039)	Somatic					p.I615I	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			1	1862	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	615			Cadherin 6.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.1845C>T																																																																																					0.363	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		6	10	0	0	0	0.00308	0	6	10				
MTNR1B	4544	broad.mit.edu	37	11	92715180	92715180	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:92715180G>A	ENST00000257068.2	+	2	797	c.791G>A	c.(790-792)tGg>tAg	p.W264*		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	264					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	GCCATCTGCTGGGCTCCACTT	0.552																																							uc001pdk.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(790-792)TGG>TAG		melatonin receptor 1B	Ramelteon(DB00980)						165.0	141.0	149.0					11																	92715180		2201	4298	6499	SO:0001587	stop_gained	4544				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity	g.chr11:92715180G>A	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.791G>A	11.37:g.92715180G>A	ENSP00000257068:p.Trp264*		Somatic					p.W264*	NM_005959	NP_005950	WXS	Illumina HiSeq	Unspecified	P49286	MTR1B_HUMAN			2	894	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	264			Helical; Name=6; (Potential).			Nonsense_Mutation	SNP	ENST00000257068.2	37	c.791G>A	CCDS8290.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146807	0.77888	.	.	ENSG00000134640	ENST00000257068	.	.	.	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8848	16.6739	0.85273	0.0:0.0:1.0:0.0	.	.	.	.	X	264	.	ENSP00000257068:W264X	W	+	2	0	MTNR1B	92354828	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	8.837000	0.92110	2.226000	0.72624	0.491000	0.48974	TGG		0.552	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1			39	67	0	0	0	0.01441	0	39	67				
PDGFD	80310	broad.mit.edu	37	11	104034583	104034583	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:104034583G>T	ENST00000393158.2	-	1	252	c.73C>A	c.(73-75)Ccg>Acg	p.P25T	PDGFD_ENST00000302251.5_Missense_Mutation_p.P25T			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	25					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		GCGCTCTGCGGGGTTGCAGAA	0.468											OREG0021315	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001phq.2		NA																	0				upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(73-75)CCG>ACG		platelet derived growth factor D isoform 1							65.0	67.0	66.0					11																	104034583		2202	4299	6501	SO:0001583	missense	80310				positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity	g.chr11:104034583G>T	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.73C>A	11.37:g.104034583G>T	ENSP00000376865:p.Pro25Thr		Somatic	OREG0021315	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1378	PDGFD_uc001php.2_Missense_Mutation_p.P25T	p.P25T	NM_025208	NP_079484	WXS	Illumina HiSeq	Unspecified	Q9GZP0	PDGFD_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)	1	445	-		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)	25					A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	c.73C>A	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	G	7.399	0.632452	0.14322	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.25579	1.79;1.85	5.27	3.36	0.38483	.	0.345212	0.25068	N	0.033386	T	0.16428	0.0395	L	0.27053	0.805	0.26090	N	0.980967	B;B	0.18741	0.018;0.03	B;B	0.21917	0.016;0.037	T	0.20174	-1.0283	10	0.28530	T	0.3	-2.1219	7.8109	0.29230	0.085:0.3076:0.6074:0.0	.	25;25	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	T	25	ENSP00000376865:P25T;ENSP00000302193:P25T	ENSP00000302193:P25T	P	-	1	0	PDGFD	103539793	0.972000	0.33761	0.532000	0.27989	0.077000	0.17291	1.774000	0.38573	0.574000	0.29417	0.650000	0.86243	CCG		0.468	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208		23	29	1	0	2.61193e-14	0.009535	4.12559e-14	23	29				
SCN2B	6327	broad.mit.edu	37	11	118037795	118037795	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:118037795G>T	ENST00000278947.5	-	4	696	c.455C>A	c.(454-456)cCt>cAt	p.P152H		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	152	Ig-like C2-type.				cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCCCGCTCAGGGGGCTCTGG	0.632																																							uc001psf.2		NA																	0					0						c.(454-456)CCT>CAT		sodium channel, voltage-gated, type II, beta							49.0	53.0	52.0					11																	118037795		2200	4296	6496	SO:0001583	missense	6327				synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr11:118037795G>T	AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.455C>A	11.37:g.118037795G>T	ENSP00000278947:p.Pro152His		Somatic					p.P152H	NM_004588	NP_004579	WXS	Illumina HiSeq	Unspecified	O60939	SCN2B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	4	646	-	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)	152			Ig-like C2-type.|Extracellular (Potential).		O75302|Q9UNN3	Missense_Mutation	SNP	ENST00000278947.5	37	c.455C>A	CCDS8390.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629786	0.87660	.	.	ENSG00000149575	ENST00000278947	D	0.97731	-4.51	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.98245	0.9419	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.98459	1.0595	10	0.46703	T	0.11	-18.7896	18.1626	0.89714	0.0:0.0:1.0:0.0	.	152	O60939	SCN2B_HUMAN	H	152	ENSP00000278947:P152H	ENSP00000278947:P152H	P	-	2	0	SCN2B	117543005	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	8.206000	0.89745	2.640000	0.89533	0.655000	0.94253	CCT		0.632	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588		17	13	1	0	2.89027e-11	0.014323	4.28784e-11	17	13				
TTC36	143941	broad.mit.edu	37	11	118399492	118399492	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:118399492A>G	ENST00000302783.4	+	2	316	c.293A>G	c.(292-294)cAg>cGg	p.Q98R	TMEM25_ENST00000359862.4_5'Flank|TMEM25_ENST00000313236.5_5'Flank|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000525992.2_RNA|TTC36_ENST00000539546.1_Missense_Mutation_p.Q39R|TMEM25_ENST00000544878.1_5'Flank|TMEM25_ENST00000354064.7_5'Flank|RP11-770J1.3_ENST00000554407.1_RNA|TMEM25_ENST00000533102.1_5'Flank|RP11-770J1.3_ENST00000556583.1_RNA|TMEM25_ENST00000524725.1_5'Flank|TMEM25_ENST00000354284.4_5'Flank|TMEM25_ENST00000411589.2_5'Flank|RP11-770J1.3_ENST00000528578.1_RNA|TMEM25_ENST00000442938.2_5'Flank	NM_001080441.1	NP_001073910.1	A6NLP5	TTC36_HUMAN	tetratricopeptide repeat domain 36	98										lung(2)	2						CGGCGACTCCAGGGAGACGTG	0.647																																							uc001ptg.1		NA																	0					0						c.(292-294)CAG>CGG		tetratricopeptide repeat domain 36							32.0	33.0	32.0					11																	118399492		2200	4295	6495	SO:0001583	missense	143941						binding	g.chr11:118399492A>G	EU489483	CCDS31687.1	11q23.3	2013-01-10			ENSG00000172425	ENSG00000172425		"""Tetratricopeptide (TTC) repeat domain containing"""	33708	protein-coding gene	gene with protein product	"""HSP70 binding protein 21"""						Standard	NM_001080441		Approved	HBP21	uc001ptg.1	A6NLP5	OTTHUMG00000166338	ENST00000302783.4:c.293A>G	11.37:g.118399492A>G	ENSP00000307640:p.Gln98Arg		Somatic				TTC36_uc010ryb.1_RNA|TTC36_uc010ryc.1_Missense_Mutation_p.Q39R|TMEM25_uc010ryd.1_5'Flank|TMEM25_uc001ptk.3_5'Flank|TMEM25_uc010rye.1_5'Flank|TMEM25_uc001pth.2_5'Flank|TMEM25_uc009zad.2_5'Flank|TMEM25_uc001pti.2_5'Flank|TMEM25_uc010ryf.1_5'Flank|TMEM25_uc001ptl.2_5'Flank|TMEM25_uc001ptm.2_5'Flank|TMEM25_uc001ptn.2_5'Flank	p.Q98R	NM_001080441	NP_001073910	WXS	Illumina HiSeq	Unspecified	A6NLP5	TTC36_HUMAN			2	293	+			98			TPR 2.		B7ZW72|B9EJD8	Missense_Mutation	SNP	ENST00000302783.4	37	c.293A>G	CCDS31687.1	.	.	.	.	.	.	.	.	.	.	A	5.230	0.227951	0.09916	.	.	ENSG00000172425	ENST00000302783;ENST00000539546	T;T	0.58652	0.32;0.32	5.27	1.72	0.24424	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.234553	0.43919	D	0.000502	T	0.43700	0.1259	L	0.52206	1.635	0.36872	D	0.888938	B	0.06786	0.001	B	0.09377	0.004	T	0.34079	-0.9843	10	0.09590	T	0.72	-5.4806	8.8144	0.34987	0.6973:0.0:0.3027:0.0	.	98	A6NLP5	TTC36_HUMAN	R	98;39	ENSP00000307640:Q98R;ENSP00000442513:Q39R	ENSP00000307640:Q98R	Q	+	2	0	TTC36	117904702	0.996000	0.38824	0.843000	0.33291	0.988000	0.76386	1.674000	0.37544	0.327000	0.23409	0.459000	0.35465	CAG		0.647	TTC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389241.2	NM_001080441		3	48	0	0	0	0.009096	0	3	48				
CBL	867	broad.mit.edu	37	11	119148982	119148982	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:119148982G>T	ENST00000264033.4	+	8	1578	c.1202G>T	c.(1201-1203)tGc>tTc	p.C401F		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	401	Asp/Glu-rich (acidic).				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E366_Q409del(13)|p.C401Y(2)|p.E366_K477del(1)|p.C401S(1)|p.G397_I429del(1)|p.E369_Q409del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CACCTCATGTGCACATCCTGT	0.388			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																														uc001pwe.2		NA		"""Dom, Rec"""	yes		11	11q23.3	867		Cas-Br-M (murine) ecotropic retroviral transforming			L					19	Deletion - In frame(16)|Substitution - Missense(3)	p.E366_Q409del(13)|p.G397_I429del(1)|p.C401Y(1)|p.C401S(1)|p.E366_K477del(1)	haematopoietic_and_lymphoid_tissue(19)	haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149						c.(1201-1203)TGC>TTC		Cas-Br-M (murine) ecotropic retroviral							133.0	123.0	127.0					11																	119148982		2199	4295	6494	SO:0001583	missense	867	CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:119148982G>T	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1202G>T	11.37:g.119148982G>T	ENSP00000264033:p.Cys401Phe		Somatic					p.C401F	NM_005188	NP_005179	WXS	Illumina HiSeq	Unspecified	P22681	CBL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)	8	1340	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	401			Asp/Glu-rich (acidic).|RING-type.		A3KMP8	Missense_Mutation	SNP	ENST00000264033.4	37	c.1202G>T	CCDS8418.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645780	0.67358	.	.	ENSG00000110395	ENST00000264033	D	0.98135	-4.74	5.52	5.52	0.82312	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.99462	0.9809	H	0.99659	4.685	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97902	1.0303	10	0.87932	D	0	-20.4653	19.8212	0.96595	0.0:0.0:1.0:0.0	.	401	P22681	CBL_HUMAN	F	401	ENSP00000264033:C401F	ENSP00000264033:C401F	C	+	2	0	CBL	118654192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.759000	0.94783	0.557000	0.71058	TGC		0.388	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188		39	61	1	0	2.52991e-16	0.01441	4.11813e-16	39	61				
USP2	9099	broad.mit.edu	37	11	119243549	119243549	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:119243549C>A	ENST00000260187.2	-	2	936	c.642G>T	c.(640-642)caG>caT	p.Q214H	RP11-334E6.3_ENST00000530918.2_RNA|USP2_ENST00000455332.2_Intron	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	214					cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		AGGGAGGGGCCTGGGAGGGCA	0.632																																							uc001pwm.3		NA																	0				ovary(2)|urinary_tract(1)|skin(1)	4						c.(640-642)CAG>CAT		ubiquitin specific peptidase 2 isoform a							61.0	63.0	63.0					11																	119243549		2199	4295	6494	SO:0001583	missense	9099				cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity	g.chr11:119243549C>A	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.642G>T	11.37:g.119243549C>A	ENSP00000260187:p.Gln214His		Somatic				USP2_uc001pwn.3_Intron	p.Q214H	NM_004205	NP_004196	WXS	Illumina HiSeq	Unspecified	O75604	UBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)	2	937	-		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)	214					B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	ENST00000260187.2	37	c.642G>T	CCDS8422.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397923	0.25205	.	.	ENSG00000036672	ENST00000260187;ENST00000530918	T	0.19669	2.13	5.37	3.48	0.39840	.	1.365910	0.05235	N	0.511150	T	0.15869	0.0382	N	0.14661	0.345	0.80722	D	1	P	0.38922	0.651	B	0.37833	0.259	T	0.01341	-1.1380	10	0.46703	T	0.11	-5.2791	9.802	0.40770	0.0:0.8385:0.0:0.1615	.	214	O75604	UBP2_HUMAN	H	214;184	ENSP00000260187:Q214H	ENSP00000260187:Q214H	Q	-	3	2	USP2	118748759	0.000000	0.05858	0.389000	0.26208	0.532000	0.34746	-0.041000	0.12084	0.618000	0.30179	0.655000	0.94253	CAG		0.632	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997		39	43	1	0	5.2432e-18	0.01441	8.82907e-18	39	43				
OR6T1	219874	broad.mit.edu	37	11	123814234	123814234	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:123814234G>T	ENST00000321252.2	-	1	346	c.312C>A	c.(310-312)taC>taA	p.Y104*		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CTAGAAAGAAGTAGAGGTAGG	0.512																																							uc010sab.1		NA																	0				ovary(1)	1						c.(310-312)TAC>TAA		olfactory receptor, family 6, subfamily T,							102.0	82.0	89.0					11																	123814234		2202	4299	6501	SO:0001587	stop_gained	219874				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123814234G>T	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.312C>A	11.37:g.123814234G>T	ENSP00000325203:p.Tyr104*		Somatic					p.Y104*	NM_001005187	NP_001005187	WXS	Illumina HiSeq	Unspecified	Q8NGN1	OR6T1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	312	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	104			Helical; Name=3; (Potential).		Q6IFE7	Nonsense_Mutation	SNP	ENST00000321252.2	37	c.312C>A	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638671	0.67130	.	.	ENSG00000181499	ENST00000321252	.	.	.	4.26	0.754	0.18410	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-17.6585	3.0353	0.06119	0.3579:0.2217:0.4204:0.0	.	.	.	.	X	104	.	ENSP00000325203:Y104X	Y	-	3	2	OR6T1	123319444	0.000000	0.05858	0.919000	0.36401	0.885000	0.51271	-0.785000	0.04628	0.776000	0.33473	0.655000	0.94253	TAC		0.512	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187		4	30	1	0	1.23904e-05	0.000602	1.48786e-05	4	30				
OR10G8	219869	broad.mit.edu	37	11	123900899	123900899	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:123900899C>T	ENST00000431524.1	+	1	603	c.570C>T	c.(568-570)gaC>gaT	p.D190D		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCTGTGCAGACACCTCAGCCA	0.507																																							uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(568-570)GAC>GAT		olfactory receptor, family 10, subfamily G,							203.0	179.0	187.0					11																	123900899		2201	4299	6500	SO:0001819	synonymous_variant	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123900899C>T	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.570C>T	11.37:g.123900899C>T			Somatic					p.D190D	NM_001004464	NP_001004464	WXS	Illumina HiSeq	Unspecified	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	570	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	190			Extracellular (Potential).		B2RNJ3|Q6IEV2	Silent	SNP	ENST00000431524.1	37	c.570C>T	CCDS31704.1																																																																																				0.507	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		55	119	0	0	0	0.01441	0	55	119				
ROBO4	54538	broad.mit.edu	37	11	124765732	124765732	+	Silent	SNP	C	C	A	rs148618121		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:124765732C>A	ENST00000306534.3	-	5	1241	c.756G>T	c.(754-756)ccG>ccT	p.P252P	ROBO4_ENST00000533054.1_Silent_p.P107P|ROBO4_ENST00000526899.1_5'UTR	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	252	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CTGCAGGATCCGGGTTCAGCA	0.597																																							uc001qbg.2		NA																	0				ovary(1)|skin(1)	2						c.(754-756)CCG>CCT		roundabout homolog 4, magic roundabout							73.0	75.0	74.0					11																	124765732		2201	4299	6500	SO:0001819	synonymous_variant	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124765732C>A	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.756G>T	11.37:g.124765732C>A			Somatic				ROBO4_uc010sas.1_Silent_p.P107P|ROBO4_uc001qbh.2_Silent_p.P142P|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	p.P252P	NM_019055	NP_061928	WXS	Illumina HiSeq	Unspecified	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	5	896	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	252			Fibronectin type-III 1.		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	c.756G>T	CCDS8455.1																																																																																				0.597	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		18	41	1	0	2.94398e-08	0.007413	3.92978e-08	18	41				
CACNA1C	775	broad.mit.edu	37	12	2602407	2602407	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:2602407G>T	ENST00000347598.4	+	7	968	c.968G>T	c.(967-969)gGg>gTg	p.G323V	CACNA1C_ENST00000402845.3_Missense_Mutation_p.G323V|CACNA1C_ENST00000399617.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000335762.5_Missense_Mutation_p.G323V|CACNA1C_ENST00000327702.7_Missense_Mutation_p.G323V|CACNA1C_ENST00000399641.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399638.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399595.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000406454.3_Missense_Mutation_p.G323V|CACNA1C_ENST00000399621.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399601.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399644.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399649.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399591.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399629.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399634.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399606.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000344100.3_Missense_Mutation_p.G323V|CACNA1C_ENST00000399597.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399655.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399637.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000399603.1_Missense_Mutation_p.G323V|CACNA1C_ENST00000480911.1_Missense_Mutation_p.G323V	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	323					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGGGCCACGGGCGGCAGTGC	0.607																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(967-969)GGG>GTG		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						80.0	83.0	82.0					12																	2602407		2163	4280	6443	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2602407G>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.968G>T	12.37:g.2602407G>T	ENSP00000266376:p.Gly323Val		Somatic				CACNA1C_uc009zdv.1_Missense_Mutation_p.G320V|CACNA1C_uc001qkb.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkc.2_Missense_Mutation_p.G323V|CACNA1C_uc001qke.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkf.2_Missense_Mutation_p.G323V|CACNA1C_uc001qjz.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkd.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkg.2_Missense_Mutation_p.G323V|CACNA1C_uc009zdw.1_Missense_Mutation_p.G323V|CACNA1C_uc001qkh.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkl.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkn.2_Missense_Mutation_p.G323V|CACNA1C_uc001qko.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkp.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkr.2_Missense_Mutation_p.G323V|CACNA1C_uc001qku.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkq.2_Missense_Mutation_p.G323V|CACNA1C_uc001qks.2_Missense_Mutation_p.G323V|CACNA1C_uc001qkt.2_Missense_Mutation_p.G323V|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_Missense_Mutation_p.G59V|CACNA1C_uc001qkj.1_Missense_Mutation_p.G59V|CACNA1C_uc001qkk.1_Missense_Mutation_p.G59V|CACNA1C_uc001qkm.1_Missense_Mutation_p.G59V	p.G323V	NM_199460	NP_955630	WXS	Illumina HiSeq	Unspecified	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	7	1281	+			323			I.|Extracellular (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.968G>T	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076146	0.76415	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97529	-4.36;-4.37;-4.35;-4.36;-4.36;-4.35;-4.38;-4.28;-4.32;-4.38;-4.3;-4.3;-4.37;-4.42;-4.29;-4.22;-4.42;-4.37;-4.36;-4.42;-4.3;-4.41;-4.42	5.06	5.06	0.68205	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98302	0.9437	M	0.75150	2.29	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.981;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0;0.999;1.0;1.0;0.996;1.0;0.999;0.999;1.0;1.0;1.0;0.999;0.872;1.0;0.99;0.999;1.0;1.0;0.999;0.999	D	0.99342	1.0912	10	0.87932	D	0	.	18.6169	0.91305	0.0:0.0:1.0:0.0	.	323;320;323;323;323;323;323;323;323;323;323;294;323;323;323;323;323;323;323;323;323;323;323;323	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	V	323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;164	ENSP00000336982:G323V;ENSP00000382563:G323V;ENSP00000437936:G323V;ENSP00000382552:G323V;ENSP00000382547:G323V;ENSP00000382506:G323V;ENSP00000382530:G323V;ENSP00000382546:G323V;ENSP00000382500:G323V;ENSP00000382549:G323V;ENSP00000266376:G323V;ENSP00000382515:G323V;ENSP00000382510:G323V;ENSP00000341092:G323V;ENSP00000382537:G323V;ENSP00000329877:G323V;ENSP00000382557:G323V;ENSP00000385724:G323V;ENSP00000382512:G323V;ENSP00000382542:G323V;ENSP00000382526:G323V;ENSP00000385896:G323V;ENSP00000382504:G323V	ENSP00000323129:G164V	G	+	2	0	CACNA1C	2472668	1.000000	0.71417	0.998000	0.56505	0.481000	0.33189	9.601000	0.98297	2.633000	0.89246	0.455000	0.32223	GGG		0.607	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		24	80	1	0	2.49675e-24	0.007291	4.42022e-24	24	80				
CACNA1C	775	broad.mit.edu	37	12	2714876	2714876	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:2714876G>A	ENST00000347598.4	+	25	3140	c.3140G>A	c.(3139-3141)cGg>cAg	p.R1047Q	CACNA1C_ENST00000402845.3_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R1052Q|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R1027Q|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399634.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R1047Q|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R1027Q|CACNA1C_ENST00000480911.1_Missense_Mutation_p.R1027Q	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1047					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTCGCCATCCGGACCATCGGG	0.577																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(3139-3141)CGG>CAG		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						165.0	154.0	158.0					12																	2714876		2203	4300	6503	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2714876G>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3140G>A	12.37:g.2714876G>A	ENSP00000266376:p.Arg1047Gln		Somatic				CACNA1C_uc009zdv.1_Missense_Mutation_p.R1024Q|CACNA1C_uc001qkb.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkc.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qke.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkf.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qjz.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkd.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkg.2_Missense_Mutation_p.R1027Q|CACNA1C_uc009zdw.1_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkh.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkl.2_Missense_Mutation_p.R1047Q|CACNA1C_uc001qkn.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qko.2_Missense_Mutation_p.R1047Q|CACNA1C_uc001qkp.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkr.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qku.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkq.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qks.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qkt.2_Missense_Mutation_p.R1027Q|CACNA1C_uc001qka.1_Missense_Mutation_p.R562Q|CACNA1C_uc001qki.1_Missense_Mutation_p.R763Q|CACNA1C_uc001qkj.1_Missense_Mutation_p.R763Q|CACNA1C_uc001qkk.1_Missense_Mutation_p.R763Q|CACNA1C_uc001qkm.1_Missense_Mutation_p.R763Q	p.R1047Q	NM_199460	NP_955630	WXS	Illumina HiSeq	Unspecified	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	25	3453	+			1047			Cytoplasmic (Potential).|III.		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.3140G>A	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	34	5.314669	0.95655	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97598	-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45	4.33	4.33	0.51752	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98137	0.9385	M	0.70275	2.135	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;0.999;0.999;0.997;1.0;0.999;0.998;0.999;0.999;0.999;0.999;0.998;1.0;0.998;0.999;1.0;1.0;0.999;0.997;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D	0.87578	0.988;0.996;0.99;0.988;0.996;0.996;0.997;0.951;0.981;0.996;0.99;0.927;0.997;0.994;0.998;0.975;0.902;0.996;0.934;0.975;0.996;0.996;0.951;0.964;0.993	D	0.99194	1.0871	10	0.87932	D	0	.	17.3763	0.87392	0.0:0.0:1.0:0.0	.	1027;1024;1047;1027;1027;1027;1027;1027;1027;1047;1027;998;1047;1027;1027;1027;1027;1027;1027;1027;1027;1027;1027;1027;1027	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Q	1052;1027;1027;1027;1027;1027;1027;1027;1027;1027;1047;1047;1027;1027;1027;1027;1027;1027;1027;1027;1027;1027;1027;868	ENSP00000336982:R1052Q;ENSP00000382563:R1027Q;ENSP00000437936:R1027Q;ENSP00000382552:R1027Q;ENSP00000382547:R1027Q;ENSP00000382506:R1027Q;ENSP00000382530:R1027Q;ENSP00000382546:R1027Q;ENSP00000382500:R1027Q;ENSP00000382549:R1027Q;ENSP00000266376:R1047Q;ENSP00000382515:R1047Q;ENSP00000382510:R1027Q;ENSP00000341092:R1027Q;ENSP00000382537:R1027Q;ENSP00000329877:R1027Q;ENSP00000382557:R1027Q;ENSP00000385724:R1027Q;ENSP00000382512:R1027Q;ENSP00000382542:R1027Q;ENSP00000382526:R1027Q;ENSP00000385896:R1027Q;ENSP00000382504:R1027Q	ENSP00000323129:R868Q	R	+	2	0	CACNA1C	2585137	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.452000	0.80683	2.418000	0.82041	0.561000	0.74099	CGG		0.577	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		39	53	0	0	0	0.01441	0	39	53				
C12orf5	57103	broad.mit.edu	37	12	4461605	4461605	+	Silent	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:4461605A>T	ENST00000179259.4	+	6	628	c.561A>T	c.(559-561)ccA>ccT	p.P187P		NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	187					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			GCGGTATTCCAGGATTAGCAG	0.423																																					Colon(1;100 192 35375 49454 52532)	Colon(1;100 192 35375 49454 52532)	uc001qmp.2		NA																	0				skin(1)	1						c.(559-561)CCA>CCT		TP53-induced glycolysis and apoptosis regulator							120.0	109.0	113.0					12																	4461605		2203	4300	6503	SO:0001819	synonymous_variant	57103					intracellular	fructose-2,6-bisphosphate 2-phosphatase activity	g.chr12:4461605A>T	AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.561A>T	12.37:g.4461605A>T			Somatic					p.P187P	NM_020375	NP_065108	WXS	Illumina HiSeq	Unspecified	Q9NQ88	TIGAR_HUMAN	all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)		6	640	+			187					B2R840	Silent	SNP	ENST00000179259.4	37	c.561A>T	CCDS8525.1																																																																																				0.423	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398290.1	NM_020375		36	45	0	0	0	0.01441	0	36	45				
CD163	9332	broad.mit.edu	37	12	7639150	7639150	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:7639150G>T	ENST00000359156.4	-	10	2605	c.2403C>A	c.(2401-2403)caC>caA	p.H801Q	CD163_ENST00000432237.2_Missense_Mutation_p.H801Q|CD163_ENST00000541972.1_Missense_Mutation_p.H789Q|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000396620.3_Missense_Mutation_p.H834Q	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	801	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	GCCCCCAGCCGTGTGAATGGC	0.483																																							uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(2401-2403)CAC>CAA		CD163 antigen isoform a							122.0	124.0	123.0					12																	7639150		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7639150G>T	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2403C>A	12.37:g.7639150G>T	ENSP00000352071:p.His801Gln		Somatic				CD163_uc001qta.3_Missense_Mutation_p.H801Q|CD163_uc009zfw.2_Missense_Mutation_p.H834Q	p.H801Q	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			10	2531	-			801			SRCR 7.|Extracellular (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.2403C>A	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682133	0.29872	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.54	-7.56	0.01322	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.414255	0.23489	N	0.047633	T	0.13157	0.0319	N	0.01515	-0.825	0.19945	N	0.999949	B;P;P	0.49696	0.217;0.881;0.927	B;B;P	0.48400	0.053;0.32;0.576	T	0.49011	-0.8983	10	0.15066	T	0.55	.	5.8095	0.18457	0.1732:0.2159:0.505:0.1059	.	834;801;801	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	Q	801;789;834;801	ENSP00000352071:H801Q;ENSP00000444071:H789Q;ENSP00000379863:H834Q;ENSP00000403885:H801Q	ENSP00000352071:H801Q	H	-	3	2	CD163	7530417	0.000000	0.05858	0.327000	0.25402	0.986000	0.74619	-3.480000	0.00457	-0.839000	0.04212	-0.295000	0.09555	CAC		0.483	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		21	99	1	0	2.39556e-15	0.00278	3.84603e-15	21	99				
DPPA3	359787	broad.mit.edu	37	12	7867942	7867942	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:7867942G>T	ENST00000345088.2	+	2	363	c.246G>T	c.(244-246)agG>agT	p.R82S		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	82					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		TTTACAGCAGGAGAGGAGTAA	0.483																																							uc001qtf.2		NA																	0					0						c.(244-246)AGG>AGT		stella							97.0	83.0	88.0					12																	7867942		2203	4298	6501	SO:0001583	missense	359787					cytoplasm|nucleus		g.chr12:7867942G>T	AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.246G>T	12.37:g.7867942G>T	ENSP00000339250:p.Arg82Ser		Somatic					p.R82S	NM_199286	NP_954980	WXS	Illumina HiSeq	Unspecified	Q6W0C5	DPPA3_HUMAN		Kidney(36;0.0887)	2	324	+			82					Q0P5U3|Q6JZS6	Missense_Mutation	SNP	ENST00000345088.2	37	c.246G>T	CCDS8582.1	.	.	.	.	.	.	.	.	.	.	G	8.401	0.841939	0.16963	.	.	ENSG00000187569	ENST00000345088	T	0.46063	0.88	2.48	-1.5	0.08691	.	.	.	.	.	T	0.27134	0.0665	N	0.24115	0.695	0.09310	N	1	P	0.35383	0.498	B	0.37943	0.261	T	0.22034	-1.0228	9	0.56958	D	0.05	-12.3604	6.1532	0.20322	0.5856:0.0:0.4144:0.0	.	82	Q6W0C5	DPPA3_HUMAN	S	82	ENSP00000339250:R82S	ENSP00000339250:R82S	R	+	3	2	DPPA3	7759209	0.003000	0.15002	0.000000	0.03702	0.050000	0.14768	0.173000	0.16724	-0.403000	0.07622	-0.379000	0.06801	AGG		0.483	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399718.1	NM_199286		18	11	1	0	2.94398e-08	0.007413	3.92978e-08	18	11				
SLC2A14	144195	broad.mit.edu	37	12	7981387	7981387	+	Missense_Mutation	SNP	T	T	C	rs533625592		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:7981387T>C	ENST00000543909.1	-	11	1417	c.658A>G	c.(658-660)Atc>Gtc	p.I220V	SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000431042.2_Missense_Mutation_p.I197V|SLC2A14_ENST00000340749.5_Missense_Mutation_p.I197V|SLC2A14_ENST00000535295.1_Missense_Mutation_p.I111V|SLC2A14_ENST00000542546.1_Missense_Mutation_p.I111V|SLC2A14_ENST00000396589.2_Missense_Mutation_p.I220V|SLC2A14_ENST00000539924.1_Missense_Mutation_p.I235V			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	220					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CTTTGCAGGATAGCTGGAAGG	0.453																																							uc001qtk.2		NA																	0				ovary(1)	1						c.(658-660)ATC>GTC		glucose transporter 14							149.0	134.0	139.0					12																	7981387		2203	4300	6503	SO:0001583	missense	144195				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity	g.chr12:7981387T>C	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.658A>G	12.37:g.7981387T>C	ENSP00000440480:p.Ile220Val		Somatic				SLC2A14_uc001qtl.2_Missense_Mutation_p.I197V|SLC2A14_uc001qtm.2_Missense_Mutation_p.I197V|SLC2A14_uc010sgg.1_Missense_Mutation_p.I111V|SLC2A14_uc001qtn.2_Missense_Mutation_p.I220V|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Missense_Mutation_p.I235V	p.I220V	NM_153449	NP_703150	WXS	Illumina HiSeq	Unspecified	Q8TDB8	GTR14_HUMAN		Kidney(36;0.0883)	11	1451	-			220			Helical; Name=6; (Potential).		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	c.658A>G	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.603089	0.00849	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	3.92	-4.45	0.03546	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.626565	0.16793	N	0.199307	T	0.50446	0.1616	N	0.05158	-0.105	0.09310	N	0.999999	B;B;B;B	0.10296	0.003;0.003;0.001;0.001	B;B;B;B	0.13407	0.009;0.006;0.005;0.006	T	0.47195	-0.9136	10	0.12103	T	0.63	.	5.5658	0.17170	0.0:0.3738:0.1464:0.4798	.	235;111;197;220	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	V	197;220;197;220;111;111;235	ENSP00000340450:I197V;ENSP00000440480:I220V;ENSP00000407287:I197V;ENSP00000379834:I220V;ENSP00000440492:I111V;ENSP00000443903:I111V;ENSP00000445929:I235V	ENSP00000340450:I197V	I	-	1	0	SLC2A14	7872654	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-1.585000	0.02112	-0.671000	0.05274	-0.467000	0.05162	ATC		0.453	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		11	70	0	0	0	0.00245	0	11	70				
GRIN2B	2904	broad.mit.edu	37	12	13716716	13716716	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:13716716G>T	ENST00000609686.1	-	13	3665	c.3456C>A	c.(3454-3456)acC>acA	p.T1152T		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1152					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGTAGATGTCGGTCAGGTCTA	0.577																																							uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(3454-3456)ACC>ACA		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						109.0	90.0	96.0					12																	13716716		2203	4300	6503	SO:0001819	synonymous_variant	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13716716G>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3456C>A	12.37:g.13716716G>T			Somatic					p.T1152T	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			13	3635	-			1152			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	c.3456C>A	CCDS8662.1																																																																																				0.577	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			8	27	1	0	5.50884e-06	0.013537	6.6836e-06	8	27				
LMO3	55885	broad.mit.edu	37	12	16753644	16753644	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:16753644C>A	ENST00000320122.6	-	2	673	c.151G>T	c.(151-153)Ggc>Tgc	p.G51C	LMO3_ENST00000541846.1_Missense_Mutation_p.G51C|LMO3_ENST00000261169.6_Missense_Mutation_p.G62C|LMO3_ENST00000534946.1_Missense_Mutation_p.G51C|LMO3_ENST00000354662.1_Missense_Mutation_p.G51C|LMO3_ENST00000540445.1_Intron|LMO3_ENST00000441439.2_Missense_Mutation_p.G51C|LMO3_ENST00000540848.1_Missense_Mutation_p.G51C|LMO3_ENST00000535535.1_Missense_Mutation_p.G51C|LMO3_ENST00000537568.1_Intron|LMO3_ENST00000537304.1_Missense_Mutation_p.G51C|LMO3_ENST00000447609.1_Missense_Mutation_p.G51C|LMO3_ENST00000541295.1_Missense_Mutation_p.G69C	NM_001243611.1	NP_001230540.1	Q8TAP4	LMO3_HUMAN	LIM domain only 3 (rhombotin-like 2)	51	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|skin(1)	5		Hepatocellular(102;0.244)				AGGGTGGAGCCCACCTCTCCC	0.483																																							uc001rdk.1		NA																	0					0						c.(151-153)GGC>TGC		LIM domain only 3							151.0	129.0	137.0					12																	16753644		2203	4300	6503	SO:0001583	missense	55885				regulation of transcription, DNA-dependent|transcription, DNA-dependent		zinc ion binding	g.chr12:16753644C>A	BC026311	CCDS8678.1, CCDS58210.1, CCDS58211.1, CCDS58212.1	12p13	2004-05-19			ENSG00000048540	ENSG00000048540			6643	protein-coding gene	gene with protein product		180386		RBTNL2		11489251	Standard	NM_018640		Approved	Rhom-3, DAT1	uc010shy.2	Q8TAP4	OTTHUMG00000168837	ENST00000320122.6:c.151G>T	12.37:g.16753644C>A	ENSP00000312856:p.Gly51Cys		Somatic				LMO3_uc001rdj.1_Missense_Mutation_p.G62C|LMO3_uc010shy.1_Missense_Mutation_p.G69C|LMO3_uc001rdl.1_Missense_Mutation_p.G51C|LMO3_uc009zii.1_RNA|LMO3_uc010shz.1_Intron|LMO3_uc001rdm.1_Missense_Mutation_p.G51C|LMO3_uc001rdo.1_Intron|LMO3_uc001rdp.1_Intron|LMO3_uc001rdn.1_Missense_Mutation_p.G51C|LMO3_uc009zij.1_RNA|LMO3_uc009zik.1_RNA	p.G51C	NM_018640	NP_061110	WXS	Illumina HiSeq	Unspecified	Q8TAP4	LMO3_HUMAN			2	591	-		Hepatocellular(102;0.244)	51			LIM zinc-binding 1.		B4DG90|B4DH35|Q58A66|Q58A67|Q8N974|Q9UDD5	Missense_Mutation	SNP	ENST00000320122.6	37	c.151G>T	CCDS8678.1	.	.	.	.	.	.	.	.	.	.	C	32	5.106813	0.94292	.	.	ENSG00000048540	ENST00000354662;ENST00000441439;ENST00000447609;ENST00000320122;ENST00000261169;ENST00000540848;ENST00000535535;ENST00000537304;ENST00000541295;ENST00000534946;ENST00000541846;ENST00000539534;ENST00000546281;ENST00000537757;ENST00000546279;ENST00000538051;ENST00000545436;ENST00000540590;ENST00000538020	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31	5.72	5.72	0.89469	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.94295	0.8167	M	0.83312	2.635	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94455	0.7671	10	0.87932	D	0	.	19.8807	0.96899	0.0:1.0:0.0:0.0	.	69;51;62	B4DG90;Q8TAP4;Q58A67	.;LMO3_HUMAN;.	C	51;51;51;51;62;51;51;51;69;51;51;51;51;51;51;51;51;51;51	ENSP00000346689:G51C;ENSP00000412479:G51C;ENSP00000413703:G51C;ENSP00000312856:G51C;ENSP00000261169:G62C;ENSP00000445751:G51C;ENSP00000446115:G51C;ENSP00000440099:G51C;ENSP00000446463:G69C;ENSP00000439275:G51C;ENSP00000444393:G51C;ENSP00000443807:G51C;ENSP00000442713:G51C;ENSP00000445193:G51C;ENSP00000441360:G51C;ENSP00000445504:G51C;ENSP00000444269:G51C;ENSP00000439989:G51C;ENSP00000446095:G51C	ENSP00000261169:G62C	G	-	1	0	LMO3	16644911	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.813000	0.86123	2.704000	0.92352	0.650000	0.86243	GGC		0.483	LMO3-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401279.1	NM_018640		12	53	1	0	1.49906e-05	0.00245	1.7891e-05	12	53				
PKP2	5318	broad.mit.edu	37	12	33049511	33049511	+	Missense_Mutation	SNP	T	T	C	rs549598534		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:33049511T>C	ENST00000070846.6	-	1	179	c.155A>G	c.(154-156)aAg>aGg	p.K52R	PKP2_ENST00000340811.4_Missense_Mutation_p.K52R|PKP2_ENST00000546741.1_5'UTR	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	52					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCGCAGGCTCTTGACTGTCTG	0.726													T|||	1	0.000199681	0.0	0.0	5008	,	,		8458	0.001		0.0	False		,,,				2504	0.0						uc001rlj.3		NA																	0				ovary(1)|pancreas(1)	2						c.(154-156)AAG>AGG		plakophilin 2 isoform 2b							8.0	9.0	9.0					12																	33049511		2030	4065	6095	SO:0001583	missense	5318				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding	g.chr12:33049511T>C	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.155A>G	12.37:g.33049511T>C	ENSP00000070846:p.Lys52Arg		Somatic				PKP2_uc001rlk.3_Missense_Mutation_p.K52R|PKP2_uc010skj.1_Missense_Mutation_p.K52R	p.K52R	NM_004572	NP_004563	WXS	Illumina HiSeq	Unspecified	Q99959	PKP2_HUMAN			1	270	-	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		52					A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	c.155A>G	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.529799	0.45073	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.81078	-1.45;-1.43	3.96	2.33	0.28932	.	0.415347	0.20534	N	0.090454	T	0.64034	0.2562	N	0.19112	0.55	0.28772	N	0.900324	B;B;B	0.27997	0.197;0.125;0.125	B;B;B	0.30716	0.119;0.056;0.056	T	0.52563	-0.8559	10	0.20519	T	0.43	-18.4892	7.2331	0.26053	0.0:0.1518:0.0:0.8482	.	52;52;52	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	R	52	ENSP00000342800:K52R;ENSP00000070846:K52R	ENSP00000070846:K52R	K	-	2	0	PKP2	32940778	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.532000	0.36029	0.315000	0.23110	0.402000	0.26972	AAG		0.726	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572		2	11	0	0	0	0.004672	0	2	11				
SCN8A	6334	broad.mit.edu	37	12	52100473	52100473	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:52100473G>T	ENST00000354534.6	+	11	1787	c.1609G>T	c.(1609-1611)Ggg>Tgg	p.G537W	SCN8A_ENST00000550891.1_Missense_Mutation_p.G537W|SCN8A_ENST00000545061.1_Missense_Mutation_p.G537W	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	537					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CAACAGAATAGGGAGGAAATT	0.373																																							uc001ryw.2		NA																	0				ovary(7)	7						c.(1609-1611)GGG>TGG		sodium channel, voltage gated, type VIII, alpha	Lamotrigine(DB00555)						46.0	46.0	46.0					12																	52100473		1876	4108	5984	SO:0001583	missense	6334				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity	g.chr12:52100473G>T	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.1609G>T	12.37:g.52100473G>T	ENSP00000346534:p.Gly537Trp		Somatic				SCN8A_uc010snl.1_Missense_Mutation_p.G402W|SCN8A_uc001ryx.1_Missense_Mutation_p.G402W|SCN8A_uc001ryz.1_Missense_Mutation_p.G402W|SCN8A_uc001ryy.2_Missense_Mutation_p.G402W	p.G537W	NM_014191	NP_055006	WXS	Illumina HiSeq	Unspecified	Q9UQD0	SCN8A_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.181)	11	1787	+			537					B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	c.1609G>T	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009504	0.75046	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961;ENST00000551216	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81	4.41	4.41	0.53225	Domain of unknown function DUF3451 (1);	0.197072	0.44902	D	0.000407	D	0.92821	0.7717	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;0.996	D;D;D;D	0.87578	0.97;0.996;0.998;0.965	D	0.93692	0.7008	10	0.66056	D	0.02	.	17.5555	0.87888	0.0:0.0:1.0:0.0	.	537;537;537;537	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	W	537;537;537;537;450;335	ENSP00000448415:G537W;ENSP00000346534:G537W;ENSP00000440360:G537W;ENSP00000347255:G537W;ENSP00000447567:G335W	ENSP00000346534:G537W	G	+	1	0	SCN8A	50386740	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.194000	0.94962	2.448000	0.82819	0.462000	0.41574	GGG		0.373	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		6	4	1	0	0.00116845	0.001168	0.00127269	6	4				
PDE1B	5153	broad.mit.edu	37	12	54963089	54963089	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:54963089G>T	ENST00000243052.3	+	4	785	c.349G>T	c.(349-351)Gag>Tag	p.E117*	PDE1B_ENST00000538346.1_Nonsense_Mutation_p.E76*|PDE1B_ENST00000550620.1_Nonsense_Mutation_p.E97*|PDE1B_ENST00000394277.3_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	117					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CCGCCGAGCAGAGGAGAAGCC	0.657																																							uc001sgd.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(349-351)GAG>TAG		phosphodiesterase 1B isoform 1							56.0	58.0	57.0					12																	54963089		2203	4300	6503	SO:0001587	stop_gained	5153				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:54963089G>T	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.349G>T	12.37:g.54963089G>T	ENSP00000243052:p.Glu117*		Somatic				PDE1B_uc010soz.1_5'UTR|PDE1B_uc010spa.1_Nonsense_Mutation_p.E76*|PDE1B_uc001sgf.2_5'UTR|PDE1B_uc001sge.2_Nonsense_Mutation_p.E97*|PDE1B_uc009znq.2_Intron	p.E117*	NM_000924	NP_000915	WXS	Illumina HiSeq	Unspecified	Q01064	PDE1B_HUMAN			4	515	+			117					Q92825|Q96KP3	Nonsense_Mutation	SNP	ENST00000243052.3	37	c.349G>T	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	G	38	6.828481	0.97869	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	.	.	.	4.97	4.97	0.65823	.	0.000000	0.51477	D	0.000082	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	16.1185	0.81325	0.0:0.0:1.0:0.0	.	.	.	.	X	117;76;97	.	ENSP00000243052:E117X	E	+	1	0	PDE1B	53249356	1.000000	0.71417	0.937000	0.37676	0.998000	0.95712	9.619000	0.98369	2.488000	0.83962	0.655000	0.94253	GAG		0.657	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			9	35	1	0	0.000442599	0.006214	0.000493086	9	35				
ITGA7	3679	broad.mit.edu	37	12	56094734	56094734	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:56094734G>A	ENST00000555728.1	-	4	647	c.619C>T	c.(619-621)Cct>Tct	p.P207S	ITGA7_ENST00000257880.7_Missense_Mutation_p.P207S|ITGA7_ENST00000257879.6_Missense_Mutation_p.P207S|ITGA7_ENST00000347027.6_Missense_Mutation_p.P207S|ITGA7_ENST00000452168.2_Missense_Mutation_p.P110S|ITGA7_ENST00000394230.2_Missense_Mutation_p.P207S|ITGA7_ENST00000553804.1_Missense_Mutation_p.P207S|ITGA7_ENST00000394229.2_Missense_Mutation_p.P207S			Q13683	ITA7_HUMAN	integrin, alpha 7	207					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TGGCTATCAGGGGAGAAGGCG	0.572																																							uc001shh.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(619-621)CCT>TCT		integrin alpha 7 isoform 1 precursor							85.0	80.0	81.0					12																	56094734		2203	4300	6503	SO:0001583	missense	3679				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity	g.chr12:56094734G>A		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.619C>T	12.37:g.56094734G>A	ENSP00000452387:p.Pro207Ser		Somatic				ITGA7_uc001shg.2_Missense_Mutation_p.P207S|ITGA7_uc010sps.1_Missense_Mutation_p.P110S|ITGA7_uc009znx.2_Missense_Mutation_p.P94S	p.P207S	NM_001144996	NP_001138468	WXS	Illumina HiSeq	Unspecified	Q13683	ITA7_HUMAN			4	839	-			207			FG-GAP 3.|Extracellular (Potential).		B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37	c.619C>T		.	.	.	.	.	.	.	.	.	.	G	17.11	3.305240	0.60305	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728;ENST00000557257	T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	4.47	4.47	0.54385	.	0.000000	0.64402	D	0.000002	T	0.62612	0.2442	N	0.17474	0.49	0.49687	D	0.999815	B;B;P;D	0.53462	0.057;0.04;0.611;0.96	B;B;B;P	0.54499	0.113;0.029;0.406;0.754	T	0.57458	-0.7808	10	0.22109	T	0.4	.	10.1871	0.43004	0.0:0.0:0.8014:0.1986	.	110;207;207;270	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	S	207;207;207;110;207;207;207;207;207;49	ENSP00000452120:P207S;ENSP00000257879:P207S;ENSP00000343009:P207S;ENSP00000393844:P110S;ENSP00000257880:P207S;ENSP00000377777:P207S;ENSP00000377776:P207S;ENSP00000452387:P207S;ENSP00000450578:P49S	ENSP00000257879:P207S	P	-	1	0	ITGA7	54381001	0.000000	0.05858	0.995000	0.50966	0.958000	0.62258	0.248000	0.18198	2.505000	0.84491	0.555000	0.69702	CCT		0.572	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206		11	14	0	0	0	0.010729	0	11	14				
ZFC3H1	196441	broad.mit.edu	37	12	72017243	72017243	+	Silent	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:72017243A>G	ENST00000378743.3	-	24	4999	c.4641T>C	c.(4639-4641)aaT>aaC	p.N1547N		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1547					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AAGGATTATCATTAGATGGAT	0.348																																							uc001swo.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(4639-4641)AAT>AAC		proline/serine-rich coiled-coil 2							104.0	94.0	97.0					12																	72017243		1836	4090	5926	SO:0001819	synonymous_variant	196441				RNA processing	intracellular	metal ion binding	g.chr12:72017243A>G	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4641T>C	12.37:g.72017243A>G			Somatic					p.N1547N	NM_144982	NP_659419	WXS	Illumina HiSeq	Unspecified	O60293	ZC3H1_HUMAN			24	5000	-			1547					Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	37	c.4641T>C	CCDS41813.1																																																																																				0.348	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		14	73	0	0	0	0.004007	0	14	73				
EEA1	8411	broad.mit.edu	37	12	93244898	93244898	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:93244898C>T	ENST00000322349.8	-	9	1051	c.787G>A	c.(787-789)Gct>Act	p.A263T		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	263					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TCTGAGCTAGCATATTGTGAC	0.358																																							uc001tck.2		NA																	0				ovary(2)|skin(1)	3						c.(787-789)GCT>ACT		early endosome antigen 1, 162kD							126.0	102.0	110.0					12																	93244898		2203	4300	6503	SO:0001583	missense	8411				early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding	g.chr12:93244898C>T	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.787G>A	12.37:g.93244898C>T	ENSP00000317955:p.Ala263Thr		Somatic					p.A263T	NM_003566	NP_003557	WXS	Illumina HiSeq	Unspecified	Q15075	EEA1_HUMAN			9	1052	-			263			Potential.		Q14221	Missense_Mutation	SNP	ENST00000322349.8	37	c.787G>A	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	C	8.454	0.853856	0.17106	.	.	ENSG00000102189	ENST00000322349;ENST00000540777	D	0.83591	-1.74	5.84	3.98	0.46160	.	0.527337	0.16826	N	0.197972	T	0.63212	0.2492	N	0.11560	0.145	0.29695	N	0.840648	B	0.06786	0.001	B	0.04013	0.001	T	0.52253	-0.8600	10	0.15499	T	0.54	.	5.8704	0.18801	0.2742:0.5858:0.0:0.14	.	263	Q15075	EEA1_HUMAN	T	263;262	ENSP00000317955:A263T	ENSP00000317955:A263T	A	-	1	0	EEA1	91769029	0.997000	0.39634	0.749000	0.31150	0.864000	0.49448	1.972000	0.40540	0.764000	0.33197	0.650000	0.86243	GCT		0.358	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566		6	51	0	0	0	0.001984	0	6	51				
CORO1C	23603	broad.mit.edu	37	12	109094945	109094945	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:109094945T>C	ENST00000261401.3	-	2	322	c.150A>G	c.(148-150)atA>atG	p.I50M	CORO1C_ENST00000541050.1_Missense_Mutation_p.I50M|CORO1C_ENST00000549772.1_Missense_Mutation_p.I56M|CORO1C_ENST00000420959.2_Missense_Mutation_p.I103M|CORO1C_ENST00000549384.1_Intron	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	50					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						CACTTGCCTCTATGATTATGG	0.473																																							uc001tnj.2		NA																	0				skin(3)	3						c.(148-150)ATA>ATG		coronin, actin binding protein, 1C isoform 1							173.0	154.0	160.0					12																	109094945		2203	4300	6503	SO:0001583	missense	23603				actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding	g.chr12:109094945T>C	BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.150A>G	12.37:g.109094945T>C	ENSP00000261401:p.Ile50Met		Somatic				CORO1C_uc009zva.2_Missense_Mutation_p.I103M|CORO1C_uc010sxf.1_Missense_Mutation_p.I50M	p.I50M	NM_014325	NP_055140	WXS	Illumina HiSeq	Unspecified	Q9ULV4	COR1C_HUMAN			2	246	-			50					A7MAP0|A7MAP1|B3KU12|Q9NSK5	Missense_Mutation	SNP	ENST00000261401.3	37	c.150A>G	CCDS9120.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.847992	0.71603	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000549772;ENST00000420959;ENST00000547294;ENST00000550032;ENST00000551550;ENST00000546571;ENST00000551044	T;T;T;T;T;T;T;T;T	0.77229	-0.04;-0.04;0.02;-0.1;-0.4;-0.02;-0.61;-0.76;-1.08	5.37	1.31	0.21738	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Domain of unknown function DUF1899 (1);	0.416092	0.28515	N	0.015062	T	0.73001	0.3531	L	0.33245	0.995	0.42351	D	0.992377	B;B;B	0.29936	0.262;0.001;0.014	P;B;B	0.50049	0.629;0.078;0.272	T	0.68903	-0.5286	10	0.52906	T	0.07	-9.3235	0.2572	0.00213	0.308:0.1577:0.16:0.3743	.	50;103;50	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	M	50;50;56;103;50;50;50;50;50	ENSP00000261401:I50M;ENSP00000438341:I50M;ENSP00000447534:I56M;ENSP00000394496:I103M;ENSP00000449330:I50M;ENSP00000447989:I50M;ENSP00000448527:I50M;ENSP00000448195:I50M;ENSP00000447049:I50M	ENSP00000261401:I50M	I	-	3	3	CORO1C	107619074	0.032000	0.19561	1.000000	0.80357	0.993000	0.82548	-0.880000	0.04183	0.829000	0.34733	0.482000	0.46254	ATA		0.473	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403802.1	NM_014325		36	100	0	0	0	0.006999	0	36	100				
CUX2	23316	broad.mit.edu	37	12	111760342	111760342	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:111760342C>A	ENST00000261726.6	+	18	3038	c.2884C>A	c.(2884-2886)Cag>Aag	p.Q962K		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	962					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GCTCTCTGACCAGCTCGGCCA	0.677																																							uc001tsa.1		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(2884-2886)CAG>AAG		cut-like 2							16.0	21.0	19.0					12																	111760342		2195	4291	6486	SO:0001583	missense	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111760342C>A	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2884C>A	12.37:g.111760342C>A	ENSP00000261726:p.Gln962Lys		Somatic					p.Q962K	NM_015267	NP_056082	WXS	Illumina HiSeq	Unspecified	O14529	CUX2_HUMAN			18	3037	+			962			CUT 2.		A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	c.2884C>A	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	c	24.5	4.533934	0.85812	.	.	ENSG00000111249	ENST00000261726	T	0.45668	0.89	4.65	4.65	0.58169	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.200023	0.45361	D	0.000361	T	0.38108	0.1028	N	0.03608	-0.345	0.51233	D	0.999917	D	0.56746	0.977	P	0.61592	0.891	T	0.46816	-0.9164	10	0.25106	T	0.35	-17.6578	17.6118	0.88055	0.0:1.0:0.0:0.0	.	962	O14529	CUX2_HUMAN	K	962	ENSP00000261726:Q962K	ENSP00000261726:Q962K	Q	+	1	0	CUX2	110244725	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.808000	0.86044	2.166000	0.68216	0.282000	0.19409	CAG		0.677	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		6	12	1	0	2.7689e-08	0.001984	3.73865e-08	6	12				
SLC8B1	80024	broad.mit.edu	37	12	113745551	113745551	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:113745551C>A	ENST00000552014.1	-	14	1871	c.1356G>T	c.(1354-1356)cgG>cgT	p.R452R	SLC8B1_ENST00000549069.1_5'Flank|SLC8B1_ENST00000546737.1_Silent_p.R396R|SLC8B1_ENST00000553238.1_5'Flank|SLC8B1_ENST00000550047.1_5'UTR|SLC8B1_ENST00000202831.3_Silent_p.R452R			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	452					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)										TGTTGCTCAGCCGGAAGACCA	0.637																																							uc001tvc.2		NA																	0				central_nervous_system(1)	1						c.(1354-1356)CGG>CGT		solute carrier family 24 member 6 precursor							71.0	60.0	64.0					12																	113745551		2203	4300	6503	SO:0001819	synonymous_variant	80024				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity	g.chr12:113745551C>A	AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.1356G>T	12.37:g.113745551C>A			Somatic				SLC24A6_uc001tuz.2_Silent_p.R157R|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Silent_p.R190R	p.R452R	NM_024959	NP_079235	WXS	Illumina HiSeq	Unspecified	Q6J4K2	NCKX6_HUMAN			13	1566	-			452			Helical; Name=10; (Potential).		A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Silent	SNP	ENST00000552014.1	37	c.1356G>T	CCDS31909.1																																																																																				0.637	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404830.3	NM_024959		24	28	1	0	1.77063e-15	0.005443	2.85838e-15	24	28				
TMEM132D	121256	broad.mit.edu	37	12	129563149	129563149	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr12:129563149A>T	ENST00000422113.2	-	8	2371	c.2045T>A	c.(2044-2046)cTc>cAc	p.L682H	TMEM132D_ENST00000389441.4_Missense_Mutation_p.L220H	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	682					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCCTGGGCTGAGCTGCAAGGA	0.567																																							uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(2044-2046)CTC>CAC		transmembrane protein 132D precursor							142.0	120.0	127.0					12																	129563149		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:129563149A>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2045T>A	12.37:g.129563149A>T	ENSP00000408581:p.Leu682His		Somatic				TMEM132D_uc001uia.2_Missense_Mutation_p.L220H	p.L682H	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	8	2373	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	682			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.2045T>A	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.610829	0.46527	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.13778	2.56;2.56	4.79	3.65	0.41850	.	0.000000	0.64402	D	0.000002	T	0.29652	0.0740	L	0.58428	1.81	0.41672	D	0.98924	D;D	0.89917	1.0;1.0	D;D	0.80764	0.961;0.994	T	0.00926	-1.1512	9	.	.	.	-40.1604	10.1812	0.42968	0.9208:0.0:0.0792:0.0	.	682;220	Q14C87;Q14C87-2	T132D_HUMAN;.	H	220;682	ENSP00000374092:L220H;ENSP00000408581:L682H	.	L	-	2	0	TMEM132D	128129102	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.216000	0.58540	0.680000	0.31366	0.460000	0.39030	CTC		0.567	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		32	24	0	0	0	0.004289	0	32	24				
PABPC3	5042	broad.mit.edu	37	13	25671622	25671622	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:25671622C>A	ENST00000281589.3	+	1	1323	c.1286C>A	c.(1285-1287)cCt>cAt	p.P429H		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	429					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGACCAAGTCCTCGCTGGACT	0.512																																							uc001upy.2		NA																	0				ovary(3)|skin(1)	4						c.(1285-1287)CCT>CAT		poly(A) binding protein, cytoplasmic 3							166.0	162.0	163.0					13																	25671622		2203	4300	6503	SO:0001583	missense	5042				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding	g.chr13:25671622C>A	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1286C>A	13.37:g.25671622C>A	ENSP00000281589:p.Pro429His		Somatic					p.P429H	NM_030979	NP_112241	WXS	Illumina HiSeq	Unspecified	Q9H361	PABP3_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	1347	+		Lung SC(185;0.0225)|Breast(139;0.0602)	429					Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	c.1286C>A	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	9.268	1.044913	0.19748	.	.	ENSG00000151846	ENST00000281589	T	0.36699	1.24	0.664	0.664	0.17890	.	0.000000	0.47455	U	0.000238	T	0.40015	0.1100	M	0.88105	2.93	0.42656	D	0.993469	P	0.37914	0.611	B	0.36567	0.228	T	0.44847	-0.9301	10	0.72032	D	0.01	.	7.0697	0.25171	0.0:0.9999:0.0:1.0E-4	.	429	Q9H361	PABP3_HUMAN	H	429	ENSP00000281589:P429H	ENSP00000281589:P429H	P	+	2	0	PABPC3	24569622	1.000000	0.71417	0.860000	0.33809	0.043000	0.13939	1.853000	0.39358	0.593000	0.29745	0.313000	0.20887	CCT		0.512	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		17	152	1	0	2.98393e-07	0.00278	3.82622e-07	17	152				
MTMR6	9107	broad.mit.edu	37	13	25826072	25826072	+	Missense_Mutation	SNP	T	T	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:25826072T>G	ENST00000381801.5	-	12	2158	c.1397A>C	c.(1396-1398)aAg>aCg	p.K466T	MTMR6_ENST00000540661.1_Missense_Mutation_p.K466T	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	466	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		TAAGTACTTCTTTTGGTCTTC	0.348																																							uc001uqf.3		NA																	0				ovary(2)|skin(2)	4						c.(1396-1398)AAG>ACG		myotubularin related protein 6							111.0	126.0	121.0					13																	25826072		2203	4298	6501	SO:0001583	missense	9107					cytoplasm|nuclear envelope	calcium-activated potassium channel activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr13:25826072T>G	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1397A>C	13.37:g.25826072T>G	ENSP00000371221:p.Lys466Thr		Somatic				MTMR6_uc001uqe.1_Missense_Mutation_p.K466T	p.K466T	NM_004685	NP_004676	WXS	Illumina HiSeq	Unspecified	Q9Y217	MTMR6_HUMAN		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)	12	1716	-		Lung SC(185;0.0225)|Breast(139;0.0351)	466			Myotubularin phosphatase.		B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	c.1397A>C	CCDS9313.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.908|8.908	0.958027|0.958027	0.18507|0.18507	.|.	.|.	ENSG00000139505|ENSG00000139505	ENST00000319298|ENST00000540661;ENST00000541021;ENST00000381801	.|D;D	.|0.90444	.|-2.67;-2.67	5.58|5.58	3.08|3.08	0.35506|0.35506	.|Myotubularin phosphatase domain (1);	0.416878|0.416878	0.30714|0.30714	N|N	0.009030|0.009030	T|T	0.77638|0.77638	0.4160|0.4160	N|N	0.11651|0.11651	0.15|0.15	0.40445|0.40445	D|D	0.98008|0.98008	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.65150|0.65150	-0.6238|-0.6238	7|10	0.24483|0.31617	T|T	0.36|0.26	.|.	5.5844|5.5844	0.17267|0.17267	0.0:0.146:0.1459:0.7081|0.0:0.146:0.1459:0.7081	.|.	.|466;466	.|Q9Y217;Q9Y217-2	.|MTMR6_HUMAN;.	N|T	35|466	.|ENSP00000443161:K466T;ENSP00000371221:K466T	ENSP00000317987:K35N|ENSP00000371221:K466T	K|K	-|-	3|2	2|0	MTMR6|MTMR6	24724072|24724072	0.998000|0.998000	0.40836|0.40836	0.978000|0.978000	0.43139|0.43139	0.960000|0.960000	0.62799|0.62799	1.458000|1.458000	0.35223|0.35223	0.380000|0.380000	0.24823|0.24823	0.477000|0.477000	0.44152|0.44152	AAA|AAG		0.348	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685		59	60	0	0	0	0.01441	0	59	60				
PCDH17	27253	broad.mit.edu	37	13	58206761	58206761	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:58206761G>T	ENST00000377918.3	+	1	107	c.81G>T	c.(79-81)gaG>gaT	p.E27D		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	27	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CCGTGCCGGAGGAGCAAGGGG	0.632																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(79-81)GAG>GAT		protocadherin 17 precursor							41.0	39.0	40.0					13																	58206761		2203	4300	6503	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58206761G>T	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.81G>T	13.37:g.58206761G>T	ENSP00000367151:p.Glu27Asp		Somatic				PCDH17_uc010aec.1_Missense_Mutation_p.E27D	p.E27D	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	973	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	27			Extracellular (Potential).|Cadherin 1.		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.81G>T	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655976	0.47467	.	.	ENSG00000118946	ENST00000377918	T	0.59772	0.24	5.55	4.71	0.59529	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.045219	0.85682	D	0.000000	T	0.69169	0.3081	M	0.92077	3.27	0.49299	D	0.999776	B;B	0.21606	0.047;0.058	B;B	0.36766	0.149;0.232	T	0.68945	-0.5275	9	.	.	.	.	9.4352	0.38635	0.0714:0.0:0.7864:0.1423	.	27;27	O14917-2;O14917	.;PCD17_HUMAN	D	27	ENSP00000367151:E27D	.	E	+	3	2	PCDH17	57104762	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.451000	0.73481	1.591000	0.50007	0.655000	0.94253	GAG		0.632	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		10	5	1	0	0.000673444	0.008291	0.000740409	10	5				
TBC1D4	9882	broad.mit.edu	37	13	75861045	75861045	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:75861045C>G	ENST00000377636.3	-	21	4126	c.3780G>C	c.(3778-3780)aaG>aaC	p.K1260N	TBC1D4_ENST00000377625.2_Missense_Mutation_p.K1197N|TBC1D4_ENST00000425511.1_Missense_Mutation_p.K424N|TBC1D4_ENST00000431480.2_Missense_Mutation_p.K1252N	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1260					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GCTCCACTGTCTTTTGATAAG	0.463																																							uc001vjl.1		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(3778-3780)AAG>AAC		TBC1 domain family, member 4							120.0	118.0	119.0					13																	75861045		1862	4105	5967	SO:0001583	missense	9882					cytoplasm	Rab GTPase activator activity	g.chr13:75861045C>G	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.3780G>C	13.37:g.75861045C>G	ENSP00000366863:p.Lys1260Asn		Somatic				TBC1D4_uc010tht.1_Missense_Mutation_p.K470N|TBC1D4_uc010thu.1_Missense_Mutation_p.K417N|TBC1D4_uc010aer.2_Missense_Mutation_p.K1252N|TBC1D4_uc010aes.2_Missense_Mutation_p.K1197N	p.K1260N	NM_014832	NP_055647	WXS	Illumina HiSeq	Unspecified	O60343	TBCD4_HUMAN		GBM - Glioblastoma multiforme(99;0.0116)	21	4127	-		Prostate(6;0.014)|Breast(118;0.0982)	1260					A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	37	c.3780G>C	CCDS41901.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006939	0.54361	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.04194	3.94;3.93;3.96;3.68	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000003	T	0.05227	0.0139	L	0.34521	1.04	0.58432	D	0.99999	B;B;B;B	0.22746	0.007;0.007;0.007;0.074	B;B;B;B	0.17979	0.007;0.011;0.011;0.02	T	0.47209	-0.9135	10	0.25106	T	0.35	-35.8167	14.8438	0.70246	0.1438:0.8562:0.0:0.0	.	424;1197;1252;1260	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	N	1260;1252;1197;424	ENSP00000366863:K1260N;ENSP00000395986:K1252N;ENSP00000366852:K1197N;ENSP00000390654:K424N	ENSP00000366852:K1197N	K	-	3	2	TBC1D4	74759046	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.141000	0.42168	2.798000	0.96311	0.655000	0.94253	AAG		0.463	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832		10	35	0	0	0	0.010729	0	10	35				
SLITRK5	26050	broad.mit.edu	37	13	88328774	88328774	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:88328774G>T	ENST00000325089.6	+	2	1350	c.1131G>T	c.(1129-1131)gcG>gcT	p.A377A	SLITRK5_ENST00000400028.3_Silent_p.A136A	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	377	LRRNT.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.A377A(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GTCCCACCGCGTGCTCTTGCA	0.577																																							uc001vln.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(1129-1131)GCG>GCT		SLIT and NTRK-like family, member 5 precursor							73.0	64.0	67.0					13																	88328774		2203	4300	6503	SO:0001819	synonymous_variant	26050					integral to membrane		g.chr13:88328774G>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1131G>T	13.37:g.88328774G>T			Somatic				SLITRK5_uc010tic.1_Silent_p.A136A	p.A377A	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	1350	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		377			Extracellular (Potential).|LRRNT.		B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	c.1131G>T	CCDS9465.1																																																																																				0.577	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			16	22	1	0	3.99206e-14	0.007413	6.2717e-14	16	22				
DCT	1638	broad.mit.edu	37	13	95121220	95121220	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:95121220C>A	ENST00000377028.5	-	2	788	c.375G>T	c.(373-375)gtG>gtT	p.V125V	DCT_ENST00000446125.1_Silent_p.V125V|DCT_ENST00000490854.1_5'Flank	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	125					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TCTGCCGAATCACTGGTGGTT	0.502																																							uc001vlv.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(373-375)GTG>GTT		dopachrome tautomerase isoform 1							186.0	189.0	188.0					13																	95121220		2203	4300	6503	SO:0001819	synonymous_variant	1638				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity	g.chr13:95121220C>A	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.375G>T	13.37:g.95121220C>A			Somatic				DCT_uc010afh.2_Silent_p.V125V	p.V125V	NM_001922	NP_001913	WXS	Illumina HiSeq	Unspecified	P40126	TYRP2_HUMAN		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)	2	802	-	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)	125			Lumenal, melanosome (Potential).		Q09GT4	Silent	SNP	ENST00000377028.5	37	c.375G>T	CCDS9470.1																																																																																				0.502	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3			74	91	1	0	2.77303e-49	0.01441	5.19168e-49	74	91				
COL4A2	1284	broad.mit.edu	37	13	111090995	111090995	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:111090995A>T	ENST00000360467.5	+	15	1198	c.892A>T	c.(892-894)Atg>Ttg	p.M298L		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	298	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AGAAGGAATCATGGGCTTTCC	0.522																																							uc001vqx.2		NA																	0				skin(3)|central_nervous_system(2)|ovary(1)	6						c.(892-894)ATG>TTG		alpha 2 type IV collagen preproprotein							150.0	154.0	152.0					13																	111090995		1894	4120	6014	SO:0001583	missense	1284				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	g.chr13:111090995A>T	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.892A>T	13.37:g.111090995A>T	ENSP00000353654:p.Met298Leu		Somatic					p.M298L	NM_001846	NP_001837	WXS	Illumina HiSeq	Unspecified	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		15	1181	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	298			Triple-helical region.		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	c.892A>T	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	A	6.109	0.388454	0.11581	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.95205	-3.64	4.52	-2.53	0.06326	.	0.190183	0.36002	N	0.002850	D	0.85301	0.5665	N	0.22421	0.69	0.30737	N	0.746581	B	0.02656	0.0	B	0.04013	0.001	T	0.73288	-0.4030	10	0.34782	T	0.22	.	5.4244	0.16417	0.4685:0.1553:0.3763:0.0	.	298	P08572	CO4A2_HUMAN	L	298	ENSP00000353654:M298L	ENSP00000257309:M298L	M	+	1	0	COL4A2	109888996	0.935000	0.31712	0.910000	0.35882	0.240000	0.25518	0.022000	0.13511	-0.342000	0.08363	-0.385000	0.06624	ATG		0.522	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846		26	29	0	0	0	0.013726	0	26	29				
MCF2L	23263	broad.mit.edu	37	13	113699673	113699673	+	Missense_Mutation	SNP	G	G	A	rs199644323		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:113699673G>A	ENST00000375608.3	+	5	515	c.457G>A	c.(457-459)Gca>Aca	p.A153T	MCF2L_ENST00000375604.2_Missense_Mutation_p.A180T|MCF2L_ENST00000397030.1_Missense_Mutation_p.A156T|MCF2L_ENST00000535094.2_Missense_Mutation_p.A123T|MCF2L_ENST00000375601.3_Missense_Mutation_p.A127T|MCF2L_ENST00000434480.2_Missense_Mutation_p.A129T|MCF2L_ENST00000480321.1_3'UTR|MCF2L_ENST00000397021.1_Missense_Mutation_p.A85T|MCF2L_ENST00000442652.2_Missense_Mutation_p.A153T|MCF2L_ENST00000423482.2_Missense_Mutation_p.A121T|MCF2L_ENST00000375597.4_Missense_Mutation_p.A121T|MCF2L_ENST00000421756.1_Missense_Mutation_p.A127T			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	153	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CCTGCGCATCGCAGTAAGTGC	0.652																																							uc001vsu.2		NA																	0				ovary(1)|kidney(1)	2						c.(538-540)GCA>ACA		MCF.2 cell line derived transforming		G	THR/ALA,THR/ALA	0,4406		0,0,2203	53.0	48.0	50.0		367,361	4.3	1.0	13		50	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	MCF2L	NM_001112732.2,NM_024979.4	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	123/1126,121/1124	113699673	1,13005	2203	4300	6503	SO:0001583	missense	23263				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity	g.chr13:113699673G>A	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.457G>A	13.37:g.113699673G>A	ENSP00000364758:p.Ala153Thr		Somatic				MCF2L_uc001vsq.2_Missense_Mutation_p.A180T|MCF2L_uc010tjr.1_Missense_Mutation_p.A123T|MCF2L_uc001vsr.2_Missense_Mutation_p.A127T|MCF2L_uc001vss.3_Missense_Mutation_p.A121T|MCF2L_uc010tjs.1_Missense_Mutation_p.A121T|MCF2L_uc001vst.1_Missense_Mutation_p.A85T	p.A180T	NM_001112732	NP_001106203	WXS	Illumina HiSeq	Unspecified	O15068	MCF2L_HUMAN			4	560	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)	153			CRAL-TRIO.		A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	37	c.538G>A		.	.	.	.	.	.	.	.	.	.	G	18.51	3.639079	0.67244	0.0	1.16E-4	ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000430480;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000409954;ENST00000423482;ENST00000375597;ENST00000397021;ENST00000423251	D;D;D;D;D;D;D;D;T;D;D;T	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-0.03;-1.81;-1.81;0.24	4.29	4.29	0.51040	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90202	0.6937	M	0.78456	2.415	0.41831	D	0.990077	D;D;D;D;P;D	0.67145	0.984;0.984;0.984;0.996;0.943;0.987	P;P;P;P;P;P	0.60173	0.613;0.613;0.701;0.87;0.475;0.802	D	0.91448	0.5179	10	0.87932	D	0	.	12.3996	0.55405	0.0:0.0:1.0:0.0	.	121;123;180;85;121;153	E9PDN8;O15068-9;G5E9A1;E2QRA2;O15068-4;O15068	.;.;.;.;.;MCF2L_HUMAN	T	153;153;180;156;123;123;127;127;129;94;121;121;85;43	ENSP00000364758:A153T;ENSP00000401422:A153T;ENSP00000364754:A180T;ENSP00000380225:A156T;ENSP00000440374:A123T;ENSP00000397285:A127T;ENSP00000364751:A127T;ENSP00000407722:A129T;ENSP00000386551:A94T;ENSP00000405639:A121T;ENSP00000364747:A121T;ENSP00000405996:A43T	ENSP00000364747:A121T	A	+	1	0	MCF2L	112747674	1.000000	0.71417	0.979000	0.43373	0.116000	0.19942	3.461000	0.53035	2.373000	0.80994	0.561000	0.74099	GCA		0.652	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4			12	7	0	0	0	0.00245	0	12	7				
MCF2L	23263	broad.mit.edu	37	13	113714936	113714936	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:113714936C>T	ENST00000375608.3	+	6	547	c.489C>T	c.(487-489)gtC>gtT	p.V163V	MCF2L_ENST00000375604.2_Silent_p.V190V|MCF2L_ENST00000397030.1_Silent_p.V166V|MCF2L_ENST00000535094.2_Silent_p.V133V|MCF2L_ENST00000375601.3_Silent_p.V137V|MCF2L_ENST00000434480.2_Silent_p.V139V|MCF2L_ENST00000442652.2_Silent_p.V163V|MCF2L_ENST00000423482.2_Silent_p.V131V|MCF2L_ENST00000375597.4_Silent_p.V131V|MCF2L_ENST00000421756.1_Silent_p.V137V			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	163	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TGCAGCTCGTCCTCGTGCTTC	0.567																																							uc001vsu.2		NA																	0				ovary(1)|kidney(1)	2						c.(568-570)GTC>GTT		MCF.2 cell line derived transforming							66.0	60.0	62.0					13																	113714936		2203	4300	6503	SO:0001819	synonymous_variant	23263				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity	g.chr13:113714936C>T	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.489C>T	13.37:g.113714936C>T			Somatic				MCF2L_uc001vsq.2_Silent_p.V190V|MCF2L_uc010tjr.1_Silent_p.V133V|MCF2L_uc001vsr.2_Silent_p.V137V|MCF2L_uc001vss.3_Silent_p.V131V|MCF2L_uc010tjs.1_Silent_p.V131V|MCF2L_uc001vst.1_Silent_p.V95V	p.V190V	NM_001112732	NP_001106203	WXS	Illumina HiSeq	Unspecified	O15068	MCF2L_HUMAN			5	592	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)	163			CRAL-TRIO.		A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Silent	SNP	ENST00000375608.3	37	c.570C>T																																																																																					0.567	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4			15	19	0	0	0	0.008871	0	15	19				
F7	2155	broad.mit.edu	37	13	113771857	113771857	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:113771857C>A	ENST00000375581.3	+	8	787	c.752C>A	c.(751-753)gCg>gAg	p.A251E	F7_ENST00000346342.3_Missense_Mutation_p.A229E|F7_ENST00000541084.1_Missense_Mutation_p.A182E	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	251	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		A -> P (in FA7D). {ECO:0000269|PubMed:19751712}.|A -> T (in FA7D). {ECO:0000269|PubMed:18976247}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	GTGGTCTCCGCGGCCCACTGT	0.617																																							uc001vsv.2		NA																	0					0	GRCh37	CM051920|CM073037	F7	M		c.(751-753)GCG>GAG		coagulation factor VII isoform a precursor	Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)						177.0	162.0	167.0					13																	113771857		2203	4300	6503	SO:0001583	missense	2155				anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity	g.chr13:113771857C>A		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.752C>A	13.37:g.113771857C>A	ENSP00000364731:p.Ala251Glu		Somatic				F7_uc001vsw.2_Missense_Mutation_p.A229E|F7_uc010tjt.1_Missense_Mutation_p.A182E	p.A251E	NM_000131	NP_000122	WXS	Illumina HiSeq	Unspecified	P08709	FA7_HUMAN	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		8	803	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	251		A -> P (in FA7D).|A -> T (in FA7D).	Peptidase S1.		B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	ENST00000375581.3	37	c.752C>A	CCDS9528.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339464	0.60963	.	.	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	D;D;D	0.95377	-3.69;-3.69;-3.69	4.34	4.34	0.51931	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98893	0.9625	H	0.99525	4.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99222	1.0879	10	0.87932	D	0	.	17.7604	0.88463	0.0:1.0:0.0:0.0	.	182;229;251	F5H8B0;P08709-2;P08709	.;.;FA7_HUMAN	E	229;182;251	ENSP00000329546:A229E;ENSP00000442051:A182E;ENSP00000364731:A251E	ENSP00000329546:A229E	A	+	2	0	F7	112819858	1.000000	0.71417	0.291000	0.24904	0.003000	0.03518	7.257000	0.78362	2.342000	0.79632	0.563000	0.77884	GCG		0.617	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4	NM_000131		37	59	1	0	1.90571e-15	0.004289	3.06798e-15	37	59				
TEP1	7011	broad.mit.edu	37	14	20849833	20849833	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:20849833C>A	ENST00000262715.5	-	31	4477	c.4437G>T	c.(4435-4437)gaG>gaT	p.E1479D	TEP1_ENST00000545983.1_Intron|TEP1_ENST00000556935.1_Missense_Mutation_p.E1371D	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1479	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCAGAGGGCCCTCCCCTAGCA	0.612																																							uc001vxe.2		NA																	0				ovary(5)	5						c.(4435-4437)GAG>GAT		telomerase-associated protein 1							57.0	60.0	59.0					14																	20849833		2203	4300	6503	SO:0001583	missense	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20849833C>A		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.4437G>T	14.37:g.20849833C>A	ENSP00000262715:p.Glu1479Asp		Somatic				TEP1_uc010ahk.2_Missense_Mutation_p.E822D|TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Missense_Mutation_p.E1371D|TEP1_uc010tlh.1_Intron	p.E1479D	NM_007110	NP_009041	WXS	Illumina HiSeq	Unspecified	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	31	4477	-	all_cancers(95;0.00123)	all_lung(585;0.235)	1479			NACHT.		A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	c.4437G>T	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985586	0.53934	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.49720	0.8;0.77	5.12	1.89	0.25635	.	0.482890	0.22396	N	0.060613	T	0.51584	0.1683	M	0.65975	2.015	0.80722	D	1	D;D;D	0.58268	0.982;0.976;0.97	P;P;P	0.58013	0.831;0.722;0.681	T	0.49244	-0.8960	10	0.20519	T	0.43	-27.5886	3.8741	0.09048	0.1609:0.5218:0.0:0.3173	.	1371;822;1479	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	D	1479;1479;1371	ENSP00000262715:E1479D;ENSP00000452574:E1371D	ENSP00000262715:E1479D	E	-	3	2	TEP1	19919673	0.989000	0.36119	0.999000	0.59377	0.938000	0.57974	0.319000	0.19522	0.138000	0.18790	0.563000	0.77884	GAG		0.612	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		11	28	1	0	0.000151284	0.001855	0.00017315	11	28				
RNASE3	6037	broad.mit.edu	37	14	21360130	21360130	+	Silent	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:21360130C>G	ENST00000304639.3	+	2	343	c.285C>G	c.(283-285)ctC>ctG	p.L95L		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	95					antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	ACAGAACTCTCAACAATTGTC	0.413																																							uc001vyj.2		NA																	0					0						c.(283-285)CTC>CTG		ribonuclease, RNase A family, 3 (eosinophil	Pranlukast(DB01411)						107.0	111.0	109.0					14																	21360130		2191	4300	6491	SO:0001819	synonymous_variant	6037				defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21360130C>G	X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.285C>G	14.37:g.21360130C>G			Somatic					p.L95L	NM_002935	NP_002926	WXS	Illumina HiSeq	Unspecified	P12724	ECP_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	2	339	+	all_cancers(95;0.00453)		95					Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Silent	SNP	ENST00000304639.3	37	c.285C>G	CCDS9560.1																																																																																				0.413	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073795.2	NM_002935		25	40	0	0	0	0.012213	0	25	40				
TPPP2	122664	broad.mit.edu	37	14	21500233	21500233	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:21500233G>T	ENST00000321760.6	+	4	658	c.510G>T	c.(508-510)aaG>aaT	p.K170N	TPPP2_ENST00000530140.2_Missense_Mutation_p.K170N|RP11-998D10.1_ENST00000531638.1_5'Flank|AL161668.5_ENST00000533984.1_lincRNA|NDRG2_ENST00000403829.3_Intron	NM_173846.4	NP_776245.2	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family member 2	170						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		AGAAGACCAAGTAGAGAGGAG	0.517																																							uc001vzh.2		NA																	0					0						c.(508-510)AAG>AAT		tubulin polymerization-promoting protein family							159.0	124.0	136.0					14																	21500233		2203	4300	6503	SO:0001583	missense	122664					cytoplasm		g.chr14:21500233G>T	AY072034	CCDS9566.1	14q11.2	2014-01-21	2007-05-02	2007-05-02	ENSG00000179636	ENSG00000179636			19293	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 8"""	C14orf8		15590652, 17105200	Standard	NM_173846		Approved	p25beta, p18, CT152	uc001vzh.3	P59282	OTTHUMG00000029642	ENST00000321760.6:c.510G>T	14.37:g.21500233G>T	ENSP00000317595:p.Lys170Asn		Somatic				NDRG2_uc010tll.1_Intron	p.K170N	NM_173846	NP_776245	WXS	Illumina HiSeq	Unspecified	P59282	TPPP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)	4	698	+	all_cancers(95;0.000759)		170					Q2VYF3	Missense_Mutation	SNP	ENST00000321760.6	37	c.510G>T	CCDS9566.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574930	0.28092	.	.	ENSG00000179636	ENST00000321760;ENST00000530140	T;T	0.52295	0.67;0.67	4.47	-2.87	0.05700	.	0.408748	0.22313	N	0.061704	T	0.30198	0.0757	L	0.42245	1.32	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13575	-1.0504	10	0.72032	D	0.01	.	2.799	0.05409	0.2554:0.1424:0.4879:0.1143	.	170	P59282	TPPP2_HUMAN	N	170	ENSP00000317595:K170N;ENSP00000435356:K170N	ENSP00000317595:K170N	K	+	3	2	TPPP2	20570073	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.357000	0.07651	-0.709000	0.05008	-0.182000	0.12963	AAG		0.517	TPPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073914.3	NM_173846		8	40	1	0	0.000274275	0.004482	0.000309087	8	40				
LRP10	26020	broad.mit.edu	37	14	23345384	23345384	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:23345384G>C	ENST00000359591.4	+	5	1918	c.1227G>C	c.(1225-1227)gaG>gaC	p.E409D	LRP10_ENST00000546834.1_Missense_Mutation_p.E409D	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	409	LDL-receptor class A 4. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		GCCGGGACGAGAAGTGCGTGT	0.582																																							uc001whd.2		NA																	0				central_nervous_system(1)	1						c.(1225-1227)GAG>GAC		low density lipoprotein receptor-related protein							193.0	175.0	181.0					14																	23345384		2203	4300	6503	SO:0001583	missense	26020				endocytosis	coated pit|integral to membrane		g.chr14:23345384G>C	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.1227G>C	14.37:g.23345384G>C	ENSP00000352601:p.Glu409Asp		Somatic				LRP10_uc001whe.2_Missense_Mutation_p.E285D	p.E409D	NM_014045	NP_054764	WXS	Illumina HiSeq	Unspecified	Q7Z4F1	LRP10_HUMAN		GBM - Glioblastoma multiforme(265;0.00549)	5	1780	+	all_cancers(95;4.69e-05)		409			LDL-receptor class A 4.|Extracellular (Potential).		A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	37	c.1227G>C	CCDS9578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.58|10.58	1.389681|1.389681	0.25118|0.25118	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000359591;ENST00000546834|ENST00000551466	D;T|T	0.95622|0.43688	-3.76;1.24|0.94	5.97|5.97	3.97|3.97	0.46021|0.46021	.|.	0.135168|0.135168	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.25494|0.25494	0.0620|0.0620	N|N	0.05510|0.05510	-0.035|-0.035	0.34835|0.34835	D|D	0.740098|0.740098	B|.	0.12013|.	0.005|.	B|.	0.12156|.	0.007|.	T|T	0.36432|0.36432	-0.9748|-0.9748	10|8	0.27082|0.39692	T|T	0.32|0.17	-15.5172|-15.5172	8.1041|8.1041	0.30874|0.30874	0.1515:0.0:0.7084:0.1401|0.1515:0.0:0.7084:0.1401	.|.	409|.	Q7Z4F1|.	LRP10_HUMAN|.	D|Q	409|311	ENSP00000352601:E409D;ENSP00000447559:E409D|ENSP00000447977:E311Q	ENSP00000352601:E409D|ENSP00000447977:E311Q	E|E	+|+	3|1	2|0	LRP10|LRP10	22415224|22415224	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	0.415000|0.415000	0.21181|0.21181	1.531000|1.531000	0.49152|0.49152	0.655000|0.655000	0.94253|0.94253	GAG|GAA		0.582	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3			3	164	0	0	0	0.000602	0	3	164				
MYH7	4625	broad.mit.edu	37	14	23902898	23902898	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:23902898T>C	ENST00000355349.3	-	3	206	c.44A>G	c.(43-45)tAc>tGc	p.Y15C		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	15					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTTGCGCAGGTAGGGGGCGGC	0.572																																							uc001wjx.2		NA																	0				ovary(3)|skin(1)	4						c.(43-45)TAC>TGC		myosin, heavy chain 7, cardiac muscle, beta							60.0	60.0	60.0					14																	23902898		2203	4300	6503	SO:0001583	missense	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23902898T>C	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.44A>G	14.37:g.23902898T>C	ENSP00000347507:p.Tyr15Cys		Somatic					p.Y15C	NM_000257	NP_000248	WXS	Illumina HiSeq	Unspecified	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	3	150	-	all_cancers(95;2.54e-05)		15			Myosin head-like.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.44A>G	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.625487	0.66901	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.86956	-2.19	4.26	-8.51	0.00923	.	.	.	.	.	D	0.88276	0.6393	M	0.93763	3.455	0.41869	D	0.990264	B	0.06786	0.001	B	0.13407	0.009	T	0.66372	-0.5940	9	0.87932	D	0	.	14.253	0.66033	0.711:0.0:0.0:0.289	.	15	P12883	MYH7_HUMAN	C	15	ENSP00000347507:Y15C	ENSP00000347507:Y15C	Y	-	2	0	MYH7	22972738	0.974000	0.33945	0.882000	0.34594	0.974000	0.67602	0.139000	0.16036	-2.085000	0.00864	0.454000	0.30748	TAC		0.572	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		16	14	0	0	0	0.008871	0	16	14				
THTPA	79178	broad.mit.edu	37	14	24026245	24026245	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:24026245T>C	ENST00000288014.6	+	1	1015	c.279T>C	c.(277-279)tgT>tgC	p.C93C	RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_Silent_p.C93C|RP11-66N24.4_ENST00000553985.1_RNA|THTPA_ENST00000554789.1_Silent_p.C93C|THTPA_ENST00000554970.1_Splice_Site|RP11-66N24.4_ENST00000556354.1_RNA|THTPA_ENST00000556015.1_Silent_p.C93C			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	93	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		CCCAACTCTGTAAGGTGCTGC	0.582																																							uc001wkh.3		NA																	0					0						c.(277-279)TGT>TGC		thiamine triphosphatase	Thiamine(DB00152)						94.0	87.0	89.0					14																	24026245		2203	4300	6503	SO:0001819	synonymous_variant	79178				dephosphorylation|generation of precursor metabolites and energy|thiamine metabolic process	cytosol|nucleolus|soluble fraction	thiamin-triphosphatase activity	g.chr14:24026245T>C	AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.279T>C	14.37:g.24026245T>C			Somatic				THTPA_uc001wkb.3_Intron|THTPA_uc001wkg.3_Silent_p.C93C|THTPA_uc010akr.2_Intron|THTPA_uc001wki.3_Silent_p.C93C	p.C93C	NM_001126339	NP_001119811	WXS	Illumina HiSeq	Unspecified	Q9BU02	THTPA_HUMAN		GBM - Glioblastoma multiforme(265;0.00643)	2	649	+	all_cancers(95;0.000251)		93					D3DS50|G3V4J3	Silent	SNP	ENST00000288014.6	37	c.279T>C	CCDS32053.1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.816172	0.50527	.	.	ENSG00000157306	ENST00000554970;ENST00000556545	.	.	.	5.38	3.02	0.34903	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4582	0.21942	0.0:0.0823:0.1586:0.7591	.	.	.	.	.	-1	.	.	.	+	.	.	THTPA	23096085	0.931000	0.31567	0.951000	0.38953	0.929000	0.56500	0.735000	0.26115	0.485000	0.27652	0.533000	0.62120	.		0.582	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413800.2			5	64	0	0	0	0.00308	0	5	64				
LTB4R2	56413	broad.mit.edu	37	14	24780785	24780785	+	Silent	SNP	G	G	T	rs148919542		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:24780785G>T	ENST00000528054.1	+	1	2625	c.1008G>T	c.(1006-1008)acG>acT	p.T336T	LTB4R2_ENST00000543919.1_Silent_p.T305T|CIDEB_ENST00000258807.5_5'Flank|LTB4R_ENST00000396789.4_5'Flank|CIDEB_ENST00000555817.1_5'Flank|LTB4R_ENST00000345363.3_5'UTR|LTB4R2_ENST00000533293.1_Silent_p.T305T|CIDEB_ENST00000336557.5_5'Flank			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	336					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		GTTTCCTCACGCGGCTCTTCG	0.647																																							uc001woq.1		NA																	0					0						c.(1006-1008)ACG>ACT		leukotriene B4 receptor 2							39.0	48.0	45.0					14																	24780785		2203	4299	6502	SO:0001819	synonymous_variant	56413				chemotaxis|negative regulation of adenylate cyclase activity	integral to plasma membrane		g.chr14:24780785G>T	AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.1008G>T	14.37:g.24780785G>T			Somatic				CIDEB_uc001woo.2_5'Flank|CIDEB_uc001wop.2_5'Flank|LTB4R2_uc010alo.2_Silent_p.T305T|LTB4R2_uc001wor.2_Silent_p.T305T|LTB4R_uc001wos.2_5'UTR|LTB4R_uc010alp.2_5'Flank	p.T336T	NM_019839	NP_062813	WXS	Illumina HiSeq	Unspecified	Q9NPC1	LT4R2_HUMAN		GBM - Glioblastoma multiforme(265;0.018)	1	2625	+			336			Cytoplasmic (Potential).		Q5KU28|Q9NPE5	Silent	SNP	ENST00000528054.1	37	c.1008G>T																																																																																					0.647	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000073194.4			11	38	1	0	1.36491e-13	0.001855	2.11039e-13	11	38				
SYNE2	23224	broad.mit.edu	37	14	64675528	64675528	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:64675528A>C	ENST00000344113.4	+	101	18466	c.18254A>C	c.(18253-18255)aAc>aCc	p.N6085T	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000394768.2_Missense_Mutation_p.N2470T|SYNE2_ENST00000555002.1_Missense_Mutation_p.N2719T|SYNE2_ENST00000358025.3_Missense_Mutation_p.N6085T|SYNE2_ENST00000555022.1_5'UTR|SYNE2_ENST00000357395.3_Missense_Mutation_p.N2470T|SYNE2_ENST00000554584.1_Missense_Mutation_p.N6047T|SYNE2_ENST00000554805.1_5'Flank	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6085					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCCGTGTTTAACATCTGTGAC	0.527																																							uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(18253-18255)AAC>ACC		spectrin repeat containing, nuclear envelope 2							129.0	105.0	113.0					14																	64675528		2203	4300	6503	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64675528A>C	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18254A>C	14.37:g.64675528A>C	ENSP00000341781:p.Asn6085Thr		Somatic				SYNE2_uc001xgl.2_Missense_Mutation_p.N6085T|SYNE2_uc010apy.2_Missense_Mutation_p.N2470T|SYNE2_uc001xgn.2_Missense_Mutation_p.N1047T|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_Missense_Mutation_p.N55T|SYNE2_uc001xgq.2_Missense_Mutation_p.N450T|SYNE2_uc001xgr.2_5'Flank	p.N6085T	NM_015180	NP_055995	WXS	Illumina HiSeq	Unspecified	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	101	18484	+			6085			Cytoplasmic (Potential).|Spectrin 6.		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.18254A>C	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	12.09	1.835079	0.32421	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000556906	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	5.66	3.35	0.38373	.	0.000000	0.52532	D	0.000078	T	0.47284	0.1437	L	0.35854	1.095	0.80722	D	1	P;P;B;P;P	0.41475	0.678;0.751;0.211;0.747;0.67	P;P;B;P;B	0.51582	0.674;0.531;0.081;0.627;0.332	T	0.43097	-0.9412	10	0.54805	T	0.06	.	8.6053	0.33769	0.7875:0.0:0.2125:0.0	.	2470;473;6047;6085;6085	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	T	6085;2470;6085;6047;6053;2719;2470;55	ENSP00000350719:N6085T;ENSP00000349969:N2470T;ENSP00000341781:N6085T;ENSP00000452570:N6047T;ENSP00000450831:N2719T;ENSP00000378249:N2470T;ENSP00000452298:N55T	ENSP00000261678:N6053T	N	+	2	0	SYNE2	63745281	0.998000	0.40836	1.000000	0.80357	0.941000	0.58515	1.093000	0.30939	0.988000	0.38734	0.460000	0.39030	AAC		0.527	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		26	72	0	0	0	0.003755	0	26	72				
DCAF5	8816	broad.mit.edu	37	14	69520831	69520831	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:69520831C>G	ENST00000341516.5	-	9	2719	c.2572G>C	c.(2572-2574)Gcc>Ccc	p.A858P	DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000554215.1_Missense_Mutation_p.A776P|DCAF5_ENST00000556847.1_Missense_Mutation_p.A776P|DCAF5_ENST00000557386.1_Missense_Mutation_p.A857P	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	858					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						GAAGAGTAGGCCACCACCTCC	0.557																																							uc001xkp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2572-2574)GCC>CCC		WD repeat domain 22							129.0	113.0	119.0					14																	69520831		2203	4300	6503	SO:0001583	missense	8816					CUL4 RING ubiquitin ligase complex		g.chr14:69520831C>G	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2572G>C	14.37:g.69520831C>G	ENSP00000341351:p.Ala858Pro		Somatic				DCAF5_uc001xkq.2_Missense_Mutation_p.A857P	p.A858P	NM_003861	NP_003852	WXS	Illumina HiSeq	Unspecified	Q96JK2	DCAF5_HUMAN			9	2791	-			858					B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	c.2572G>C	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	C	9.344	1.063766	0.20067	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.68624	-0.34;-0.17;-0.17;0.28	5.09	2.04	0.26737	.	0.330584	0.26311	N	0.025119	T	0.49304	0.1549	N	0.19112	0.55	0.26084	N	0.981054	B;B	0.28880	0.226;0.145	B;B	0.34873	0.191;0.093	T	0.42481	-0.9449	10	0.40728	T	0.16	-7.1464	7.5398	0.27731	0.0:0.5907:0.0:0.4093	.	857;858	G3V4J7;Q96JK2	.;DCAF5_HUMAN	P	858;776;776;857	ENSP00000341351:A858P;ENSP00000451551:A776P;ENSP00000452052:A776P;ENSP00000451845:A857P	ENSP00000341351:A858P	A	-	1	0	DCAF5	68590584	0.489000	0.26004	0.751000	0.31187	0.685000	0.39939	0.368000	0.20399	0.715000	0.32103	0.561000	0.74099	GCC		0.557	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861		6	32	0	0	0	0.004482	0	6	32				
SLC8A3	6547	broad.mit.edu	37	14	70635016	70635016	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:70635016C>T	ENST00000381269.2	-	2	877	c.124G>A	c.(124-126)Ggg>Agg	p.G42R	SLC8A3_ENST00000356921.2_Missense_Mutation_p.G42R|SLC8A3_ENST00000357887.3_Missense_Mutation_p.G42R|SLC8A3_ENST00000534137.1_Missense_Mutation_p.G42R|SLC8A3_ENST00000528359.1_Missense_Mutation_p.G42R	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	42					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTGTTCTGCCCTGTGCTTGGC	0.562																																							uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(124-126)GGG>AGG		solute carrier family 8 (sodium/calcium							72.0	59.0	63.0					14																	70635016		2203	4300	6503	SO:0001583	missense	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70635016C>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.124G>A	14.37:g.70635016C>T	ENSP00000370669:p.Gly42Arg		Somatic				SLC8A3_uc001xlw.2_Missense_Mutation_p.G42R|SLC8A3_uc001xlx.2_Missense_Mutation_p.G42R|SLC8A3_uc001xlz.2_Missense_Mutation_p.G42R|SLC8A3_uc010ara.2_RNA	p.G42R	NM_183002	NP_892114	WXS	Illumina HiSeq	Unspecified	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	2	878	-			42			Extracellular (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	c.124G>A	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728493	0.30593	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.37411	1.26;1.2;1.34;1.27;1.34	4.84	4.84	0.62591	.	0.456273	0.23391	N	0.048697	T	0.42337	0.1198	L	0.43923	1.385	0.39141	D	0.962047	P;P;P;P	0.51240	0.631;0.684;0.866;0.943	B;B;P;P	0.49140	0.369;0.177;0.601;0.57	T	0.38802	-0.9644	10	0.45353	T	0.12	.	18.1311	0.89602	0.0:1.0:0.0:0.0	.	42;42;42;42	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	R	42	ENSP00000349392:G42R;ENSP00000370669:G42R;ENSP00000350560:G42R;ENSP00000436688:G42R;ENSP00000433531:G42R	ENSP00000349392:G42R	G	-	1	0	SLC8A3	69704769	0.988000	0.35896	1.000000	0.80357	0.998000	0.95712	1.876000	0.39588	2.509000	0.84616	0.563000	0.77884	GGG		0.562	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			18	32	0	0	0	0.008871	0	18	32				
NRXN3	9369	broad.mit.edu	37	14	79175973	79175973	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:79175973G>A	ENST00000554719.1	+	4	1007	c.516G>A	c.(514-516)gtG>gtA	p.V172V	RP11-232C2.2_ENST00000555680.1_RNA|NRXN3_ENST00000335750.5_Silent_p.V172V	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	176	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GGTACCATGTGGACATTCAGC	0.478																																							uc001xun.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(514-516)GTG>GTA		neurexin 3 isoform 1 precursor							106.0	109.0	108.0					14																	79175973		2203	4300	6503	SO:0001819	synonymous_variant	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79175973G>A	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.516G>A	14.37:g.79175973G>A			Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Silent_p.V306V	p.V172V	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	4	1007	+		Renal(4;0.00876)	545			Extracellular (Potential).|Laminin G-like 3.		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000554719.1	37	c.516G>A	CCDS9870.1																																																																																				0.478	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		23	70	0	0	0	0.005443	0	23	70				
STON2	85439	broad.mit.edu	37	14	81744475	81744475	+	Missense_Mutation	SNP	C	C	A	rs201960264		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:81744475C>A	ENST00000267540.2	-	4	1380	c.1180G>T	c.(1180-1182)Gat>Tat	p.D394Y	STON2_ENST00000555447.1_Missense_Mutation_p.D394Y|STON2_ENST00000556280.1_5'Flank	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	394					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CCAAAGTGATCAGGGTCATCA	0.488																																							uc010tvu.1		NA																	0				skin(3)|pancreas(2)	5						c.(1180-1182)GAT>TAT		stonin 2							88.0	84.0	86.0					14																	81744475		2203	4300	6503	SO:0001583	missense	85439				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding	g.chr14:81744475C>A	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.1180G>T	14.37:g.81744475C>A	ENSP00000267540:p.Asp394Tyr		Somatic				STON2_uc001xvk.1_Missense_Mutation_p.D394Y|STON2_uc010tvt.1_Missense_Mutation_p.D191Y	p.D394Y	NM_033104	NP_149095	WXS	Illumina HiSeq	Unspecified	Q8WXE9	STON2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0348)	4	1381	-			394					G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	c.1180G>T	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681347	0.68042	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.20200	2.09;2.1	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.50274	0.1606	M	0.71581	2.175	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.38499	-0.9658	10	0.66056	D	0.02	-24.0971	20.8794	0.99867	0.0:1.0:0.0:0.0	.	394;394	Q8WXE9;G3V2T7	STON2_HUMAN;.	Y	394;406;394	ENSP00000450857:D394Y;ENSP00000267540:D394Y	ENSP00000267540:D394Y	D	-	1	0	STON2	80814228	1.000000	0.71417	0.969000	0.41365	0.958000	0.62258	5.204000	0.65180	2.941000	0.99782	0.655000	0.94253	GAT		0.488	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104		9	36	1	0	0.000442599	0.006214	0.000493086	9	36				
FLRT2	23768	broad.mit.edu	37	14	86089745	86089745	+	Silent	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:86089745C>G	ENST00000330753.4	+	2	2654	c.1887C>G	c.(1885-1887)acC>acG	p.T629T	FLRT2_ENST00000554746.1_Silent_p.T629T	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	629					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CCATTTACACCCCAAATGGGG	0.478																																							uc001xvr.2		NA																	0				ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4						c.(1885-1887)ACC>ACG		fibronectin leucine rich transmembrane protein 2							192.0	201.0	198.0					14																	86089745		2203	4298	6501	SO:0001819	synonymous_variant	23768				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity	g.chr14:86089745C>G	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1887C>G	14.37:g.86089745C>G			Somatic				FLRT2_uc010atd.2_Silent_p.T629T	p.T629T	NM_013231	NP_037363	WXS	Illumina HiSeq	Unspecified	O43155	FLRT2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0319)	2	2654	+			629			Cytoplasmic (Potential).		A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	c.1887C>G	CCDS9877.1																																																																																				0.478	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1			62	220	0	0	0	0.01441	0	62	220				
TTC8	123016	broad.mit.edu	37	14	89337909	89337909	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:89337909G>T	ENST00000345383.5	+	11	1120	c.1036G>T	c.(1036-1038)Ggc>Tgc	p.G346C	TTC8_ENST00000536576.1_Missense_Mutation_p.G117C|TTC8_ENST00000338104.6_Missense_Mutation_p.G372C|TTC8_ENST00000358622.5_Missense_Mutation_p.G158C|TTC8_ENST00000380656.2_Missense_Mutation_p.G356C|TTC8_ENST00000354441.6_Missense_Mutation_p.G91C|TTC8_ENST00000346301.4_Missense_Mutation_p.G316C	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	382					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GCTGCAGATGGGCATTTATAA	0.383																																							uc010ath.2		NA																	0					0						c.(1114-1116)GGC>TGC		tetratricopeptide repeat domain 8 isoform B							75.0	72.0	73.0					14																	89337909		2203	4300	6503	SO:0001583	missense	123016	Bardet-Biedl_syndrome			cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding	g.chr14:89337909G>T	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1036G>T	14.37:g.89337909G>T	ENSP00000339486:p.Gly346Cys		Somatic				TTC8_uc001xxl.2_Missense_Mutation_p.G117C|TTC8_uc010ati.2_Missense_Mutation_p.G158C|TTC8_uc001xxm.2_Missense_Mutation_p.G316C|TTC8_uc010atj.2_Missense_Mutation_p.G91C|TTC8_uc001xxi.2_Missense_Mutation_p.G356C|TTC8_uc001xxj.2_Missense_Mutation_p.G346C|TTC8_uc001xxk.2_Missense_Mutation_p.G316C	p.G372C	NM_198309	NP_938051	WXS	Illumina HiSeq	Unspecified	Q8TAM2	TTC8_HUMAN			12	1248	+			382			TPR 5.		A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	37	c.1114G>T	CCDS9885.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	22.4|22.4|22.4	4.283797|4.283797|4.283797	0.80803|0.80803|0.80803	.|.|.	.|.|.	ENSG00000165533|ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000557580|ENST00000554686	T;T;T;T;T;T;T|.|.	0.55234|.|.	0.6;0.53;0.6;0.6;0.53;0.6;0.6|.|.	5.88|5.88|5.88	4.99|4.99|4.99	0.66335|0.66335|0.66335	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.|.	0.047588|0.047588|.	0.85682|0.85682|.	N|D|.	0.000000|0.000000|.	T|T|T	0.79375|0.79375|0.79375	0.4435|0.4435|0.4435	M|M|M	0.85777|0.85777|0.85777	2.775|2.775|2.775	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;B;D;D|.|.	0.89917|.|.	1.0;1.0;0.09;1.0;1.0|.|.	D;D;B;D;D|.|.	0.97110|.|.	1.0;0.999;0.061;1.0;1.0|.|.	T|T|T	0.82172|0.82172|0.82172	-0.0589|-0.0589|-0.0589	10|6|5	0.87932|.|.	D|.|.	0|.|.	-18.2635|-18.2635|-18.2635	16.5084|16.5084|16.5084	0.84278|0.84278|0.84278	0.0:0.0:0.8681:0.1319|0.0:0.0:0.8681:0.1319|0.0:0.0:0.8681:0.1319	.|.|.	91;117;382;326;356|.|.	Q8TAM2-2;B3KSL8;Q8TAM2;Q8TAM2-3;Q8TAM2-4|.|.	.;.;TTC8_HUMAN;.;.|.|.	C|V|C	346;117;316;372;91;356;158|144|305	ENSP00000339486:G346C;ENSP00000445067:G117C;ENSP00000298324:G316C;ENSP00000337653:G372C;ENSP00000346427:G91C;ENSP00000370031:G356C;ENSP00000351439:G158C|.|.	ENSP00000337653:G372C|.|.	G|G|W	+|+|+	1|2|3	0|0|0	TTC8|TTC8|TTC8	88407662|88407662|88407662	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.976000|0.976000|0.976000	0.68499|0.68499|0.68499	9.429000|9.429000|9.429000	0.97481|0.97481|0.97481	1.479000|1.479000|1.479000	0.48272|0.48272|0.48272	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GGC|GGG|TGG		0.383	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596		4	26	1	0	8.12818e-05	0.001984	9.35779e-05	4	26				
IFI27L1	122509	broad.mit.edu	37	14	94563303	94563303	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:94563303G>T	ENST00000555523.1	+	2	239	c.20G>T	c.(19-21)tGg>tTg	p.W7L	IFI27L1_ENST00000554544.1_Missense_Mutation_p.W7L|IFI27L1_ENST00000557066.1_Missense_Mutation_p.W7L|IFI27L1_ENST00000556381.1_5'UTR|IFI27L1_ENST00000553350.1_3'UTR|IFI27L1_ENST00000553664.1_Missense_Mutation_p.M29I|IFI27L1_ENST00000393115.3_Missense_Mutation_p.W7L|IFI27L1_ENST00000557218.1_Missense_Mutation_p.W7L|IFI27L1_ENST00000554562.1_Missense_Mutation_p.W7L	NM_206949.2	NP_996832.1	Q96BM0	I27L1_HUMAN	interferon, alpha-inducible protein 27-like 1	7						integral component of membrane (GO:0016021)				lung(2)	2						GAGAGTGGATGGGACTCAGGT	0.532																																							uc001ycl.2		NA																	0					0						c.(19-21)TGG>TTG		interferon, alpha-inducible protein 27-like 1							132.0	96.0	108.0					14																	94563303		2203	4300	6503	SO:0001583	missense	122509					integral to membrane		g.chr14:94563303G>T	BC015423	CCDS9919.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000165948			19754	protein-coding gene	gene with protein product		611320	"""family with sequence similarity 14, member B"""	FAM14B			Standard	NM_145249		Approved		uc001yck.3	Q96BM0		ENST00000555523.1:c.20G>T	14.37:g.94563303G>T	ENSP00000451851:p.Trp7Leu		Somatic				IFI27L1_uc001yck.2_Missense_Mutation_p.W7L	p.W7L	NM_206949	NP_996832	WXS	Illumina HiSeq	Unspecified	Q96BM0	I27L1_HUMAN			2	228	+			7						Missense_Mutation	SNP	ENST00000555523.1	37	c.20G>T	CCDS9919.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.825|7.825	0.718691|0.718691	0.15372|0.15372	.|.	.|.	ENSG00000165948|ENSG00000165948	ENST00000553664|ENST00000555523;ENST00000393115;ENST00000557218;ENST00000554544;ENST00000557066;ENST00000554562	.|T;T;T	.|0.42513	.|1.61;1.61;0.97	0.67|0.67	0.67|0.67	0.17923|0.17923	.|.	.|30.216700	.|0.00597	.|U	.|0.000378	T|T	0.23649|0.23649	0.0572|0.0572	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B	.|0.28850	.|0.225	.|B	.|0.17433	.|0.018	T|T	0.13656|0.13656	-1.0501|-1.0501	4|9	.|0.12103	.|T	.|0.63	.|.	.|.	.|.	.|.	.|.	.|7	.|Q96BM0	.|I27L1_HUMAN	I|L	29|7	.|ENSP00000451851:W7L;ENSP00000376824:W7L;ENSP00000450620:W7L	.|ENSP00000376824:W7L	M|W	+|+	3|2	0|0	IFI27L1|IFI27L1	93633056|93633056	0.001000|0.001000	0.12720|0.12720	0.004000|0.004000	0.12327|0.12327	0.004000|0.004000	0.04260|0.04260	-0.069000|-0.069000	0.11542|0.11542	0.625000|0.625000	0.30304|0.30304	0.491000|0.491000	0.48974|0.48974	ATG|TGG		0.532	IFI27L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412868.1	NM_206949		4	19	1	0	3.59834e-05	0.001168	4.20883e-05	4	19				
SERPINA6	866	broad.mit.edu	37	14	94770882	94770882	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr14:94770882G>T	ENST00000341584.3	-	5	1237	c.1091C>A	c.(1090-1092)aCt>aAt	p.T364N		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	364					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	GGTGACCCCAGTGGAGCCAGC	0.517																																							uc001ycv.2		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1090-1092)ACT>AAT		corticosteroid binding globulin precursor	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)						186.0	146.0	160.0					14																	94770882		2203	4300	6503	SO:0001583	missense	866				regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding	g.chr14:94770882G>T	J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.1091C>A	14.37:g.94770882G>T	ENSP00000342850:p.Thr364Asn		Somatic				SERPINA6_uc010auv.2_RNA	p.T364N	NM_001756	NP_001747	WXS	Illumina HiSeq	Unspecified	P08185	CBG_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	5	1195	-		all_cancers(154;0.0482)|all_epithelial(191;0.166)	364					A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	37	c.1091C>A	CCDS9924.1	.	.	.	.	.	.	.	.	.	.	G	9.512	1.106086	0.20632	.	.	ENSG00000170099	ENST00000341584	D	0.91011	-2.77	4.37	-1.5	0.08691	Serpin domain (3);	0.936265	0.08891	N	0.878649	D	0.92163	0.7515	M	0.85630	2.765	0.09310	N	1	P	0.41131	0.739	P	0.51742	0.678	D	0.83439	0.0042	10	0.72032	D	0.01	.	1.7913	0.03052	0.1635:0.2544:0.4006:0.1815	.	364	P08185	CBG_HUMAN	N	364	ENSP00000342850:T364N	ENSP00000342850:T364N	T	-	2	0	SERPINA6	93840635	0.257000	0.24022	0.000000	0.03702	0.000000	0.00434	2.931000	0.48932	-0.388000	0.07797	-1.984000	0.00453	ACT		0.517	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	NM_001756		14	23	1	0	1.62849e-17	0.004007	2.70339e-17	14	23				
SCG5	6447	broad.mit.edu	37	15	32976839	32976839	+	Missense_Mutation	SNP	C	C	A	rs202071901	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:32976839C>A	ENST00000300175.4	+	4	568	c.458C>A	c.(457-459)cCg>cAg	p.P153Q	SCG5_ENST00000413748.2_Missense_Mutation_p.P152Q|SCG5_ENST00000494364.1_Missense_Mutation_p.P152Q|SCG5_ENST00000498069.1_3'UTR|SCG5_ENST00000497208.1_Missense_Mutation_p.P153Q	NM_001144757.1	NP_001138229.1	P05408	7B2_HUMAN	secretogranin V (7B2 protein)	153					intracellular protein transport (GO:0006886)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|regulation of hormone secretion (GO:0046883)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	enzyme inhibitor activity (GO:0004857)|GTP binding (GO:0005525)|unfolded protein binding (GO:0051082)			lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	6		all_lung(180;7.32e-08)		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)		CTCTTTGATCCGGAACATGAC	0.473																																							uc001zha.2		NA																	0					0						c.(457-459)CCG>CAG		secretogranin V isoform 1							84.0	80.0	81.0					15																	32976839		1932	4130	6062	SO:0001583	missense	6447				intracellular protein transport|neuropeptide signaling pathway|peptide hormone processing|regulation of hormone secretion	extracellular region|stored secretory granule	enzyme inhibitor activity|GTP binding|unfolded protein binding	g.chr15:32976839C>A	Y00757	CCDS45207.1, CCDS45208.1	15q13-q14	2006-03-20	2006-03-20	2006-03-20	ENSG00000166922	ENSG00000166922			10816	protein-coding gene	gene with protein product	"""prohormone convertase chaperone"""	173120	"""secretory granule, neuroendocrine protein 1 (7B2 protein)"""	SGNE1		8162254, 12646671	Standard	NM_003020		Approved	7B2, SgV	uc001zha.2	P05408	OTTHUMG00000159447	ENST00000300175.4:c.458C>A	15.37:g.32976839C>A	ENSP00000300175:p.Pro153Gln		Somatic				SCG5_uc001zgz.2_Missense_Mutation_p.P152Q	p.P153Q	NM_001144757	NP_001138229	WXS	Illumina HiSeq	Unspecified	P05408	7B2_HUMAN		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)	4	575	+		all_lung(180;7.32e-08)	153					P01164|Q6FHD0|Q9BS38	Missense_Mutation	SNP	ENST00000300175.4	37	c.458C>A	CCDS45207.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659826	0.88154	.	.	ENSG00000166922	ENST00000300175;ENST00000413748;ENST00000494364;ENST00000497208;ENST00000471027	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.75236	0.3822	L	0.49455	1.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.69109	-0.5232	9	0.25751	T	0.34	.	19.8108	0.96545	0.0:1.0:0.0:0.0	.	153;152	P05408;Q6FHD0	7B2_HUMAN;.	Q	153;152;152;153;143	.	ENSP00000300175:P153Q	P	+	2	0	SCG5	30764131	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.463000	0.80869	2.698000	0.92095	0.563000	0.77884	CCG		0.473	SCG5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355438.1	NM_003020		6	13	1	0	1.06961e-07	0.00308	1.39287e-07	6	13				
TLN2	83660	broad.mit.edu	37	15	62939619	62939619	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:62939619G>T	ENST00000561311.1	+	3	340	c.110G>T	c.(109-111)cGg>cTg	p.R37L	TLN2_ENST00000306829.6_Missense_Mutation_p.R37L|RP11-625H11.1_ENST00000560347.1_5'Flank|RP11-625H11.1_ENST00000558940.1_5'Flank			Q9Y4G6	TLN2_HUMAN	talin 2	37					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						ATTCGGGAACGGGTGCCTGAG	0.468																																							uc002alb.3		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(109-111)CGG>CTG		talin 2							204.0	188.0	193.0					15																	62939619		2203	4300	6503	SO:0001583	missense	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:62939619G>T	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.110G>T	15.37:g.62939619G>T	ENSP00000453508:p.Arg37Leu		Somatic				MGC15885_uc010uib.1_5'Flank|MGC15885_uc002ala.3_5'Flank	p.R37L	NM_015059	NP_055874	WXS	Illumina HiSeq	Unspecified	Q9Y4G6	TLN2_HUMAN			1	110	+			37					A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	c.110G>T	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522268	0.64747	.	.	ENSG00000171914	ENST00000306829	T	0.70282	-0.47	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.73590	0.3606	M	0.62723	1.935	0.80722	D	1	P	0.42871	0.792	B	0.43575	0.424	T	0.76567	-0.2912	10	0.62326	D	0.03	-23.402	18.7456	0.91791	0.0:0.0:1.0:0.0	.	37	Q9Y4G6	TLN2_HUMAN	L	37	ENSP00000303476:R37L	ENSP00000303476:R37L	R	+	2	0	TLN2	60726911	1.000000	0.71417	0.820000	0.32676	0.239000	0.25481	9.803000	0.99136	2.748000	0.94277	0.655000	0.94253	CGG		0.468	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			36	83	1	0	4.21674e-32	0.01441	7.67394e-32	36	83				
HERC1	8925	broad.mit.edu	37	15	64027005	64027005	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:64027005G>T	ENST00000443617.2	-	13	2651	c.2564C>A	c.(2563-2565)cCt>cAt	p.P855H		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	855					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCGTAATGGAGGTAACAGCAT	0.383																																							uc002amp.2		NA																	0				ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						c.(2563-2565)CCT>CAT		hect domain and RCC1-like domain 1							90.0	80.0	83.0					15																	64027005		1872	4107	5979	SO:0001583	missense	8925				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity	g.chr15:64027005G>T	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.2564C>A	15.37:g.64027005G>T	ENSP00000390158:p.Pro855His		Somatic				HERC1_uc010uil.1_Intron	p.P855H	NM_003922	NP_003913	WXS	Illumina HiSeq	Unspecified	Q15751	HERC1_HUMAN			13	2712	-			855					Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	c.2564C>A	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	32	5.150903	0.94645	.	.	ENSG00000103657	ENST00000443617	T	0.59502	0.26	5.59	5.59	0.84812	.	0.000000	0.64402	U	0.000001	T	0.76256	0.3962	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77859	-0.2431	10	0.87932	D	0	.	19.5833	0.95478	0.0:0.0:1.0:0.0	.	855	Q15751	HERC1_HUMAN	H	855	ENSP00000390158:P855H	ENSP00000390158:P855H	P	-	2	0	HERC1	61814058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.612000	0.88384	0.655000	0.94253	CCT		0.383	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		3	13	1	0	1.024e-07	0.000602	1.33943e-07	3	13				
IGDCC3	9543	broad.mit.edu	37	15	65621255	65621255	+	Nonsense_Mutation	SNP	C	C	A	rs372840863		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:65621255C>A	ENST00000327987.4	-	14	2688	c.2437G>T	c.(2437-2439)Gaa>Taa	p.E813*	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	813					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGCTACTGTTCCGAGTGAGCT	0.632																																							uc002aos.2		NA																	0				ovary(3)	3						c.(2437-2439)GAA>TAA		putative neuronal cell adhesion molecule							26.0	32.0	30.0					15																	65621255		2153	4238	6391	SO:0001587	stop_gained	9543							g.chr15:65621255C>A	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2437G>T	15.37:g.65621255C>A	ENSP00000332773:p.Glu813*		Somatic				IGDCC3_uc002aor.1_Nonsense_Mutation_p.E99*	p.E813*	NM_004884	NP_004875	WXS	Illumina HiSeq	Unspecified	Q8IVU1	IGDC3_HUMAN			14	2689	-			813			Cytoplasmic (Potential).		O95215	Nonsense_Mutation	SNP	ENST00000327987.4	37	c.2437G>T	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	C	37	6.367024	0.97511	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	.	.	.	5.26	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	3.6233	2.2141	0.03955	0.1577:0.5178:0.1529:0.1717	.	.	.	.	X	813;636	.	ENSP00000332773:E813X	E	-	1	0	IGDCC3	63408308	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.112000	0.15479	0.596000	0.29794	0.650000	0.86243	GAA		0.632	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884		14	28	1	0	0.000566183	0.00499	0.000628378	14	28				
UACA	55075	broad.mit.edu	37	15	70980144	70980144	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:70980144G>A	ENST00000322954.6	-	6	625	c.440C>T	c.(439-441)cCt>cTt	p.P147L	UACA_ENST00000560441.1_Missense_Mutation_p.P134L|UACA_ENST00000379983.2_Missense_Mutation_p.P134L|UACA_ENST00000539319.1_Missense_Mutation_p.P147L	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	147					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TATGCTAGAAGGACAATCTGC	0.363																																							uc002asr.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(439-441)CCT>CTT		uveal autoantigen with coiled-coil domains and							91.0	84.0	86.0					15																	70980144		2199	4297	6496	SO:0001583	missense	55075					cytoskeleton|extracellular region		g.chr15:70980144G>A	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.440C>T	15.37:g.70980144G>A	ENSP00000314556:p.Pro147Leu		Somatic				UACA_uc010uke.1_Missense_Mutation_p.P147L|UACA_uc002asq.2_Missense_Mutation_p.P134L|UACA_uc010bin.1_Missense_Mutation_p.P133L	p.P147L	NM_018003	NP_060473	WXS	Illumina HiSeq	Unspecified	Q9BZF9	UACA_HUMAN			6	544	-			147			ANK 4.		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	c.440C>T	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805106	0.50315	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362;ENST00000539319	T;T;T	0.68181	0.13;0.13;-0.31	5.7	4.77	0.60923	Ankyrin repeat-containing domain (4);	0.625902	0.15091	N	0.281078	T	0.33059	0.0850	N	0.01352	-0.895	0.23215	N	0.998107	B;B;B;B	0.32188	0.123;0.149;0.149;0.359	B;B;B;B	0.27076	0.045;0.076;0.076;0.067	T	0.11542	-1.0583	10	0.14252	T	0.57	-11.1964	10.4861	0.44722	0.0707:0.132:0.7973:0.0	.	147;147;147;134	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	L	147;134;134;147	ENSP00000314556:P147L;ENSP00000369319:P134L;ENSP00000438667:P147L	ENSP00000314556:P147L	P	-	2	0	UACA	68767198	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.666000	0.54540	2.692000	0.91855	0.467000	0.42956	CCT		0.363	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			11	20	0	0	0	0.008291	0	11	20				
SYNM	23336	broad.mit.edu	37	15	99669911	99669911	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:99669911C>A	ENST00000560674.1	+	4	957	c.488C>A	c.(487-489)cCa>cAa	p.P163Q	SYNM_ENST00000328642.7_Missense_Mutation_p.P448Q|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000336292.6_Missense_Mutation_p.P448Q|SYNM_ENST00000561323.1_3'UTR			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	449	Coil 1B.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CCTGACAGACCAAAAGCCGGA	0.507																																					Pancreas(125;1071 1762 21750 40003 40381)	Pancreas(125;1071 1762 21750 40003 40381)	uc002bup.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1345-1347)CCA>CAA		desmuslin isoform A							51.0	55.0	54.0					15																	99669911		1935	4131	6066	SO:0001583	missense	23336				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding	g.chr15:99669911C>A	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.488C>A	15.37:g.99669911C>A	ENSP00000453040:p.Pro163Gln		Somatic				SYNM_uc002buo.2_Missense_Mutation_p.P449Q|SYNM_uc002buq.2_Intron	p.P449Q	NM_145728	NP_663780	WXS	Illumina HiSeq	Unspecified	O15061	SYNEM_HUMAN			6	1466	+			449			Tail.		A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000560674.1	37	c.1346C>A		.	.	.	.	.	.	.	.	.	.	C	10.43	1.348991	0.24426	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	T;T	0.29397	1.57;1.57	5.67	4.69	0.59074	.	.	.	.	.	T	0.22437	0.0541	.	.	.	0.09310	N	1	B;B	0.26195	0.144;0.031	B;B	0.24394	0.053;0.009	T	0.06789	-1.0807	8	0.38643	T	0.18	.	10.9471	0.47306	0.3609:0.6391:0.0:0.0	.	449;448	O15061;C9JIE4	SYNEM_HUMAN;.	Q	448	ENSP00000336775:P448Q;ENSP00000330469:P448Q	ENSP00000330469:P448Q	P	+	2	0	SYNM	97487434	0.162000	0.22906	0.143000	0.22291	0.015000	0.08874	2.115000	0.41921	2.671000	0.90904	0.655000	0.94253	CCA		0.507	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728		6	19	1	0	2.7689e-08	0.001984	3.73865e-08	6	19				
LINS	55180	broad.mit.edu	37	15	101114206	101114206	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr15:101114206A>G	ENST00000314742.8	-	5	1094	c.872T>C	c.(871-873)aTt>aCt	p.I291T	LINS_ENST00000560133.1_Missense_Mutation_p.I172T|LINS_ENST00000561308.1_Missense_Mutation_p.I291T|LINS_ENST00000559149.1_5'UTR	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	291										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						AAAAGCCTGAATAGGCCAGGT	0.423																																							uc002bwe.2		NA																	0					0						c.(871-873)ATT>ACT		lines homolog 1							75.0	74.0	74.0					15																	101114206		2203	4300	6503	SO:0001583	missense	55180							g.chr15:101114206A>G	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.872T>C	15.37:g.101114206A>G	ENSP00000318423:p.Ile291Thr		Somatic				LINS1_uc002bwd.2_5'Flank|LINS1_uc002bwf.2_Missense_Mutation_p.I291T|LINS1_uc002bwg.2_Missense_Mutation_p.I291T|LINS1_uc002bwh.2_Missense_Mutation_p.I291T|LINS1_uc010usa.1_Missense_Mutation_p.I172T|LINS1_uc002bwi.2_Missense_Mutation_p.I291T	p.I291T	NM_001040614	NP_001035704	WXS	Illumina HiSeq	Unspecified	Q8NG48	LINES_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		6	1163	-	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		291					Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	c.872T>C	CCDS10385.1	.	.	.	.	.	.	.	.	.	.	A	8.213	0.800762	0.16397	.	.	ENSG00000140471	ENST00000314742	T	0.17854	2.25	6.07	2.5	0.30297	.	0.924585	0.09410	N	0.805976	T	0.15782	0.0380	L	0.40543	1.245	0.09310	N	1	B;B;B	0.20052	0.041;0.018;0.041	B;B;B	0.19946	0.027;0.011;0.016	T	0.30880	-0.9963	10	0.36615	T	0.2	-0.3062	10.0123	0.41995	0.7415:0.0:0.2585:0.0	.	172;291;291	B4DQT3;Q8NG48-2;Q8NG48	.;.;LINES_HUMAN	T	291	ENSP00000318423:I291T	ENSP00000318423:I291T	I	-	2	0	LINS	98931729	0.434000	0.25570	0.000000	0.03702	0.915000	0.54546	1.498000	0.35660	0.196000	0.20367	0.533000	0.62120	ATT		0.423	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148		16	17	0	0	0	0.004007	0	16	17				
AMDHD2	51005	broad.mit.edu	37	16	2571043	2571043	+	Silent	SNP	C	C	T	rs150383216		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:2571043C>T	ENST00000293971.6	+	3	373	c.279C>T	c.(277-279)ctC>ctT	p.L93L	ATP6C_ENST00000569317.1_Silent_p.L46L|AMDHD2_ENST00000413459.3_Silent_p.L93L|AMDHD2_ENST00000302956.4_Silent_p.L93L	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	93					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						GGGTTGCCCTCGTGGCCCGGA	0.612																																							uc002cqq.2		NA																	0				skin(2)|large_intestine(1)|breast(1)	4						c.(277-279)CTC>CTT		amidohydrolase domain containing 2 isoform 1							99.0	101.0	100.0					16																	2571043		2198	4300	6498	SO:0001819	synonymous_variant	51005				N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity	g.chr16:2571043C>T	AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.279C>T	16.37:g.2571043C>T			Somatic				AMDHD2_uc002cqp.2_Silent_p.L93L|AMDHD2_uc010uwc.1_Silent_p.L93L|AMDHD2_uc010uwd.1_5'UTR	p.L93L	NM_015944	NP_057028	WXS	Illumina HiSeq	Unspecified	Q9Y303	NAGA_HUMAN			3	376	+			93					B4DL77|Q8WV54	Silent	SNP	ENST00000293971.6	37	c.279C>T																																																																																					0.612	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435652.1	NM_015944		23	70	0	0	0	0.003954	0	23	70				
GRIN2A	2903	broad.mit.edu	37	16	9858086	9858086	+	Nonsense_Mutation	SNP	G	G	T	rs558130047		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:9858086G>T	ENST00000396573.2	-	14	3624	c.3315C>A	c.(3313-3315)taC>taA	p.Y1105*	GRIN2A_ENST00000330684.3_Nonsense_Mutation_p.Y1105*|GRIN2A_ENST00000535259.1_Nonsense_Mutation_p.Y948*|GRIN2A_ENST00000562109.1_Nonsense_Mutation_p.Y1105*|GRIN2A_ENST00000396575.2_Nonsense_Mutation_p.Y1105*|GRIN2A_ENST00000404927.2_Nonsense_Mutation_p.Y1105*	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1105					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGGTTTTCAGGTAGGTGCGCT	0.468																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(3313-3315)TAC>TAA		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						153.0	145.0	148.0					16																	9858086		2197	4300	6497	SO:0001587	stop_gained	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9858086G>T		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3315C>A	16.37:g.9858086G>T	ENSP00000379818:p.Tyr1105*		Somatic				GRIN2A_uc010uym.1_Nonsense_Mutation_p.Y1105*|GRIN2A_uc010uyn.1_Nonsense_Mutation_p.Y948*|GRIN2A_uc002czr.3_Nonsense_Mutation_p.Y1105*	p.Y1105*	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	3863	-			1105			Cytoplasmic (Potential).		O00669|Q17RZ6	Nonsense_Mutation	SNP	ENST00000396573.2	37	c.3315C>A	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	39	7.409699	0.98265	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	.	.	.	5.34	2.33	0.28932	.	0.054505	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1627	0.20373	0.4385:0.0:0.5615:0.0	.	.	.	.	X	1105;1105;948;1105;1105	.	.	Y	-	3	2	GRIN2A	9765587	1.000000	0.71417	0.990000	0.47175	0.990000	0.78478	2.193000	0.42658	0.644000	0.30656	-0.229000	0.12294	TAC		0.468	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			24	90	1	0	7.68411e-24	0.008361	1.35222e-23	24	90				
NPIPB4	440345	broad.mit.edu	37	16	21848679	21848679	+	Silent	SNP	G	G	T	rs562361291	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:21848679G>T	ENST00000415645.2	-	7	1068	c.1029C>A	c.(1027-1029)ccC>ccA	p.P343P	NPIPB4_ENST00000537951.1_Silent_p.P127P|NPIPB4_ENST00000451409.1_Silent_p.P160P|NPIPB4_ENST00000357370.5_Silent_p.P305P			C9JG80	NPIB4_HUMAN	nuclear pore complex interacting protein family, member B4	343	Pro-rich.					integral component of membrane (GO:0016021)											GCAGACACTCGGGAGGTGTCT	0.572																																							uc002djr.3		NA																	0					NA						c.(1027-1029)CCC>CCA		nuclear pore complex interacting protein-like 3																																				SO:0001819	synonymous_variant	0							g.chr16:21848679G>T			16p12.2	2013-06-11			ENSG00000185864	ENSG00000185864			41985	protein-coding gene	gene with protein product							Standard	XM_006721108		Approved			C9JG80	OTTHUMG00000163555	ENST00000415645.2:c.1029C>A	16.37:g.21848679G>T			Somatic				uc002djs.3_RNA|uc010vbm.1_5'Flank|uc002djn.3_RNA|uc002djq.3_Silent_p.P324P|uc010vbn.1_Silent_p.P343P	p.P343P	NM_130464	NP_569731	WXS	Illumina HiSeq	Unspecified					9	1211	-									Silent	SNP	ENST00000415645.2	37	c.1029C>A																																																																																					0.572	NPIPB4-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				60	76	1	0	1.15062e-32	0.01441	2.11367e-32	60	76				
NPIPB4	440345	broad.mit.edu	37	16	21848767	21848767	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:21848767G>A	ENST00000415645.2	-	7	980	c.941C>T	c.(940-942)cCc>cTc	p.P314L	NPIPB4_ENST00000537951.1_Missense_Mutation_p.P98L|NPIPB4_ENST00000451409.1_Missense_Mutation_p.P131L|NPIPB4_ENST00000357370.5_Intron			C9JG80	NPIB4_HUMAN	nuclear pore complex interacting protein family, member B4	314	Pro-rich.					integral component of membrane (GO:0016021)											ATCCGCTGAGGGTGGAAGGGG	0.552																																							uc002djr.3		NA																	0					NA						c.(940-942)CCC>CTC		nuclear pore complex interacting protein-like 3																																				SO:0001583	missense	0							g.chr16:21848767G>A			16p12.2	2013-06-11			ENSG00000185864	ENSG00000185864			41985	protein-coding gene	gene with protein product							Standard	XM_006721108		Approved			C9JG80	OTTHUMG00000163555	ENST00000415645.2:c.941C>T	16.37:g.21848767G>A	ENSP00000404439:p.Pro314Leu		Somatic				uc002djs.3_RNA|uc010vbm.1_5'Flank|uc002djn.3_RNA|uc002djq.3_Missense_Mutation_p.P295L|uc010vbn.1_Missense_Mutation_p.P314L	p.P314L	NM_130464	NP_569731	WXS	Illumina HiSeq	Unspecified					9	1123	-									Missense_Mutation	SNP	ENST00000415645.2	37	c.941C>T		.	.	.	.	.	.	.	.	.	.	.	10.90	1.482747	0.26598	.	.	ENSG00000185864	ENST00000415645;ENST00000537951;ENST00000451409	T	0.55588	0.51	.	.	.	.	.	.	.	.	T	0.67107	0.2858	.	.	.	.	.	.	D;P	0.76494	0.999;0.811	D;B	0.78314	0.991;0.446	T	0.71790	-0.4486	5	0.72032	D	0.01	.	.	.	.	.	314;314	C9JG80;Q92617	.;NPPL3_HUMAN	L	314;98;131	ENSP00000404439:P314L	ENSP00000404439:P314L	P	-	2	0	RP11-645C24.1	21756268	0.038000	0.19896	0.037000	0.18230	0.037000	0.13140	0.064000	0.14437	0.064000	0.16427	0.064000	0.15345	CCC		0.552	NPIPB4-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				15	75	0	0	0	0.00333	0	15	75				
CDR2	1039	broad.mit.edu	37	16	22359093	22359093	+	Silent	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:22359093A>C	ENST00000268383.2	-	5	865	c.558T>G	c.(556-558)ggT>ggG	p.G186G		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	186						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		GGCTTGGCTGACCTTGCAAGG	0.448																																							uc002dkn.2		NA																	0				skin(1)	1						c.(556-558)GGT>GGG		cerebellar degeneration-related protein 2							106.0	94.0	98.0					16																	22359093		2197	4300	6497	SO:0001819	synonymous_variant	1039					nucleus	protein binding	g.chr16:22359093A>C	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.558T>G	16.37:g.22359093A>C			Somatic					p.G186G	NM_001802	NP_001793	WXS	Illumina HiSeq	Unspecified	Q01850	CDR2_HUMAN		GBM - Glioblastoma multiforme(48;0.0188)	5	866	-			186					A8K8A8|Q13977	Silent	SNP	ENST00000268383.2	37	c.558T>G	CCDS32404.1																																																																																				0.448	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430081.1			18	60	0	0	0	0.008871	0	18	60				
GSG1L	146395	broad.mit.edu	37	16	27818870	27818870	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:27818870T>A	ENST00000447459.2	-	6	920	c.836A>T	c.(835-837)gAg>gTg	p.E279V	GSG1L_ENST00000395724.3_Missense_Mutation_p.E228V|GSG1L_ENST00000380897.3_Missense_Mutation_p.E124V|GSG1L_ENST00000380898.2_Missense_Mutation_p.E142V|GSG1L_ENST00000569166.1_Missense_Mutation_p.E142V	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	279					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						GTCCCTCTTCTCCATCCTGGA	0.488																																							uc002doz.2		NA																	0				ovary(1)	1						c.(835-837)GAG>GTG		GSG1-like isoform 1							61.0	51.0	55.0					16																	27818870		2197	4300	6497	SO:0001583	missense	146395					integral to membrane		g.chr16:27818870T>A	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.836A>T	16.37:g.27818870T>A	ENSP00000394954:p.Glu279Val		Somatic				GSG1L_uc010bya.1_Missense_Mutation_p.E228V|GSG1L_uc010bxz.1_Missense_Mutation_p.E142V|GSG1L_uc002doy.2_Missense_Mutation_p.E124V	p.E279V	NM_001109763	NP_001103233	WXS	Illumina HiSeq	Unspecified	Q6UXU4	GSG1L_HUMAN			6	921	-			279					Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	37	c.836A>T	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	T	12.43	1.934819	0.34189	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T	0.36340	1.3;1.26	3.81	3.81	0.43845	.	0.086790	0.41605	D	0.000855	T	0.31040	0.0784	N	0.03608	-0.345	0.36713	D	0.880757	B;D;D	0.61080	0.003;0.989;0.982	B;D;P	0.75020	0.002;0.985;0.699	T	0.34502	-0.9826	10	0.31617	T	0.26	0.3097	9.2781	0.37711	0.0:0.0:0.0:1.0	.	228;142;279	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	V	279;228;142;124	ENSP00000394954:E279V;ENSP00000379074:E228V	ENSP00000370282:E124V	E	-	2	0	GSG1L	27726371	1.000000	0.71417	0.994000	0.49952	0.187000	0.23431	1.956000	0.40382	1.966000	0.57179	0.459000	0.35465	GAG		0.488	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675		16	22	0	0	0	0.008871	0	16	22				
PRSS36	146547	broad.mit.edu	37	16	31154757	31154757	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:31154757A>C	ENST00000268281.4	-	8	1064	c.1006T>G	c.(1006-1008)Tgg>Ggg	p.W336G	PRSS36_ENST00000418068.2_Missense_Mutation_p.W336G|PRSS36_ENST00000569305.1_Missense_Mutation_p.W336G	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	336	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						TGGGCCTCCCAGGGCCAGGCC	0.662																																							uc002ebd.2		NA																	0				ovary(1)	1						c.(1006-1008)TGG>GGG		protease, serine, 36 precursor							26.0	32.0	30.0					16																	31154757		2196	4299	6495	SO:0001583	missense	146547				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity	g.chr16:31154757A>C	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.1006T>G	16.37:g.31154757A>C	ENSP00000268281:p.Trp336Gly		Somatic				PRSS36_uc010vff.1_Missense_Mutation_p.W111G|PRSS36_uc010vfg.1_Missense_Mutation_p.W336G|PRSS36_uc010vfh.1_Missense_Mutation_p.W336G	p.W336G	NM_173502	NP_775773	WXS	Illumina HiSeq	Unspecified	Q5K4E3	POLS2_HUMAN			8	1065	-			336			Peptidase S1 2.		A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	c.1006T>G	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	A	18.80	3.701345	0.68501	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	T;T	0.50001	0.76;0.76	4.11	4.11	0.48088	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.73992	0.3658	H	0.94698	3.57	0.41059	D	0.985366	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	T	0.79843	-0.1632	9	0.87932	D	0	.	9.4342	0.38628	1.0:0.0:0.0:0.0	.	336;336;336	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	G	336	ENSP00000268281:W336G;ENSP00000407160:W336G	ENSP00000268281:W336G	W	-	1	0	PRSS36	31062258	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.551000	0.53698	1.727000	0.51537	0.402000	0.26972	TGG		0.662	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502		14	11	0	0	0	0.003163	0	14	11				
ITGAX	3687	broad.mit.edu	37	16	31384596	31384596	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:31384596A>T	ENST00000268296.4	+	20	2514	c.2393A>T	c.(2392-2394)aAc>aTc	p.N798I	ITGAX_ENST00000562522.1_Missense_Mutation_p.N798I	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	798					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						GTGGGGAGTAACCTGGAGCTG	0.537																																							uc002ebu.1		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2392-2394)AAC>ATC		integrin alpha X precursor							120.0	95.0	103.0					16																	31384596		2197	4300	6497	SO:0001583	missense	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31384596A>T	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2393A>T	16.37:g.31384596A>T	ENSP00000268296:p.Asn798Ile		Somatic				ITGAX_uc002ebt.2_Missense_Mutation_p.N798I	p.N798I	NM_000887	NP_000878	WXS	Illumina HiSeq	Unspecified	P20702	ITAX_HUMAN			20	2460	+			798			Extracellular (Potential).		Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	c.2393A>T	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.759353	0.31137	.	.	ENSG00000140678	ENST00000268296	T	0.47869	0.83	4.89	-2.18	0.07037	Integrin alpha-2 (1);	.	.	.	.	T	0.54013	0.1832	L	0.47716	1.5	0.09310	N	1	D	0.58268	0.982	P	0.55749	0.783	T	0.58978	-0.7540	9	0.54805	T	0.06	.	16.481	0.84157	0.2384:0.7616:0.0:0.0	.	798	P20702	ITAX_HUMAN	I	798	ENSP00000268296:N798I	ENSP00000268296:N798I	N	+	2	0	ITGAX	31292097	0.000000	0.05858	0.074000	0.20217	0.892000	0.51952	-0.167000	0.09940	-0.157000	0.11059	-0.438000	0.05819	AAC		0.537	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		23	70	0	0	0	0.005443	0	23	70				
Unknown	0	broad.mit.edu	37	16	33784717	33784717	+	IGR	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:33784717C>A								RP11-812E19.3 (6973 upstream) : AC136932.2 (161231 downstream)																							CAACGTGTACCCGTGGTGGGG	0.602																																							uc010vgb.1		NA																	0					NA						c.(106-108)CCG>ACG		RecName: Full=Transporter;																																				SO:0001628	intergenic_variant	0							g.chr16:33784717C>A																													16.37:g.33784717C>A			Somatic					p.P36T			WXS	Illumina HiSeq	Unspecified					2	126	+									Missense_Mutation	SNP		37	c.106C>A		.	.	.	.	.	.	.	.	.	.	.	3.398	-0.122955	0.06795	.	.	ENSG00000198555	ENST00000359871	.	.	.	2.12	2.12	0.27331	.	0.000000	0.64402	U	0.000002	T	0.70422	0.3222	.	.	.	.	.	.	D	0.89917	1.0	D	0.83275	0.996	T	0.77504	-0.2563	6	.	.	.	.	10.3204	0.43762	0.0:1.0:0.0:0.0	.	88	F8WED4	.	T	88	.	.	P	+	1	0	AC133561.1	33692218	1.000000	0.71417	1.000000	0.80357	0.206000	0.24218	7.378000	0.79679	1.504000	0.48704	0.194000	0.17425	CCG	0	0.602									6	64	1	0	5.18039e-06	0.00308	6.29815e-06	6	64				
ZNF423	23090	broad.mit.edu	37	16	49670254	49670254	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:49670254G>T	ENST00000561648.1	-	4	2862	c.2809C>A	c.(2809-2811)Cgg>Agg	p.R937R	ZNF423_ENST00000535559.1_Silent_p.R820R|ZNF423_ENST00000567169.1_Silent_p.R820R|ZNF423_ENST00000562520.1_Silent_p.R877R|ZNF423_ENST00000262383.2_Silent_p.R937R|ZNF423_ENST00000562871.1_Silent_p.R877R|ZNF423_ENST00000563137.2_Silent_p.R877R	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	937					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AAGAAAGTCCGTGAACAAACG	0.592																																							uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(2809-2811)CGG>AGG		zinc finger protein 423							76.0	62.0	67.0					16																	49670254		2198	4300	6498	SO:0001819	synonymous_variant	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49670254G>T	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2809C>A	16.37:g.49670254G>T			Somatic				ZNF423_uc010vgn.1_Silent_p.R820R	p.R937R	NM_015069	NP_055884	WXS	Illumina HiSeq	Unspecified	Q2M1K9	ZN423_HUMAN			5	3107	-		all_cancers(37;0.0155)	937			C2H2-type 22.		O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	c.2809C>A	CCDS32445.1																																																																																				0.592	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		21	16	1	0	3.01185e-09	0.003954	4.26315e-09	21	16				
SLC6A2	6530	broad.mit.edu	37	16	55725860	55725860	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:55725860T>A	ENST00000379906.2	+	5	1069	c.814T>A	c.(814-816)Ttc>Atc	p.F272I	SLC6A2_ENST00000414754.3_Missense_Mutation_p.F272I|SLC6A2_ENST00000567238.1_Missense_Mutation_p.F167I|SLC6A2_ENST00000561820.1_Missense_Mutation_p.F272I|SLC6A2_ENST00000566163.1_Intron|SLC6A2_ENST00000568943.1_Missense_Mutation_p.F272I|SLC6A2_ENST00000219833.8_Missense_Mutation_p.F272I	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	272					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GCTGCCTTACTTCGTGCTGTT	0.607																																							uc002eif.2		NA																	0				lung(4)|ovary(2)|pancreas(2)	8						c.(814-816)TTC>ATC		solute carrier family 6 member 2	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)						139.0	89.0	105.0					16																	55725860		2198	4300	6498	SO:0001583	missense	6530				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity	g.chr16:55725860T>A		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.814T>A	16.37:g.55725860T>A	ENSP00000369237:p.Phe272Ile		Somatic				SLC6A2_uc010ccd.2_Missense_Mutation_p.F272I|SLC6A2_uc002eig.2_Missense_Mutation_p.F272I|SLC6A2_uc002eih.2_Missense_Mutation_p.F272I|SLC6A2_uc002eii.2_Missense_Mutation_p.F167I|SLC6A2_uc002eij.2_Intron	p.F272I	NM_001043	NP_001034	WXS	Illumina HiSeq	Unspecified	P23975	SC6A2_HUMAN		BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	6	925	+			272			Helical; Name=5; (Potential).		B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	c.814T>A	CCDS10754.1	.	.	.	.	.	.	.	.	.	.	T	13.79	2.343216	0.41498	.	.	ENSG00000103546	ENST00000414754;ENST00000379906;ENST00000219833	T;T;T	0.71579	-0.58;-0.58;-0.58	4.75	-2.09	0.07232	.	0.348573	0.28877	N	0.013847	T	0.31167	0.0788	N	0.01096	-1.015	0.31607	N	0.651936	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.004;0.002	T	0.25745	-1.0123	10	0.19147	T	0.46	.	6.2481	0.20830	0.0:0.3439:0.231:0.4251	.	272;167;272	Q96KH8;B4DX48;P23975	.;.;SC6A2_HUMAN	I	272	ENSP00000394956:F272I;ENSP00000369237:F272I;ENSP00000219833:F272I	ENSP00000219833:F272I	F	+	1	0	SLC6A2	54283361	0.747000	0.28283	0.950000	0.38849	0.987000	0.75469	-0.090000	0.11163	-0.187000	0.10516	-0.242000	0.12053	TTC		0.607	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			19	13	0	0	0	0.008871	0	19	13				
MT1M	4499	broad.mit.edu	37	16	56667691	56667691	+	Nonsense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:56667691T>A	ENST00000379818.3	+	3	622	c.123T>A	c.(121-123)tgT>tgA	p.C41*	MT1JP_ENST00000564564.1_RNA|AC026461.1_ENST00000600389.1_5'Flank	NM_176870.2	NP_789846.1	Q8N339	MT1M_HUMAN	metallothionein 1M	41	Alpha.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5						CCGTGGGCTGTGCCAAGTGTG	0.597																																							uc002ejn.2		NA																	0				ovary(1)	1						c.(121-123)TGT>TGA		metallothionein 1M							127.0	130.0	129.0					16																	56667691		2198	4300	6498	SO:0001587	stop_gained	4499						metal ion binding	g.chr16:56667691T>A	AF136177	CCDS42166.1	16q13	2008-02-05				ENSG00000205364		"""Metallothioneins"""	14296	protein-coding gene	gene with protein product		156357	"""metallothionein 1K"""	MT1, MT1K		2286373, 8049263	Standard	NM_176870		Approved		uc002ejn.3	Q8N339		ENST00000379818.3:c.123T>A	16.37:g.56667691T>A	ENSP00000369146:p.Cys41*		Somatic				MT1A_uc002eji.2_Intron|MT1M_uc010vhe.1_RNA|uc002ejo.1_5'Flank|uc002ejp.1_5'Flank	p.C41*	NM_176870	NP_789846	WXS	Illumina HiSeq	Unspecified	Q8N339	MT1M_HUMAN			3	233	+			41			Alpha.	Divalent metal cation; cluster A.	Q8TDN3	Nonsense_Mutation	SNP	ENST00000379818.3	37	c.123T>A	CCDS42166.1	.	.	.	.	.	.	.	.	.	.	T	37	6.582604	0.97680	.	.	ENSG00000205364	ENST00000379818	.	.	.	2.41	-0.029	0.13920	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.7301	0.18034	0.0:0.5145:0.0:0.4855	.	.	.	.	X	41	.	ENSP00000369146:C41X	C	+	3	2	MT1M	55225192	0.997000	0.39634	0.973000	0.42090	0.929000	0.56500	0.688000	0.25422	-0.149000	0.11215	0.378000	0.23410	TGT		0.597	MT1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434359.1	NM_176870		70	57	0	0	0	0.01441	0	70	57				
TRADD	8717	broad.mit.edu	37	16	67188856	67188856	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:67188856C>G	ENST00000345057.4	-	5	1103	c.635G>C	c.(634-636)cGg>cCg	p.R212P	TRADD_ENST00000566104.1_5'Flank|TRADD_ENST00000486556.1_Missense_Mutation_p.R152P	NM_003789.3	NP_003780.1	Q15628	TRADD_HUMAN	TNFRSF1A-associated via death domain	212	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic process (GO:0043065)|positive regulation of hair follicle development (GO:0051798)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|nucleus (GO:0005634)|receptor complex (GO:0043235)	binding, bridging (GO:0060090)|death domain binding (GO:0070513)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GCTCAGCGGCCGATTCACTGC	0.706																																							uc002eri.1		NA																	0				lung(1)	1						c.(634-636)CGG>CCG		TNFRSF1A-associated via death domain							8.0	8.0	8.0					16																	67188856		1818	3639	5457	SO:0001583	missense	8717				activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|tumor necrosis factor-mediated signaling pathway	cytoskeleton|cytosol|receptor complex	binding, bridging|death domain binding|identical protein binding|kinase binding|signal transducer activity	g.chr16:67188856C>G	L41690	CCDS10829.1	16q22	2008-07-28			ENSG00000102871	ENSG00000102871			12030	protein-coding gene	gene with protein product		603500				7758105	Standard	NM_003789		Approved	Hs.89862	uc002eri.1	Q15628	OTTHUMG00000137519	ENST00000345057.4:c.635G>C	16.37:g.67188856C>G	ENSP00000341268:p.Arg212Pro		Somatic				TRADD_uc002erh.1_Missense_Mutation_p.R152P	p.R212P	NM_003789	NP_003780	WXS	Illumina HiSeq	Unspecified	Q15628	TRADD_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)	5	715	-		Ovarian(137;0.0563)	212			Death.		B2RDS3|B3KQZ9|Q52NZ1	Missense_Mutation	SNP	ENST00000345057.4	37	c.635G>C	CCDS10829.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.008639	0.54361	.	.	ENSG00000102871	ENST00000345057	.	.	.	5.0	5.0	0.66597	Death (1);DEATH-like (1);	0.127989	0.51477	D	0.000082	T	0.77955	0.4208	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80197	-0.1482	9	0.87932	D	0	-45.2158	17.0179	0.86424	0.0:1.0:0.0:0.0	.	212	Q15628	TRADD_HUMAN	P	212	.	ENSP00000341268:R212P	R	-	2	0	TRADD	65746357	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	7.546000	0.82137	2.598000	0.87819	0.462000	0.41574	CGG		0.706	TRADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268841.2			6	18	0	0	0	0.00308	0	6	18				
CTCF	10664	broad.mit.edu	37	16	67644874	67644874	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:67644874G>T	ENST00000264010.4	+	3	583	c.139G>T	c.(139-141)Ggg>Tgg	p.G47W	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	47					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		CCAGACGGATGGGGGTGAGGT	0.522																																					Colon(175;1200 1966 6945 23069 27405)	Colon(175;1200 1966 6945 23069 27405)	uc002etl.2		NA																	0				ovary(1)	1						c.(139-141)GGG>TGG		CCCTC-binding factor							71.0	73.0	73.0					16																	67644874		2198	4300	6498	SO:0001583	missense	10664				chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:67644874G>T	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.139G>T	16.37:g.67644874G>T	ENSP00000264010:p.Gly47Trp		Somatic				CTCF_uc010cek.2_Intron	p.G47W	NM_006565	NP_006556	WXS	Illumina HiSeq	Unspecified	P49711	CTCF_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)	3	429	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	47					B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	c.139G>T	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027990	0.54790	.	.	ENSG00000102974	ENST00000264010	T	0.08458	3.09	5.19	5.19	0.71726	.	0.169578	0.42172	D	0.000744	T	0.06142	0.0159	N	0.14661	0.345	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.25187	-1.0139	10	0.72032	D	0.01	-3.4618	12.2434	0.54555	0.0773:0.0:0.9227:0.0	.	47	P49711	CTCF_HUMAN	W	47	ENSP00000264010:G47W	ENSP00000264010:G47W	G	+	1	0	CTCF	66202375	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.651000	0.74372	2.696000	0.92011	0.655000	0.94253	GGG		0.522	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565		19	41	1	0	6.33239e-15	0.010504	1.00836e-14	19	41				
CDH3	1001	broad.mit.edu	37	16	68713715	68713715	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:68713715G>T	ENST00000264012.4	+	7	1249	c.705G>T	c.(703-705)atG>atT	p.M235I	CDH3_ENST00000429102.2_Missense_Mutation_p.M235I|CDH3_ENST00000581171.1_Missense_Mutation_p.M180I	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CTTCTGTGATGCAGGTGACAG	0.473																																							uc002ewf.2		NA																	2	Unknown(2)	p.?(1)	breast(2)	ovary(3)|breast(1)|skin(1)	5						c.(703-705)ATG>ATT		cadherin 3, type 1 preproprotein							134.0	103.0	113.0					16																	68713715		2198	4300	6498	SO:0001583	missense	1001				adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	g.chr16:68713715G>T	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.705G>T	16.37:g.68713715G>T	ENSP00000264012:p.Met235Ile		Somatic				CDH3_uc010vli.1_Missense_Mutation_p.M180I	p.M235I	NM_001793	NP_001784	WXS	Illumina HiSeq	Unspecified	P22223	CADH3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)	7	1837	+		Ovarian(137;0.0564)	235			Extracellular (Potential).|Cadherin 2.		B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	c.705G>T	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979316	0.92982	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.50548	0.74;0.74	5.04	5.04	0.67666	Cadherin (4);Cadherin-like (1);	0.000000	0.50627	D	0.000115	T	0.49795	0.1578	N	0.20766	0.605	0.58432	D	0.999999	P	0.50369	0.934	P	0.57009	0.811	T	0.54351	-0.8307	10	0.59425	D	0.04	.	15.9079	0.79445	0.0:0.0:1.0:0.0	.	235	P22223	CADH3_HUMAN	I	235;235;180	ENSP00000398485:M235I;ENSP00000264012:M235I	ENSP00000264012:M235I	M	+	3	0	CDH3	67271216	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.384000	0.73177	2.349000	0.79799	0.650000	0.86243	ATG		0.473	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793		14	38	1	0	3.32936e-07	0.006122	4.25055e-07	14	38				
NFAT5	10725	broad.mit.edu	37	16	69725937	69725937	+	Nonsense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:69725937A>T	ENST00000354436.2	+	12	2473	c.2155A>T	c.(2155-2157)Aga>Tga	p.R719*	NFAT5_ENST00000393742.2_Nonsense_Mutation_p.R643*|NFAT5_ENST00000349945.1_Nonsense_Mutation_p.R643*|NFAT5_ENST00000566899.1_Nonsense_Mutation_p.R643*|NFAT5_ENST00000432919.1_Nonsense_Mutation_p.R737*|NFAT5_ENST00000567239.1_Nonsense_Mutation_p.R736*	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	719					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AACTCAGTCTAGAGAGATATT	0.463																																							uc002exm.1		NA																	0					0						c.(2155-2157)AGA>TGA		nuclear factor of activated T-cells 5 isoform c							119.0	112.0	114.0					16																	69725937		2198	4300	6498	SO:0001587	stop_gained	10725				excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:69725937A>T	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2155A>T	16.37:g.69725937A>T	ENSP00000346420:p.Arg719*		Somatic				NFAT5_uc002exi.2_Nonsense_Mutation_p.R643*|NFAT5_uc002exj.1_Nonsense_Mutation_p.R643*|NFAT5_uc002exk.1_Nonsense_Mutation_p.R643*|NFAT5_uc002exl.1_Nonsense_Mutation_p.R737*|NFAT5_uc002exn.1_Nonsense_Mutation_p.R736*|NFAT5_uc002exo.1_5'Flank	p.R719*	NM_006599	NP_006590	WXS	Illumina HiSeq	Unspecified	O94916	NFAT5_HUMAN			12	3363	+			719					A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Nonsense_Mutation	SNP	ENST00000354436.2	37	c.2155A>T	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	A	40	8.018078	0.98613	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	.	.	.	6.08	4.96	0.65561	.	0.165278	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.1739	12.6014	0.56499	0.7389:0.2611:0.0:0.0	.	.	.	.	X	737;736;643;719;643	.	ENSP00000338806:R643X	R	+	1	2	NFAT5	68283438	0.905000	0.30787	0.942000	0.38095	0.984000	0.73092	1.611000	0.36879	1.073000	0.40885	0.533000	0.62120	AGA		0.463	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714		25	45	0	0	0	0.007291	0	25	45				
FUK	197258	broad.mit.edu	37	16	70513219	70513219	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:70513219T>C	ENST00000288078.6	+	23	3298	c.3066T>C	c.(3064-3066)gcT>gcC	p.A1022A	FUK_ENST00000378912.2_Silent_p.A1028A|FUK_ENST00000571514.1_Silent_p.A513A	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	1022						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				AGAGCCTGGCTGGGGCAGGCG	0.627																																							uc002eyy.2		NA																	0				ovary(1)	1						c.(3064-3066)GCT>GCC		fucokinase							35.0	40.0	38.0					16																	70513219		1999	4170	6169	SO:0001819	synonymous_variant	197258					cytoplasm	ATP binding|fucokinase activity	g.chr16:70513219T>C		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.3066T>C	16.37:g.70513219T>C			Somatic				FUK_uc010cft.2_Silent_p.A1028A|FUK_uc002eyz.2_Silent_p.A513A	p.A1022A	NM_145059	NP_659496	WXS	Illumina HiSeq	Unspecified	Q8N0W3	FUK_HUMAN			23	3124	+		Ovarian(137;0.0694)	1022					Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	ENST00000288078.6	37	c.3066T>C	CCDS10891.2																																																																																				0.627	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059		16	25	0	0	0	0.010504	0	16	25				
C16orf46	123775	broad.mit.edu	37	16	81095100	81095100	+	Missense_Mutation	SNP	G	G	A	rs139506410		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:81095100G>A	ENST00000299578.5	-	4	1089	c.854C>T	c.(853-855)gCg>gTg	p.A285V	C16orf46_ENST00000378611.4_Missense_Mutation_p.A285V|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000444657.3_5'Flank	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	285						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						TATCTGGGCCGCTGGGGAAGG	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17266	0.0		0.0	False		,,,				2504	0.0						uc002fgc.3		NA																	0					0						c.(853-855)GCG>GTG		chromosome 16 open reading frame 46 isoform 2		G	VAL/ALA,VAL/ALA	1,4403	2.1+/-5.4	0,1,2201	119.0	112.0	114.0		854,854	-11.1	0.0	16	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	C16orf46	NM_001100873.1,NM_152337.2	64,64	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	285/389,285/396	81095100	2,13002	2202	4300	6502	SO:0001583	missense	123775							g.chr16:81095100G>A	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.854C>T	16.37:g.81095100G>A	ENSP00000299578:p.Ala285Val		Somatic				C16orf46_uc010chf.2_Missense_Mutation_p.A285V|C16orf46_uc010vno.1_Missense_Mutation_p.A12V	p.A285V	NM_152337	NP_689550	WXS	Illumina HiSeq	Unspecified	Q6P387	CP046_HUMAN			4	1113	-			285					Q96MA7	Missense_Mutation	SNP	ENST00000299578.5	37	c.854C>T	CCDS10932.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	7.274	0.607770	0.14002	2.27E-4	1.16E-4	ENSG00000166455	ENST00000378611;ENST00000444657;ENST00000299578	T;T	0.12255	2.7;2.7	5.53	-11.1	0.00147	.	2.425600	0.01339	N	0.011518	T	0.05640	0.0148	N	0.19112	0.55	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.06405	0.002;0.002	T	0.29671	-1.0004	10	0.02654	T	1	.	6.0165	0.19605	0.0917:0.2251:0.4626:0.2205	.	285;285	Q6P387-2;Q6P387	.;CP046_HUMAN	V	285;12;285	ENSP00000367874:A285V;ENSP00000299578:A285V	ENSP00000299578:A285V	A	-	2	0	C16orf46	79652601	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.616000	0.00881	-3.789000	0.00106	-0.253000	0.11424	GCG		0.577	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337		2	115	0	0	0	0.004672	0	2	115				
SDR42E1	93517	broad.mit.edu	37	16	82033819	82033819	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:82033819C>A	ENST00000328945.5	-	3	206	c.79G>T	c.(79-81)Gcc>Tcc	p.A27S	SDR42E1_ENST00000534209.1_5'UTR	NM_145168.2	NP_660151.2	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E, member 1	27					steroid biosynthetic process (GO:0006694)	integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)			NS(2)|endometrium(1)|lung(4)|skin(3)	10						TGGTTCAGGGCACAGCCCAGG	0.443																																							uc002fgu.2		NA																	0					0						c.(79-81)GCC>TCC		short chain dehydrogenase/reductase family 42E,							137.0	130.0	132.0					16																	82033819		1910	4123	6033	SO:0001583	missense	93517				steroid biosynthetic process	integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding	g.chr16:82033819C>A	AF161368	CCDS42205.1	16q23.3	2011-09-14				ENSG00000184860	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	29834	protein-coding gene	gene with protein product						19027726	Standard	NM_145168		Approved	HSPC105	uc002fgu.3	Q8WUS8		ENST00000328945.5:c.79G>T	16.37:g.82033819C>A	ENSP00000332407:p.Ala27Ser		Somatic					p.A27S	NM_145168	NP_660151	WXS	Illumina HiSeq	Unspecified	Q8WUS8	D42E1_HUMAN			3	207	-			27					B2RDS1|Q9P0D1	Missense_Mutation	SNP	ENST00000328945.5	37	c.79G>T	CCDS42205.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920659	0.33908	.	.	ENSG00000184860	ENST00000328945;ENST00000532128	D;D	0.89196	-2.48;-2.48	6.03	4.07	0.47477	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.162937	0.56097	D	0.000025	D	0.83529	0.5274	L	0.47190	1.495	0.36301	D	0.857044	B	0.27068	0.167	B	0.35114	0.196	T	0.75693	-0.3229	10	0.08179	T	0.78	-23.0121	9.3471	0.38115	0.0:0.7686:0.0:0.2314	.	27	Q8WUS8	D42E1_HUMAN	S	27;24	ENSP00000332407:A27S;ENSP00000434529:A24S	ENSP00000332407:A27S	A	-	1	0	SDR42E1	80591320	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.765000	0.38481	2.861000	0.98227	0.655000	0.94253	GCC		0.443	SDR42E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388081.2	NM_145168		40	33	1	0	1.03325e-14	0.011902	1.63644e-14	40	33				
JPH3	57338	broad.mit.edu	37	16	87678146	87678146	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr16:87678146G>T	ENST00000284262.2	+	2	907	c.665G>T	c.(664-666)gGg>gTg	p.G222V		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	222					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CTGCTGAGTGGGCTGAAGCTG	0.657																																							uc002fkd.2		NA																	0				ovary(1)|pancreas(1)	2						c.(664-666)GGG>GTG		junctophilin 3							47.0	51.0	49.0					16																	87678146		2198	4300	6498	SO:0001583	missense	57338				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding	g.chr16:87678146G>T	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.665G>T	16.37:g.87678146G>T	ENSP00000284262:p.Gly222Val		Somatic				JPH3_uc010vou.1_RNA	p.G222V	NM_020655	NP_065706	WXS	Illumina HiSeq	Unspecified	Q8WXH2	JPH3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0287)	2	919	+			222			Cytoplasmic (Potential).		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	37	c.665G>T	CCDS10962.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337277	0.81911	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.56611	0.45	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.71550	0.3353	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.74976	-0.3480	10	0.87932	D	0	.	17.6314	0.88109	0.0:0.0:1.0:0.0	.	222	Q8WXH2	JPH3_HUMAN	V	85;222	ENSP00000284262:G222V	ENSP00000284262:G222V	G	+	2	0	JPH3	86235647	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	6.474000	0.73578	2.403000	0.81681	0.561000	0.74099	GGG		0.657	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2			8	12	1	0	0.00400662	0.004007	0.00431596	8	12				
ANKFY1	51479	broad.mit.edu	37	17	4074090	4074090	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:4074090G>A	ENST00000341657.4	-	23	3240	c.3205C>T	c.(3205-3207)Cgc>Tgc	p.R1069C	ANKFY1_ENST00000574367.1_Missense_Mutation_p.R1070C|CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000570535.1_Missense_Mutation_p.R1111C	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	1069					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						ACCCCGAGGCGAGCCCCCGAC	0.597																																							uc002fxq.1		NA																	0				ovary(2)|skin(1)	3						c.(3205-3207)CGC>TGC		ankyrin repeat and FYVE domain containing 1							72.0	87.0	82.0					17																	4074090		2193	4283	6476	SO:0001583	missense	51479					endosome membrane	metal ion binding|protein binding	g.chr17:4074090G>A	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.3205C>T	17.37:g.4074090G>A	ENSP00000343362:p.Arg1069Cys		Somatic				ANKFY1_uc002fxn.2_Missense_Mutation_p.R1111C|ANKFY1_uc002fxo.2_Missense_Mutation_p.R1070C|ANKFY1_uc002fxp.2_Missense_Mutation_p.R1068C|ANKFY1_uc010ckp.2_Missense_Mutation_p.R1011C	p.R1069C	NM_016376	NP_057460	WXS	Illumina HiSeq	Unspecified	Q9P2R3	ANFY1_HUMAN			23	3243	-			1069			ANK 21.		A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37	c.3205C>T		.	.	.	.	.	.	.	.	.	.	G	15.90	2.969781	0.53614	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	5.43	5.43	0.79202	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.35248	0.0925	N	0.00500	-1.43	0.80722	D	1	D;B;B;B	0.89917	1.0;0.179;0.273;0.273	D;B;B;B	0.85130	0.997;0.008;0.019;0.019	T	0.59857	-0.7375	9	0.36615	T	0.2	-16.4535	13.2422	0.60004	0.0:0.0:0.8414:0.1586	.	1011;1069;1070;1111	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	C	1070;1011	.	ENSP00000343362:R1070C	R	-	1	0	ANKFY1	4020839	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.838000	0.86804	2.554000	0.86153	0.655000	0.94253	CGC		0.597	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376		11	35	0	0	0	0.013537	0	11	35				
PITPNM3	83394	broad.mit.edu	37	17	6381910	6381910	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:6381910C>A	ENST00000262483.8	-	7	821	c.734G>T	c.(733-735)aGa>aTa	p.R245I	PITPNM3_ENST00000421306.3_Missense_Mutation_p.R209I	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	245					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CAGGAACTCTCTGTAGACCTG	0.647																																							uc002gdd.3		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(733-735)AGA>ATA		PITPNM family member 3 isoform 1							77.0	68.0	71.0					17																	6381910		2203	4300	6503	SO:0001583	missense	83394				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding	g.chr17:6381910C>A	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.734G>T	17.37:g.6381910C>A	ENSP00000262483:p.Arg245Ile		Somatic				PITPNM3_uc010cln.2_Missense_Mutation_p.R209I|PITPNM3_uc002gdc.3_5'UTR	p.R245I	NM_031220	NP_112497	WXS	Illumina HiSeq	Unspecified	Q9BZ71	PITM3_HUMAN		Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)	7	885	-			245					A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	c.734G>T	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828410	0.32329	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.20069	2.1;2.1	4.45	1.23	0.21249	.	1.085490	0.06859	N	0.798770	T	0.13543	0.0328	N	0.19112	0.55	0.09310	N	1	B;B	0.18461	0.02;0.028	B;B	0.25614	0.062;0.009	T	0.37126	-0.9719	10	0.39692	T	0.17	.	3.8421	0.08918	0.127:0.2688:0.497:0.1072	.	209;245	F8WEW5;Q9BZ71	.;PITM3_HUMAN	I	245;209	ENSP00000262483:R245I;ENSP00000407882:R209I	ENSP00000262483:R245I	R	-	2	0	PITPNM3	6322634	0.000000	0.05858	0.270000	0.24601	0.965000	0.64279	-0.491000	0.06474	0.215000	0.20761	0.455000	0.32223	AGA		0.647	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		3	17	1	0	0.00909568	0.009096	0.00967345	3	17				
PHF23	79142	broad.mit.edu	37	17	7139797	7139797	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:7139797G>C	ENST00000320316.3	-	4	675	c.449C>G	c.(448-450)tCc>tGc	p.S150C	PHF23_ENST00000571362.1_Missense_Mutation_p.S83C|PHF23_ENST00000576955.1_Missense_Mutation_p.S20C|PHF23_ENST00000570753.1_5'Flank|PHF23_ENST00000454255.2_Missense_Mutation_p.S146C|DVL2_ENST00000005340.5_5'Flank|DVL2_ENST00000575458.1_5'Flank	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	150							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						GGATGTGGGGGACAAAGGAGA	0.592																																							uc002gfa.2		NA																	0					0						c.(448-450)TCC>TGC		PHD finger protein 23							63.0	70.0	68.0					17																	7139797		1957	4132	6089	SO:0001583	missense	79142						zinc ion binding	g.chr17:7139797G>C	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.449C>G	17.37:g.7139797G>C	ENSP00000322579:p.Ser150Cys		Somatic				DVL2_uc002gez.1_5'Flank|DVL2_uc010vtr.1_5'Flank|DVL2_uc010clz.1_5'Flank|PHF23_uc010vtt.1_Missense_Mutation_p.S83C|PHF23_uc010cma.2_Missense_Mutation_p.S20C	p.S150C	NM_024297	NP_077273	WXS	Illumina HiSeq	Unspecified	Q9BUL5	PHF23_HUMAN			4	676	-			150					A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Missense_Mutation	SNP	ENST00000320316.3	37	c.449C>G	CCDS42250.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507876	0.27036	.	.	ENSG00000040633	ENST00000320316;ENST00000454255;ENST00000043410	T;T	0.34859	1.35;1.34	4.81	3.77	0.43336	.	0.545614	0.15459	N	0.261223	T	0.28101	0.0693	L	0.29908	0.895	0.26211	N	0.979294	P;B	0.46395	0.877;0.145	B;B	0.43916	0.436;0.112	T	0.12451	-1.0547	10	0.87932	D	0	-3.391	7.16	0.25659	0.1235:0.0:0.8765:0.0	.	83;150	B4DLK6;Q9BUL5	.;PHF23_HUMAN	C	150;146;150	ENSP00000322579:S150C;ENSP00000414607:S146C	ENSP00000043410:S150C	S	-	2	0	PHF23	7080521	1.000000	0.71417	0.695000	0.30226	0.977000	0.68977	2.750000	0.47500	2.492000	0.84095	0.563000	0.77884	TCC		0.592	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440047.1	NM_024297		8	27	0	0	0	0.004482	0	8	27				
DNAH2	146754	broad.mit.edu	37	17	7646377	7646377	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:7646377C>A	ENST00000572933.1	+	12	3281	c.1821C>A	c.(1819-1821)gaC>gaA	p.D607E	DNAH2_ENST00000082259.3_Missense_Mutation_p.D689E|DNAH2_ENST00000389173.2_Missense_Mutation_p.D607E|DNAH2_ENST00000570791.1_Missense_Mutation_p.D689E			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	607	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAAGTCTGGACAAGGATTGCA	0.527																																							uc002giu.1		NA																	0				ovary(6)|skin(6)|central_nervous_system(1)	13						c.(1819-1821)GAC>GAA		dynein heavy chain domain 3							111.0	91.0	98.0					17																	7646377		2203	4300	6503	SO:0001583	missense	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7646377C>A	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1821C>A	17.37:g.7646377C>A	ENSP00000458355:p.Asp607Glu		Somatic				DNAH2_uc002git.2_Missense_Mutation_p.D689E|DNAH2_uc010vuk.1_Missense_Mutation_p.D607E	p.D607E	NM_020877	NP_065928	WXS	Illumina HiSeq	Unspecified	Q9P225	DYH2_HUMAN			11	1835	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	607			Stem (By similarity).		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	c.1821C>A	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	8.149	0.786993	0.16189	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.52754	0.65;0.65	5.22	1.95	0.26073	Dynein heavy chain, domain-1 (1);	0.177262	0.46145	D	0.000303	T	0.19087	0.0458	N	0.02916	-0.46	0.20821	N	0.999842	B;B	0.19583	0.0;0.037	B;B	0.20955	0.005;0.032	T	0.19976	-1.0289	10	0.17832	T	0.49	.	7.656	0.28375	0.1361:0.7066:0.0:0.1573	.	607;689	Q9P225;Q9P225-3	DYH2_HUMAN;.	E	607;607;689	ENSP00000373825:D607E;ENSP00000082259:D689E	ENSP00000082259:D689E	D	+	3	2	DNAH2	7587102	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	0.698000	0.25571	1.205000	0.43262	0.563000	0.77884	GAC		0.527	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		14	49	1	0	9.16793e-09	0.00499	1.27308e-08	14	49				
DNAH2	146754	broad.mit.edu	37	17	7720969	7720969	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:7720969G>T	ENST00000572933.1	+	66	11571	c.10111G>T	c.(10111-10113)Ggg>Tgg	p.G3371W	DNAH2_ENST00000389173.2_Missense_Mutation_p.G3371W			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3371	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GAACATCCAAGGGTTGCCCTC	0.592																																							uc002giu.1		NA																	0				ovary(6)|skin(6)|central_nervous_system(1)	13						c.(10111-10113)GGG>TGG		dynein heavy chain domain 3							86.0	84.0	85.0					17																	7720969		2203	4300	6503	SO:0001583	missense	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7720969G>T	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10111G>T	17.37:g.7720969G>T	ENSP00000458355:p.Gly3371Trp		Somatic				DNAH2_uc010cnm.1_Missense_Mutation_p.G309W	p.G3371W	NM_020877	NP_065928	WXS	Illumina HiSeq	Unspecified	Q9P225	DYH2_HUMAN			65	10125	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	3371			AAA 5 (By similarity).		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	c.10111G>T	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474133	0.84640	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.74002	-0.8	5.36	5.36	0.76844	.	0.129409	0.51477	D	0.000087	D	0.91462	0.7305	H	0.97214	3.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94344	0.7573	10	0.87932	D	0	.	17.8503	0.88744	0.0:0.0:1.0:0.0	.	3332;3371	Q9P225-2;Q9P225	.;DYH2_HUMAN	W	3332;3371	ENSP00000373825:G3371W	ENSP00000353818:G3332W	G	+	1	0	DNAH2	7661694	1.000000	0.71417	0.977000	0.42913	0.941000	0.58515	8.605000	0.90883	2.514000	0.84764	0.557000	0.71058	GGG		0.592	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		13	34	1	0	6.72482e-11	0.003163	9.85187e-11	13	34				
MYH8	4626	broad.mit.edu	37	17	10302880	10302880	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:10302880G>T	ENST00000403437.2	-	28	3936	c.3842C>A	c.(3841-3843)gCg>gAg	p.A1281E	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1281					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTGCAGGCGCGCTCTCTGTGC	0.473									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	0				skin(6)|ovary(3)|breast(2)	11						c.(3841-3843)GCG>GAG		myosin, heavy chain 8, skeletal muscle,							136.0	129.0	131.0					17																	10302880		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10302880G>T		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3842C>A	17.37:g.10302880G>T	ENSP00000384330:p.Ala1281Glu		Somatic				uc002gml.1_Intron	p.A1281E	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			28	3937	-			1281			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.3842C>A	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000486	0.74818	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.83419	-1.72	5.38	3.34	0.38264	Myosin tail (1);	0.000000	0.41396	U	0.000886	D	0.90621	0.7059	M	0.92026	3.265	0.47778	D	0.999512	P	0.42993	0.797	P	0.52309	0.695	D	0.92430	0.5953	10	0.87932	D	0	.	15.797	0.78420	0.0:0.2578:0.7422:0.0	.	1281	P13535	MYH8_HUMAN	E	1281	ENSP00000384330:A1281E	ENSP00000252173:A1281E	A	-	2	0	MYH8	10243605	0.987000	0.35691	0.212000	0.23672	0.565000	0.35776	3.832000	0.55783	0.804000	0.34136	0.655000	0.94253	GCG		0.473	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		15	41	1	0	8.00594e-06	0.007413	9.69314e-06	15	41				
MYH4	4622	broad.mit.edu	37	17	10351287	10351287	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:10351287G>T	ENST00000255381.2	-	34	4923	c.4813C>A	c.(4813-4815)Ctg>Atg	p.L1605M	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1605					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCAGCATCCAGTGTACTCTGC	0.438																																							uc002gmn.2		NA																	0				ovary(10)|skin(2)|central_nervous_system(1)	13						c.(4813-4815)CTG>ATG		myosin, heavy polypeptide 4, skeletal muscle							266.0	233.0	244.0					17																	10351287		2203	4300	6503	SO:0001583	missense	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10351287G>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4813C>A	17.37:g.10351287G>T	ENSP00000255381:p.Leu1605Met		Somatic				uc002gml.1_Intron	p.L1605M	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			34	4924	-			1605			Potential.			Missense_Mutation	SNP	ENST00000255381.2	37	c.4813C>A	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457254	0.26161	.	.	ENSG00000141048	ENST00000255381	D	0.85556	-2.0	5.52	3.55	0.40652	Myosin tail (1);	0.000000	0.30085	U	0.010448	D	0.93465	0.7915	H	0.95574	3.69	0.40559	D	0.981191	D	0.55385	0.971	P	0.62298	0.9	D	0.94443	0.7660	10	0.87932	D	0	.	12.2223	0.54441	0.1381:0.0:0.8619:0.0	.	1605	Q9Y623	MYH4_HUMAN	M	1605	ENSP00000255381:L1605M	ENSP00000255381:L1605M	L	-	1	2	MYH4	10292012	0.991000	0.36638	0.390000	0.26220	0.098000	0.18820	2.034000	0.41145	0.819000	0.34492	-0.136000	0.14681	CTG		0.438	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		32	87	1	0	8.69298e-16	0.006999	1.40721e-15	32	87				
MYH2	4620	broad.mit.edu	37	17	10427825	10427825	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:10427825C>G	ENST00000245503.5	-	35	5517	c.5133G>C	c.(5131-5133)gaG>gaC	p.E1711D	MYH2_ENST00000397183.2_Missense_Mutation_p.E1711D|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1711					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CATCCAGGAGCTCCTGTTCTG	0.522																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(5131-5133)GAG>GAC		myosin heavy chain IIa							101.0	98.0	99.0					17																	10427825		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10427825C>G		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5133G>C	17.37:g.10427825C>G	ENSP00000245503:p.Glu1711Asp		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.E1711D|MYH2_uc010coj.2_Intron	p.E1711D	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			35	5261	-			1711			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.5133G>C	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415973	0.62511	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.81579	-1.51;-1.51	5.31	3.29	0.37713	Myosin tail (1);	0.000000	0.39475	U	0.001359	D	0.88603	0.6481	M	0.86343	2.81	0.39766	D	0.972097	B	0.32409	0.37	P	0.53062	0.717	D	0.87437	0.2392	10	0.49607	T	0.09	.	9.1969	0.37233	0.0:0.7111:0.0:0.2889	.	1711	Q9UKX2	MYH2_HUMAN	D	1711	ENSP00000245503:E1711D;ENSP00000380367:E1711D	ENSP00000245503:E1711D	E	-	3	2	MYH2	10368550	0.978000	0.34361	1.000000	0.80357	0.856000	0.48823	0.258000	0.18387	0.782000	0.33613	0.491000	0.48974	GAG		0.522	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		7	72	0	0	0	0.004482	0	7	72				
TEKT3	64518	broad.mit.edu	37	17	15234527	15234527	+	Missense_Mutation	SNP	G	G	C	rs200461036		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:15234527G>C	ENST00000395930.1	-	3	562	c.376C>G	c.(376-378)Cgc>Ggc	p.R126G	TEKT3_ENST00000338696.2_Missense_Mutation_p.R126G	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	126					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TGAATCAGGCGAGATGTATCC	0.413																																							uc002gon.2		NA																	0				ovary(2)	2						c.(376-378)CGC>GGC		tektin 3							248.0	225.0	233.0					17																	15234527		2203	4300	6503	SO:0001583	missense	64518				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule		g.chr17:15234527G>C	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.376C>G	17.37:g.15234527G>C	ENSP00000379263:p.Arg126Gly		Somatic					p.R126G	NM_031898	NP_114104	WXS	Illumina HiSeq	Unspecified	Q9BXF9	TEKT3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)	3	563	-			126					B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	37	c.376C>G	CCDS11169.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595879	0.66332	.	.	ENSG00000125409	ENST00000395930;ENST00000338696;ENST00000536146;ENST00000539316	T;T;T;T	0.50001	4.12;4.12;4.12;0.76	5.61	4.65	0.58169	.	0.044077	0.85682	D	0.000000	T	0.74913	0.3779	M	0.92649	3.33	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	T	0.82265	-0.0543	10	0.72032	D	0.01	-0.105	14.8729	0.70471	0.0692:0.0:0.9308:0.0	.	126	Q9BXF9	TEKT3_HUMAN	G	126	ENSP00000379263:R126G;ENSP00000343995:R126G;ENSP00000446111:R126G;ENSP00000439713:R126G	ENSP00000343995:R126G	R	-	1	0	TEKT3	15175252	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	4.785000	0.62418	1.517000	0.48917	-0.140000	0.14226	CGC		0.413	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2	NM_031898		23	68	0	0	0	0.012319	0	23	68				
SUPT6H	6830	broad.mit.edu	37	17	27002069	27002069	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:27002069G>T	ENST00000314616.6	+	5	710	c.427G>T	c.(427-429)Gaa>Taa	p.E143*	SUPT6H_ENST00000347486.4_Nonsense_Mutation_p.E143*|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	143	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ACATGAAAAAGAAGCTATTGC	0.522																																							uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(427-429)GAA>TAA		suppressor of Ty 6 homolog							90.0	83.0	86.0					17																	27002069		2203	4300	6503	SO:0001587	stop_gained	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27002069G>T	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.427G>T	17.37:g.27002069G>T	ENSP00000319104:p.Glu143*		Somatic				SUPT6H_uc010crt.2_Nonsense_Mutation_p.E143*	p.E143*	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			5	517	+	Lung NSC(42;0.00431)		143			Asp/Glu-rich.		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	ENST00000314616.6	37	c.427G>T	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	37	6.192423	0.97362	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.71	5.71	0.89125	.	0.052596	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-22.6506	19.8546	0.96752	0.0:0.0:1.0:0.0	.	.	.	.	X	143	.	ENSP00000319104:E143X	E	+	1	0	SUPT6H	24026196	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	9.010000	0.93611	2.697000	0.92050	0.655000	0.94253	GAA		0.522	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		4	29	1	0	3.59834e-05	0.001168	4.20883e-05	4	29				
RARA	5914	broad.mit.edu	37	17	38487528	38487528	+	Missense_Mutation	SNP	C	C	T	rs201015843		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:38487528C>T	ENST00000254066.5	+	2	513	c.58C>T	c.(58-60)Ccg>Tcg	p.P20S	RARA_ENST00000425707.3_Missense_Mutation_p.P20S|RARA_ENST00000394089.2_Missense_Mutation_p.P20S	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	20	Modulating.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CAATGGGTACCCGGTGCCTCC	0.642			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																		uc002huk.1		NA		Dom	yes		17	17q12	5914	T	"""retinoic acid receptor, alpha"""			L	PML|ZNF145|TIF1|NUMA1|NPM1		APL		0				ovary(1)|lung(1)|breast(1)	3						c.(58-60)CCG>TCG		retinoic acid receptor, alpha isoform 1	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)						53.0	51.0	52.0					17																	38487528		2203	4300	6503	SO:0001583	missense	5914				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr17:38487528C>T	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.58C>T	17.37:g.38487528C>T	ENSP00000254066:p.Pro20Ser		Somatic				RARA_uc002hul.3_Missense_Mutation_p.P20S|RARA_uc010wfe.1_Missense_Mutation_p.P20S	p.P20S	NM_000964	NP_000955	WXS	Illumina HiSeq	Unspecified	P10276	RARA_HUMAN	STAD - Stomach adenocarcinoma(5;0.00143)		2	513	+		Breast(137;0.00328)	20			Modulating.		B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Missense_Mutation	SNP	ENST00000254066.5	37	c.58C>T	CCDS11366.1	.	.	.	.	.	.	.	.	.	.	c	15.18	2.757630	0.49468	.	.	ENSG00000131759	ENST00000254066;ENST00000425707;ENST00000394089	D;D;D	0.98264	-3.08;-4.83;-3.08	5.29	5.29	0.74685	.	.	.	.	.	D	0.96549	0.8874	L	0.49126	1.545	0.80722	D	1	B;B	0.31318	0.319;0.319	B;B	0.28784	0.094;0.059	D	0.95773	0.8810	9	0.42905	T	0.14	.	17.708	0.88314	0.0:1.0:0.0:0.0	.	20;20	B8Y636;P10276	.;RARA_HUMAN	S	20	ENSP00000254066:P20S;ENSP00000389993:P20S;ENSP00000377649:P20S	ENSP00000254066:P20S	P	+	1	0	RARA	35741054	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.420000	0.73349	2.462000	0.83206	0.651000	0.88453	CCG		0.642	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257136.2			38	22	0	0	0	0.00874	0	38	22				
FKBP10	60681	broad.mit.edu	37	17	39978051	39978051	+	Silent	SNP	C	C	A	rs541344214		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:39978051C>A	ENST00000321562.4	+	9	1649	c.1545C>A	c.(1543-1545)ggC>ggA	p.G515G	FKBP10_ENST00000544340.1_Silent_p.G288G	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	515	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.G515G(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		ACAAGGATGGCGAGGTCCCTC	0.602																																							uc002hxv.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(1)	1						c.(1543-1545)GGC>GGA		FK506 binding protein 10 precursor							113.0	99.0	104.0					17																	39978051		2203	4300	6503	SO:0001819	synonymous_variant	60681				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr17:39978051C>A	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.1545C>A	17.37:g.39978051C>A			Somatic				FKBP10_uc002hxw.1_Silent_p.G279G	p.G515G	NM_021939	NP_068758	WXS	Illumina HiSeq	Unspecified	Q96AY3	FKB10_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.148)	9	1870	+		Breast(137;0.00122)	515			1 (Potential).|EF-hand 1.		Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Silent	SNP	ENST00000321562.4	37	c.1545C>A	CCDS11409.1	.	.	.	.	.	.	.	.	.	.	C	7.839	0.721558	0.15372	.	.	ENSG00000141756	ENST00000455106	.	.	.	5.42	-1.07	0.09968	.	.	.	.	.	T	0.54303	0.1850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48647	-0.9017	4	.	.	.	-24.0573	8.7594	0.34665	0.2019:0.6385:0.0746:0.085	.	.	.	.	E	319	.	.	A	+	2	0	FKBP10	37231577	0.112000	0.22096	0.998000	0.56505	0.915000	0.54546	-0.429000	0.06982	-0.101000	0.12219	-0.545000	0.04230	GCG		0.602	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257410.2	NM_021939		17	58	1	0	1.67942e-08	0.006122	2.31018e-08	17	58				
ARL4D	379	broad.mit.edu	37	17	41477375	41477375	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:41477375G>T	ENST00000320033.4	+	2	482	c.275G>T	c.(274-276)cGc>cTc	p.R92L		NM_001661.3	NP_001652.2	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	92					GTP catabolic process (GO:0006184)|protein secretion (GO:0009306)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		TCTTATACCCGCCGGACAGAC	0.647																																							uc002idt.2		NA																	0				ovary(1)	1						c.(274-276)CGC>CTC		ADP-ribosylation factor-like 4D							65.0	70.0	68.0					17																	41477375		2203	4300	6503	SO:0001583	missense	379				protein secretion|small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|GTPase activity|protein binding	g.chr17:41477375G>T	AB060692	CCDS11463.1	17q21.31	2014-05-09	2005-11-03	2005-11-03	ENSG00000175906	ENSG00000175906		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	656	protein-coding gene	gene with protein product		600732	"""ADP-ribosylation factor 4-like"""	ARF4L		7590735	Standard	NM_001661		Approved		uc002idt.3	P49703		ENST00000320033.4:c.275G>T	17.37:g.41477375G>T	ENSP00000322628:p.Arg92Leu		Somatic					p.R92L	NM_001661	NP_001652	WXS	Illumina HiSeq	Unspecified	P49703	ARL4D_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.155)	2	456	+		Breast(137;0.00908)	92					B2RC59|D3DX43	Missense_Mutation	SNP	ENST00000320033.4	37	c.275G>T	CCDS11463.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917572	0.73098	.	.	ENSG00000175906	ENST00000320033	D	0.83250	-1.7	4.79	4.79	0.61399	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91012	0.7173	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92032	0.5634	10	0.87932	D	0	-18.5493	17.115	0.86686	0.0:0.0:1.0:0.0	.	92	P49703	ARL4D_HUMAN	L	92	ENSP00000322628:R92L	ENSP00000322628:R92L	R	+	2	0	ARL4D	38832901	1.000000	0.71417	0.989000	0.46669	0.005000	0.04900	9.466000	0.97665	2.627000	0.88993	0.563000	0.77884	CGC		0.647	ARL4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453481.2	NM_001661		20	34	1	0	5.35356e-11	0.00278	7.88237e-11	20	34				
MPO	4353	broad.mit.edu	37	17	56349090	56349090	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:56349090C>A	ENST00000225275.3	-	11	2132	c.1956G>T	c.(1954-1956)aaG>aaT	p.K652N	MPO_ENST00000340482.3_Missense_Mutation_p.K684N	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	652					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GGCCTTTGCGCTTCAGAGGCT	0.627																																							uc002ivu.1		NA																	0				ovary(2)|large_intestine(1)|pancreas(1)	4						c.(1954-1956)AAG>AAT		myeloperoxidase	Cefdinir(DB00535)						68.0	49.0	55.0					17																	56349090		2203	4300	6503	SO:0001583	missense	4353				anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity	g.chr17:56349090C>A		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1956G>T	17.37:g.56349090C>A	ENSP00000225275:p.Lys652Asn		Somatic					p.K652N	NM_000250	NP_000241	WXS	Illumina HiSeq	Unspecified	P05164	PERM_HUMAN			11	2133	-			652					A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	c.1956G>T	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	C	6.415	0.444728	0.12164	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.73152	-0.72;-0.72	5.44	-0.254	0.12992	.	0.747764	0.12982	N	0.423144	T	0.35595	0.0937	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24657	-1.0154	10	0.62326	D	0.03	-3.0861	1.3256	0.02125	0.2417:0.42:0.1285:0.2097	.	652	P05164	PERM_HUMAN	N	684;652	ENSP00000344419:K684N;ENSP00000225275:K652N	ENSP00000225275:K652N	K	-	3	2	MPO	53704089	0.000000	0.05858	0.010000	0.14722	0.009000	0.06853	-0.193000	0.09573	-0.233000	0.09797	0.563000	0.77884	AAG		0.627	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1			15	12	1	0	6.94344e-10	0.006122	9.97269e-10	15	12				
BRIP1	83990	broad.mit.edu	37	17	59763348	59763348	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:59763348G>A	ENST00000259008.2	-	19	3021	c.2754C>T	c.(2752-2754)acC>acT	p.T918T	BRIP1_ENST00000577598.1_Silent_p.T918T	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	918	Interaction with BRCA1.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AATAAGGTGAGGTACTGTACT	0.363			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															uc002izk.1		NA	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	F|N|Mis	BRCA1 interacting protein C-terminal helicase 1			"""L, E"""		AML|leukemia|breast			0				ovary(1)	1						c.(2752-2754)ACC>ACT	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	BRCA1 interacting protein C-terminal helicase 1							180.0	180.0	180.0					17																	59763348		2203	4300	6503	SO:0001819	synonymous_variant	83990	FanconAnemia			DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding	g.chr17:59763348G>A	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.2754C>T	17.37:g.59763348G>A			Somatic				BRIP1_uc002izl.1_Silent_p.T299T	p.T918T	NM_032043	NP_114432	WXS	Illumina HiSeq	Unspecified	Q9BX63	FANCJ_HUMAN			19	2895	-			918			Interaction with BRCA1.		Q3MJE2|Q8NCI5	Silent	SNP	ENST00000259008.2	37	c.2754C>T	CCDS11631.1																																																																																				0.363	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043		21	82	0	0	0	0.00333	0	21	82				
KPNA2	3838	broad.mit.edu	37	17	66038394	66038394	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:66038394G>T	ENST00000537025.2	+	5	1116	c.496G>T	c.(496-498)Gca>Tca	p.A166S	KPNA2_ENST00000330459.3_Missense_Mutation_p.A166S			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	166	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGCCATCCCAGCATTCATTTC	0.468																																							uc002jgk.2		NA																	0				central_nervous_system(2)	2						c.(496-498)GCA>TCA		karyopherin alpha 2							251.0	246.0	248.0					17																	66038394		2203	4296	6499	SO:0001583	missense	3838				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity	g.chr17:66038394G>T	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.496G>T	17.37:g.66038394G>T	ENSP00000438483:p.Ala166Ser		Somatic				KPNA2_uc002jgl.2_Missense_Mutation_p.A166S	p.A166S	NM_002266	NP_002257	WXS	Illumina HiSeq	Unspecified	P52292	IMA2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		5	628	+	all_cancers(12;1.18e-09)		166			NLS binding site (major) (By similarity).|ARM 3.		B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	37	c.496G>T	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949832	0.53186	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.71934	-0.61;-0.61	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.71804	0.3383	L	0.61218	1.895	0.80722	D	1	B	0.12013	0.005	B	0.17722	0.019	T	0.67635	-0.5620	10	0.59425	D	0.04	.	19.8706	0.96849	0.0:0.0:1.0:0.0	.	166	P52292	IMA2_HUMAN	S	166	ENSP00000332455:A166S;ENSP00000438483:A166S	ENSP00000332455:A166S	A	+	1	0	KPNA2	63468856	1.000000	0.71417	0.999000	0.59377	0.218000	0.24690	7.836000	0.86788	2.691000	0.91804	0.563000	0.77884	GCA		0.468	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266		67	296	1	0	1.71382e-40	0.01441	3.18825e-40	67	296				
ABCA10	10349	broad.mit.edu	37	17	67148534	67148534	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:67148534G>A	ENST00000269081.4	-	36	5134	c.4225C>T	c.(4225-4227)Cgt>Tgt	p.R1409C	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1409	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ATGGCCATACGGTCACACACA	0.493																																							uc010dfa.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(4225-4227)CGT>TGT		ATP-binding cassette, sub-family A, member 10							152.0	115.0	127.0					17																	67148534		2203	4300	6503	SO:0001583	missense	10349				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67148534G>A	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.4225C>T	17.37:g.67148534G>A	ENSP00000269081:p.Arg1409Cys		Somatic				ABCA10_uc002jhz.2_5'Flank|ABCA10_uc010wqs.1_Missense_Mutation_p.R401C|ABCA10_uc010wqt.1_RNA	p.R1409C	NM_080282	NP_525021	WXS	Illumina HiSeq	Unspecified	Q8WWZ4	ABCAA_HUMAN			36	5104	-	Breast(10;6.95e-12)		1409			ABC transporter 2.		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	c.4225C>T	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133732	0.56828	.	.	ENSG00000154263	ENST00000269081	D	0.99186	-5.53	3.28	1.15	0.20763	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.32952	U	0.005460	D	0.99108	0.9693	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.99461	1.0943	10	0.87932	D	0	.	9.3079	0.37887	0.1865:0.0:0.8135:0.0	.	401;1409	B4DPV2;Q8WWZ4	.;ABCAA_HUMAN	C	1409	ENSP00000269081:R1409C	ENSP00000269081:R1409C	R	-	1	0	ABCA10	64660129	1.000000	0.71417	0.939000	0.37840	0.465000	0.32709	2.254000	0.43214	0.192000	0.20272	0.563000	0.77884	CGT		0.493	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282		4	44	0	0	0	0.009096	0	4	44				
KIF19	124602	broad.mit.edu	37	17	72346895	72346895	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:72346895C>G	ENST00000389916.4	+	12	1576	c.1438C>G	c.(1438-1440)Cga>Gga	p.R480G		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	480					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GGAGGAGCAGCGAAAGGAGTG	0.647																																							uc002jkm.3		NA																	0					0						c.(1438-1440)CGA>GGA		kinesin family member 19							87.0	79.0	82.0					17																	72346895		2203	4300	6503	SO:0001583	missense	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72346895C>G	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1438C>G	17.37:g.72346895C>G	ENSP00000374566:p.Arg480Gly		Somatic				KIF19_uc002jkj.2_Missense_Mutation_p.R480G|KIF19_uc002jkk.2_Missense_Mutation_p.R438G|KIF19_uc002jkl.2_Missense_Mutation_p.R438G	p.R480G	NM_153209	NP_694941	WXS	Illumina HiSeq	Unspecified	Q2TAC6	KIF19_HUMAN			12	1576	+			480					A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	c.1438C>G	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	c	9.171	1.021068	0.19433	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.74632	-0.86;-0.67	5.75	2.43	0.29744	.	.	.	.	.	T	0.66096	0.2755	M	0.61703	1.905	0.39675	D	0.970818	B;P;B;B	0.43431	0.196;0.807;0.004;0.332	B;B;B;B	0.38194	0.113;0.267;0.007;0.13	T	0.62388	-0.6865	9	0.27082	T	0.32	.	8.8565	0.35231	0.5685:0.3193:0.1122:0.0	.	480;438;438;480	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	G	438;480	ENSP00000449134:R438G;ENSP00000374566:R480G	ENSP00000374566:R480G	R	+	1	2	KIF19	69858490	0.992000	0.36948	0.951000	0.38953	0.004000	0.04260	2.007000	0.40883	0.708000	0.31955	0.645000	0.84053	CGA		0.647	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		13	55	0	0	0	0.00245	0	13	55				
LLGL2	3993	broad.mit.edu	37	17	73566089	73566089	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:73566089G>T	ENST00000392550.3	+	15	1744	c.1627G>T	c.(1627-1629)Gag>Tag	p.E543*	LLGL2_ENST00000577200.1_Nonsense_Mutation_p.E543*|LLGL2_ENST00000167462.5_Nonsense_Mutation_p.E543*	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	543					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GCAGGCTGTGGAGCAGGTGGA	0.687																																							uc002joh.2		NA																	0				ovary(2)	2						c.(1627-1629)GAG>TAG		lethal giant larvae homolog 2 isoform c							34.0	34.0	34.0					17																	73566089		2202	4300	6502	SO:0001587	stop_gained	3993				cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding	g.chr17:73566089G>T	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1627G>T	17.37:g.73566089G>T	ENSP00000376333:p.Glu543*		Somatic				LLGL2_uc002joi.2_Nonsense_Mutation_p.E543*|LLGL2_uc010dgg.1_Nonsense_Mutation_p.E543*|LLGL2_uc002joj.2_Nonsense_Mutation_p.E532*|LLGL2_uc010wsd.1_Nonsense_Mutation_p.E170*	p.E543*	NM_001031803	NP_001026973	WXS	Illumina HiSeq	Unspecified	Q6P1M3	L2GL2_HUMAN	all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)		15	1781	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		543			WD 9.		Q14521|Q9BR62	Nonsense_Mutation	SNP	ENST00000392550.3	37	c.1627G>T	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	G	37	6.464324	0.97590	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	.	.	.	5.2	3.2	0.36748	.	0.410134	0.29594	N	0.011717	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0187	10.6277	0.45516	0.0721:0.1332:0.7947:0.0	.	.	.	.	X	543;543;532	.	ENSP00000167462:E543X	E	+	1	0	LLGL2	71077684	1.000000	0.71417	0.991000	0.47740	0.659000	0.38960	4.701000	0.61810	0.578000	0.29487	-0.324000	0.08512	GAG		0.687	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524		26	25	1	0	3.90053e-15	0.012213	6.24511e-15	26	25				
QRICH2	84074	broad.mit.edu	37	17	74289852	74289852	+	Missense_Mutation	SNP	C	C	T	rs138229886		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:74289852C>T	ENST00000262765.5	-	4	637	c.458G>A	c.(457-459)cGt>cAt	p.R153H		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	153										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						AGCTTCATCACGGGCCCTCGG	0.542																																							uc002jrd.1		NA																	0				ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(457-459)CGT>CAT		glutamine rich 2		C	HIS/ARG	0,4406		0,0,2203	66.0	65.0	65.0		458	-3.7	0.0	17	dbSNP_134	65	1,8599	1.2+/-3.3	0,1,4299	no	missense	QRICH2	NM_032134.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	153/1664	74289852	1,13005	2203	4300	6503	SO:0001583	missense	84074						protein binding	g.chr17:74289852C>T	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.458G>A	17.37:g.74289852C>T	ENSP00000262765:p.Arg153His		Somatic				QRICH2_uc010wsz.1_Missense_Mutation_p.R79H|QRICH2_uc010dgw.1_Intron	p.R153H	NM_032134	NP_115510	WXS	Illumina HiSeq	Unspecified	Q9H0J4	QRIC2_HUMAN			4	638	-			153					A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	c.458G>A	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	C	5.257	0.232795	0.09969	0.0	1.16E-4	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.08193	3.12	3.32	-3.66	0.04489	.	.	.	.	.	T	0.05777	0.0151	N	0.25426	0.745	0.09310	N	1	B;B	0.17465	0.022;0.022	B;B	0.14578	0.011;0.011	T	0.37407	-0.9707	9	0.45353	T	0.12	0.0875	8.9541	0.35807	0.0:0.36:0.0:0.64	.	153;153	B5MD94;Q9H0J4	.;QRIC2_HUMAN	H	153	ENSP00000262765:R153H	ENSP00000262765:R153H	R	-	2	0	QRICH2	71801447	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.303000	0.02743	-0.803000	0.04415	-1.008000	0.02478	CGT		0.542	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		4	48	0	0	0	0.009096	0	4	48				
ST6GALNAC2	10610	broad.mit.edu	37	17	74569353	74569353	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:74569353C>A	ENST00000225276.5	-	4	773	c.454G>T	c.(454-456)Gcc>Tcc	p.A152S	ST6GALNAC2_ENST00000586520.1_5'UTR|RP11-666A8.9_ENST00000588104.1_RNA	NM_006456.2	NP_006447.2	Q9UJ37	SIA7B_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2	152					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	11						CCCACCACGGCACACCGGATA	0.602																																							uc002jsg.3		NA																	0					0						c.(454-456)GCC>TCC		sialyltransferase 7B							37.0	32.0	33.0					17																	74569353		2203	4300	6503	SO:0001583	missense	10610				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr17:74569353C>A	U14550	CCDS11747.1	17q25.1	2013-03-01	2003-12-05	2005-02-07	ENSG00000070731	ENSG00000070731	2.4.99.7	"""Sialyltransferases"""	10867	protein-coding gene	gene with protein product		610137	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"", ""sialyltransferase-like 1"""	SIAT7, SIAT7B, SIATL1		11984005	Standard	NM_006456		Approved	ST6GalNAII, STHM	uc002jsg.4	Q9UJ37	OTTHUMG00000180301	ENST00000225276.5:c.454G>T	17.37:g.74569353C>A	ENSP00000225276:p.Ala152Ser		Somatic					p.A152S	NM_006456	NP_006447	WXS	Illumina HiSeq	Unspecified	Q9UJ37	SIA7B_HUMAN			4	709	-			152			Lumenal (Potential).		Q12971	Missense_Mutation	SNP	ENST00000225276.5	37	c.454G>T	CCDS11747.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800966	0.50315	.	.	ENSG00000070731	ENST00000225276	T	0.50001	0.76	4.76	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	M	0.84082	2.675	0.43430	D	0.995592	D	0.89917	1.0	D	0.97110	1.0	T	0.73199	-0.4058	10	0.87932	D	0	-20.0295	12.0505	0.53503	0.0:0.8252:0.1748:0.0	.	152	Q9UJ37	SIA7B_HUMAN	S	152	ENSP00000225276:A152S	ENSP00000225276:A152S	A	-	1	0	ST6GALNAC2	72080948	1.000000	0.71417	0.040000	0.18447	0.087000	0.18053	6.566000	0.73978	0.954000	0.37851	0.585000	0.79938	GCC		0.602	ST6GALNAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450650.1	NM_006456		16	10	1	0	1.67942e-08	0.006122	2.31018e-08	16	10				
JMJD6	23210	broad.mit.edu	37	17	74720008	74720008	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:74720008G>A	ENST00000397625.4	-	3	765	c.651C>T	c.(649-651)ctC>ctT	p.L217L	METTL23_ENST00000341249.6_5'Flank|METTL23_ENST00000590964.1_5'Flank|METTL23_ENST00000586752.1_5'Flank|METTL23_ENST00000589977.1_5'Flank|METTL23_ENST00000588822.1_5'Flank|JMJD6_ENST00000585429.1_Silent_p.L217L|METTL23_ENST00000588783.1_5'Flank|METTL23_ENST00000591571.1_5'Flank|METTL23_ENST00000586738.1_5'Flank|JMJD6_ENST00000445478.2_Silent_p.L217L|METTL23_ENST00000588302.1_5'Flank	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6	217	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						TCACTTTGATGAGTTCCCTGG	0.542																																							uc002jso.2		NA																	0				skin(2)|ovary(1)	3						c.(649-651)CTC>CTT		jumonji domain containing 6 isoform 2							134.0	130.0	131.0					17																	74720008		1946	4137	6083	SO:0001819	synonymous_variant	23210				mRNA processing|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine|regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|sprouting angiogenesis|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-R2 specific)|histone demethylase activity (H4-R3 specific)|identical protein binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-lysine 5-dioxygenase activity|single-stranded RNA binding	g.chr17:74720008G>A	AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.651C>T	17.37:g.74720008G>A			Somatic				JMJD6_uc002jsn.1_Silent_p.L217L|JMJD6_uc010dgz.2_Silent_p.L217L|C17orf95_uc002jsp.2_5'Flank|C17orf95_uc002jsq.2_5'Flank|C17orf95_uc002jsr.2_5'Flank|C17orf95_uc002jss.2_5'Flank|C17orf95_uc002jst.2_5'Flank	p.L217L	NM_015167	NP_055982	WXS	Illumina HiSeq	Unspecified	Q6NYC1	JMJD6_HUMAN			3	975	-			217			JmjC.		B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Silent	SNP	ENST00000397625.4	37	c.651C>T	CCDS42384.1																																																																																				0.542	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403211.1	NM_015167		46	36	0	0	0	0.01441	0	46	36				
CYTH1	9267	broad.mit.edu	37	17	76695001	76695001	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:76695001C>A	ENST00000446868.3	-	8	670	c.600G>T	c.(598-600)ctG>ctT	p.L200L	CYTH1_ENST00000585509.1_Silent_p.L141L|CYTH1_ENST00000589297.1_Silent_p.L141L|RNU6-638P_ENST00000516582.1_RNA|CYTH1_ENST00000589296.1_Intron|CYTH1_ENST00000591455.1_Silent_p.L200L|CYTH1_ENST00000361101.4_Silent_p.L200L			Q15438	CYH1_HUMAN	cytohesin 1	200	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						TGGGGTTGTGCAGACTGGTGT	0.512																																							uc002jvw.2		NA																	0				ovary(1)	1						c.(598-600)CTG>CTT		cytohesin 1 isoform 2							252.0	242.0	245.0					17																	76695001		2203	4300	6503	SO:0001819	synonymous_variant	9267				regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding	g.chr17:76695001C>A	M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.600G>T	17.37:g.76695001C>A			Somatic				CYTH1_uc010wtw.1_Silent_p.L141L|CYTH1_uc010wtx.1_Silent_p.L141L	p.L200L	NM_017456	NP_059430	WXS	Illumina HiSeq	Unspecified	Q15438	CYH1_HUMAN			8	671	-			200			SEC7.		A6NFW7|B7Z1T4|Q9P123|Q9P124	Silent	SNP	ENST00000446868.3	37	c.600G>T																																																																																					0.512	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317099.1	NM_004762		40	240	1	0	4.1673e-28	0.01441	7.49092e-28	40	240				
CCDC40	55036	broad.mit.edu	37	17	78063594	78063594	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr17:78063594C>T	ENST00000397545.4	+	17	2770	c.2743C>T	c.(2743-2745)Caa>Taa	p.Q915*	CCDC40_ENST00000573903.1_3'UTR|CCDC40_ENST00000374877.3_Nonsense_Mutation_p.Q915*	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	915					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GAAAAAAATCCAACTGGCAAA	0.502																																							uc010dht.2		NA																	0				ovary(3)	3						c.(2743-2745)CAA>TAA		coiled-coil domain containing 40							67.0	66.0	66.0					17																	78063594		1897	4119	6016	SO:0001587	stop_gained	55036				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm		g.chr17:78063594C>T	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2743C>T	17.37:g.78063594C>T	ENSP00000380679:p.Gln915*		Somatic				CCDC40_uc002jxm.3_Nonsense_Mutation_p.Q698*|CCDC40_uc002jxn.3_Nonsense_Mutation_p.Q311*	p.Q915*	NM_017950	NP_060420	WXS	Illumina HiSeq	Unspecified	Q4G0X9	CCD40_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)		17	2770	+	all_neural(118;0.167)		915			Potential.		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Nonsense_Mutation	SNP	ENST00000397545.4	37	c.2743C>T	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	C	40	7.925030	0.98565	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-23.3224	17.808	0.88607	0.0:1.0:0.0:0.0	.	.	.	.	X	915	.	ENSP00000364011:Q915X	Q	+	1	0	CCDC40	75678189	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	6.467000	0.73547	2.294000	0.77228	0.563000	0.77884	CAA		0.502	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082		14	53	0	0	0	0.004007	0	14	53				
USP14	9097	broad.mit.edu	37	18	180238	180238	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:180238G>A	ENST00000261601.7	+	5	394	c.303G>A	c.(301-303)atG>atA	p.M101I	USP14_ENST00000400266.3_Missense_Mutation_p.M90I|USP14_ENST00000582707.1_Missense_Mutation_p.M66I|USP14_ENST00000383589.2_Missense_Mutation_p.M55I	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	101					negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CCAACTAGATGGAGTTACCAT	0.313																																							uc002kkf.1		NA																	0				ovary(2)	2						c.(301-303)ATG>ATA		ubiquitin specific protease 14 isoform a							104.0	85.0	91.0					18																	180238		2203	4300	6503	SO:0001583	missense	9097				regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr18:180238G>A	U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.303G>A	18.37:g.180238G>A	ENSP00000261601:p.Met101Ile		Somatic				USP14_uc002kkg.1_Missense_Mutation_p.M66I|USP14_uc010wyr.1_Missense_Mutation_p.M90I	p.M101I	NM_005151	NP_005142	WXS	Illumina HiSeq	Unspecified	P54578	UBP14_HUMAN			5	519	+		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)	101					J3QRZ5|Q53XY5	Missense_Mutation	SNP	ENST00000261601.7	37	c.303G>A	CCDS32780.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988749	0.35131	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	T;T	0.28895	1.59;1.6	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	M	0.63843	1.955	0.80722	D	1	B;B;B	0.21688	0.035;0.019;0.059	B;B;B	0.17098	0.008;0.013;0.017	T	0.09618	-1.0666	10	0.22109	T	0.4	-12.6456	19.568	0.95403	0.0:0.0:1.0:0.0	.	90;66;101	B7Z4N8;A6NJA2;P54578	.;.;UBP14_HUMAN	I	101;66;90	ENSP00000261601:M101I;ENSP00000383125:M90I	ENSP00000261601:M101I	M	+	3	0	USP14	170238	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.913000	0.92730	2.729000	0.93468	0.591000	0.81541	ATG		0.313	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440305.3	NM_005151		33	15	0	0	0	0.003755	0	33	15				
EMILIN2	84034	broad.mit.edu	37	18	2890886	2890886	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:2890886C>A	ENST00000254528.3	+	4	920	c.761C>A	c.(760-762)aCt>aAt	p.T254N		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	254					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GTCTTCAACACTAAGGAATCT	0.498																																							uc002kln.2		NA																	0				skin(2)|ovary(1)	3						c.(760-762)ACT>AAT		elastin microfibril interfacer 2 precursor							48.0	52.0	51.0					18																	2890886		2203	4300	6503	SO:0001583	missense	84034				cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding	g.chr18:2890886C>A	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.761C>A	18.37:g.2890886C>A	ENSP00000254528:p.Thr254Asn		Somatic					p.T254N	NM_032048	NP_114437	WXS	Illumina HiSeq	Unspecified	Q9BXX0	EMIL2_HUMAN		READ - Rectum adenocarcinoma(2;0.1)	4	920	+			254			Potential.		B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	c.761C>A	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.887335	0.00527	.	.	ENSG00000132205	ENST00000254528	T	0.34472	1.36	5.2	-3.98	0.04082	.	1.287830	0.05013	N	0.471429	T	0.12178	0.0296	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24657	-1.0154	10	0.15952	T	0.53	-1.0664	7.392	0.26915	0.3046:0.3557:0.3397:0.0	.	254	Q9BXX0	EMIL2_HUMAN	N	254	ENSP00000254528:T254N	ENSP00000254528:T254N	T	+	2	0	EMILIN2	2880886	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.026000	0.13599	-0.586000	0.05898	-0.310000	0.09108	ACT		0.498	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048		29	21	1	0	1.06801e-11	0.009535	1.61303e-11	29	21				
AFG3L2	10939	broad.mit.edu	37	18	12358888	12358888	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:12358888G>A	ENST00000269143.3	-	8	1038	c.807C>T	c.(805-807)taC>taT	p.Y269Y		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	269					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	TTCTGATGGTGTAGAGCAAGA	0.572																																							uc002kqz.1		NA																	0					0						c.(805-807)TAC>TAT		AFG3 ATPase family gene 3-like 2	Adenosine triphosphate(DB00171)						56.0	52.0	53.0					18																	12358888		2203	4300	6503	SO:0001819	synonymous_variant	10939				cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding	g.chr18:12358888G>A	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.807C>T	18.37:g.12358888G>A			Somatic					p.Y269Y	NM_006796	NP_006787	WXS	Illumina HiSeq	Unspecified	Q9Y4W6	AFG32_HUMAN			8	920	-			269			Helical; (Potential).		Q6P1L0	Silent	SNP	ENST00000269143.3	37	c.807C>T	CCDS11859.1																																																																																				0.572	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796		6	20	0	0	0	0.001168	0	6	20				
NPC1	4864	broad.mit.edu	37	18	21113343	21113343	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:21113343G>T	ENST00000269228.5	-	24	4284	c.3730C>A	c.(3730-3732)Ctc>Atc	p.L1244I	NPC1_ENST00000412552.2_Missense_Mutation_p.L926I	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	1244					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AAGACAGGGAGAAATATTAAT	0.403																																							uc002kum.3		NA																	0				ovary(2)	2						c.(3730-3732)CTC>ATC		Niemann-Pick disease, type C1 precursor							88.0	89.0	88.0					18																	21113343		2203	4300	6503	SO:0001583	missense	4864				autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity	g.chr18:21113343G>T	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.3730C>A	18.37:g.21113343G>T	ENSP00000269228:p.Leu1244Ile		Somatic				NPC1_uc010dlu.1_RNA|NPC1_uc010xaz.1_Missense_Mutation_p.L977I	p.L1244I	NM_000271	NP_000262	WXS	Illumina HiSeq	Unspecified	O15118	NPC1_HUMAN			24	4004	-	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)		1244			Helical; (Potential).		B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	c.3730C>A	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403601	0.83230	.	.	ENSG00000141458	ENST00000269228;ENST00000412552	D;D	0.89939	-2.59;-2.59	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.95529	0.8547	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95595	0.8658	10	0.87932	D	0	-33.0818	20.0203	0.97492	0.0:0.0:1.0:0.0	.	1255;1244	Q59GR1;O15118	.;NPC1_HUMAN	I	1244;926	ENSP00000269228:L1244I;ENSP00000408606:L926I	ENSP00000269228:L1244I	L	-	1	0	NPC1	19367341	1.000000	0.71417	0.997000	0.53966	0.374000	0.29953	9.863000	0.99569	2.730000	0.93505	0.655000	0.94253	CTC		0.403	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271		3	48	1	0	0.004672	0.004672	0.00501427	3	48				
CDH2	1000	broad.mit.edu	37	18	25543382	25543383	+	Missense_Mutation	DNP	GG	GG	TT	rs200230866		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:25543382_25543383GG>TT	ENST00000269141.3	-	15	2875_2876	c.2452_2453CC>AA	c.(2452-2454)CCc>AAc	p.P818N	CDH2_ENST00000399380.3_Missense_Mutation_p.P787N|AC015933.2_ENST00000423367.1_RNA	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	818					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CGGATACTGGGGCTCGGCGTGG	0.53																																							uc002kwg.2		NA																	0				ovary(3)|lung(1)	4						c.(2452-2454)CCC>AAC		cadherin 2, type 1 preproprotein																																				SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25543382_25543383GG>TT	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2452_2453delinsTT	18.37:g.25543382_25543383delinsTT	ENSP00000269141:p.Pro818Asn		Somatic				CDH2_uc010xbn.1_Missense_Mutation_p.P787N	p.P818N	NM_001792	NP_001783	WXS	Illumina HiSeq	Unspecified	P19022	CADH2_HUMAN			15	2911_2912	-			818			Cytoplasmic (Potential).		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	DNP	ENST00000269141.3	37	c.2452_2453CC>AA	CCDS11891.1																																																																																				0.530	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		8	11	0	0	0	0.004672	0	8	11				
CCDC178	374864	broad.mit.edu	37	18	30992018	30992018	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:30992018G>A	ENST00000383096.3	-	3	217	c.35C>T	c.(34-36)aCt>aTt	p.T12I	CCDC178_ENST00000406524.2_Missense_Mutation_p.T12I|CCDC178_ENST00000300227.8_Missense_Mutation_p.T12I|CCDC178_ENST00000402325.1_Missense_Mutation_p.T12I|CCDC178_ENST00000403303.1_Missense_Mutation_p.T12I|CCDC178_ENST00000579947.1_Missense_Mutation_p.T12I|CCDC178_ENST00000583930.1_Missense_Mutation_p.T12I|CCDC178_ENST00000579916.1_Missense_Mutation_p.T12I			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	12																	ATCATCTCTAGTGGAAGAAGA	0.269																																							uc002kxn.2		NA																	0				ovary(1)	1						c.(34-36)ACT>ATT		hypothetical protein LOC374864 isoform 1							43.0	45.0	44.0					18																	30992018		2201	4292	6493	SO:0001583	missense	374864							g.chr18:30992018G>A	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.35C>T	18.37:g.30992018G>A	ENSP00000372576:p.Thr12Ile		Somatic				C18orf34_uc010xbr.1_Missense_Mutation_p.T12I|C18orf34_uc010dmf.1_Missense_Mutation_p.T12I|C18orf34_uc002kxo.2_Missense_Mutation_p.T12I|C18orf34_uc002kxp.2_Missense_Mutation_p.T12I	p.T12I	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			2	177	-			12					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.35C>T	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	G	3.165	-0.171270	0.06421	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.52526	2.24;2.24;2.22;2.21;2.23;0.66	3.45	-0.405	0.12392	.	.	.	.	.	T	0.33498	0.0865	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B	0.16396	0.017;0.017;0.017;0.017;0.017	B;B;B;B;B	0.10450	0.005;0.005;0.005;0.005;0.005	T	0.32903	-0.9889	9	0.87932	D	0	-0.0486	3.5809	0.07952	0.3419:0.1925:0.4656:0.0	.	12;12;12;12;12	F8W7A7;A1L4G8;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;CR034_HUMAN	I	12	ENSP00000385591:T12I;ENSP00000372576:T12I;ENSP00000300227:T12I;ENSP00000385867:T12I;ENSP00000385234:T12I;ENSP00000382130:T12I	ENSP00000300227:T12I	T	-	2	0	C18orf34	29246016	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.051000	0.03507	-0.104000	0.12154	0.655000	0.94253	ACT		0.269	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		3	17	0	0	0	0.009096	0	3	17				
RIT2	6014	broad.mit.edu	37	18	40695453	40695454	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:40695453_40695454GG>TT	ENST00000326695.5	-	1	202_203	c.31_32CC>AA	c.(31-33)CCg>AAg	p.P11K	RIT2_ENST00000282028.4_Missense_Mutation_p.P11K|RIT2_ENST00000590910.1_Missense_Mutation_p.P11K|RIT2_ENST00000589109.1_Missense_Mutation_p.P11K	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	11					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGCGCTGCCCGGGGAGCAGCTG	0.53																																							uc002lav.2		NA																	0				ovary(1)	1						c.(31-33)CCG>AAG		Ras-like without CAAX 2																																				SO:0001583	missense	6014				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity	g.chr18:40695453_40695454GG>TT	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.31_32delinsTT	18.37:g.40695453_40695454delinsTT	ENSP00000321805:p.Pro11Lys		Somatic				RIT2_uc010dnf.2_Missense_Mutation_p.P11K	p.P11K	NM_002930	NP_002921	WXS	Illumina HiSeq	Unspecified	Q99578	RIT2_HUMAN			1	204_205	-			11					B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	DNP	ENST00000326695.5	37	c.31_32CC>AA	CCDS11921.1																																																																																				0.530	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930		23	36	0	0	0	0.004672	0	23	36				
SETBP1	26040	broad.mit.edu	37	18	42530157	42530157	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:42530157G>T	ENST00000282030.5	+	4	1148	c.852G>T	c.(850-852)ctG>ctT	p.L284L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	284						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ACAAAGATCTGCTCTTGGGAG	0.577									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(850-852)CTG>CTT		SET binding protein 1 isoform a							58.0	62.0	61.0					18																	42530157		2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42530157G>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.852G>T	18.37:g.42530157G>T			Somatic					p.L284L	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	1148	+			284					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.852G>T	CCDS11923.2																																																																																				0.577	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		9	19	1	0	2.17888e-05	0.006214	2.56906e-05	9	19				
DYM	54808	broad.mit.edu	37	18	46917985	46917985	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:46917985G>T	ENST00000269445.6	-	3	628	c.171C>A	c.(169-171)acC>acA	p.T57T	DYM_ENST00000442713.2_Silent_p.T57T|DYM_ENST00000584977.1_5'UTR	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	57					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						AGACTGAAATGGTTGCTTCCT	0.323																																							uc002ldi.1		NA																	0					0						c.(169-171)ACC>ACA		dymeclin							120.0	110.0	113.0					18																	46917985		2203	4300	6503	SO:0001819	synonymous_variant	54808					Golgi apparatus		g.chr18:46917985G>T	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.171C>A	18.37:g.46917985G>T			Somatic				DYM_uc010xdf.1_Silent_p.T57T	p.T57T	NM_017653	NP_060123	WXS	Illumina HiSeq	Unspecified	Q7RTS9	DYM_HUMAN			3	536	-			57					A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Silent	SNP	ENST00000269445.6	37	c.171C>A	CCDS11937.1																																																																																				0.323	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653		37	41	1	0	4.64027e-19	0.01441	7.90464e-19	37	41				
SMAD4	4089	broad.mit.edu	37	18	48575058	48575058	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:48575058G>T	ENST00000342988.3	+	3	790	c.252G>T	c.(250-252)gtG>gtT	p.V84V	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Silent_p.V84V|SMAD4_ENST00000588745.1_Silent_p.V84V|SMAD4_ENST00000452201.2_Silent_p.V84V	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	84	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ttttCTAGGTGGCTGGTCGGA	0.368																																							uc010xdp.1		NA																	40	Whole gene deletion(36)|Unknown(4)	p.0?(35)|p.?(4)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369						c.(250-252)GTG>GTT		mothers against decapentaplegic homolog 4							130.0	118.0	122.0					18																	48575058		2203	4300	6503	SO:0001819	synonymous_variant	4089	Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia			BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	g.chr18:48575058G>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.252G>T	18.37:g.48575058G>T			Somatic				SMAD4_uc010xdo.1_RNA	p.V84V	NM_005359	NP_005350	WXS	Illumina HiSeq	Unspecified	Q13485	SMAD4_HUMAN		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)	3	790	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	84			MH1.		A8K405	Silent	SNP	ENST00000342988.3	37	c.252G>T	CCDS11950.1																																																																																				0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359		8	18	1	0	0.00307968	0.00308	0.00332356	8	18				
ALPK2	115701	broad.mit.edu	37	18	56205108	56205108	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:56205108G>T	ENST00000361673.3	-	5	2524	c.2311C>A	c.(2311-2313)Cct>Act	p.P771T	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	771						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						ACAGCCACAGGCTCCCTGAAG	0.517																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(2311-2313)CCT>ACT		heart alpha-kinase							171.0	159.0	163.0					18																	56205108		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56205108G>T	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2311C>A	18.37:g.56205108G>T	ENSP00000354991:p.Pro771Thr		Somatic				ALPK2_uc002lhk.1_Missense_Mutation_p.P102T	p.P771T	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			5	2525	-			771					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.2311C>A	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959375	0.53400	.	.	ENSG00000198796	ENST00000361673	T	0.43294	0.95	5.57	4.69	0.59074	.	2.282190	0.01335	N	0.011373	T	0.61060	0.2317	L	0.48642	1.525	0.09310	N	1	D;D	0.67145	0.996;0.995	D;P	0.65443	0.935;0.702	T	0.40327	-0.9569	10	0.66056	D	0.02	-6.8529	10.7831	0.46390	0.0883:0.0:0.9117:0.0	.	771;771	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	T	771	ENSP00000354991:P771T	ENSP00000354991:P771T	P	-	1	0	ALPK2	54356088	0.092000	0.21681	0.054000	0.19295	0.082000	0.17680	1.424000	0.34848	1.334000	0.45468	0.591000	0.81541	CCT		0.517	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		15	20	1	0	2.61681e-11	0.00245	3.92188e-11	15	20				
ZNF516	9658	broad.mit.edu	37	18	74091788	74091788	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:74091788G>A	ENST00000443185.2	-	4	2599	c.2282C>T	c.(2281-2283)cCg>cTg	p.P761L	RP11-504I13.3_ENST00000583287.1_RNA|ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	761					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GTAAGGACACGGGTGAACGAC	0.612																																							uc010dqx.1		NA																	0				ovary(1)	1						c.(2281-2283)CCG>CTG		zinc finger protein 516							35.0	40.0	39.0					18																	74091788		2031	4182	6213	SO:0001583	missense	9658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:74091788G>A	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.2282C>T	18.37:g.74091788G>A	ENSP00000394757:p.Pro761Leu		Somatic				ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	p.P761L	NM_014643	NP_055458	WXS	Illumina HiSeq	Unspecified	Q92618	ZN516_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)	3	2517	-		Prostate(75;0.0869)|Esophageal squamous(42;0.129)	761			C2H2-type 9; atypical.			Missense_Mutation	SNP	ENST00000443185.2	37	c.2282C>T		.	.	.	.	.	.	.	.	.	.	G	17.95	3.514511	0.64522	.	.	ENSG00000101493	ENST00000443185	T	0.27104	1.69	4.12	3.24	0.37175	Zinc finger, C2H2-like (1);	0.263470	0.32041	N	0.006663	T	0.46521	0.1397	.	.	.	0.46396	D	0.999023	D	0.89917	1.0	D	0.67103	0.949	T	0.48790	-0.9004	9	0.87932	D	0	-62.8132	10.5788	0.45244	0.0909:0.0:0.9091:0.0	.	761	Q92618	ZN516_HUMAN	L	761	ENSP00000394757:P761L	ENSP00000394757:P761L	P	-	2	0	ZNF516	72220776	0.997000	0.39634	1.000000	0.80357	0.773000	0.43773	2.899000	0.48679	1.067000	0.40740	0.561000	0.74099	CCG		0.612	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643		5	10	0	0	0	0.001168	0	5	10				
EFNA2	1943	broad.mit.edu	37	19	1295574	1295574	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:1295574G>T	ENST00000215368.2	+	2	186	c.171G>T	c.(169-171)ggG>ggT	p.G57G	MUM1_ENST00000344663.3_Intron	NM_001405.3	NP_001396.2	O43921	EFNA2_HUMAN	ephrin-A2	57	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|olfactory bulb development (GO:0021772)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			lung(2)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGACGGCGGGGGCTACACGG	0.721																																							uc002lry.1		NA																	0					0						c.(169-171)GGG>GGT		ephrin-A2 precursor							22.0	19.0	20.0					19																	1295574		2188	4281	6469	SO:0001819	synonymous_variant	1943				cell-cell signaling	anchored to membrane|plasma membrane	ephrin receptor binding	g.chr19:1295574G>T		CCDS12061.1	19p13	2011-03-09			ENSG00000099617	ENSG00000099617		"""Ephrins"""	3222	protein-coding gene	gene with protein product		602756		EPLG6			Standard	NM_001405		Approved	ELF-1, LERK6	uc002lry.2	O43921		ENST00000215368.2:c.171G>T	19.37:g.1295574G>T			Somatic					p.G57G	NM_001405	NP_001396	WXS	Illumina HiSeq	Unspecified	O43921	EFNA2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	171	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)	57					O76020	Silent	SNP	ENST00000215368.2	37	c.171G>T	CCDS12061.1																																																																																				0.721	EFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450016.1	NM_001405		3	3	1	0	0.004672	0.004672	0.00501427	3	3				
MUM1	84939	broad.mit.edu	37	19	1362247	1362247	+	Splice_Site	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:1362247A>G	ENST00000415183.3	+	5	1140		c.e5-1		MUM1_ENST00000591806.1_Splice_Site|MUM1_ENST00000311401.5_Splice_Site|MUM1_ENST00000344663.3_Splice_Site			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1						chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTATTGGCAGAGTGCCAGT	0.438																																							uc010xgm.1		NA																	0					0						c.e5-2		SubName: Full=MUM1 protein;							73.0	61.0	65.0					19																	1362247		2203	4300	6503	SO:0001630	splice_region_variant	84939				chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding	g.chr19:1362247A>G	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1115-1A>G	19.37:g.1362247A>G			Somatic				MUM1_uc010dsi.2_Splice_Site_p.E303_splice|MUM1_uc002lrz.2_Splice_Site_p.E372_splice|MUM1_uc002lsb.2_Splice_Site_p.E303_splice	p.E371_splice			WXS	Illumina HiSeq	Unspecified	Q2TAK8	MUM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1181	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)						A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Splice_Site	SNP	ENST00000415183.3	37	c.1112_splice		.	.	.	.	.	.	.	.	.	.	A	11.57	1.677945	0.29783	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0036	0.41944	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MUM1	1313247	1.000000	0.71417	0.592000	0.28758	0.020000	0.10135	2.373000	0.44266	1.616000	0.50265	0.459000	0.35465	.		0.438	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	Intron	6	11	0	0	0	0.001984	0	6	11				
SLC39A3	29985	broad.mit.edu	37	19	2733240	2733240	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:2733240C>A	ENST00000269740.4	-	3	783	c.454G>T	c.(454-456)Ggc>Tgc	p.G152C	SLC39A3_ENST00000545664.1_Missense_Mutation_p.G152C|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3	152					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCCGTGGCCGTGGGGCTCC	0.726																																							uc002lwg.2		NA																	0					0						c.(454-456)GGC>TGC		solute carrier family 39 (zinc transporter),							13.0	15.0	14.0					19																	2733240		2188	4247	6435	SO:0001583	missense	29985					integral to membrane|plasma membrane	zinc ion transmembrane transporter activity	g.chr19:2733240C>A	AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.454G>T	19.37:g.2733240C>A	ENSP00000269740:p.Gly152Cys		Somatic				SLC39A3_uc010xgy.1_Missense_Mutation_p.G152C	p.G152C	NM_144564	NP_653165	WXS	Illumina HiSeq	Unspecified	Q9BRY0	S39A3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	3	708	-		Hepatocellular(1079;0.137)	152			Cytoplasmic (Potential).		B3KMJ3|Q8WUG1	Missense_Mutation	SNP	ENST00000269740.4	37	c.454G>T	CCDS12093.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447717	0.43429	.	.	ENSG00000141873	ENST00000545664;ENST00000269740	T;T	0.49432	0.78;0.78	4.79	-6.15	0.02105	.	1.136350	0.06359	N	0.711412	T	0.42131	0.1189	L	0.47190	1.495	0.09310	N	0.999998	D;P	0.53885	0.963;0.936	P;P	0.51550	0.667;0.673	T	0.48990	-0.8985	10	0.52906	T	0.07	-0.1928	2.5833	0.04824	0.1131:0.1742:0.3882:0.3245	.	152;152	F5H385;Q9BRY0	.;S39A3_HUMAN	C	152	ENSP00000445345:G152C;ENSP00000269740:G152C	ENSP00000269740:G152C	G	-	1	0	SLC39A3	2684240	0.000000	0.05858	0.000000	0.03702	0.458000	0.32498	-0.960000	0.03849	-0.480000	0.06803	-0.263000	0.10527	GGC		0.726	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451354.2			5	8	1	0	0.000602214	0.000602	0.000667103	5	8				
ATCAY	85300	broad.mit.edu	37	19	3917771	3917771	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:3917771G>C	ENST00000450849.2	+	10	1464	c.997G>C	c.(997-999)Gag>Cag	p.E333Q	ATCAY_ENST00000398448.3_Missense_Mutation_p.E339Q|ATCAY_ENST00000600960.1_Missense_Mutation_p.E333Q|RN7SL202P_ENST00000584410.1_RNA|ATCAY_ENST00000301260.6_Missense_Mutation_p.E333Q	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	333	Mediates interaction with GLS.				apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GGCCAGGAGGGAGAGGTGTGT	0.542																																							uc002lyy.3		NA																	0				breast(1)	1						c.(997-999)GAG>CAG		caytaxin							71.0	79.0	77.0					19																	3917771		1916	4105	6021	SO:0001583	missense	85300				transport		protein binding	g.chr19:3917771G>C		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.997G>C	19.37:g.3917771G>C	ENSP00000390941:p.Glu333Gln		Somatic				ATCAY_uc010xhz.1_Missense_Mutation_p.E339Q|ATCAY_uc010dts.2_Missense_Mutation_p.E90Q	p.E333Q	NM_033064	NP_149053	WXS	Illumina HiSeq	Unspecified	Q86WG3	ATCAY_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)	10	1427	+		Hepatocellular(1079;0.137)	333					Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	c.997G>C	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933847	0.52866	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.38077	1.18;1.18;1.16	4.75	4.75	0.60458	.	0.174390	0.48767	N	0.000162	T	0.28896	0.0717	L	0.29908	0.895	0.48762	D	0.999704	B;B;B	0.33345	0.409;0.169;0.105	B;B;B	0.35240	0.097;0.198;0.097	T	0.05162	-1.0902	10	0.15066	T	0.55	-27.3761	17.0755	0.86585	0.0:0.0:1.0:0.0	.	339;333;333	B4DS11;Q86WG3-3;Q86WG3	.;.;ATCAY_HUMAN	Q	333;333;333;339;311	ENSP00000390941:E333Q;ENSP00000301260:E333Q;ENSP00000381466:E339Q	ENSP00000301260:E333Q	E	+	1	0	ATCAY	3868771	1.000000	0.71417	0.998000	0.56505	0.567000	0.35839	7.552000	0.82192	2.352000	0.79861	0.313000	0.20887	GAG		0.542	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2			10	23	0	0	0	0.001855	0	10	23				
MCEMP1	199675	broad.mit.edu	37	19	7743422	7743422	+	Missense_Mutation	SNP	G	G	T	rs267605762		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:7743422G>T	ENST00000333598.3	+	5	873	c.419G>T	c.(418-420)tGg>tTg	p.W140L	TRAPPC5_ENST00000426877.2_5'Flank|C19orf59_ENST00000597445.1_Missense_Mutation_p.W97L|CTD-3214H19.16_ENST00000597959.1_Silent_p.L12L|TRAPPC5_ENST00000317378.5_5'Flank|TRAPPC5_ENST00000596148.1_5'Flank	NM_174918.2	NP_777578.2	Q8IX19	MCEM1_HUMAN		140						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)|stomach(1)	5						AAGAGAGGCTGGGATTCCGTT	0.527											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002mhh.1		NA																	0				skin(1)	1						c.(418-420)TGG>TTG		mast cell-expressed membrane protein 1							133.0	126.0	128.0					19																	7743422		2203	4300	6503	SO:0001583	missense	199675					integral to membrane		g.chr19:7743422G>T																												ENST00000333598.3:c.419G>T	19.37:g.7743422G>T	ENSP00000329920:p.Trp140Leu		Somatic	OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	644	TRAPPC5_uc002mhi.1_5'Flank|TRAPPC5_uc002mhj.1_5'Flank|TRAPPC5_uc002mhk.1_5'Flank	p.W140L	NM_174918	NP_777578	WXS	Illumina HiSeq	Unspecified	Q8IX19	MCEM1_HUMAN			5	444	+			140			Extracellular (Potential).		Q8IX20	Missense_Mutation	SNP	ENST00000333598.3	37	c.419G>T	CCDS12183.1	.	.	.	.	.	.	.	.	.	.	G	7.363	0.625291	0.14257	.	.	ENSG00000183019	ENST00000333598	T	0.49432	0.78	3.84	0.368	0.16146	.	1.013360	0.07924	N	0.976354	T	0.30510	0.0767	N	0.24115	0.695	0.09310	N	1	B	0.26809	0.16	B	0.28232	0.087	T	0.32929	-0.9888	10	0.56958	D	0.05	0.6672	2.5037	0.04639	0.2846:0.0:0.4847:0.2307	.	140	Q8IX19	MCEM1_HUMAN	L	140	ENSP00000329920:W140L	ENSP00000329920:W140L	W	+	2	0	C19orf59	7649422	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	1.340000	0.33896	0.145000	0.18977	-0.169000	0.13324	TGG		0.527	C19orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461248.1			9	29	1	0	2.61681e-11	0.00245	3.92188e-11	9	29				
MUC16	94025	broad.mit.edu	37	19	9006391	9006391	+	Missense_Mutation	SNP	G	G	C	rs201544283		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:9006391G>C	ENST00000397910.4	-	45	39830	c.39627C>G	c.(39625-39627)agC>agG	p.S13209R	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13211	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAACACTGGTGCTCTTGAACA	0.562																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(39625-39627)AGC>AGG		mucin 16							103.0	86.0	91.0					19																	9006391		2028	4192	6220	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9006391G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39627C>G	19.37:g.9006391G>C	ENSP00000381008:p.Ser13209Arg		Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.S26R|MUC16_uc010xki.1_Intron	p.S13209R	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			45	39831	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.39627C>G	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.901|8.901	0.956376|0.956376	0.18507|0.18507	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000441155	.|T	.|0.28454	.|1.61	2.85|2.85	-5.71|-5.71	0.02413|0.02413	.|SEA (1);	.|.	.|.	.|.	.|.	T|T	0.44767|0.44767	0.1309|0.1309	M|M	0.86651|0.86651	2.83|2.83	.|.	.|.	.|.	.|B;P	.|0.48694	.|0.095;0.914	.|B;P	.|0.58391	.|0.067;0.838	T|T	0.45220|0.45220	-0.9276|-0.9276	4|8	.|0.87932	.|D	.|0	-2.947|-2.947	0.9252|0.9252	0.01323|0.01323	0.4293:0.2284:0.1763:0.166|0.4293:0.2284:0.1763:0.166	.|.	.|20854;13209	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	G|R	49|13209;340	.|ENSP00000381008:S13209R	.|ENSP00000381008:S13209R	A|S	-|-	2|3	0|2	MUC16|MUC16	8867391|8867391	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-4.323000|-4.323000	0.00253|0.00253	-2.688000|-2.688000	0.00405|0.00405	-0.384000|-0.384000	0.06662|0.06662	GCA|AGC		0.562	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		11	87	0	0	0	0.001855	0	11	87				
MUC16	94025	broad.mit.edu	37	19	9017345	9017345	+	Splice_Site	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:9017345C>T	ENST00000397910.4	-	26	38182		c.e26+1			NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated						cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGCTGCTCACCATTGACATA	0.552																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.e26+1		mucin 16							179.0	162.0	167.0					19																	9017345		1970	4158	6128	SO:0001630	splice_region_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9017345C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37978+1G>A	19.37:g.9017345C>T			Somatic					p.G12660_splice	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			26	38182	-								Q6ZQW5|Q96RK2	Splice_Site	SNP	ENST00000397910.4	37	c.37978_splice	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	11.68	1.710252	0.30322	.	.	ENSG00000181143	ENST00000397910	.	.	.	3.26	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3292	0.43812	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MUC16	8878345	1.000000	0.71417	0.958000	0.39756	0.425000	0.31504	4.170000	0.58229	1.518000	0.48934	0.400000	0.26472	.		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	Intron	46	103	0	0	0	0.01441	0	46	103				
MUC16	94025	broad.mit.edu	37	19	9091524	9091524	+	Silent	SNP	G	G	A	rs375390174	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:9091524G>A	ENST00000397910.4	-	1	494	c.291C>T	c.(289-291)tcC>tcT	p.S97S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	97	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCTTTGCTCGGAGTGTGTCA	0.537													G|||	9	0.00179712	0.0068	0.0	5008	,	,		19717	0.0		0.0	False		,,,				2504	0.0						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(289-291)TCC>TCT		mucin 16		G		29,3943		0,29,1957	138.0	136.0	137.0		291	-2.0	0.0	19		137	1,8329		0,1,4164	no	coding-synonymous	MUC16	NM_024690.2		0,30,6121	AA,AG,GG		0.012,0.7301,0.2439		97/14508	9091524	30,12272	1986	4165	6151	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9091524G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.291C>T	19.37:g.9091524G>A			Somatic					p.S97S	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	495	-			97			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.291C>T	CCDS54212.1																																																																																				0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		18	105	0	0	0	0.008871	0	18	105				
ZNF709	163051	broad.mit.edu	37	19	12575498	12575498	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:12575498G>A	ENST00000397732.3	-	4	1409	c.1238C>T	c.(1237-1239)aCt>aTt	p.T413I	ZNF709_ENST00000428311.1_Missense_Mutation_p.T413I|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T413I(2)		large_intestine(3)|upper_aerodigestive_tract(3)	6						TCCAGTGTGAGTTCTTTCATG	0.418																																					GBM(33;565 669 12371 29134 51667)	GBM(33;565 669 12371 29134 51667)	uc002mtv.3		NA																	2	Substitution - Missense(2)		kidney(1)|skin(1)		0						c.(1237-1239)ACT>ATT		zinc finger protein 709 isoform a							106.0	111.0	109.0					19																	12575498		2202	4299	6501	SO:0001583	missense	163051				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12575498G>A	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1238C>T	19.37:g.12575498G>A	ENSP00000380840:p.Thr413Ile		Somatic				ZNF709_uc002mtw.3_Missense_Mutation_p.T381I|ZNF709_uc002mtx.3_Missense_Mutation_p.T413I	p.T413I	NM_152601	NP_689814	WXS	Illumina HiSeq	Unspecified	Q8N972	ZN709_HUMAN			4	1399	-			413			C2H2-type 11.		A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	c.1238C>T	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	G	0.031	-1.333208	0.01298	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.06142	3.34;3.34	3.05	-3.79	0.04320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35067	N	0.003471	T	0.01976	0.0062	N	0.11000	0.08	0.09310	N	1	B	0.28258	0.205	B	0.25884	0.064	T	0.43814	-0.9368	10	0.02654	T	1	.	5.8441	0.18652	0.2644:0.3999:0.3357:0.0	.	413	Q8N972	ZN709_HUMAN	I	413	ENSP00000380840:T413I;ENSP00000404127:T413I	ENSP00000404127:T413I	T	-	2	0	ZNF709;CTD-2192J16.17	12436498	0.000000	0.05858	0.002000	0.10522	0.972000	0.66771	-2.485000	0.00979	-0.610000	0.05716	0.591000	0.81541	ACT		0.418	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601		5	140	0	0	0	0.001168	0	5	140				
CC2D1A	54862	broad.mit.edu	37	19	14034553	14034553	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:14034553G>A	ENST00000318003.7	+	17	2110	c.1869G>A	c.(1867-1869)ctG>ctA	p.L623L	CC2D1A_ENST00000589606.1_Silent_p.L623L	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	623					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			TGGACATTCTGAAGCAAGCCT	0.627																																							uc002mxo.2		NA																	0					0						c.(1867-1869)CTG>CTA		coiled-coil and C2 domain containing 1A							77.0	84.0	82.0					19																	14034553		2012	4179	6191	SO:0001819	synonymous_variant	54862				positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity	g.chr19:14034553G>A	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.1869G>A	19.37:g.14034553G>A			Somatic				CC2D1A_uc002mxp.2_Silent_p.L623L|CC2D1A_uc010dzh.2_Silent_p.L192L|CC2D1A_uc002mxq.1_Silent_p.L268L	p.L623L	NM_017721	NP_060191	WXS	Illumina HiSeq	Unspecified	Q6P1N0	C2D1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)		17	2168	+			623					Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Silent	SNP	ENST00000318003.7	37	c.1869G>A	CCDS42512.1																																																																																				0.627	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721		5	59	0	0	0	0.001168	0	5	59				
SLC1A6	6511	broad.mit.edu	37	19	15082612	15082612	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:15082612C>G	ENST00000221742.3	-	2	287	c.280G>C	c.(280-282)Gag>Cag	p.E94Q	SLC1A6_ENST00000598504.1_Missense_Mutation_p.E94Q|SLC1A6_ENST00000600144.1_Missense_Mutation_p.E94Q|SLC1A6_ENST00000544886.2_Missense_Mutation_p.E94Q|SLC1A6_ENST00000430939.2_Missense_Mutation_p.R98T	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	94					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						ATCAGAAGCTCTCCAGGAAAA	0.572																																							uc002naa.1		NA																	0				pancreas(3)|ovary(2)|skin(1)	6						c.(280-282)GAG>CAG		solute carrier family 1 (high affinity	L-Glutamic Acid(DB00142)						145.0	126.0	133.0					19																	15082612		2203	4300	6503	SO:0001583	missense	6511				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr19:15082612C>G		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.280G>C	19.37:g.15082612C>G	ENSP00000221742:p.Glu94Gln		Somatic				SLC1A6_uc010dzu.1_Missense_Mutation_p.E94Q|SLC1A6_uc010xod.1_Missense_Mutation_p.R98T|SLC1A6_uc002nab.2_Missense_Mutation_p.E94Q|SLC1A6_uc002nac.2_Missense_Mutation_p.E94Q|SLC1A6_uc002nad.1_Missense_Mutation_p.E94Q	p.E94Q	NM_005071	NP_005062	WXS	Illumina HiSeq	Unspecified	P48664	EAA4_HUMAN			2	288	-			94					Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	c.280G>C	CCDS12321.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.8|20.8	4.042753|4.042753	0.75732|0.75732	.|.	.|.	ENSG00000105143|ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610|ENST00000430939	T;T|T	0.59502|0.74737	0.26;0.26|-0.87	4.02|4.02	4.02|4.02	0.46733|0.46733	Sodium:dicarboxylate symporter, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72179|0.72179	0.3428|0.3428	L|L	0.42245|0.42245	1.32|1.32	0.58432|0.58432	D|D	0.999991|0.999991	D;D;D|B	0.60575|0.26708	0.976;0.988;0.978|0.157	P;D;P|B	0.65323|0.39185	0.855;0.934;0.905|0.293	T|T	0.70741|0.70741	-0.4789|-0.4789	10|9	0.87932|0.38643	D|T	0|0.18	-18.0044|-18.0044	13.6802|13.6802	0.62479|0.62479	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	94;95;94|98	Q8N753;Q59GB0;P48664|E7EV13	.;.;EAA4_HUMAN|.	Q|T	94;94;95|98	ENSP00000221742:E94Q;ENSP00000446175:E94Q|ENSP00000409386:R98T	ENSP00000221742:E94Q|ENSP00000409386:R98T	E|R	-|-	1|2	0|0	SLC1A6|SLC1A6	14943612|14943612	1.000000|1.000000	0.71417|0.71417	0.938000|0.938000	0.37757|0.37757	0.948000|0.948000	0.59901|0.59901	7.449000|7.449000	0.80643|0.80643	2.072000|2.072000	0.62099|0.62099	0.561000|0.561000	0.74099|0.74099	GAG|AGA		0.572	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		26	52	0	0	0	0.007291	0	26	52				
CASP14	23581	broad.mit.edu	37	19	15166240	15166240	+	Splice_Site	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:15166240G>T	ENST00000427043.3	+	6	828		c.e6-1		CASP14_ENST00000221740.1_Splice_Site|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase						cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						GGAATTCCCAGGATACATCGC	0.542																																							uc010dzv.1		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.e6-1		caspase 14 precursor							92.0	81.0	85.0					19																	15166240		2203	4300	6503	SO:0001630	splice_region_variant	23581				apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity	g.chr19:15166240G>T		CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.521-1G>T	19.37:g.15166240G>T			Somatic				CASP14_uc002naf.2_Splice_Site_p.G174_splice	p.G174_splice	NM_012114	NP_036246	WXS	Illumina HiSeq	Unspecified	P31944	CASPE_HUMAN			6	829	+								O95823|Q3SYC9	Splice_Site	SNP	ENST00000427043.3	37	c.521_splice	CCDS12323.1	.	.	.	.	.	.	.	.	.	.	G	8.486	0.860799	0.17178	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0259	0.58814	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CASP14	15027240	1.000000	0.71417	0.787000	0.31911	0.050000	0.14768	4.534000	0.60622	2.197000	0.70478	0.462000	0.41574	.		0.542	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	Intron	24	49	1	0	5.45024e-15	0.00333	8.70256e-15	24	49				
BST2	684	broad.mit.edu	37	19	17514602	17514602	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:17514602C>A	ENST00000252593.6	-	4	517	c.445G>T	c.(445-447)Gcg>Tcg	p.A149S	CTD-2521M24.9_ENST00000500836.2_lincRNA|BST2_ENST00000527220.1_5'UTR	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	149					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						TTCTTGTCCGCGATTCTCACG	0.612																																							uc002ngl.2		NA																	0				ovary(3)	3						c.(445-447)GCG>TCG		bone marrow stromal cell antigen 2 precursor							118.0	111.0	113.0					19																	17514602		2203	4300	6503	SO:0001583	missense	684				B cell activation|cell proliferation|cell-cell signaling|defense response to virus|humoral immune response|innate immune response|multicellular organismal development|positive regulation of I-kappaB kinase/NF-kappaB cascade	anchored to membrane|Golgi apparatus|integral to plasma membrane|late endosome	protein homodimerization activity|signal transducer activity	g.chr19:17514602C>A		CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.445G>T	19.37:g.17514602C>A	ENSP00000252593:p.Ala149Ser		Somatic				uc010eat.1_5'Flank|uc002ngm.1_5'Flank	p.A149S	NM_004335	NP_004326	WXS	Illumina HiSeq	Unspecified	Q10589	BST2_HUMAN			4	454	-			149			Extracellular (Potential).|		A8K4Y4|Q53G07	Missense_Mutation	SNP	ENST00000252593.6	37	c.445G>T	CCDS12358.1	.	.	.	.	.	.	.	.	.	.	C	8.880	0.951431	0.18431	.	.	ENSG00000130303	ENST00000416178;ENST00000252593	T	0.47177	0.85	0.789	-0.909	0.10514	.	.	.	.	.	T	0.28732	0.0712	L	0.27053	0.805	0.09310	N	1	B	0.12630	0.006	B	0.17979	0.02	T	0.19224	-1.0312	9	0.36615	T	0.2	.	3.6526	0.08209	0.4308:0.5692:0.0:0.0	.	149	Q10589	BST2_HUMAN	S	149	ENSP00000252593:A149S	ENSP00000252593:A149S	A	-	1	0	BST2	17375602	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-2.358000	0.01085	-0.213000	0.10094	0.297000	0.19635	GCG		0.612	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387346.1	NM_004335		24	33	1	0	0.000375601	0.00278	0.000420845	24	33				
FAM129C	199786	broad.mit.edu	37	19	17651213	17651213	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:17651213G>T	ENST00000335393.4	+	10	1223	c.1085G>T	c.(1084-1086)gGa>gTa	p.G362V	FAM129C_ENST00000332386.5_Missense_Mutation_p.G362V|FAM129C_ENST00000300971.2_Missense_Mutation_p.G362V|FAM129C_ENST00000601861.1_Missense_Mutation_p.G331V|FAM129C_ENST00000352727.3_Missense_Mutation_p.G362V|FAM129C_ENST00000599164.1_Missense_Mutation_p.G331V|FAM129C_ENST00000449408.2_Missense_Mutation_p.G88V|FAM129C_ENST00000600871.1_Missense_Mutation_p.G308V|FAM129C_ENST00000595684.1_Missense_Mutation_p.G362V|FAM129C_ENST00000599124.1_Missense_Mutation_p.G331V	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	362										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						GATATCAGGGGACCGCTCGAG	0.706																																							uc010xpr.1		NA																	0					0						c.(1084-1086)GGA>GTA		B-cell novel protein 1 isoform a							23.0	23.0	23.0					19																	17651213		2203	4300	6503	SO:0001583	missense	199786							g.chr19:17651213G>T	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1085G>T	19.37:g.17651213G>T	ENSP00000335040:p.Gly362Val		Somatic				FAM129C_uc010xpq.1_Missense_Mutation_p.G362V|FAM129C_uc002ngy.3_Missense_Mutation_p.G88V|FAM129C_uc010xpu.1_Missense_Mutation_p.G88V|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Missense_Mutation_p.G88V|FAM129C_uc002nhb.2_5'UTR	p.G362V	NM_173544	NP_775815	WXS	Illumina HiSeq	Unspecified	Q86XR2	NIBL2_HUMAN			10	1223	+			362					B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	c.1085G>T	CCDS12362.1	.	.	.	.	.	.	.	.	.	.	g	16.15	3.041657	0.55003	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000449408;ENST00000435646	T;T;T;T;T	0.74315	2.17;2.17;1.87;1.88;-0.83	4.04	0.0971	0.14493	.	0.272209	0.26052	N	0.026629	T	0.76471	0.3992	M	0.67953	2.075	0.20821	N	0.999846	D;D;D;D;D	0.56746	0.977;0.977;0.977;0.977;0.977	P;P;P;P;P	0.56648	0.742;0.803;0.742;0.742;0.742	T	0.67063	-0.5765	10	0.59425	D	0.04	-12.4006	6.3173	0.21199	0.1071:0.3546:0.5383:0.0	.	308;362;362;362;362	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;Q86XR2-2	.;NIBL2_HUMAN;.;.;.	V	362;362;362;362;88;308	ENSP00000335040:G362V;ENSP00000333447:G362V;ENSP00000341067:G362V;ENSP00000300971:G362V;ENSP00000394929:G88V	ENSP00000300971:G362V	G	+	2	0	FAM129C	17512213	0.134000	0.22483	0.026000	0.17262	0.220000	0.24768	0.232000	0.17891	-0.064000	0.13043	0.479000	0.44913	GGA		0.706	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544		6	21	1	0	0.00621372	0.006214	0.00664459	6	21				
SLC5A5	6528	broad.mit.edu	37	19	18004572	18004572	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:18004572C>A	ENST00000222248.3	+	15	2165	c.1818C>A	c.(1816-1818)ccC>ccA	p.P606P		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	606					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GCTTCCTGCCCACCAATGAGG	0.587																																					Melanoma(65;1008 1708 7910 46650)	Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1816-1818)CCC>CCA		solute carrier family 5 (sodium iodide							34.0	30.0	31.0					19																	18004572		2203	4300	6503	SO:0001819	synonymous_variant	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:18004572C>A		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1818C>A	19.37:g.18004572C>A			Somatic					p.P606P	NM_000453	NP_000444	WXS	Illumina HiSeq	Unspecified	Q92911	SC5A5_HUMAN			15	2165	+			606			Cytoplasmic (Potential).		O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	37	c.1818C>A	CCDS12368.1																																																																																				0.587	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			7	8	1	0	4.68919e-08	0.008291	6.17498e-08	7	8				
ELL	8178	broad.mit.edu	37	19	18576628	18576628	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:18576628C>A	ENST00000262809.4	-	3	355	c.284G>T	c.(283-285)tGc>tTc	p.C95F	ELL_ENST00000596124.3_5'UTR	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	95					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		CTGCTGGATGCAGTCGAAGCT	0.662			T	MLL	AL																																		uc002njh.2		NA		Dom	yes		19	19p13.1	8178	T	ELL gene (11-19 lysine-rich leukemia gene)			L	MLL		AL		0				lung(1)	1						c.(283-285)TGC>TTC		elongation factor RNA polymerase II							36.0	40.0	39.0					19																	18576628		2203	4300	6503	SO:0001583	missense	8178				positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding	g.chr19:18576628C>A	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.284G>T	19.37:g.18576628C>A	ENSP00000262809:p.Cys95Phe		Somatic				ELL_uc010ebq.2_Missense_Mutation_p.C38F|ELL_uc002njg.2_5'UTR	p.C95F	NM_006532	NP_006523	WXS	Illumina HiSeq	Unspecified	P55199	ELL_HUMAN		GBM - Glioblastoma multiforme(1328;7.81e-07)	3	356	-			95						Missense_Mutation	SNP	ENST00000262809.4	37	c.284G>T	CCDS12380.1	.	.	.	.	.	.	.	.	.	.	c	22.1	4.246963	0.80024	.	.	ENSG00000105656	ENST00000262809	T	0.42131	0.98	3.82	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.68933	0.3055	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	T	0.77202	-0.2674	10	0.72032	D	0.01	-0.9198	14.9121	0.70767	0.0:1.0:0.0:0.0	.	39;95	Q59HG4;P55199	.;ELL_HUMAN	F	95	ENSP00000262809:C95F	ENSP00000262809:C95F	C	-	2	0	ELL	18437628	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.364000	0.79526	1.974000	0.57490	0.479000	0.44913	TGC		0.662	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466362.1	NM_006532		17	23	1	0	0.000295444	0.014323	0.000332303	17	23				
NCAN	1463	broad.mit.edu	37	19	19330057	19330057	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:19330057G>T	ENST00000252575.6	+	3	506	c.407G>T	c.(406-408)gGg>gTg	p.G136V		NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	136	Ig-like V-type.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	AGTGACTCTGGGCTGTACCGC	0.672																																							uc002nlz.2		NA																	0				ovary(4)	4						c.(406-408)GGG>GTG		chondroitin sulfate proteoglycan 3 precursor							31.0	26.0	27.0					19																	19330057		2203	4300	6503	SO:0001583	missense	1463				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr19:19330057G>T	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.407G>T	19.37:g.19330057G>T	ENSP00000252575:p.Gly136Val		Somatic					p.G136V	NM_004386	NP_004377	WXS	Illumina HiSeq	Unspecified	O14594	NCAN_HUMAN	Epithelial(12;0.00544)		3	506	+			136			Ig-like V-type.		Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	c.407G>T	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158157	0.57368	.	.	ENSG00000130287	ENST00000539499;ENST00000252575	T	0.14516	2.5	4.59	4.59	0.56863	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40818	N	0.001010	T	0.45013	0.1321	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56962	-0.7892	10	0.87932	D	0	.	14.9149	0.70789	0.0:0.0:1.0:0.0	.	136	O14594	NCAN_HUMAN	V	150;136	ENSP00000252575:G136V	ENSP00000252575:G136V	G	+	2	0	NCAN	19191057	1.000000	0.71417	0.993000	0.49108	0.239000	0.25481	9.388000	0.97237	2.113000	0.64589	0.491000	0.48974	GGG		0.672	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		5	13	1	0	4.096e-09	0.001168	5.76985e-09	5	13				
CTC-260E6.6	0	broad.mit.edu	37	19	20370222	20370222	+	RNA	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:20370222C>A	ENST00000593655.1	-	0	199																											TGTGACTGTTCGATAAACTCC	0.413																																							uc002nov.2		NA																	0					0						c.(1015-1017)CGA>AGA		SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;																																						284441							g.chr19:20370222C>A																													19.37:g.20370222C>A			Somatic					p.R339R	NR_003128		WXS	Illumina HiSeq	Unspecified					1	1766	+									Silent	SNP	ENST00000593655.1	37	c.1015C>A																																																																																					0.413	CTC-260E6.6-006	KNOWN	basic	antisense	antisense	OTTHUMT00000462901.1			7	29	1	0	7.48243e-07	0.006214	9.4702e-07	7	29				
ZNF100	163227	broad.mit.edu	37	19	21910143	21910143	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:21910143T>C	ENST00000358296.6	-	5	1169	c.971A>G	c.(970-972)aAa>aGa	p.K324R	ZNF100_ENST00000305570.6_Missense_Mutation_p.K260R	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GTTAAAAGCTTTGCCACATTC	0.408																																							uc002nqi.2		NA																	0					0						c.(970-972)AAA>AGA		zinc finger protein 100							59.0	63.0	62.0					19																	21910143		2198	4292	6490	SO:0001583	missense	163227				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21910143T>C	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.971A>G	19.37:g.21910143T>C	ENSP00000351042:p.Lys324Arg		Somatic				ZNF100_uc002nqh.2_Missense_Mutation_p.K260R	p.K324R	NM_173531	NP_775802	WXS	Illumina HiSeq	Unspecified	Q8IYN0	ZN100_HUMAN			5	1170	-			324			C2H2-type 6.		Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	c.971A>G	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	5.915	0.352894	0.11182	.	.	ENSG00000197020	ENST00000358296	T	0.07688	3.17	0.841	0.841	0.18918	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09992	0.0245	L	0.48218	1.51	0.24966	N	0.991694	B;B	0.28584	0.216;0.043	B;B	0.37239	0.244;0.102	T	0.35151	-0.9800	9	0.56958	D	0.05	.	6.5745	0.22557	0.0:0.0:0.0:1.0	.	324;378	Q8IYN0;Q4G131	ZN100_HUMAN;.	R	324	ENSP00000351042:K324R	ENSP00000351042:K324R	K	-	2	0	ZNF100	21701983	0.028000	0.19301	0.852000	0.33557	0.852000	0.48524	0.639000	0.24690	0.157000	0.19338	0.155000	0.16302	AAA		0.408	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531		34	69	0	0	0	0.00874	0	34	69				
ZNF100	163227	broad.mit.edu	37	19	21910147	21910147	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:21910147C>A	ENST00000358296.6	-	5	1165	c.967G>T	c.(967-969)Ggc>Tgc	p.G323C	ZNF100_ENST00000305570.6_Missense_Mutation_p.G259C	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						AAAGCTTTGCCACATTCTGTA	0.403																																							uc002nqi.2		NA																	0					0						c.(967-969)GGC>TGC		zinc finger protein 100							58.0	62.0	61.0					19																	21910147		2200	4290	6490	SO:0001583	missense	163227				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21910147C>A	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.967G>T	19.37:g.21910147C>A	ENSP00000351042:p.Gly323Cys		Somatic				ZNF100_uc002nqh.2_Missense_Mutation_p.G259C	p.G323C	NM_173531	NP_775802	WXS	Illumina HiSeq	Unspecified	Q8IYN0	ZN100_HUMAN			5	1166	-			323			C2H2-type 6.		Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	c.967G>T	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	11.56	1.675368	0.29783	.	.	ENSG00000197020	ENST00000358296	T	0.01516	4.81	0.841	0.841	0.18918	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13756	0.0333	H	0.96518	3.835	0.34949	D	0.751042	D;D	0.89917	0.975;1.0	P;D	0.85130	0.721;0.997	T	0.09465	-1.0673	9	0.87932	D	0	.	8.3927	0.32537	0.0:1.0:0.0:0.0	.	323;377	Q8IYN0;Q4G131	ZN100_HUMAN;.	C	323	ENSP00000351042:G323C	ENSP00000351042:G323C	G	-	1	0	ZNF100	21701987	0.353000	0.24904	0.839000	0.33178	0.839000	0.47603	2.757000	0.47557	0.182000	0.20032	0.185000	0.17295	GGC		0.403	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531		34	68	1	0	7.63091e-17	0.007835	1.2561e-16	34	68				
ZNF208	7757	broad.mit.edu	37	19	22155850	22155850	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:22155850C>T	ENST00000397126.4	-	4	2134	c.1986G>A	c.(1984-1986)gaG>gaA	p.E662E	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGGGCTTCTCTCCAGCAT	0.383																																							uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(1684-1686)GAG>GAA		zinc finger protein 208							58.0	64.0	62.0					19																	22155850		2065	4226	6291	SO:0001819	synonymous_variant	7757							g.chr19:22155850C>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1986G>A	19.37:g.22155850C>T			Somatic				ZNF208_uc002nqo.1_Intron	p.E562E	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					5	1835	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.1686G>A	CCDS54240.1																																																																																				0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		3	63	0	0	0	0.004672	0	3	63				
TSHZ3	57616	broad.mit.edu	37	19	31768367	31768367	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:31768367C>T	ENST00000240587.4	-	2	2659	c.2332G>A	c.(2332-2334)Gac>Aac	p.D778N		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	778					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					AAATAGCGGTCGAGGTGGTCT	0.572																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2332-2334)GAC>AAC		zinc finger protein 537							98.0	85.0	89.0					19																	31768367		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31768367C>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2332G>A	19.37:g.31768367C>T	ENSP00000240587:p.Asp778Asn		Somatic					p.D778N	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	2397	-	Esophageal squamous(110;0.226)		778					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2332G>A	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226050	0.79576	.	.	ENSG00000121297	ENST00000240587	T	0.51071	0.72	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.47801	0.1465	L	0.41236	1.265	0.80722	D	1	D	0.56746	0.977	P	0.46940	0.532	T	0.38045	-0.9679	10	0.33141	T	0.24	-35.6866	19.1085	0.93307	0.0:1.0:0.0:0.0	.	778	Q63HK5	TSH3_HUMAN	N	778	ENSP00000240587:D778N	ENSP00000240587:D778N	D	-	1	0	TSHZ3	36460207	1.000000	0.71417	0.997000	0.53966	0.932000	0.56968	7.461000	0.80834	2.501000	0.84356	0.655000	0.94253	GAC		0.572	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		7	34	0	0	0	0.00308	0	7	34				
RHPN2	85415	broad.mit.edu	37	19	33490580	33490580	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:33490580C>T	ENST00000254260.3	-	10	1172	c.1137G>A	c.(1135-1137)gaG>gaA	p.E379E	RHPN2_ENST00000400226.4_Silent_p.E228E	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	379	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					ACAGGCACTTCTCCTGGTGGT	0.582																																							uc002nuf.2		NA																	0				central_nervous_system(5)|ovary(1)	6						c.(1135-1137)GAG>GAA		rhophilin, Rho GTPase binding protein 2							96.0	76.0	83.0					19																	33490580		2203	4300	6503	SO:0001819	synonymous_variant	85415				signal transduction	perinuclear region of cytoplasm	protein binding	g.chr19:33490580C>T	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1137G>A	19.37:g.33490580C>T			Somatic				RHPN2_uc010xro.1_Silent_p.E228E|RHPN2_uc002nue.2_Silent_p.E109E	p.E379E	NM_033103	NP_149094	WXS	Illumina HiSeq	Unspecified	Q8IUC4	RHPN2_HUMAN			10	1203	-	Esophageal squamous(110;0.137)		379			BRO1.		B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	ENST00000254260.3	37	c.1137G>A	CCDS12427.1																																																																																				0.582	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103		6	57	0	0	0	0.001168	0	6	57				
MAG	4099	broad.mit.edu	37	19	35791212	35791212	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:35791212T>A	ENST00000392213.3	+	6	1034	c.875T>A	c.(874-876)cTg>cAg	p.L292Q	MAG_ENST00000361922.4_Missense_Mutation_p.L292Q|MAG_ENST00000537831.2_Missense_Mutation_p.L267Q	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	292	Ig-like C2-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTCCTGGAGCTGGAGGAGGTG	0.682																																							uc002nyy.1		NA																	0				breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7						c.(874-876)CTG>CAG		myelin associated glycoprotein isoform a							23.0	25.0	25.0					19																	35791212		2203	4299	6502	SO:0001583	missense	4099				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding	g.chr19:35791212T>A	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.875T>A	19.37:g.35791212T>A	ENSP00000376048:p.Leu292Gln		Somatic				MAG_uc002nyx.1_Missense_Mutation_p.L292Q|MAG_uc010eds.1_Missense_Mutation_p.L267Q|MAG_uc002nyz.1_Missense_Mutation_p.L292Q	p.L292Q	NM_002361	NP_002352	WXS	Illumina HiSeq	Unspecified	P20916	MAG_HUMAN	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		6	1024	+	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	292			Ig-like C2-type 2.|Extracellular (Potential).		B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	37	c.875T>A	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	t	18.88	3.717463	0.68844	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.69806	-0.43;-0.43;-0.43	4.03	4.03	0.46877	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.086033	0.48767	D	0.000167	D	0.85465	0.5703	H	0.95187	3.635	0.58432	D	0.999996	D;D;D	0.89917	0.991;1.0;0.998	P;D;D	0.91635	0.887;0.999;0.956	D	0.88554	0.3118	10	0.87932	D	0	.	10.9489	0.47317	0.0:0.0:0.0:1.0	.	329;292;292	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	Q	329;292;292;267	ENSP00000355234:L292Q;ENSP00000376048:L292Q;ENSP00000440695:L267Q	ENSP00000262624:L329Q	L	+	2	0	MAG	40483052	1.000000	0.71417	1.000000	0.80357	0.462000	0.32619	6.547000	0.73892	1.687000	0.51057	0.248000	0.18094	CTG		0.682	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600		8	13	0	0	0	0.004482	0	8	13				
NPHS1	4868	broad.mit.edu	37	19	36333395	36333395	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:36333395T>C	ENST00000378910.5	-	18	2391	c.2392A>G	c.(2392-2394)Acg>Gcg	p.T798A	NPHS1_ENST00000353632.6_Missense_Mutation_p.T798A	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	798	Ig-like C2-type 7.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGGCGCCCCGTTGGTCCCCTG	0.622																																							uc002oby.2		NA																	0				ovary(4)|skin(1)	5						c.(2392-2394)ACG>GCG		nephrin precursor							94.0	92.0	93.0					19																	36333395		2203	4300	6503	SO:0001583	missense	4868				cell adhesion|excretion|muscle organ development	integral to plasma membrane		g.chr19:36333395T>C		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2392A>G	19.37:g.36333395T>C	ENSP00000368190:p.Thr798Ala		Somatic					p.T798A	NM_004646	NP_004637	WXS	Illumina HiSeq	Unspecified	O60500	NPHN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		18	2392	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		798			Ig-like C2-type 7.|Extracellular (Potential).		A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	c.2392A>G	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.276557	0.23307	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.79352	-1.26;-1.26	4.46	4.46	0.54185	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.255256	0.39274	N	0.001406	T	0.72661	0.3488	L	0.54323	1.7	0.30681	N	0.752327	B	0.24823	0.112	B	0.30029	0.11	T	0.71925	-0.4445	10	0.42905	T	0.14	-9.6225	10.1106	0.42561	0.0:0.0:0.0:1.0	.	798	O60500	NPHN_HUMAN	A	798	ENSP00000368190:T798A;ENSP00000343634:T798A	ENSP00000343634:T798A	T	-	1	0	NPHS1	41025235	0.978000	0.34361	0.587000	0.28692	0.002000	0.02628	2.338000	0.43957	1.890000	0.54733	0.456000	0.33151	ACG		0.622	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1			7	75	0	0	0	0.006214	0	7	75				
NPHS1	4868	broad.mit.edu	37	19	36339557	36339557	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:36339557C>A	ENST00000378910.5	-	9	1151	c.1152G>T	c.(1150-1152)atG>atT	p.M384I	NPHS1_ENST00000591817.1_5'Flank|NPHS1_ENST00000353632.6_Missense_Mutation_p.M384I	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	384	Ig-like C2-type 4.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGTCTCCTCCATGGGCAGCA	0.632																																							uc002oby.2		NA																	0				ovary(4)|skin(1)	5						c.(1150-1152)ATG>ATT		nephrin precursor							38.0	36.0	37.0					19																	36339557		2203	4299	6502	SO:0001583	missense	4868				cell adhesion|excretion|muscle organ development	integral to plasma membrane		g.chr19:36339557C>A		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.1152G>T	19.37:g.36339557C>A	ENSP00000368190:p.Met384Ile		Somatic					p.M384I	NM_004646	NP_004637	WXS	Illumina HiSeq	Unspecified	O60500	NPHN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		9	1152	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		384			Ig-like C2-type 4.|Extracellular (Potential).		A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	c.1152G>T	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078950	0.36662	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.75589	-0.95;-0.95	5.43	-8.64	0.00874	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.247084	0.38778	N	0.001577	T	0.44138	0.1279	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.18263	0.021	T	0.25117	-1.0141	10	0.66056	D	0.02	-3.7375	7.8582	0.29495	0.0:0.2182:0.3596:0.4222	.	384	O60500	NPHN_HUMAN	I	384	ENSP00000368190:M384I;ENSP00000343634:M384I	ENSP00000343634:M384I	M	-	3	0	NPHS1	41031397	0.015000	0.18098	0.304000	0.25085	0.763000	0.43281	-2.082000	0.01365	-1.124000	0.02936	0.461000	0.40582	ATG		0.632	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1			6	17	1	0	1.12685e-05	0.004482	1.35871e-05	6	17				
HKR1	284459	broad.mit.edu	37	19	37854448	37854448	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:37854448G>T	ENST00000324411.4	+	6	2020	c.1751G>T	c.(1750-1752)tGt>tTt	p.C584F	HKR1_ENST00000541583.2_Missense_Mutation_p.C523F|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000591471.1_Missense_Mutation_p.C311F|HKR1_ENST00000544914.1_Missense_Mutation_p.C311F|HKR1_ENST00000392153.3_Missense_Mutation_p.C565F|HKR1_ENST00000589392.1_Missense_Mutation_p.C566F	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	584					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGCAGGGAGTGTGGGCAAGGC	0.532																																							uc002ogb.2		NA																	0				ovary(2)	2						c.(1750-1752)TGT>TTT		GLI-Kruppel family member HKR1							61.0	60.0	60.0					19																	37854448		2203	4300	6503	SO:0001583	missense	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854448G>T	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1751G>T	19.37:g.37854448G>T	ENSP00000315505:p.Cys584Phe		Somatic				HKR1_uc002ofx.2_Missense_Mutation_p.C300F|HKR1_uc002ofy.2_Missense_Mutation_p.C300F|HKR1_uc002oga.2_Missense_Mutation_p.C566F|HKR1_uc010xto.1_Missense_Mutation_p.C566F|HKR1_uc002ogc.2_Missense_Mutation_p.C565F|HKR1_uc010xtp.1_Missense_Mutation_p.C523F|HKR1_uc002ogd.2_Missense_Mutation_p.C523F	p.C584F	NM_181786	NP_861451	WXS	Illumina HiSeq	Unspecified	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	2020	+			584			C2H2-type 11.		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	c.1751G>T	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.037147	0.54896	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	D;D;D;D	0.99974	-10.2;-2.16;-2.16;-2.16	3.14	2.09	0.27110	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.99977	0.9993	H	0.97103	3.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.969	D;D;D;B	0.97110	0.997;1.0;0.995;0.414	D	0.95772	0.8809	9	0.87932	D	0	.	9.4253	0.38576	0.1123:0.0:0.8877:0.0	.	523;565;584;566	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	F	311;363;565;620;584;523	ENSP00000437774:C311F;ENSP00000375994:C565F;ENSP00000315505:C584F;ENSP00000438261:C523F	ENSP00000315505:C584F	C	+	2	0	HKR1	42546288	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.642000	0.54367	0.653000	0.30826	0.650000	0.86243	TGT		0.532	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		11	22	1	0	3.07112e-06	0.010729	3.74932e-06	11	22				
ZNF527	84503	broad.mit.edu	37	19	37879792	37879792	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:37879792G>A	ENST00000436120.2	+	5	948	c.841G>A	c.(841-843)Gat>Aat	p.D281N	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGAATGTGGTGATGCCTTTAG	0.383																																							uc010efk.1		NA																	0				ovary(2)	2						c.(841-843)GAT>AAT		zinc finger protein 527							123.0	116.0	118.0					19																	37879792		2023	4192	6215	SO:0001583	missense	84503				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37879792G>A	AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.841G>A	19.37:g.37879792G>A	ENSP00000390179:p.Asp281Asn		Somatic				ZNF527_uc002ogf.3_Missense_Mutation_p.D249N|ZNF527_uc010xtq.1_RNA	p.D281N	NM_032453	NP_115829	WXS	Illumina HiSeq	Unspecified	Q8NB42	ZN527_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	952	+			281			C2H2-type 1; degenerate.		B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	37	c.841G>A	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562685	0.45694	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.19	-3.77	0.04346	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.470986	0.15838	N	0.242167	T	0.11707	0.0285	N	0.02315	-0.6	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15037	-1.0451	9	0.66056	D	0.02	.	5.6617	0.17672	0.5917:0.1627:0.2455:0.0	.	281;249	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	N	281;249;229	.	ENSP00000325231:D249N	D	+	1	0	ZNF527	42571632	0.908000	0.30866	0.004000	0.12327	0.315000	0.28087	1.062000	0.30555	-0.443000	0.07180	-0.150000	0.13652	GAT		0.383	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453		33	133	0	0	0	0.004289	0	33	133				
RASGRP4	115727	broad.mit.edu	37	19	38901791	38901791	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:38901791G>T	ENST00000587738.1	-	15	1886	c.1816C>A	c.(1816-1818)Cct>Act	p.P606T	RASGRP4_ENST00000293062.9_Missense_Mutation_p.P509T|RASGRP4_ENST00000433821.2_Missense_Mutation_p.P514T|RASGRP4_ENST00000587753.1_Missense_Mutation_p.P537T|RASGRP4_ENST00000454404.2_Missense_Mutation_p.P572T|RASGRP4_ENST00000426920.2_Missense_Mutation_p.P417T|RASGRP4_ENST00000586305.1_Missense_Mutation_p.P592T			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	606					activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GATGGGACAGGAGCTCCGGGG	0.612																																							uc002oir.2		NA																	0				pancreas(1)|lung(1)|skin(1)	3						c.(1816-1818)CCT>ACT		RAS guanyl releasing protein 4 isoform a							61.0	67.0	65.0					19																	38901791		2013	4174	6187	SO:0001583	missense	115727				activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity	g.chr19:38901791G>T	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1816C>A	19.37:g.38901791G>T	ENSP00000465772:p.Pro606Thr		Somatic				RASGRP4_uc010efz.1_RNA|RASGRP4_uc010ega.1_RNA|RASGRP4_uc010xua.1_Missense_Mutation_p.P537T|RASGRP4_uc010xub.1_Missense_Mutation_p.P572T|RASGRP4_uc010xuc.1_Missense_Mutation_p.P514T|RASGRP4_uc010xud.1_Missense_Mutation_p.P509T|RASGRP4_uc010xue.1_Missense_Mutation_p.P417T|RASGRP4_uc010egb.2_Missense_Mutation_p.P592T	p.P606T	NM_170604	NP_733749	WXS	Illumina HiSeq	Unspecified	Q8TDF6	GRP4_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		15	2030	-	all_cancers(60;4.21e-06)		606					A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	ENST00000587738.1	37	c.1816C>A	CCDS46068.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176029	0.38413	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000454404	T;T;T	0.77877	-1.13;-0.84;-0.97	5.53	3.35	0.38373	.	1.140440	0.06395	N	0.717702	T	0.71384	0.3333	L	0.32530	0.975	0.19775	N	0.999952	P;B;P;P;P;B;B	0.49635	0.926;0.073;0.666;0.666;0.666;0.023;0.146	P;B;B;B;B;B;B	0.44597	0.454;0.031;0.212;0.212;0.212;0.013;0.038	T	0.58142	-0.7688	10	0.46703	T	0.11	-10.7966	8.1389	0.31071	0.0832:0.0:0.7586:0.1582	.	417;509;514;572;537;592;606	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	T	514;509;417;606	ENSP00000411878:P514T;ENSP00000293062:P509T;ENSP00000445966:P417T	ENSP00000293062:P509T	P	-	1	0	RASGRP4	43593631	0.650000	0.27331	0.083000	0.20561	0.040000	0.13550	1.346000	0.33964	0.657000	0.30906	0.313000	0.20887	CCT		0.612	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604		16	20	1	0	1.66031e-10	0.003954	2.41424e-10	16	20				
IFNL2	282616	broad.mit.edu	37	19	39759454	39759454	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:39759454T>A	ENST00000331982.5	+	2	203	c.148T>A	c.(148-150)Tct>Act	p.S50T		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	50					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											CAAGTCCCTGTCTCCACAGGA	0.632																																							uc002oku.1		NA																	0				ovary(1)|skin(1)	2						c.(148-150)TCT>ACT		interleukin 28A precursor							31.0	33.0	32.0					19																	39759454		2203	4297	6500	SO:0001583	missense	282616				response to virus	extracellular space	cytokine activity	g.chr19:39759454T>A	AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.148T>A	19.37:g.39759454T>A	ENSP00000333639:p.Ser50Thr		Somatic					p.S50T	NM_172138	NP_742150	WXS	Illumina HiSeq	Unspecified	Q8IZJ0	IL28A_HUMAN	Epithelial(26;5.39e-26)|all cancers(26;4.1e-23)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		2	200	+	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		50					Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	ENST00000331982.5	37	c.148T>A	CCDS42567.1	.	.	.	.	.	.	.	.	.	.	T	13.00	2.106835	0.37145	.	.	ENSG00000183709	ENST00000331982	T	0.39056	1.1	3.35	3.35	0.38373	.	0.467815	0.19037	N	0.124398	T	0.46151	0.1378	M	0.79926	2.475	0.28649	N	0.906753	B	0.26902	0.163	B	0.32928	0.155	T	0.51919	-0.8644	10	0.72032	D	0.01	-2.2851	8.3096	0.32062	0.0:0.0:0.0:1.0	.	50	Q8IZJ0	IL28A_HUMAN	T	50	ENSP00000333639:S50T	ENSP00000333639:S50T	S	+	1	0	IL28A	44451294	0.962000	0.33011	0.998000	0.56505	0.500000	0.33767	0.752000	0.26362	1.534000	0.49203	0.352000	0.21897	TCT		0.632	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463833.1	NM_172138		11	15	0	0	0	0.001855	0	11	15				
ZNF780A	284323	broad.mit.edu	37	19	40580582	40580582	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:40580582C>T	ENST00000595687.2	-	6	1976	c.1767G>A	c.(1765-1767)gaG>gaA	p.E589E	ZNF780A_ENST00000455521.1_Silent_p.E590E|ZNF780A_ENST00000450241.2_Silent_p.E555E|ZNF780A_ENST00000340963.5_Silent_p.E589E|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000594395.1_Silent_p.E590E|ZNF780A_ENST00000414720.2_Intron	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTTTCCCACACTCCTTACATT	0.393																																							uc002omy.2		NA																	0					0						c.(1765-1767)GAG>GAA		zinc finger protein 780A isoform b							144.0	143.0	143.0					19																	40580582		2203	4300	6503	SO:0001819	synonymous_variant	284323				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40580582C>T	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1767G>A	19.37:g.40580582C>T			Somatic				ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Silent_p.E589E|ZNF780A_uc010xvh.1_Silent_p.E590E	p.E589E	NM_001010880	NP_001010880	WXS	Illumina HiSeq	Unspecified	O75290	Z780A_HUMAN			6	1992	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		589			C2H2-type 16.		E9PB48|Q6ZN87	Silent	SNP	ENST00000595687.2	37	c.1767G>A	CCDS33026.2																																																																																				0.393	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880		4	147	0	0	0	0.004482	0	4	147				
SPTBN4	57731	broad.mit.edu	37	19	41062044	41062044	+	Missense_Mutation	SNP	G	G	T	rs552777551		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:41062044G>T	ENST00000352632.3	+	25	5225	c.5139G>T	c.(5137-5139)aaG>aaT	p.K1713N	SPTBN4_ENST00000598249.1_Missense_Mutation_p.K1713N|SPTBN4_ENST00000392023.1_Missense_Mutation_p.K389N|SPTBN4_ENST00000595535.1_Missense_Mutation_p.K1713N|SPTBN4_ENST00000338932.3_Missense_Mutation_p.K1713N|SPTBN4_ENST00000392025.1_Missense_Mutation_p.K456N			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1713					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGGCGCTCAAGGAGCTGGGTG	0.647																																							uc002ony.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(5137-5139)AAG>AAT		spectrin, beta, non-erythrocytic 4 isoform							37.0	37.0	37.0					19																	41062044		2203	4300	6503	SO:0001583	missense	57731				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	g.chr19:41062044G>T	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5139G>T	19.37:g.41062044G>T	ENSP00000263373:p.Lys1713Asn		Somatic				SPTBN4_uc002onx.2_Missense_Mutation_p.K1713N|SPTBN4_uc002onz.2_Missense_Mutation_p.K1713N|SPTBN4_uc010egx.2_Missense_Mutation_p.K456N|SPTBN4_uc002ooa.2_Missense_Mutation_p.K389N	p.K1713N	NM_020971	NP_066022	WXS	Illumina HiSeq	Unspecified	Q9H254	SPTN4_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		25	5225	+			1713			Spectrin 14.		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	c.5139G>T	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703879	0.88924	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	4.29	4.29	0.51040	.	0.000000	0.64402	D	0.000003	T	0.68769	0.3037	M	0.77616	2.38	0.51767	D	0.999931	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.98;0.993;0.999;0.998	T	0.72469	-0.4284	10	0.51188	T	0.08	.	15.682	0.77376	0.0:0.0:1.0:0.0	.	456;389;1713;1713	C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;SPTN4_HUMAN;.	N	1713;1713;1713;456;389	ENSP00000263373:K1713N;ENSP00000340345:K1713N;ENSP00000375879:K456N;ENSP00000375877:K389N	ENSP00000340345:K1713N	K	+	3	2	SPTBN4	45753884	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.509000	0.73725	2.209000	0.71365	0.555000	0.69702	AAG		0.647	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			12	12	1	0	6.40141e-05	0.010729	7.41349e-05	12	12				
CYP2A7	1549	broad.mit.edu	37	19	41388078	41388078	+	Missense_Mutation	SNP	G	G	A	rs149348812	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:41388078G>A	ENST00000301146.4	-	1	579	c.38C>T	c.(37-39)gCc>gTc	p.A13V	CYP2A7_ENST00000291764.3_Missense_Mutation_p.A13V|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	13						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGTCAGGCAGGCCAGCAAGGC	0.572													.|||	3	0.000599042	0.0	0.0014	5008	,	,		17820	0.0		0.0	False		,,,				2504	0.002						uc002opm.2		NA																	0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						c.(37-39)GCC>GTC		cytochrome P450, family 2, subfamily A,		G	VAL/ALA,VAL/ALA	4,4402	4.2+/-10.8	0,4,2199	82.0	71.0	74.0		38,38	1.2	0.0	19	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CYP2A7	NM_030589.2,NM_000764.2	64,64	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	benign,benign	13/444,13/495	41388078	5,13001	2203	4300	6503	SO:0001583	missense	1549					endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr19:41388078G>A	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.38C>T	19.37:g.41388078G>A	ENSP00000301146:p.Ala13Val		Somatic				CYP2A7_uc002opo.2_Intron|CYP2A7_uc002opn.2_Missense_Mutation_p.A13V	p.A13V	NM_000764	NP_000755	WXS	Illumina HiSeq	Unspecified	P20853	CP2A7_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		1	580	-			13					Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	c.38C>T	CCDS12569.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	2.796	-0.250297	0.05867	9.08E-4	1.16E-4	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.69806	-0.42;-0.43	2.31	1.25	0.21368	.	0.875212	0.09797	U	0.754563	T	0.38692	0.1050	N	0.17474	0.49	0.09310	N	1	B;B	0.27997	0.197;0.124	B;B	0.19666	0.026;0.011	T	0.35450	-0.9788	10	0.02654	T	1	.	4.2347	0.10620	0.2076:0.0:0.7924:0.0	.	13;13	F8W816;P20853	.;CP2A7_HUMAN	V	13	ENSP00000301146:A13V;ENSP00000291764:A13V	ENSP00000291764:A13V	A	-	2	0	CYP2A7	46079918	0.762000	0.28451	0.006000	0.13384	0.533000	0.34776	2.936000	0.48971	1.294000	0.44707	0.162000	0.16502	GCC		0.572	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589		3	64	0	0	0	0.00308	0	3	64				
CYP2A7	1549	broad.mit.edu	37	19	41388100	41388100	+	Missense_Mutation	SNP	G	G	T	rs199972709		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:41388100G>T	ENST00000301146.4	-	1	557	c.16C>A	c.(16-18)Ctg>Atg	p.L6M	CYP2A7_ENST00000291764.3_Missense_Mutation_p.L6M|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	6						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ACCAGAAGCAGCCCTGAGGCC	0.567																																							uc002opm.2		NA																	0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						c.(16-18)CTG>ATG		cytochrome P450, family 2, subfamily A,		G	MET/LEU,MET/LEU	1,4405	2.1+/-5.4	0,1,2202	76.0	67.0	70.0		16,16	-0.8	0.8	19		70	0,8600		0,0,4300	yes	missense,missense	CYP2A7	NM_030589.2,NM_000764.2	15,15	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	benign,benign	6/444,6/495	41388100	1,13005	2203	4300	6503	SO:0001583	missense	1549					endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr19:41388100G>T	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.16C>A	19.37:g.41388100G>T	ENSP00000301146:p.Leu6Met		Somatic				CYP2A7_uc002opo.2_Intron|CYP2A7_uc002opn.2_Missense_Mutation_p.L6M	p.L6M	NM_000764	NP_000755	WXS	Illumina HiSeq	Unspecified	P20853	CP2A7_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		1	558	-			6					Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	c.16C>A	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	G	8.990	0.977398	0.18812	2.27E-4	0.0	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.72394	-0.62;-0.65	2.16	-0.755	0.11061	.	0.964830	0.08457	U	0.942989	T	0.61476	0.2350	L	0.60455	1.87	0.22389	N	0.999142	B;B	0.19200	0.034;0.02	B;B	0.12837	0.008;0.003	T	0.44817	-0.9303	10	0.25106	T	0.35	.	6.4728	0.22018	0.0:0.0:0.522:0.478	.	6;6	F8W816;P20853	.;CP2A7_HUMAN	M	6	ENSP00000301146:L6M;ENSP00000291764:L6M	ENSP00000291764:L6M	L	-	1	2	CYP2A7	46079940	0.000000	0.05858	0.754000	0.31244	0.370000	0.29829	-0.567000	0.05916	-0.220000	0.09988	0.162000	0.16502	CTG		0.567	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589		3	61	1	0	0.000157383	0.00308	0.000179081	3	61				
PSG6	5675	broad.mit.edu	37	19	43414963	43414963	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:43414963C>T	ENST00000292125.2	-	3	519	c.475G>A	c.(475-477)Gag>Aag	p.E159K	PSG6_ENST00000187910.2_Missense_Mutation_p.E159K|PSG6_ENST00000402603.4_Missense_Mutation_p.E159K	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	159	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				TCCATGACCTCCCTGGGGTTT	0.532																																							uc002ovj.1		NA																	0				ovary(1)|skin(1)	2						c.(475-477)GAG>AAG		pregnancy specific beta-1-glycoprotein 6 isoform							175.0	175.0	175.0					19																	43414963		2201	4299	6500	SO:0001583	missense	5675				female pregnancy	extracellular region		g.chr19:43414963C>T		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.475G>A	19.37:g.43414963C>T	ENSP00000292125:p.Glu159Lys		Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.E166K|PSG6_uc002ovi.2_Missense_Mutation_p.E160K|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_5'UTR|PSG6_uc002ovf.1_Missense_Mutation_p.E159K|PSG6_uc002ovg.1_Missense_Mutation_p.E159K	p.E159K	NM_002782	NP_002773	WXS	Illumina HiSeq	Unspecified	Q00889	PSG6_HUMAN			3	527	-		Prostate(69;0.00899)	159			Ig-like C2-type 1.		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	c.475G>A	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	11.94	1.787822	0.31593	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.12672	2.66;2.66;2.66	1.64	1.64	0.23874	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23133	0.0559	L	0.58302	1.8	0.09310	N	1	D;P;P	0.55605	0.972;0.596;0.69	P;B;P	0.56216	0.794;0.379;0.669	T	0.06215	-1.0839	9	0.66056	D	0.02	.	6.6645	0.23032	0.0:1.0:0.0:0.0	.	159;159;159	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	K	159	ENSP00000187910:E159K;ENSP00000385736:E159K;ENSP00000292125:E159K	ENSP00000187910:E159K	E	-	1	0	PSG6	48106803	0.001000	0.12720	0.005000	0.12908	0.003000	0.03518	0.324000	0.19610	0.894000	0.36317	0.194000	0.17425	GAG		0.532	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		14	176	0	0	0	0.007413	0	14	176				
IRGQ	126298	broad.mit.edu	37	19	44097349	44097349	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:44097349T>C	ENST00000602269.1	-	2	886	c.701A>G	c.(700-702)gAc>gGc	p.D234G	IRGQ_ENST00000601520.1_5'Flank|IRGQ_ENST00000422989.1_Missense_Mutation_p.D234G|L34079.2_ENST00000594374.1_5'Flank			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	234	IRG-type G.									endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				AAGGCCCACGTCAGCCTTGCC	0.687																																							uc002oww.2		NA																	0				ovary(1)|pancreas(1)	2						c.(700-702)GAC>GGC		immunity-related GTPase family, Q							36.0	41.0	39.0					19																	44097349		2199	4290	6489	SO:0001583	missense	126298						protein binding	g.chr19:44097349T>C	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.701A>G	19.37:g.44097349T>C	ENSP00000472250:p.Asp234Gly		Somatic				IRGQ_uc010eiv.2_Missense_Mutation_p.D234G	p.D234G	NM_001007561	NP_001007562	WXS	Illumina HiSeq	Unspecified	Q8WZA9	IRGQ_HUMAN			2	819	-		Prostate(69;0.0199)	234					B2RNP3	Missense_Mutation	SNP	ENST00000602269.1	37	c.701A>G	CCDS33040.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.616771	0.00828	.	.	ENSG00000167378	ENST00000422989	T	0.38401	1.14	4.5	2.38	0.29361	.	0.596486	0.16514	N	0.211107	T	0.17746	0.0426	N	0.25144	0.715	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.32587	-0.9901	10	0.02654	T	1	-4.9076	6.3006	0.21111	0.0:0.2929:0.0:0.7071	.	234	Q8WZA9	IRGQ_HUMAN	G	234	ENSP00000387535:D234G	ENSP00000387535:D234G	D	-	2	0	IRGQ	48789189	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	0.444000	0.21661	0.465000	0.27167	0.533000	0.62120	GAC		0.687	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561		7	37	0	0	0	0.008291	0	7	37				
EXOC3L2	90332	broad.mit.edu	37	19	45731239	45731239	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:45731239G>A	ENST00000252482.3	-	3	313	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L	EXOC3L2_ENST00000413988.1_Silent_p.L96L			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	96					exocytosis (GO:0006887)	exocyst (GO:0000145)				endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		TACCTCTGCAGGAACTCTGCC	0.622																																							uc002pay.1		NA																	0				ovary(1)	1						c.(286-288)CTG>TTG		exocyst complex component 3-like 2							32.0	30.0	30.0					19																	45731239		2203	4300	6503	SO:0001819	synonymous_variant	90332							g.chr19:45731239G>A	AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.286C>T	19.37:g.45731239G>A			Somatic					p.L96L	NM_138568	NP_612635	WXS	Illumina HiSeq	Unspecified	Q2M3D2	EX3L2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00883)	4	327	-		all_neural(266;0.224)|Ovarian(192;0.231)	96					Q8N9W2|Q96GV2	Silent	SNP	ENST00000252482.3	37	c.286C>T	CCDS12657.1																																																																																				0.622	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568		6	26	0	0	0	0.004482	0	6	26				
PTGIR	5739	broad.mit.edu	37	19	47127112	47127112	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:47127112G>C	ENST00000291294.2	-	2	504	c.371C>G	c.(370-372)cCc>cGc	p.P124R	PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000596260.1_Missense_Mutation_p.P124R|PTGIR_ENST00000597185.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	124					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	GTAGAGGTAGGGGTGGCTCAG	0.692																																							uc002pex.2		NA																	0					0						c.(370-372)CCC>CGC		prostaglandin I2 (prostacyclin) receptor (IP)	Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Epoprostenol(DB01240)|Iloprost(DB01088)|Misoprostol(DB00929)						13.0	13.0	13.0					19																	47127112		2159	4223	6382	SO:0001583	missense	5739				cell-cell signaling|G-protein signaling, coupled to cyclic nucleotide second messenger|platelet activation	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity	g.chr19:47127112G>C		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.371C>G	19.37:g.47127112G>C	ENSP00000291294:p.Pro124Arg		Somatic					p.P124R	NM_000960	NP_000951	WXS	Illumina HiSeq	Unspecified	P43119	PI2R_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	2	484	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	124			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000291294.2	37	c.371C>G	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415207	0.83449	.	.	ENSG00000160013	ENST00000291294	T	0.61274	0.12	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.80722	0.4677	M	0.91140	3.18	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.85261	0.1050	10	0.87932	D	0	-17.5182	15.5026	0.75713	0.0:0.0:1.0:0.0	.	124	P43119	PI2R_HUMAN	R	124	ENSP00000291294:P124R	ENSP00000291294:P124R	P	-	2	0	PTGIR	51818952	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.501000	0.81600	2.511000	0.84671	0.563000	0.77884	CCC		0.692	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1			12	11	0	0	0	0.001855	0	12	11				
C5AR1	728	broad.mit.edu	37	19	47824025	47824025	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:47824025G>T	ENST00000355085.3	+	2	1013	c.991G>T	c.(991-993)Gag>Tag	p.E331*		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	331					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CGTGGTTAGGGAGAGCAAGTC	0.622																																							uc002pgj.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(991-993)GAG>TAG		complement component 5 receptor 1							62.0	60.0	61.0					19																	47824025		2203	4300	6503	SO:0001587	stop_gained	728				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity	g.chr19:47824025G>T		CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.991G>T	19.37:g.47824025G>T	ENSP00000347197:p.Glu331*		Somatic					p.E331*	NM_001736	NP_001727	WXS	Illumina HiSeq	Unspecified	P21730	C5AR_HUMAN		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)	2	1040	+		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	331			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000355085.3	37	c.991G>T	CCDS33063.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980785	0.92982	.	.	ENSG00000197405	ENST00000355085	.	.	.	5.02	5.02	0.67125	.	0.973131	0.08414	U	0.949450	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	11.0567	0.47922	0.088:0.0:0.912:0.0	.	.	.	.	X	331	.	ENSP00000347197:E331X	E	+	1	0	C5AR1	52515865	0.537000	0.26386	0.021000	0.16686	0.285000	0.27093	2.344000	0.44010	2.469000	0.83416	0.579000	0.79373	GAG		0.622	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466925.1	NM_001736		10	37	1	0	1.76689e-08	0.006214	2.40791e-08	10	37				
SHANK1	50944	broad.mit.edu	37	19	51192119	51192119	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:51192119C>T	ENST00000293441.1	-	16	2172	c.2154G>A	c.(2152-2154)atG>atA	p.M718I	SHANK1_ENST00000391814.1_Missense_Mutation_p.M718I|SHANK1_ENST00000391813.1_Missense_Mutation_p.M105I|SHANK1_ENST00000359082.3_Missense_Mutation_p.M709I	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	718	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GGAAGTCTCCCATTCGCAGTC	0.647																																							uc002psx.1		NA																	0				large_intestine(2)	2						c.(2152-2154)ATG>ATA		SH3 and multiple ankyrin repeat domains 1							27.0	24.0	25.0					19																	51192119		2201	4297	6498	SO:0001583	missense	50944				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding	g.chr19:51192119C>T	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.2154G>A	19.37:g.51192119C>T	ENSP00000293441:p.Met718Ile		Somatic				SHANK1_uc002psw.1_Missense_Mutation_p.M102I	p.M718I	NM_016148	NP_057232	WXS	Illumina HiSeq	Unspecified	Q9Y566	SHAN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	16	2173	-		all_neural(266;0.057)	718			PDZ.		A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	c.2154G>A	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189371	0.38707	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	3.19	3.19	0.36642	PDZ/DHR/GLGF (4);	0.000000	0.85682	U	0.000000	T	0.36991	0.0987	N	0.02876	-0.465	0.45567	D	0.998511	P;D	0.53619	0.835;0.961	P;D	0.64595	0.602;0.927	T	0.54146	-0.8337	10	0.62326	D	0.03	-10.1369	13.646	0.62281	0.0:1.0:0.0:0.0	.	718;105	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	I	718;105;709;718	ENSP00000293441:M718I;ENSP00000375689:M105I;ENSP00000351984:M709I;ENSP00000375690:M718I	ENSP00000293441:M718I	M	-	3	0	SHANK1	55883931	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	1.010000	0.29898	1.806000	0.52798	0.289000	0.19496	ATG		0.647	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		4	3	0	0	0	0.000602	0	4	3				
ZNF347	84671	broad.mit.edu	37	19	53644353	53644353	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:53644353C>A	ENST00000334197.7	-	5	1796	c.1728G>T	c.(1726-1728)aaG>aaT	p.K576N	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_Missense_Mutation_p.K577N|ZNF347_ENST00000601469.2_Missense_Mutation_p.K577N	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	576					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		GAGTGAAGACCTTGCCACACT	0.413																																					Melanoma(64;205 1597 17324 45721)	Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NA																	0					0						c.(1726-1728)AAG>AAT		zinc finger protein 347							153.0	144.0	147.0					19																	53644353		2203	4300	6503	SO:0001583	missense	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53644353C>A	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.1728G>T	19.37:g.53644353C>A	ENSP00000334146:p.Lys576Asn		Somatic				ZNF347_uc010eql.1_Missense_Mutation_p.K577N|ZNF347_uc002qbc.1_Missense_Mutation_p.K577N	p.K576N	NM_032584	NP_115973	WXS	Illumina HiSeq	Unspecified	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	5	1797	-			576			C2H2-type 12.		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	c.1728G>T	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242630	0.39598	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.07908	3.15;3.15	3.01	-4.52	0.03472	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29620	0.0739	M	0.93638	3.44	0.09310	N	0.999999	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.977	T	0.05178	-1.0901	9	0.87932	D	0	.	5.1321	0.14915	0.1371:0.4419:0.0:0.421	.	577;576	G5E9N4;Q96SE7	.;ZN347_HUMAN	N	576;577	ENSP00000334146:K576N;ENSP00000405218:K577N	ENSP00000334146:K576N	K	-	3	2	ZNF347	58336165	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-1.204000	0.03017	-1.074000	0.03132	-0.136000	0.14681	AAG		0.413	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584		36	134	1	0	1.30998e-17	0.005524	2.18082e-17	36	134				
KIR3DL1	3811	broad.mit.edu	37	19	55294961	55294961	+	Intron	SNP	T	T	C	rs557011669		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:55294961T>C	ENST00000538269.1	+	2	61				KIR2DL3_ENST00000434419.2_Missense_Mutation_p.S281P|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.S281P|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.S307P|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GGACCAAGAGTCTGCAGGAAA	0.507													.|||	1	0.000199681	0.0	0.0	5008	,	,		16114	0.0		0.0	False		,,,				2504	0.001					GBM(72;624 1217 3963 34152 38303)	uc002qhb.1		NA																	0					0						c.(841-843)TCT>CCT		killer cell immunoglobulin-like receptor, two							176.0	175.0	175.0					19																	55294961		2171	4192	6363	SO:0001627	intron_variant	3802				immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity	g.chr19:55294961T>C	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-34028T>C	19.37:g.55294961T>C			Somatic				KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_5'Flank|KIR2DL3_uc010erw.1_Missense_Mutation_p.S282P|KIR2DL1_uc002qgz.1_Missense_Mutation_p.S191P|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_Missense_Mutation_p.S307P	p.S281P	NM_014218	NP_055033	WXS	Illumina HiSeq	Unspecified	P43626	KI2L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	7	879	+			281			Cytoplasmic (Potential).		O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37	c.841T>C		.	.	.	.	.	.	.	.	.	.	C	0.004	-2.259216	0.00265	.	.	ENSG00000243772;ENSG00000125498;ENSG00000125498	ENST00000434419;ENST00000336077;ENST00000291633	T;T;T	0.00475	7.2;7.16;7.18	0.929	-0.209	0.13180	.	.	.	.	.	T	0.00144	0.0004	.	.	.	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.34625	-0.9821	8	0.02654	T	1	.	3.9139	0.09214	0.0:0.4484:0.0:0.5516	.	307;281;281	Q6IST4;Q6H2H3;P43627	.;.;KI2L2_HUMAN	P	281;281;307	ENSP00000415758:S281P;ENSP00000336769:S281P;ENSP00000291633:S307P	ENSP00000291633:S307P	S	+	1	0	KIR2DL1;KIR2DL3	59986773	0.068000	0.21057	0.018000	0.16275	0.013000	0.08279	-0.071000	0.11505	-0.551000	0.06175	-1.160000	0.01791	TCT		0.507	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289		6	106	0	0	0	0.004482	0	6	106				
NLRP5	126206	broad.mit.edu	37	19	56539104	56539104	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:56539104A>G	ENST00000390649.3	+	7	1505	c.1505A>G	c.(1504-1506)cAc>cGc	p.H502R		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	502	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ACAGGCCTGCACGCCGCTTTT	0.632																																							uc002qmj.2		NA																	0				ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(1504-1506)CAC>CGC		NACHT, LRR and PYD containing protein 5							33.0	35.0	34.0					19																	56539104		2123	4224	6347	SO:0001583	missense	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56539104A>G	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1505A>G	19.37:g.56539104A>G	ENSP00000375063:p.His502Arg		Somatic				NLRP5_uc002qmi.2_Missense_Mutation_p.H483R	p.H502R	NM_153447	NP_703148	WXS	Illumina HiSeq	Unspecified	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	7	1505	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	502			NACHT.		A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	c.1505A>G	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	A	9.188	1.025348	0.19433	.	.	ENSG00000171487	ENST00000390649	T	0.71579	-0.58	2.98	1.96	0.26148	.	0.244896	0.21529	N	0.073080	T	0.48205	0.1487	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42172	-0.9467	10	0.87932	D	0	.	4.8282	0.13427	0.8552:0.0:0.1448:0.0	.	502	P59047	NALP5_HUMAN	R	502	ENSP00000375063:H502R	ENSP00000375063:H502R	H	+	2	0	NLRP5	61230916	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.656000	0.24948	0.549000	0.28973	0.459000	0.35465	CAC		0.632	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		5	17	0	0	0	0.000602	0	5	17				
GALP	85569	broad.mit.edu	37	19	56688566	56688566	+	Splice_Site	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:56688566T>C	ENST00000357330.2	+	2	169		c.e2+2		GALP_ENST00000590002.1_Splice_Site|GALP_ENST00000440823.1_Splice_Site	NM_033106.3	NP_149097.1	Q9UBC7	GALP_HUMAN	galanin-like peptide						behavioral response to starvation (GO:0042595)|defense response to bacterium (GO:0042742)|neuropeptide signaling pathway (GO:0007218)|regulation of appetite (GO:0032098)|response to insulin (GO:0032868)	extracellular region (GO:0005576)				lung(4)	4		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		GCCCACCGGGTAACGCCTCCC	0.592																																							uc002qmo.1		NA																	0					0						c.e2+2		galanin-like peptide isoform 1 precursor							53.0	37.0	43.0					19																	56688566		2203	4300	6503	SO:0001630	splice_region_variant	85569				neuropeptide signaling pathway	extracellular region	hormone activity	g.chr19:56688566T>C	AF188493	CCDS12940.1, CCDS46202.1	19q13.42	2013-02-26	2007-08-24			ENSG00000197487		"""Endogenous ligands"""	24840	protein-coding gene	gene with protein product		611178				10601261	Standard	NM_033106		Approved		uc002qmo.1	Q9UBC7		ENST00000357330.2:c.87+2T>C	19.37:g.56688566T>C			Somatic				GALP_uc010eti.2_Splice_Site_p.R29_splice	p.R29_splice	NM_033106	NP_149097	WXS	Illumina HiSeq	Unspecified	Q9UBC7	GALP_HUMAN		GBM - Glioblastoma multiforme(193;0.0507)	2	169	+		Colorectal(82;0.000147)|Ovarian(87;0.243)						A1KXL3	Splice_Site	SNP	ENST00000357330.2	37	c.87_splice	CCDS12940.1	.	.	.	.	.	.	.	.	.	.	T	7.138	0.581219	0.13686	.	.	ENSG00000197487	ENST00000357330;ENST00000440823	.	.	.	2.43	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.21527	N	0.999657	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8628	0.13592	0.2725:0.0:0.0:0.7275	.	.	.	.	.	-1	.	.	.	+	.	.	GALP	61380378	0.901000	0.30685	0.011000	0.14972	0.144000	0.21451	1.691000	0.37721	0.126000	0.18424	0.402000	0.26972	.		0.592	GALP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457832.1	NM_033106	Intron	4	19	0	0	0	0.001984	0	4	19				
ALLC	55821	broad.mit.edu	37	2	3749982	3749982	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:3749982T>C	ENST00000252505.3	+	12	1167	c.1005T>C	c.(1003-1005)gaT>gaC	p.D335D	AC010907.5_ENST00000441632.1_RNA|ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	354					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		ATCTGTTCGATAGCCTGACCC	0.587										HNSCC(21;0.051)																													uc010ewt.2		NA																	0				central_nervous_system(1)	1						c.(1003-1005)GAT>GAC		allantoicase isoform a							41.0	45.0	44.0					2																	3749982		2020	4170	6190	SO:0001819	synonymous_variant	55821						allantoicase activity	g.chr2:3749982T>C	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.1005T>C	2.37:g.3749982T>C		HNSCC(21;0.051)	Somatic				ALLC_uc002qyf.2_Silent_p.D106D	p.D335D	NM_018436	NP_060906	WXS	Illumina HiSeq	Unspecified	Q8N6M5	ALLC_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)	12	1166	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)	354					Q53T95|Q5RL81|Q96RE6|Q9NZA7	Silent	SNP	ENST00000252505.3	37	c.1005T>C	CCDS46223.1																																																																																				0.587	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1			4	16	0	0	0	0.001984	0	4	16				
ZNF512	84450	broad.mit.edu	37	2	27840351	27840351	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:27840351G>T	ENST00000355467.4	+	13	1391	c.1308G>T	c.(1306-1308)gtG>gtT	p.V436V	ZNF512_ENST00000416005.2_Silent_p.V407V|ZNF512_ENST00000556601.1_Silent_p.V305V|ZNF512_ENST00000413371.2_Silent_p.V359V|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000379717.1_Silent_p.V435V	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					GAAACTTTGTGGCTGGAAAAT	0.383																																							uc002rla.2		NA																	0				ovary(1)	1						c.(1306-1308)GTG>GTT		zinc finger protein 512							86.0	84.0	85.0					2																	27840351		2203	4300	6503	SO:0001819	synonymous_variant	84450				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:27840351G>T	AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.1308G>T	2.37:g.27840351G>T			Somatic				ZNF512_uc010ylv.1_Silent_p.V357V|ZNF512_uc010ylw.1_Silent_p.V407V|ZNF512_uc002rlb.2_Silent_p.V357V|ZNF512_uc010ylx.1_Silent_p.V357V|ZNF512_uc002rlc.2_Silent_p.V357V|ZNF512_uc010yly.1_RNA|ZNF512_uc010ylz.1_Silent_p.V329V	p.V436V	NM_032434	NP_115810	WXS	Illumina HiSeq	Unspecified	Q96ME7	ZN512_HUMAN			13	1395	+	Acute lymphoblastic leukemia(172;0.155)		436					B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Silent	SNP	ENST00000355467.4	37	c.1308G>T	CCDS1758.1																																																																																				0.383	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215029.2	NM_032434		17	29	1	0	5.03518e-11	0.007413	7.43229e-11	17	29				
SLC4A1AP	22950	broad.mit.edu	37	2	27907997	27907997	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:27907997G>A	ENST00000326019.6	+	10	2251	c.1969G>A	c.(1969-1971)Gaa>Aaa	p.E657K		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	657	Glu-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					ggaagaggaagaagagaaaga	0.478																																							uc002rlk.3		NA																	0					0						c.(1969-1971)GAA>AAA		solute carrier family 4 (anion exchanger),							54.0	55.0	55.0					2																	27907997		2203	4297	6500	SO:0001583	missense	22950					cytoplasm|nucleus	double-stranded RNA binding|protein binding	g.chr2:27907997G>A		CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1969G>A	2.37:g.27907997G>A	ENSP00000323837:p.Glu657Lys		Somatic					p.E657K	NM_018158	NP_060628	WXS	Illumina HiSeq	Unspecified	Q9BWU0	NADAP_HUMAN			10	2251	+	Acute lymphoblastic leukemia(172;0.155)		657			Glu-rich.		A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Missense_Mutation	SNP	ENST00000326019.6	37	c.1969G>A	CCDS33166.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255340	0.59321	.	.	ENSG00000163798	ENST00000326019	T	0.33438	1.41	5.27	5.27	0.74061	.	0.453384	0.24904	N	0.034671	T	0.29783	0.0744	M	0.65975	2.015	0.41827	D	0.990052	P	0.40144	0.704	B	0.33750	0.169	T	0.09487	-1.0672	10	0.19590	T	0.45	-19.2309	14.8255	0.70107	0.0:0.1437:0.8563:0.0	.	657	Q9BWU0	NADAP_HUMAN	K	657	ENSP00000323837:E657K	ENSP00000323837:E657K	E	+	1	0	SLC4A1AP	27761501	1.000000	0.71417	0.784000	0.31847	0.406000	0.30931	5.221000	0.65272	2.613000	0.88420	0.563000	0.77884	GAA		0.478	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324550.1	NM_018158		8	11	0	0	0	0.00308	0	8	11				
ABCG5	64240	broad.mit.edu	37	2	44053653	44053653	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:44053653C>T	ENST00000260645.1	-	6	781	c.642G>A	c.(640-642)atG>atA	p.M214I	ABCG5_ENST00000405322.1_Intron|ABCG5_ENST00000543989.1_Intron	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	214	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CATCAAACAGCATGACCTCTG	0.502																																							uc002rtn.2		NA																	0				ovary(1)|skin(1)	2						c.(640-642)ATG>ATA		ATP-binding cassette sub-family G member 5							134.0	119.0	124.0					2																	44053653		2203	4300	6503	SO:0001583	missense	64240				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44053653C>T	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.642G>A	2.37:g.44053653C>T	ENSP00000260645:p.Met214Ile		Somatic				ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	p.M214I	NM_022436	NP_071881	WXS	Illumina HiSeq	Unspecified	Q9H222	ABCG5_HUMAN			6	782	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	214			ABC transporter.|Cytoplasmic (Potential).		Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	37	c.642G>A	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389309	0.42410	.	.	ENSG00000138075	ENST00000260645	D	0.83591	-1.74	5.77	5.77	0.91146	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.042435	0.85682	D	0.000000	T	0.66277	0.2773	N	0.03891	-0.335	0.80722	D	1	B	0.25272	0.122	B	0.25884	0.064	T	0.64402	-0.6416	10	0.32370	T	0.25	.	14.4278	0.67227	0.1475:0.8525:0.0:0.0	.	214	Q9H222	ABCG5_HUMAN	I	214	ENSP00000260645:M214I	ENSP00000260645:M214I	M	-	3	0	ABCG5	43907157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.664000	0.46783	2.722000	0.93159	0.655000	0.94253	ATG		0.502	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436		30	77	0	0	0	0.004289	0	30	77				
BCL11A	53335	broad.mit.edu	37	2	60687643	60687643	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:60687643A>G	ENST00000335712.6	-	4	2631	c.2404T>C	c.(2404-2406)Tgt>Cgt	p.C802R	BCL11A_ENST00000356842.4_Intron|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.C768R|BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000538214.1_Intron	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	802					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CAAATTTCACATTTGTAAACG	0.438			T	IGH@	B-CLL																																		uc002sae.1		NA		Dom	yes		2	2p13	53335	T	B-cell CLL/lymphoma 11A			L	IGH@		B-CLL		0				central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13						c.(2404-2406)TGT>CGT		B-cell CLL/lymphoma 11A isoform 1							124.0	120.0	121.0					2																	60687643		2203	4300	6503	SO:0001583	missense	53335				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding	g.chr2:60687643A>G	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.2404T>C	2.37:g.60687643A>G	ENSP00000338774:p.Cys802Arg		Somatic				BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Missense_Mutation_p.C650R|BCL11A_uc002saf.1_Missense_Mutation_p.C768R	p.C802R	NM_022893	NP_075044	WXS	Illumina HiSeq	Unspecified	Q9H165	BC11A_HUMAN	LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)		4	2632	-			802			C2H2-type 6.		D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	c.2404T>C	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.659059	0.47467	.	.	ENSG00000119866	ENST00000335712;ENST00000358510	D;D	0.99974	-10.2;-10.2	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.305199	0.35407	N	0.003234	D	0.99984	0.9995	H	0.98133	4.155	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.991;1.0	D	0.99226	1.0880	10	0.87932	D	0	-0.7053	16.5655	0.84588	1.0:0.0:0.0:0.0	.	768;802	Q9H165-6;Q9H165	.;BC11A_HUMAN	R	802;768	ENSP00000338774:C802R;ENSP00000351307:C768R	ENSP00000338774:C802R	C	-	1	0	BCL11A	60541147	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.302000	0.77476	0.533000	0.62120	TGT		0.438	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893		13	29	0	0	0	0.00245	0	13	29				
CTNNA2	1496	broad.mit.edu	37	2	80874880	80874881	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:80874880_80874881CC>AA	ENST00000402739.4	+	18	2750_2751	c.2745_2746CC>AA	c.(2743-2748)ccCCtt>ccAAtt	p.L916I	CTNNA2_ENST00000541047.1_Missense_Mutation_p.L868I|CTNNA2_ENST00000343114.3_Missense_Mutation_p.L547I|CTNNA2_ENST00000361291.4_Missense_Mutation_p.L902I|CTNNA2_ENST00000540488.1_Missense_Mutation_p.L823I|CTNNA2_ENST00000496558.1_Missense_Mutation_p.L868I|CTNNA2_ENST00000466387.1_Missense_Mutation_p.L868I	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	916					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AGAAGAAGCCCCTTGTGAAGAG	0.47																																							uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(2743-2748)CCCCTT>CCAATT		catenin, alpha 2 isoform 1																																				SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80874880_80874881CC>AA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	Exception_encountered	2.37:g.80874880_80874881delinsAA	ENSP00000384638:p.Leu916Ile		Somatic				CTNNA2_uc010yse.1_Missense_Mutation_p.L868I|CTNNA2_uc010ysf.1_Missense_Mutation_p.L868I|CTNNA2_uc010ysg.1_Missense_Mutation_p.L823I|CTNNA2_uc010ysi.1_Missense_Mutation_p.L500I|CTNNA2_uc010ysj.1_Missense_Mutation_p.L197I	p.L916I	NM_004389	NP_004380	WXS	Illumina HiSeq	Unspecified	P26232	CTNA2_HUMAN			18	2750_2751	+			916					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	DNP	ENST00000402739.4	37	c.2745_2746CC>AA																																																																																					0.470	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		34	60	0	0	0	0.004672	0	34	60				
SH3RF3	344558	broad.mit.edu	37	2	109964268	109964268	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:109964268G>A	ENST00000309415.6	+	2	712	c.712G>A	c.(712-714)Ggc>Agc	p.G238S		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	238	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CGAGCTGCACGGCACACAGGG	0.582																																							uc010ywt.1		NA																	0				ovary(1)	1						c.(712-714)GGC>AGC		SH3 domain containing ring finger 3							56.0	64.0	61.0					2																	109964268		2155	4250	6405	SO:0001583	missense	344558						zinc ion binding	g.chr2:109964268G>A	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.712G>A	2.37:g.109964268G>A	ENSP00000309186:p.Gly238Ser		Somatic					p.G238S	NM_001099289	NP_001092759	WXS	Illumina HiSeq	Unspecified	Q8TEJ3	SH3R3_HUMAN			2	712	+			238			SH3 1.		A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37	c.712G>A		.	.	.	.	.	.	.	.	.	.	G	19.25	3.791129	0.70452	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.63255	-0.03;-0.03	4.82	4.82	0.62117	Src homology-3 domain (4);	.	.	.	.	T	0.75903	0.3913	.	.	.	0.80722	D	1	D	0.60160	0.987	P	0.57468	0.821	T	0.80039	-0.1549	8	0.66056	D	0.02	.	17.9004	0.88901	0.0:0.0:1.0:0.0	.	238	Q8TEJ3	SH3R3_HUMAN	S	238	ENSP00000414997:G238S;ENSP00000309186:G238S	ENSP00000309186:G238S	G	+	1	0	SH3RF3	109330700	1.000000	0.71417	0.040000	0.18447	0.131000	0.20780	9.563000	0.98148	2.215000	0.71742	0.484000	0.47621	GGC		0.582	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289		13	26	0	0	0	0.006122	0	13	26				
AMER3	205147	broad.mit.edu	37	2	131521341	131521341	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:131521341C>A	ENST00000423981.1	+	2	1806	c.1696C>A	c.(1696-1698)Cag>Aag	p.Q566K	AMER3_ENST00000321420.4_Missense_Mutation_p.Q566K	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	566					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										ACCCAGCAGGCAGGAGCTGTG	0.692																																							uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(1696-1698)CAG>AAG		hypothetical protein LOC205147							18.0	22.0	20.0					2																	131521341		2200	4295	6495	SO:0001583	missense	205147							g.chr2:131521341C>A	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1696C>A	2.37:g.131521341C>A	ENSP00000392700:p.Gln566Lys		Somatic				FAM123C_uc010fmv.2_Missense_Mutation_p.Q566K|FAM123C_uc010fms.1_Missense_Mutation_p.Q566K|FAM123C_uc010fmt.1_Missense_Mutation_p.Q566K|FAM123C_uc010fmu.1_Missense_Mutation_p.Q566K	p.Q566K	NM_152698	NP_689911	WXS	Illumina HiSeq	Unspecified	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	1886	+	Colorectal(110;0.1)		566					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.1696C>A	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.598708	0.28445	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.44083	0.93;0.93	4.69	1.16	0.20824	.	0.495268	0.15477	N	0.260312	T	0.23094	0.0558	L	0.27053	0.805	0.22199	N	0.99929	B	0.14438	0.01	B	0.09377	0.004	T	0.12734	-1.0536	10	0.25106	T	0.35	.	3.5306	0.07775	0.4327:0.4239:0.0:0.1434	.	566	Q8N944	F123C_HUMAN	K	566	ENSP00000314914:Q566K;ENSP00000392700:Q566K	ENSP00000314914:Q566K	Q	+	1	0	FAM123C	131237811	0.003000	0.15002	0.581000	0.28614	0.879000	0.50718	-0.005000	0.12855	0.472000	0.27344	0.561000	0.74099	CAG		0.692	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		3	11	1	0	6.4e-05	0.004672	7.41349e-05	3	11				
LOC401010	401010	broad.mit.edu	37	2	132200831	132200831	+	IGR	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:132200831C>A								AC073869.19 (34209 upstream) : RP11-109E12.1 (18562 downstream)																							AGCGCCAGCTCCGGGAAGCCG	0.642																																							uc002tst.2		NA																	0					0						c.(1171-1173)GAG>TAG		SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);																																				SO:0001628	intergenic_variant	401010							g.chr2:132200831C>A																													2.37:g.132200831C>A			Somatic					p.E391*	NR_002826		WXS	Illumina HiSeq	Unspecified					1	1637	-									Nonsense_Mutation	SNP		37	c.1171G>T																																																																																				0	0.642									10	9	1	0	3.27435e-08	0.00245	4.34111e-08	10	9				
GPR39	2863	broad.mit.edu	37	2	133174748	133174748	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:133174748C>T	ENST00000329321.3	+	1	602	c.133C>T	c.(133-135)Ctt>Ttt	p.L45F		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	45					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CGTGATGGGCCTTCTGGGGAA	0.522																																							uc002ttl.2		NA																	0					0						c.(133-135)CTT>TTT		G protein-coupled receptor 39							134.0	122.0	126.0					2																	133174748		2203	4300	6503	SO:0001583	missense	2863					integral to plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr2:133174748C>T	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.133C>T	2.37:g.133174748C>T	ENSP00000327417:p.Leu45Phe		Somatic					p.L45F	NM_001508	NP_001499	WXS	Illumina HiSeq	Unspecified	O43194	GPR39_HUMAN			1	602	+			45			Helical; Name=1; (Potential).		B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	37	c.133C>T	CCDS2170.1	.	.	.	.	.	.	.	.	.	.	C	9.641	1.138928	0.21123	.	.	ENSG00000183840	ENST00000329321	T	0.45276	0.9	5.34	2.93	0.34026	.	0.224075	0.46145	D	0.000314	T	0.20618	0.0496	N	0.08118	0	0.25035	N	0.991247	B	0.28552	0.215	B	0.20767	0.031	T	0.15636	-1.0430	10	0.87932	D	0	.	8.333	0.32197	0.5518:0.38:0.0682:0.0	.	45	O43194	GPR39_HUMAN	F	45	ENSP00000327417:L45F	ENSP00000327417:L45F	L	+	1	0	GPR39	132891218	0.999000	0.42202	0.988000	0.46212	0.409000	0.31022	4.243000	0.58721	0.485000	0.27652	-0.442000	0.05670	CTT		0.522	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1			13	41	0	0	0	0.013537	0	13	41				
LCT	3938	broad.mit.edu	37	2	136567006	136567006	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:136567006C>T	ENST00000264162.2	-	8	2921	c.2911G>A	c.(2911-2913)Gtg>Atg	p.V971M	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	971	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.V971L(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TAGGCCTTCACCTTCAAAGCT	0.498																																							uc002tuu.1		NA																	1	Substitution - Missense(1)	p.V971L(1)	ovary(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(2911-2913)GTG>ATG		lactase-phlorizin hydrolase preproprotein							89.0	91.0	90.0					2																	136567006		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136567006C>T	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2911G>A	2.37:g.136567006C>T	ENSP00000264162:p.Val971Met		Somatic					p.V971M	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	8	2922	-			971			3.|Extracellular (Potential).|4 X approximate repeats.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.2911G>A	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158234	0.78114	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.54279	0.58	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.101330	0.64402	D	0.000002	T	0.69771	0.3148	L	0.49256	1.55	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68599	-0.5366	10	0.54805	T	0.06	-21.7281	20.0139	0.97470	0.0:1.0:0.0:0.0	.	971	P09848	LPH_HUMAN	M	971;403	ENSP00000264162:V971M	ENSP00000264162:V971M	V	-	1	0	LCT	136283476	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	7.818000	0.86416	2.724000	0.93272	0.563000	0.77884	GTG		0.498	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		20	65	0	0	0	0.003954	0	20	65				
LRP1B	53353	broad.mit.edu	37	2	141709435	141709435	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:141709435C>A	ENST00000389484.3	-	19	3933	c.2962G>T	c.(2962-2964)Gac>Tac	p.D988Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	988	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTGCCAGAGTCGCAGTGCCAT	0.453										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(2962-2964)GAC>TAC		low density lipoprotein-related protein 1B							167.0	135.0	146.0					2																	141709435		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141709435C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2962G>T	2.37:g.141709435C>A	ENSP00000374135:p.Asp988Tyr	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Missense_Mutation_p.D170Y	p.D988Y	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	19	3934	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	988			Extracellular (Potential).|LDL-receptor class A 6.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.2962G>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	33	5.243591	0.95272	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.98762	-5.12;-5.12	6.16	6.16	0.99307	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97609	1.0128	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	171;988	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	Y	988;926;133	ENSP00000374135:D988Y;ENSP00000413239:D133Y	ENSP00000374135:D988Y	D	-	1	0	LRP1B	141425905	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.216000	0.77974	2.937000	0.99478	0.650000	0.86243	GAC		0.453	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		6	55	1	0	5.9392e-07	0.001168	7.54961e-07	6	55				
LRP1B	53353	broad.mit.edu	37	2	141819784	141819784	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:141819784C>G	ENST00000389484.3	-	8	2043	c.1072G>C	c.(1072-1074)Ggg>Cgg	p.G358R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	358					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGGTTCATCCCATCCATGTCA	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(1072-1074)GGG>CGG		low density lipoprotein-related protein 1B							148.0	130.0	136.0					2																	141819784		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141819784C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1072G>C	2.37:g.141819784C>G	ENSP00000374135:p.Gly358Arg	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.G358R	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	8	2044	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	358			Extracellular (Potential).|LDL-receptor class B 3.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.1072G>C	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586887	0.86851	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94537	-3.45	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.98495	0.9498	H	0.97291	3.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99123	1.0850	10	0.87932	D	0	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	358	Q9NZR2	LRP1B_HUMAN	R	358;296	ENSP00000374135:G358R	ENSP00000374135:G358R	G	-	1	0	LRP1B	141536254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.729000	0.84864	2.805000	0.96524	0.655000	0.94253	GGG		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		28	29	0	0	0	0.010818	0	28	29				
NEB	4703	broad.mit.edu	37	2	152408338	152408338	+	Missense_Mutation	SNP	C	C	A	rs368399531		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:152408338C>A	ENST00000172853.10	-	101	14902	c.14755G>T	c.(14755-14757)Gtg>Ttg	p.V4919L	NEB_ENST00000397345.3_Missense_Mutation_p.V6620L|NEB_ENST00000427231.2_Missense_Mutation_p.V6620L|NEB_ENST00000603639.1_Missense_Mutation_p.V6620L|NEB_ENST00000409198.1_Missense_Mutation_p.V4919L|NEB_ENST00000604864.1_Missense_Mutation_p.V6620L			P20929	NEBU_HUMAN	nebulin	4919					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ACACTGTGCACATAGTCATAG	0.483																																							uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(14755-14757)GTG>TTG		nebulin isoform 3							94.0	89.0	91.0					2																	152408338		1956	4140	6096	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152408338C>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14755G>T	2.37:g.152408338C>A	ENSP00000172853:p.Val4919Leu		Somatic				NEB_uc002txr.2_Missense_Mutation_p.V1342L	p.V4919L	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	101	14946	-			4919			Nebulin 134.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.14755G>T		.	.	.	.	.	.	.	.	.	.	C	12.56	1.975037	0.34848	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.06371	3.45;3.45;3.45;3.31;3.45	6.06	1.51	0.23008	.	0.639379	0.16172	N	0.226224	T	0.04227	0.0117	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.42849	-0.9427	10	0.25751	T	0.34	.	7.7596	0.28944	0.1086:0.5531:0.0:0.3383	.	4919;1350	P20929;Q14215	NEBU_HUMAN;.	L	4919;6620;6620;968;1350;4919	ENSP00000386259:V4919L;ENSP00000380505:V6620L;ENSP00000416578:V6620L;ENSP00000410961:V1350L;ENSP00000172853:V4919L	ENSP00000172853:V4919L	V	-	1	0	NEB	152116584	0.000000	0.05858	0.986000	0.45419	0.988000	0.76386	0.159000	0.16442	0.379000	0.24794	0.655000	0.94253	GTG		0.483	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		12	24	1	0	7.03913e-09	0.013537	9.82126e-09	12	24				
KCNJ3	3760	broad.mit.edu	37	2	155555453	155555453	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:155555453C>A	ENST00000295101.2	+	1	643	c.166C>A	c.(166-168)Cag>Aag	p.Q56K	AC061961.2_ENST00000443901.1_RNA|KCNJ3_ENST00000544049.1_Missense_Mutation_p.Q56K	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	56					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	GTGCAATGTACAGCACGGCAA	0.622																																							uc002tyv.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(166-168)CAG>AAG		potassium inwardly-rectifying channel J3	Halothane(DB01159)						83.0	80.0	81.0					2																	155555453		2203	4300	6503	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155555453C>A	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.166C>A	2.37:g.155555453C>A	ENSP00000295101:p.Gln56Lys		Somatic				KCNJ3_uc010zce.1_Missense_Mutation_p.Q56K	p.Q56K	NM_002239	NP_002230	WXS	Illumina HiSeq	Unspecified	P48549	IRK3_HUMAN			1	361	+			56			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.166C>A	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484621	0.44147	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.93604	-3.25;-3.25	4.92	4.92	0.64577	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.89012	0.6594	N	0.21373	0.66	0.80722	D	1	B;B	0.29188	0.013;0.236	B;B	0.30401	0.065;0.115	D	0.88015	0.2765	10	0.59425	D	0.04	.	16.6727	0.85271	0.0:1.0:0.0:0.0	.	56;56	B4DEW7;P48549	.;IRK3_HUMAN	K	56	ENSP00000295101:Q56K;ENSP00000438410:Q56K	ENSP00000295101:Q56K	Q	+	1	0	KCNJ3	155263699	1.000000	0.71417	0.970000	0.41538	0.995000	0.86356	7.761000	0.85260	2.287000	0.76781	0.555000	0.69702	CAG		0.622	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		15	15	1	0	4.93089e-13	0.00245	7.58399e-13	15	15				
NR4A2	4929	broad.mit.edu	37	2	157184479	157184479	+	Missense_Mutation	SNP	T	T	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:157184479T>G	ENST00000339562.4	-	5	1404	c.1042A>C	c.(1042-1044)Aaa>Caa	p.K348Q	NR4A2_ENST00000409108.2_Missense_Mutation_p.K348Q|NR4A2_ENST00000539077.1_Missense_Mutation_p.K359Q|NR4A2_ENST00000409572.1_Missense_Mutation_p.K348Q|NR4A2_ENST00000426264.1_Missense_Mutation_p.K285Q|NR4A2_ENST00000429376.1_Missense_Mutation_p.K285Q	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	348	Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CTCTTCGGTTTCGAGGGCAAA	0.622																																							uc002tyz.3		NA																	0				ovary(3)	3						c.(1042-1044)AAA>CAA		nuclear receptor subfamily 4, group A, member 2							29.0	29.0	29.0					2																	157184479		2203	4300	6503	SO:0001583	missense	4929				cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr2:157184479T>G	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1042A>C	2.37:g.157184479T>G	ENSP00000344479:p.Lys348Gln		Somatic				NR4A2_uc002tyx.3_Missense_Mutation_p.K285Q|NR4A2_uc010zcf.1_Missense_Mutation_p.K348Q|NR4A2_uc010zcg.1_5'UTR	p.K348Q	NM_006186	NP_006177	WXS	Illumina HiSeq	Unspecified	P43354	NR4A2_HUMAN			5	1464	-			348			Pro-rich.		Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	c.1042A>C	CCDS2201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.1|23.1	4.372706|4.372706	0.82573|0.82573	.|.	.|.	ENSG00000153234|ENSG00000153234	ENST00000406048|ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000429376	.|T;T;T;T;T;T	.|0.55588	.|0.51;0.51;0.51;0.51;0.51;0.51	6.17|6.17	5.0|5.0	0.66597|0.66597	.|Nuclear hormone receptor, ligand-binding (2);	.|0.317462	.|0.20090	.|U	.|0.099472	T|T	0.73385|0.73385	0.3580|0.3580	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	T|T	0.76033|0.76033	-0.3107|-0.3107	5|10	.|0.72032	.|D	.|0.01	.|.	13.403|13.403	0.60893|0.60893	0.0:0.0:0.1313:0.8687|0.0:0.0:0.1313:0.8687	.|.	.|348	.|P43354	.|NR4A2_HUMAN	A|Q	129|348;285;348;359;348;285	.|ENSP00000344479:K348Q;ENSP00000389986:K285Q;ENSP00000386747:K348Q;ENSP00000444925:K359Q;ENSP00000386993:K348Q;ENSP00000410952:K285Q	.|ENSP00000344479:K348Q	E|K	-|-	2|1	0|0	NR4A2|NR4A2	156892725|156892725	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.040000|8.040000	0.89188|0.89188	1.124000|1.124000	0.41980|0.41980	0.533000|0.533000	0.62120|0.62120	GAA|AAA		0.622	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2			4	4	0	0	0	0.001168	0	4	4				
FAP	2191	broad.mit.edu	37	2	163074507	163074507	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:163074507G>C	ENST00000188790.4	-	9	958	c.751C>G	c.(751-753)Cca>Gca	p.P251A	FAP_ENST00000443424.1_Missense_Mutation_p.P226A	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TTTGGGTATGGAATATTTATT	0.343																																							uc002ucd.2		NA																	0				ovary(3)	3						c.(751-753)CCA>GCA		fibroblast activation protein, alpha subunit							91.0	95.0	93.0					2																	163074507		2203	4300	6503	SO:0001583	missense	2191				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity	g.chr2:163074507G>C	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.751C>G	2.37:g.163074507G>C	ENSP00000188790:p.Pro251Ala		Somatic				FAP_uc010zct.1_Missense_Mutation_p.P226A|FAP_uc010fpd.2_Intron|FAP_uc010fpe.1_Missense_Mutation_p.P218A	p.P251A	NM_004460	NP_004451	WXS	Illumina HiSeq	Unspecified	Q12884	SEPR_HUMAN			9	959	-			251			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000188790.4	37	c.751C>G	CCDS33311.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953021	0.73902	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.29655	1.56;1.86	5.74	5.74	0.90152	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	L	0.52266	1.64	0.80722	D	1	B;D;D	0.62365	0.256;0.991;0.991	P;P;P	0.55087	0.506;0.768;0.768	T	0.08994	-1.0695	10	0.48119	T	0.1	-28.7784	13.5017	0.61459	0.0714:0.0:0.9286:0.0	.	226;251;251	B4DLR2;B2RD89;Q12884	.;.;SEPR_HUMAN	A	251;226	ENSP00000188790:P251A;ENSP00000411391:P226A	ENSP00000188790:P251A	P	-	1	0	FAP	162782753	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.293000	0.78740	2.873000	0.98535	0.563000	0.77884	CCA		0.343	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2			10	85	0	0	0	0.00245	0	10	85				
STK39	27347	broad.mit.edu	37	2	169020276	169020276	+	Missense_Mutation	SNP	T	T	C	rs201338418		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:169020276T>C	ENST00000355999.4	-	4	1250	c.545A>G	c.(544-546)tAt>tGt	p.Y182C		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						TCTGTGTAGATAGTCTAAGCC	0.378																																							uc002uea.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(544-546)TAT>TGT		serine threonine kinase 39 (STE20/SPS1 homolog,							155.0	140.0	145.0					2																	169020276		1849	4092	5941	SO:0001583	missense	27347				response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity	g.chr2:169020276T>C	AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.545A>G	2.37:g.169020276T>C	ENSP00000348278:p.Tyr182Cys		Somatic					p.Y182C	NM_013233	NP_037365	WXS	Illumina HiSeq	Unspecified	Q9UEW8	STK39_HUMAN			4	705	-			182			Protein kinase.		O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Missense_Mutation	SNP	ENST00000355999.4	37	c.545A>G	CCDS42770.1	.	.	.	.	.	.	.	.	.	.	-	24.0	4.481085	0.84747	.	.	ENSG00000198648	ENST00000355999	T	0.75260	-0.92	6.03	6.03	0.97812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87853	0.6282	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89556	0.3803	10	0.87932	D	0	-0.6197	16.5582	0.84512	0.0:0.0:0.0:1.0	.	182	Q9UEW8	STK39_HUMAN	C	182	ENSP00000348278:Y182C	ENSP00000348278:Y182C	Y	-	2	0	STK39	168728522	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.960000	0.70348	2.308000	0.77769	0.533000	0.62120	TAT		0.378	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258112.2	NM_013233		4	52	0	0	0	0.009096	0	4	52				
TTN	7273	broad.mit.edu	37	2	179642637	179642637	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:179642637G>T	ENST00000591111.1	-	25	4498	c.4274C>A	c.(4273-4275)gCa>gAa	p.A1425E	TTN_ENST00000589042.1_Missense_Mutation_p.A1425E|TTN_ENST00000342992.6_Missense_Mutation_p.A1425E|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.A1425E|TTN_ENST00000359218.5_Missense_Mutation_p.A1379E|TTN_ENST00000460472.2_Missense_Mutation_p.A1379E|TTN_ENST00000342175.6_Missense_Mutation_p.A1379E			Q8WZ42	TITIN_HUMAN	titin	33621	ZIS5.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGACATCCTTGCAGGTGACAT	0.507																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(4273-4275)GCA>GAA		titin isoform N2-A							57.0	56.0	56.0					2																	179642637		2203	4299	6502	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179642637G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4274C>A	2.37:g.179642637G>T	ENSP00000465570:p.Ala1425Glu		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.A1379E|TTN_uc010zfi.1_Missense_Mutation_p.A1379E|TTN_uc010zfj.1_Missense_Mutation_p.A1379E|TTN_uc002unb.2_Missense_Mutation_p.A1425E|uc002unc.1_RNA	p.A1425E	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		25	4498	-			1425					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.4274C>A		.	.	.	.	.	.	.	.	.	.	G	13.15	2.149873	0.37923	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.63255	-0.03;0.19;0.17;0.17;0.31	5.52	2.67	0.31697	Ribonuclease H-like (1);	.	.	.	.	T	0.60612	0.2282	L	0.38175	1.15	0.23227	N	0.998087	B;B;B;P;P	0.48503	0.046;0.046;0.265;0.856;0.911	B;B;B;B;P	0.52514	0.043;0.043;0.152;0.383;0.701	T	0.50775	-0.8788	9	0.87932	D	0	.	8.0611	0.30633	0.1286:0.1384:0.733:0.0	.	1379;1379;1379;1425;1425	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	E	1425;1379;1379;1379;1379;1425	ENSP00000343764:A1425E;ENSP00000434586:A1379E;ENSP00000340554:A1379E;ENSP00000352154:A1379E;ENSP00000354117:A1425E	ENSP00000340554:A1379E	A	-	2	0	TTN	179350882	0.427000	0.25514	0.815000	0.32552	0.847000	0.48162	1.808000	0.38912	1.283000	0.44513	0.650000	0.86243	GCA		0.507	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		17	33	1	0	2.4624e-09	0.008871	3.50234e-09	17	33				
NCKAP1	10787	broad.mit.edu	37	2	183853815	183853815	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:183853815C>A	ENST00000361354.4	-	9	1262	c.890G>T	c.(889-891)cGg>cTg	p.R297L	NCKAP1_ENST00000360982.2_Missense_Mutation_p.R303L	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	297					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AACTTCATCCCGAAAGAGAGA	0.408																																							uc002upc.2		NA																	0				ovary(2)	2						c.(889-891)CGG>CTG		NCK-associated protein 1 isoform 1							95.0	88.0	90.0					2																	183853815		2203	4300	6503	SO:0001583	missense	10787				apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding	g.chr2:183853815C>A	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.890G>T	2.37:g.183853815C>A	ENSP00000355348:p.Arg297Leu		Somatic				NCKAP1_uc002upb.2_Missense_Mutation_p.R303L	p.R297L	NM_013436	NP_038464	WXS	Illumina HiSeq	Unspecified	Q9Y2A7	NCKP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		9	1292	-			297					O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	c.890G>T	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570339	0.96540	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.57273	0.41;0.41	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.87758	2.905	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70227	0.968;0.946	T	0.80350	-0.1419	10	0.87932	D	0	-9.0428	20.2982	0.98569	0.0:1.0:0.0:0.0	.	297;303	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	L	297;303	ENSP00000355348:R297L;ENSP00000354251:R303L	ENSP00000354251:R303L	R	-	2	0	NCKAP1	183562060	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.480000	0.81109	2.873000	0.98535	0.563000	0.77884	CGG		0.408	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842		12	13	1	0	1.3612e-06	0.003163	1.69716e-06	12	13				
AOX1	316	broad.mit.edu	37	2	201534333	201534333	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:201534333C>T	ENST00000374700.2	+	34	4075	c.3834C>T	c.(3832-3834)tcC>tcT	p.S1278S	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1278					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGGGGTGTTCCGTGTTTTTCG	0.502																																							uc002uvx.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(3832-3834)TCC>TCT		aldehyde oxidase 1	Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)						202.0	200.0	201.0					2																	201534333		2203	4300	6503	SO:0001819	synonymous_variant	316				inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity	g.chr2:201534333C>T	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3834C>T	2.37:g.201534333C>T			Somatic				AOX1_uc010zhf.1_Silent_p.S834S|AOX1_uc010fsu.2_Silent_p.S644S	p.S1278S	NM_001159	NP_001150	WXS	Illumina HiSeq	Unspecified	Q06278	ADO_HUMAN			34	3935	+			1278					O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	ENST00000374700.2	37	c.3834C>T	CCDS33360.1																																																																																				0.502	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159		11	220	0	0	0	0.00245	0	11	220				
FAM126B	285172	broad.mit.edu	37	2	201888717	201888717	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:201888717G>A	ENST00000418596.3	-	3	203	c.16C>T	c.(16-18)Cgt>Tgt	p.R6C	FAM126B_ENST00000485144.1_5'Flank	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	6						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						ACAACACAACGGTCAGTTCCC	0.323																																							uc002uws.3		NA																	0				ovary(1)	1						c.(16-18)CGT>TGT		hypothetical protein LOC285172							184.0	172.0	176.0					2																	201888717		2203	4300	6503	SO:0001583	missense	285172					intracellular		g.chr2:201888717G>A	BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.16C>T	2.37:g.201888717G>A	ENSP00000393667:p.Arg6Cys		Somatic				FAM126B_uc002uwu.2_5'UTR|FAM126B_uc002uwv.2_Missense_Mutation_p.R6C|FAM126B_uc002uww.1_Missense_Mutation_p.R6C	p.R6C	NM_173822	NP_776183	WXS	Illumina HiSeq	Unspecified	Q8IXS8	F126B_HUMAN			3	204	-			6					B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	ENST00000418596.3	37	c.16C>T	CCDS2335.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742718	0.89573	.	.	ENSG00000155744	ENST00000418596;ENST00000452799;ENST00000453765;ENST00000446678	T;T;T;T	0.80033	-1.21;-1.19;-1.2;-1.33	5.77	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.86192	0.5874	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.87613	0.2505	10	0.72032	D	0.01	-7.3922	16.3972	0.83613	0.0:0.0:0.8676:0.1324	.	6	Q8IXS8	F126B_HUMAN	C	6	ENSP00000393667:R6C;ENSP00000401905:R6C;ENSP00000408374:R6C;ENSP00000412139:R6C	ENSP00000286181:R6C	R	-	1	0	FAM126B	201596962	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.767000	0.55288	1.401000	0.46761	0.650000	0.86243	CGT		0.323	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256285.3	NM_173822		26	40	0	0	0	0.012213	0	26	40				
MARCH4	57574	broad.mit.edu	37	2	217142435	217142435	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:217142435G>T	ENST00000273067.4	-	3	2591	c.825C>A	c.(823-825)atC>atA	p.I275I		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	275						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		TCCCGTAGCAGATCTGGAAGA	0.562																																							uc002vgb.2		NA																	0				ovary(1)	1						c.(823-825)ATC>ATA		membrane-associated ring finger (C3HC4) 4							204.0	170.0	182.0					2																	217142435		2203	4300	6503	SO:0001819	synonymous_variant	57574					Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:217142435G>T	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.825C>A	2.37:g.217142435G>T			Somatic					p.I275I	NM_020814	NP_065865	WXS	Illumina HiSeq	Unspecified	Q9P2E8	MARH4_HUMAN		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)	3	2592	-		Renal(323;0.0854)	275			Helical; (Potential).		Q4KMN7|Q86WR8	Silent	SNP	ENST00000273067.4	37	c.825C>A	CCDS33376.1																																																																																				0.562	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814		38	135	1	0	1.96642e-18	0.006999	3.33041e-18	38	135				
DOCK10	55619	broad.mit.edu	37	2	225717798	225717798	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:225717798T>C	ENST00000258390.7	-	17	1997	c.1930A>G	c.(1930-1932)Atg>Gtg	p.M644V	DOCK10_ENST00000409592.3_Missense_Mutation_p.M638V	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	644					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TGAGCCATCATGTTGAAAGGC	0.323																																							uc010fwz.1		NA																	0				ovary(2)	2						c.(1930-1932)ATG>GTG		dedicator of cytokinesis 10							101.0	93.0	96.0					2																	225717798		1843	4085	5928	SO:0001583	missense	55619						GTP binding	g.chr2:225717798T>C	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1930A>G	2.37:g.225717798T>C	ENSP00000258390:p.Met644Val		Somatic				DOCK10_uc002vob.2_Missense_Mutation_p.M638V	p.M644V	NM_014689	NP_055504	WXS	Illumina HiSeq	Unspecified	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	17	2169	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	644					B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	c.1930A>G	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	T	8.282	0.815737	0.16607	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.17528	2.27;2.27	5.28	1.27	0.21489	.	0.543151	0.19735	N	0.107274	T	0.06142	0.0159	N	0.02916	-0.46	0.20638	N	0.99988	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36817	-0.9732	10	0.28530	T	0.3	.	7.7341	0.28804	0.0:0.6243:0.1118:0.2639	.	644;638	Q96BY6;B3FL70	DOC10_HUMAN;.	V	638;644	ENSP00000386694:M638V;ENSP00000258390:M644V	ENSP00000258390:M644V	M	-	1	0	DOCK10	225426042	0.991000	0.36638	0.974000	0.42286	0.954000	0.61252	0.873000	0.28052	0.281000	0.22233	-0.479000	0.04858	ATG		0.323	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			15	47	0	0	0	0.00278	0	15	47				
NYAP2	57624	broad.mit.edu	37	2	226446778	226446778	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:226446778T>C	ENST00000272907.6	+	4	1058	c.645T>C	c.(643-645)caT>caC	p.H215H	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	215					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TCAAAAAGCATGGGCCCCGGA	0.572																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(643-645)CAT>CAC		hypothetical protein LOC57624							122.0	128.0	126.0					2																	226446778		1925	4124	6049	SO:0001819	synonymous_variant	57624							g.chr2:226446778T>C	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.645T>C	2.37:g.226446778T>C			Somatic				KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_5'UTR	p.H215H	NM_020864	NP_065915	WXS	Illumina HiSeq	Unspecified	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	820	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	215					A2RRN4|Q96NL2	Silent	SNP	ENST00000272907.6	37	c.645T>C	CCDS46529.1																																																																																				0.572	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		8	126	0	0	0	0.006214	0	8	126				
NYAP2	57624	broad.mit.edu	37	2	226447461	226447461	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:226447461G>T	ENST00000272907.6	+	4	1741	c.1328G>T	c.(1327-1329)gGg>gTg	p.G443V	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	443	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GTCAGCATGGGGAGGTCCCTG	0.632																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1327-1329)GGG>GTG		hypothetical protein LOC57624							38.0	42.0	41.0					2																	226447461		2017	4184	6201	SO:0001583	missense	57624							g.chr2:226447461G>T	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1328G>T	2.37:g.226447461G>T	ENSP00000272907:p.Gly443Val		Somatic				KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.G213V	p.G443V	NM_020864	NP_065915	WXS	Illumina HiSeq	Unspecified	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	1503	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	443			Pro-rich.		A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	c.1328G>T	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704502	0.68615	.	.	ENSG00000144460	ENST00000272907	T	0.35421	1.31	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.54822	0.1882	L	0.54323	1.7	0.80722	D	1	P	0.51653	0.947	P	0.60473	0.875	T	0.57400	-0.7818	10	0.87932	D	0	-26.4106	18.7321	0.91739	0.0:0.0:1.0:0.0	.	443	Q9P242	K1486_HUMAN	V	443	ENSP00000272907:G443V	ENSP00000272907:G443V	G	+	2	0	KIAA1486	226155705	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	6.364000	0.73086	2.415000	0.81967	0.563000	0.77884	GGG		0.632	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		19	19	1	0	8.10497e-08	0.010504	1.06253e-07	19	19				
GIGYF2	26058	broad.mit.edu	37	2	233675975	233675975	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:233675975G>T	ENST00000409547.1	+	19	2231	c.1920G>T	c.(1918-1920)ttG>ttT	p.L640F	GIGYF2_ENST00000409480.1_Missense_Mutation_p.L662F|GIGYF2_ENST00000452341.2_Missense_Mutation_p.L471F|GIGYF2_ENST00000373566.3_Missense_Mutation_p.L662F|GIGYF2_ENST00000373563.4_Missense_Mutation_p.L640F|GIGYF2_ENST00000409451.3_Missense_Mutation_p.L661F|GIGYF2_ENST00000409196.3_Missense_Mutation_p.L634F	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	640	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CACAGGTTTTGGCCCAACAGC	0.428																																							uc002vti.3		NA																	0				ovary(4)|central_nervous_system(3)	7						c.(1918-1920)TTG>TTT		GRB10 interacting GYF protein 2 isoform b							131.0	116.0	121.0					2																	233675975		2203	4300	6503	SO:0001583	missense	26058				cell death		protein binding	g.chr2:233675975G>T	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1920G>T	2.37:g.233675975G>T	ENSP00000386537:p.Leu640Phe		Somatic				GIGYF2_uc010zmj.1_Missense_Mutation_p.L640F|GIGYF2_uc002vtg.2_Missense_Mutation_p.L634F|GIGYF2_uc002vtj.3_Missense_Mutation_p.L661F|GIGYF2_uc002vtk.3_Missense_Mutation_p.L640F|GIGYF2_uc002vth.3_Missense_Mutation_p.L634F|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Missense_Mutation_p.L471F|GIGYF2_uc002vtq.3_5'UTR	p.L640F	NM_015575	NP_056390	WXS	Illumina HiSeq	Unspecified	Q6Y7W6	PERQ2_HUMAN		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)	19	2257	+		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)	640			Gln-rich.		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	c.1920G>T	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747365	0.49257	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.76968	-0.93;-0.9;-0.93;-0.9;-1.06;-0.89;-0.91;-1.05;-0.83	5.89	5.0	0.66597	.	0.087218	0.47093	D	0.000255	D	0.85665	0.5749	M	0.69823	2.125	0.44995	D	0.99801	D;D;B;D	0.76494	0.999;0.995;0.435;0.997	D;P;B;P	0.70016	0.967;0.858;0.088;0.879	D	0.83522	0.0086	10	0.20519	T	0.43	-3.1263	15.3012	0.73952	0.0:0.1392:0.8607:0.0	.	471;661;640;634	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	F	662;583;640;662;640;640;583;634;661;634;471	ENSP00000362667:L662F;ENSP00000362664:L640F;ENSP00000386765:L662F;ENSP00000386537:L640F;ENSP00000404195:L583F;ENSP00000387070:L634F;ENSP00000387170:L661F;ENSP00000410297:L634F;ENSP00000411505:L471F	ENSP00000362664:L640F	L	+	3	2	GIGYF2	233384219	1.000000	0.71417	0.853000	0.33588	0.221000	0.24807	2.580000	0.46068	1.451000	0.47736	0.561000	0.74099	TTG		0.428	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146		14	46	1	0	1.99824e-07	0.00499	2.56791e-07	14	46				
NEU2	4759	broad.mit.edu	37	2	233899170	233899170	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:233899170G>T	ENST00000233840.3	+	2	546	c.546G>T	c.(544-546)cgG>cgT	p.R182R		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	182			R -> Q (in dbSNP:rs2233393).		ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	ACGCCTACCGGAAACTTCACC	0.652																																							uc010zmn.1		NA																	0					0						c.(544-546)CGG>CGT		neuraminidase 2							69.0	72.0	71.0					2																	233899170		2203	4300	6503	SO:0001819	synonymous_variant	4759						exo-alpha-sialidase activity	g.chr2:233899170G>T	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.546G>T	2.37:g.233899170G>T			Somatic					p.R182R	NM_005383	NP_005374	WXS	Illumina HiSeq	Unspecified	Q9Y3R4	NEUR2_HUMAN		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	2	546	+		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)	182					Q3KNW4|Q6NTB4	Silent	SNP	ENST00000233840.3	37	c.546G>T	CCDS2501.1																																																																																				0.652	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383		11	19	1	0	4.68919e-08	0.008291	6.17498e-08	11	19				
KLHL30	377007	broad.mit.edu	37	2	239057702	239057702	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:239057702G>T	ENST00000409223.1	+	7	1501	c.1394G>T	c.(1393-1395)cGc>cTc	p.R465L	KLHL30_ENST00000305959.4_Missense_Mutation_p.R447L			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	465										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		TCCTCGCCTCGCTGTGCTGCA	0.652																																							uc002vxr.1		NA																	0					0						c.(1339-1341)CGC>CTC		kelch-like 30							74.0	89.0	84.0					2																	239057702		2165	4251	6416	SO:0001583	missense	377007							g.chr2:239057702G>T		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1394G>T	2.37:g.239057702G>T	ENSP00000386389:p.Arg465Leu		Somatic					p.R447L	NM_198582	NP_940984	WXS	Illumina HiSeq	Unspecified	Q0D2K2	KLH30_HUMAN		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)	6	1373	+		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	465			Kelch 4.		Q6ZUS1	Missense_Mutation	SNP	ENST00000409223.1	37	c.1340G>T	CCDS46555.2	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907504	0.72868	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	T;T	0.65364	-0.15;-0.15	4.49	4.49	0.54785	Kelch-type beta propeller (1);	0.059738	0.64402	D	0.000002	T	0.69024	0.3065	L	0.59436	1.845	0.54753	D	0.999984	D	0.59357	0.985	P	0.52343	0.696	T	0.74182	-0.3748	10	0.72032	D	0.01	.	16.0887	0.81076	0.0:0.0:1.0:0.0	.	465	Q0D2K2	KLH30_HUMAN	L	465;447	ENSP00000386389:R465L;ENSP00000302386:R447L	ENSP00000302386:R447L	R	+	2	0	KLHL30	238722441	1.000000	0.71417	0.988000	0.46212	0.189000	0.23516	9.102000	0.94226	2.327000	0.79052	0.491000	0.48974	CGC		0.652	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328518.1	NM_198582		7	24	1	0	8.12818e-05	0.001984	9.35779e-05	7	24				
KIF1A	547	broad.mit.edu	37	2	241666337	241666337	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:241666337G>T	ENST00000320389.7	-	37	3883	c.3725C>A	c.(3724-3726)gCt>gAt	p.A1242D	KIF1A_ENST00000498729.2_Missense_Mutation_p.A1343D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1242					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GTCCCACGCAGCCTCAAATTG	0.532																																							uc002vzy.2		NA																	0				lung(1)	1						c.(3724-3726)GCT>GAT		axonal transport of synaptic vesicles							54.0	55.0	55.0					2																	241666337		2048	4218	6266	SO:0001583	missense	547				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity	g.chr2:241666337G>T	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.3725C>A	2.37:g.241666337G>T	ENSP00000322791:p.Ala1242Asp		Somatic				KIF1A_uc010fzk.2_Missense_Mutation_p.A1343D|KIF1A_uc002vzz.1_Missense_Mutation_p.A1351D|KIF1A_uc002vzw.2_5'Flank|KIF1A_uc002vzx.2_5'Flank	p.A1242D	NM_004321	NP_004312	WXS	Illumina HiSeq	Unspecified	Q12756	KIF1A_HUMAN		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)	37	3871	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	1242					B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	c.3725C>A	CCDS46561.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.181315|3.181315	0.57800|0.57800	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283|ENST00000431776	T;T;D|.	0.81579|.	-1.18;-1.24;-1.51|.	4.62|4.62	4.62|4.62	0.57501|0.57501	.|.	0.195714|.	0.42548|.	U|.	0.000690|.	T|T	0.73753|0.73753	0.3627|0.3627	M|M	0.80847|0.80847	2.515|2.515	0.52099|0.52099	D|D	0.999941|0.999941	P;D;P|.	0.56035|.	0.907;0.974;0.909|.	P;P;P|.	0.52031|.	0.667;0.466;0.688|.	T|T	0.75690|0.75690	-0.3230|-0.3230	10|5	0.87932|.	D|.	0|.	.|.	11.0425|11.0425	0.47840|0.47840	0.0863:0.0:0.9137:0.0|0.0863:0.0:0.9137:0.0	.|.	1343;1351;1242|.	F5H045;Q12756-2;Q12756|.	.;.;KIF1A_HUMAN|.	D|M	1242;1343;1351;1351|175	ENSP00000322791:A1242D;ENSP00000438388:A1343D;ENSP00000384231:A1351D|.	ENSP00000322791:A1242D|.	A|L	-|-	2|1	0|2	KIF1A|KIF1A	241315010|241315010	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.767000|0.767000	0.43475|0.43475	7.668000|7.668000	0.83897|0.83897	2.126000|2.126000	0.65437|0.65437	0.585000|0.585000	0.79938|0.79938	GCT|CTG		0.532	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483		6	6	1	0	0.00116845	0.001168	0.00127269	6	6				
TMC2	117532	broad.mit.edu	37	20	2596792	2596792	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:2596792G>T	ENST00000358864.1	+	15	1897	c.1882G>T	c.(1882-1884)Gct>Tct	p.A628S	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	628					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GCCTTCATATGCTGAGTTTGA	0.458																																							uc002wgf.1		NA																	0				ovary(3)	3						c.(1882-1884)GCT>TCT		transmembrane cochlear-expressed protein 2							175.0	147.0	156.0					20																	2596792		2203	4300	6503	SO:0001583	missense	117532					integral to membrane		g.chr20:2596792G>T	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1882G>T	20.37:g.2596792G>T	ENSP00000351732:p.Ala628Ser		Somatic				TMC2_uc002wgg.1_Missense_Mutation_p.A612S	p.A628S	NM_080751	NP_542789	WXS	Illumina HiSeq	Unspecified	Q8TDI7	TMC2_HUMAN			15	1897	+			628			Cytoplasmic (Potential).		Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	c.1882G>T	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530789	0.45073	.	.	ENSG00000149488	ENST00000358864	T	0.62639	0.01	5.34	4.28	0.50868	.	0.348186	0.31624	N	0.007336	T	0.39226	0.1070	N	0.05199	-0.095	0.36996	D	0.895027	B	0.06786	0.001	B	0.18263	0.021	T	0.36578	-0.9742	10	0.24483	T	0.36	0.0718	12.5539	0.56242	0.0:0.0:0.7995:0.2005	.	628	Q8TDI7	TMC2_HUMAN	S	628	ENSP00000351732:A628S	ENSP00000351732:A628S	A	+	1	0	TMC2	2544792	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.952000	0.49097	2.690000	0.91761	0.655000	0.94253	GCT		0.458	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2			9	61	1	0	2.74318e-10	0.006214	3.97897e-10	9	61				
FASTKD5	60493	broad.mit.edu	37	20	3128579	3128579	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:3128579T>C	ENST00000380266.3	-	2	1459	c.1138A>G	c.(1138-1140)Ata>Gta	p.I380V	UBOX5_ENST00000348031.2_Intron|UBOX5_ENST00000217173.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	380					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						TGAGGAGCTATCTCTCCAATC	0.443																																							uc002whz.2		NA																	0					0						c.(1138-1140)ATA>GTA		FAST kinase domains 5							96.0	90.0	92.0					20																	3128579		2203	4300	6503	SO:0001583	missense	60493				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr20:3128579T>C	BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.1138A>G	20.37:g.3128579T>C	ENSP00000369618:p.Ile380Val		Somatic				uc002whv.1_Intron|UBOX5_uc002whw.2_Intron|UBOX5_uc002whx.2_Intron|UBOX5_uc002why.1_Intron	p.I380V	NM_021826	NP_068598	WXS	Illumina HiSeq	Unspecified	Q7L8L6	FAKD5_HUMAN			2	1449	-			380					Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	ENST00000380266.3	37	c.1138A>G	CCDS13048.1	.	.	.	.	.	.	.	.	.	.	T	0.032	-1.328879	0.01298	.	.	ENSG00000215251	ENST00000380266	T	0.14022	2.54	5.48	0.652	0.17823	.	0.464976	0.21773	N	0.069334	T	0.06416	0.0165	N	0.19112	0.55	0.29101	N	0.881495	B	0.09022	0.002	B	0.06405	0.002	T	0.37103	-0.9720	10	0.15066	T	0.55	.	5.0207	0.14360	0.0:0.3437:0.1556:0.5007	.	380	Q7L8L6	FAKD5_HUMAN	V	380	ENSP00000369618:I380V	ENSP00000369618:I380V	I	-	1	0	FASTKD5	3076579	0.937000	0.31787	0.995000	0.50966	0.561000	0.35649	1.005000	0.29834	0.061000	0.16311	0.260000	0.18958	ATA		0.443	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077701.2	NM_021826		12	77	0	0	0	0.001855	0	12	77				
PLCB1	23236	broad.mit.edu	37	20	8698344	8698344	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:8698344C>G	ENST00000338037.6	+	14	1389	c.1362C>G	c.(1360-1362)agC>agG	p.S454R	PLCB1_ENST00000378641.3_Missense_Mutation_p.S454R|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.S454R	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	454	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CTCTTCCAAGCCCTATGGATT	0.408																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(1360-1362)AGC>AGG		phosphoinositide-specific phospholipase C beta 1							78.0	87.0	84.0					20																	8698344		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8698344C>G	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1362C>G	20.37:g.8698344C>G	ENSP00000338185:p.Ser454Arg		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.S353R|PLCB1_uc002wna.2_Missense_Mutation_p.S454R|PLCB1_uc002wnc.1_Missense_Mutation_p.S353R|PLCB1_uc002wnd.1_Missense_Mutation_p.S31R	p.S454R	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			14	1365	+			454			PI-PLC X-box.		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.1362C>G	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727013	0.69074	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.60040	0.22;0.22;0.22	5.85	2.88	0.33553	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.108359	0.85682	D	0.000000	T	0.78020	0.4218	M	0.89658	3.05	0.51012	D	0.999905	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.942	T	0.80169	-0.1494	10	0.87932	D	0	.	11.6405	0.51230	0.0:0.8055:0.0:0.1945	.	454;454	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	R	454;454;454;374;374	ENSP00000367908:S454R;ENSP00000338185:S454R;ENSP00000367904:S454R	ENSP00000338185:S454R	S	+	3	2	PLCB1	8646344	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.282000	0.33226	0.386000	0.24997	-0.137000	0.14449	AGC		0.408	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			45	77	0	0	0	0.01441	0	45	77				
PLCB1	23236	broad.mit.edu	37	20	8745828	8745828	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:8745828C>T	ENST00000338037.6	+	26	2780	c.2753C>T	c.(2752-2754)tCg>tTg	p.S918L	PLCB1_ENST00000378641.3_Missense_Mutation_p.S918L|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.S918L	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	918					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CAACAGAAATCGTTTGTGAAA	0.398																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2752-2754)TCG>TTG		phosphoinositide-specific phospholipase C beta 1							81.0	75.0	77.0					20																	8745828		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8745828C>T	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2753C>T	20.37:g.8745828C>T	ENSP00000338185:p.Ser918Leu		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.S817L|PLCB1_uc002wna.2_Missense_Mutation_p.S918L|PLCB1_uc002wnc.1_Missense_Mutation_p.S817L|PLCB1_uc002wnd.1_Missense_Mutation_p.S495L	p.S918L	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			26	2756	+			918					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.2753C>T	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024843	0.54683	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.40476	1.03;1.03;1.03	5.78	5.78	0.91487	Phosphatidylinositol-4, 5-bisphosphate phosphodiesterase beta, conserved site (1);	0.434154	0.26282	N	0.025279	T	0.34221	0.0890	N	0.25647	0.755	0.40219	D	0.977718	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.09596	-1.0667	10	0.20519	T	0.43	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	918;918	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	L	918;918;918;838;838	ENSP00000367908:S918L;ENSP00000338185:S918L;ENSP00000367904:S918L	ENSP00000338185:S918L	S	+	2	0	PLCB1	8693828	1.000000	0.71417	0.973000	0.42090	0.994000	0.84299	4.571000	0.60879	2.894000	0.99253	0.655000	0.94253	TCG		0.398	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			22	32	0	0	0	0.00632	0	22	32				
PAK7	57144	broad.mit.edu	37	20	9538263	9538263	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:9538263C>T	ENST00000378429.3	-	8	2281	c.1735G>A	c.(1735-1737)Gat>Aat	p.D579N	PAK7_ENST00000353224.5_Missense_Mutation_p.D579N|PAK7_ENST00000378423.1_Missense_Mutation_p.D579N	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	579	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			ACCCGGCCATCGCTTGTCAGG	0.443																																							uc002wnl.2		NA																	0				lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1735-1737)GAT>AAT		p21-activated kinase 7							116.0	100.0	105.0					20																	9538263		2203	4300	6503	SO:0001583	missense	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9538263C>T	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1735G>A	20.37:g.9538263C>T	ENSP00000367686:p.Asp579Asn		Somatic				PAK7_uc002wnk.2_Missense_Mutation_p.D579N|PAK7_uc002wnj.2_Missense_Mutation_p.D579N|PAK7_uc010gby.1_Missense_Mutation_p.D579N	p.D579N	NM_020341	NP_065074	WXS	Illumina HiSeq	Unspecified	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		8	2280	-			579			Protein kinase.		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	c.1735G>A	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.756094	0.96898	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.14144	2.53;2.53;2.53	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.24661	0.0598	N	0.25992	0.78	0.80722	D	1	P;P	0.46859	0.885;0.885	P;P	0.60068	0.868;0.868	T	0.00961	-1.1499	9	.	.	.	.	19.8171	0.96573	0.0:1.0:0.0:0.0	.	579;579	B0AZM9;Q9P286	.;PAK7_HUMAN	N	579;579;579;527	ENSP00000367686:D579N;ENSP00000322957:D579N;ENSP00000367679:D579N	.	D	-	1	0	PAK7	9486263	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.818000	0.86416	2.678000	0.91216	0.643000	0.83706	GAT		0.443	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			17	72	0	0	0	0.010504	0	17	72				
SYNDIG1	79953	broad.mit.edu	37	20	24645992	24645992	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:24645992C>G	ENST00000376862.3	+	4	1262	c.629C>G	c.(628-630)gCc>gGc	p.A210G		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	210					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						ACCAACAAAGCCGTGGCCAAG	0.567																																							uc002wtw.1		NA																	0					0						c.(628-630)GCC>GGC		transmembrane protein 90B							128.0	142.0	137.0					20																	24645992		2203	4300	6503	SO:0001583	missense	79953				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane		g.chr20:24645992C>G	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.629C>G	20.37:g.24645992C>G	ENSP00000366058:p.Ala210Gly		Somatic					p.A210G	NM_024893	NP_079169	WXS	Illumina HiSeq	Unspecified	Q9H7V2	SYNG1_HUMAN			4	1262	+			210			Extracellular (Potential).		Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	c.629C>G	CCDS13164.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422933	0.83559	.	.	ENSG00000101463	ENST00000376862	D	0.87334	-2.24	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.90655	0.7069	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91286	0.5055	10	0.72032	D	0.01	-34.4274	17.4359	0.87552	0.0:1.0:0.0:0.0	.	210	Q9H7V2	SYNG1_HUMAN	G	210	ENSP00000366058:A210G	ENSP00000366058:A210G	A	+	2	0	SYNDIG1	24593992	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	7.555000	0.82223	2.714000	0.92807	0.561000	0.74099	GCC		0.567	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893		36	163	0	0	0	0.01441	0	36	163				
FRG1B	284802	broad.mit.edu	37	20	29625877	29625877	+	Missense_Mutation	SNP	G	G	A	rs7266938	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:29625877G>A	ENST00000278882.3	+	5	501	c.121G>A	c.(121-123)Gcc>Acc	p.A41T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A41T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A46T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	41								p.A41T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GTACAGAATCGCCCTGAAATC	0.358																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(31-33)GCC>ACC		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29625877G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.121G>A	20.37:g.29625877G>A	ENSP00000278882:p.Ala41Thr		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron	p.A11T			WXS	Illumina HiSeq	Unspecified					2	63	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.31G>A		.	.	.	.	.	.	.	.	.	.	g	8.740	0.918766	0.17982	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62498	0.02	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	.	.	.	0.52099	D	0.999942	B	0.24186	0.099	B	0.27715	0.082	T	0.43956	-0.9359	9	0.33940	T	0.23	.	9.3557	0.38164	0.0:0.0:1.0:0.0	rs7266938;rs7266938	46	F5H5R5	.	T	41;46;41	ENSP00000408863:A46T	ENSP00000278882:A41T	A	+	1	0	FRG1B	28239538	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	5.232000	0.65332	1.250000	0.43966	0.184000	0.17185	GCC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		4	54	0	0	0	0.000602	0	4	54				
FRG1B	284802	broad.mit.edu	37	20	29628243	29628243	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:29628243T>C	ENST00000278882.3	+	6	625	c.245T>C	c.(244-246)tTg>tCg	p.L82S	FRG1B_ENST00000358464.4_Missense_Mutation_p.L82S|FRG1B_ENST00000439954.2_Missense_Mutation_p.L87S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	82								p.L82S(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGGCTTTGTTGGCCTCAAAT	0.363																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(154-156)TTG>TCG		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29628243T>C			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.245T>C	20.37:g.29628243T>C	ENSP00000278882:p.Leu82Ser		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.L4S	p.L52S			WXS	Illumina HiSeq	Unspecified					3	187	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.155T>C		.	.	.	.	.	.	.	.	.	.	t	12.14	1.848999	0.32699	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49139	0.79	2.08	2.08	0.27032	Actin cross-linking (1);	0.147685	0.45361	D	0.000380	T	0.38665	0.1049	.	.	.	0.46185	D	0.99891	B;B	0.27656	0.03;0.184	B;B	0.35813	0.11;0.211	T	0.24548	-1.0157	9	0.38643	T	0.18	.	8.0833	0.30758	0.0:0.0:0.0:1.0	.	87;82	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	82;87;82	ENSP00000408863:L87S	ENSP00000278882:L82S	L	+	2	0	FRG1B	28241904	1.000000	0.71417	0.998000	0.56505	0.541000	0.35023	6.955000	0.76007	1.208000	0.43306	0.347000	0.21830	TTG		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		6	92	0	0	0	0.006214	0	6	92				
FRG1B	284802	broad.mit.edu	37	20	29628245	29628245	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:29628245G>A	ENST00000278882.3	+	6	627	c.247G>A	c.(247-249)Gcc>Acc	p.A83T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A83T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A88T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	83								p.A83T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGCTTTGTTGGCCTCAAATAG	0.353																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(157-159)GCC>ACC		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29628245G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.247G>A	20.37:g.29628245G>A	ENSP00000278882:p.Ala83Thr		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.A5T	p.A53T			WXS	Illumina HiSeq	Unspecified					3	189	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.157G>A		.	.	.	.	.	.	.	.	.	.	g	18.80	3.700173	0.68501	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50277	0.75	2.08	2.08	0.27032	Actin cross-linking (1);	0.055129	0.64402	D	0.000001	T	0.40473	0.1118	.	.	.	0.51482	D	0.99992	B;P	0.40875	0.016;0.731	B;P	0.45558	0.085;0.485	T	0.12502	-1.0545	9	0.21540	T	0.41	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	88;83	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	83;88;83	ENSP00000408863:A88T	ENSP00000278882:A83T	A	+	1	0	FRG1B	28241906	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCC		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		6	92	0	0	0	0.008291	0	6	92				
ZNFX1	57169	broad.mit.edu	37	20	47887258	47887258	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:47887258C>A	ENST00000396105.1	-	3	1337	c.1091G>T	c.(1090-1092)aGc>aTc	p.S364I	ZNFX1_ENST00000371752.1_Missense_Mutation_p.S364I|ZNFX1_ENST00000371754.4_Missense_Mutation_p.S364I	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	364							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GATAGCAGTGCTGTCGTATTT	0.478																																							uc002xui.2		NA																	0				ovary(2)	2						c.(1090-1092)AGC>ATC		zinc finger, NFX1-type containing 1							124.0	119.0	120.0					20																	47887258		2203	4300	6503	SO:0001583	missense	57169						metal ion binding	g.chr20:47887258C>A	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1091G>T	20.37:g.47887258C>A	ENSP00000379412:p.Ser364Ile		Somatic					p.S364I	NM_021035	NP_066363	WXS	Illumina HiSeq	Unspecified	Q9P2E3	ZNFX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		3	1338	-			364					Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	c.1091G>T	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977803	0.53720	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;D	0.88818	-2.2;-2.43;-2.43;-1.14;-1.86	6.06	6.06	0.98353	.	0.074902	0.85682	D	0.000000	D	0.94574	0.8252	M	0.84219	2.685	0.45150	D	0.998162	D	0.71674	0.998	D	0.64237	0.923	D	0.93994	0.7269	10	0.52906	T	0.07	-25.1719	19.1847	0.93639	0.0:1.0:0.0:0.0	.	364	Q9P2E3	ZNFX1_HUMAN	I	364;364;364;364;364;168	ENSP00000360819:S364I;ENSP00000360817:S364I;ENSP00000379412:S364I;ENSP00000360809:S364I;ENSP00000413800:S168I	ENSP00000360809:S364I	S	-	2	0	ZNFX1	47320665	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.520000	0.45554	2.882000	0.98803	0.655000	0.94253	AGC		0.478	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035		34	87	1	0	0.000159656	0.004878	0.000181315	34	87				
BMP7	655	broad.mit.edu	37	20	55746136	55746136	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:55746136G>C	ENST00000395863.3	-	7	1680	c.1175C>G	c.(1174-1176)cCc>cGc	p.P392R	BMP7_ENST00000460817.1_5'UTR|BMP7_ENST00000395864.3_Missense_Mutation_p.P326R	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	392					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GCAGGGCTTGGGCACCGTTTC	0.532																																							uc010gip.1		NA																	0				skin(1)	1						c.(1174-1176)CCC>CGC		bone morphogenetic protein 7 precursor							108.0	89.0	95.0					20																	55746136		2203	4300	6503	SO:0001583	missense	655				BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	g.chr20:55746136G>C		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.1175C>G	20.37:g.55746136G>C	ENSP00000379204:p.Pro392Arg		Somatic				BMP7_uc010giq.1_Missense_Mutation_p.P326R	p.P392R	NM_001719	NP_001710	WXS	Illumina HiSeq	Unspecified	P18075	BMP7_HUMAN	BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		7	1704	-	all_lung(29;0.0133)|Melanoma(10;0.242)		392					Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	c.1175C>G	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149306	0.94645	.	.	ENSG00000101144	ENST00000395863;ENST00000395864	D;D	0.83755	-1.76;-1.76	5.36	5.36	0.76844	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92306	0.7559	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93267	0.6648	10	0.87932	D	0	.	19.091	0.93227	0.0:0.0:1.0:0.0	.	326;392	B1AKZ9;P18075	.;BMP7_HUMAN	R	392;326	ENSP00000379204:P392R;ENSP00000379205:P326R	ENSP00000379204:P392R	P	-	2	0	BMP7	55179543	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.726000	0.98782	2.496000	0.84212	0.655000	0.94253	CCC		0.532	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2			38	40	0	0	0	0.01441	0	38	40				
GNAS	2778	broad.mit.edu	37	20	57480483	57480483	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:57480483C>T	ENST00000371085.3	+	6	902	c.478C>T	c.(478-480)Cgt>Tgt	p.R160C	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.R146C|GNAS_ENST00000371102.4_Missense_Mutation_p.R789C|GNAS_ENST00000354359.7_Missense_Mutation_p.R161C|GNAS_ENST00000371095.3_Missense_Mutation_p.R146C|GNAS_ENST00000371100.4_Missense_Mutation_p.R803C|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R145C	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	160					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TGAAGGAGTGCGTGCCTGCTA	0.468			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	Colon(117;935 1597 6045 8307 46442)	uc002xzw.2		NA		Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		0				pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	GRCh37	CM002273	GNAS	M		c.(2407-2409)CGT>TGT		GNAS complex locus XLas							130.0	116.0	121.0					20																	57480483		2203	4300	6503	SO:0001583	missense	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57480483C>T	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.478C>T	20.37:g.57480483C>T	ENSP00000360126:p.Arg160Cys	TSP Lung(22;0.16)	Somatic				GNAS_uc002xzt.2_3'UTR|GNAS_uc010gjq.2_Missense_Mutation_p.R101C|GNAS_uc002xzx.2_Missense_Mutation_p.R101C|GNAS_uc010gjr.2_Missense_Mutation_p.R51C|GNAS_uc002xzy.2_Missense_Mutation_p.R86C|GNAS_uc002yaa.2_Missense_Mutation_p.R146C|GNAS_uc010zzt.1_Missense_Mutation_p.R161C|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_Missense_Mutation_p.R51C|GNAS_uc002yae.2_Missense_Mutation_p.R85C	p.R803C	NM_080425	NP_536350	WXS	Illumina HiSeq	Unspecified	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		6	2692	+	all_lung(29;0.0104)		160					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	c.2407C>T	CCDS13472.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.84|18.84	3.708344|3.708344	0.68615|0.68615	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000450130|ENST00000371100;ENST00000371102;ENST00000349036;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	.|D;D;D;D;D;D;D;D	.|0.89681	.|-2.55;-2.55;-2.55;-2.55;-2.55;-2.55;-2.55;-2.55	5.93|5.93	4.93|4.93	0.64822|0.64822	.|G protein alpha subunit, helical insertion (4);	.|0.247996	.|0.39687	.|N	.|0.001291	D|D	0.82504|0.82504	0.5051|0.5051	L|L	0.51422|0.51422	1.61|1.61	0.51012|0.51012	D|D	0.999907|0.999907	.|B;B;B;P	.|0.46656	.|0.013;0.003;0.001;0.882	.|B;B;B;B	.|0.32762	.|0.004;0.004;0.002;0.152	D|D	0.84965|0.84965	0.0879|0.0879	5|10	.|0.87932	.|D	.|0	.|.	11.2577|11.2577	0.49063|0.49063	0.341:0.659:0.0:0.0|0.341:0.659:0.0:0.0	.|.	.|160;161;145;803	.|P63092;A6NI00;P63092-3;Q5JWF2	.|GNAS2_HUMAN;.;.;GNAS1_HUMAN	V|C	174|803;789;177;146;160;161;145;146	.|ENSP00000360141:R803C;ENSP00000360143:R789C;ENSP00000265621:R177C;ENSP00000360136:R146C;ENSP00000360126:R160C;ENSP00000346328:R161C;ENSP00000265620:R145C;ENSP00000304472:R146C	.|ENSP00000265620:R145C	A|R	+|+	2|1	0|0	GNAS|GNAS	56913878|56913878	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.450000|0.450000	0.32258|0.32258	3.690000|3.690000	0.54713|0.54713	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GCG|CGT		0.468	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516		6	117	0	0	0	0.00308	0	6	117				
OGFR	11054	broad.mit.edu	37	20	61444144	61444144	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:61444144G>T	ENST00000290291.6	+	7	1202	c.1177G>T	c.(1177-1179)Gag>Tag	p.E393*	OGFR_ENST00000370461.1_Nonsense_Mutation_p.E341*	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	393					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GAGCCGGCGGGAGCAGCCGCC	0.652																																							uc002ydj.2		NA																	0					0						c.(1177-1179)GAG>TAG		opioid growth factor receptor							21.0	25.0	24.0					20																	61444144		2199	4295	6494	SO:0001587	stop_gained	11054				regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity	g.chr20:61444144G>T	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1177G>T	20.37:g.61444144G>T	ENSP00000290291:p.Glu393*		Somatic				OGFR_uc002ydk.2_Nonsense_Mutation_p.E376*|OGFR_uc002ydl.2_Nonsense_Mutation_p.E341*|uc011aam.1_3'UTR	p.E393*	NM_007346	NP_031372	WXS	Illumina HiSeq	Unspecified	Q9NZT2	OGFR_HUMAN			7	1212	+	Breast(26;3.65e-08)		393					O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Nonsense_Mutation	SNP	ENST00000290291.6	37	c.1177G>T	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191755	0.58017	.	.	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163;ENST00000370469;ENST00000370461	.	.	.	4.7	4.7	0.59300	.	0.407810	0.24193	N	0.040698	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-16.249	8.9012	0.35497	0.103:0.0:0.897:0.0	.	.	.	.	X	393;393;393;248;341	.	ENSP00000290291:E393X	E	+	1	0	OGFR	60914589	0.152000	0.22762	0.031000	0.17742	0.257000	0.26127	2.999000	0.49473	2.135000	0.66039	0.555000	0.69702	GAG		0.652	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1			11	11	1	0	3.07112e-06	0.010729	3.74932e-06	11	11				
TPTE	7179	broad.mit.edu	37	21	10921972	10921972	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr21:10921972C>A	ENST00000361285.4	-	18	1380	c.1051G>T	c.(1051-1053)Gcc>Tcc	p.A351S	TPTE_ENST00000298232.7_Missense_Mutation_p.A333S|TPTE_ENST00000342420.5_Missense_Mutation_p.A313S|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	351	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATAAGGAAGGCACAAACCATA	0.338																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(1051-1053)GCC>TCC		transmembrane phosphatase with tensin homology							139.0	119.0	126.0					21																	10921972		2203	4299	6502	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10921972C>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1051G>T	21.37:g.10921972C>A	ENSP00000355208:p.Ala351Ser		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.A333S|TPTE_uc002yir.1_Missense_Mutation_p.A313S|TPTE_uc010gkv.1_Missense_Mutation_p.A213S	p.A351S	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	18	1419	-			351			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.1051G>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	6.859	0.527787	0.13127	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98996	-5.31;-5.31;-5.31	2.26	2.26	0.28386	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.291598	0.36268	N	0.002682	D	0.96710	0.8926	L	0.28458	0.855	0.18873	N	0.999982	P;P;P	0.37207	0.537;0.537;0.587	B;B;P	0.44447	0.321;0.444;0.45	D	0.92680	0.6157	10	0.23302	T	0.38	-2.1423	8.1577	0.31178	0.0:1.0:0.0:0.0	.	313;333;351	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	S	333;351;313	ENSP00000298232:A333S;ENSP00000355208:A351S;ENSP00000344441:A313S	ENSP00000298232:A333S	A	-	1	0	TPTE	9943843	0.893000	0.30496	0.807000	0.32361	0.028000	0.11728	1.219000	0.32479	1.307000	0.44944	0.121000	0.15741	GCC		0.338	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			14	39	1	0	1.99824e-07	0.00499	2.56791e-07	14	39				
TMPRSS15	5651	broad.mit.edu	37	21	19732101	19732101	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr21:19732101C>A	ENST00000284885.3	-	8	886	c.853G>T	c.(853-855)Ggt>Tgt	p.G285C		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	285	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GATCCTACACCTTCATAAATA	0.259																																							uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(853-855)GGT>TGT		enterokinase precursor							30.0	35.0	33.0					21																	19732101		2189	4252	6441	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19732101C>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.853G>T	21.37:g.19732101C>A	ENSP00000284885:p.Gly285Cys		Somatic					p.G285C	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			8	884	-			285			Extracellular (Potential).|CUB 1.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.853G>T	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283412	0.59867	.	.	ENSG00000154646	ENST00000284885	T	0.27402	1.67	4.95	4.95	0.65309	CUB (5);	0.144056	0.45126	D	0.000382	T	0.68063	0.2960	H	0.96916	3.905	0.50813	D	0.999897	D	0.89917	1.0	D	0.91635	0.999	T	0.78738	-0.2087	9	.	.	.	.	13.5476	0.61713	0.0:1.0:0.0:0.0	.	285	P98073	ENTK_HUMAN	C	285	ENSP00000284885:G285C	.	G	-	1	0	TMPRSS15	18653972	1.000000	0.71417	0.997000	0.53966	0.796000	0.44982	4.253000	0.58791	2.574000	0.86865	0.305000	0.20034	GGT		0.259	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		11	28	1	0	1.08611e-07	0.010729	1.41122e-07	11	28				
TIAM1	7074	broad.mit.edu	37	21	32624181	32624181	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr21:32624181C>T	ENST00000286827.3	-	6	1759	c.1288G>A	c.(1288-1290)Gca>Aca	p.A430T	TIAM1_ENST00000541036.1_Missense_Mutation_p.A430T|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	430					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GTGCCCTGTGCGGCGGTCAGC	0.662																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(1288-1290)GCA>ACA		T-cell lymphoma invasion and metastasis 1							63.0	66.0	65.0					21																	32624181		2203	4298	6501	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32624181C>T		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1288G>A	21.37:g.32624181C>T	ENSP00000286827:p.Ala430Thr		Somatic				TIAM1_uc011adk.1_Missense_Mutation_p.A430T|TIAM1_uc011adl.1_Missense_Mutation_p.A430T|TIAM1_uc002yox.1_Missense_Mutation_p.A38T	p.A430T	NM_003253	NP_003244	WXS	Illumina HiSeq	Unspecified	Q13009	TIAM1_HUMAN			6	1760	-			430					B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.1288G>A	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555880	0.27827	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.42131	1.01;0.98	4.62	2.82	0.32997	Pleckstrin homology-type (1);	0.302384	0.35320	N	0.003282	T	0.25082	0.0609	N	0.22421	0.69	0.43137	D	0.994887	P;B;B;B	0.35628	0.513;0.223;0.047;0.379	B;B;B;B	0.27380	0.079;0.036;0.004;0.036	T	0.07385	-1.0775	10	0.56958	D	0.05	.	10.5725	0.45209	0.0:0.8449:0.0:0.1551	.	430;430;271;430	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	T	430;271;430	ENSP00000286827:A430T;ENSP00000441570:A430T	ENSP00000286827:A430T	A	-	1	0	TIAM1	31546052	0.067000	0.21026	0.628000	0.29241	0.273000	0.26683	1.432000	0.34936	0.571000	0.29365	-0.126000	0.14955	GCA		0.662	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		22	57	0	0	0	0.007291	0	22	57				
ITSN1	6453	broad.mit.edu	37	21	35122620	35122620	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr21:35122620T>C	ENST00000381318.3	+	6	807	c.519T>C	c.(517-519)gcT>gcC	p.A173A	ITSN1_ENST00000399367.3_Silent_p.A173A|ITSN1_ENST00000399349.1_Silent_p.A173A|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399326.3_Silent_p.A173A|ITSN1_ENST00000381285.4_Silent_p.A173A|ITSN1_ENST00000399338.4_Silent_p.A173A|ITSN1_ENST00000379960.5_Silent_p.A173A|ITSN1_ENST00000399353.1_Silent_p.A136A|ITSN1_ENST00000437442.2_Silent_p.A173A|ITSN1_ENST00000399352.1_Silent_p.A173A|ITSN1_ENST00000399355.2_Silent_p.A173A|ITSN1_ENST00000381291.4_Silent_p.A173A	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	173					apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CTGCATTTGCTCATCCTGGTA	0.443																																							uc002yta.1		NA																	0				ovary(3)|skin(1)	4						c.(517-519)GCT>GCC		intersectin 1 isoform ITSN-l							88.0	81.0	84.0					21																	35122620		2203	4300	6503	SO:0001819	synonymous_variant	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35122620T>C	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.519T>C	21.37:g.35122620T>C			Somatic				DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Silent_p.A173A|ITSN1_uc010gmg.2_Silent_p.A136A|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Silent_p.A173A|ITSN1_uc010gmi.2_Silent_p.A136A|ITSN1_uc010gmj.2_Silent_p.A57A|ITSN1_uc002ysy.2_Silent_p.A173A|ITSN1_uc002ysx.2_Silent_p.A136A|ITSN1_uc002ytb.1_Silent_p.A173A|ITSN1_uc002ytc.1_Silent_p.A173A|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Silent_p.A136A|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Silent_p.A173A|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Silent_p.A107A	p.A173A	NM_003024	NP_003015	WXS	Illumina HiSeq	Unspecified	Q15811	ITSN1_HUMAN			6	787	+			173					A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	c.519T>C	CCDS33545.1																																																																																				0.443	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		17	108	0	0	0	0.014323	0	17	108				
SH3BGR	6450	broad.mit.edu	37	21	40871829	40871829	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr21:40871829C>T	ENST00000333634.4	+	4	660	c.582C>T	c.(580-582)gcC>gcT	p.A194A	SH3BGR_ENST00000380634.1_Silent_p.A83A|SH3BGR_ENST00000380631.1_Silent_p.A83A|SH3BGR_ENST00000458295.1_Intron|SH3BGR_ENST00000380637.3_Silent_p.A83A	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	194	Glu-rich (acidic).				positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		TCCCTGAAGCCCAGGAGAAGA	0.483																																							uc002yya.2		NA																	0					0						c.(580-582)GCC>GCT		SH3-binding domain and glutamic acid-rich							123.0	112.0	116.0					21																	40871829		2203	4300	6503	SO:0001819	synonymous_variant	6450				protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity	g.chr21:40871829C>T		CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.582C>T	21.37:g.40871829C>T			Somatic				SH3BGR_uc002yxz.2_Silent_p.A83A	p.A194A	NM_007341	NP_031367	WXS	Illumina HiSeq	Unspecified	P55822	SH3BG_HUMAN		STAD - Stomach adenocarcinoma(101;0.00151)	4	636	+		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)	194			Glu-rich (acidic).		A6ND59|D3DSI2|Q9BRB8	Silent	SNP	ENST00000333634.4	37	c.582C>T	CCDS13666.1																																																																																				0.483	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157377.6	NM_007341		13	61	0	0	0	0.001855	0	13	61				
THOC5	8563	broad.mit.edu	37	22	29908010	29908010	+	Splice_Site	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr22:29908010C>A	ENST00000490103.1	-	18	1919	c.1797G>T	c.(1795-1797)cgG>cgT	p.R599R	THOC5_ENST00000397872.1_Splice_Site_p.R599R|THOC5_ENST00000397871.1_Splice_Site_p.R599R|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397873.2_Splice_Site_p.R599R	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	599					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGGGTCTTACCCGAATGTTGT	0.572																																							uc003afr.2		NA																	0				breast(3)	3						c.(1795-1797)CGG>CGT		THO complex 5							118.0	84.0	96.0					22																	29908010		2203	4300	6503	SO:0001630	splice_region_variant	8563				intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding	g.chr22:29908010C>A	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1797+1G>T	22.37:g.29908010C>A			Somatic				THOC5_uc003afq.2_Silent_p.R260R|THOC5_uc003afs.2_Silent_p.R599R|THOC5_uc003aft.2_Silent_p.R599R|THOC5_uc003afu.2_Silent_p.R599R|THOC5_uc010gvo.2_Silent_p.R343R	p.R599R	NM_001002878	NP_001002878	WXS	Illumina HiSeq	Unspecified	Q13769	THOC5_HUMAN			19	2132	-			599					O60839|Q9UPZ5	Silent	SNP	ENST00000490103.1	37	c.1797G>T	CCDS13859.1																																																																																				0.572	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	NM_003678	Silent	9	31	1	0	7.48243e-07	0.006214	9.4702e-07	9	31				
ZMAT5	55954	broad.mit.edu	37	22	30136662	30136662	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr22:30136662T>A	ENST00000344318.3	-	4	364	c.248A>T	c.(247-249)cAg>cTg	p.Q83L	ZMAT5_ENST00000397781.3_Missense_Mutation_p.Q83L	NM_001003692.1	NP_001003692.1	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin-type 5	83					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)			GCTCAGCTCCTGCAGGTCTCG	0.632																																							uc003agm.2		NA																	0				ovary(1)	1						c.(247-249)CAG>CTG		zinc finger, matrin type 5							98.0	66.0	77.0					22																	30136662		2203	4300	6503	SO:0001583	missense	55954				mRNA processing	cytoplasm|U12-type spliceosomal complex	nucleic acid binding|zinc ion binding	g.chr22:30136662T>A		CCDS13868.1	22q12.2	2013-09-20	2010-09-15		ENSG00000100319	ENSG00000100319		"""Zinc fingers, matrin-type"""	28046	protein-coding gene	gene with protein product	"""U11/U12 snRNP 20K"""					9847074	Standard	NM_019103		Approved	SNRNP20	uc003agn.3	Q9UDW3	OTTHUMG00000151292	ENST00000344318.3:c.248A>T	22.37:g.30136662T>A	ENSP00000344241:p.Gln83Leu		Somatic				ZMAT5_uc003agn.2_Missense_Mutation_p.Q83L	p.Q83L	NM_019103	NP_061976	WXS	Illumina HiSeq	Unspecified	Q9UDW3	ZMAT5_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)		5	499	-			83					A8K9F6	Missense_Mutation	SNP	ENST00000344318.3	37	c.248A>T	CCDS13868.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.856658	0.51376	.	.	ENSG00000100319	ENST00000344318;ENST00000397781	.	.	.	4.88	4.88	0.63580	.	0.592892	0.18500	N	0.139393	T	0.48095	0.1481	L	0.44542	1.39	0.36521	D	0.870141	B	0.26318	0.146	B	0.19148	0.024	T	0.53865	-0.8378	9	0.35671	T	0.21	-29.1747	12.3294	0.55031	0.0:0.0:0.0:1.0	.	83	Q9UDW3	ZMAT5_HUMAN	L	83	.	ENSP00000344241:Q83L	Q	-	2	0	ZMAT5	28466662	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	4.066000	0.57520	2.042000	0.60477	0.533000	0.62120	CAG		0.632	ZMAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322114.1	NM_019103		6	8	0	0	0	0.00308	0	6	8				
SLC5A1	6523	broad.mit.edu	37	22	32464549	32464549	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr22:32464549C>A	ENST00000266088.4	+	5	689	c.439C>A	c.(439-441)Ctt>Att	p.L147I	SLC5A1_ENST00000543737.1_Missense_Mutation_p.L20I	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	147					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	CTACCTTTCCCTTCTGTCCCT	0.582																																							uc003amc.2		NA																	0				skin(1)	1						c.(439-441)CTT>ATT		solute carrier family 5 (sodium/glucose							158.0	124.0	135.0					22																	32464549		2203	4300	6503	SO:0001583	missense	6523				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding	g.chr22:32464549C>A		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.439C>A	22.37:g.32464549C>A	ENSP00000266088:p.Leu147Ile		Somatic				SLC5A1_uc011alz.1_Missense_Mutation_p.L20I	p.L147I	NM_000343	NP_000334	WXS	Illumina HiSeq	Unspecified	P13866	SC5A1_HUMAN			5	671	+			147			Helical; (Potential).		B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	37	c.439C>A	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.448322	0.26074	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.87729	-2.29;-2.29	5.38	-10.8	0.00216	.	0.741339	0.12865	N	0.432758	T	0.58466	0.2124	N	0.01019	-1.045	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.55068	-0.8198	10	0.21540	T	0.41	.	12.9596	0.58451	0.1604:0.221:0.6185:0.0	.	147	P13866	SC5A1_HUMAN	I	147;20	ENSP00000266088:L147I;ENSP00000444898:L20I	ENSP00000266088:L147I	L	+	1	0	SLC5A1	30794549	0.004000	0.15560	0.000000	0.03702	0.842000	0.47809	-0.020000	0.12525	-3.082000	0.00250	-1.367000	0.01198	CTT		0.582	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343		11	51	1	0	7.93312e-07	0.00245	9.95462e-07	11	51				
RFPL2	10739	broad.mit.edu	37	22	32589087	32589087	+	Missense_Mutation	SNP	C	C	T	rs377247596		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr22:32589087C>T	ENST00000400237.1	-	4	1293	c.358G>A	c.(358-360)Gtc>Atc	p.V120I	RFPL2_ENST00000248980.4_Missense_Mutation_p.V59I|RFPL2_ENST00000248983.4_Missense_Mutation_p.V30I|RFPL2_ENST00000400236.3_Missense_Mutation_p.V30I|RFPL2_ENST00000489846.1_5'UTR			O75678	RFPL2_HUMAN	ret finger protein-like 2	120							zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						TTGAGGCAGACGGCGCATCCA	0.532																																							uc003amg.3		NA																	0				skin(1)	1						c.(358-360)GTC>ATC		ret finger protein-like 2 isoform 2		C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	100.0	98.0	99.0		358,88,88,175	-1.0	0.0	22		99	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	RFPL2	NM_001098527.2,NM_001159545.1,NM_001159546.1,NM_006605.3	29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	120/379,30/289,30/289,59/318	32589087	1,13005	2203	4300	6503	SO:0001583	missense	10739						zinc ion binding	g.chr22:32589087C>T	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.358G>A	22.37:g.32589087C>T	ENSP00000383096:p.Val120Ile		Somatic				RFPL2_uc003ame.3_Missense_Mutation_p.V59I|RFPL2_uc003amf.3_Missense_Mutation_p.V30I|RFPL2_uc003amh.3_Missense_Mutation_p.V30I	p.V120I	NM_001098527	NP_001091997	WXS	Illumina HiSeq	Unspecified	O75678	RFPL2_HUMAN			4	1294	-			120			RING-type; degenerate.			Missense_Mutation	SNP	ENST00000400237.1	37	c.358G>A	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	C	5.367	0.252932	0.10185	0.0	1.16E-4	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	0.501	-1.0	0.10196	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	.	.	.	.	T	0.08537	0.0212	N	0.21324	0.655	0.09310	N	1	P;P	0.48162	0.906;0.792	B;B	0.42422	0.387;0.164	T	0.15521	-1.0434	8	0.17369	T	0.5	.	.	.	.	.	120;59	O75678;O75678-3	RFPL2_HUMAN;.	I	59;30;30;120	ENSP00000248980:V59I;ENSP00000248983:V30I;ENSP00000383095:V30I;ENSP00000383096:V120I	ENSP00000248980:V59I	V	-	1	0	RFPL2	30919087	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	0.894000	0.28350	-1.433000	0.01977	-0.680000	0.03767	GTC		0.532	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605		3	64	0	0	0	0.004672	0	3	64				
ISX	91464	broad.mit.edu	37	22	35480424	35480424	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr22:35480424G>T	ENST00000308700.6	+	3	1382	c.430G>T	c.(430-432)Ggc>Tgc	p.G144C	ISX_ENST00000404699.2_Missense_Mutation_p.G144C	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	144					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						GGAGAAGATTGGCAACCTGGG	0.547																																							uc003anj.2		NA																	0				ovary(3)|skin(2)	5						c.(430-432)GGC>TGC		intestine-specific homeobox							60.0	54.0	56.0					22																	35480424		2203	4300	6503	SO:0001583	missense	91464					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr22:35480424G>T	AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.430G>T	22.37:g.35480424G>T	ENSP00000311492:p.Gly144Cys		Somatic				ISX_uc011amg.1_Missense_Mutation_p.G132C	p.G144C	NM_001008494	NP_001008494	WXS	Illumina HiSeq	Unspecified	Q2M1V0	ISX_HUMAN			3	1381	+			144					Q68DJ5	Missense_Mutation	SNP	ENST00000308700.6	37	c.430G>T	CCDS33640.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715887	0.48622	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	D;D	0.91945	-2.94;-2.94	5.12	-0.692	0.11301	Homeobox (1);	0.706306	0.12878	N	0.431688	D	0.92054	0.7482	L	0.56769	1.78	0.09310	N	1	D	0.69078	0.997	P	0.55667	0.781	D	0.84637	0.0693	10	0.62326	D	0.03	.	8.9065	0.35526	0.5368:0.0:0.4632:0.0	.	144	Q2M1V0	ISX_HUMAN	C	144	ENSP00000311492:G144C;ENSP00000386037:G144C	ENSP00000311492:G144C	G	+	1	0	ISX	33810424	0.972000	0.33761	0.015000	0.15790	0.016000	0.09150	1.640000	0.37186	0.013000	0.14918	-0.136000	0.14681	GGC		0.547	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494		4	14	1	0	0.00116845	0.001168	0.00127269	4	14				
FBLN1	2192	broad.mit.edu	37	22	45937139	45937139	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr22:45937139C>A	ENST00000327858.6	+	9	1048	c.953C>A	c.(952-954)cCg>cAg	p.P318Q	FBLN1_ENST00000348697.2_Missense_Mutation_p.P318Q|FBLN1_ENST00000442170.2_Missense_Mutation_p.P318Q|FBLN1_ENST00000340923.5_Missense_Mutation_p.P318Q|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000402984.3_Missense_Mutation_p.P356Q|FBLN1_ENST00000262722.7_Missense_Mutation_p.P318Q	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	318	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ATCAGTGCCCCGTGCCCTATC	0.527																																							uc003bgj.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(952-954)CCG>CAG		fibulin 1 isoform D							154.0	125.0	135.0					22																	45937139		2203	4300	6503	SO:0001583	missense	2192				interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr22:45937139C>A		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.953C>A	22.37:g.45937139C>A	ENSP00000331544:p.Pro318Gln		Somatic				FBLN1_uc003bgg.1_Missense_Mutation_p.P318Q|FBLN1_uc003bgh.2_Missense_Mutation_p.P318Q|FBLN1_uc010gzz.2_Missense_Mutation_p.P356Q|FBLN1_uc003bgi.1_Missense_Mutation_p.P318Q	p.P318Q	NM_006486	NP_006477	WXS	Illumina HiSeq	Unspecified	P23142	FBLN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)	9	1100	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	318			EGF-like 4; calcium-binding (Potential).		B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	c.953C>A	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300717	0.81136	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923	D;D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91	5.31	5.31	0.75309	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.049849	0.85682	D	0.000000	D	0.95249	0.8459	L	0.60845	1.875	0.51767	D	0.999935	D;D;D;D	0.89917	1.0;0.997;0.999;0.997	D;D;D;D	0.77004	0.989;0.972;0.988;0.969	D	0.95468	0.8549	10	0.66056	D	0.02	.	18.6118	0.91288	0.0:1.0:0.0:0.0	.	356;318;318;318	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	Q	318;356;318;318;318;318	ENSP00000262723:P318Q;ENSP00000385521:P356Q;ENSP00000262722:P318Q;ENSP00000331544:P318Q;ENSP00000393812:P318Q;ENSP00000342212:P318Q	ENSP00000262722:P318Q	P	+	2	0	FBLN1	44315803	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.588000	0.82629	2.484000	0.83849	0.655000	0.94253	CCG		0.527	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486		12	47	1	0	7.93312e-07	0.00245	9.95462e-07	12	47				
HDAC11	79885	broad.mit.edu	37	3	13546094	13546094	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:13546094C>G	ENST00000295757.3	+	10	1138	c.955C>G	c.(955-957)Ctg>Gtg	p.L319V	HDAC11_ENST00000402271.1_Missense_Mutation_p.L240V|HDAC11_ENST00000404040.1_Missense_Mutation_p.L219V|HDAC11_ENST00000402259.1_Missense_Mutation_p.L153V|HDAC11_ENST00000446613.2_Missense_Mutation_p.L127V|HDAC11_ENST00000433119.1_3'UTR|HDAC11_ENST00000437379.2_Missense_Mutation_p.L291V|HDAC11_ENST00000522202.1_Missense_Mutation_p.L268V	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	319	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)	p.L319L(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						CATACTTAATCTGTTTGGCCT	0.622																																							uc003bxy.2		NA																	1	Substitution - coding silent(1)		breast(1)	ovary(2)	2						c.(955-957)CTG>GTG		histone deacetylase 11 isoform 1							84.0	78.0	80.0					3																	13546094		2203	4300	6503	SO:0001583	missense	79885				regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex|plasma membrane	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding	g.chr3:13546094C>G	AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.955C>G	3.37:g.13546094C>G	ENSP00000295757:p.Leu319Val		Somatic				HDAC11_uc010heb.2_3'UTR|HDAC11_uc011aux.1_Missense_Mutation_p.L127V|HDAC11_uc011auy.1_Missense_Mutation_p.L268V	p.L319V	NM_024827	NP_079103	WXS	Illumina HiSeq	Unspecified	Q96DB2	HDA11_HUMAN			10	1088	+			319			Histone deacetylase.		B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Missense_Mutation	SNP	ENST00000295757.3	37	c.955C>G	CCDS2615.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.070272	0.55539	.	.	ENSG00000163517	ENST00000295757;ENST00000402259;ENST00000402271;ENST00000446613;ENST00000404040;ENST00000522202;ENST00000437379	T;T;T;T;T;T;T	0.74632	-0.83;0.55;-0.86;0.54;-0.33;-0.76;-0.81	5.38	-1.2	0.09554	Histone deacetylase domain (1);	0.000000	0.64402	D	0.000002	D	0.85999	0.5828	M	0.91249	3.19	0.44018	D	0.996735	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.84144	0.0419	10	0.87932	D	0	-10.6428	10.0632	0.42288	0.0:0.5271:0.0:0.4729	.	268;319	B4DDK1;Q96DB2	.;HDA11_HUMAN	V	319;153;240;127;219;268;291	ENSP00000295757:L319V;ENSP00000384706:L153V;ENSP00000384123:L240V;ENSP00000401487:L127V;ENSP00000385475:L219V;ENSP00000429794:L268V;ENSP00000395188:L291V	ENSP00000295757:L319V	L	+	1	2	HDAC11	13521094	0.000000	0.05858	0.056000	0.19401	0.695000	0.40330	-0.757000	0.04772	-0.633000	0.05545	-0.258000	0.10820	CTG		0.622	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827		5	37	0	0	0	0.001168	0	5	37				
COLQ	8292	broad.mit.edu	37	3	15531057	15531057	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:15531057G>A	ENST00000383788.5	-	2	319	c.194C>T	c.(193-195)cCa>cTa	p.P65L	COLQ_ENST00000383781.4_Missense_Mutation_p.P55L|COLQ_ENST00000435459.2_Missense_Mutation_p.P55L|COLQ_ENST00000383786.5_Missense_Mutation_p.P65L|COLQ_ENST00000603808.1_Missense_Mutation_p.P65L|COLQ_ENST00000383785.2_Missense_Mutation_p.P65L|COLQ_ENST00000383787.2_Missense_Mutation_p.P65L	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	65	PRAD.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						TCTGAAGAATGGTGGTGGGAA	0.562																																							uc003bzx.2		NA																	0					0						c.(193-195)CCA>CTA		acetylcholinesterase collagen-like tail subunit							82.0	72.0	76.0					3																	15531057		2203	4300	6503	SO:0001583	missense	8292				acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft		g.chr3:15531057G>A	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.194C>T	3.37:g.15531057G>A	ENSP00000373298:p.Pro65Leu		Somatic				HACL1_uc011avr.1_RNA|COLQ_uc003bzv.2_Missense_Mutation_p.P55L|COLQ_uc003bzz.2_Missense_Mutation_p.P65L|COLQ_uc010heo.2_Missense_Mutation_p.P65L|COLQ_uc003cac.1_RNA|COLQ_uc003cae.1_5'UTR|COLQ_uc003cad.1_RNA	p.P65L	NM_005677	NP_005668	WXS	Illumina HiSeq	Unspecified	Q9Y215	COLQ_HUMAN			2	320	-			65			PRAD.		B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	ENST00000383788.5	37	c.194C>T	CCDS33709.1	.	.	.	.	.	.	.	.	.	.	G	9.699	1.154070	0.21371	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383785;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786;ENST00000430319	D;D;D;D;D;D	0.92149	-2.68;-2.91;-2.81;-2.98;-2.82;-2.93	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.95211	0.8447	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.996;0.998	D	0.95400	0.8489	10	0.72032	D	0.01	-5.6872	14.4789	0.67567	0.0:0.0:1.0:0.0	.	65;65;65;55	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	L	65;55;55;65;65;55;65;65;42	ENSP00000373297:P65L;ENSP00000373291:P55L;ENSP00000402511:P55L;ENSP00000373295:P65L;ENSP00000373298:P65L;ENSP00000373296:P65L	ENSP00000373291:P55L	P	-	2	0	COLQ	15506061	1.000000	0.71417	0.534000	0.28014	0.340000	0.28889	5.291000	0.65667	2.491000	0.84063	0.561000	0.74099	CCA		0.562	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343575.1	NM_005677		4	27	0	0	0	0.000602	0	4	27				
DCP1A	55802	broad.mit.edu	37	3	53326317	53326317	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:53326317G>A	ENST00000607628.1	-	7	1274	c.1165C>T	c.(1165-1167)Ctc>Ttc	p.L389F	DCP1A_ENST00000480258.1_5'UTR|Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000606822.1_Missense_Mutation_p.L351F|DCP1A_ENST00000294241.6_Missense_Mutation_p.L389F	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	389					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		ACGCTTGGGAGGGATGTGCCA	0.542																																							uc003dgs.3		NA																	0					0						c.(1165-1167)CTC>TTC		DCP1 decapping enzyme homolog A							178.0	174.0	175.0					3																	53326317		2034	4210	6244	SO:0001583	missense	55802				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding	g.chr3:53326317G>A	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.1165C>T	3.37:g.53326317G>A	ENSP00000475920:p.Leu389Phe		Somatic				DCP1A_uc003dgt.3_RNA	p.L389F	NM_018403	NP_060873	WXS	Illumina HiSeq	Unspecified	Q9NPI6	DCP1A_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)	7	1258	-			389					B4DHN9|U3KQM8	Missense_Mutation	SNP	ENST00000607628.1	37	c.1165C>T																																																																																					0.542	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403		24	58	0	0	0	0.00333	0	24	58				
CADPS	8618	broad.mit.edu	37	3	62751566	62751566	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:62751566C>A	ENST00000383710.4	-	2	884	c.535G>T	c.(535-537)Gct>Tct	p.A179S	CADPS_ENST00000490353.2_Missense_Mutation_p.A179S|CADPS_ENST00000283269.9_Missense_Mutation_p.A179S|CADPS_ENST00000357948.3_Missense_Mutation_p.A179S	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	179					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CTCTGCACAGCGTTCATGAAG	0.522																																							uc003dll.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(535-537)GCT>TCT		Ca2+-dependent secretion activator isoform 1							131.0	116.0	121.0					3																	62751566		2203	4300	6503	SO:0001583	missense	8618				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding	g.chr3:62751566C>A	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.535G>T	3.37:g.62751566C>A	ENSP00000373215:p.Ala179Ser		Somatic				CADPS_uc003dlm.2_Missense_Mutation_p.A179S|CADPS_uc003dln.2_Missense_Mutation_p.A179S	p.A179S	NM_003716	NP_003707	WXS	Illumina HiSeq	Unspecified	Q9ULU8	CAPS1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)	2	895	-		Lung SC(41;0.0452)	179					A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	c.535G>T	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878857	0.91740	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.89192	0.6645	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.91635	0.999;0.989;0.992	D	0.89478	0.3748	10	0.56958	D	0.05	.	17.9568	0.89072	0.0:1.0:0.0:0.0	.	179;179;179	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	S	179	ENSP00000373215:A179S;ENSP00000350632:A179S;ENSP00000283269:A179S;ENSP00000418736:A179S	ENSP00000283269:A179S	A	-	1	0	CADPS	62726606	1.000000	0.71417	0.403000	0.26384	0.989000	0.77384	7.462000	0.80851	2.602000	0.87976	0.655000	0.94253	GCT		0.522	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		25	20	1	0	5.77227e-19	0.008361	9.8045e-19	25	20				
MAGI1	9223	broad.mit.edu	37	3	65438997	65438997	+	Silent	SNP	T	T	C	rs147479917		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:65438997T>C	ENST00000497477.2	-	6	977	c.978A>G	c.(976-978)acA>acG	p.T326T	MAGI1_ENST00000483466.1_Silent_p.T326T|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000402939.2_Silent_p.T326T|MAGI1_ENST00000330909.8_Silent_p.T326T			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	326	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CTAACCAAGATGTTGTTTTCG	0.413																																							uc003dmn.2		NA																	0				lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6						c.(976-978)ACA>ACG		membrane associated guanylate kinase, WW and PDZ		T	,,	0,4406		0,0,2203	117.0	113.0	114.0		978,978,978	3.4	1.0	3	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	MAGI1	NM_001033057.1,NM_004742.2,NM_015520.1	,,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,,	326/1463,326/1257,326/1288	65438997	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9223				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding	g.chr3:65438997T>C	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.978A>G	3.37:g.65438997T>C			Somatic				MAGI1_uc003dmm.2_Silent_p.T326T|MAGI1_uc003dmo.2_Silent_p.T326T|MAGI1_uc003dmp.2_Silent_p.T326T|MAGI1_uc010hny.2_Silent_p.T211T|MAGI1_uc003dmr.2_Silent_p.T327T	p.T326T	NM_001033057	NP_001028229	WXS	Illumina HiSeq	Unspecified	Q96QZ7	MAGI1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)	6	1504	-		Lung NSC(201;0.0016)	326			WW 1.		A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	37	c.978A>G		.	.	.	.	.	.	.	.	.	.	T	9.841	1.191102	0.21954	0.0	1.16E-4	ENSG00000151276	ENST00000460329	.	.	.	5.78	3.42	0.39159	.	.	.	.	.	T	0.58935	0.2157	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52373	-0.8584	4	.	.	.	-15.5926	9.4662	0.38813	0.0:0.262:0.0:0.738	.	.	.	.	R	207	.	.	H	-	2	0	MAGI1	65414037	0.994000	0.37717	1.000000	0.80357	0.994000	0.84299	0.198000	0.17217	0.464000	0.27142	0.533000	0.62120	CAT		0.413	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742		37	20	0	0	0	0.010771	0	37	20				
EPHA6	285220	broad.mit.edu	37	3	96962882	96962883	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:96962882_96962883GG>TT	ENST00000389672.5	+	5	1395_1396	c.1357_1358GG>TT	c.(1357-1359)GGg>TTg	p.G453L	EPHA6_ENST00000470610.2_Missense_Mutation_p.G453L	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	359	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TGACACAGGAGGGAGAAAAGAT	0.465																																							uc010how.1		NA																	0				stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(1357-1359)GGG>TTG		EPH receptor A6 isoform a																																				SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:96962882_96962883GG>TT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	Exception_encountered	3.37:g.96962882_96962883delinsTT	ENSP00000374323:p.Gly453Leu		Somatic				EPHA6_uc003drp.1_Missense_Mutation_p.G453L	p.G453L	NM_001080448	NP_001073917	WXS	Illumina HiSeq	Unspecified	Q9UF33	EPHA6_HUMAN			5	1400_1401	+			358			Fibronectin type-III 1.|Extracellular (Potential).		D6RAL5	Missense_Mutation	DNP	ENST00000389672.5	37	c.1357_1358GG>TT	CCDS46876.1																																																																																				0.465	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		4	7	0	0	0	0.004672	0	4	7				
GPR128	84873	broad.mit.edu	37	3	100365486	100365486	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:100365486C>T	ENST00000273352.3	+	10	1452	c.1184C>T	c.(1183-1185)aCa>aTa	p.T395I	GPR128_ENST00000475887.1_Missense_Mutation_p.T100I|SNORA31_ENST00000517180.1_RNA	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	395	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						GACTGGGACACATATGGCTGT	0.388																																					Pancreas(87;185 1975 7223 18722)	Pancreas(87;185 1975 7223 18722)	uc003duc.2		NA																	0				ovary(3)|skin(1)	4						c.(1183-1185)ACA>ATA		G protein-coupled receptor 128 precursor							114.0	114.0	114.0					3																	100365486		2203	4300	6503	SO:0001583	missense	84873				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:100365486C>T	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1184C>T	3.37:g.100365486C>T	ENSP00000273352:p.Thr395Ile		Somatic				GPR128_uc011bhc.1_Missense_Mutation_p.T96I	p.T395I	NM_032787	NP_116176	WXS	Illumina HiSeq	Unspecified	Q96K78	GP128_HUMAN			10	1452	+			395			GPS.|Extracellular (Potential).		Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	37	c.1184C>T	CCDS2938.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266457	0.59540	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.71461	-0.57;-0.57	5.62	5.62	0.85841	GPS domain (3);	0.000000	0.64402	D	0.000013	D	0.89392	0.6702	H	0.96633	3.855	0.48040	D	0.999578	D;D	0.71674	0.992;0.998	D;D	0.74674	0.971;0.984	D	0.92591	0.6083	10	0.87932	D	0	.	16.3824	0.83473	0.0:1.0:0.0:0.0	.	100;395	E9PHI0;Q96K78	.;GP128_HUMAN	I	395;100	ENSP00000273352:T395I;ENSP00000419788:T100I	ENSP00000273352:T395I	T	+	2	0	GPR128	101848176	0.998000	0.40836	0.948000	0.38648	0.230000	0.25150	5.096000	0.64535	2.625000	0.88918	0.655000	0.94253	ACA		0.388	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1			20	16	0	0	0	0.014323	0	20	16				
POPDC2	64091	broad.mit.edu	37	3	119367247	119367247	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:119367247C>G	ENST00000264231.3	-	3	1035	c.869G>C	c.(868-870)tGt>tCt	p.C290S	POPDC2_ENST00000493094.1_Missense_Mutation_p.C290S|POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000468801.1_Missense_Mutation_p.C290S|POPDC2_ENST00000538678.1_Missense_Mutation_p.C290S	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	290					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		AGCTGGCTCACAGACTTCCTC	0.602																																							uc003ecx.1		NA																	0				central_nervous_system(1)	1						c.(868-870)TGT>TCT		popeye protein 2							124.0	119.0	121.0					3																	119367247		2203	4300	6503	SO:0001583	missense	64091					integral to membrane		g.chr3:119367247C>G	AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.869G>C	3.37:g.119367247C>G	ENSP00000264231:p.Cys290Ser		Somatic				POPDC2_uc010hqw.1_Missense_Mutation_p.C290S|POPDC2_uc003ecy.1_Missense_Mutation_p.C108S	p.C290S	NM_022135	NP_071418	WXS	Illumina HiSeq	Unspecified	Q9HBU9	POPD2_HUMAN		GBM - Glioblastoma multiforme(114;0.242)	3	1003	-			290					Q86UE7	Missense_Mutation	SNP	ENST00000264231.3	37	c.869G>C	CCDS2992.1	.	.	.	.	.	.	.	.	.	.	C	0.415	-0.911341	0.02434	.	.	ENSG00000121577	ENST00000264231;ENST00000493094;ENST00000468801;ENST00000538678	T;T;T;T	0.16597	2.37;2.37;2.33;2.33	5.08	-9.64	0.00541	.	3.156180	0.00604	N	0.000388	T	0.10508	0.0257	L	0.43152	1.355	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28004	-1.0057	10	0.07813	T	0.8	.	5.798	0.18397	0.1027:0.5096:0.2482:0.1396	.	290;290	Q9HBU9-2;Q9HBU9	.;POPD2_HUMAN	S	290	ENSP00000264231:C290S;ENSP00000417250:C290S;ENSP00000420715:C290S;ENSP00000438271:C290S	ENSP00000264231:C290S	C	-	2	0	POPDC2	120849937	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.295000	0.01143	-1.996000	0.00970	-0.367000	0.07326	TGT		0.602	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1	NM_022135		33	37	0	0	0	0.00623	0	33	37				
COL6A6	131873	broad.mit.edu	37	3	130284056	130284056	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:130284056C>A	ENST00000358511.6	+	3	911	c.880C>A	c.(880-882)Cag>Aag	p.Q294K	COL6A6_ENST00000453409.2_Missense_Mutation_p.Q294K	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	294	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AGAGGTTCTCCAGCATATACA	0.453																																							uc010htl.2		NA																	0				ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(880-882)CAG>AAG		collagen type VI alpha 6 precursor							86.0	87.0	86.0					3																	130284056		1876	4098	5974	SO:0001583	missense	131873				axon guidance|cell adhesion	collagen		g.chr3:130284056C>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.880C>A	3.37:g.130284056C>A	ENSP00000351310:p.Gln294Lys		Somatic					p.Q294K	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			3	911	+			294			Nonhelical region.|VWFA 2.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	c.880C>A	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	6.786	0.514068	0.12944	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.77750	-1.12;-1.12	5.21	4.33	0.51752	von Willebrand factor, type A (3);	0.107858	0.41823	D	0.000804	T	0.65842	0.2730	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.51748	-0.8666	10	0.27785	T	0.31	.	5.7296	0.18032	0.1406:0.6464:0.1364:0.0767	.	294	A6NMZ7	CO6A6_HUMAN	K	294	ENSP00000351310:Q294K;ENSP00000399236:Q294K	ENSP00000351310:Q294K	Q	+	1	0	COL6A6	131766746	0.003000	0.15002	0.067000	0.19924	0.397000	0.30659	-0.003000	0.12901	1.335000	0.45486	0.561000	0.74099	CAG		0.453	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		15	16	1	0	8.60227e-14	0.004007	1.34425e-13	15	16				
A4GNT	51146	broad.mit.edu	37	3	137849858	137849858	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:137849858A>T	ENST00000236709.3	-	2	442	c.241T>A	c.(241-243)Tgg>Agg	p.W81R		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	81					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						ACCACAGGCCACTCAGGATAA	0.493																																							uc003ers.2		NA																	0				central_nervous_system(1)	1						c.(241-243)TGG>AGG		alpha-1,4-N-acetylglucosaminyltransferase							109.0	111.0	110.0					3																	137849858		2203	4300	6503	SO:0001583	missense	51146				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr3:137849858A>T	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.241T>A	3.37:g.137849858A>T	ENSP00000236709:p.Trp81Arg		Somatic					p.W81R	NM_016161	NP_057245	WXS	Illumina HiSeq	Unspecified	Q9UNA3	A4GCT_HUMAN			2	443	-			81			Lumenal (Potential).		Q0VDK1|Q0VDK2	Missense_Mutation	SNP	ENST00000236709.3	37	c.241T>A	CCDS3097.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.264093	0.00262	.	.	ENSG00000118017	ENST00000236709	D	0.81996	-1.56	5.27	2.16	0.27623	Glycosyltransferase, DXD sugar-binding motif (1);	0.882556	0.09324	N	0.817804	T	0.55369	0.1916	N	0.00666	-1.275	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44298	-0.9337	10	0.18710	T	0.47	-28.0121	9.9651	0.41719	0.0785:0.0:0.5957:0.3258	.	81	Q9UNA3	A4GCT_HUMAN	R	81	ENSP00000236709:W81R	ENSP00000236709:W81R	W	-	1	0	A4GNT	139332548	0.031000	0.19500	0.435000	0.26784	0.221000	0.24807	0.546000	0.23284	0.594000	0.29761	-0.232000	0.12228	TGG		0.493	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161		19	18	0	0	0	0.00278	0	19	18				
DHX36	170506	broad.mit.edu	37	3	154042092	154042092	+	Silent	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:154042092T>A	ENST00000496811.1	-	1	194	c.114A>T	c.(112-114)ggA>ggT	p.G38G	DHX36_ENST00000308361.6_Silent_p.G38G|DHX36_ENST00000329463.5_Silent_p.G38G|DHX36_ENST00000544526.1_Silent_p.G38G	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	38	Gly-rich.|RNA-binding; sufficient and required for recruitment to cytoplasmic stress granules.				ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CGCCGCCGCCTCCTCCGGAGC	0.706																																							uc003ezy.3		NA																	0				skin(1)	1						c.(112-114)GGA>GGT		DEAH (Asp-Glu-Ala-His) box polypeptide 36							21.0	28.0	26.0					3																	154042092		2187	4282	6469	SO:0001819	synonymous_variant	170506					cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr3:154042092T>A	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.114A>T	3.37:g.154042092T>A			Somatic				DHX36_uc010hvq.2_Silent_p.G38G|DHX36_uc003ezz.3_Silent_p.G38G	p.G38G	NM_020865	NP_065916	WXS	Illumina HiSeq	Unspecified	Q9H2U1	DHX36_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		1	195	-			38			Gly-rich.		B2RB00|Q70JU3|Q8IYE5|Q9P240	Silent	SNP	ENST00000496811.1	37	c.114A>T	CCDS3171.1																																																																																				0.706	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	NM_020865		17	9	0	0	0	0.012319	0	17	9				
BDH1	622	broad.mit.edu	37	3	197273292	197273292	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr3:197273292C>A	ENST00000392378.2	-	2	333	c.23G>T	c.(22-24)aGa>aTa	p.R8I	BDH1_ENST00000358186.2_Missense_Mutation_p.R8I|BDH1_ENST00000392379.1_Missense_Mutation_p.R8I|BDH1_ENST00000441275.1_Intron	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	8					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		TGACAGGGGTCTGGAGAGGCG	0.537																																							uc003fxr.2		NA																	0				ovary(1)	1						c.(22-24)AGA>ATA		3-hydroxybutyrate dehydrogenase, type 1	NADH(DB00157)						87.0	92.0	90.0					3																	197273292		2203	4300	6503	SO:0001583	missense	622				cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity	g.chr3:197273292C>A	M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.23G>T	3.37:g.197273292C>A	ENSP00000376183:p.Arg8Ile		Somatic				BDH1_uc003fxs.2_Missense_Mutation_p.R8I|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Missense_Mutation_p.R8I	p.R8I	NM_203314	NP_976059	WXS	Illumina HiSeq	Unspecified	Q02338	BDH_HUMAN	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	3	425	-	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	8					D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	ENST00000392378.2	37	c.23G>T	CCDS3328.1	.	.	.	.	.	.	.	.	.	.	c	27.3	4.822134	0.90873	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000432819;ENST00000431056;ENST00000445160	T;T;T;D;D	0.88818	-1.36;-1.36;-1.36;-2.43;-2.39	4.8	4.8	0.61643	.	0.181371	0.48767	D	0.000162	D	0.89410	0.6707	L	0.29908	0.895	0.46798	D	0.9992	D	0.69078	0.997	P	0.60949	0.881	D	0.90219	0.4270	10	0.66056	D	0.02	.	14.1051	0.65083	0.0:1.0:0.0:0.0	.	8	Q02338	BDH_HUMAN	I	8	ENSP00000376183:R8I;ENSP00000350914:R8I;ENSP00000376184:R8I;ENSP00000409849:R8I;ENSP00000396149:R8I	ENSP00000350914:R8I	R	-	2	0	BDH1	198757689	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	3.279000	0.51670	2.604000	0.88044	0.645000	0.84053	AGA		0.537	BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340267.1	NM_004051		26	24	1	0	2.09667e-21	0.003755	3.62432e-21	26	24				
ZNF518B	85460	broad.mit.edu	37	4	10445615	10445616	+	Missense_Mutation	DNP	CC	CC	AA	rs80340183		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:10445615_10445616CC>AA	ENST00000326756.3	-	3	2775_2776	c.2337_2338GG>TT	c.(2335-2340)agGGtt>agTTtt	p.779_780RV>SF		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	779					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						GAATTAAGAACCCTCAACACAG	0.465																																							uc003gmn.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(2335-2340)AGGGTT>AGTTTT		zinc finger protein 518B																																				SO:0001583	missense	85460				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:10445615_10445616CC>AA	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2337_2338delinsAA	4.37:g.10445615_10445616delinsAA	ENSP00000317614:p.R779_V780delinsSF		Somatic					p.779_780RV>SF	NM_053042	NP_444270	WXS	Illumina HiSeq	Unspecified	Q9C0D4	Z518B_HUMAN			3	2824_2825	-			779_780					Q96LN8	Missense_Mutation	DNP	ENST00000326756.3	37	c.2337_2338GG>TT	CCDS33960.1																																																																																				0.465	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		4	34	0	0	0	0.004672	0	4	34				
SLIT2	9353	broad.mit.edu	37	4	20530694	20530694	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:20530694G>C	ENST00000504154.1	+	16	1837	c.1585G>C	c.(1585-1587)Gag>Cag	p.E529Q	SLIT2_ENST00000273739.5_Missense_Mutation_p.E533Q|SLIT2_ENST00000503823.1_Missense_Mutation_p.E521Q|SLIT2_ENST00000503837.1_Missense_Mutation_p.E525Q|MIR218-1_ENST00000384999.1_RNA	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	529	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CAAAATCCCGGAGCACATTCC	0.443																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(1585-1587)GAG>CAG		slit homolog 2 precursor							104.0	102.0	103.0					4																	20530694		2203	4300	6503	SO:0001583	missense	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20530694G>C	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1585G>C	4.37:g.20530694G>C	ENSP00000422591:p.Glu529Gln		Somatic				SLIT2_uc003gps.1_Missense_Mutation_p.E521Q	p.E529Q	NM_004787	NP_004778	WXS	Illumina HiSeq	Unspecified	O94813	SLIT2_HUMAN			16	1789	+			529			LRRNT 3.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	c.1585G>C	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708035	0.30322	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.96300	-3.97;-3.97;-3.97;-3.97	6.07	6.07	0.98685	Leucine-rich repeat-containing N-terminal (2);	0.136147	0.64402	D	0.000003	D	0.94509	0.8232	L	0.37507	1.11	0.47659	D	0.999482	B;B	0.22851	0.052;0.076	B;B	0.31390	0.053;0.129	D	0.90401	0.4402	10	0.25106	T	0.35	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	521;529	O94813-3;O94813	.;SLIT2_HUMAN	Q	521;529;533;525;525	ENSP00000427548:E521Q;ENSP00000422591:E529Q;ENSP00000273739:E533Q;ENSP00000422261:E525Q	ENSP00000273739:E533Q	E	+	1	0	SLIT2	20139792	1.000000	0.71417	0.273000	0.24645	0.220000	0.24768	7.628000	0.83189	2.885000	0.99019	0.655000	0.94253	GAG		0.443	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			17	55	0	0	0	0.008871	0	17	55				
GBA3	57733	broad.mit.edu	37	4	22749343	22749343	+	RNA	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:22749343G>T	ENST00000503442.1	+	0	377				GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCAACTCAGTGTCTGACCAGG	0.433																																							uc003gqp.3		NA																	0					0						c.(709-711)GTG>GTT		cytosolic beta-glucosidase isoform a							141.0	139.0	140.0					4																	22749343		1905	4111	6016			57733				glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity	g.chr4:22749343G>T	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22749343G>T			Somatic				GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Silent_p.V238V	p.V237V	NM_020973	NP_066024	WXS	Illumina HiSeq	Unspecified	Q9H227	GBA3_HUMAN			3	802	+			237					Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Silent	SNP	ENST00000503442.1	37	c.711G>T																																																																																					0.433	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2			12	111	1	0	1.5842e-08	0.001855	2.19466e-08	12	111				
SEL1L3	23231	broad.mit.edu	37	4	25780734	25780734	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:25780734A>C	ENST00000399878.3	-	16	2671	c.2549T>G	c.(2548-2550)cTg>cGg	p.L850R	SEL1L3_ENST00000502949.1_Missense_Mutation_p.L697R|SEL1L3_ENST00000264868.5_Missense_Mutation_p.L815R	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	850						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						GAATGTCTCCAGGTTGCCTGT	0.453																																							uc003gru.3		NA																	0					0						c.(2548-2550)CTG>CGG		sel-1 suppressor of lin-12-like 3							138.0	129.0	132.0					4																	25780734		1968	4148	6116	SO:0001583	missense	23231					integral to membrane	binding	g.chr4:25780734A>C	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2549T>G	4.37:g.25780734A>C	ENSP00000382767:p.Leu850Arg		Somatic				SEL1L3_uc003grv.2_Missense_Mutation_p.L257R	p.L850R	NM_015187	NP_056002	WXS	Illumina HiSeq	Unspecified	Q68CR1	SE1L3_HUMAN			16	2701	-			850			Sel1-like 7.		A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	37	c.2549T>G	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752827	0.69648	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949;ENST00000514321	T;T;T	0.15952	2.59;2.6;2.38	5.22	5.22	0.72569	Tetratricopeptide-like helical (1);	0.365907	0.26457	N	0.024275	T	0.24160	0.0585	N	0.22421	0.69	0.44055	D	0.996794	D;D	0.67145	0.982;0.996	P;P	0.60236	0.637;0.871	T	0.02574	-1.1139	10	0.32370	T	0.25	-9.4067	15.1041	0.72306	1.0:0.0:0.0:0.0	.	257;850	B4DTH5;Q68CR1	.;SE1L3_HUMAN	R	850;815;697;31	ENSP00000382767:L850R;ENSP00000264868:L815R;ENSP00000425438:L697R	ENSP00000264868:L815R	L	-	2	0	SEL1L3	25389832	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.081000	0.76844	1.967000	0.57214	0.459000	0.35465	CTG		0.453	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187		12	66	0	0	0	0.010729	0	12	66				
KDR	3791	broad.mit.edu	37	4	55962478	55962478	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:55962478G>T	ENST00000263923.4	-	19	2941	c.2646C>A	c.(2644-2646)ctC>ctA	p.L882L		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	882	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTTCAGACATGAGAGCTCGAT	0.463			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		0				lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(2644-2646)CTC>CTA		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						225.0	196.0	206.0					4																	55962478		2203	4300	6503	SO:0001819	synonymous_variant	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55962478G>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2646C>A	4.37:g.55962478G>T		TSP Lung(20;0.16)	Somatic				KDR_uc003hat.1_Silent_p.L882L	p.L882L	NM_002253	NP_002244	WXS	Illumina HiSeq	Unspecified	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		19	2948	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		882			Protein kinase.|Cytoplasmic (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	c.2646C>A	CCDS3497.1																																																																																				0.463	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			22	60	1	0	3.08376e-08	0.00333	4.0977e-08	22	60				
POLR2B	5431	broad.mit.edu	37	4	57891066	57891066	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:57891066G>T	ENST00000381227.1	+	23	3392	c.2979G>T	c.(2977-2979)aaG>aaT	p.K993N	POLR2B_ENST00000431623.2_Missense_Mutation_p.K918N|POLR2B_ENST00000441246.2_Missense_Mutation_p.K986N|POLR2B_ENST00000314595.5_Missense_Mutation_p.K993N			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	993					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					CGGCTAACAAGGGTGAAATTG	0.338																																							uc003hcl.1		NA																	0				ovary(2)	2						c.(2977-2979)AAG>AAT		DNA directed RNA polymerase II polypeptide B							149.0	149.0	149.0					4																	57891066		2203	4300	6503	SO:0001583	missense	5431				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding	g.chr4:57891066G>T		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2979G>T	4.37:g.57891066G>T	ENSP00000370625:p.Lys993Asn		Somatic				POLR2B_uc011cae.1_Missense_Mutation_p.K986N|POLR2B_uc011caf.1_Missense_Mutation_p.K918N|POLR2B_uc003hcm.1_Missense_Mutation_p.K486N	p.K993N	NM_000938	NP_000929	WXS	Illumina HiSeq	Unspecified	P30876	RPB2_HUMAN			22	3022	+	Glioma(25;0.08)|all_neural(26;0.181)		993					A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	c.2979G>T	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676837	0.47886	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63	5.48	1.31	0.21738	DNA-directed RNA polymerase, subunit 2, domain 6 (2);	0.052271	0.85682	N	0.000000	T	0.62901	0.2466	L	0.31420	0.93	0.58432	D	0.999999	P;P	0.42296	0.775;0.775	P;P	0.48873	0.497;0.593	T	0.54370	-0.8304	10	0.22109	T	0.4	.	11.2741	0.49157	0.41:0.0:0.59:0.0	.	918;993	C9J4M6;P30876	.;RPB2_HUMAN	N	993;918;986;993	ENSP00000370625:K993N;ENSP00000391096:K918N;ENSP00000391452:K986N;ENSP00000312735:K993N	ENSP00000312735:K993N	K	+	3	2	POLR2B	57585823	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	2.738000	0.47401	0.294000	0.22547	-0.150000	0.13652	AAG		0.338	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938		30	60	1	0	2.49991e-28	0.003271	4.50754e-28	30	60				
TMPRSS11A	339967	broad.mit.edu	37	4	68797728	68797728	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:68797728G>T	ENST00000334830.7	-	4	1058	c.312C>A	c.(310-312)aaC>aaA	p.N104K	TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.N101K|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.N100K|UBA6-AS1_ENST00000500538.2_RNA			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	104	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TGACTACTTGGTTCTTGATAT	0.353																																					NSCLC(26;2 894 10941 14480 22546)	NSCLC(26;2 894 10941 14480 22546)	uc003hdr.1		NA																	0				skin(1)	1						c.(310-312)AAC>AAA		transmembrane protease, serine 11A isoform 1							146.0	142.0	143.0					4																	68797728		2203	4300	6503	SO:0001583	missense	339967				cell cycle|proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity	g.chr4:68797728G>T	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.312C>A	4.37:g.68797728G>T	ENSP00000334611:p.Asn104Lys		Somatic				LOC550112_uc003hdl.3_Intron|TMPRSS11A_uc003hds.1_Missense_Mutation_p.N101K	p.N104K	NM_182606	NP_872412	WXS	Illumina HiSeq	Unspecified	Q6ZMR5	TM11A_HUMAN			4	433	-			104			SEA.|Extracellular (Potential).		J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	ENST00000334830.7	37	c.312C>A	CCDS3519.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129440	0.37630	.	.	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	6.08	0.581	0.17407	SEA (1);	0.094893	0.45867	D	0.000340	T	0.53334	0.1790	M	0.72479	2.2	0.28998	N	0.887638	D;D	0.61697	0.99;0.99	P;P	0.61800	0.894;0.894	T	0.50825	-0.8782	10	0.87932	D	0	.	7.5002	0.27513	0.557:0.0:0.443:0.0	.	101;104	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	K	100;104;101;81	ENSP00000426911:N100K;ENSP00000334611:N104K;ENSP00000379491:N101K;ENSP00000427621:N81K	ENSP00000334611:N104K	N	-	3	2	TMPRSS11A	68480323	0.992000	0.36948	0.730000	0.30809	0.168000	0.22595	0.375000	0.20518	0.131000	0.18576	-0.122000	0.15005	AAC		0.353	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606		4	35	1	0	2.0095e-06	0.001984	2.47388e-06	4	35				
UGT2B15	7366	broad.mit.edu	37	4	69533895	69533895	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:69533895T>A	ENST00000338206.5	-	2	745	c.736A>T	c.(736-738)Aca>Tca	p.T246S		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	246					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	TCAAATAATGTAGTGGGTCTT	0.368																																							uc011cal.1		NA																	0					0						c.(736-738)ACA>TCA		UDP glycosyltransferase 2B15 precursor							61.0	67.0	65.0					4																	69533895		2200	4296	6496	SO:0001583	missense	7366				steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69533895T>A	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.736A>T	4.37:g.69533895T>A	ENSP00000341045:p.Thr246Ser		Somatic					p.T246S	NM_001076	NP_001067	WXS	Illumina HiSeq	Unspecified	P54855	UDB15_HUMAN			2	774	-			246					A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	c.736A>T	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	t	11.19	1.566236	0.27915	.	.	ENSG00000196620	ENST00000338206	T	0.60672	0.17	2.27	2.27	0.28462	.	0.319538	0.28047	U	0.016809	T	0.49813	0.1579	L	0.58428	1.81	0.22940	N	0.998535	B	0.26577	0.153	B	0.30943	0.122	T	0.38672	-0.9650	10	0.30078	T	0.28	.	8.0697	0.30682	0.0:0.0:0.0:1.0	.	246	P54855	UDB15_HUMAN	S	246	ENSP00000341045:T246S	ENSP00000341045:T246S	T	-	1	0	UGT2B15	69216490	1.000000	0.71417	0.531000	0.27976	0.797000	0.45037	5.081000	0.64444	1.034000	0.39945	0.254000	0.18369	ACA		0.368	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076		24	33	0	0	0	0.004878	0	24	33				
COPS4	51138	broad.mit.edu	37	4	83996468	83996468	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:83996468C>T	ENST00000264389.2	+	10	1241	c.1106C>T	c.(1105-1107)aCg>aTg	p.T369M	COPS4_ENST00000509093.1_Missense_Mutation_p.R341C|COPS4_ENST00000511653.1_Silent_p.N418N|COPS4_ENST00000503682.1_Missense_Mutation_p.T401M	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	369					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				GCCCTGCCAACGTGGGATAAG	0.373																																							uc003hoa.2		NA																	0				kidney(1)	1						c.(1105-1107)ACG>ATG		COP9 signalosome subunit 4							74.0	72.0	73.0					4																	83996468		2203	4300	6503	SO:0001583	missense	51138				cullin deneddylation	cytoplasm|signalosome	protein binding	g.chr4:83996468C>T	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.1106C>T	4.37:g.83996468C>T	ENSP00000264389:p.Thr369Met		Somatic				COPS4_uc003hob.2_Silent_p.N418N|COPS4_uc010ijw.2_Missense_Mutation_p.T401M|COPS4_uc010ijx.2_Missense_Mutation_p.R341C	p.T369M	NM_016129	NP_057213	WXS	Illumina HiSeq	Unspecified	Q9BT78	CSN4_HUMAN			10	1245	+		Hepatocellular(203;0.114)	369					B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	ENST00000264389.2	37	c.1106C>T	CCDS3600.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.12|18.12	3.552510|3.552510	0.65425|0.65425	.|.	.|.	ENSG00000138663|ENSG00000138663	ENST00000509093|ENST00000264389;ENST00000509317;ENST00000503682	T|T;T;T	0.32753|0.47177	1.44|0.88;0.9;0.85	6.08|6.08	6.08|6.08	0.98989|0.98989	.|Proteasome component (PCI) domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.37128|0.37128	0.0992|0.0992	L|L	0.28115|0.28115	0.83|0.83	0.80722|0.80722	D|D	1|1	D|B;B	0.55605|0.33103	0.972|0.397;0.047	P|B;B	0.53490|0.18561	0.727|0.022;0.009	T|T	0.15983|0.15983	-1.0418|-1.0418	9|10	0.72032|0.49607	D|T	0.01|0.09	-17.442|-17.442	20.6721|20.6721	0.99693|0.99693	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	341|401;369	B3KST5|D6RFN0;Q9BT78	.|.;CSN4_HUMAN	C|M	341|369;257;401	ENSP00000425976:R341C|ENSP00000264389:T369M;ENSP00000425486:T257M;ENSP00000424791:T401M	ENSP00000425976:R341C|ENSP00000264389:T369M	R|T	+|+	1|2	0|0	COPS4|COPS4	84215492|84215492	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.993000|0.993000	0.82548|0.82548	7.414000|7.414000	0.80117|0.80117	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CGT|ACG		0.373	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1			13	30	0	0	0	0.00245	0	13	30				
CDS1	1040	broad.mit.edu	37	4	85560101	85560101	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:85560101G>C	ENST00000295887.5	+	9	1258	c.835G>C	c.(835-837)Gga>Cga	p.G279R		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		GACTTGGGAAGGATTCATTGG	0.279																																							uc011ccv.1		NA																	0				large_intestine(2)|ovary(1)|breast(1)	4						c.(835-837)GGA>CGA		CDP-diacylglycerol synthase 1							100.0	97.0	98.0					4																	85560101		2201	4298	6499	SO:0001583	missense	1040				signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity	g.chr4:85560101G>C	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.835G>C	4.37:g.85560101G>C	ENSP00000295887:p.Gly279Arg		Somatic				CDS1_uc010ike.1_Missense_Mutation_p.G83R	p.G279R	NM_001263	NP_001254	WXS	Illumina HiSeq	Unspecified	Q92903	CDS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00101)	9	1333	+		Hepatocellular(203;0.114)	279			Helical; (Potential).		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000295887.5	37	c.835G>C	CCDS3608.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803166	0.90623	.	.	ENSG00000163624	ENST00000295887	D	0.95103	-3.61	5.15	5.15	0.70609	.	0.106126	0.64402	D	0.000004	D	0.98492	0.9497	H	0.97783	4.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99819	1.1046	10	0.87932	D	0	-12.9674	18.6599	0.91469	0.0:0.0:1.0:0.0	.	279	Q92903	CDS1_HUMAN	R	279	ENSP00000295887:G279R	ENSP00000295887:G279R	G	+	1	0	CDS1	85779125	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.796000	0.99103	2.406000	0.81754	0.557000	0.71058	GGA		0.279	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2			6	10	0	0	0	0.004482	0	6	10				
SMARCAD1	56916	broad.mit.edu	37	4	95194771	95194771	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:95194771C>G	ENST00000354268.4	+	12	1649	c.1576C>G	c.(1576-1578)Cta>Gta	p.L526V	SMARCAD1_ENST00000509418.1_Missense_Mutation_p.L96V|SMARCAD1_ENST00000457823.2_Missense_Mutation_p.L526V			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	526	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TTTTTAGGGCCTAGGAAAAAC	0.313																																							uc003htc.3		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(1576-1578)CTA>GTA		SWI/SNF-related, matrix-associated							76.0	72.0	73.0					4																	95194771		2203	4300	6503	SO:0001583	missense	56916				chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity	g.chr4:95194771C>G	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.1576C>G	4.37:g.95194771C>G	ENSP00000346217:p.Leu526Val		Somatic				SMARCAD1_uc003htb.3_Missense_Mutation_p.L526V|SMARCAD1_uc003htd.3_Missense_Mutation_p.L526V|SMARCAD1_uc010ila.2_Missense_Mutation_p.L389V|SMARCAD1_uc011cdw.1_Missense_Mutation_p.L96V	p.L526V	NM_020159	NP_064544	WXS	Illumina HiSeq	Unspecified	Q9H4L7	SMRCD_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)	12	1831	+			526			ATP (By similarity).|Helicase ATP-binding.		B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	c.1576C>G	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951770	0.73787	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94	5.26	4.18	0.49190	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.38720	N	0.001592	D	0.98311	0.9440	H	0.98577	4.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97692	1.0179	10	0.87932	D	0	-8.921	6.9118	0.24338	0.0:0.7955:0.0:0.2045	.	526;526	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	V	526;526;526;96	ENSP00000351947:L526V;ENSP00000415576:L526V;ENSP00000346217:L526V;ENSP00000423286:L96V	ENSP00000346217:L526V	L	+	1	2	SMARCAD1	95413794	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.955000	0.56715	2.592000	0.87571	0.655000	0.94253	CTA		0.313	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159		3	7	0	0	0	0.004672	0	3	7				
ETNPPL	64850	broad.mit.edu	37	4	109663733	109663733	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:109663733G>T	ENST00000296486.3	-	13	1561	c.1407C>A	c.(1405-1407)gaC>gaA	p.D469E	ETNPPL_ENST00000510706.1_Missense_Mutation_p.D429E|ETNPPL_ENST00000512646.1_Missense_Mutation_p.D411E|ETNPPL_ENST00000411864.2_Missense_Mutation_p.D463E	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	469						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										CAGTGGTGCTGTCCCTAAGCA	0.488																																							uc003hzc.2		NA																	0				ovary(1)	1						c.(1405-1407)GAC>GAA		alanine-glyoxylate aminotransferase 2-like 1							219.0	186.0	197.0					4																	109663733		2203	4300	6503	SO:0001583	missense	64850				cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding	g.chr4:109663733G>T	AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.1407C>A	4.37:g.109663733G>T	ENSP00000296486:p.Asp469Glu		Somatic				AGXT2L1_uc010imc.2_Missense_Mutation_p.D463E|AGXT2L1_uc011cfm.1_Missense_Mutation_p.D429E|AGXT2L1_uc011cfn.1_Missense_Mutation_p.D396E|AGXT2L1_uc011cfo.1_Missense_Mutation_p.D411E	p.D469E	NM_031279	NP_112569	WXS	Illumina HiSeq	Unspecified	Q8TBG4	AT2L1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000281)	13	1588	-			469					B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	ENST00000296486.3	37	c.1407C>A	CCDS3682.1	.	.	.	.	.	.	.	.	.	.	G	5.082	0.200708	0.09652	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	D;T;D;T	0.84730	-1.53;-1.08;-1.89;-1.48	5.54	-7.75	0.01236	.	1.269400	0.05140	N	0.494104	T	0.62097	0.2400	N	0.11560	0.145	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.53746	-0.8395	9	.	.	.	-3.3576	0.5111	0.00596	0.3612:0.2426:0.1468:0.2494	.	411;463;469	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	E	469;463;411;429	ENSP00000296486:D469E;ENSP00000392269:D463E;ENSP00000427065:D411E;ENSP00000423240:D429E	.	D	-	3	2	AGXT2L1	109883182	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.924000	0.03996	-2.264000	0.00689	-0.150000	0.13652	GAC		0.488	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363508.1	NM_031279		8	47	1	0	0.000274275	0.004482	0.000309087	8	47				
COL25A1	84570	broad.mit.edu	37	4	109753571	109753571	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:109753571C>A	ENST00000399132.1	-	32	2205	c.1675G>T	c.(1675-1677)Gga>Tga	p.G559*	COL25A1_ENST00000399127.1_Nonsense_Mutation_p.G571*|COL25A1_ENST00000399126.1_Nonsense_Mutation_p.G559*	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CCATGGGGTCCCATAGGACCA	0.393																																							uc003hze.1		NA																	0				ovary(2)	2						c.(1675-1677)GGA>TGA		collagen, type XXV, alpha 1 isoform 1							57.0	55.0	56.0					4																	109753571		1817	4073	5890	SO:0001587	stop_gained	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:109753571C>A	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1675G>T	4.37:g.109753571C>A	ENSP00000382083:p.Gly559*		Somatic				COL25A1_uc003hzg.2_Nonsense_Mutation_p.G559*|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Nonsense_Mutation_p.G356*	p.G559*	NM_198721	NP_942014	WXS	Illumina HiSeq	Unspecified	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	31	2206	-		Hepatocellular(203;0.217)	559			Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000399132.1	37	c.1675G>T	CCDS43258.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.497739|10.497739	0.99416|0.99416	.|.	.|.	ENSG00000188517|ENSG00000188517	ENST00000443653|ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.79930|.	0.4531|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.77316|.	-0.2633|.	4|.	.|.	.|.	.|.	-7.6765|-7.6765	20.1325|20.1325	0.98004|0.98004	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	486|559;561;540;571;559	.|.	.|.	G|G	-|-	2|1	0|0	COL25A1|COL25A1	109973020|109973020	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.871000|5.871000	0.69628|0.69628	2.839000|2.839000	0.97877|0.97877	0.650000|0.650000	0.86243|0.86243	GGG|GGA		0.393	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		5	15	1	0	0.00198382	0.001984	0.00214883	5	15				
ANK2	287	broad.mit.edu	37	4	114279924	114279924	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:114279924C>G	ENST00000357077.4	+	38	10203	c.10150C>G	c.(10150-10152)Cca>Gca	p.P3384A	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.P3351A|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3384					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAGCATCGCACCAGATAATAG	0.463																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(10150-10152)CCA>GCA		ankyrin 2 isoform 1							100.0	102.0	101.0					4																	114279924		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114279924C>G	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10150C>G	4.37:g.114279924C>G	ENSP00000349588:p.Pro3384Ala		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.P686A|ANK2_uc011cgb.1_Missense_Mutation_p.P3399A	p.P3384A	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	10250	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3351					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.10150C>G	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	2.088	-0.409115	0.04799	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.95788	-0.17;-0.19;-3.81	5.49	-0.592	0.11671	.	0.404776	0.21078	N	0.080539	D	0.90573	0.7045	M	0.61703	1.905	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.75499	-0.3296	10	0.09590	T	0.72	.	5.5125	0.16888	0.0:0.485:0.2399:0.2751	.	3351;3384	Q01484;Q01484-4	ANK2_HUMAN;.	A	3384;3351;394	ENSP00000349588:P3384A;ENSP00000264366:P3351A;ENSP00000422498:P394A	ENSP00000264366:P3351A	P	+	1	0	ANK2	114499373	0.000000	0.05858	0.000000	0.03702	0.396000	0.30629	0.451000	0.21779	-0.214000	0.10078	0.650000	0.86243	CCA		0.463	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		13	69	0	0	0	0.00245	0	13	69				
FHDC1	85462	broad.mit.edu	37	4	153896290	153896290	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:153896290C>T	ENST00000511601.1	+	12	2035	c.1847C>T	c.(1846-1848)tCa>tTa	p.S616L	FHDC1_ENST00000260008.3_Missense_Mutation_p.S616L			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	616									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					AACCCACCCTCAGCACAGGCG	0.657																																							uc003inf.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1846-1848)TCA>TTA		FH2 domain containing 1							50.0	66.0	61.0					4																	153896290		2200	4291	6491	SO:0001583	missense	85462				actin cytoskeleton organization		actin binding	g.chr4:153896290C>T	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.1847C>T	4.37:g.153896290C>T	ENSP00000427567:p.Ser616Leu		Somatic					p.S616L	NM_033393	NP_203751	WXS	Illumina HiSeq	Unspecified	Q9C0D6	FHDC1_HUMAN			11	1922	+	all_hematologic(180;0.093)		616						Missense_Mutation	SNP	ENST00000511601.1	37	c.1847C>T	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767164	0.31320	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.29655	1.56;1.56	5.59	2.87	0.33458	.	1.034390	0.07709	N	0.941776	T	0.25082	0.0609	L	0.41236	1.265	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.26608	-1.0098	10	0.26408	T	0.33	.	7.839	0.29387	0.1299:0.7292:0.0:0.1408	.	616	Q9C0D6	FHDC1_HUMAN	L	616	ENSP00000427567:S616L;ENSP00000260008:S616L	ENSP00000260008:S616L	S	+	2	0	FHDC1	154115740	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	0.312000	0.19397	0.693000	0.31634	0.563000	0.77884	TCA		0.657	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393		10	63	0	0	0	0.003163	0	10	63				
DCHS2	54798	broad.mit.edu	37	4	155287395	155287395	+	Missense_Mutation	SNP	C	C	T	rs536580730	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:155287395C>T	ENST00000357232.4	-	5	660	c.661G>A	c.(661-663)Gtg>Atg	p.V221M	DCHS2_ENST00000339452.1_Missense_Mutation_p.V815M	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	221	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGGGACGACACGTTTCCTGGA	0.458													c|||	2	0.000399361	0.0	0.0	5008	,	,		20605	0.002		0.0	False		,,,				2504	0.0						uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(661-663)GTG>ATG		dachsous 2 isoform 1							161.0	141.0	148.0					4																	155287395		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155287395C>T	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.661G>A	4.37:g.155287395C>T	ENSP00000349768:p.Val221Met		Somatic				DCHS2_uc003inx.2_Missense_Mutation_p.V815M	p.V221M	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	5	661	-	all_hematologic(180;0.208)	Renal(120;0.0854)	221			Cadherin 2.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.661G>A	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	c	1.232	-0.623789	0.03636	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.59772	0.24;0.61	5.69	2.62	0.31277	Cadherin (2);Cadherin-like (1);	1.042350	0.07660	N	0.933525	T	0.45135	0.1327	L	0.28556	0.865	0.09310	N	0.999999	B;B	0.32918	0.39;0.096	B;B	0.24155	0.051;0.007	T	0.26052	-1.0114	10	0.37606	T	0.19	.	13.086	0.59140	0.1045:0.1225:0.7731:0.0	.	815;221	E9PC11;Q6V1P9	.;PCD23_HUMAN	M	221;815;815	ENSP00000349768:V221M;ENSP00000345062:V815M	ENSP00000345062:V815M	V	-	1	0	DCHS2	155506845	0.003000	0.15002	0.610000	0.28997	0.012000	0.07955	-0.330000	0.07925	0.771000	0.33359	-1.369000	0.01192	GTG		0.458	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		5	21	0	0	0	0.001168	0	5	21				
RXFP1	59350	broad.mit.edu	37	4	159520580	159520580	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:159520580C>T	ENST00000307765.5	+	4	640	c.389C>T	c.(388-390)gCa>gTa	p.A130V	RXFP1_ENST00000460056.2_Missense_Mutation_p.A49V|RXFP1_ENST00000470033.1_Missense_Mutation_p.A97V|RXFP1_ENST00000423548.1_Missense_Mutation_p.A130V|RXFP1_ENST00000448688.2_Missense_Mutation_p.A49V|RXFP1_ENST00000343542.5_Missense_Mutation_p.A130V	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	130					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.A130E(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		AATGTGACTGCAATGTAAGTA	0.373																																							uc003ipz.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(388-390)GCA>GTA		relaxin/insulin-like family peptide receptor 1							108.0	94.0	98.0					4																	159520580		1863	4100	5963	SO:0001583	missense	59350					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr4:159520580C>T	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.389C>T	4.37:g.159520580C>T	ENSP00000303248:p.Ala130Val		Somatic				RXFP1_uc010iqj.1_5'UTR|RXFP1_uc011cja.1_Missense_Mutation_p.A49V|RXFP1_uc010iqo.2_Missense_Mutation_p.A130V|RXFP1_uc011cjb.1_Missense_Mutation_p.A76V|RXFP1_uc010iqk.2_5'UTR|RXFP1_uc011cjc.1_Missense_Mutation_p.A49V|RXFP1_uc011cjd.1_Missense_Mutation_p.A49V|RXFP1_uc010iql.2_5'UTR|RXFP1_uc011cje.1_Missense_Mutation_p.A157V|RXFP1_uc010iqm.2_Missense_Mutation_p.A97V|RXFP1_uc011cjf.1_5'UTR|RXFP1_uc010iqn.2_Missense_Mutation_p.A76V	p.A130V	NM_021634	NP_067647	WXS	Illumina HiSeq	Unspecified	Q9HBX9	RXFP1_HUMAN		COAD - Colon adenocarcinoma(41;0.0219)	4	471	+	all_hematologic(180;0.24)	Renal(120;0.0854)	130			Extracellular (Potential).		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	c.389C>T	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	C	7.558	0.664203	0.14710	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000423548;ENST00000448688;ENST00000343542;ENST00000470033	T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48	5.02	-1.18	0.09617	Leucine-rich repeat-containing N-terminal (1);	0.813676	0.11404	N	0.567549	T	0.20740	0.0499	N	0.02315	-0.6	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.005;0.003;0.002;0.002;0.003	T	0.23547	-1.0185	10	0.15499	T	0.54	.	5.5955	0.17325	0.3585:0.0739:0.0:0.5676	.	157;49;130;97;130	B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;Q9HBX9	.;.;.;.;RXFP1_HUMAN	V	49;130;130;49;130;97	ENSP00000423306:A49V;ENSP00000303248:A130V;ENSP00000405841:A130V;ENSP00000414885:A49V;ENSP00000345889:A130V;ENSP00000420712:A97V	ENSP00000303248:A130V	A	+	2	0	RXFP1	159740030	0.030000	0.19436	0.003000	0.11579	0.957000	0.61999	0.512000	0.22755	-0.388000	0.07797	-0.423000	0.05987	GCA		0.373	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634		4	17	0	0	0	0.009096	0	4	17				
FSTL5	56884	broad.mit.edu	37	4	162459355	162459355	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:162459355G>C	ENST00000306100.5	-	10	1711	c.1275C>G	c.(1273-1275)atC>atG	p.I425M	FSTL5_ENST00000427802.2_Missense_Mutation_p.I424M|FSTL5_ENST00000536695.1_Missense_Mutation_p.I424M|FSTL5_ENST00000379164.4_Missense_Mutation_p.I424M	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	425	Ig-like 2.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AAAGAGAAGAGATGTCTTCAT	0.423																																							uc003iqh.2		NA																	0				ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(1273-1275)ATC>ATG		follistatin-like 5 isoform a							253.0	230.0	238.0					4																	162459355		2203	4300	6503	SO:0001583	missense	56884					extracellular region	calcium ion binding	g.chr4:162459355G>C	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1275C>G	4.37:g.162459355G>C	ENSP00000305334:p.Ile425Met		Somatic				FSTL5_uc003iqi.2_Missense_Mutation_p.I424M|FSTL5_uc010iqv.2_Missense_Mutation_p.I424M	p.I425M	NM_020116	NP_064501	WXS	Illumina HiSeq	Unspecified	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	10	1711	-	all_hematologic(180;0.24)		425			Ig-like 2.		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	c.1275C>G	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761719	0.49468	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.27	2.64	0.31445	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.69260	0.3091	L	0.33245	0.995	0.51012	D	0.999908	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.91635	0.999;0.991;0.961	T	0.67440	-0.5670	10	0.72032	D	0.01	.	7.4446	0.27203	0.4322:0.0:0.5678:0.0	.	424;424;425	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	M	425;424;424;424	ENSP00000305334:I425M;ENSP00000368462:I424M;ENSP00000389270:I424M;ENSP00000440409:I424M	ENSP00000305334:I425M	I	-	3	3	FSTL5	162678805	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.354000	0.44098	0.317000	0.23160	-0.251000	0.11542	ATC		0.423	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		24	93	0	0	0	0.005443	0	24	93				
TLL1	7092	broad.mit.edu	37	4	166795155	166795155	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:166795155T>C	ENST00000061240.2	+	1	746	c.99T>C	c.(97-99)taT>taC	p.Y33Y	TLL1_ENST00000507499.1_Silent_p.Y33Y|TLL1_ENST00000513213.1_Silent_p.Y33Y	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	33					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GCCTCGATTATGATTACACTT	0.542																																							uc003irh.1		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(97-99)TAT>TAC		tolloid-like 1 precursor							206.0	212.0	210.0					4																	166795155		2203	4300	6503	SO:0001819	synonymous_variant	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:166795155T>C	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.99T>C	4.37:g.166795155T>C			Somatic				TLL1_uc011cjn.1_Silent_p.Y33Y|TLL1_uc011cjo.1_5'UTR	p.Y33Y	NM_012464	NP_036596	WXS	Illumina HiSeq	Unspecified	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	1	746	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	33					B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	37	c.99T>C	CCDS3811.1																																																																																				0.542	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			55	77	0	0	0	0.01441	0	55	77				
PLEKHG4B	153478	broad.mit.edu	37	5	143307	143307	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:143307G>T	ENST00000283426.6	+	2	605	c.555G>T	c.(553-555)caG>caT	p.Q185H	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	185							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TCCCCAGCCAGGTGCCCAAGC	0.672																																							uc003jak.2		NA																	0				skin(2)	2						c.(553-555)CAG>CAT		pleckstrin homology domain containing, family G							42.0	50.0	47.0					5																	143307		2202	4297	6499	SO:0001583	missense	153478				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr5:143307G>T	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.555G>T	5.37:g.143307G>T	ENSP00000283426:p.Gln185His		Somatic					p.Q185H	NM_052909	NP_443141	WXS	Illumina HiSeq	Unspecified	Q96PX9	PKH4B_HUMAN	all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)	2	605	+			185						Missense_Mutation	SNP	ENST00000283426.6	37	c.555G>T	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	.	7.958	0.746265	0.15710	.	.	ENSG00000153404	ENST00000283426;ENST00000502646	T;T	0.24723	1.84;1.84	2.39	1.44	0.22558	.	.	.	.	.	T	0.20618	0.0496	N	0.24115	0.695	0.09310	N	1	D	0.56521	0.976	P	0.50708	0.648	T	0.09164	-1.0687	9	0.45353	T	0.12	.	4.3993	0.11379	0.2092:0.0:0.7908:0.0	.	185	Q96PX9	PKH4B_HUMAN	H	185;99	ENSP00000283426:Q185H;ENSP00000422493:Q99H	ENSP00000283426:Q185H	Q	+	3	2	PLEKHG4B	196307	0.001000	0.12720	0.008000	0.14137	0.137000	0.21094	0.546000	0.23284	1.038000	0.40049	0.313000	0.20887	CAG		0.672	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909		29	25	1	0	1.88708e-17	0.008361	3.12382e-17	29	25				
CCDC127	133957	broad.mit.edu	37	5	205459	205459	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:205459C>A	ENST00000296824.3	-	3	868	c.736G>T	c.(736-738)Gaa>Taa	p.E246*		NM_145265.2	NP_660308.1	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127	246										breast(1)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12			all cancers(22;0.0236)|Lung(60;0.113)			TTCTTCAGTTCGACAACGAGT	0.438																																							uc003jam.1		NA																	0					0						c.(736-738)GAA>TAA		coiled-coil domain containing 127							86.0	91.0	89.0					5																	205459		2203	4300	6503	SO:0001587	stop_gained	133957							g.chr5:205459C>A	AK098567	CCDS3852.1	5p15.33	2008-02-05			ENSG00000164366	ENSG00000164366			30520	protein-coding gene	gene with protein product						12477932	Standard	NM_145265		Approved	FLJ25701	uc003jam.1	Q96BQ5	OTTHUMG00000161586	ENST00000296824.3:c.736G>T	5.37:g.205459C>A	ENSP00000296824:p.Glu246*		Somatic					p.E246*	NM_145265	NP_660308	WXS	Illumina HiSeq	Unspecified	Q96BQ5	CC127_HUMAN	all cancers(22;0.0236)|Lung(60;0.113)		3	836	-			246						Nonsense_Mutation	SNP	ENST00000296824.3	37	c.736G>T	CCDS3852.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249672	0.39797	.	.	ENSG00000164366	ENST00000296824	.	.	.	5.48	4.6	0.57074	.	0.261125	0.44483	D	0.000446	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-13.9149	14.0983	0.65037	0.0:0.8483:0.1517:0.0	.	.	.	.	X	246	.	ENSP00000296824:E246X	E	-	1	0	CCDC127	258459	0.686000	0.27661	0.052000	0.19188	0.005000	0.04900	1.212000	0.32394	1.305000	0.44909	0.561000	0.74099	GAA		0.438	CCDC127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365459.2	NM_145265		83	47	1	0	6.44939e-38	0.01441	1.19599e-37	83	47				
SLC12A7	10723	broad.mit.edu	37	5	1057703	1057703	+	Missense_Mutation	SNP	G	G	A	rs140477969		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:1057703G>A	ENST00000264930.5	-	22	2952	c.2909C>T	c.(2908-2910)gCg>gTg	p.A970V		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	970					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGTAGGCGGCGCTTGGGTCCT	0.632																																							uc003jbu.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(2908-2910)GCG>GTG		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)	G	VAL/ALA	0,4406		0,0,2203	128.0	123.0	125.0		2909	2.4	0.0	5	dbSNP_134	125	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC12A7	NM_006598.2	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	970/1084	1057703	1,13005	2203	4300	6503	SO:0001583	missense	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1057703G>A	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2909C>T	5.37:g.1057703G>A	ENSP00000264930:p.Ala970Val		Somatic					p.A970V	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		22	2975	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		970			Cytoplasmic (Potential).		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	c.2909C>T	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	G	5.734	0.319860	0.10845	0.0	1.16E-4	ENSG00000113504	ENST00000264930	T	0.44083	0.93	3.39	2.42	0.29668	.	0.544673	0.16988	U	0.191419	T	0.33059	0.0850	L	0.39397	1.21	0.18873	N	0.999988	B	0.11235	0.004	B	0.04013	0.001	T	0.30966	-0.9960	10	0.52906	T	0.07	.	10.9692	0.47431	0.0:0.0:0.8141:0.1859	.	970	Q9Y666	S12A7_HUMAN	V	970	ENSP00000264930:A970V	ENSP00000264930:A970V	A	-	2	0	SLC12A7	1110703	0.129000	0.22400	0.012000	0.15200	0.008000	0.06430	1.892000	0.39748	1.622000	0.50330	0.491000	0.48974	GCG		0.632	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		54	187	0	0	0	0.01441	0	54	187				
CLPTM1L	81037	broad.mit.edu	37	5	1323984	1323984	+	Splice_Site	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:1323984C>A	ENST00000320895.5	-	12	1455	c.1198G>T	c.(1198-1200)Gcc>Tcc	p.A400S	CLPTM1L_ENST00000506641.1_5'UTR|CLPTM1L_ENST00000507807.1_Splice_Site_p.A231S|CLPTM1L_ENST00000320927.6_Splice_Site_p.A364S	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	400					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		TACTTCATGGCCTGCAGGGAA	0.532																																							uc003jch.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1198-1200)GCC>TCC		CLPTM1-like							66.0	59.0	61.0					5																	1323984		2203	4300	6503	SO:0001630	splice_region_variant	81037				apoptosis	integral to membrane		g.chr5:1323984C>A	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1198-1G>T	5.37:g.1323984C>A			Somatic				CLPTM1L_uc003jcg.2_Missense_Mutation_p.A231S	p.A400S	NM_030782	NP_110409	WXS	Illumina HiSeq	Unspecified	Q96KA5	CLP1L_HUMAN	Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)	12	1244	-	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		400			Cytoplasmic (Potential).		D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	c.1198G>T	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.268873	0.59540	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.58210	0.35;0.56;0.53	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.67683	0.2919	M	0.72894	2.215	0.80722	D	1	D;D	0.67145	0.988;0.996	P;P	0.59761	0.863;0.858	T	0.70842	-0.4762	10	0.48119	T	0.1	-38.5886	16.1501	0.81611	0.0:1.0:0.0:0.0	.	400;231	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	S	400;231;364	ENSP00000313854:A400S;ENSP00000423321:A231S;ENSP00000315196:A364S	ENSP00000313854:A400S	A	-	1	0	CLPTM1L	1376984	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	7.065000	0.76727	2.089000	0.63090	0.491000	0.48974	GCC		0.532	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	Missense_Mutation	57	32	1	0	2.02627e-32	0.01441	3.69905e-32	57	32				
ICE1	23379	broad.mit.edu	37	5	5463945	5463945	+	Missense_Mutation	SNP	G	G	T	rs373732140		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:5463945G>T	ENST00000296564.7	+	13	4720	c.4498G>T	c.(4498-4500)Ggt>Tgt	p.G1500C		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1500					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TTCAAGCAGTGGTCAGAGCAC	0.458																																							uc003jdm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(4498-4500)GGT>TGT		hypothetical protein LOC23379		G	CYS/GLY	1,3825		0,1,1912	58.0	56.0	56.0		4498	1.5	0.0	5		56	0,8258		0,0,4129	no	missense	KIAA0947	NM_015325.1	159	0,1,6041	TT,TG,GG		0.0,0.0261,0.0083	probably-damaging	1500/2267	5463945	1,12083	1913	4129	6042	SO:0001583	missense	23379							g.chr5:5463945G>T																												ENST00000296564.7:c.4498G>T	5.37:g.5463945G>T	ENSP00000296564:p.Gly1500Cys		Somatic					p.G1500C	NM_015325	NP_056140	WXS	Illumina HiSeq	Unspecified	Q9Y2F5	K0947_HUMAN			13	4720	+			1500					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.4498G>T	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877866	0.51801	2.61E-4	0.0	ENSG00000164151	ENST00000296564	T	0.15256	2.44	5.38	1.51	0.23008	.	.	.	.	.	T	0.23014	0.0556	N	0.24115	0.695	0.09310	N	1	D	0.76494	0.999	D	0.68483	0.958	T	0.12477	-1.0546	9	0.87932	D	0	-8.0124	7.2958	0.26393	0.3813:0.0:0.6187:0.0	.	1500	Q9Y2F5	K0947_HUMAN	C	1500	ENSP00000296564:G1500C	ENSP00000296564:G1500C	G	+	1	0	KIAA0947	5516945	0.001000	0.12720	0.000000	0.03702	0.965000	0.64279	0.461000	0.21940	-0.010000	0.14271	0.460000	0.39030	GGT		0.458	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			3	50	1	0	0.00024832	0.009096	0.000280918	3	50				
MTRR	4552	broad.mit.edu	37	5	7873601	7873601	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:7873601C>T	ENST00000264668.2	+	3	356	c.326C>T	c.(325-327)cCg>cTg	p.P109L	MTRR_ENST00000440940.2_Missense_Mutation_p.P82L|MTRR_ENST00000341013.6_Intron|MTRR_ENST00000502509.1_Intron	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	109	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CAAACACTGCCGGTTGATTTC	0.458																																							uc003jed.2		NA																	0				ovary(1)	1						c.(325-327)CCG>CTG		methionine synthase reductase isoform 2	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)						145.0	150.0	149.0					5																	7873601		2203	4300	6503	SO:0001583	missense	4552				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding	g.chr5:7873601C>T	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.326C>T	5.37:g.7873601C>T	ENSP00000264668:p.Pro109Leu		Somatic				MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Missense_Mutation_p.P82L|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_RNA	p.P109L	NM_024010	NP_076915	WXS	Illumina HiSeq	Unspecified	Q9UBK8	MTRR_HUMAN			3	356	+			109			Flavodoxin-like.		O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	c.326C>T	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	C	35	5.535606	0.96460	.	.	ENSG00000124275	ENST00000264668;ENST00000440940;ENST00000502550;ENST00000512217	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.67	5.67	0.87782	Flavodoxin/nitric oxide synthase (2);	0.168313	0.53938	D	0.000046	T	0.77465	0.4134	M	0.87381	2.88	0.80722	D	1	D	0.69078	0.997	P	0.57960	0.83	T	0.80388	-0.1403	10	0.56958	D	0.05	-30.2387	19.773	0.96379	0.0:1.0:0.0:0.0	.	109	Q9UBK8	MTRR_HUMAN	L	109;82;82;82	ENSP00000264668:P109L;ENSP00000402510:P82L;ENSP00000424599:P82L;ENSP00000421318:P82L	ENSP00000264668:P109L	P	+	2	0	MTRR	7926601	0.999000	0.42202	0.924000	0.36721	0.986000	0.74619	4.668000	0.61568	2.677000	0.91161	0.655000	0.94253	CCG		0.458	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			22	123	0	0	0	0.005443	0	22	123				
ANKH	56172	broad.mit.edu	37	5	14769250	14769250	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:14769250C>A	ENST00000284268.6	-	2	477	c.147G>T	c.(145-147)ctG>ctT	p.L49L		NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	49					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						CGTAGCTGGCCAGCATCTCGA	0.522																																							uc003jfm.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(145-147)CTG>CTT		progressive ankylosis protein							45.0	44.0	44.0					5																	14769250		2203	4300	6503	SO:0001819	synonymous_variant	56172				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity	g.chr5:14769250C>A	AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.147G>T	5.37:g.14769250C>A			Somatic					p.L49L	NM_054027	NP_473368	WXS	Illumina HiSeq	Unspecified	Q9HCJ1	ANKH_HUMAN			2	478	-			49			Cytoplasmic (Potential).		B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Silent	SNP	ENST00000284268.6	37	c.147G>T	CCDS3885.1																																																																																				0.522	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207063.1	NM_054027		6	52	1	0	5.9392e-07	0.001168	7.54961e-07	6	52				
MARCH11	441061	broad.mit.edu	37	5	16091127	16091127	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:16091127G>C	ENST00000332432.8	-	3	956	c.757C>G	c.(757-759)Ctg>Gtg	p.L253V	MARCH11_ENST00000505509.1_5'UTR	NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	253					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						ATTAAGAACAGGGATCCTAGG	0.448																																							uc003jfo.2		NA																	0					0						c.(757-759)CTG>GTG		membrane-associated ring finger (C3HC4) 11							74.0	73.0	73.0					5																	16091127		1927	4127	6054	SO:0001583	missense	441061					cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding	g.chr5:16091127G>C	BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.757C>G	5.37:g.16091127G>C	ENSP00000333181:p.Leu253Val		Somatic				MARCH11_uc010itw.1_Missense_Mutation_p.L9V	p.L253V	NM_001102562	NP_001096032	WXS	Illumina HiSeq	Unspecified	A6NNE9	MARHB_HUMAN			3	970	-			253			Helical; (Potential).		A7E2S6	Missense_Mutation	SNP	ENST00000332432.8	37	c.757C>G	CCDS47192.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311839	0.60414	.	.	ENSG00000183654	ENST00000332432	T	0.58652	0.32	5.52	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.72028	0.3410	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.71467	-0.4584	10	0.37606	T	0.19	-12.7919	14.3598	0.66764	0.0714:0.0:0.9286:0.0	.	253	A6NNE9	MARHB_HUMAN	V	253	ENSP00000333181:L253V	ENSP00000333181:L253V	L	-	1	2	MARCH11	16144127	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.192000	0.58378	1.348000	0.45733	-0.152000	0.13540	CTG		0.448	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000366096.2	NM_001102562		13	9	0	0	0	0.00499	0	13	9				
CDH18	1016	broad.mit.edu	37	5	19520842	19520842	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:19520842A>G	ENST00000507958.1	-	12	2426	c.1436T>C	c.(1435-1437)cTg>cCg	p.L479P	CDH18_ENST00000506372.1_Missense_Mutation_p.L479P|CDH18_ENST00000274170.4_Missense_Mutation_p.L479P|CDH18_ENST00000382275.1_Missense_Mutation_p.L479P|CDH18_ENST00000511273.1_Missense_Mutation_p.L479P|CDH18_ENST00000502796.1_Missense_Mutation_p.L479P			Q13634	CAD18_HUMAN	cadherin 18, type 2	479	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ATTGACATCCAGAACTCTAAT	0.408																																							uc003jgc.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(1435-1437)CTG>CCG		cadherin 18, type 2 preproprotein							155.0	153.0	153.0					5																	19520842		2203	4300	6503	SO:0001583	missense	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19520842A>G	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1436T>C	5.37:g.19520842A>G	ENSP00000425093:p.Leu479Pro		Somatic				CDH18_uc003jgd.2_Missense_Mutation_p.L479P|CDH18_uc011cnm.1_Missense_Mutation_p.L479P	p.L479P	NM_004934	NP_004925	WXS	Illumina HiSeq	Unspecified	Q13634	CAD18_HUMAN			9	1813	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		479			Extracellular (Potential).|Cadherin 4.		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	c.1436T>C	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.712466	0.68730	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000511273	T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46	5.22	5.22	0.72569	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.82323	0.5012	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.88801	0.3285	9	.	.	.	.	14.212	0.65771	1.0:0.0:0.0:0.0	.	479;479	B4DHG6;Q13634	.;CAD18_HUMAN	P	479	ENSP00000371710:L479P;ENSP00000425093:L479P;ENSP00000274170:L479P;ENSP00000424931:L479P;ENSP00000422138:L479P;ENSP00000425854:L479P	.	L	-	2	0	CDH18	19556599	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.675000	0.84002	2.102000	0.63906	0.528000	0.53228	CTG		0.408	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		32	231	0	0	0	0.00623	0	32	231				
C7	730	broad.mit.edu	37	5	40955492	40955492	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:40955492C>T	ENST00000313164.9	+	10	1456	c.1097C>T	c.(1096-1098)aCc>aTc	p.T366I		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	366	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TGTATAGGAACCCAGAACAAT	0.403																																							uc003jmh.2		NA																	0					0						c.(1096-1098)ACC>ATC		complement component 7 precursor							120.0	118.0	118.0					5																	40955492		1848	4098	5946	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40955492C>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1097C>T	5.37:g.40955492C>T	ENSP00000322061:p.Thr366Ile		Somatic				C7_uc011cpn.1_RNA	p.T366I	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			10	1211	+		Ovarian(839;0.0112)	366			MACPF.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.1097C>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066102	0.36470	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	D	0.84442	-1.85	5.26	2.29	0.28610	Membrane attack complex component/perforin (MACPF) domain (3);	1.307600	0.05074	N	0.482200	D	0.85013	0.5600	L	0.41824	1.3	0.09310	N	1	P	0.50819	0.939	P	0.52386	0.697	T	0.69533	-0.5120	10	0.21014	T	0.42	-5.7265	9.5797	0.39479	0.2355:0.4609:0.3036:0.0	.	366	P10643	CO7_HUMAN	I	366;206	ENSP00000322061:T366I	ENSP00000322061:T366I	T	+	2	0	C7	40991249	0.000000	0.05858	0.272000	0.24630	0.034000	0.12701	-0.390000	0.07332	0.221000	0.20879	0.655000	0.94253	ACC		0.403	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			22	132	0	0	0	0.005443	0	22	132				
PIK3R1	5295	broad.mit.edu	37	5	67576452	67576452	+	Nonsense_Mutation	SNP	T	T	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:67576452T>G	ENST00000521381.1	+	6	1347	c.731T>G	c.(730-732)tTa>tGa	p.L244*	PIK3R1_ENST00000274335.5_Nonsense_Mutation_p.L244*|PIK3R1_ENST00000396611.1_Nonsense_Mutation_p.L244*|PIK3R1_ENST00000521657.1_Nonsense_Mutation_p.L244*	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	244	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	CAGTATTTGTTAAAACATTTC	0.383			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																													uc003jva.2		NA		Rec	yes		5	5q13.1	5295	Mis|F|O	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""			"""E, O"""			gliobastoma|ovarian|colorectal		2	Whole gene deletion(1)|Unknown(1)	p.?(1)	large_intestine(1)|lung(1)	endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101						c.(730-732)TTA>TGA		phosphoinositide-3-kinase, regulatory subunit 1	Isoproterenol(DB01064)						107.0	117.0	114.0					5																	67576452		2203	4300	6503	SO:0001587	stop_gained	5295				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	g.chr5:67576452T>G	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.731T>G	5.37:g.67576452T>G	ENSP00000428056:p.Leu244*	TCGA GBM(4;<1E-08)	Somatic				PIK3R1_uc003jvb.2_Nonsense_Mutation_p.L244*	p.L244*	NM_181523	NP_852664	WXS	Illumina HiSeq	Unspecified	P27986	P85A_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	6	1291	+		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)	244			Rho-GAP.		B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Nonsense_Mutation	SNP	ENST00000521381.1	37	c.731T>G	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	T	37	6.034244	0.97221	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335	.	.	.	5.79	5.79	0.91817	.	0.148407	0.46145	D	0.000303	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5003	16.1296	0.81418	0.0:0.0:0.0:1.0	.	.	.	.	X	244	.	ENSP00000274335:L244X	L	+	2	0	PIK3R1	67612208	1.000000	0.71417	0.943000	0.38184	0.996000	0.88848	7.499000	0.81566	2.216000	0.71823	0.379000	0.24179	TTA		0.383	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504		5	48	0	0	0	0.001984	0	5	48				
WDR36	134430	broad.mit.edu	37	5	110428091	110428091	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:110428091G>A	ENST00000513710.2	+	1	109	c.105G>A	c.(103-105)ctG>ctA	p.L35L	WDR36_ENST00000506538.2_Silent_p.L35L|CTC-551A13.2_ENST00000507269.3_RNA|WDR36_ENST00000505303.1_5'UTR			Q8NI36	WDR36_HUMAN	WD repeat domain 36	35					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TAGACACGCTGAAGGGACTGG	0.632																																							uc003kpd.2		NA																	0				ovary(1)|skin(1)	2						c.(103-105)CTG>CTA		WD repeat domain 36							65.0	72.0	69.0					5																	110428091		2202	4300	6502	SO:0001819	synonymous_variant	134430				response to stimulus|rRNA processing|visual perception	small-subunit processome		g.chr5:110428091G>A	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.105G>A	5.37:g.110428091G>A			Somatic				WDR36_uc010jbu.2_RNA	p.L35L	NM_139281	NP_644810	WXS	Illumina HiSeq	Unspecified	Q8NI36	WDR36_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)	1	222	+		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)	35					A2RUS4|Q68E02|Q8N1Q2	Silent	SNP	ENST00000513710.2	37	c.105G>A	CCDS4102.1																																																																																				0.632	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281		30	16	0	0	0	0.010818	0	30	16				
CAMK4	814	broad.mit.edu	37	5	110679794	110679794	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:110679794G>T	ENST00000282356.4	+	2	632	c.234G>T	c.(232-234)aaG>aaT	p.K78N	CAMK4_ENST00000512453.1_Missense_Mutation_p.K78N	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	78	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AAGTGTTAAAGAAAACAGTAA	0.438																																							uc011cvj.1		NA																	0				ovary(3)|lung(2)	5						c.(232-234)AAG>AAT		calcium/calmodulin-dependent protein kinase IV							105.0	110.0	109.0					5																	110679794		2202	4299	6501	SO:0001583	missense	814				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr5:110679794G>T	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.234G>T	5.37:g.110679794G>T	ENSP00000282356:p.Lys78Asn		Somatic				CAMK4_uc003kpf.2_Missense_Mutation_p.K78N|CAMK4_uc010jbv.2_5'UTR	p.K78N	NM_001744	NP_001735	WXS	Illumina HiSeq	Unspecified	Q16566	KCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)	3	333	+		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)	78			Protein kinase.		D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	c.234G>T	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.200449	0.38905	.	.	ENSG00000152495	ENST00000508074;ENST00000512453;ENST00000282356	T;T;T	0.67345	-0.26;-0.26;-0.26	6.16	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	N	0.05199	-0.095	0.51482	D	0.999929	P	0.44816	0.844	B	0.37888	0.26	T	0.51180	-0.8738	10	0.02654	T	1	.	10.8744	0.46902	0.0709:0.1306:0.7985:0.0	.	78	Q16566	KCC4_HUMAN	N	78	ENSP00000426940:K78N;ENSP00000422634:K78N;ENSP00000282356:K78N	ENSP00000282356:K78N	K	+	3	2	CAMK4	110707693	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.365000	0.52335	1.629000	0.50426	-0.143000	0.13931	AAG		0.438	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		6	19	1	0	2.0095e-06	0.001984	2.47388e-06	6	19				
ISOC1	51015	broad.mit.edu	37	5	128430635	128430635	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:128430635G>A	ENST00000173527.5	+	1	192	c.176G>A	c.(175-177)gGc>gAc	p.G59D	MIR4633_ENST00000584064.1_RNA	NM_016048.2	NP_057132.2	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	59						extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	catalytic activity (GO:0003824)			kidney(2)|lung(7)	9		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		AGCCTGTACGGCGACCAGATC	0.637																																							uc003kva.2		NA																	0					0						c.(175-177)GGC>GAC		isochorismatase domain containing 1							35.0	41.0	39.0					5																	128430635		2039	4180	6219	SO:0001583	missense	51015					peroxisome	catalytic activity	g.chr5:128430635G>A	AF151869	CCDS43357.1	5q22.1-q33.3	2010-03-19			ENSG00000066583	ENSG00000066583			24254	protein-coding gene	gene with protein product						10810093, 18566572	Standard	NM_016048		Approved	CGI-111	uc003kva.3	Q96CN7	OTTHUMG00000163144	ENST00000173527.5:c.176G>A	5.37:g.128430635G>A	ENSP00000173527:p.Gly59Asp		Somatic					p.G59D	NM_016048	NP_057132	WXS	Illumina HiSeq	Unspecified	Q96CN7	ISOC1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)	1	194	+		all_cancers(142;0.0813)|Prostate(80;0.0865)	59					Q7Z770	Missense_Mutation	SNP	ENST00000173527.5	37	c.176G>A	CCDS43357.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564736	0.86439	.	.	ENSG00000066583	ENST00000506986;ENST00000514194;ENST00000173527;ENST00000513879	.	.	.	4.05	4.05	0.47172	.	0.000000	0.64402	D	0.000002	T	0.64681	0.2620	L	0.29908	0.895	0.51233	D	0.999917	D	0.76494	0.999	D	0.79108	0.992	T	0.63761	-0.6564	8	.	.	.	-13.7185	16.7385	0.85453	0.0:0.0:1.0:0.0	.	59	Q96CN7	ISOC1_HUMAN	D	38;59;59;50	.	.	G	+	2	0	ISOC1	128458534	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	7.072000	0.76777	2.242000	0.73789	0.205000	0.17691	GGC		0.637	ISOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371826.1	NM_016048		15	7	0	0	0	0.00499	0	15	7				
BRD8	10902	broad.mit.edu	37	5	137495798	137495798	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:137495798C>T	ENST00000254900.5	-	19	2863	c.2492G>A	c.(2491-2493)cGa>cAa	p.R831Q	BRD8_ENST00000411594.2_Missense_Mutation_p.R834Q|BRD8_ENST00000455658.2_Missense_Mutation_p.R790Q|BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000402931.1_Missense_Mutation_p.R831Q|BRD8_ENST00000230901.5_Missense_Mutation_p.R904Q	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	831					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATCTCTCCCTCGAAGACTTTT	0.502																																							uc003lcf.1		NA																	0				ovary(1)	1						c.(2491-2493)CGA>CAA		bromodomain containing 8 isoform 2							164.0	148.0	153.0					5																	137495798		2203	4300	6503	SO:0001583	missense	10902				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity	g.chr5:137495798C>T	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.2492G>A	5.37:g.137495798C>T	ENSP00000254900:p.Arg831Gln		Somatic				BRD8_uc003lcc.1_RNA|BRD8_uc011cyl.1_Missense_Mutation_p.R610Q|BRD8_uc003lcg.2_Missense_Mutation_p.R904Q|BRD8_uc003lci.2_Missense_Mutation_p.R834Q|BRD8_uc003lch.2_Missense_Mutation_p.R725Q|BRD8_uc011cym.1_Missense_Mutation_p.R815Q|BRD8_uc010jer.1_Missense_Mutation_p.R800Q|BRD8_uc011cyn.1_Missense_Mutation_p.R790Q	p.R831Q	NM_139199	NP_631938	WXS	Illumina HiSeq	Unspecified	Q9H0E9	BRD8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		19	2547	-			831					O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	c.2492G>A	CCDS4198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.473563|5.473563	0.96291|0.96291	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000441656|ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658	.|T;T;T;T;T;T;T	.|0.35789	.|1.59;1.29;1.3;1.37;1.35;1.3;1.34	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.50616|0.50616	0.1626|0.1626	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.993;1.0;1.0;1.0;1.0	.|D;D;D;P;D;D;D;D	.|0.79108	.|0.988;0.951;0.951;0.881;0.978;0.955;0.97;0.992	T|T	0.51537|0.51537	-0.8693|-0.8693	5|10	.|0.72032	.|D	.|0.01	-5.234|-5.234	17.4533|17.4533	0.87599|0.87599	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|790;815;610;904;834;725;904;831	.|F8W820;B4DN43;B4DMS9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9	.|.;.;.;.;.;.;.;BRD8_HUMAN	K|Q	825|831;860;829;904;831;834;725;790	.|ENSP00000254900:R831Q;ENSP00000398067:R860Q;ENSP00000398873:R829Q;ENSP00000230901:R904Q;ENSP00000384845:R831Q;ENSP00000394330:R834Q;ENSP00000408396:R790Q	.|ENSP00000230901:R904Q	E|R	-|-	1|2	0|0	BRD8|BRD8	137523697|137523697	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.477000|7.477000	0.81069|0.81069	2.704000|2.704000	0.92352|0.92352	0.561000|0.561000	0.74099|0.74099	GAG|CGA		0.502	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696		12	87	0	0	0	0.003163	0	12	87				
PSD2	84249	broad.mit.edu	37	5	139218323	139218323	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:139218323C>A	ENST00000274710.3	+	13	2139	c.1934C>A	c.(1933-1935)cCc>cAc	p.P645H		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	645					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTGTCGGCCCCTGCTGCCC	0.622																																							uc003leu.1		NA																	0				ovary(1)	1						c.(1933-1935)CCC>CAC		pleckstrin and Sec7 domain containing 2							55.0	52.0	53.0					5																	139218323		2203	4300	6503	SO:0001583	missense	84249				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr5:139218323C>A	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1934C>A	5.37:g.139218323C>A	ENSP00000274710:p.Pro645His		Somatic					p.P645H	NM_032289	NP_115665	WXS	Illumina HiSeq	Unspecified	Q9BQI7	PSD2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		13	2139	+			645					D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	c.1934C>A	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853861	0.91355	.	.	ENSG00000146005	ENST00000274710	D	0.81739	-1.53	5.06	5.06	0.68205	.	0.053889	0.85682	D	0.000000	D	0.91171	0.7219	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92619	0.6106	10	0.87932	D	0	.	18.796	0.91994	0.0:1.0:0.0:0.0	.	645	Q9BQI7	PSD2_HUMAN	H	645	ENSP00000274710:P645H	ENSP00000274710:P645H	P	+	2	0	PSD2	139198507	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.744000	0.85034	2.514000	0.84764	0.561000	0.74099	CCC		0.622	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289		14	22	1	0	1.01871e-10	0.008871	1.48499e-10	14	22				
PSD2	84249	broad.mit.edu	37	5	139218355	139218355	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:139218355C>A	ENST00000274710.3	+	13	2171	c.1966C>A	c.(1966-1968)Cag>Aag	p.Q656K		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	656					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCCTCTGCCAGGTACATGT	0.652																																							uc003leu.1		NA																	0				ovary(1)	1						c.(1966-1968)CAG>AAG		pleckstrin and Sec7 domain containing 2							38.0	39.0	39.0					5																	139218355		2203	4300	6503	SO:0001583	missense	84249				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr5:139218355C>A	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1966C>A	5.37:g.139218355C>A	ENSP00000274710:p.Gln656Lys		Somatic					p.Q656K	NM_032289	NP_115665	WXS	Illumina HiSeq	Unspecified	Q9BQI7	PSD2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		13	2171	+			656			Potential.		D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	c.1966C>A	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038417	0.55003	.	.	ENSG00000146005	ENST00000274710	T	0.12984	2.63	5.06	4.17	0.49024	.	0.115715	0.64402	D	0.000010	T	0.20577	0.0495	M	0.77820	2.39	0.58432	D	0.999997	B	0.20780	0.048	B	0.13407	0.009	T	0.03112	-1.1071	10	0.42905	T	0.14	.	15.6809	0.77367	0.0:0.8625:0.1375:0.0	.	656	Q9BQI7	PSD2_HUMAN	K	656	ENSP00000274710:Q656K	ENSP00000274710:Q656K	Q	+	1	0	PSD2	139198539	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	5.870000	0.69620	1.223000	0.43536	0.561000	0.74099	CAG		0.652	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289		17	19	1	0	1.9806e-07	0.014323	2.5621e-07	17	19				
PCDHB12	56124	broad.mit.edu	37	5	140589465	140589465	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:140589465G>T	ENST00000239450.2	+	1	1175	c.986G>T	c.(985-987)gGa>gTa	p.G329V	PCDHB12_ENST00000541609.1_5'UTR	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	329	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGACTTTTTGGAAAATCTACA	0.408																																							uc003liz.2		NA																	0				skin(2)|ovary(1)	3						c.(985-987)GGA>GTA		protocadherin beta 12 precursor							76.0	77.0	77.0					5																	140589465		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589465G>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.986G>T	5.37:g.140589465G>T	ENSP00000239450:p.Gly329Val		Somatic				PCDHB12_uc011dak.1_5'UTR	p.G329V	NM_018932	NP_061755	WXS	Illumina HiSeq	Unspecified	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1175	+			329			Extracellular (Potential).|Cadherin 3.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.986G>T	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248577	0.39797	.	.	ENSG00000120328	ENST00000239450	T	0.01705	4.68	4.06	3.16	0.36331	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.10121	0.0248	M	0.85542	2.76	0.19575	N	0.999963	D	0.56746	0.977	P	0.62560	0.904	T	0.03433	-1.1037	9	0.56958	D	0.05	.	13.2235	0.59903	0.0:0.4482:0.5518:0.0	.	329	Q9Y5F1	PCDBC_HUMAN	V	329	ENSP00000239450:G329V	ENSP00000239450:G329V	G	+	2	0	PCDHB12	140569649	0.000000	0.05858	0.598000	0.28837	0.906000	0.53458	0.887000	0.28254	0.789000	0.33779	0.491000	0.48974	GGA		0.408	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		23	14	1	0	3.08376e-08	0.00333	4.0977e-08	23	14				
PCDHGA5	56110	broad.mit.edu	37	5	140743982	140743982	+	Missense_Mutation	SNP	G	G	A	rs368621667		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:140743982G>A	ENST00000518069.1	+	1	85	c.85G>A	c.(85-87)Ggg>Agg	p.G29R	PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	29					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAGGATCCGGGCAGATCCG	0.662																																							uc003lju.1		NA																	0				ovary(4)	4						c.(85-87)GGG>AGG		protocadherin gamma subfamily A, 5 isoform 1							31.0	40.0	37.0					5																	140743982		2153	4283	6436	SO:0001583	missense	56110				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140743982G>A	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.85G>A	5.37:g.140743982G>A	ENSP00000429834:p.Gly29Arg		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.G29R	p.G29R	NM_018918	NP_061741	WXS	Illumina HiSeq	Unspecified	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	85	+			29					Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	c.85G>A	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	12.18	1.861861	0.32884	.	.	ENSG00000253485	ENST00000518069	T	0.28895	1.59	5.17	3.32	0.38043	Cadherin, N-terminal (1);	.	.	.	.	T	0.41488	0.1161	M	0.86502	2.82	0.23391	N	0.997776	B;B	0.28258	0.191;0.205	B;B	0.30029	0.063;0.11	T	0.34950	-0.9808	9	0.49607	T	0.09	.	11.9445	0.52920	0.0:0.1322:0.7302:0.1375	.	29;29	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	R	29	ENSP00000429834:G29R	ENSP00000429834:G29R	G	+	1	0	PCDHGA5	140724166	.	.	0.697000	0.30258	0.668000	0.39293	.	.	0.645000	0.30675	0.558000	0.71614	GGG		0.662	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		10	9	0	0	0	0.006214	0	10	9				
PCDHGA6	56109	broad.mit.edu	37	5	140753830	140753830	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:140753830G>A	ENST00000517434.1	+	1	180	c.180G>A	c.(178-180)gcG>gcA	p.A60A	PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A60A(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAGTTGGCGGAGCACGGAG	0.602																																							uc003ljy.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(178-180)GCG>GCA		protocadherin gamma subfamily A, 6 isoform 1							47.0	54.0	52.0					5																	140753830		2198	4300	6498	SO:0001819	synonymous_variant	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140753830G>A	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.180G>A	5.37:g.140753830G>A			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.A60A	p.A60A	NM_018919	NP_061742	WXS	Illumina HiSeq	Unspecified	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	180	+			60			Cadherin 1.|Extracellular (Potential).		A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	c.180G>A	CCDS54926.1																																																																																				0.602	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		14	19	0	0	0	0.003163	0	14	19				
PCDHGB4	8641	broad.mit.edu	37	5	140768185	140768185	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:140768185A>C	ENST00000519479.1	+	1	734	c.734A>C	c.(733-735)gAc>gCc	p.D245A	PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	245	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAGTCAAGACGTATACAGG	0.522																																							uc003lkc.1		NA																	0					0						c.(733-735)GAC>GCC		protocadherin gamma subfamily B, 4 isoform 1							184.0	184.0	184.0					5																	140768185		2042	4209	6251	SO:0001583	missense	8641				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140768185A>C	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.734A>C	5.37:g.140768185A>C	ENSP00000428288:p.Asp245Ala		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.D245A	p.D245A	NM_003736	NP_003727	WXS	Illumina HiSeq	Unspecified	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	734	+			245			Cadherin 3.|Extracellular (Potential).		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	37	c.734A>C	CCDS54928.1	.	.	.	.	.	.	.	.	.	.	.	2.045	-0.419086	0.04766	.	.	ENSG00000253953	ENST00000519479	T	0.01821	4.62	4.99	4.99	0.66335	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.01940	0.0061	N	0.17379	0.485	0.09310	N	1	P;P	0.38250	0.624;0.491	P;B	0.47299	0.543;0.341	T	0.47824	-0.9087	9	0.09338	T	0.73	.	7.1137	0.25405	0.6986:0.2228:0.0785:0.0	.	245;245	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	A	245	ENSP00000428288:D245A	ENSP00000428288:D245A	D	+	2	0	PCDHGB4	140748369	0.000000	0.05858	0.119000	0.21687	0.018000	0.09664	0.717000	0.25851	1.998000	0.58463	0.533000	0.62120	GAC		0.522	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		5	170	0	0	0	0.001984	0	5	170				
RARS	5917	broad.mit.edu	37	5	167943881	167943881	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:167943881C>G	ENST00000231572.3	+	13	1605	c.1551C>G	c.(1549-1551)atC>atG	p.I517M	RARS_ENST00000538719.1_Missense_Mutation_p.I311M	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	517					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		ATGACTACATCTTCTCCTTTG	0.418																																							uc003lzx.2		NA																	0				ovary(2)|skin(1)	3						c.(1549-1551)ATC>ATG		arginyl-tRNA synthetase							210.0	200.0	203.0					5																	167943881		2203	4300	6503	SO:0001583	missense	5917				arginyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	arginine-tRNA ligase activity|ATP binding|protein binding	g.chr5:167943881C>G	BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1551C>G	5.37:g.167943881C>G	ENSP00000231572:p.Ile517Met		Somatic				RARS_uc011deo.1_Missense_Mutation_p.I311M	p.I517M	NM_002887	NP_002878	WXS	Illumina HiSeq	Unspecified	P54136	SYRC_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)	13	1592	+	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	517					B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	ENST00000231572.3	37	c.1551C>G	CCDS4367.1	.	.	.	.	.	.	.	.	.	.	c	18.95	3.731354	0.69189	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	T;T	0.64438	-0.08;-0.1	5.97	5.09	0.68999	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.155151	0.64402	D	0.000019	T	0.73806	0.3634	M	0.79926	2.475	0.48632	D	0.999686	B	0.32302	0.363	P	0.46825	0.528	T	0.75706	-0.3224	10	0.62326	D	0.03	-9.386	11.9497	0.52948	0.2421:0.6411:0.1168:0.0	.	517	P54136	SYRC_HUMAN	M	517;311	ENSP00000231572:I517M;ENSP00000439108:I311M	ENSP00000231572:I517M	I	+	3	3	RARS	167876459	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	1.549000	0.36212	1.508000	0.48769	0.651000	0.88453	ATC		0.418	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887		29	97	0	0	0	0.003755	0	29	97				
CDYL	9425	broad.mit.edu	37	6	4735027	4735027	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:4735027C>A	ENST00000328908.5	+	3	266	c.135C>A	c.(133-135)agC>agA	p.S45R				Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	45					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CAGACCCCAGCATCTCCGTGA	0.557																																							uc003mwi.2		NA																	0					0						c.(133-135)AGC>AGA		chromodomain protein, Y chromosome-like isoform							88.0	86.0	87.0					6																	4735027		2203	4300	6503	SO:0001583	missense	9425				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity	g.chr6:4735027C>A	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.135C>A	6.37:g.4735027C>A	ENSP00000330512:p.Ser45Arg		Somatic					p.S45R	NM_001143971	NP_001137443	WXS	Illumina HiSeq	Unspecified	Q9Y232	CDYL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.182)	3	266	+	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)	45					A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	ENST00000328908.5	37	c.135C>A		.	.	.	.	.	.	.	.	.	.	C	3.714	-0.058941	0.07317	.	.	ENSG00000153046	ENST00000328908	T	0.46063	0.88	1.2	-0.893	0.10567	.	.	.	.	.	T	0.10294	0.0252	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.01281	0.0	T	0.30937	-0.9961	8	0.54805	T	0.06	.	3.4661	0.07550	0.0:0.4423:0.0:0.5577	.	45	Q9Y232	CDYL1_HUMAN	R	45	ENSP00000330512:S45R	ENSP00000330512:S45R	S	+	3	2	CDYL	4680026	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.861000	0.04268	-0.246000	0.09611	0.591000	0.81541	AGC		0.557	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824		19	48	1	0	2.89027e-11	0.014323	4.28784e-11	19	48				
LRRC16A	55604	broad.mit.edu	37	6	25466175	25466175	+	Splice_Site	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:25466175T>A	ENST00000329474.6	+	9	1057	c.689T>A	c.(688-690)cTg>cAg	p.L230Q	LRRC16A_ENST00000377969.3_Splice_Site_p.L69Q	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	230					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						GATCTAAAACTGGTAAGTAAT	0.353																																							uc011djw.1		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						c.(688-690)CTG>CAG		leucine rich repeat containing 16A							146.0	137.0	140.0					6																	25466175		1849	4083	5932	SO:0001630	splice_region_variant	55604				actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus		g.chr6:25466175T>A	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.690+1T>A	6.37:g.25466175T>A			Somatic				LRRC16A_uc010jpx.2_Missense_Mutation_p.L230Q|LRRC16A_uc010jpy.2_Missense_Mutation_p.L230Q|LRRC16A_uc003nez.1_Missense_Mutation_p.L69Q	p.L230Q	NM_017640	NP_060110	WXS	Illumina HiSeq	Unspecified	Q5VZK9	LR16A_HUMAN			9	1065	+			230					B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	37	c.689T>A	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.310074	0.81247	.	.	ENSG00000079691	ENST00000329474;ENST00000399313;ENST00000377969	T;T	0.59364	0.27;0.27	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000001	T	0.71634	0.3363	M	0.79805	2.47	0.58432	D	0.999991	D;D;D;D	0.76494	0.987;0.995;0.996;0.999	P;D;D;D	0.70016	0.839;0.919;0.923;0.967	T	0.76990	-0.2754	10	0.87932	D	0	.	14.927	0.70887	0.0:0.0:0.0:1.0	.	230;230;230;69	Q5VZK9;B2RTQ5;Q5VZK9-2;Q5VZK9-4	LR16A_HUMAN;.;.;.	Q	230;230;69	ENSP00000331983:L230Q;ENSP00000367206:L69Q	ENSP00000331983:L230Q	L	+	2	0	LRRC16A	25574154	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.123000	0.77176	2.254000	0.74563	0.529000	0.55759	CTG		0.353	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	Missense_Mutation	33	57	0	0	0	0.003271	0	33	57				
LRRC16A	55604	broad.mit.edu	37	6	25466178	25466178	+	Splice_Site	SNP	T	T	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:25466178T>G	ENST00000329474.6	+	9	1058		c.e9+2		LRRC16A_ENST00000377969.3_Splice_Site	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CTAAAACTGGTAAGTAATCAA	0.358																																							uc011djw.1		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						c.e9+2		leucine rich repeat containing 16A							141.0	133.0	135.0					6																	25466178		1847	4083	5930	SO:0001630	splice_region_variant	55604				actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus		g.chr6:25466178T>G	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.690+2T>G	6.37:g.25466178T>G			Somatic				LRRC16A_uc010jpx.2_Splice_Site_p.L230_splice|LRRC16A_uc010jpy.2_Splice_Site_p.L230_splice|LRRC16A_uc003nez.1_Splice_Site_p.L69_splice	p.L230_splice	NM_017640	NP_060110	WXS	Illumina HiSeq	Unspecified	Q5VZK9	LR16A_HUMAN			9	1066	+								B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Splice_Site	SNP	ENST00000329474.6	37	c.690_splice	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617008	0.66672	.	.	ENSG00000079691	ENST00000329474;ENST00000399313;ENST00000377969	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.927	0.70887	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRC16A	25574157	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.123000	0.77176	2.254000	0.74563	0.529000	0.55759	.		0.358	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	Intron	32	53	0	0	0	0.013726	0	32	53				
SLC17A4	10050	broad.mit.edu	37	6	25771161	25771161	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:25771161G>T	ENST00000377905.4	+	6	746	c.627G>T	c.(625-627)atG>atT	p.M209I	SLC17A4_ENST00000439485.2_Intron|SLC17A4_ENST00000397076.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	209					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CAGGGTCAATGCTGGGGTCCT	0.493																																							uc003nfe.2		NA																	0				skin(1)	1						c.(625-627)ATG>ATT		solute carrier family 17 (sodium phosphate),							294.0	275.0	281.0					6																	25771161		2203	4300	6503	SO:0001583	missense	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25771161G>T	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.627G>T	6.37:g.25771161G>T	ENSP00000367137:p.Met209Ile		Somatic				SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Missense_Mutation_p.M146I|SLC17A4_uc010jqa.2_5'Flank	p.M209I	NM_005495	NP_005486	WXS	Illumina HiSeq	Unspecified	Q9Y2C5	S17A4_HUMAN			6	746	+			209			Helical; (Potential).		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	c.627G>T	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	9.697	1.153408	0.21371	.	.	ENSG00000146039	ENST00000377905	T	0.57107	0.42	5.39	0.904	0.19302	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.317020	0.04883	N	0.448013	T	0.12347	0.0300	N	0.13098	0.295	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.12785	-1.0534	10	0.22706	T	0.39	.	3.0574	0.06189	0.3533:0.0:0.4578:0.1889	.	209	Q9Y2C5	S17A4_HUMAN	I	209	ENSP00000367137:M209I	ENSP00000367137:M209I	M	+	3	0	SLC17A4	25879140	0.000000	0.05858	0.340000	0.25575	0.399000	0.30720	-0.025000	0.12413	0.590000	0.29694	0.563000	0.77884	ATG		0.493	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			11	94	1	0	7.93312e-07	0.00245	9.95462e-07	11	94				
HIST1H3B	8358	broad.mit.edu	37	6	26031935	26031935	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:26031935C>T	ENST00000244661.2	-	1	353	c.354G>A	c.(352-354)gtG>gtA	p.V118V		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	118					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						GCATAATAGTCACTCGCTTAG	0.512																																							uc003nfs.1		NA																	0				ovary(2)	2						c.(352-354)GTG>GTA		histone cluster 1, H3b							76.0	77.0	76.0					6																	26031935		2203	4300	6503	SO:0001819	synonymous_variant	8358				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26031935C>T	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.354G>A	6.37:g.26031935C>T			Somatic					p.V118V	NM_003537	NP_003528	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	354	-			118					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000244661.2	37	c.354G>A	CCDS4573.1																																																																																				0.512	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537		4	63	0	0	0	0.009096	0	4	63				
HIST1H2BG	8339	broad.mit.edu	37	6	26216739	26216739	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:26216739C>A	ENST00000244601.3	-	1	133	c.133G>T	c.(133-135)Gtg>Ttg	p.V45L	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	45					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				TGTTTTAGCACCTTGTACACA	0.527																																							uc003ngz.2		NA																	0				ovary(1)	1						c.(133-135)GTG>TTG		histone cluster 1, H2bg							261.0	232.0	242.0					6																	26216739		2203	4300	6503	SO:0001583	missense	8339				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26216739C>A	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.133G>T	6.37:g.26216739C>A	ENSP00000244601:p.Val45Leu		Somatic				HIST1H2AE_uc003nha.1_5'Flank	p.V45L	NM_003518	NP_003509	WXS	Illumina HiSeq	Unspecified	P62807	H2B1C_HUMAN			1	134	-		all_hematologic(11;0.196)	45					P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000244601.3	37	c.133G>T	CCDS4594.1	.	.	.	.	.	.	.	.	.	.	.	14.13	2.444015	0.43429	.	.	ENSG00000187990	ENST00000244601	T	0.69435	-0.4	4.0	4.0	0.46444	.	.	.	.	.	T	0.72415	0.3457	.	.	.	0.38542	D	0.949234	.	.	.	.	.	.	T	0.77389	-0.2606	6	0.72032	D	0.01	.	15.6296	0.76893	0.0:1.0:0.0:0.0	.	.	.	.	L	45	ENSP00000244601:V45L	ENSP00000244601:V45L	V	-	1	0	HIST1H2BG	26324718	1.000000	0.71417	1.000000	0.80357	0.131000	0.20780	7.473000	0.81007	2.222000	0.72286	0.655000	0.94253	GTG		0.527	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518		40	155	1	0	6.34439e-16	0.01441	1.02987e-15	40	155				
OR2J3	442186	broad.mit.edu	37	6	29080190	29080190	+	Missense_Mutation	SNP	C	C	A	rs371162693		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:29080190C>A	ENST00000377169.1	+	1	523	c.523C>A	c.(523-525)Cgc>Agc	p.R175S		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R175S(1)		endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						GTGTGGACACCGCCAAGTAGA	0.488																																							uc011dll.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(523-525)CGC>AGC		olfactory receptor, family 2, subfamily J,							136.0	145.0	142.0					6																	29080190		1289	2571	3860	SO:0001583	missense	442186				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29080190C>A		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.523C>A	6.37:g.29080190C>A	ENSP00000366374:p.Arg175Ser		Somatic					p.R175S	NM_001005216	NP_001005216	WXS	Illumina HiSeq	Unspecified	O76001	OR2J3_HUMAN			1	523	+			175			Extracellular (Potential).		B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	c.523C>A	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	C	1.894	-0.454862	0.04540	.	.	ENSG00000204701	ENST00000377169	T	0.00084	8.75	2.78	0.9	0.19278	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	M	0.64567	1.98	0.09310	N	1	B	0.30973	0.302	B	0.36885	0.235	T	0.14559	-1.0468	9	0.59425	D	0.04	.	2.9118	0.05739	0.3858:0.3478:0.0:0.2664	.	175	O76001	OR2J3_HUMAN	S	175	ENSP00000366374:R175S	ENSP00000366374:R175S	R	+	1	0	OR2J3	29188169	0.000000	0.05858	0.038000	0.18304	0.013000	0.08279	0.090000	0.15025	0.491000	0.27793	-0.436000	0.05848	CGC		0.488	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2			19	38	1	0	1.33834e-09	0.007413	1.90819e-09	19	38				
LRFN2	57497	broad.mit.edu	37	6	40360552	40360552	+	Silent	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:40360552C>G	ENST00000338305.6	-	3	2042	c.1500G>C	c.(1498-1500)acG>acC	p.T500T		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	500	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCGTGAGTGTCGTGGCTGTGT	0.602																																							uc003oph.1		NA																	0				ovary(2)|skin(1)	3						c.(1498-1500)ACG>ACC		leucine rich repeat and fibronectin type III							62.0	50.0	54.0					6																	40360552		2203	4300	6503	SO:0001819	synonymous_variant	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40360552C>G	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1500G>C	6.37:g.40360552C>G			Somatic					p.T500T	NM_020737	NP_065788	WXS	Illumina HiSeq	Unspecified	Q9ULH4	LRFN2_HUMAN			3	1965	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		500			Fibronectin type-III.|Extracellular (Potential).		A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	37	c.1500G>C	CCDS34443.1																																																																																				0.602	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		4	14	0	0	0	0.009096	0	4	14				
CUL9	23113	broad.mit.edu	37	6	43171718	43171718	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:43171718C>T	ENST00000252050.4	+	20	4236	c.4152C>T	c.(4150-4152)acC>acT	p.T1384T	CUL9_ENST00000372647.2_Silent_p.T1384T|CUL9_ENST00000354495.3_Silent_p.T1274T	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1384					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AGAACATCACCTCTCCCGGTA	0.567																																							uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(4150-4152)ACC>ACT		p53-associated parkin-like cytoplasmic protein							58.0	61.0	60.0					6																	43171718		2203	4300	6503	SO:0001819	synonymous_variant	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43171718C>T	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.4152C>T	6.37:g.43171718C>T			Somatic				CUL9_uc003oul.2_Silent_p.T1384T|CUL9_uc010jyk.2_Silent_p.T536T	p.T1384T	NM_015089	NP_055904	WXS	Illumina HiSeq	Unspecified	Q8IWT3	CUL9_HUMAN			20	4227	+			1384					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	c.4152C>T	CCDS4890.1																																																																																				0.567	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		3	36	0	0	0	0.004672	0	3	36				
GPR115	221393	broad.mit.edu	37	6	47682410	47682410	+	Missense_Mutation	SNP	A	A	C	rs376220222		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:47682410A>C	ENST00000283303.2	+	6	1687	c.1429A>C	c.(1429-1431)Aca>Cca	p.T477P	RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Missense_Mutation_p.T534P|GPR115_ENST00000327753.3_Missense_Mutation_p.T477P	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	477					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						TGTTGCAGTGACATTTTTCAG	0.408																																					GBM(22;431 510 9010 26644 32828)	GBM(22;431 510 9010 26644 32828)	uc003oza.1		NA																	0				ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						c.(1429-1431)ACA>CCA		G-protein coupled receptor 115 precursor							266.0	245.0	253.0					6																	47682410		2203	4300	6503	SO:0001583	missense	221393				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47682410A>C	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1429A>C	6.37:g.47682410A>C	ENSP00000283303:p.Thr477Pro		Somatic				GPR115_uc003oyz.1_Missense_Mutation_p.T534P|GPR115_uc003ozb.1_Missense_Mutation_p.T475P	p.T477P	NM_153838	NP_722580	WXS	Illumina HiSeq	Unspecified	Q8IZF3	GP115_HUMAN			6	1687	+			477			Extracellular (Potential).		B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	c.1429A>C	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	A	15.98	2.992996	0.54041	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.45668	0.89;0.89;0.89	5.45	5.45	0.79879	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.64238	0.2580	M	0.88181	2.935	0.39255	D	0.964113	D	0.89917	1.0	D	0.87578	0.998	T	0.73448	-0.3979	10	0.87932	D	0	-15.6713	14.9854	0.71345	1.0:0.0:0.0:0.0	.	477	Q8IZF3	GP115_HUMAN	P	534;477;477	ENSP00000360264:T534P;ENSP00000328319:T477P;ENSP00000283303:T477P	ENSP00000283303:T477P	T	+	1	0	GPR115	47790369	1.000000	0.71417	0.936000	0.37596	0.504000	0.33889	6.274000	0.72587	2.197000	0.70478	0.533000	0.62120	ACA		0.408	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		50	150	0	0	0	0.01441	0	50	150				
PKHD1	5314	broad.mit.edu	37	6	51909840	51909840	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:51909840C>A	ENST00000371117.3	-	25	2914	c.2639G>T	c.(2638-2640)cGt>cTt	p.R880L	PKHD1_ENST00000340994.4_Missense_Mutation_p.R880L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	880					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ATATACCACACGCGTGGCTGC	0.463																																							uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(2638-2640)CGT>CTT		fibrocystin isoform 1							108.0	95.0	100.0					6																	51909840		2203	4299	6502	SO:0001583	missense	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51909840C>A	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2639G>T	6.37:g.51909840C>A	ENSP00000360158:p.Arg880Leu		Somatic				PKHD1_uc003pai.2_Missense_Mutation_p.R880L	p.R880L	NM_138694	NP_619639	WXS	Illumina HiSeq	Unspecified	P08F94	PKHD1_HUMAN			25	2915	-	Lung NSC(77;0.0605)		880			Extracellular (Potential).		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	c.2639G>T	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202504	0.58234	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87887	-2.11;-2.31	5.25	4.38	0.52667	.	0.078660	0.52532	D	0.000066	D	0.88926	0.6570	M	0.80028	2.48	0.28648	N	0.906838	D;D	0.89917	0.995;1.0	D;D	0.65010	0.909;0.931	T	0.83172	-0.0093	10	0.31617	T	0.26	.	11.9545	0.52974	0.0:0.9149:0.0:0.0851	.	880;880	P08F94-2;P08F94	.;PKHD1_HUMAN	L	880	ENSP00000360158:R880L;ENSP00000341097:R880L	ENSP00000341097:R880L	R	-	2	0	PKHD1	52017799	0.964000	0.33143	0.766000	0.31476	0.616000	0.37450	2.556000	0.45862	1.353000	0.45828	0.655000	0.94253	CGT		0.463	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		7	20	1	0	2.17888e-05	0.006214	2.56906e-05	7	20				
FHL5	9457	broad.mit.edu	37	6	97052641	97052641	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:97052641G>T	ENST00000326771.2	+	4	555	c.175G>T	c.(175-177)Gac>Tac	p.D59Y	FHL5_ENST00000541107.1_Missense_Mutation_p.D59Y	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	59	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		TTGTTACAAAGACCGGCACTG	0.433																																							uc003pos.1		NA																	0				ovary(2)	2						c.(175-177)GAC>TAC		activator of cAMP-responsive element modulator							83.0	78.0	80.0					6																	97052641		2203	4300	6503	SO:0001583	missense	9457					nucleus	zinc ion binding	g.chr6:97052641G>T	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.175G>T	6.37:g.97052641G>T	ENSP00000326022:p.Asp59Tyr		Somatic				FHL5_uc003pot.1_Missense_Mutation_p.D59Y	p.D59Y	NM_020482	NP_065228	WXS	Illumina HiSeq	Unspecified	Q5TD97	FHL5_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0948)	4	580	+		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)	59			LIM zinc-binding 1.		B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	ENST00000326771.2	37	c.175G>T	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.969203	0.74246	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	D;D;D	0.89617	-2.54;-2.54;-2.54	5.36	3.11	0.35812	Zinc finger, LIM-type (5);	0.797544	0.10918	N	0.619819	D	0.94470	0.8220	H	0.95917	3.74	0.47994	D	0.999568	D	0.69078	0.997	D	0.67900	0.954	D	0.91784	0.5438	10	0.87932	D	0	.	8.976	0.35935	0.0998:0.1387:0.7615:0.0	.	59	Q5TD97	FHL5_HUMAN	Y	59	ENSP00000442357:D59Y;ENSP00000326022:D59Y;ENSP00000396390:D59Y	ENSP00000326022:D59Y	D	+	1	0	FHL5	97159362	1.000000	0.71417	0.941000	0.38009	0.996000	0.88848	6.582000	0.74049	0.469000	0.27268	0.655000	0.94253	GAC		0.433	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482		10	27	1	0	3.07112e-06	0.010729	3.74932e-06	10	27				
MMS22L	253714	broad.mit.edu	37	6	97729166	97729166	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:97729166C>G	ENST00000275053.4	-	3	502	c.237G>C	c.(235-237)tgG>tgC	p.W79C	MMS22L_ENST00000369251.2_Missense_Mutation_p.W79C	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	79					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						TTTCAGTAACCCACTGAATGC	0.318																																							uc003ppb.2		NA																	0					0						c.(235-237)TGG>TGC		hypothetical protein LOC253714							114.0	117.0	116.0					6																	97729166		2203	4300	6503	SO:0001583	missense	253714				double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding	g.chr6:97729166C>G		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.237G>C	6.37:g.97729166C>G	ENSP00000275053:p.Trp79Cys		Somatic				C6orf167_uc011eaf.1_Missense_Mutation_p.W79C|C6orf167_uc010kcn.1_5'UTR|C6orf167_uc010kco.1_5'UTR|C6orf167_uc003ppc.2_Missense_Mutation_p.W79C	p.W79C	NM_198468	NP_940870	WXS	Illumina HiSeq	Unspecified	Q6ZRQ5	MMS22_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0457)	3	503	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)	79					D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	c.237G>C	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283706	0.80803	.	.	ENSG00000146263	ENST00000275053;ENST00000369251;ENST00000510018	T;T;T	0.35605	1.3;1.3;1.3	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.57666	0.2069	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.60606	-0.7230	10	0.87932	D	0	-4.6735	19.8807	0.96899	0.0:1.0:0.0:0.0	.	79;79	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	C	79;79;5	ENSP00000275053:W79C;ENSP00000358254:W79C;ENSP00000427288:W5C	ENSP00000275053:W79C	W	-	3	0	MMS22L	97835887	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.168000	0.64978	2.692000	0.91855	0.591000	0.81541	TGG		0.318	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468		14	26	0	0	0	0.001855	0	14	26				
PNISR	25957	broad.mit.edu	37	6	99860520	99860520	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:99860520G>A	ENST00000369239.5	-	4	388	c.184C>T	c.(184-186)Cca>Tca	p.P62S	PNISR_ENST00000466057.1_5'UTR|PNISR_ENST00000438806.1_Missense_Mutation_p.P62S	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	62						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TGTCCATTTGGCATCATTCCT	0.453																																							uc003ppo.3		NA																	0					0						c.(184-186)CCA>TCA		splicing factor, arginine/serine-rich 130							168.0	145.0	153.0					6																	99860520		2203	4300	6503	SO:0001583	missense	25957					nuclear speck		g.chr6:99860520G>A	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.184C>T	6.37:g.99860520G>A	ENSP00000358242:p.Pro62Ser		Somatic				SFRS18_uc003ppp.3_Missense_Mutation_p.P62S|SFRS18_uc011eag.1_Missense_Mutation_p.P62S|SFRS18_uc003ppr.2_Missense_Mutation_p.P62S|SFRS18_uc003ppt.2_Missense_Mutation_p.P62S|SFRS18_uc003pps.2_Missense_Mutation_p.P62S	p.P62S	NM_032870	NP_116259	WXS	Illumina HiSeq	Unspecified	Q8TF01	PNISR_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0631)	4	412	-		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)	62					A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	37	c.184C>T	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037404	0.93630	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.41758	0.99;0.99	5.82	5.82	0.92795	.	0.046382	0.85682	D	0.000000	T	0.47563	0.1452	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.87578	0.986;0.998	T	0.36456	-0.9747	10	0.41790	T	0.15	.	20.1001	0.97870	0.0:0.0:1.0:0.0	.	62;62	E1P5D4;Q8TF01	.;PNISR_HUMAN	S	62	ENSP00000358242:P62S;ENSP00000387997:P62S	ENSP00000358242:P62S	P	-	1	0	PNISR	99967241	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.111000	0.94308	2.760000	0.94817	0.655000	0.94253	CCA		0.453	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870		3	62	0	0	0	0.009096	0	3	62				
HEY2	23493	broad.mit.edu	37	6	126080295	126080295	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:126080295T>C	ENST00000368364.3	+	5	558	c.361T>C	c.(361-363)Ttc>Ctc	p.F121L	HEY2_ENST00000368365.1_Missense_Mutation_p.F75L	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	121					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		TGCCATGGACTTCATGAGCAT	0.562																																							uc003qad.2		NA																	0				breast(1)	1						c.(361-363)TTC>CTC		hairy/enhancer-of-split related with YRPW motif							131.0	120.0	124.0					6																	126080295		2203	4300	6503	SO:0001583	missense	23493				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding	g.chr6:126080295T>C	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.361T>C	6.37:g.126080295T>C	ENSP00000357348:p.Phe121Leu		Somatic				HEY2_uc011ebr.1_Missense_Mutation_p.F75L	p.F121L	NM_012259	NP_036391	WXS	Illumina HiSeq	Unspecified	Q9UBP5	HEY2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)	5	552	+			121						Missense_Mutation	SNP	ENST00000368364.3	37	c.361T>C	CCDS5131.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.924278	0.92319	.	.	ENSG00000135547	ENST00000368365;ENST00000368364	T;T	0.39787	1.06;1.06	5.54	5.54	0.83059	Orange subgroup (1);	0.000000	0.85682	D	0.000000	T	0.27798	0.0684	L	0.52126	1.63	0.58432	D	0.999999	B	0.25563	0.129	B	0.37304	0.246	T	0.15292	-1.0442	10	0.12103	T	0.63	-10.2504	15.6615	0.77190	0.0:0.0:0.0:1.0	.	121	Q9UBP5	HEY2_HUMAN	L	75;121	ENSP00000357349:F75L;ENSP00000357348:F121L	ENSP00000357348:F121L	F	+	1	0	HEY2	126121988	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.956000	0.87863	2.106000	0.64143	0.459000	0.35465	TTC		0.562	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1			7	59	0	0	0	0.00308	0	7	59				
SOGA3	387104	broad.mit.edu	37	6	127797417	127797417	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:127797417G>A	ENST00000525778.1	-	6	2499	c.1754C>T	c.(1753-1755)gCc>gTc	p.A585V	SOGA3_ENST00000481848.2_Missense_Mutation_p.A585V|SOGA3_ENST00000368268.2_Missense_Mutation_p.A585V|SOGA3_ENST00000556132.1_Missense_Mutation_p.A585V|SOGA3_ENST00000465909.2_Missense_Mutation_p.A585V|SOGA3_ENST00000474293.2_5'Flank			Q5TF21	SOGA3_HUMAN	SOGA family member 3	585					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CTTGAGCTCGGCCTCCCTAGT	0.557																																							uc003qbd.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(1753-1755)GCC>GTC		hypothetical protein LOC387104 precursor							101.0	106.0	104.0					6																	127797417		2073	4215	6288	SO:0001583	missense	387104					integral to membrane		g.chr6:127797417G>A	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1754C>T	6.37:g.127797417G>A	ENSP00000434570:p.Ala585Val		Somatic				C6orf174_uc003qbc.2_5'Flank	p.A585V	NM_001012279	NP_001012279	WXS	Illumina HiSeq	Unspecified	Q5TF21	CF174_HUMAN		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)	6	2619	-			585			Potential.			Missense_Mutation	SNP	ENST00000525778.1	37	c.1754C>T	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913960	0.92178	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.52	5.52	0.82312	.	0.051276	0.85682	D	0.000000	T	0.60011	0.2236	L	0.55481	1.735	0.58432	D	0.999999	D	0.71674	0.998	D	0.76575	0.988	T	0.60244	-0.7301	10	0.56958	D	0.05	-12.8895	19.4511	0.94867	0.0:0.0:1.0:0.0	.	585	Q5TF21	CF174_HUMAN	V	585	ENSP00000451768:A585V;ENSP00000357251:A585V;ENSP00000434570:A585V;ENSP00000435559:A585V	ENSP00000435559:A585V	A	-	2	0	C6orf174	127839110	1.000000	0.71417	0.958000	0.39756	0.991000	0.79684	9.827000	0.99397	2.613000	0.88420	0.561000	0.74099	GCC		0.557	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279		14	30	0	0	0	0.004007	0	14	30				
KIAA1244	57221	broad.mit.edu	37	6	138655328	138655328	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:138655328G>T	ENST00000251691.4	+	33	5511	c.5345G>T	c.(5344-5346)aGg>aTg	p.R1782M		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGGACTGCCAGGGAGTTTGAC	0.562																																							uc003qhu.2		NA																	0				ovary(1)|skin(1)	2						c.(5344-5346)AGG>ATG		brefeldin A-inhibited guanine							32.0	34.0	33.0					6																	138655328		2203	4300	6503	SO:0001583	missense	57221				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr6:138655328G>T	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5345G>T	6.37:g.138655328G>T	ENSP00000251691:p.Arg1782Met		Somatic					p.R1782M	NM_020340	NP_065073	WXS	Illumina HiSeq	Unspecified	Q5TH69	BIG3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)	33	5345	+	Breast(32;0.135)		1782						Missense_Mutation	SNP	ENST00000251691.4	37	c.5345G>T	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226206	0.58668	.	.	ENSG00000112379	ENST00000251691	T	0.17691	2.26	5.02	5.02	0.67125	.	0.527326	0.18126	N	0.150884	T	0.17577	0.0422	N	0.14661	0.345	0.46654	D	0.999148	D	0.89917	1.0	D	0.83275	0.996	T	0.22941	-1.0202	10	0.33940	T	0.23	-24.9104	18.3435	0.90313	0.0:0.0:1.0:0.0	.	1782	Q5TH69	BIG3_HUMAN	M	1782	ENSP00000251691:R1782M	ENSP00000251691:R1782M	R	+	2	0	KIAA1244	138697021	0.998000	0.40836	0.048000	0.18961	0.979000	0.70002	7.948000	0.87774	2.341000	0.79615	0.411000	0.27672	AGG		0.562	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340		6	14	1	0	2.0095e-06	0.001984	2.47388e-06	6	14				
CCDC170	80129	broad.mit.edu	37	6	151857490	151857490	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:151857490G>T	ENST00000239374.7	+	2	194	c.95G>T	c.(94-96)cGg>cTg	p.R32L	CCDC170_ENST00000544131.1_3'UTR|CCDC170_ENST00000367290.5_Missense_Mutation_p.R32L	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	32																	CCGGTCACGCGGGAGCAGTTA	0.423																																							uc003qol.2		NA																	0					0						c.(94-96)CGG>CTG		hypothetical protein LOC80129							103.0	97.0	99.0					6																	151857490		1861	4092	5953	SO:0001583	missense	80129							g.chr6:151857490G>T	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.95G>T	6.37:g.151857490G>T	ENSP00000239374:p.Arg32Leu		Somatic					p.R32L	NM_025059	NP_079335	WXS	Illumina HiSeq	Unspecified	Q8IYT3	CF097_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)	2	184	+		Ovarian(120;0.126)	32			Potential.		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	ENST00000239374.7	37	c.95G>T	CCDS43515.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.248056	0.39697	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.09538	2.98;2.97	5.75	4.88	0.63580	.	0.297969	0.31660	N	0.007263	T	0.08714	0.0216	M	0.73962	2.25	0.30400	N	0.780075	P	0.47191	0.891	B	0.41988	0.372	T	0.03306	-1.1050	10	0.56958	D	0.05	-1.5472	14.6143	0.68537	0.07:0.0:0.93:0.0	.	32	Q8IYT3	CF097_HUMAN	L	32	ENSP00000239374:R32L;ENSP00000356259:R32L	ENSP00000239374:R32L	R	+	2	0	C6orf97	151899183	1.000000	0.71417	0.803000	0.32268	0.004000	0.04260	5.457000	0.66672	1.428000	0.47296	0.585000	0.79938	CGG		0.423	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059		14	42	1	0	1.01871e-10	0.008871	1.48499e-10	14	42				
SLC22A1	6580	broad.mit.edu	37	6	160557608	160557608	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:160557608G>T	ENST00000366963.4	+	6	1134	c.987G>T	c.(985-987)aaG>aaT	p.K329N	SLC22A1_ENST00000324965.4_Missense_Mutation_p.K329N|SLC22A1_ENST00000457470.2_Missense_Mutation_p.K329N	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	329					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	TCACCGAAAAGCTGAGCCCTT	0.602																																							uc003qtc.2		NA																	0					0						c.(985-987)AAG>AAT		solute carrier family 22 member 1 isoform a							187.0	146.0	160.0					6																	160557608		2203	4300	6503	SO:0001583	missense	6580					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding	g.chr6:160557608G>T	U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.987G>T	6.37:g.160557608G>T	ENSP00000355930:p.Lys329Asn		Somatic				SLC22A1_uc003qtd.2_Missense_Mutation_p.K329N	p.K329N	NM_003057	NP_003048	WXS	Illumina HiSeq	Unspecified	O15245	S22A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	6	1092	+		Breast(66;0.000776)|Ovarian(120;0.00556)	329			Cytoplasmic (Potential).		A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	ENST00000366963.4	37	c.987G>T	CCDS5274.1	.	.	.	.	.	.	.	.	.	.	G	9.880	1.201427	0.22121	.	.	ENSG00000175003	ENST00000366963;ENST00000324965;ENST00000457470	T;T;T	0.75154	-0.91;-0.91;-0.91	4.56	1.65	0.23941	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.546367	0.19498	N	0.112817	T	0.38852	0.1056	N	0.16790	0.44	0.38849	D	0.956237	B;B	0.19445	0.036;0.01	B;B	0.22880	0.042;0.033	T	0.33624	-0.9861	10	0.51188	T	0.08	.	7.0446	0.25038	0.1395:0.0:0.7173:0.1432	.	329;329	O15245-2;O15245	.;S22A1_HUMAN	N	329	ENSP00000355930:K329N;ENSP00000318103:K329N;ENSP00000409557:K329N	ENSP00000318103:K329N	K	+	3	2	SLC22A1	160477598	0.997000	0.39634	0.991000	0.47740	0.147000	0.21601	2.790000	0.47821	0.869000	0.35703	0.561000	0.74099	AAG		0.602	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042938.2			33	60	1	0	1.41504e-22	0.011902	2.47526e-22	33	60				
SDK1	221935	broad.mit.edu	37	7	4089086	4089086	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:4089086G>T	ENST00000404826.2	+	18	2848	c.2709G>T	c.(2707-2709)caG>caT	p.Q903H	SDK1_ENST00000389531.3_Missense_Mutation_p.Q903H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	903	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCATCAACCAGGGATACAAGG	0.602																																							uc003smx.2		NA																	0				large_intestine(3)|ovary(2)|skin(1)	6						c.(2707-2709)CAG>CAT		sidekick 1 precursor							76.0	61.0	66.0					7																	4089086		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4089086G>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2709G>T	7.37:g.4089086G>T	ENSP00000385899:p.Gln903His		Somatic				SDK1_uc010kso.2_Missense_Mutation_p.Q179H	p.Q903H	NM_152744	NP_689957	WXS	Illumina HiSeq	Unspecified	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	18	2848	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	903			Fibronectin type-III 3.		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.2709G>T	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713581	0.68730	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57752	0.38;0.38	5.13	5.13	0.70059	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.73450	0.3588	M	0.86097	2.795	0.51482	D	0.999928	D;D	0.89917	1.0;0.999	D;D	0.73708	0.981;0.964	T	0.77993	-0.2378	10	0.87932	D	0	.	12.4543	0.55695	0.0873:0.0:0.9127:0.0	.	903;903	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	H	903	ENSP00000385899:Q903H;ENSP00000374182:Q903H	ENSP00000374182:Q903H	Q	+	3	2	SDK1	4055612	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.791000	0.55469	2.392000	0.81423	0.557000	0.71058	CAG		0.602	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		17	37	1	0	1.33834e-09	0.007413	1.90819e-09	17	37				
MEOX2	4223	broad.mit.edu	37	7	15725928	15725928	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:15725928C>A	ENST00000262041.5	-	1	509	c.100G>T	c.(100-102)Gac>Tac	p.D34Y	AC005550.4_ENST00000442176.1_lincRNA|AC005550.5_ENST00000438923.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	34					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		GACATATGGTCAGATCTTCCA	0.577																																					Esophageal Squamous(140;197 1769 16409 18257 29929)	Esophageal Squamous(140;197 1769 16409 18257 29929)	uc003stc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(100-102)GAC>TAC		mesenchyme homeobox 2							68.0	58.0	61.0					7																	15725928		2203	4300	6503	SO:0001583	missense	4223				blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:15725928C>A		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.100G>T	7.37:g.15725928C>A	ENSP00000262041:p.Asp34Tyr		Somatic				MEOX2_uc011jxw.1_Missense_Mutation_p.D34Y	p.D34Y	NM_005924	NP_005915	WXS	Illumina HiSeq	Unspecified	P50222	MEOX2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)	1	381	-			34					B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	ENST00000262041.5	37	c.100G>T	CCDS34605.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774049	0.69992	.	.	ENSG00000106511	ENST00000262041	D	0.93076	-3.16	4.46	4.46	0.54185	.	0.099730	0.64402	D	0.000002	D	0.95639	0.8582	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.96084	0.9056	10	0.72032	D	0.01	-25.4357	17.7395	0.88404	0.0:1.0:0.0:0.0	.	34	P50222	MEOX2_HUMAN	Y	34	ENSP00000262041:D34Y	ENSP00000262041:D34Y	D	-	1	0	MEOX2	15692453	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	6.577000	0.74027	2.482000	0.83794	0.650000	0.86243	GAC		0.577	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924		12	20	1	0	0.000151284	0.001855	0.00017315	12	20				
DNAH11	8701	broad.mit.edu	37	7	21906152	21906152	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:21906152G>C	ENST00000409508.3	+	71	11592	c.11561G>C	c.(11560-11562)tGg>tCg	p.W3854S	DNAH11_ENST00000328843.6_Missense_Mutation_p.W3861S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3861					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GCCAAGCAGTGGAGGAAGTGG	0.423									Kartagener syndrome																														uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(11581-11583)TGG>TCG		dynein, axonemal, heavy chain 11							137.0	131.0	133.0					7																	21906152		1867	4104	5971	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21906152G>C	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.11561G>C	7.37:g.21906152G>C	ENSP00000475939:p.Trp3854Ser		Somatic					p.W3861S	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			72	11613	+			3861					Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.11582G>C		.	.	.	.	.	.	.	.	.	.	G	25.0	4.593441	0.86953	.	.	ENSG00000105877	ENST00000328843	T	0.11821	2.74	5.81	5.81	0.92471	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.24941	-1.0146	9	0.87932	D	0	.	19.6713	0.95912	0.0:0.0:1.0:0.0	.	3861	Q96DT5	DYH11_HUMAN	S	3861	ENSP00000330671:W3861S	ENSP00000330671:W3861S	W	+	2	0	DNAH11	21872677	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.761000	0.74945	2.756000	0.94617	0.655000	0.94253	TGG		0.423	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		7	100	0	0	0	0.008291	0	7	100				
TBX20	57057	broad.mit.edu	37	7	35288451	35288451	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:35288451C>A	ENST00000408931.3	-	3	909	c.383G>T	c.(382-384)aGg>aTg	p.R128M		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	128					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TGGAAACATCCTCCTGACAGA	0.527																																							uc011kas.1		NA																	0				central_nervous_system(1)	1						c.(382-384)AGG>ATG		T-box transcription factor TBX20							66.0	62.0	63.0					7																	35288451		2203	4300	6503	SO:0001583	missense	57057					nucleus	DNA binding	g.chr7:35288451C>A	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.383G>T	7.37:g.35288451C>A	ENSP00000386170:p.Arg128Met		Somatic					p.R128M	NM_001077653	NP_001071121	WXS	Illumina HiSeq	Unspecified	Q9UMR3	TBX20_HUMAN			3	394	-			128			T-box.		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	c.383G>T	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	C	30	5.049746	0.93740	.	.	ENSG00000164532	ENST00000408931	D	0.91295	-2.82	5.87	5.87	0.94306	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.055351	0.85682	D	0.000000	D	0.97707	0.9248	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.98348	1.0542	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	128	Q9UMR3	TBX20_HUMAN	M	128	ENSP00000386170:R128M	ENSP00000386170:R128M	R	-	2	0	TBX20	35254976	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.624000	0.83124	2.941000	0.99782	0.655000	0.94253	AGG		0.527	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417		21	45	1	0	2.4375e-19	0.007291	4.17653e-19	21	45				
VPS41	27072	broad.mit.edu	37	7	38835164	38835164	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:38835164C>A	ENST00000310301.4	-	9	672	c.618G>T	c.(616-618)gtG>gtT	p.V206V	VPS41_ENST00000466017.1_5'UTR|VPS41_ENST00000395969.2_Silent_p.V181V	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	206					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CATCCCGGGGCACATTGGTGA	0.458																																							uc003tgy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(616-618)GTG>GTT		vacuolar protein sorting 41 isoform 1							113.0	100.0	105.0					7																	38835164		2203	4300	6503	SO:0001819	synonymous_variant	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38835164C>A	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.618G>T	7.37:g.38835164C>A			Somatic				VPS41_uc003tgz.2_Silent_p.V181V|VPS41_uc010kxn.2_Intron	p.V206V	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			9	644	-			206					E9PF36|Q86TP8|Q99851|Q99852	Silent	SNP	ENST00000310301.4	37	c.618G>T	CCDS5457.1																																																																																				0.458	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			35	70	1	0	7.93934e-33	0.00623	1.46304e-32	35	70				
ABCA13	154664	broad.mit.edu	37	7	48319189	48319189	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:48319189G>A	ENST00000435803.1	+	18	8422	c.8398G>A	c.(8398-8400)Gac>Aac	p.D2800N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2800					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTATATTTTGACACACCTTT	0.328																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(8398-8400)GAC>AAC		ATP binding cassette, sub-family A (ABC1),							47.0	48.0	47.0					7																	48319189		1797	4064	5861	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48319189G>A	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8398G>A	7.37:g.48319189G>A	ENSP00000411096:p.Asp2800Asn		Somatic				ABCA13_uc010kys.1_5'Flank	p.D2800N	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			18	8423	+			2800					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.8398G>A	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	3.904	-0.021371	0.07634	.	.	ENSG00000179869	ENST00000435803	T	0.54071	0.59	5.3	0.18	0.15068	.	0.392046	0.21437	N	0.074557	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24941	-1.0146	10	0.06891	T	0.86	.	7.9668	0.30104	0.4321:0.0:0.5679:0.0	.	2800	Q86UQ4	ABCAD_HUMAN	N	2800	ENSP00000411096:D2800N	ENSP00000411096:D2800N	D	+	1	0	ABCA13	48289735	0.000000	0.05858	0.000000	0.03702	0.389000	0.30415	-0.138000	0.10374	0.022000	0.15160	0.650000	0.86243	GAC		0.328	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		9	33	0	0	0	0.004482	0	9	33				
COBL	23242	broad.mit.edu	37	7	51095726	51095726	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:51095726G>A	ENST00000265136.7	-	10	3232	c.3067C>T	c.(3067-3069)Cct>Tct	p.P1023S	COBL_ENST00000395542.2_Missense_Mutation_p.P1105S	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1023	Poly-Pro.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GTGTGTGGAGGGGGTGGGTCT	0.632																																					NSCLC(189;2119 2138 12223 30818 34679)	NSCLC(189;2119 2138 12223 30818 34679)	uc003tpr.3		NA																	0				skin(3)|ovary(2)	5						c.(3067-3069)CCT>TCT		cordon-bleu homolog							53.0	53.0	53.0					7																	51095726		2203	4300	6503	SO:0001583	missense	23242							g.chr7:51095726G>A	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3067C>T	7.37:g.51095726G>A	ENSP00000265136:p.Pro1023Ser		Somatic				COBL_uc003tps.2_Missense_Mutation_p.P1080S|COBL_uc011kcl.1_Missense_Mutation_p.P1023S|COBL_uc003tpp.3_Missense_Mutation_p.P809S|COBL_uc003tpq.3_Missense_Mutation_p.P964S|COBL_uc003tpo.3_Missense_Mutation_p.P565S	p.P1023S	NM_015198	NP_056013	WXS	Illumina HiSeq	Unspecified	O75128	COBL_HUMAN			10	3252	-	Glioma(55;0.08)		1023			Poly-Pro.		A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	c.3067C>T	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	G	9.680	1.149139	0.21288	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.12774	2.65;2.66;2.66;2.65	5.19	1.29	0.21616	.	1.184750	0.06300	N	0.700706	T	0.18759	0.0450	L	0.27053	0.805	0.09310	N	1	B;B;P;P;D	0.69078	0.084;0.084;0.524;0.759;0.997	B;B;B;B;D	0.63033	0.04;0.022;0.095;0.187;0.91	T	0.21449	-1.0245	10	0.31617	T	0.26	.	4.1023	0.10018	0.4198:0.0:0.4242:0.156	.	1023;1080;1023;1105;565	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	S	1023;915;908;1105	ENSP00000265136:P1023S;ENSP00000401204:P915S;ENSP00000413498:P908S;ENSP00000378912:P1105S	ENSP00000265136:P1023S	P	-	1	0	COBL	51063220	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	0.020000	0.13466	-0.042000	0.13535	0.563000	0.77884	CCT		0.632	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		14	35	0	0	0	0.003163	0	14	35				
ZNF479	90827	broad.mit.edu	37	7	57193821	57193821	+	Splice_Site	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:57193821C>A	ENST00000331162.4	-	4	437		c.e4-1			NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			ACAGCAATACCTGTTTTATTA	0.328																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.e4-1		zinc finger protein 479							30.0	32.0	31.0					7																	57193821		1739	3779	5518	SO:0001630	splice_region_variant	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57193821C>A	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.167-1G>T	7.37:g.57193821C>A			Somatic					p.G56_splice	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		4	438	-									Splice_Site	SNP	ENST00000331162.4	37	c.167_splice	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	C	1.997	-0.430293	0.04701	.	.	ENSG00000185177	ENST00000331162	.	.	.	1.25	1.25	0.21368	.	.	.	.	.	.	.	.	.	.	.	0.21064	N	0.999793	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8275	0.18562	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF479	57197763	0.056000	0.20664	0.045000	0.18777	0.023000	0.10783	0.141000	0.16076	0.669000	0.31146	0.393000	0.25936	.		0.328	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	Intron	19	33	1	0	1.00905e-13	0.008871	1.56844e-13	19	33				
ZNF679	168417	broad.mit.edu	37	7	63726427	63726427	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:63726427G>T	ENST00000421025.1	+	5	685	c.416G>T	c.(415-417)gGa>gTa	p.G139V	ZNF679_ENST00000255746.4_Missense_Mutation_p.G139V	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GTGCAAAAAGGAGGTTGTAAT	0.333																																							uc003tsx.2		NA																	0				skin(1)	1						c.(415-417)GGA>GTA		zinc finger protein 679							200.0	179.0	185.0					7																	63726427		692	1591	2283	SO:0001583	missense	168417				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63726427G>T	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.416G>T	7.37:g.63726427G>T	ENSP00000416809:p.Gly139Val		Somatic					p.G139V	NM_153363	NP_699194	WXS	Illumina HiSeq	Unspecified	Q8IYX0	ZN679_HUMAN			5	685	+			139						Missense_Mutation	SNP	ENST00000421025.1	37	c.416G>T	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	G	6.393	0.440666	0.12104	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.05996	3.36;3.36	0.449	-0.897	0.10553	.	.	.	.	.	T	0.14442	0.0349	M	0.70595	2.14	0.09310	N	1	D	0.63880	0.993	P	0.58660	0.843	T	0.09796	-1.0658	8	0.54805	T	0.06	.	.	.	.	.	139	Q8IYX0	ZN679_HUMAN	V	139	ENSP00000416809:G139V;ENSP00000255746:G139V	ENSP00000255746:G139V	G	+	2	0	ZNF679	63363862	0.000000	0.05858	0.002000	0.10522	0.107000	0.19398	0.202000	0.17295	-0.614000	0.05687	0.194000	0.17425	GGA		0.333	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363		6	17	1	0	4.096e-09	0.001168	5.76985e-09	6	17				
KCTD7	154881	broad.mit.edu	37	7	66098317	66098317	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:66098317C>A	ENST00000275532.3	+	2	384	c.200C>A	c.(199-201)tCc>tAc	p.S67Y	KCTD7_ENST00000443322.1_Missense_Mutation_p.S67Y	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	67	BTB.				cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						ACACGCCTGTCCACACTGCGG	0.572																																							uc003tve.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(199-201)TCC>TAC		potassium channel tetramerisation domain							126.0	93.0	105.0					7																	66098317		2203	4300	6503	SO:0001583	missense	154881					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr7:66098317C>A	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.200C>A	7.37:g.66098317C>A	ENSP00000275532:p.Ser67Tyr		Somatic				RABGEF1_uc003tvf.2_Intron|KCTD7_uc003tvd.3_Missense_Mutation_p.S67Y	p.S67Y	NM_153033	NP_694578	WXS	Illumina HiSeq	Unspecified	Q96MP8	KCTD7_HUMAN			2	362	+			67			BTB.		A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	37	c.200C>A	CCDS5534.1	.	.	.	.	.	.	.	.	.	.	c	19.74	3.883126	0.72410	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.50001	0.76;0.76	4.58	4.58	0.56647	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.	.	.	.	T	0.72630	0.3484	M	0.87038	2.855	0.80722	D	1	D	0.64830	0.994	D	0.72982	0.979	T	0.79087	-0.1947	9	0.72032	D	0.01	.	16.7975	0.85606	0.0:1.0:0.0:0.0	.	67	Q96MP8	KCTD7_HUMAN	Y	67	ENSP00000275532:S67Y;ENSP00000411624:S67Y	ENSP00000275532:S67Y	S	+	2	0	KCTD7	65735752	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	7.319000	0.79040	2.264000	0.75181	0.456000	0.33151	TCC		0.572	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033		15	50	1	0	0.000958276	0.007413	0.00105159	15	50				
WBSCR17	64409	broad.mit.edu	37	7	70885934	70885934	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:70885934C>A	ENST00000333538.5	+	5	1439	c.805C>A	c.(805-807)Cgt>Agt	p.R269S	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	269					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AAACCGGAAGCGTGTGATCCT	0.542																																							uc003tvy.2		NA																	0				skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7						c.(805-807)CGT>AGT		UDP-GalNAc:polypeptide							201.0	187.0	192.0					7																	70885934		2203	4300	6503	SO:0001583	missense	64409					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:70885934C>A	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.805C>A	7.37:g.70885934C>A	ENSP00000329654:p.Arg269Ser		Somatic				WBSCR17_uc003tvz.2_5'UTR	p.R269S	NM_022479	NP_071924	WXS	Illumina HiSeq	Unspecified	Q6IS24	GLTL3_HUMAN			5	805	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	269			Lumenal (Potential).		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	c.805C>A	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747595	0.69533	.	.	ENSG00000185274	ENST00000333538	T	0.58506	0.33	5.45	3.4	0.38934	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.71091	0.3299	L	0.58101	1.795	0.53688	D	0.999972	D	0.89917	1.0	D	0.87578	0.998	T	0.73477	-0.3970	10	0.52906	T	0.07	.	14.4083	0.67099	0.319:0.681:0.0:0.0	.	269	Q6IS24	GLTL3_HUMAN	S	269	ENSP00000329654:R269S	ENSP00000329654:R269S	R	+	1	0	WBSCR17	70523870	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	2.977000	0.49297	1.258000	0.44101	0.650000	0.86243	CGT		0.542	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		133	163	1	0	6.91809e-85	0.01441	1.32052e-84	133	163				
CALN1	83698	broad.mit.edu	37	7	71488689	71488689	+	Missense_Mutation	SNP	C	C	A	rs557342382		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:71488689C>A	ENST00000329008.5	-	4	626	c.328G>T	c.(328-330)Ggt>Tgt	p.G110C	CALN1_ENST00000395276.2_Missense_Mutation_p.G110C|CALN1_ENST00000431984.1_Missense_Mutation_p.G110C|CALN1_ENST00000395275.2_Missense_Mutation_p.G152C|CALN1_ENST00000412588.1_Missense_Mutation_p.G152C|CALN1_ENST00000405452.2_Missense_Mutation_p.G110C	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				CCATCGCGACCTTCTGAAGAC	0.418																																							uc003twa.3		NA																	0				skin(1)	1						c.(328-330)GGT>TGT		calneuron 1 isoform 2							133.0	121.0	125.0					7																	71488689		2203	4300	6503	SO:0001583	missense	83698					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding	g.chr7:71488689C>A	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.328G>T	7.37:g.71488689C>A	ENSP00000332498:p.Gly110Cys		Somatic				CALN1_uc003twb.3_Missense_Mutation_p.G152C|CALN1_uc003twc.3_Missense_Mutation_p.G110C	p.G110C	NM_001017440	NP_001017440	WXS	Illumina HiSeq	Unspecified	Q9BXU9	CABP8_HUMAN			4	855	-		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)	110			Cytoplasmic (Potential).		J3KQA7	Missense_Mutation	SNP	ENST00000329008.5	37	c.328G>T	CCDS5541.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023625	0.54683	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452;ENST00000446128	T;T;T;T;T;T;T	0.74632	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.86	5.87	4.99	0.66335	.	0.145349	0.64402	D	0.000006	T	0.59649	0.2209	N	0.08118	0	0.43953	D	0.996625	B;B	0.31989	0.35;0.35	B;B	0.35240	0.198;0.198	T	0.64605	-0.6368	10	0.62326	D	0.03	-1.8835	15.1857	0.72999	0.0:0.8584:0.1416:0.0	.	110;110	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	C	110;152;110;110;152;110;110	ENSP00000332498:G110C;ENSP00000378690:G152C;ENSP00000378691:G110C;ENSP00000410704:G110C;ENSP00000391882:G152C;ENSP00000384354:G110C;ENSP00000411806:G110C	ENSP00000332498:G110C	G	-	1	0	CALN1	71126625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.384000	0.66225	1.611000	0.50210	0.655000	0.94253	GGT		0.418	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320044.2	NM_031468		42	82	1	0	1.67886e-27	0.01441	2.99942e-27	42	82				
CLIP2	7461	broad.mit.edu	37	7	73811523	73811523	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:73811523A>C	ENST00000395060.1	+	13	2840	c.2840A>C	c.(2839-2841)aAg>aCg	p.K947T	CLIP2_ENST00000223398.6_Missense_Mutation_p.K947T|CLIP2_ENST00000361545.5_Missense_Mutation_p.K912T			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	947						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CAGAAACTCAAGGATGACATC	0.642																																							uc003uam.2		NA																	0				skin(3)	3						c.(2839-2841)AAG>ACG		CAP-GLY domain containing linker protein 2							99.0	87.0	91.0					7																	73811523		2203	4300	6503	SO:0001583	missense	7461					microtubule associated complex		g.chr7:73811523A>C	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2840A>C	7.37:g.73811523A>C	ENSP00000378500:p.Lys947Thr		Somatic				CLIP2_uc003uan.2_Missense_Mutation_p.K912T	p.K947T	NM_003388	NP_003379	WXS	Illumina HiSeq	Unspecified	Q9UDT6	CLIP2_HUMAN			14	3167	+			947			Potential.		O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	c.2840A>C	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531605	0.64972	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.60548	0.2;0.18;0.2	4.54	4.54	0.55810	.	0.122077	0.56097	D	0.000032	T	0.53238	0.1784	N	0.24115	0.695	0.35892	D	0.829713	P;P	0.51933	0.949;0.915	P;B	0.51701	0.677;0.236	T	0.65344	-0.6191	10	0.54805	T	0.06	-36.8532	12.7078	0.57070	1.0:0.0:0.0:0.0	.	912;947	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	T	947;947;912;947	ENSP00000223398:K947T;ENSP00000355151:K912T;ENSP00000378500:K947T	ENSP00000223398:K947T	K	+	2	0	CLIP2	73449459	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.486000	0.90451	1.693000	0.51124	0.459000	0.35465	AAG		0.642	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388		18	81	0	0	0	0.010504	0	18	81				
CACNA2D1	781	broad.mit.edu	37	7	81611924	81611924	+	Silent	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:81611924T>A	ENST00000356253.5	-	24	2205	c.1950A>T	c.(1948-1950)ccA>ccT	p.P650P	CACNA2D1_ENST00000356860.3_Silent_p.P638P			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	650					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CAAAATTATCTGGCTTCAGGG	0.353																																							uc003uhr.1		NA																	0				ovary(5)|pancreas(1)	6						c.(1912-1914)CCA>CCT		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						95.0	101.0	99.0					7																	81611924		2203	4300	6503	SO:0001819	synonymous_variant	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81611924T>A	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1950A>T	7.37:g.81611924T>A			Somatic					p.P638P	NM_000722	NP_000713	WXS	Illumina HiSeq	Unspecified	P54289	CA2D1_HUMAN			24	2170	-			650			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Silent	SNP	ENST00000356253.5	37	c.1914A>T		.	.	.	.	.	.	.	.	.	.	T	10.14	1.269566	0.23221	.	.	ENSG00000153956	ENST00000443883	.	.	.	5.84	-1.6	0.08426	.	.	.	.	.	T	0.50188	0.1601	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43766	-0.9371	4	.	.	.	-13.6264	5.6824	0.17784	0.1767:0.3254:0.0:0.4979	.	.	.	.	L	149	.	.	Q	-	2	0	CACNA2D1	81449860	0.013000	0.17824	1.000000	0.80357	0.944000	0.59088	-0.981000	0.03766	0.076000	0.16826	0.533000	0.62120	CAG		0.353	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				47	73	0	0	0	0.01441	0	47	73				
CFAP69	79846	broad.mit.edu	37	7	89917641	89917641	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:89917641C>A	ENST00000389297.4	+	15	2001	c.1750C>A	c.(1750-1752)Ctt>Att	p.L584I	C7orf63_ENST00000497910.1_Missense_Mutation_p.L566I|C7orf63_ENST00000316089.8_Missense_Mutation_p.L584I	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		584										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						TAATGTACTTCTTTTTAGTAC	0.378																																							uc010lep.2		NA																	0				ovary(1)	1						c.(1750-1752)CTT>ATT		hypothetical protein LOC79846 isoform 1							122.0	117.0	119.0					7																	89917641		1865	4104	5969	SO:0001583	missense	79846						binding	g.chr7:89917641C>A																												ENST00000389297.4:c.1750C>A	7.37:g.89917641C>A	ENSP00000373948:p.Leu584Ile		Somatic				C7orf63_uc003ukf.2_RNA|C7orf63_uc003ukg.2_Missense_Mutation_p.L259I|C7orf63_uc011khj.1_Missense_Mutation_p.L566I|C7orf63_uc011khk.1_Missense_Mutation_p.L146I	p.L584I	NM_001039706	NP_001034795	WXS	Illumina HiSeq	Unspecified	A5D8W1	CG063_HUMAN			15	2001	+			584					A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	ENST00000389297.4	37	c.1750C>A	CCDS43613.2	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925743	0.52759	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170;ENST00000449577	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	5.62	4.74	0.60224	Armadillo-type fold (1);	0.202066	0.42548	D	0.000685	T	0.47135	0.1429	L	0.58428	1.81	0.34267	D	0.680575	P;B;B	0.35033	0.481;0.17;0.103	B;B;B	0.41088	0.347;0.082;0.046	T	0.59705	-0.7404	10	0.35671	T	0.21	-16.5476	9.3542	0.38157	0.1434:0.7842:0.0:0.0723	.	566;584;584	A5D8W1-5;A5D8W1;A5D8W1-2	.;CG063_HUMAN;.	I	584;584;566;467;167	ENSP00000373948:L584I;ENSP00000321753:L584I;ENSP00000419549:L566I;ENSP00000392365:L467I;ENSP00000391571:L167I	ENSP00000321753:L584I	L	+	1	0	C7orf63	89755577	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	2.871000	0.48459	1.385000	0.46445	-0.218000	0.12543	CTT		0.378	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4			24	119	1	0	1.17739e-12	0.005443	1.80144e-12	24	119				
ANKIB1	54467	broad.mit.edu	37	7	92027594	92027594	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:92027594T>C	ENST00000265742.3	+	20	2977	c.2601T>C	c.(2599-2601)tcT>tcC	p.S867S		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	867							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGCAAGAGTCTGGGCTGGCCC	0.458																																							uc003ulw.2		NA																	0				lung(1)	1						c.(2599-2601)TCT>TCC		ankyrin repeat and IBR domain containing 1							64.0	63.0	63.0					7																	92027594		1892	4116	6008	SO:0001819	synonymous_variant	54467						protein binding|zinc ion binding	g.chr7:92027594T>C	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2601T>C	7.37:g.92027594T>C			Somatic				ANKIB1_uc010lew.1_Silent_p.S136S	p.S867S	NM_019004	NP_061877	WXS	Illumina HiSeq	Unspecified	Q9P2G1	AKIB1_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		20	2977	+	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		867			UIM.		Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	37	c.2601T>C	CCDS47639.1																																																																																				0.458	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1			15	18	0	0	0	0.004007	0	15	18				
HEPACAM2	253012	broad.mit.edu	37	7	92821574	92821574	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:92821574G>T	ENST00000394468.2	-	9	1455	c.1378C>A	c.(1378-1380)Cat>Aat	p.H460N	HEPACAM2_ENST00000453812.2_Missense_Mutation_p.H483N|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.H448N|HEPACAM2_ENST00000440868.1_Silent_p.T439T|HEPACAM2_ENST00000492616.1_5'UTR	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	460					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TACTCTGGATGGTCTTGCTGC	0.458																																							uc003umm.2		NA																	0				ovary(3)|breast(1)|kidney(1)	5						c.(1378-1380)CAT>AAT		HEPACAM family member 2 isoform 1							135.0	113.0	120.0					7																	92821574		2203	4300	6503	SO:0001583	missense	253012					integral to membrane		g.chr7:92821574G>T	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.1378C>A	7.37:g.92821574G>T	ENSP00000377980:p.His460Asn		Somatic				HEPACAM2_uc003uml.2_Missense_Mutation_p.H448N|HEPACAM2_uc010lff.2_Silent_p.T439T|HEPACAM2_uc011khy.1_Missense_Mutation_p.H483N	p.H460N	NM_001039372	NP_001034461	WXS	Illumina HiSeq	Unspecified	A8MVW5	HECA2_HUMAN			9	1401	-			460			Cytoplasmic (Potential).		B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	c.1378C>A	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	G	2.150	-0.394619	0.04899	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000453812	T;T;T	0.50813	0.78;0.78;0.73	4.55	-1.14	0.09741	.	0.422934	0.26704	N	0.022938	T	0.13713	0.0332	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.20706	-1.0267	10	0.02654	T	1	-1.0517	1.8566	0.03180	0.2796:0.1319:0.4535:0.135	.	483;460;448	E9PDV5;A8MVW5;A8MVW5-2	.;HECA2_HUMAN;.	N	460;448;483	ENSP00000377980:H460N;ENSP00000340532:H448N;ENSP00000390204:H483N	ENSP00000340532:H448N	H	-	1	0	HEPACAM2	92659510	0.319000	0.24607	0.029000	0.17559	0.498000	0.33706	0.173000	0.16724	-0.114000	0.11936	0.563000	0.77884	CAT		0.458	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151		50	74	1	0	1.17673e-23	0.01441	2.06456e-23	50	74				
PTCD1	26024	broad.mit.edu	37	7	99022666	99022666	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:99022666C>A	ENST00000292478.4	-	6	1739	c.1489G>T	c.(1489-1491)Gtg>Ttg	p.V497L	PTCD1_ENST00000555673.1_Missense_Mutation_p.V546L|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.V546L	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	497					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CCGGACTCCACCACCTCGGCC	0.617																																							uc003uqh.2		NA																	0				ovary(1)	1						c.(1489-1491)GTG>TTG		pentatricopeptide repeat domain 1							64.0	65.0	65.0					7																	99022666		2203	4300	6503	SO:0001583	missense	26024							g.chr7:99022666C>A	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1489G>T	7.37:g.99022666C>A	ENSP00000292478:p.Val497Leu		Somatic				PTCD1_uc011kiw.1_Missense_Mutation_p.V546L	p.V497L	NM_015545	NP_056360	WXS	Illumina HiSeq	Unspecified	O75127	PTCD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		6	1620	-	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		497					Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	c.1489G>T	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060054	0.36373	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000438524;ENST00000555673;ENST00000413834	T;T;T	0.62364	0.05;0.03;0.03	5.58	4.7	0.59300	.	0.256680	0.45126	D	0.000395	T	0.54303	0.1850	L	0.55103	1.725	0.41763	D	0.989724	P;B	0.38729	0.644;0.085	B;B	0.38985	0.287;0.02	T	0.50083	-0.8869	10	0.14252	T	0.57	-17.0242	10.5438	0.45047	0.0:0.852:0.0:0.148	.	546;497	G3V325;O75127	.;PTCD1_HUMAN	L	497;279;546;546	ENSP00000292478:V497L;ENSP00000450995:V546L;ENSP00000400168:V546L	ENSP00000400168:V546L	V	-	1	0	ATP5J2-PTCD1;PTCD1	98860602	1.000000	0.71417	0.852000	0.33557	0.275000	0.26752	3.984000	0.56923	1.344000	0.45657	0.561000	0.74099	GTG		0.617	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545		49	62	1	0	3.93605e-18	0.01441	6.64706e-18	49	62				
MUC17	140453	broad.mit.edu	37	7	100685958	100685958	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:100685958T>A	ENST00000306151.4	+	3	11325	c.11261T>A	c.(11260-11262)cTt>cAt	p.L3754H		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3754	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATAAGCACCCTTGGGACCACT	0.483																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11260-11262)CTT>CAT		mucin 17 precursor							227.0	220.0	222.0					7																	100685958		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100685958T>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11261T>A	7.37:g.100685958T>A	ENSP00000302716:p.Leu3754His		Somatic				MUC17_uc010lho.1_RNA	p.L3754H	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	11314	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3754			Extracellular (Potential).|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11261T>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	t	7.617	0.676001	0.14841	.	.	ENSG00000169876	ENST00000306151	T	0.02890	4.12	2.18	0.0245	0.14142	.	.	.	.	.	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	D	0.69142	0.962	T	0.45556	-0.9253	9	0.41790	T	0.15	.	3.2297	0.06744	0.0:0.5362:0.278:0.1858	.	3754	Q685J3	MUC17_HUMAN	H	3754	ENSP00000302716:L3754H	ENSP00000302716:L3754H	L	+	2	0	MUC17	100472678	0.001000	0.12720	0.000000	0.03702	0.041000	0.13682	1.132000	0.31418	-0.140000	0.11394	-0.858000	0.03015	CTT		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		100	166	0	0	0	0.01441	0	100	166				
TRIM56	81844	broad.mit.edu	37	7	100731715	100731715	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:100731715G>T	ENST00000306085.6	+	3	1419	c.1122G>T	c.(1120-1122)caG>caT	p.Q374H		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	374					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					AGGAGCAGCAGCCCCAGAAGG	0.642																																					Ovarian(89;1092 1379 22756 38989 39611)	Ovarian(89;1092 1379 22756 38989 39611)	uc003uxq.2		NA																	0				kidney(1)|central_nervous_system(1)|skin(1)	3						c.(1120-1122)CAG>CAT		tripartite motif-containing 56							32.0	40.0	37.0					7																	100731715		2027	4189	6216	SO:0001583	missense	81844				defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding	g.chr7:100731715G>T	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1122G>T	7.37:g.100731715G>T	ENSP00000305161:p.Gln374His		Somatic				TRIM56_uc003uxr.2_Intron	p.Q374H	NM_030961	NP_112223	WXS	Illumina HiSeq	Unspecified	Q9BRZ2	TRI56_HUMAN			3	1353	+	Lung NSC(181;0.136)|all_lung(186;0.182)		374					Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	ENST00000306085.6	37	c.1122G>T	CCDS43625.1	.	.	.	.	.	.	.	.	.	.	G	2.402	-0.337296	0.05278	.	.	ENSG00000169871	ENST00000306085	T	0.41400	1.0	3.32	1.44	0.22558	.	.	.	.	.	T	0.19127	0.0459	N	0.08118	0	0.09310	N	1	B	0.33379	0.41	B	0.28784	0.094	T	0.12066	-1.0562	9	0.45353	T	0.12	.	5.5935	0.17313	0.2629:0.0:0.7371:0.0	.	374	Q9BRZ2	TRI56_HUMAN	H	374	ENSP00000305161:Q374H	ENSP00000305161:Q374H	Q	+	3	2	TRIM56	100518435	0.000000	0.05858	0.001000	0.08648	0.165000	0.22458	0.101000	0.15251	0.379000	0.24794	0.455000	0.32223	CAG		0.642	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961		9	20	1	0	0.00621372	0.006214	0.00664459	9	20				
SERPINE1	5054	broad.mit.edu	37	7	100773858	100773858	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:100773858C>A	ENST00000223095.4	+	3	585	c.428C>A	c.(427-429)aCg>aAg	p.T143K	SERPINE1_ENST00000445463.2_Missense_Mutation_p.T128K	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	143					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TTCCGGAGCACGGTCAAGCAA	0.532																																							uc003uxt.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(427-429)ACG>AAG		plasminogen activator inhibitor-1 isoform 1	Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)						242.0	224.0	230.0					7																	100773858		2203	4300	6503	SO:0001583	missense	5054				angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr7:100773858C>A	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.428C>A	7.37:g.100773858C>A	ENSP00000223095:p.Thr143Lys		Somatic				SERPINE1_uc011kkj.1_Missense_Mutation_p.T128K|SERPINE1_uc003uxu.1_5'Flank	p.T143K	NM_000602	NP_000593	WXS	Illumina HiSeq	Unspecified	P05121	PAI1_HUMAN			3	576	+	Lung NSC(181;0.136)|all_lung(186;0.182)		143					B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	c.428C>A	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	C	1.131	-0.652304	0.03480	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000441467	D;D	0.83837	-1.77;-1.77	5.44	2.14	0.27477	Serpin domain (3);	0.533090	0.21292	N	0.076955	T	0.56262	0.1973	N	0.05574	-0.02	0.19300	N	0.99998	P;P	0.45396	0.687;0.857	B;B	0.25614	0.026;0.062	T	0.52373	-0.8584	10	0.23891	T	0.37	.	10.3834	0.44125	0.0:0.7378:0.0:0.2622	.	128;143	F8WD53;P05121	.;PAI1_HUMAN	K	143;128;128	ENSP00000223095:T143K;ENSP00000396766:T128K	ENSP00000223095:T143K	T	+	2	0	SERPINE1	100560578	0.002000	0.14202	0.062000	0.19696	0.015000	0.08874	0.665000	0.25083	0.648000	0.30732	-0.291000	0.09656	ACG		0.532	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		119	274	1	0	1.324e-77	0.01441	2.51903e-77	119	274				
RELN	5649	broad.mit.edu	37	7	103216019	103216019	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:103216019A>T	ENST00000428762.1	-	29	4438	c.4279T>A	c.(4279-4281)Tgt>Agt	p.C1427S	RELN_ENST00000343529.5_Missense_Mutation_p.C1427S|RELN_ENST00000424685.2_Missense_Mutation_p.C1427S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1427	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCACAGAAACACACTCCTGAA	0.433																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(4279-4281)TGT>AGT		reelin isoform a							140.0	119.0	126.0					7																	103216019		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103216019A>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4279T>A	7.37:g.103216019A>T	ENSP00000392423:p.Cys1427Ser		Somatic				RELN_uc010liz.2_Missense_Mutation_p.C1427S	p.C1427S	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	29	4439	-			1427			EGF-like 3.		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.4279T>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.750569	0.89753	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.48201	0.82;0.82;0.82	5.52	5.52	0.82312	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.73659	0.3615	M	0.89715	3.055	0.58432	D	0.999999	P;D	0.65815	0.955;0.995	P;D	0.67548	0.684;0.952	T	0.80207	-0.1478	10	0.87932	D	0	.	15.9441	0.79779	1.0:0.0:0.0:0.0	.	1427;1427	P78509-2;P78509	.;RELN_HUMAN	S	1427	ENSP00000392423:C1427S;ENSP00000345694:C1427S;ENSP00000388446:C1427S	ENSP00000345694:C1427S	C	-	1	0	RELN	103003255	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.910000	0.92685	2.225000	0.72522	0.460000	0.39030	TGT		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		23	45	0	0	0	0.009535	0	23	45				
IMMP2L	83943	broad.mit.edu	37	7	110526703	110526703	+	Missense_Mutation	SNP	G	G	C	rs374545050		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:110526703G>C	ENST00000405709.2	-	5	796	c.354C>G	c.(352-354)atC>atG	p.I118M	IMMP2L_ENST00000415362.1_Missense_Mutation_p.I118M|IMMP2L_ENST00000331762.3_Missense_Mutation_p.I118M|IMMP2L_ENST00000450877.1_Missense_Mutation_p.I100M|IMMP2L_ENST00000452895.1_Missense_Mutation_p.I118M|IMMP2L_ENST00000489381.1_Intron	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	118					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		CTTCAACCCAGATGTGACCAC	0.398																																							uc003vfq.1		NA																	0					0						c.(352-354)ATC>ATG		IMP2 inner mitochondrial membrane protease-like		G	MET/ILE	0,4406		0,0,2203	141.0	129.0	133.0		354	-0.9	1.0	7		133	1,8599	1.2+/-3.3	0,1,4299	no	missense	IMMP2L	NM_032549.3	10	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign	118/176	110526703	1,13005	2203	4300	6503	SO:0001583	missense	83943				protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity	g.chr7:110526703G>C	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.354C>G	7.37:g.110526703G>C	ENSP00000384966:p.Ile118Met		Somatic				IMMP2L_uc010ljr.1_Missense_Mutation_p.I118M	p.I118M	NM_032549	NP_115938	WXS	Illumina HiSeq	Unspecified	Q96T52	IMP2L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)	5	797	-			118					Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Missense_Mutation	SNP	ENST00000405709.2	37	c.354C>G	CCDS5753.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812501	0.32053	0.0	1.16E-4	ENSG00000184903	ENST00000405709;ENST00000331762;ENST00000452895;ENST00000450877;ENST00000415362	.	.	.	5.58	-0.914	0.10497	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S26A, signal peptidase I, conserved site (1);	0.323184	0.37715	N	0.001965	T	0.40979	0.1139	L	0.37800	1.135	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.11131	-1.0600	9	0.54805	T	0.06	-28.3975	7.4508	0.27237	0.2935:0.439:0.2675:0.0	.	118	Q96T52	IMP2L_HUMAN	M	118;118;118;100;118	.	ENSP00000329553:I118M	I	-	3	3	IMMP2L	110313939	0.554000	0.26522	0.994000	0.49952	0.997000	0.91878	-0.350000	0.07721	-0.202000	0.10268	0.484000	0.47621	ATC		0.398	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549		17	96	0	0	0	0.014323	0	17	96				
PPP1R3A	5506	broad.mit.edu	37	7	113519437	113519437	+	Silent	SNP	G	G	C	rs142416047		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:113519437G>C	ENST00000284601.3	-	4	1778	c.1710C>G	c.(1708-1710)acC>acG	p.T570T		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	570					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGGGGATTGCGGTATGTTCGC	0.468																																							uc010ljy.1		NA																	0				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(1708-1710)ACC>ACG		protein phosphatase 1, regulatory (inhibitor)							121.0	112.0	115.0					7																	113519437		2203	4299	6502	SO:0001819	synonymous_variant	5506				glycogen metabolic process	integral to membrane		g.chr7:113519437G>C	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1710C>G	7.37:g.113519437G>C			Somatic					p.T570T	NM_002711	NP_002702	WXS	Illumina HiSeq	Unspecified	Q16821	PPR3A_HUMAN			4	1741	-			570					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	37	c.1710C>G	CCDS5759.1																																																																																				0.468	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		29	92	0	0	0	0.008361	0	29	92				
PPP1R3A	5506	broad.mit.edu	37	7	113558931	113558931	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:113558931G>T	ENST00000284601.3	-	1	189	c.121C>A	c.(121-123)Cca>Aca	p.P41T		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	41					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CGTCTACTTGGTTGAGGGGAG	0.373																																							uc010ljy.1		NA																	0				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(121-123)CCA>ACA		protein phosphatase 1, regulatory (inhibitor)							81.0	82.0	81.0					7																	113558931		2203	4300	6503	SO:0001583	missense	5506				glycogen metabolic process	integral to membrane		g.chr7:113558931G>T	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.121C>A	7.37:g.113558931G>T	ENSP00000284601:p.Pro41Thr		Somatic					p.P41T	NM_002711	NP_002702	WXS	Illumina HiSeq	Unspecified	Q16821	PPR3A_HUMAN			1	152	-			41					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	c.121C>A	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763062	0.69763	.	.	ENSG00000154415	ENST00000284601	T	0.20463	2.07	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.52370	0.1730	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49588	-0.8924	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	41	Q16821	PPR3A_HUMAN	T	41	ENSP00000284601:P41T	ENSP00000284601:P41T	P	-	1	0	PPP1R3A	113346167	1.000000	0.71417	0.463000	0.27130	0.780000	0.44128	7.333000	0.79214	2.941000	0.99782	0.655000	0.94253	CCA		0.373	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		32	63	1	0	4.90274e-10	0.00623	7.07637e-10	32	63				
TFEC	22797	broad.mit.edu	37	7	115596827	115596827	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:115596827A>T	ENST00000265440.7	-	4	468	c.288T>A	c.(286-288)gaT>gaA	p.D96E	TFEC_ENST00000393485.1_Missense_Mutation_p.D67E|TFEC_ENST00000320239.7_Missense_Mutation_p.D67E|TFEC_ENST00000484212.1_Missense_Mutation_p.D186E|TFEC_ENST00000457268.1_Missense_Mutation_p.D29E	NM_012252.3	NP_036384.1	O14948	TFEC_HUMAN	transcription factor EC	96	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			CGCTATACACATCCAAAATAC	0.318																																							uc003vhj.1		NA																	0				large_intestine(1)	1						c.(286-288)GAT>GAA		transcription factor EC isoform a							89.0	85.0	86.0					7																	115596827		2203	4299	6502	SO:0001583	missense	22797					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr7:115596827A>T	D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000265440.7:c.288T>A	7.37:g.115596827A>T	ENSP00000265440:p.Asp96Glu		Somatic				TFEC_uc003vhk.1_Missense_Mutation_p.D67E|TFEC_uc003vhl.3_Missense_Mutation_p.D67E|TFEC_uc011kmw.1_Missense_Mutation_p.D186E|TFEC_uc003vhm.1_RNA	p.D96E	NM_012252	NP_036384	WXS	Illumina HiSeq	Unspecified	O14948	TFEC_HUMAN	STAD - Stomach adenocarcinoma(10;0.00878)		4	472	-			96			Necessary for transcriptional transactivation.		B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	ENST00000265440.7	37	c.288T>A	CCDS5762.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214098	0.79352	.	.	ENSG00000105967	ENST00000265440;ENST00000457268;ENST00000320239;ENST00000393485;ENST00000484212	T;T;T;T;T	0.26373	1.74;1.82;1.75;2.21;2.07	5.19	2.81	0.32909	.	0.050269	0.85682	D	0.000000	T	0.43612	0.1255	M	0.67953	2.075	0.36947	D	0.892679	D;P;D;D	0.89917	1.0;0.944;0.979;1.0	D;P;P;D	0.80764	0.994;0.655;0.839;0.994	T	0.44847	-0.9301	10	0.54805	T	0.06	-14.8828	7.8383	0.29382	0.7655:0.0:0.2345:0.0	.	186;67;67;96	B7Z757;O14948-3;O14948-2;O14948	.;.;.;TFEC_HUMAN	E	96;29;67;67;186	ENSP00000265440:D96E;ENSP00000387650:D29E;ENSP00000318676:D67E;ENSP00000377125:D67E;ENSP00000417432:D186E	ENSP00000265440:D96E	D	-	3	2	TFEC	115384063	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.211000	0.42825	0.380000	0.24823	0.482000	0.46254	GAT		0.318	TFEC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059839.4	NM_012252		14	34	0	0	0	0.00245	0	14	34				
MET	4233	broad.mit.edu	37	7	116371799	116371799	+	Silent	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:116371799C>T	ENST00000318493.6	+	3	1465	c.1278C>T	c.(1276-1278)cgC>cgT	p.R426R	MET_ENST00000397752.3_Silent_p.R426R|MET_ENST00000495962.1_3'UTR|MET_ENST00000436117.2_Silent_p.R426R			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTTTGCAGCGCGTTGACTTAT	0.433			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		0				upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(1276-1278)CGC>CGT		met proto-oncogene isoform b precursor							119.0	111.0	114.0					7																	116371799		1920	4113	6033	SO:0001819	synonymous_variant	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116371799C>T	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1278C>T	7.37:g.116371799C>T			Somatic				MET_uc010lkh.2_Silent_p.R426R|MET_uc011knc.1_Silent_p.R426R|MET_uc011knd.1_Silent_p.R426R|MET_uc011kne.1_Silent_p.R426R|MET_uc011knf.1_Silent_p.R426R|MET_uc011kng.1_Silent_p.R426R|MET_uc011knh.1_Silent_p.R426R|MET_uc011kni.1_Silent_p.R426R|MET_uc011knj.1_5'UTR|MET_uc010lkg.2_Silent_p.R426R|MET_uc011kna.1_Silent_p.R426R|MET_uc011knb.1_Silent_p.R426R	p.R426R	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		3	1465	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	426			Extracellular (Potential).|Sema.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	ENST00000318493.6	37	c.1278C>T	CCDS47689.1																																																																																				0.433	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			13	63	0	0	0	0.001855	0	13	63				
PTPRZ1	5803	broad.mit.edu	37	7	121650942	121650942	+	Silent	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:121650942A>T	ENST00000393386.2	+	12	2253	c.1842A>T	c.(1840-1842)ccA>ccT	p.P614P	PTPRZ1_ENST00000449182.1_Silent_p.P614P	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	614					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						CCGAAAACCCAGAGACAATAA	0.418																																							uc003vjy.2		NA																	0				ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(1840-1842)CCA>CCT		protein tyrosine phosphatase, receptor-type,							50.0	51.0	51.0					7																	121650942		2203	4300	6503	SO:0001819	synonymous_variant	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121650942A>T	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1842A>T	7.37:g.121650942A>T			Somatic				PTPRZ1_uc003vjz.2_Silent_p.P614P|PTPRZ1_uc011knt.1_Silent_p.P64P	p.P614P	NM_002851	NP_002842	WXS	Illumina HiSeq	Unspecified	P23471	PTPRZ_HUMAN			12	2237	+			614			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	c.1842A>T	CCDS34740.1																																																																																				0.418	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		23	35	0	0	0	0.005443	0	23	35				
SLC13A1	6561	broad.mit.edu	37	7	122787356	122787356	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:122787356G>T	ENST00000194130.2	-	7	708	c.669C>A	c.(667-669)ggC>ggA	p.G223G	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	223					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TGGTTCTCATGCCTGAGTTCT	0.413																																							uc003vkm.2		NA																	0				ovary(2)	2						c.(667-669)GGC>GGA		solute carrier family 13 (sodium/sulfate	Succinic acid(DB00139)						173.0	136.0	149.0					7																	122787356		2203	4300	6503	SO:0001819	synonymous_variant	6561					integral to membrane|plasma membrane	sodium:sulfate symporter activity	g.chr7:122787356G>T		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.669C>A	7.37:g.122787356G>T			Somatic				SLC13A1_uc010lks.2_Silent_p.G99G	p.G223G	NM_022444	NP_071889	WXS	Illumina HiSeq	Unspecified	Q9BZW2	S13A1_HUMAN			7	694	-			223					Q9H5Z0	Silent	SNP	ENST00000194130.2	37	c.669C>A	CCDS5786.1																																																																																				0.413	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444		6	14	1	0	0.00307968	0.00308	0.00332356	6	14				
GRM8	2918	broad.mit.edu	37	7	126173364	126173365	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:126173364_126173365CT>AA	ENST00000339582.2	-	9	2879_2880	c.2071_2072AG>TT	c.(2071-2073)AGt>TTt	p.S691F	GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000444921.2_Missense_Mutation_p.S691F|GRM8_ENST00000358373.3_Missense_Mutation_p.S691F			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	691					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.S691T(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AGATGCTGGACTAATGAACTTG	0.5										HNSCC(24;0.065)																													uc003vlr.2		NA																	1	Substitution - Missense(1)	p.S691T(1)	breast(1)	lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(2071-2073)AGT>TTT		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)																																			SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126173364_126173365CT>AA		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2071_2072delinsAA	7.37:g.126173364_126173365delinsAA	ENSP00000344173:p.Ser691Phe	HNSCC(24;0.065)	Somatic				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.S691F|GRM8_uc010lkz.1_RNA	p.S691F	NM_000845	NP_000836	WXS	Illumina HiSeq	Unspecified	O00222	GRM8_HUMAN			8	2382_2383	-		Prostate(267;0.186)	691			Cytoplasmic (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	DNP	ENST00000339582.2	37	c.2071_2072AG>TT	CCDS5794.1																																																																																				0.500	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			43	53	0	0	0	0.004672	0	43	53				
LEP	3952	broad.mit.edu	37	7	127894638	127894638	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:127894638A>T	ENST00000308868.4	+	3	377	c.326A>T	c.(325-327)cAc>cTc	p.H109L		NM_000230.2	NP_000221.1	P41159	LEP_HUMAN	leptin	109					adipose tissue development (GO:0060612)|adult feeding behavior (GO:0008343)|bile acid metabolic process (GO:0008206)|bone mineralization involved in bone maturation (GO:0035630)|cellular response to L-ascorbic acid (GO:0071298)|cellular response to retinoic acid (GO:0071300)|central nervous system neuron development (GO:0021954)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|fatty acid beta-oxidation (GO:0006635)|female pregnancy (GO:0007565)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process (GO:0006114)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|leptin-mediated signaling pathway (GO:0033210)|leukocyte tethering or rolling (GO:0050901)|negative regulation of apoptotic process (GO:0043066)|negative regulation of appetite (GO:0032099)|negative regulation of cartilage development (GO:0061037)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of glutamine transport (GO:2000486)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vasoconstriction (GO:0045906)|ovulation from ovarian follicle (GO:0001542)|placenta development (GO:0001890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of developmental growth (GO:0048639)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of ion transport (GO:0043270)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of blood pressure (GO:0008217)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis (GO:0006111)|regulation of insulin secretion (GO:0050796)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of lipoprotein lipid oxidation (GO:0060587)|regulation of steroid biosynthetic process (GO:0050810)|response to dietary excess (GO:0002021)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to vitamin E (GO:0033197)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)				endometrium(1)|large_intestine(2)|lung(5)	8						GATCTTCTTCACGTGCTGGCC	0.567																																							uc003vml.2		NA																	0					0						c.(325-327)CAC>CTC		leptin precursor							85.0	83.0	83.0					7																	127894638		2203	4300	6503	SO:0001583	missense	3952				adult feeding behavior|energy reserve metabolic process|negative regulation of appetite|placenta development|positive regulation of developmental growth	extracellular space		g.chr7:127894638A>T		CCDS5800.1	7q31	2008-03-06	2008-03-06		ENSG00000174697	ENSG00000174697			6553	protein-coding gene	gene with protein product		164160	"""leptin (murine obesity homolog)"", ""leptin (obesity homolog, mouse)"""	OBS, OB		1686014, 16932309	Standard	NM_000230		Approved		uc003vml.2	P41159	OTTHUMG00000157564	ENST00000308868.4:c.326A>T	7.37:g.127894638A>T	ENSP00000312652:p.His109Leu		Somatic				LEP_uc003vmm.2_Missense_Mutation_p.H108L	p.H109L	NM_000230	NP_000221	WXS	Illumina HiSeq	Unspecified	P41159	LEP_HUMAN			3	383	+			109					O15158|Q56A88	Missense_Mutation	SNP	ENST00000308868.4	37	c.326A>T	CCDS5800.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.529073	0.44969	.	.	ENSG00000174697	ENST00000308868	T	0.74947	-0.89	5.76	3.26	0.37387	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.434043	0.22019	N	0.065748	T	0.72787	0.3504	M	0.78049	2.395	0.35623	D	0.809626	P;P	0.45396	0.857;0.857	B;B	0.43950	0.437;0.437	T	0.77696	-0.2491	10	0.59425	D	0.04	-12.932	5.2522	0.15529	0.7292:0.1803:0.0905:0.0	.	109;109	A4D0Y8;P41159	.;LEP_HUMAN	L	109	ENSP00000312652:H109L	ENSP00000312652:H109L	H	+	2	0	LEP	127681874	0.015000	0.18098	0.999000	0.59377	0.177000	0.22998	0.383000	0.20651	1.020000	0.39573	0.533000	0.62120	CAC		0.567	LEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349174.1			17	40	0	0	0	0.007413	0	17	40				
PLXNA4	91584	broad.mit.edu	37	7	132192822	132192823	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:132192822_132192823CC>TA	ENST00000359827.3	-	2	1592_1593	c.630_631GG>TA	c.(628-633)gcGGat>gcTAat	p.D211N	PLXNA4_ENST00000423507.2_Missense_Mutation_p.D211N|PLXNA4_ENST00000378539.5_Missense_Mutation_p.D211N|PLXNA4_ENST00000321063.4_Missense_Mutation_p.D211N			Q9HCM2	PLXA4_HUMAN	plexin A4	211	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AACATGCCATCCGCCTCAGAGT	0.515																																							uc003vra.3		NA																	0				ovary(1)	1						c.(628-633)GCGGAT>GCTAAT		plexin A4 isoform 1																																				SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:132192822_132192823CC>TA	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.630_631delinsTA	7.37:g.132192822_132192823delinsTA	ENSP00000352882:p.Asp211Asn		Somatic				PLXNA4_uc003vrc.2_Missense_Mutation_p.D211N|PLXNA4_uc003vrb.2_Missense_Mutation_p.D211N	p.D211N	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			2	859_860	-			211			Extracellular (Potential).|Sema.		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	DNP	ENST00000359827.3	37	c.630_631GG>TA	CCDS43646.1																																																																																				0.515	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		30	90	0	0	0	0.004672	0	30	90				
AKR1B15	441282	broad.mit.edu	37	7	134260294	134260294	+	Splice_Site	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:134260294G>T	ENST00000457545.2	+	7	896	c.636G>T	c.(634-636)caG>caT	p.Q212H	AKR1B15_ENST00000423958.1_Splice_Site_p.Q184H	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	212							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						TGACTAACCAGGTAAATTCTA	0.458																																							uc011kpr.1		NA																	0				ovary(1)	1						c.(634-636)CAG>CAT		aldo-keto reductase family 1, member B15							67.0	74.0	72.0					7																	134260294		2202	4297	6499	SO:0001630	splice_region_variant	441282						oxidoreductase activity	g.chr7:134260294G>T		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.636+1G>T	7.37:g.134260294G>T			Somatic				AKR1B15_uc011kps.1_Missense_Mutation_p.Q184H	p.Q212H	NM_001080538	NP_001074007	WXS	Illumina HiSeq	Unspecified	C9JRZ8	AK1BF_HUMAN			7	935	+			212				NADP (By similarity).	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	c.636G>T	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	G	19.40	3.821243	0.71028	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.31769	1.48;1.48	3.82	3.82	0.43975	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.71221	0.3314	H	0.98866	4.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84158	0.0427	9	0.87932	D	0	.	14.4026	0.67060	0.0:0.0:1.0:0.0	.	184;212	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	H	212;184	ENSP00000389289:Q212H;ENSP00000397009:Q184H	ENSP00000397009:Q184H	Q	+	3	2	AKR1B15	133910834	1.000000	0.71417	0.999000	0.59377	0.822000	0.46500	7.081000	0.76844	1.937000	0.56155	0.543000	0.68304	CAG		0.458	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		Missense_Mutation	42	110	1	0	3.28156e-27	0.01441	5.84496e-27	42	110				
CALD1	800	broad.mit.edu	37	7	134552502	134552502	+	Silent	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:134552502T>A	ENST00000361675.2	+	3	247	c.18T>A	c.(16-18)cgT>cgA	p.R6R	CALD1_ENST00000422748.1_Silent_p.R6R|CALD1_ENST00000417172.1_Silent_p.R6R|CALD1_ENST00000361901.2_Silent_p.R6R|CALD1_ENST00000361388.2_Silent_p.R6R			Q05682	CALD1_HUMAN	caldesmon 1	6					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						ATTTTGAGCGTCGCAGAGAAC	0.433																																							uc003vrz.2		NA																	0					0						c.(16-18)CGT>CGA		caldesmon 1 isoform 1							87.0	81.0	83.0					7																	134552502		2203	4300	6503	SO:0001819	synonymous_variant	800				cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding	g.chr7:134552502T>A	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.18T>A	7.37:g.134552502T>A			Somatic				CALD1_uc003vry.2_Silent_p.R6R|CALD1_uc003vsa.2_Silent_p.R6R|CALD1_uc003vsb.2_Silent_p.R6R|CALD1_uc010lmm.2_Silent_p.R6R|CALD1_uc011kpt.1_5'UTR	p.R6R	NM_033138	NP_149129	WXS	Illumina HiSeq	Unspecified	Q05682	CALD1_HUMAN			3	477	+			6					A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Silent	SNP	ENST00000361675.2	37	c.18T>A	CCDS5835.1																																																																																				0.433	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138		20	25	0	0	0	0.005443	0	20	25				
ATP6V0A4	50617	broad.mit.edu	37	7	138406718	138406718	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:138406718C>A	ENST00000310018.2	-	19	2345	c.2063G>T	c.(2062-2064)aGc>aTc	p.S688I	ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.S688I|ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.S688I	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	688					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AGGGCTGGAGCTATCACCTTC	0.552																																							uc003vuf.2		NA																	0				pancreas(1)	1						c.(2062-2064)AGC>ATC		ATPase, H+ transporting, lysosomal V0 subunit							96.0	83.0	87.0					7																	138406718		2203	4300	6503	SO:0001583	missense	50617				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity	g.chr7:138406718C>A	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.2063G>T	7.37:g.138406718C>A	ENSP00000308122:p.Ser688Ile		Somatic				ATP6V0A4_uc003vug.2_Missense_Mutation_p.S688I|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.S688I	p.S688I	NM_130841	NP_570856	WXS	Illumina HiSeq	Unspecified	Q9HBG4	VPP4_HUMAN			18	2301	-			688			Cytoplasmic (Potential).		A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	c.2063G>T	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	C	9.207	1.029837	0.19512	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.85013	-1.93;-1.93;-1.93	4.55	-2.21	0.06973	.	2.722220	0.00954	N	0.003005	T	0.75657	0.3879	L	0.31371	0.925	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.58769	-0.7578	10	0.42905	T	0.14	1.2482	4.1719	0.10334	0.1651:0.3926:0.0:0.4424	.	688	Q9HBG4	VPP4_HUMAN	I	688	ENSP00000308122:S688I;ENSP00000376774:S688I;ENSP00000253856:S688I	ENSP00000308122:S688I	S	-	2	0	ATP6V0A4	138057258	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.306000	0.01133	-0.227000	0.09884	-0.136000	0.14681	AGC		0.552	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632		16	28	1	0	1.99824e-07	0.00499	2.56791e-07	16	28				
SSPO	23145	broad.mit.edu	37	7	149499006	149499006	+	RNA	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:149499006G>T	ENST00000378016.2	+	0	7458							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGACCTGCGGCCTGACTGCC	0.687																																							uc010lpk.2		NA																	0					0						c.(7456-7458)CGG>CGT		SCO-spondin precursor							25.0	27.0	27.0					7																	149499006		2142	4238	6380			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149499006G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149499006G>T			Somatic					p.R2486R	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		51	7458	+	Melanoma(164;0.165)|Ovarian(565;0.177)		2486			LDL-receptor class A 10.		Q76B61	Silent	SNP	ENST00000378016.2	37	c.7458G>T																																																																																					0.687	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				4	33	1	0	0.00116845	0.001168	0.00127269	4	33				
LRRC61	65999	broad.mit.edu	37	7	150034263	150034263	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:150034263G>A	ENST00000359623.4	+	3	901	c.313G>A	c.(313-315)Gca>Aca	p.A105T	LRRC61_ENST00000493307.1_Missense_Mutation_p.A105T|LRRC61_ENST00000323078.7_Missense_Mutation_p.A105T	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	105										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCTCAATGCCGCAGGCAACCT	0.642																																							uc003wgv.2		NA																	0					0						c.(313-315)GCA>ACA		leucine rich repeat containing 61							33.0	34.0	34.0					7																	150034263		2203	4300	6503	SO:0001583	missense	65999							g.chr7:150034263G>A	BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.313G>A	7.37:g.150034263G>A	ENSP00000352642:p.Ala105Thr		Somatic				LRRC61_uc003wgx.2_Missense_Mutation_p.A105T|LRRC61_uc003wgw.2_Missense_Mutation_p.A105T|LRRC61_uc003wgz.3_Missense_Mutation_p.A105T	p.A105T	NM_023942	NP_076431	WXS	Illumina HiSeq	Unspecified	Q9BV99	LRC61_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)		3	987	+			105			LRR 4.		B3KUW0|D3DWY8	Missense_Mutation	SNP	ENST00000359623.4	37	c.313G>A	CCDS5901.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231161	0.39399	.	.	ENSG00000127399	ENST00000323078;ENST00000359623;ENST00000493307	T;T;T	0.23754	1.89;1.89;1.89	4.66	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.16041	0.0386	L	0.31804	0.96	0.53005	D	0.999969	B	0.33494	0.414	B	0.28232	0.087	T	0.05273	-1.0895	10	0.15499	T	0.54	-11.6754	12.042	0.53458	0.0:0.0:0.8262:0.1738	.	105	Q9BV99	LRC61_HUMAN	T	105	ENSP00000339047:A105T;ENSP00000352642:A105T;ENSP00000420560:A105T	ENSP00000339047:A105T	A	+	1	0	LRRC61	149665196	1.000000	0.71417	0.039000	0.18376	0.589000	0.36550	4.956000	0.63645	0.960000	0.38005	-0.467000	0.05162	GCA		0.642	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350696.1	NM_023942		4	32	0	0	0	0.000602	0	4	32				
GIMAP6	474344	broad.mit.edu	37	7	150324908	150324908	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:150324908C>A	ENST00000328902.5	-	3	994	c.778G>T	c.(778-780)Gag>Tag	p.E260*	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	260						cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCACGTCCTCAGAGCCTTGG	0.522																																							uc003whn.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(778-780)GAG>TAG		GTPase, IMAP family member 6							134.0	109.0	118.0					7																	150324908		2203	4300	6503	SO:0001587	stop_gained	474344						GTP binding	g.chr7:150324908C>A	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.778G>T	7.37:g.150324908C>A	ENSP00000330374:p.Glu260*		Somatic				GIMAP6_uc003whm.2_Nonsense_Mutation_p.E180*	p.E260*	NM_024711	NP_078987	WXS	Illumina HiSeq	Unspecified	Q6P9H5	GIMA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	1202	-			260					C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Nonsense_Mutation	SNP	ENST00000328902.5	37	c.778G>T	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515431	0.64634	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	.	.	.	3.96	-1.7	0.08159	.	1.342970	0.04890	N	0.449315	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	4.3434	0.11120	0.0:0.3792:0.3165:0.3043	.	.	.	.	X	260;321	.	ENSP00000330374:E260X	E	-	1	0	GIMAP6	149955841	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.804000	0.04535	-0.269000	0.09298	0.655000	0.94253	GAG		0.522	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711		33	35	1	0	2.38352e-08	0.004289	3.2407e-08	33	35				
KMT2C	58508	broad.mit.edu	37	7	151859569	151859569	+	Missense_Mutation	SNP	G	G	A	rs138747124		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:151859569G>A	ENST00000262189.6	-	43	11311	c.11093C>T	c.(11092-11094)aCg>aTg	p.T3698M	KMT2C_ENST00000355193.2_Missense_Mutation_p.T3698M	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3698			T -> S (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A3700fs*26(2)|p.T3698M(2)									ATTTGCATACGTCTGTTGATT	0.468																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		4	Substitution - Missense(2)|Insertion - Frameshift(2)	p.T3698S(1)	large_intestine(2)|breast(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(11092-11094)ACG>ATG		myeloid/lymphoid or mixed-lineage leukemia 3		G	MET/THR	3,4403	6.2+/-15.9	0,3,2200	242.0	245.0	244.0		11093	3.7	0.0	7	dbSNP_134	244	0,8600		0,0,4300	yes	missense	MLL3	NM_170606.2	81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	3698/4912	151859569	3,13003	2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151859569G>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11093C>T	7.37:g.151859569G>A	ENSP00000262189:p.Thr3698Met		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.T2759M|MLL3_uc003wky.2_Missense_Mutation_p.T1207M	p.T3698M	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	43	11312	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	3698		T -> S (in a colorectal cancer sample; somatic mutation).			Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.11093C>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417134	0.25552	6.81E-4	0.0	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.88896	-1.77;-1.75;-2.44	5.51	3.71	0.42584	.	0.507408	0.16272	U	0.221726	T	0.78685	0.4322	L	0.34521	1.04	0.09310	N	0.999999	P;B;B	0.44309	0.832;0.079;0.079	B;B;B	0.32805	0.153;0.014;0.014	T	0.70824	-0.4767	10	0.66056	D	0.02	.	6.3582	0.21412	0.0698:0.132:0.6612:0.137	.	3698;2759;3698	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	M	3698;3698;284	ENSP00000262189:T3698M;ENSP00000347325:T3698M;ENSP00000410411:T284M	ENSP00000262189:T3698M	T	-	2	0	MLL3	151490502	0.025000	0.19082	0.000000	0.03702	0.009000	0.06853	1.008000	0.29872	0.693000	0.31634	0.650000	0.86243	ACG		0.468	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			6	251	0	0	0	0.00308	0	6	251				
RP1L1	94137	broad.mit.edu	37	8	10466664	10466664	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:10466664G>T	ENST00000382483.3	-	4	5167	c.4944C>A	c.(4942-4944)ggC>ggA	p.G1648G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1728					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCGCCTCCTCGCCCAGCTGGC	0.677																																							uc003wtc.2		NA																	0		p.G1648D(1)		ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4942-4944)GGC>GGA		retinitis pigmentosa 1-like 1							29.0	33.0	31.0					8																	10466664		1997	4155	6152	SO:0001819	synonymous_variant	94137				intracellular signal transduction			g.chr8:10466664G>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4944C>A	8.37:g.10466664G>T			Somatic					p.G1648G	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5173	-			1648					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	c.4944C>A	CCDS43708.1																																																																																				0.677	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			8	15	1	0	1.58986e-06	0.008291	1.97386e-06	8	15				
MTUS1	57509	broad.mit.edu	37	8	17581246	17581246	+	Missense_Mutation	SNP	C	C	T	rs190088038		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:17581246C>T	ENST00000262102.6	-	4	2608	c.2384G>A	c.(2383-2385)cGg>cAg	p.R795Q	MTUS1_ENST00000519263.1_Intron|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_5'Flank|MTUS1_ENST00000381861.3_5'Flank	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	795					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TCCTGTCCTCCGCAGCGCAGG	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		15727	0.001		0.0	False		,,,				2504	0.0						uc003wxv.2		NA																	0				ovary(1)|skin(1)	2						c.(2383-2385)CGG>CAG		mitochondrial tumor suppressor 1 isoform 1		C	GLN/ARG,	1,3853		0,1,1926	123.0	117.0	119.0		2384,	0.5	0.0	8		119	0,8248		0,0,4124	no	missense,intron	MTUS1	NM_001001924.2,NM_001001925.2	43,	0,1,6050	TT,TC,CC		0.0,0.0259,0.0083	possibly-damaging,	795/1271,	17581246	1,12101	1927	4124	6051	SO:0001583	missense	57509					Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle		g.chr8:17581246C>T	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2384G>A	8.37:g.17581246C>T	ENSP00000262102:p.Arg795Gln		Somatic				MTUS1_uc003wxt.2_5'Flank|MTUS1_uc011kyg.1_5'Flank|MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Intron|MTUS1_uc010lsz.2_Missense_Mutation_p.R795Q	p.R795Q	NM_001001924	NP_001001924	WXS	Illumina HiSeq	Unspecified	Q9ULD2	MTUS1_HUMAN		Colorectal(111;0.0778)	4	2858	-			795					A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	c.2384G>A	CCDS43717.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.10	1.256486	0.22965	2.59E-4	0.0	ENSG00000129422	ENST00000262102	T	0.35605	1.3	3.42	0.511	0.16989	.	0.869334	0.09600	N	0.780298	T	0.14700	0.0355	N	0.11560	0.145	0.09310	N	0.999998	B	0.23490	0.086	B	0.15870	0.014	T	0.30119	-0.9989	10	0.08837	T	0.75	0.0362	4.5033	0.11874	0.0:0.444:0.1657:0.3903	.	795	Q9ULD2	MTUS1_HUMAN	Q	795	ENSP00000262102:R795Q	ENSP00000262102:R795Q	R	-	2	0	MTUS1	17625526	0.000000	0.05858	0.002000	0.10522	0.980000	0.70556	-0.189000	0.09629	0.079000	0.16929	0.655000	0.94253	CGG		0.488	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031		8	32	0	0	0	0.00308	0	8	32				
UNC5D	137970	broad.mit.edu	37	8	35544126	35544127	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:35544126_35544127GG>TT	ENST00000404895.2	+	7	1311_1312	c.983_984GG>TT	c.(982-984)cGG>cTT	p.R328L	UNC5D_ENST00000416672.1_Missense_Mutation_p.R328L|UNC5D_ENST00000453357.2_Missense_Mutation_p.R323L|UNC5D_ENST00000287272.2_Missense_Mutation_p.R272L|UNC5D_ENST00000420357.1_Missense_Mutation_p.R272L	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	328	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.R323Q(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAACATTTGCGGATCCGGGAGT	0.5																																							uc003xjr.1		NA																	1	Substitution - Missense(1)		endometrium(1)	upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(982-984)CGG>CTT		unc-5 homolog D precursor																																				SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35544126_35544127GG>TT	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	Exception_encountered	8.37:g.35544126_35544127delinsTT	ENSP00000385143:p.Arg328Leu		Somatic				UNC5D_uc003xjs.1_Missense_Mutation_p.R323L|UNC5D_uc003xjt.1_Missense_Mutation_p.R97L	p.R328L	NM_080872	NP_543148	WXS	Illumina HiSeq	Unspecified	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	7	1311_1312	+			328			Extracellular (Potential).|TSP type-1 2.		Q8WYP7	Missense_Mutation	DNP	ENST00000404895.2	37	c.983_984GG>TT	CCDS6093.2																																																																																				0.500	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			9	48	0	0	0	0.004672	0	9	48				
KCNU1	157855	broad.mit.edu	37	8	36793211	36793211	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:36793211C>G	ENST00000399881.3	+	27	3260	c.3223C>G	c.(3223-3225)Cct>Gct	p.P1075A		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	1075					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CACAAATTGTCCTCCCACCAT	0.373																																							uc010lvw.2		NA																	0				ovary(1)	1						c.(3223-3225)CCT>GCT		potassium channel, subfamily U, member 1							145.0	142.0	143.0					8																	36793211		1930	4149	6079	SO:0001583	missense	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36793211C>G	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.3223C>G	8.37:g.36793211C>G	ENSP00000382770:p.Pro1075Ala		Somatic					p.P1075A	NM_001031836	NP_001027006	WXS	Illumina HiSeq	Unspecified	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	27	3310	+			1075			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000399881.3	37	c.3223C>G	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.264085	0.23136	.	.	ENSG00000215262	ENST00000399881	T	0.33654	1.4	4.67	-4.08	0.03963	.	.	.	.	.	T	0.20941	0.0504	N	0.25647	0.755	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.22521	-1.0214	9	0.59425	D	0.04	.	5.4729	0.16680	0.0:0.2461:0.2717:0.4823	.	1075	A8MYU2	KCNU1_HUMAN	A	1075	ENSP00000382770:P1075A	ENSP00000382770:P1075A	P	+	1	0	KCNU1	36912369	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.493000	0.06459	-1.028000	0.03321	0.655000	0.94253	CCT		0.373	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		13	44	0	0	0	0.001855	0	13	44				
CHRNB3	1142	broad.mit.edu	37	8	42587132	42587132	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:42587132G>T	ENST00000289957.2	+	5	810	c.682G>T	c.(682-684)Gtc>Ttc	p.V228F		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	228					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	GTATTCCTTCGTCCTGAGACG	0.478																																							uc003xpi.1		NA																	0				ovary(1)	1						c.(682-684)GTC>TTC		cholinergic receptor, nicotinic, beta							89.0	92.0	91.0					8																	42587132		2203	4300	6503	SO:0001583	missense	1142				synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr8:42587132G>T	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.682G>T	8.37:g.42587132G>T	ENSP00000289957:p.Val228Phe		Somatic					p.V228F	NM_000749	NP_000740	WXS	Illumina HiSeq	Unspecified	Q05901	ACHB3_HUMAN	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		5	810	+	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	228			Extracellular (Potential).		Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	c.682G>T	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	g	14.12	2.441713	0.43326	.	.	ENSG00000147432	ENST00000289957	T	0.80033	-1.33	5.46	5.46	0.80206	Neurotransmitter-gated ion-channel ligand-binding (3);	0.052626	0.85682	D	0.000000	D	0.86497	0.5947	M	0.66939	2.045	0.48395	D	0.999643	D	0.65815	0.995	D	0.69824	0.966	T	0.82649	-0.0353	10	0.14252	T	0.57	.	14.127	0.65228	0.0:0.0:0.8128:0.1872	.	228	Q05901	ACHB3_HUMAN	F	228	ENSP00000289957:V228F	ENSP00000289957:V228F	V	+	1	0	CHRNB3	42706289	0.929000	0.31497	0.109000	0.21407	0.265000	0.26407	2.384000	0.44362	2.568000	0.86640	0.558000	0.71614	GTC		0.478	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1			28	19	1	0	1.32003e-05	0.005443	1.58188e-05	28	19				
TOX	9760	broad.mit.edu	37	8	59764193	59764193	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:59764193T>C	ENST00000361421.1	-	4	803	c.583A>G	c.(583-585)Atg>Gtg	p.M195V		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	195						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CTTCCTCCCATATTCAAACCA	0.517																																					Pancreas(161;610 1969 17913 21374 22725)	Pancreas(161;610 1969 17913 21374 22725)	uc003xtw.1		NA																	0				kidney(2)|lung(1)|skin(1)	4						c.(583-585)ATG>GTG		thymus high mobility group box protein TOX							149.0	122.0	131.0					8																	59764193		2203	4300	6503	SO:0001583	missense	9760					nucleus	DNA binding	g.chr8:59764193T>C		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.583A>G	8.37:g.59764193T>C	ENSP00000354842:p.Met195Val		Somatic					p.M195V	NM_014729	NP_055544	WXS	Illumina HiSeq	Unspecified	O94900	TOX_HUMAN			4	804	-		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)	195					Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	37	c.583A>G	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	T	12.09	1.832743	0.32421	.	.	ENSG00000198846	ENST00000361421	T	0.11385	2.78	5.82	3.42	0.39159	.	0.131843	0.64402	N	0.000002	T	0.09862	0.0242	L	0.36672	1.1	0.38457	D	0.947116	P	0.48764	0.915	B	0.43990	0.438	T	0.23691	-1.0181	9	.	.	.	.	8.797	0.34885	0.0:0.0662:0.1284:0.8054	.	195	O94900	TOX_HUMAN	V	195	ENSP00000354842:M195V	.	M	-	1	0	TOX	59926747	1.000000	0.71417	0.977000	0.42913	0.984000	0.73092	2.551000	0.45820	0.453000	0.26858	0.454000	0.30748	ATG		0.517	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729		7	31	0	0	0	0.004482	0	7	31				
TRIM55	84675	broad.mit.edu	37	8	67066507	67066507	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:67066507G>T	ENST00000315962.4	+	9	1835	c.1462G>T	c.(1462-1464)Gca>Tca	p.A488S	TRIM55_ENST00000353317.5_Intron|TRIM55_ENST00000276573.7_Missense_Mutation_p.A488S|TRIM55_ENST00000350034.4_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	488					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			GGCAGCAGCCGCAGCGAGTGA	0.567																																							uc003xvv.2		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1462-1464)GCA>TCA		tripartite motif-containing 55 isoform 1							65.0	63.0	64.0					8																	67066507		2203	4300	6503	SO:0001583	missense	84675					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding	g.chr8:67066507G>T	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1462G>T	8.37:g.67066507G>T	ENSP00000323913:p.Ala488Ser		Somatic				TRIM55_uc003xvu.2_Missense_Mutation_p.A488S|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	p.A488S	NM_184085	NP_908973	WXS	Illumina HiSeq	Unspecified	Q9BYV6	TRI55_HUMAN	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		9	1688	+		Lung NSC(129;0.138)|all_lung(136;0.221)	488					B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	c.1462G>T	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175291	0.38413	.	.	ENSG00000147573	ENST00000315962;ENST00000276573	T;T	0.37235	1.21;1.26	5.89	5.0	0.66597	.	0.000000	0.64402	D	0.000008	T	0.27697	0.0681	L	0.29908	0.895	0.80722	D	1	P;P	0.47762	0.9;0.897	B;B	0.42959	0.402;0.403	T	0.05852	-1.0860	10	0.62326	D	0.03	.	8.3994	0.32576	0.1336:0.1304:0.736:0.0	.	488;488	Q9BYV6;Q9BYV6-3	TRI55_HUMAN;.	S	488	ENSP00000323913:A488S;ENSP00000276573:A488S	ENSP00000276573:A488S	A	+	1	0	TRIM55	67229061	0.998000	0.40836	0.992000	0.48379	0.071000	0.16799	2.550000	0.45811	1.466000	0.48025	0.650000	0.86243	GCA		0.567	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085		16	25	1	0	1.67942e-08	0.006122	2.31018e-08	16	25				
CSPP1	79848	broad.mit.edu	37	8	68049813	68049813	+	Silent	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:68049813C>G	ENST00000262210.5	+	15	1966	c.1935C>G	c.(1933-1935)ctC>ctG	p.L645L	CSPP1_ENST00000412460.1_Silent_p.L351L	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	680					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GTGCTCCTCTCAGGGATGCAA	0.338																																							uc003xxi.2		NA																	0				ovary(3)|breast(2)	5						c.(2038-2040)CTC>CTG		centrosome spindle pole associated protein 1							99.0	98.0	98.0					8																	68049813		1839	4086	5925	SO:0001819	synonymous_variant	79848					centrosome|microtubule|spindle		g.chr8:68049813C>G	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.1935C>G	8.37:g.68049813C>G			Somatic				CSPP1_uc003xxg.1_Silent_p.L672L|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Silent_p.L645L|CSPP1_uc003xxk.2_Silent_p.L351L	p.L680L	NM_001077204	NP_001070672	WXS	Illumina HiSeq	Unspecified	Q1MSJ5	CSPP1_HUMAN	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)		17	2071	+	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	680					A6ND63|Q70F00|Q8TBC1	Silent	SNP	ENST00000262210.5	37	c.2040C>G	CCDS43744.1																																																																																				0.338	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		9	21	0	0	0	0.010729	0	9	21				
TRPA1	8989	broad.mit.edu	37	8	72971673	72971673	+	Splice_Site	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:72971673T>A	ENST00000262209.4	-	8	1152	c.945A>T	c.(943-945)agA>agT	p.R315S		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	315					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ACAATGAAGCTCTGAAAAAAC	0.229																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(943-945)AGA>AGT		ankyrin-like protein 1	Menthol(DB00825)						17.0	20.0	19.0					8																	72971673		2146	4174	6320	SO:0001630	splice_region_variant	8989					integral to plasma membrane		g.chr8:72971673T>A	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.945-1A>T	8.37:g.72971673T>A			Somatic					p.R315S	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		8	1120	-			315			ANK 8.|Cytoplasmic (Potential).		A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	c.945A>T	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.064722	0.55432	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.63580	-0.05;-0.05	5.02	2.65	0.31530	Ankyrin repeat-containing domain (4);	0.044446	0.85682	D	0.000000	T	0.59155	0.2173	N	0.17248	0.465	0.38150	D	0.938707	D	0.76494	0.999	D	0.72982	0.979	T	0.55604	-0.8115	10	0.22109	T	0.4	.	9.2792	0.37718	0.0:0.2785:0.0:0.7215	.	315	O75762	TRPA1_HUMAN	S	167;315	ENSP00000428151:R167S;ENSP00000262209:R315S	ENSP00000262209:R315S	R	-	3	2	TRPA1	73134227	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	0.642000	0.24735	0.462000	0.27095	0.533000	0.62120	AGA		0.229	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	Missense_Mutation	26	27	0	0	0	0.003755	0	26	27				
LRRCC1	85444	broad.mit.edu	37	8	86025304	86025304	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:86025304G>A	ENST00000360375.3	+	4	663	c.514G>A	c.(514-516)Gga>Aga	p.G172R	LRRCC1_ENST00000414626.2_Missense_Mutation_p.G152R	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	172					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						GGAGAAAGATGGAGACGATAA	0.323																																							uc003ycw.2		NA																	0					0						c.(514-516)GGA>AGA		sodium channel associated protein 2 isoform a							126.0	113.0	117.0					8																	86025304		1838	4096	5934	SO:0001583	missense	85444				cell division|mitosis	centriole|nucleus		g.chr8:86025304G>A	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.514G>A	8.37:g.86025304G>A	ENSP00000353538:p.Gly172Arg		Somatic				LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.M1I|LRRCC1_uc003ycx.2_Missense_Mutation_p.G79R|LRRCC1_uc003ycy.2_Missense_Mutation_p.G152R	p.G172R	NM_033402	NP_208325	WXS	Illumina HiSeq	Unspecified	Q9C099	LRCC1_HUMAN			4	668	+			172					B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	c.514G>A	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444271	0.83993	.	.	ENSG00000133739	ENST00000426019;ENST00000360375;ENST00000414626	T;T	0.35789	1.29;1.32	5.9	5.9	0.94986	.	0.186282	0.26432	N	0.024419	T	0.53706	0.1813	L	0.58669	1.825	0.58432	D	0.999993	D;D;P	0.64830	0.994;0.973;0.922	P;P;P	0.60886	0.88;0.852;0.646	T	0.30794	-0.9966	10	0.16896	T	0.51	-19.3611	20.2822	0.98520	0.0:0.0:1.0:0.0	.	152;79;172	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	R	79;172;152	ENSP00000353538:G172R;ENSP00000394695:G152R	ENSP00000353538:G172R	G	+	1	0	LRRCC1	86212556	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	9.052000	0.93855	2.806000	0.96561	0.655000	0.94253	GGA		0.323	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402		27	32	0	0	0	0.010818	0	27	32				
CNGB3	54714	broad.mit.edu	37	8	87641256	87641256	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:87641256G>T	ENST00000320005.5	-	12	1418	c.1371C>A	c.(1369-1371)gcC>gcA	p.A457A		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	457					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						CATCCATGCAGGCGCGGAAGT	0.443																																							uc003ydx.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1369-1371)GCC>GCA		cyclic nucleotide gated channel beta 3							251.0	236.0	241.0					8																	87641256		2203	4300	6503	SO:0001819	synonymous_variant	54714				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr8:87641256G>T	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1371C>A	8.37:g.87641256G>T			Somatic				CNGB3_uc010maj.2_Silent_p.A319A	p.A457A	NM_019098	NP_061971	WXS	Illumina HiSeq	Unspecified	Q9NQW8	CNGB3_HUMAN			12	1417	-			457			Extracellular (Potential).		C9JA51|Q9NRE9	Silent	SNP	ENST00000320005.5	37	c.1371C>A	CCDS6244.1																																																																																				0.443	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098		33	164	1	0	7.04047e-22	0.005524	1.22425e-21	33	164				
DCAF4L2	138009	broad.mit.edu	37	8	88885853	88885853	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:88885853G>T	ENST00000319675.3	-	1	443	c.347C>A	c.(346-348)cCg>cAg	p.P116Q		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	116										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GGTTTTGTGCGGGTATACCCG	0.547																																							uc003ydz.2		NA																	0				ovary(1)	1						c.(346-348)CCG>CAG		WD repeat domain 21C							131.0	126.0	128.0					8																	88885853		2203	4300	6503	SO:0001583	missense	138009							g.chr8:88885853G>T	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.347C>A	8.37:g.88885853G>T	ENSP00000316496:p.Pro116Gln		Somatic					p.P116Q	NM_152418	NP_689631	WXS	Illumina HiSeq	Unspecified	Q8NA75	DC4L2_HUMAN			1	444	-			116						Missense_Mutation	SNP	ENST00000319675.3	37	c.347C>A	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	G	8.199	0.797827	0.16327	.	.	ENSG00000176566	ENST00000319675	T	0.71579	-0.58	1.39	-2.79	0.05841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.223450	0.64402	D	0.000013	T	0.40862	0.1134	N	0.08118	0	0.21220	N	0.999758	B	0.10296	0.003	B	0.06405	0.002	T	0.11446	-1.0587	10	0.56958	D	0.05	.	3.6079	0.08049	0.3403:0.4573:0.2023:0.0	.	116	Q8NA75	DC4L2_HUMAN	Q	116	ENSP00000316496:P116Q	ENSP00000316496:P116Q	P	-	2	0	DCAF4L2	88954969	1.000000	0.71417	0.000000	0.03702	0.007000	0.05969	2.752000	0.47516	-1.113000	0.02981	-0.373000	0.07131	CCG		0.547	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		13	72	1	0	6.31663e-08	0.003163	8.29942e-08	13	72				
CALB1	793	broad.mit.edu	37	8	91081419	91081419	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:91081419C>T	ENST00000265431.3	-	4	459	c.278G>A	c.(277-279)cGa>cAa	p.R93Q	CALB1_ENST00000518457.1_Missense_Mutation_p.R36Q	NM_004929.2	NP_004920.1	P05937	CALB1_HUMAN	calbindin 1, 28kDa	93					cellular response to organic substance (GO:0071310)|cytosolic calcium ion homeostasis (GO:0051480)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|metanephric collecting duct development (GO:0072205)|metanephric connecting tubule development (GO:0072286)|metanephric distal convoluted tubule development (GO:0072221)|metanephric part of ureteric bud development (GO:0035502)|regulation of synaptic plasticity (GO:0048167)|retina layer formation (GO:0010842)|short-term memory (GO:0007614)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(8)|pancreas(1)	11			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CTGCTGGCATCGGAAGAGCAG	0.398																																					Melanoma(46;573 1182 27367 39727 48386)	Melanoma(46;573 1182 27367 39727 48386)	uc003yel.1		NA																	0				pancreas(1)	1						c.(277-279)CGA>CAA		calbindin 1							63.0	65.0	64.0					8																	91081419		2203	4300	6503	SO:0001583	missense	793					nucleus	calcium ion binding|vitamin D binding	g.chr8:91081419C>T		CCDS6251.1	8q21.3	2013-01-10	2002-08-29		ENSG00000104327	ENSG00000104327		"""EF-hand domain containing"""	1434	protein-coding gene	gene with protein product		114050		CALB			Standard	NM_004929		Approved		uc003yel.1	P05937	OTTHUMG00000134314	ENST00000265431.3:c.278G>A	8.37:g.91081419C>T	ENSP00000265431:p.Arg93Gln		Somatic				CALB1_uc011lge.1_Missense_Mutation_p.R36Q	p.R93Q	NM_004929	NP_004920	WXS	Illumina HiSeq	Unspecified	P05937	CALB1_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00953)		4	460	-			93					B2R696|B7Z9J4	Missense_Mutation	SNP	ENST00000265431.3	37	c.278G>A	CCDS6251.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362783	0.82353	.	.	ENSG00000104327	ENST00000265431;ENST00000518457;ENST00000523716;ENST00000520613	T;D;T;T	0.92048	-0.29;-2.96;0.97;0.82	5.81	5.81	0.92471	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91573	0.7338	L	0.42245	1.32	0.80722	D	1	D	0.58620	0.983	P	0.47044	0.535	D	0.91843	0.5485	10	0.59425	D	0.04	-6.4148	20.0826	0.97783	0.0:1.0:0.0:0.0	.	93	P05937	CALB1_HUMAN	Q	93;36;36;36	ENSP00000265431:R93Q;ENSP00000429602:R36Q;ENSP00000429246:R36Q;ENSP00000430281:R36Q	ENSP00000265431:R93Q	R	-	2	0	CALB1	91150595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.194000	0.65125	2.746000	0.94184	0.655000	0.94253	CGA		0.398	CALB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259338.2	NM_004929		9	46	0	0	0	0.010729	0	9	46				
UBR5	51366	broad.mit.edu	37	8	103297392	103297392	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:103297392G>A	ENST00000520539.1	-	40	6265	c.5659C>T	c.(5659-5661)Cga>Tga	p.R1887*	UBR5_ENST00000220959.4_Nonsense_Mutation_p.R1887*|UBR5_ENST00000521922.1_Nonsense_Mutation_p.R1881*|UBR5_ENST00000519528.1_5'Flank	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1887					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GCTTCTTCTCGCGCAGTCATC	0.433																																					Ovarian(131;96 1741 5634 7352 27489)	Ovarian(131;96 1741 5634 7352 27489)	uc003ykr.1		NA																	0				lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28						c.(5659-5661)CGA>TGA		ubiquitin protein ligase E3 component n-recognin							116.0	118.0	118.0					8																	103297392		2203	4300	6503	SO:0001587	stop_gained	51366				cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding	g.chr8:103297392G>A	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.5659C>T	8.37:g.103297392G>A	ENSP00000429084:p.Arg1887*		Somatic				UBR5_uc003yks.1_Nonsense_Mutation_p.R1887*	p.R1887*	NM_015902	NP_056986	WXS	Illumina HiSeq	Unspecified	O95071	UBR5_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000442)		40	5692	-	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		1887					B2RP24|J3KMW7|O94970|Q9NPL3	Nonsense_Mutation	SNP	ENST00000520539.1	37	c.5659C>T	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	G	50	16.240454	0.99858	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	.	.	.	5.73	3.28	0.37604	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5713	0.76341	0.0:0.0:0.7615:0.2385	.	.	.	.	X	1887;1887;1881	.	ENSP00000220959:R1887X	R	-	1	2	UBR5	103366568	1.000000	0.71417	0.813000	0.32504	0.976000	0.68499	6.727000	0.74764	0.384000	0.24942	-0.457000	0.05445	CGA		0.433	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902		8	70	0	0	0	0.004482	0	8	70				
ODF1	4956	broad.mit.edu	37	8	103572795	103572795	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:103572795G>T	ENST00000285402.3	+	2	592	c.436G>T	c.(436-438)Gga>Tga	p.G146*	ODF1_ENST00000518835.1_Start_Codon_SNP_p.M1I	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	146					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			AGTGAAGGATGGAAAGGTATG	0.468																																							uc003ykt.2		NA																	0				ovary(2)	2						c.(436-438)GGA>TGA		outer dense fiber of sperm tails 1							176.0	154.0	161.0					8																	103572795		2203	4300	6503	SO:0001587	stop_gained	4956				cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity	g.chr8:103572795G>T	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.436G>T	8.37:g.103572795G>T	ENSP00000285402:p.Gly146*		Somatic					p.G146*	NM_024410	NP_077721	WXS	Illumina HiSeq	Unspecified	Q14990	ODFP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)		2	544	+	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		146					Q3SX72	Nonsense_Mutation	SNP	ENST00000285402.3	37	c.436G>T	CCDS6293.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.710996|6.710996	0.97780|0.97780	.|.	.|.	ENSG00000155087|ENSG00000155087	ENST00000285402|ENST00000518835	.|T	.|0.18016	.|2.24	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.56097|.	D|.	0.000037|.	.|T	.|0.36936	.|0.0985	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.07481	.|-1.0770	.|6	0.36615|0.87932	T|D	0.2|0	-21.2278|-21.2278	14.9045|14.9045	0.70709|0.70709	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	146|1	.|ENSP00000430023:M1I	ENSP00000285402:G146X|ENSP00000430023:M1I	G|M	+|+	1|3	0|0	ODF1|ODF1	103641971|103641971	1.000000|1.000000	0.71417|0.71417	0.897000|0.897000	0.35233|0.35233	0.991000|0.991000	0.79684|0.79684	4.990000|4.990000	0.63876|0.63876	2.595000|2.595000	0.87683|0.87683	0.555000|0.555000	0.69702|0.69702	GGA|ATG		0.468	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			45	69	1	0	9.45407e-15	0.01441	1.50138e-14	45	69				
DPYS	1807	broad.mit.edu	37	8	105459732	105459732	+	Splice_Site	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:105459732C>A	ENST00000351513.2	-	3	556		c.e3-1			NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase						beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTCTTTAACCTAAAAGGAAG	0.338																																							uc003yly.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.e3-1		dihydropyrimidinase							86.0	79.0	82.0					8																	105459732		2203	4300	6503	SO:0001630	splice_region_variant	1807				protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding	g.chr8:105459732C>A	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.424-1G>T	8.37:g.105459732C>A			Somatic					p.V142_splice	NM_001385	NP_001376	WXS	Illumina HiSeq	Unspecified	Q14117	DPYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		3	553	-									Splice_Site	SNP	ENST00000351513.2	37	c.424_splice	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541071	0.85917	.	.	ENSG00000147647	ENST00000351513;ENST00000521573	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.547	0.99278	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPYS	105528908	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	7.487000	0.81328	2.850000	0.98022	0.650000	0.86243	.		0.338	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	Intron	11	21	1	0	0.00136819	0.013537	0.0014875	11	21				
RSPO2	340419	broad.mit.edu	37	8	108970395	108970395	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:108970395C>G	ENST00000276659.5	-	5	1149	c.529G>C	c.(529-531)Gtt>Ctt	p.V177L	RSPO2_ENST00000517939.1_Missense_Mutation_p.V110L|RSPO2_ENST00000378439.2_Missense_Mutation_p.V113L|RSPO2_ENST00000517781.1_Missense_Mutation_p.V113L	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	177	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			GGCTTTTTAACAATTTGCCGT	0.443																																							uc003yms.2		NA																	0				skin(3)|ovary(2)|pancreas(1)|lung(1)	7						c.(529-531)GTT>CTT		R-spondin family, member 2 precursor							266.0	241.0	250.0					8																	108970395		2203	4300	6503	SO:0001583	missense	340419				Wnt receptor signaling pathway	extracellular region	heparin binding	g.chr8:108970395C>G	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.529G>C	8.37:g.108970395C>G	ENSP00000276659:p.Val177Leu		Somatic				RSPO2_uc003ymq.2_Missense_Mutation_p.V110L|RSPO2_uc003ymr.2_Missense_Mutation_p.V113L	p.V177L	NM_178565	NP_848660	WXS	Illumina HiSeq	Unspecified	Q6UXX9	RSPO2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)		5	1187	-			177			TSP type-1.		B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	c.529G>C	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091805	0.36952	.	.	ENSG00000147655	ENST00000517939;ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521502	T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57	5.9	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.63558	0.2521	N	0.03999	-0.3	0.53005	D	0.999962	D;B	0.61697	0.99;0.376	D;B	0.73380	0.98;0.104	T	0.61710	-0.7007	10	0.02654	T	1	0.5931	15.2828	0.73801	0.0:0.9329:0.0:0.0671	.	177;113	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	L	110;113;113;177;110	ENSP00000428940:V110L;ENSP00000427937:V113L;ENSP00000367698:V113L;ENSP00000276659:V177L;ENSP00000428614:V110L	ENSP00000276659:V177L	V	-	1	0	RSPO2	109039571	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.666000	0.61554	1.506000	0.48736	-0.244000	0.11960	GTT		0.443	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565		46	84	0	0	0	0.01441	0	46	84				
CSMD3	114788	broad.mit.edu	37	8	113694857	113694857	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:113694857G>T	ENST00000297405.5	-	16	2735	c.2491C>A	c.(2491-2493)Cat>Aat	p.H831N	CSMD3_ENST00000352409.3_Missense_Mutation_p.H831N|CSMD3_ENST00000343508.3_Missense_Mutation_p.H791N|CSMD3_ENST00000455883.2_Missense_Mutation_p.H727N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	831						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CATTCATTATGTCCAAATGCT	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2491-2493)CAT>AAT		CUB and Sushi multiple domains 3 isoform 1							72.0	73.0	73.0					8																	113694857		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113694857G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2491C>A	8.37:g.113694857G>T	ENSP00000297405:p.His831Asn	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.H103N|CSMD3_uc003ynt.2_Missense_Mutation_p.H791N|CSMD3_uc011lhx.1_Missense_Mutation_p.H727N	p.H831N	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			16	2650	-			831			Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.2491C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615179	0.66672	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.25579	2.1;2.09;2.11;1.79;2.1	5.58	5.58	0.84498	CUB (1);	0.071490	0.56097	D	0.000039	T	0.32071	0.0817	L	0.28274	0.84	0.44323	D	0.997203	P;P;D	0.54601	0.837;0.615;0.967	P;P;P	0.55345	0.709;0.515;0.774	T	0.01706	-1.1291	10	0.17832	T	0.49	.	19.557	0.95354	0.0:0.0:1.0:0.0	.	727;831;791	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	791;831;171;727;831	ENSP00000345799:H791N;ENSP00000297405:H831N;ENSP00000341558:H171N;ENSP00000412263:H727N;ENSP00000343124:H831N	ENSP00000297405:H831N	H	-	1	0	CSMD3	113764033	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.001000	0.88508	2.623000	0.88846	0.650000	0.86243	CAT		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		31	62	1	0	2.49991e-28	0.003271	4.50754e-28	31	62				
RAD21	5885	broad.mit.edu	37	8	117874087	117874087	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:117874087C>A	ENST00000297338.2	-	4	654	c.367G>T	c.(367-369)Gac>Tac	p.D123Y	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	123					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TACTCTAAGTCAGGCAGTGGC	0.368																																							uc003yod.2		NA																	0				lung(1)|skin(1)	2						c.(367-369)GAC>TAC		RAD21 homolog							134.0	137.0	136.0					8																	117874087		2203	4300	6503	SO:0001583	missense	5885				apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding	g.chr8:117874087C>A	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.367G>T	8.37:g.117874087C>A	ENSP00000297338:p.Asp123Tyr		Somatic					p.D123Y	NM_006265	NP_006256	WXS	Illumina HiSeq	Unspecified	O60216	RAD21_HUMAN			4	655	-	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)		123					A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	c.367G>T	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.845518	0.91197	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485;ENST00000519837	T;T;T;T	0.58506	0.33;1.31;1.31;1.24	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.78923	0.4360	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80865	-0.1191	10	0.87932	D	0	-16.6768	19.8041	0.96521	0.0:1.0:0.0:0.0	.	123	O60216	RAD21_HUMAN	Y	123	ENSP00000297338:D123Y;ENSP00000429342:D123Y;ENSP00000427923:D123Y;ENSP00000430524:D123Y	ENSP00000297338:D123Y	D	-	1	0	RAD21	117943268	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.606000	0.82863	2.683000	0.91414	0.585000	0.79938	GAC		0.368	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265		50	69	1	0	3.53049e-34	0.01441	6.52639e-34	50	69				
EXT1	2131	broad.mit.edu	37	8	118817013	118817013	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:118817013G>A	ENST00000378204.2	-	10	2809	c.2003C>T	c.(2002-2004)cCt>cTt	p.P668L		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	668					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TTTGATTGGAGGCAATTTTGT	0.478			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																														uc003yok.1		NA	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	Mis|N|F|S	multiple exostoses type 1 gene			M		exostoses|osteosarcoma			0				ovary(2)|lung(2)	4						c.(2002-2004)CCT>CTT		exostosin 1							210.0	195.0	200.0					8																	118817013		2203	4300	6503	SO:0001583	missense	2131	Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity	g.chr8:118817013G>A	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.2003C>T	8.37:g.118817013G>A	ENSP00000367446:p.Pro668Leu		Somatic					p.P668L	NM_000127	NP_000118	WXS	Illumina HiSeq	Unspecified	Q16394	EXT1_HUMAN	STAD - Stomach adenocarcinoma(47;0.012)		10	2776	-	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		668			Lumenal (Potential).		B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	c.2003C>T	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811965	0.90707	.	.	ENSG00000182197	ENST00000378204	D	0.87966	-2.32	5.68	4.81	0.61882	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.95338	0.8487	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96472	0.9349	10	0.87932	D	0	-7.479	14.5144	0.67809	0.0706:0.0:0.9294:0.0	.	668	Q16394	EXT1_HUMAN	L	668	ENSP00000367446:P668L	ENSP00000367446:P668L	P	-	2	0	EXT1	118886194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	1.387000	0.46486	0.585000	0.79938	CCT		0.478	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127		9	79	0	0	0	0.006214	0	9	79				
COL14A1	7373	broad.mit.edu	37	8	121381709	121381709	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:121381709G>C	ENST00000297848.3	+	47	5566	c.5296G>C	c.(5296-5298)Gcc>Ccc	p.A1766P	COL14A1_ENST00000247781.3_Missense_Mutation_p.A1671P|COL14A1_ENST00000309791.4_Missense_Mutation_p.A1766P	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ATCATGTTCTGCCTATGGTGT	0.507																																							uc003yox.2		NA																	0				ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(5296-5298)GCC>CCC		collagen, type XIV, alpha 1 precursor							68.0	69.0	69.0					8																	121381709		2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121381709G>C		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.5296G>C	8.37:g.121381709G>C	ENSP00000297848:p.Ala1766Pro		Somatic				COL14A1_uc003yoz.2_Missense_Mutation_p.A731P	p.A1766P	NM_021110	NP_066933	WXS	Illumina HiSeq	Unspecified	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		47	5561	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		1766			Triple-helical region 2 (COL1).			Missense_Mutation	SNP	ENST00000297848.3	37	c.5296G>C	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750334	0.30955	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.92249	-2.21;-2.27;-2.34;-3.0	4.84	-0.49	0.12049	.	0.219168	0.46442	D	0.000288	T	0.81574	0.4851	L	0.34521	1.04	0.80722	D	1	P	0.46395	0.877	B	0.36030	0.216	T	0.72969	-0.4130	10	0.30078	T	0.28	.	6.1849	0.20491	0.1412:0.0:0.4874:0.3714	.	1766	Q05707	COEA1_HUMAN	P	1766;1766;1671;113	ENSP00000311809:A1766P;ENSP00000297848:A1766P;ENSP00000247781:A1671P;ENSP00000403640:A113P	ENSP00000247781:A1671P	A	+	1	0	COL14A1	121450890	1.000000	0.71417	0.997000	0.53966	0.178000	0.23041	1.754000	0.38369	-0.007000	0.14345	-0.314000	0.08810	GCC		0.507	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		39	42	0	0	0	0.01441	0	39	42				
ATAD2	29028	broad.mit.edu	37	8	124361527	124361527	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:124361527C>G	ENST00000287394.5	-	14	1911	c.1804G>C	c.(1804-1806)Gag>Cag	p.E602Q	ATAD2_ENST00000521903.1_5'UTR|MIR548AA1_ENST00000384971.2_RNA	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	602					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ATTCTTACCTCTTTATCAGGC	0.348																																							uc003yqh.3		NA																	0				ovary(2)	2						c.(1804-1806)GAG>CAG		ATPase family, AAA domain containing 2							79.0	75.0	77.0					8																	124361527		2203	4300	6503	SO:0001583	missense	29028				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity	g.chr8:124361527C>G	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1804G>C	8.37:g.124361527C>G	ENSP00000287394:p.Glu602Gln		Somatic				ATAD2_uc011lii.1_Missense_Mutation_p.E393Q|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.E602Q|MIR548D1_hsa-mir-548d-1|MI0003668_5'Flank	p.E602Q	NM_014109	NP_054828	WXS	Illumina HiSeq	Unspecified	Q6PL18	ATAD2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		14	1912	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		602					Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	c.1804G>C	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741278	0.49151	.	.	ENSG00000156802	ENST00000287394	D	0.95853	-3.83	5.7	4.81	0.61882	.	1.030790	0.07674	N	0.935848	D	0.93936	0.8059	L	0.45470	1.425	0.80722	D	1	B	0.15719	0.014	B	0.17098	0.017	D	0.84056	0.0372	10	0.38643	T	0.18	-7.4312	15.1129	0.72372	0.0:0.9312:0.0:0.0688	.	602	Q6PL18	ATAD2_HUMAN	Q	602	ENSP00000287394:E602Q	ENSP00000287394:E602Q	E	-	1	0	ATAD2	124430708	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.261000	0.51530	1.383000	0.46405	0.591000	0.81541	GAG		0.348	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109		10	58	0	0	0	0.001855	0	10	58				
TMEM71	137835	broad.mit.edu	37	8	133740100	133740100	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:133740100A>G	ENST00000356838.3	-	6	705	c.563T>C	c.(562-564)cTt>cCt	p.L188P	TMEM71_ENST00000377901.4_Intron|TMEM71_ENST00000523829.1_Missense_Mutation_p.L207P	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	207						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CTGGGACTGAAGAGACAAGCT	0.463																																							uc003ytp.2		NA																	0				ovary(2)	2						c.(616-618)CTT>CCT		transmembrane protein 71 isoform 1							141.0	134.0	136.0					8																	133740100		2203	4300	6503	SO:0001583	missense	137835					integral to membrane		g.chr8:133740100A>G	AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.563T>C	8.37:g.133740100A>G	ENSP00000349296:p.Leu188Pro		Somatic				TMEM71_uc003ytm.1_Missense_Mutation_p.L28P|TMEM71_uc003ytn.2_Missense_Mutation_p.L188P|TMEM71_uc003yto.2_Intron	p.L206P	NM_144649	NP_653250	WXS	Illumina HiSeq	Unspecified	Q6P5X7	TMM71_HUMAN	BRCA - Breast invasive adenocarcinoma(115;4.46e-05)		6	846	-	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		207					Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	ENST00000356838.3	37	c.617T>C	CCDS6366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.764|7.764	0.706083|0.706083	0.15172|0.15172	.|.	.|.	ENSG00000165071|ENSG00000165071	ENST00000522780|ENST00000523829;ENST00000356838	.|.	.|.	.|.	6.02|6.02	-3.28|-3.28	0.05033|0.05033	.|.	.|0.747880	.|0.12360	.|N	.|0.475738	T|T	0.20941|0.20941	0.0504|0.0504	N|N	0.16743|0.16743	0.435|0.435	0.09310|0.09310	N|N	0.999993|0.999993	.|B;B	.|0.12013	.|0.005;0.005	.|B;B	.|0.06405	.|0.002;0.002	T|T	0.17107|0.17107	-1.0380|-1.0380	5|9	.|0.25106	.|T	.|0.35	-1.3793|-1.3793	7.6439|7.6439	0.28309|0.28309	0.516:0.0:0.3789:0.1051|0.516:0.0:0.3789:0.1051	.|.	.|207;188	.|Q6P5X7;Q6P5X7-2	.|TMM71_HUMAN;.	L|P	45|207;188	.|.	.|ENSP00000349296:L188P	F|L	-|-	1|2	0|0	TMEM71|TMEM71	133809282|133809282	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	-0.325000|-0.325000	0.07976|0.07976	-0.740000|-0.740000	0.04803|0.04803	-1.139000|-1.139000	0.01908|0.01908	TTC|CTT		0.463	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379591.1	NM_144649		46	87	0	0	0	0.01441	0	46	87				
KCNK9	51305	broad.mit.edu	37	8	140630539	140630539	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:140630539C>T	ENST00000520439.1	-	2	1150	c.1087G>A	c.(1087-1089)Gac>Aac	p.D363N	KCNK9_ENST00000303015.1_Missense_Mutation_p.D363N|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	363					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CTCTGGTGGTCGGTAAAGCTG	0.468																																							uc003yvf.1		NA																	0				ovary(2)|lung(1)	3						c.(1087-1089)GAC>AAC		potassium channel, subfamily K, member 9							131.0	125.0	127.0					8																	140630539		2203	4300	6503	SO:0001583	missense	51305					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity	g.chr8:140630539C>T	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.1087G>A	8.37:g.140630539C>T	ENSP00000430676:p.Asp363Asn		Somatic				KCNK9_uc003yvg.1_Missense_Mutation_p.D363N|KCNK9_uc003yve.1_RNA	p.D363N	NM_016601	NP_057685	WXS	Illumina HiSeq	Unspecified	Q9NPC2	KCNK9_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0855)		2	1151	-	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	363			Cytoplasmic (Potential).		Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	c.1087G>A	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204951	0.38905	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.15952	2.38;2.38;2.38	5.72	5.72	0.89469	.	0.186228	0.45867	D	0.000326	T	0.17662	0.0424	L	0.57536	1.79	0.43133	D	0.994873	B	0.18610	0.029	B	0.08055	0.003	T	0.04128	-1.0975	10	0.20519	T	0.43	.	12.2155	0.54404	0.0:0.9228:0.0:0.0772	.	363	Q9NPC2	KCNK9_HUMAN	N	363	ENSP00000429847:D363N;ENSP00000302166:D363N;ENSP00000430676:D363N	ENSP00000302166:D363N	D	-	1	0	KCNK9	140699721	1.000000	0.71417	0.489000	0.27452	0.905000	0.53344	7.263000	0.78421	2.684000	0.91462	0.563000	0.77884	GAC		0.468	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601		25	113	0	0	0	0.010818	0	25	113				
CYP11B1	1584	broad.mit.edu	37	8	143961219	143961219	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:143961219C>A	ENST00000292427.4	-	1	43	c.11G>T	c.(10-12)aGg>aTg	p.R4M	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R4M|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R4M	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	4					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TGCCTTTGCCCTGAGTGCCAT	0.617									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	0				ovary(3)	3						c.(10-12)AGG>ATG		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						132.0	128.0	129.0					8																	143961219		2203	4300	6503	SO:0001583	missense	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143961219C>A	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.11G>T	8.37:g.143961219C>A	ENSP00000292427:p.Arg4Met		Somatic				CYP11B1_uc003yxj.2_Missense_Mutation_p.R4M|CYP11B1_uc010mey.2_Missense_Mutation_p.R4M	p.R4M	NM_000497	NP_000488	WXS	Illumina HiSeq	Unspecified	P15538	C11B1_HUMAN			1	18	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		4					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	c.11G>T	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670582	0.47781	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;D;T	0.84944	-1.12;-1.92;-1.35	2.96	2.05	0.26809	.	0.163217	0.27096	N	0.020949	D	0.84575	0.5502	L	0.47190	1.495	0.09310	N	1	D;D;D	0.65815	0.992;0.981;0.995	P;P;P	0.59288	0.838;0.759;0.855	T	0.73786	-0.3873	10	0.72032	D	0.01	.	4.9786	0.14153	0.0:0.8285:0.0:0.1715	.	4;4;4	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	M	4	ENSP00000292427:R4M;ENSP00000428043:R4M;ENSP00000366903:R4M	ENSP00000292427:R4M	R	-	2	0	CYP11B1	143958221	0.005000	0.15991	0.002000	0.10522	0.129000	0.20672	1.550000	0.36223	1.586000	0.49944	0.305000	0.20034	AGG		0.617	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			94	156	1	0	1.6696e-61	0.01441	3.1663e-61	94	156				
DMRT3	58524	broad.mit.edu	37	9	990852	990852	+	Silent	SNP	G	G	A	rs144093358		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:990852G>A	ENST00000190165.2	+	2	1304	c.1266G>A	c.(1264-1266)tcG>tcA	p.S422S		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	422					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		TCAGAAGCTCGCCCGTCCTTC	0.557																																							uc003zgw.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1264-1266)TCG>TCA		doublesex and mab-3 related transcription factor		G		3,4403	6.2+/-15.9	0,3,2200	86.0	69.0	74.0		1266	-7.7	0.7	9	dbSNP_134	74	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	DMRT3	NM_021240.2		0,7,6496	AA,AG,GG		0.0465,0.0681,0.0538		422/473	990852	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	58524				cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	g.chr9:990852G>A	AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1266G>A	9.37:g.990852G>A			Somatic					p.S422S	NM_021240	NP_067063	WXS	Illumina HiSeq	Unspecified	Q9NQL9	DMRT3_HUMAN		Lung(218;0.0196)	2	1304	+		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)	422					Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Silent	SNP	ENST00000190165.2	37	c.1266G>A	CCDS6443.1																																																																																				0.557	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051490.1	NM_021240		5	32	0	0	0	0.001984	0	5	32				
PTPRD	5789	broad.mit.edu	37	9	8486072	8486072	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:8486072T>A	ENST00000381196.4	-	25	3288	c.2745A>T	c.(2743-2745)gaA>gaT	p.E915D	PTPRD_ENST00000540109.1_Missense_Mutation_p.E915D|PTPRD_ENST00000356435.5_Missense_Mutation_p.E915D|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.E902D|PTPRD_ENST00000358503.5_Missense_Mutation_p.E893D|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	915	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTGGTACTTCTTCTGGAATGG	0.498										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(2743-2745)GAA>GAT		protein tyrosine phosphatase, receptor type, D							120.0	112.0	115.0					9																	8486072		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8486072T>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2745A>T	9.37:g.8486072T>A	ENSP00000370593:p.Glu915Asp	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Missense_Mutation_p.E906D|PTPRD_uc003zkm.2_Missense_Mutation_p.E902D|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	p.E915D	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	27	3456	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	915			Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.2745A>T	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473135	0.43942	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	5.68	4.55	0.56014	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67144	0.2862	M	0.69823	2.125	0.54753	D	0.999988	P;D;P	0.64830	0.796;0.994;0.559	P;D;B	0.70716	0.465;0.97;0.168	T	0.66476	-0.5914	9	.	.	.	.	9.0105	0.36137	0.0:0.1418:0.0:0.8582	.	902;915;915	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	D	915;915;902;893;915	ENSP00000370593:E915D;ENSP00000348812:E915D;ENSP00000353187:E902D;ENSP00000351293:E893D;ENSP00000438164:E915D	.	E	-	3	2	PTPRD	8476072	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.804000	0.47931	1.000000	0.39049	-0.261000	0.10672	GAA		0.498	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			6	31	0	0	0	0.001984	0	6	31				
PTPRD	5789	broad.mit.edu	37	9	8517893	8517893	+	Missense_Mutation	SNP	C	C	A	rs200333683		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:8517893C>A	ENST00000381196.4	-	18	2041	c.1498G>T	c.(1498-1500)Gat>Tat	p.D500Y	PTPRD_ENST00000540109.1_Missense_Mutation_p.D500Y|PTPRD_ENST00000356435.5_Missense_Mutation_p.D500Y|PTPRD_ENST00000397617.3_Missense_Mutation_p.D490Y|PTPRD_ENST00000397606.3_Missense_Mutation_p.D490Y|PTPRD_ENST00000397611.3_Missense_Mutation_p.D497Y|PTPRD_ENST00000537002.1_Missense_Mutation_p.D497Y|PTPRD_ENST00000360074.4_Missense_Mutation_p.D487Y|PTPRD_ENST00000358503.5_Missense_Mutation_p.D487Y|PTPRD_ENST00000355233.5_Missense_Mutation_p.D500Y|PTPRD_ENST00000486161.1_Missense_Mutation_p.D500Y	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	500	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AGGGGACCATCTCCAATTGAG	0.463										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(1498-1500)GAT>TAT		protein tyrosine phosphatase, receptor type, D							151.0	130.0	137.0					9																	8517893		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8517893C>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1498G>T	9.37:g.8517893C>A	ENSP00000370593:p.Asp500Tyr	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Missense_Mutation_p.D500Y|PTPRD_uc003zkq.2_Missense_Mutation_p.D500Y|PTPRD_uc003zkr.2_Missense_Mutation_p.D494Y|PTPRD_uc003zks.2_Missense_Mutation_p.D490Y|PTPRD_uc003zkl.2_Missense_Mutation_p.D500Y|PTPRD_uc003zkm.2_Missense_Mutation_p.D487Y|PTPRD_uc003zkn.2_Missense_Mutation_p.D500Y|PTPRD_uc003zko.2_Missense_Mutation_p.D497Y	p.D500Y	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	20	2209	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	500			Fibronectin type-III 2.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.1498G>T	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	3.733	-0.055123	0.07362	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.31	5.31	0.75309	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64702	0.2622	L	0.50847	1.595	0.80722	D	1	D;D;D;D;B;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.002;1.0;1.0;1.0;1.0	D;D;D;D;B;D;D;D;D	0.91635	0.992;0.999;0.997;0.999;0.01;0.999;0.996;0.996;0.999	T	0.61667	-0.7016	9	.	.	.	.	18.9787	0.92747	0.0:1.0:0.0:0.0	.	490;494;500;500;497;497;487;500;500	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	Y	500;500;487;487;500;490;497;497;500;500;500;490	ENSP00000370593:D500Y;ENSP00000348812:D500Y;ENSP00000353187:D487Y;ENSP00000351293:D487Y;ENSP00000347373:D500Y;ENSP00000380741:D490Y;ENSP00000380735:D497Y;ENSP00000440515:D497Y;ENSP00000438164:D500Y;ENSP00000417093:D500Y;ENSP00000380731:D490Y	.	D	-	1	0	PTPRD	8507893	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	7.440000	0.80464	2.484000	0.83849	0.467000	0.42956	GAT		0.463	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			20	43	1	0	6.21321e-17	0.00278	1.02562e-16	20	43				
CNTLN	54875	broad.mit.edu	37	9	17484328	17484328	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:17484328G>A	ENST00000380647.3	+	24	3975	c.3891G>A	c.(3889-3891)gtG>gtA	p.V1297V	CNTLN_ENST00000262360.5_Silent_p.V1297V|CNTLN_ENST00000425824.1_Silent_p.V1297V			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1297					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		ATGTCCATGTGGTAAGGCGAC	0.383																																							uc003zmz.2		NA																	0				pancreas(1)	1						c.(3886-3888)GTG>GTA		centlein isoform 1							123.0	121.0	121.0					9																	17484328		1859	4098	5957	SO:0001819	synonymous_variant	54875					centriole|membrane	two-component sensor activity	g.chr9:17484328G>A	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3891G>A	9.37:g.17484328G>A			Somatic				CNTLN_uc003zmy.2_Silent_p.V1297V|CNTLN_uc010mio.2_Silent_p.V976V	p.V1296V	NM_017738	NP_060208	WXS	Illumina HiSeq	Unspecified	Q9NXG0	CNTLN_HUMAN		GBM - Glioblastoma multiforme(50;6.14e-10)	24	3914	+			1297			Potential.		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	37	c.3888G>A	CCDS43789.1																																																																																				0.383	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738		25	34	0	0	0	0.005443	0	25	34				
ADAMTSL1	92949	broad.mit.edu	37	9	18504846	18504846	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:18504846C>G	ENST00000380548.4	+	2	422	c.83C>G	c.(82-84)tCc>tGc	p.S28C	ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.S28C|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.S28C|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.S28C|ADAMTSL1_ENST00000431052.2_Missense_Mutation_p.S28C|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.S28C	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	28						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		ACCGCACGCTCCGAGGAGGAC	0.582																																							uc003zne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(82-84)TCC>TGC		ADAMTS-like 1 isoform 4 precursor							67.0	72.0	70.0					9																	18504846		2203	4300	6503	SO:0001583	missense	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18504846C>G	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.83C>G	9.37:g.18504846C>G	ENSP00000369921:p.Ser28Cys		Somatic				ADAMTSL1_uc003znb.2_Missense_Mutation_p.S28C|ADAMTSL1_uc003znc.3_Missense_Mutation_p.S28C	p.S28C	NM_001040272	NP_001035362	WXS	Illumina HiSeq	Unspecified	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	2	210	+			28					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	c.83C>G	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716866	0.89205	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000431052;ENST00000380570;ENST00000380566;ENST00000276935	T;T;T;T;T;T	0.68025	-0.14;-0.09;-0.24;-0.3;-0.15;-0.12	5.4	5.4	0.78164	.	.	.	.	.	T	0.75852	0.3906	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.77978	-0.2384	9	0.66056	D	0.02	.	19.181	0.93623	0.0:1.0:0.0:0.0	.	28;28	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	C	28	ENSP00000369921:S28C;ENSP00000327887:S28C;ENSP00000401157:S28C;ENSP00000369944:S28C;ENSP00000369940:S28C;ENSP00000276935:S28C	ENSP00000276935:S28C	S	+	2	0	ADAMTSL1	18494846	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	7.324000	0.79115	2.531000	0.85337	0.561000	0.74099	TCC		0.582	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			24	49	0	0	0	0.00632	0	24	49				
SLC24A2	25769	broad.mit.edu	37	9	19576964	19576964	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:19576964C>A	ENST00000341998.2	-	5	1247	c.1186G>T	c.(1186-1188)Gtg>Ttg	p.V396L	SLC24A2_ENST00000286344.3_Missense_Mutation_p.V379L	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	396					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TTCTCATCCACATGACATTTC	0.517																																							uc003zoa.1		NA																	0				ovary(3)	3						c.(1186-1188)GTG>TTG		solute carrier family 24							219.0	180.0	193.0					9																	19576964		2203	4300	6503	SO:0001583	missense	25769				visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr9:19576964C>A	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1186G>T	9.37:g.19576964C>A	ENSP00000344801:p.Val396Leu		Somatic				SLC24A2_uc003zob.1_Missense_Mutation_p.V379L	p.V396L	NM_020344	NP_065077	WXS	Illumina HiSeq	Unspecified	Q9UI40	NCKX2_HUMAN		GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)	5	1248	-			396			Cytoplasmic (Potential).		B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	c.1186G>T	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236850	0.39498	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.74315	-0.83;-0.79	5.82	4.92	0.64577	.	0.062950	0.64402	D	0.000006	T	0.64571	0.2610	L	0.38838	1.175	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.001	T	0.58624	-0.7604	9	.	.	.	.	13.9456	0.64082	0.0:0.9257:0.0:0.0743	.	379;396	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	L	396;379	ENSP00000344801:V396L;ENSP00000286344:V379L	.	V	-	1	0	SLC24A2	19566964	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	4.860000	0.62961	1.465000	0.48006	0.591000	0.81541	GTG		0.517	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344		30	68	1	0	6.97489e-18	0.004878	1.1678e-17	30	68				
TEK	7010	broad.mit.edu	37	9	27202926	27202926	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:27202926G>A	ENST00000380036.4	+	13	2460	c.2018G>A	c.(2017-2019)cGt>cAt	p.R673H	TEK_ENST00000519097.1_Missense_Mutation_p.R526H|TEK_ENST00000406359.4_Missense_Mutation_p.R630H	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	673	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	ATTACTATCCGTTACAAGGTT	0.413																																							uc003zqi.3		NA																	0				ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12						c.(2017-2019)CGT>CAT		TEK tyrosine kinase, endothelial precursor							160.0	145.0	150.0					9																	27202926		2203	4300	6503	SO:0001583	missense	7010				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr9:27202926G>A	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2018G>A	9.37:g.27202926G>A	ENSP00000369375:p.Arg673His		Somatic				TEK_uc011lno.1_Missense_Mutation_p.R630H|TEK_uc011lnp.1_Missense_Mutation_p.R526H|TEK_uc003zqj.1_Missense_Mutation_p.R607H	p.R673H	NM_000459	NP_000450	WXS	Illumina HiSeq	Unspecified	Q02763	TIE2_HUMAN		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	13	2460	+		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)	673			Extracellular (Potential).|Fibronectin type-III 3.		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	c.2018G>A	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575694	0.86645	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.16597	2.33;2.33;2.33	5.78	5.78	0.91487	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.124634	0.36665	N	0.002477	T	0.26774	0.0655	L	0.27053	0.805	0.45515	D	0.998479	D;D;D;D	0.64830	0.984;0.991;0.994;0.994	P;D;P;P	0.63033	0.787;0.91;0.866;0.845	T	0.00677	-1.1614	10	0.51188	T	0.08	.	14.2058	0.65732	0.071:0.0:0.929:0.0	.	526;706;630;673	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	H	526;673;630	ENSP00000430686:R526H;ENSP00000369375:R673H;ENSP00000383977:R630H	ENSP00000369375:R673H	R	+	2	0	TEK	27192926	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.837000	0.69381	2.732000	0.93576	0.637000	0.83480	CGT		0.413	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3			7	57	0	0	0	0.001984	0	7	57				
LINGO2	158038	broad.mit.edu	37	9	27949151	27949151	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:27949151G>T	ENST00000379992.2	-	6	1968	c.1519C>A	c.(1519-1521)Cgt>Agt	p.R507S	LINGO2_ENST00000308675.3_Missense_Mutation_p.R507S	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	507			R -> H (in dbSNP:rs17506843).			integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TAAAGAAAACGATCTGAAGCG	0.463																																							uc003zqu.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(1519-1521)CGT>AGT		leucine rich repeat and Ig domain containing 2							140.0	137.0	138.0					9																	27949151		2203	4300	6503	SO:0001583	missense	158038					integral to membrane		g.chr9:27949151G>T	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1519C>A	9.37:g.27949151G>T	ENSP00000369328:p.Arg507Ser		Somatic				LINGO2_uc010mjf.1_Missense_Mutation_p.R507S|LINGO2_uc003zqv.1_Missense_Mutation_p.R507S	p.R507S	NM_152570	NP_689783	WXS	Illumina HiSeq	Unspecified	Q7L985	LIGO2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)	2	1713	-	Melanoma(11;0.242)	all_neural(11;2.78e-09)	507			Extracellular (Potential).		A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	c.1519C>A	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	G	1.865	-0.461564	0.04508	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.57752	0.38;0.38	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000001	T	0.32526	0.0832	N	0.08118	0	0.49798	D	0.999821	B	0.12630	0.006	B	0.13407	0.009	T	0.16897	-1.0387	9	.	.	.	.	14.9014	0.70681	0.0:0.0:0.8568:0.1432	.	507	Q7L985	LIGO2_HUMAN	S	507	ENSP00000369328:R507S;ENSP00000310126:R507S	.	R	-	1	0	LINGO2	27939151	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.081000	0.57627	2.769000	0.95229	0.655000	0.94253	CGT		0.463	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570		18	37	1	0	1.50039e-11	0.012319	2.26023e-11	18	37				
TAF1L	138474	broad.mit.edu	37	9	32631704	32631704	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:32631704T>C	ENST00000242310.4	-	1	3963	c.3874A>G	c.(3874-3876)Atg>Gtg	p.M1292V	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1292					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTAGTCCTCATATGTCCAATG	0.463																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(3874-3876)ATG>GTG		TBP-associated factor RNA polymerase 1-like							158.0	156.0	157.0					9																	32631704		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32631704T>C	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3874A>G	9.37:g.32631704T>C	ENSP00000418379:p.Met1292Val		Somatic				uc003zrh.1_5'Flank	p.M1292V	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	3964	-			1292					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.3874A>G	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.564572	0.45694	.	.	ENSG00000122728	ENST00000242310	T	0.45276	0.9	1.56	1.56	0.23342	.	0.000000	0.85682	D	0.000000	T	0.50360	0.1611	M	0.72479	2.2	0.54753	D	0.999983	D	0.54047	0.964	P	0.55011	0.766	T	0.50039	-0.8874	10	0.87932	D	0	.	6.7809	0.23646	0.0:0.0:0.0:1.0	.	1292	Q8IZX4	TAF1L_HUMAN	V	1292	ENSP00000418379:M1292V	ENSP00000418379:M1292V	M	-	1	0	TAF1L	32621704	1.000000	0.71417	0.960000	0.40013	0.737000	0.42083	5.241000	0.65384	0.426000	0.26116	0.164000	0.16699	ATG		0.463	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			31	58	0	0	0	0.003271	0	31	58				
FAM214B	80256	broad.mit.edu	37	9	35106295	35106295	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:35106295A>C	ENST00000378561.1	-	5	4227	c.1172T>G	c.(1171-1173)gTc>gGc	p.V391G	FAM214B_ENST00000605244.1_Missense_Mutation_p.V391G|FAM214B_ENST00000378557.1_Missense_Mutation_p.V391G|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000603301.1_Missense_Mutation_p.V391G|FAM214B_ENST00000378566.1_Missense_Mutation_p.V86G|FAM214B_ENST00000322813.5_Missense_Mutation_p.V391G|FAM214B_ENST00000378554.2_Missense_Mutation_p.V391G|FAM214B_ENST00000488109.2_Missense_Mutation_p.V391G			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	391						nucleus (GO:0005634)											AAAGAATGTGACAGTGACAGG	0.532																																							uc003zwl.2		NA																	0				ovary(2)	2						c.(1171-1173)GTC>GGC		hypothetical protein LOC80256							99.0	96.0	97.0					9																	35106295		2203	4300	6503	SO:0001583	missense	80256					nucleus		g.chr9:35106295A>C	AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.1172T>G	9.37:g.35106295A>C	ENSP00000367823:p.Val391Gly		Somatic				KIAA1539_uc003zwm.2_Missense_Mutation_p.V391G|KIAA1539_uc003zwn.2_Missense_Mutation_p.V86G|KIAA1539_uc003zwo.2_Missense_Mutation_p.V391G|KIAA1539_uc003zwp.1_Missense_Mutation_p.V391G|KIAA1539_uc010mkk.1_RNA	p.V391G	NM_025182	NP_079458	WXS	Illumina HiSeq	Unspecified	Q7L5A3	K1539_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		6	1497	-	all_epithelial(49;0.217)		391					B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	ENST00000378561.1	37	c.1172T>G	CCDS6578.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753582	0.69648	.	.	ENSG00000005238	ENST00000378566;ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.76779	0.4035	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79298	-0.1861	9	0.87932	D	0	-26.8707	15.2318	0.73395	1.0:0.0:0.0:0.0	.	391	Q7L5A3	K1539_HUMAN	G	86;391;391;391;391	.	ENSP00000319897:V391G	V	-	2	0	KIAA1539	35096295	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.666000	0.91149	2.269000	0.75478	0.533000	0.62120	GTC		0.532	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052261.1	NM_025182		12	68	0	0	0	0.001855	0	12	68				
GNE	10020	broad.mit.edu	37	9	36217419	36217419	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:36217419G>A	ENST00000539815.1	-	11	2152	c.2112C>T	c.(2110-2112)ccC>ccT	p.P704P	GNE_ENST00000447283.2_Silent_p.P630P|GNE_ENST00000377902.5_Silent_p.P704P|GNE_ENST00000396594.3_Silent_p.P735P|GNE_ENST00000543356.2_Silent_p.P699P|GNE_ENST00000539208.1_Silent_p.P594P			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	704	N-acetylmannosamine kinase.				carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)	p.P704P(1)|p.P699P(1)|p.P735P(1)		endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			CCAGCAGGGCGGGGTCAACCA	0.557																																					GBM(184;106 2118 20004 35750 50727)	GBM(184;106 2118 20004 35750 50727)	uc010mlh.2		NA																	3	Substitution - coding silent(3)		endometrium(3)		0						c.(2110-2112)CCC>CCT		UDP-N-acetylglucosamine-2-epimerase/N-							112.0	86.0	95.0					9																	36217419		2203	4300	6503	SO:0001819	synonymous_variant	10020				cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity	g.chr9:36217419G>A	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.2112C>T	9.37:g.36217419G>A			Somatic				CLTA_uc003zzf.1_Intron|GNE_uc010mlg.2_Silent_p.P630P|GNE_uc011lpl.1_Silent_p.P594P|GNE_uc010mli.2_Silent_p.P735P|GNE_uc010mlj.2_Silent_p.P699P	p.P704P	NM_005476	NP_005467	WXS	Illumina HiSeq	Unspecified	Q9Y223	GLCNE_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		12	2327	-			704			UDP-N-acetylglucosamine 2-epimerase.|N-acetylmannosamine kinase.		A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Silent	SNP	ENST00000539815.1	37	c.2112C>T	CCDS6602.1																																																																																				0.557	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476		6	22	0	0	0	0.00308	0	6	22				
SPATA31C1	441452	broad.mit.edu	37	9	90535546	90535546	+	RNA	SNP	C	C	A	rs560034208		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:90535546C>A	ENST00000602681.1	+	0	1450							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCTCCCCTGCGGGACTCCAC	0.592																																							uc010mqi.2		NA																	0					0						c.(724-726)CGG>AGG		family with sequence similarity 75, member C1							55.0	48.0	50.0					9																	90535546		692	1591	2283			441452							g.chr9:90535546C>A	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90535546C>A			Somatic				FAM75C1_uc004apq.3_Silent_p.R225R	p.R242R	NM_001145124	NP_001138596	WXS	Illumina HiSeq	Unspecified					4	753	+									Silent	SNP	ENST00000602681.1	37	c.724C>A																																																																																					0.592	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124		49	132	1	0	9.53978e-28	0.01441	1.70958e-27	49	132				
C9orf89	84270	broad.mit.edu	37	9	95872911	95872911	+	Missense_Mutation	SNP	G	G	T	rs150588284	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:95872911G>T	ENST00000375464.2	+	3	340	c.212G>T	c.(211-213)cGg>cTg	p.R71L	C9orf89_ENST00000488630.1_3'UTR	NM_032310.3	NP_115686.3	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	71	CARD.				negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						CACCTGCAGCGGAGCGGTGAG	0.652																																							uc004atd.2		NA																	0					0						c.(211-213)CGG>CTG		chromosome 9 open reading frame 89							88.0	87.0	87.0					9																	95872911		2203	4300	6503	SO:0001583	missense	84270				negative regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|nucleus	CARD domain binding	g.chr9:95872911G>T	AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000375464.2:c.212G>T	9.37:g.95872911G>T	ENSP00000364613:p.Arg71Leu		Somatic				C9orf89_uc004ate.2_RNA|C9orf89_uc004atf.2_RNA	p.R71L	NM_032310	NP_115686	WXS	Illumina HiSeq	Unspecified	Q96LW7	BINCA_HUMAN			3	390	+			71			CARD.		Q5BJH8|Q9BSY2	Missense_Mutation	SNP	ENST00000375464.2	37	c.212G>T	CCDS6702.2	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623625	0.46840	.	.	ENSG00000165233	ENST00000375464	T	0.15718	2.4	4.8	-2.97	0.05530	.	0.373357	0.27464	N	0.019252	T	0.10594	0.0259	.	.	.	0.27653	N	0.947329	P	0.40302	0.712	B	0.35727	0.209	T	0.13980	-1.0489	9	0.46703	T	0.11	.	10.5124	0.44870	0.5399:0.0:0.4601:0.0	.	71	Q96LW7-2	.	L	71	ENSP00000364613:R71L	ENSP00000364613:R71L	R	+	2	0	C9orf89	94912732	0.841000	0.29509	0.783000	0.31826	0.868000	0.49771	-0.189000	0.09629	-0.551000	0.06175	-0.658000	0.03865	CGG		0.652	C9orf89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053128.1	NM_032310		18	56	1	0	8.34094e-07	0.008871	1.04217e-06	18	56				
PTCH1	5727	broad.mit.edu	37	9	98241428	98241428	+	Splice_Site	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:98241428C>A	ENST00000331920.6	-	8	1368	c.1069G>T	c.(1069-1071)Gcc>Tcc	p.A357S	PTCH1_ENST00000375274.2_Splice_Site_p.A356S|PTCH1_ENST00000418258.1_Splice_Site_p.A206S|PTCH1_ENST00000437951.1_Splice_Site_p.A291S|PTCH1_ENST00000429896.2_Splice_Site_p.A206S|PTCH1_ENST00000421141.1_Splice_Site_p.A206S|PTCH1_ENST00000430669.2_Splice_Site_p.A291S|PTCH1_ENST00000548379.1_5'Flank	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	357					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AGGGCATGGGCGCTGCAGCAC	0.537																																							uc004avk.3		NA																	0				skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379						c.(1069-1071)GCC>TCC		patched isoform L							154.0	120.0	132.0					9																	98241428		2203	4300	6503	SO:0001630	splice_region_variant	5727	Basal_Cell_Nevus_syndrome			embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	g.chr9:98241428C>A	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1068-1G>T	9.37:g.98241428C>A			Somatic				PTCH1_uc010mro.2_Missense_Mutation_p.A206S|PTCH1_uc010mrp.2_Missense_Mutation_p.A206S|PTCH1_uc010mrq.2_Missense_Mutation_p.A206S|PTCH1_uc004avl.3_Missense_Mutation_p.A206S|PTCH1_uc010mrr.2_Missense_Mutation_p.A291S|PTCH1_uc004avm.3_Missense_Mutation_p.A356S|PTCH1_uc010mrs.1_Missense_Mutation_p.A77S	p.A357S	NM_000264	NP_000255	WXS	Illumina HiSeq	Unspecified	Q13635	PTC1_HUMAN			8	1257	-		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)	357			Extracellular (Potential).		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	c.1069G>T	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	31	5.084800	0.94100	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271	D;D;D;D;D;D;D;D	0.96200	-3.92;-3.89;-3.91;-3.91;-3.89;-3.91;-3.94;-3.6	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.98137	0.9385	M	0.86864	2.845	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.988;0.998;0.999;0.998	D	0.97960	1.0337	10	0.59425	D	0.04	-33.027	20.6439	0.99570	0.0:1.0:0.0:0.0	.	206;291;356;357	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	S	357;291;206;206;291;206;356;74	ENSP00000332353:A357S;ENSP00000389744:A291S;ENSP00000399981:A206S;ENSP00000396135:A206S;ENSP00000410287:A291S;ENSP00000414823:A206S;ENSP00000364423:A356S;ENSP00000364420:A74S	ENSP00000332353:A357S	A	-	1	0	PTCH1	97281249	1.000000	0.71417	0.983000	0.44433	0.569000	0.35902	7.487000	0.81328	2.884000	0.98904	0.655000	0.94253	GCC		0.537	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	Missense_Mutation	12	56	1	0	3.45872e-05	0.004007	4.06174e-05	12	56				
ERCC6L2	375748	broad.mit.edu	37	9	98669551	98669551	+	Silent	SNP	C	C	T	rs540770553		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:98669551C>T	ENST00000288985.7	+	4	1124	c.819C>T	c.(817-819)aaC>aaT	p.N273N	ERCC6L2_ENST00000437817.1_Silent_p.N84N|RNA5SP289_ENST00000362332.1_RNA|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	273	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										ATGAACTTAACAGGTAATGGG	0.299													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17456	0.0		0.0	False		,,,				2504	0.0						uc004avt.3		NA																	0					0						c.(817-819)AAC>AAT		RAD26L hypothetical protein							66.0	63.0	64.0					9																	98669551		2203	4300	6503	SO:0001819	synonymous_variant	375748				DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding	g.chr9:98669551C>T	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.819C>T	9.37:g.98669551C>T			Somatic				C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Intron|C9orf102_uc010mry.1_Intron|C9orf102_uc010mrz.2_Silent_p.N84N	p.N273N	NM_001010895	NP_001010895	WXS	Illumina HiSeq	Unspecified	Q5T890	RAD26_HUMAN			4	1207	+		Acute lymphoblastic leukemia(62;0.0559)	273			Helicase ATP-binding.		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Silent	SNP	ENST00000288985.7	37	c.819C>T	CCDS35072.1																																																																																				0.299	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895		13	26	0	0	0	0.004007	0	13	26				
CCDC180	100499483	broad.mit.edu	37	9	100092615	100092615	+	Nonsense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:100092615A>T	ENST00000357054.1	+	32	3324	c.2389A>T	c.(2389-2391)Aaa>Taa	p.K797*	CCDC180_ENST00000411667.2_Nonsense_Mutation_p.K655*|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Nonsense_Mutation_p.K658*|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000375202.2_Nonsense_Mutation_p.K658*			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	797						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGCACATGAAAAACCCTCCCA	0.463																																							uc011lut.1		NA																	0				ovary(4)|large_intestine(2)|skin(1)	7						c.(2389-2391)AAA>TAA		hypothetical protein LOC57653							64.0	65.0	65.0					9																	100092615		2203	4300	6503	SO:0001587	stop_gained	57653							g.chr9:100092615A>T	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2389A>T	9.37:g.100092615A>T	ENSP00000349562:p.Lys797*		Somatic				KIAA1529_uc004axe.1_Nonsense_Mutation_p.K797*|KIAA1529_uc004axg.1_Nonsense_Mutation_p.K658*|KIAA1529_uc004axh.1_RNA|KIAA1529_uc011luw.1_5'UTR|KIAA1529_uc011lus.1_Nonsense_Mutation_p.K615*|KIAA1529_uc010msm.1_RNA|KIAA1529_uc004axf.2_Nonsense_Mutation_p.K658*|KIAA1529_uc011luv.1_Nonsense_Mutation_p.K655*	p.K797*	NM_020893	NP_065944	WXS	Illumina HiSeq	Unspecified					30	3162	+		Acute lymphoblastic leukemia(62;0.154)						Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Nonsense_Mutation	SNP	ENST00000357054.1	37	c.2389A>T		.	.	.	.	.	.	.	.	.	.	A	47	13.266398	0.99731	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	.	.	.	4.78	1.13	0.20643	.	0.818011	0.10878	N	0.624128	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7895	3.4392	0.07457	0.5879:0.2036:0.2085:0.0	.	.	.	.	X	797;658;655;681;658	.	ENSP00000349562:K797X	K	+	1	0	C9orf174	99132436	0.148000	0.22702	0.002000	0.10522	0.058000	0.15608	1.070000	0.30653	0.366000	0.24427	0.454000	0.30748	AAA		0.463	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893		7	17	0	0	0	0.00308	0	7	17				
GRIN3A	116443	broad.mit.edu	37	9	104357194	104357194	+	Intron	SNP	C	C	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:104357194C>T	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.E7K	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TAACTGGCCTCGTTTCCCATT	0.592																																							uc004bbr.2		NA																	0				ovary(1)|skin(1)	2						c.(19-21)GAG>AAG		protein phosphatase 3 regulatory subunit B, beta	Cyclosporine(DB00091)						43.0	47.0	46.0					9																	104357194		2200	4300	6500	SO:0001627	intron_variant	5535						calcium ion binding	g.chr9:104357194C>T		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15552G>A	9.37:g.104357194C>T			Somatic				GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	p.E7K	NM_147180	NP_671709	WXS	Illumina HiSeq	Unspecified	Q96LZ3	CANB2_HUMAN			1	90	-		Acute lymphoblastic leukemia(62;0.0527)	4					B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	c.19G>A	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.785696	0.70337	.	.	ENSG00000188386	ENST00000374806;ENST00000541976	T	0.69561	-0.41	3.94	3.94	0.45596	.	0.000000	0.40385	N	0.001106	T	0.55417	0.1919	L	0.38733	1.17	0.45066	D	0.998082	B	0.27791	0.189	B	0.17433	0.018	T	0.60816	-0.7188	10	0.66056	D	0.02	-33.5175	14.2872	0.66254	0.0:1.0:0.0:0.0	.	4	Q96LZ3	CANB2_HUMAN	K	7	ENSP00000363939:E7K	ENSP00000363939:E7K	E	-	1	0	PPP3R2	103397015	0.989000	0.36119	1.000000	0.80357	0.974000	0.67602	1.605000	0.36815	2.491000	0.84063	0.563000	0.77884	GAG		0.592	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			14	30	0	0	0	0.006122	0	14	30				
OR13F1	138805	broad.mit.edu	37	9	107266778	107266778	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:107266778T>C	ENST00000334726.2	+	1	324	c.235T>C	c.(235-237)Tct>Cct	p.S79P		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TTCTGCCCTCTCTCCAATGCT	0.507																																							uc011lvm.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(235-237)TCT>CCT		olfactory receptor, family 13, subfamily F,							164.0	144.0	151.0					9																	107266778		2203	4300	6503	SO:0001583	missense	138805				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107266778T>C		CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.235T>C	9.37:g.107266778T>C	ENSP00000334452:p.Ser79Pro		Somatic					p.S79P	NM_001004485	NP_001004485	WXS	Illumina HiSeq	Unspecified	Q8NGS4	O13F1_HUMAN			1	235	+			79			Extracellular (Potential).		Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	37	c.235T>C	CCDS35087.1	.	.	.	.	.	.	.	.	.	.	A	8.632	0.893950	0.17613	.	.	ENSG00000186881	ENST00000334726	T	0.00000	10.55	3.91	0.369	0.16151	GPCR, rhodopsin-like superfamily (1);	0.271361	0.26173	N	0.025920	T	0.00012	0.0000	N	0.00000	-4.07	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.63310	-0.6666	10	0.02654	T	1	.	0.5228	0.00615	0.4241:0.1996:0.2097:0.1667	.	79	Q8NGS4	O13F1_HUMAN	P	79	ENSP00000334452:S79P	ENSP00000334452:S79P	S	+	1	0	OR13F1	106306599	0.041000	0.20044	0.981000	0.43875	0.897000	0.52465	1.700000	0.37815	-0.176000	0.10707	-0.263000	0.10527	TCT		0.507	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1			15	64	0	0	0	0.006122	0	15	64				
SVEP1	79987	broad.mit.edu	37	9	113173805	113173805	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:113173805A>T	ENST00000401783.2	-	37	6522	c.6186T>A	c.(6184-6186)aaT>aaA	p.N2062K	SVEP1_ENST00000297826.5_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.N2039K	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2062	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGCCCTGGGCATTGCAGAGAA	0.502																																							uc010mtz.2		NA																	0				ovary(7)	7						c.(6184-6186)AAT>AAA		polydom							44.0	45.0	45.0					9																	113173805		1928	4127	6055	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113173805A>T	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6186T>A	9.37:g.113173805A>T	ENSP00000384917:p.Asn2062Lys		Somatic				SVEP1_uc010mty.2_5'UTR	p.N2062K	NM_153366	NP_699197	WXS	Illumina HiSeq	Unspecified	Q4LDE5	SVEP1_HUMAN			37	6523	-			2062			Sushi 11.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.6186T>A	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.304148	0.60305	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.63417	-0.04;-0.04	5.98	3.58	0.41010	Complement control module (2);Sushi/SCR/CCP (3);	0.041861	0.85682	D	0.000000	T	0.64227	0.2579	M	0.65975	2.015	0.80722	D	1	D	0.56746	0.977	P	0.53988	0.739	T	0.64761	-0.6331	10	0.06099	T	0.92	.	10.5364	0.45007	0.8678:0.0:0.1322:0.0	.	2062	Q4LDE5	SVEP1_HUMAN	K	2062;2039	ENSP00000384917:N2062K;ENSP00000363593:N2039K	ENSP00000363593:N2039K	N	-	3	2	SVEP1	112213626	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.102000	0.41796	0.480000	0.27534	0.482000	0.46254	AAT		0.502	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				11	20	0	0	0	0.010729	0	11	20				
PTBP3	9991	broad.mit.edu	37	9	114989795	114989795	+	Silent	SNP	A	A	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:114989795A>C	ENST00000374255.2	-	13	1491	c.1344T>G	c.(1342-1344)acT>acG	p.T448T	PTBP3_ENST00000458258.1_Silent_p.T454T|PTBP3_ENST00000374257.1_Silent_p.T420T|PTBP3_ENST00000343327.2_Silent_p.T353T|PTBP3_ENST00000334318.6_Silent_p.T451T			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	448					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TGAAATCCTTAGTCAGACCTT	0.448																																							uc004bfw.2		NA																	0				skin(1)	1						c.(1342-1344)ACT>ACG		ROD1 regulator of differentiation 1 isoform 1							137.0	132.0	134.0					9																	114989795		2203	4300	6503	SO:0001819	synonymous_variant	9991				anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding	g.chr9:114989795A>C	AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1344T>G	9.37:g.114989795A>C			Somatic				ROD1_uc004bfv.2_Silent_p.T454T|ROD1_uc004bfx.2_Silent_p.T451T|ROD1_uc011lwu.1_Silent_p.T420T|ROD1_uc004bfy.2_Silent_p.T353T|ROD1_uc004bfz.2_Silent_p.T420T	p.T448T	NM_005156	NP_005147	WXS	Illumina HiSeq	Unspecified	O95758	ROD1_HUMAN			13	1531	-			448					B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Silent	SNP	ENST00000374255.2	37	c.1344T>G	CCDS6784.1																																																																																				0.448	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053679.1			10	55	0	0	0	0.008291	0	10	55				
TNFSF15	9966	broad.mit.edu	37	9	117553073	117553073	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:117553073G>A	ENST00000374045.4	-	4	528	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	TNFSF15_ENST00000374044.1_Silent_p.L62L|AL390240.1_ENST00000408807.1_RNA	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15	139					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						GGGATCAGCAGGAATTTGTTG	0.493																																							uc004bjh.2		NA																	0					0						c.(415-417)CTG>TTG		tumor necrosis factor (ligand) superfamily,							113.0	110.0	111.0					9																	117553073		2203	4300	6503	SO:0001819	synonymous_variant	9966				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|cytokine metabolic process|immune response	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding	g.chr9:117553073G>A	AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.415C>T	9.37:g.117553073G>A			Somatic				TNFSF15_uc004bjg.2_Silent_p.L80L	p.L139L	NM_005118	NP_005109	WXS	Illumina HiSeq	Unspecified	O95150	TNF15_HUMAN			4	531	-			139			Extracellular (Potential).		Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Silent	SNP	ENST00000374045.4	37	c.415C>T	CCDS6809.1																																																																																				0.493	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055424.2	NM_005118		12	21	0	0	0	0.004007	0	12	21				
ASTN2	23245	broad.mit.edu	37	9	119737613	119737613	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:119737613C>A	ENST00000313400.4	-	10	1863	c.1763G>T	c.(1762-1764)aGc>aTc	p.S588I	ASTN2_ENST00000361209.2_Missense_Mutation_p.S537I|ASTN2_ENST00000373996.3_Splice_Site|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	588					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TTGGCCCAAGCTGAAAGTAGA	0.557																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(1762-1764)AGC>ATC		astrotactin 2 isoform c							60.0	58.0	58.0					9																	119737613		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119737613C>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1763G>T	9.37:g.119737613C>A	ENSP00000314038:p.Ser588Ile		Somatic				ASTN2_uc004bjr.1_Splice_Site_p.S584_splice|ASTN2_uc004bjt.1_Missense_Mutation_p.S537I	p.S588I	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			10	1864	-			588			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.1763G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.396234|4.396234	0.83011|0.83011	.|.	.|.	ENSG00000148219|ENSG00000148219	ENST00000373996;ENST00000373986|ENST00000313400;ENST00000361209	.|T;T	.|0.12672	.|2.66;2.7	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.18923	.|0.0454	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;D	.|0.56521	.|0.974;0.976	.|P;P	.|0.53954	.|0.738;0.601	.|T	.|0.02150	.|-1.1205	.|9	.|.	.|.	.|.	.|-27.6919	20.0323|20.0323	0.97544|0.97544	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|537;588	.|O75129-2;O75129	.|.;ASTN2_HUMAN	.|I	-1|588;537	.|ENSP00000314038:S588I;ENSP00000354504:S537I	.|.	.|S	-|-	.|2	.|0	ASTN2|ASTN2	118777434|118777434	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.849000|4.849000	0.62882|0.62882	2.736000|2.736000	0.93811|0.93811	0.561000|0.561000	0.74099|0.74099	.|AGC		0.557	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		13	17	1	0	2.31682e-05	0.003163	2.72622e-05	13	17				
OR5C1	392391	broad.mit.edu	37	9	125552027	125552027	+	Silent	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:125552027G>A	ENST00000373680.2	+	1	878	c.816G>A	c.(814-816)ctG>ctA	p.L272L		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						GCTATGCCCTGGACACTGACA	0.582																																							uc011lzd.1		NA																	0				pancreas(1)	1						c.(814-816)CTG>CTA		olfactory receptor, family 5, subfamily C,							107.0	86.0	93.0					9																	125552027		2203	4300	6503	SO:0001819	synonymous_variant	392391				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125552027G>A	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.816G>A	9.37:g.125552027G>A			Somatic					p.L272L	NM_001001923	NP_001001923	WXS	Illumina HiSeq	Unspecified	Q8NGR4	OR5C1_HUMAN			1	816	+			272			Extracellular (Potential).		B2RN54|B9EGT0|Q96RC4	Silent	SNP	ENST00000373680.2	37	c.816G>A	CCDS35131.1																																																																																				0.582	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1			17	45	0	0	0	0.006122	0	17	45				
ADAMTS13	11093	broad.mit.edu	37	9	136291323	136291323	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:136291323G>A	ENST00000371929.3	+	6	988	c.544G>A	c.(544-546)Gac>Aac	p.D182N	ADAMTS13_ENST00000371911.3_Missense_Mutation_p.D182N|ADAMTS13_ENST00000371916.1_Missense_Mutation_p.D182N|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000536611.1_5'Flank|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.D182N|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.D182N	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	182	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		ACCGAGGTTTGACCTGGAGTT	0.637																																							uc004cdv.3		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(544-546)GAC>AAC		ADAM metallopeptidase with thrombospondin type 1							81.0	74.0	76.0					9																	136291323		2203	4300	6503	SO:0001583	missense	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136291323G>A	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.544G>A	9.37:g.136291323G>A	ENSP00000360997:p.Asp182Asn		Somatic				ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.D182N|ADAMTS13_uc004cdu.1_Missense_Mutation_p.D182N|ADAMTS13_uc004cdw.3_Missense_Mutation_p.D182N|ADAMTS13_uc004cdx.3_Missense_Mutation_p.D182N|ADAMTS13_uc004cdy.1_5'Flank|ADAMTS13_uc004cdq.1_Missense_Mutation_p.D182N|ADAMTS13_uc004cds.1_Silent_p.L11L|ADAMTS13_uc004cdr.1_RNA	p.D182N	NM_139025	NP_620594	WXS	Illumina HiSeq	Unspecified	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	6	988	+			182			Peptidase M12B.		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	c.544G>A	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043273	0.93685	.	.	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911;ENST00000338351	D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54	4.7	4.7	0.59300	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.93475	0.7918	M	0.67517	2.055	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	D	0.93509	0.6851	9	0.48119	T	0.1	.	16.617	0.84918	0.0:0.0:1.0:0.0	.	182;182;182;182	Q76LX8;Q76LX8-3;Q76LX8-2;E7EV88	ATS13_HUMAN;.;.;.	N	182;182;182;182;182;52	ENSP00000360997:D182N;ENSP00000360984:D182N;ENSP00000347927:D182N;ENSP00000348997:D182N;ENSP00000360979:D182N	ENSP00000345120:D52N	D	+	1	0	ADAMTS13	135281144	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.130000	0.94437	2.166000	0.68216	0.655000	0.94253	GAC		0.637	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		21	43	0	0	0	0.003954	0	21	43				
COL5A1	1289	broad.mit.edu	37	9	137645731	137645731	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:137645731G>T	ENST00000371817.3	+	15	2169	c.1755G>T	c.(1753-1755)ccG>ccT	p.P585P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	585	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGGGCGAGCCGGGAGACGTGG	0.652																																							uc004cfe.2		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(1753-1755)CCG>CCT		alpha 1 type V collagen preproprotein							141.0	133.0	136.0					9																	137645731		2203	4300	6503	SO:0001819	synonymous_variant	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137645731G>T	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1755G>T	9.37:g.137645731G>T			Somatic					p.P585P	NM_000093	NP_000084	WXS	Illumina HiSeq	Unspecified	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	15	2137	+		Myeloproliferative disorder(178;0.0341)	585			Triple-helical region.		Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	c.1755G>T	CCDS6982.1																																																																																				0.652	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		18	34	1	0	1.64113e-05	0.010504	1.95468e-05	18	34				
LCN1	3933	broad.mit.edu	37	9	138416989	138416989	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:138416989C>A	ENST00000263598.2	+	6	577	c.517C>A	c.(517-519)Cca>Aca	p.P173T	LCN1_ENST00000371781.3_Missense_Mutation_p.P173T	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	173					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		AACCTGCTCTCCAGGGAGCGA	0.577																																							uc004cfz.1		NA																	0					0						c.(517-519)CCA>ACA		lipocalin 1 precursor							104.0	112.0	109.0					9																	138416989		2203	4300	6503	SO:0001583	missense	3933				proteolysis|response to stimulus|sensory perception of taste	extracellular region	cysteine-type endopeptidase inhibitor activity|transporter activity	g.chr9:138416989C>A		CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.517C>A	9.37:g.138416989C>A	ENSP00000263598:p.Pro173Thr		Somatic				LCN1_uc004cga.1_Missense_Mutation_p.P173T	p.P173T	NM_002297	NP_002288	WXS	Illumina HiSeq	Unspecified	P31025	LCN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)	6	575	+		Myeloproliferative disorder(178;0.0511)	173					Q5T8A1	Missense_Mutation	SNP	ENST00000263598.2	37	c.517C>A	CCDS6991.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548320	0.27652	.	.	ENSG00000160349	ENST00000263598;ENST00000371781	T;T	0.11604	2.76;2.76	3.44	0.27	0.15635	Calycin-like (1);	0.499774	0.16878	N	0.195801	T	0.17959	0.0431	M	0.70842	2.15	0.09310	N	1	D	0.54601	0.967	P	0.52514	0.701	T	0.06679	-1.0813	10	0.62326	D	0.03	.	5.8993	0.18957	0.3894:0.4208:0.1898:0.0	.	173	P31025	LCN1_HUMAN	T	173	ENSP00000263598:P173T;ENSP00000360846:P173T	ENSP00000263598:P173T	P	+	1	0	LCN1	137556810	0.002000	0.14202	0.000000	0.03702	0.049000	0.14656	-0.042000	0.12063	0.062000	0.16340	-0.202000	0.12741	CCA		0.577	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1	NM_002297		15	38	1	0	2.94398e-08	0.007413	3.92978e-08	15	38				
GLT6D1	360203	broad.mit.edu	37	9	138516186	138516186	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:138516186G>T	ENST00000371763.1	-	5	841	c.588C>A	c.(586-588)gcC>gcA	p.A196A		NM_182974.2	NP_892019.2	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	196					carbohydrate metabolic process (GO:0005975)	integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	15		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		AATACCACCAGGCGTGGAGCT	0.557																																							uc010nbd.1		NA																	0				ovary(1)	1						c.(586-588)GCC>GCA		glycosyltransferase 6 domain containing 1							70.0	69.0	70.0					9																	138516186		1906	4118	6024	SO:0001819	synonymous_variant	360203				carbohydrate metabolic process	integral to membrane	transferase activity, transferring hexosyl groups	g.chr9:138516186G>T	AY336054	CCDS43900.1	9q34.3	2013-02-22	2004-09-16	2004-09-17	ENSG00000204007	ENSG00000204007		"""Glycosyltransferase family 6 domain containing"""	23671	protein-coding gene	gene with protein product		613699	"""galactosyltransferase family 6 domain containing 1"""	GLTDC1			Standard	NM_182974		Approved		uc010nbd.1	Q7Z4J2	OTTHUMG00000020911	ENST00000371763.1:c.588C>A	9.37:g.138516186G>T			Somatic					p.A196A	NM_182974	NP_892019	WXS	Illumina HiSeq	Unspecified	Q7Z4J2	GL6D1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)	5	842	-		Myeloproliferative disorder(178;0.0821)	196			Lumenal (Potential).			Silent	SNP	ENST00000371763.1	37	c.588C>A	CCDS43900.1																																																																																				0.557	GLT6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055005.2	NM_182974		9	16	1	0	6.40141e-05	0.010729	7.41349e-05	9	16				
MAN1B1	11253	broad.mit.edu	37	9	139990728	139990728	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:139990728C>A	ENST00000371589.4	+	4	578	c.505C>A	c.(505-507)Cag>Aag	p.Q169K	MAN1B1_ENST00000474902.1_5'UTR|SNORD62_ENST00000362541.1_RNA	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	169					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACCTCACCTGCAGATTAGACC	0.572																																							uc004cld.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(505-507)CAG>AAG		alpha 1,2-mannosidase							69.0	66.0	67.0					9																	139990728		2203	4300	6503	SO:0001583	missense	11253				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|endoplasmic reticulum quality control compartment|integral to membrane	alpha-mannosidase activity|calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr9:139990728C>A	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.505C>A	9.37:g.139990728C>A	ENSP00000360645:p.Gln169Lys		Somatic				MAN1B1_uc004clc.2_Missense_Mutation_p.Q70K|MAN1B1_uc011meo.1_Missense_Mutation_p.Q70K|MAN1B1_uc011mep.1_Missense_Mutation_p.Q169K|MAN1B1_uc010ncc.2_RNA	p.Q169K	NM_016219	NP_057303	WXS	Illumina HiSeq	Unspecified	Q9UKM7	MA1B1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)	4	540	+	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	169			Lumenal (Potential).		Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	ENST00000371589.4	37	c.505C>A	CCDS7029.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	12.57|12.57|12.57	1.978832|1.978832|1.978832	0.34942|0.34942|0.34942	.|.|.	.|.|.	ENSG00000177239|ENSG00000177239|ENSG00000177239	ENST00000535144;ENST00000542372|ENST00000540346|ENST00000371589	.|.|T	.|.|0.71579	.|.|-0.58	4.48|4.48|4.48	4.48|4.48|4.48	0.54585|0.54585|0.54585	.|.|.	.|.|1.228550	.|.|0.05947	.|.|U	.|.|0.638107	T|.|T	0.74928|.|0.74928	0.3781|.|0.3781	L|L|L	0.46157|0.46157|0.46157	1.445|1.445|1.445	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|P;P;P;D	.|.|0.55605	.|.|0.877;0.835;0.835;0.972	.|.|B;B;B;P	.|.|0.49561	.|.|0.339;0.211;0.211;0.615	T|.|T	0.66952|.|0.66952	-0.5793|.|-0.5793	5|.|9	.|.|.	.|.|.	.|.|.	-15.1046|-15.1046|-15.1046	16.0538|16.0538|16.0538	0.80779|0.80779|0.80779	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|70;133;169;70	.|.|B4DPS9;B4DR05;Q9UKM7;Q68D80	.|.|.;.;MA1B1_HUMAN;.	E|X|K	142;113|165|169	.|.|ENSP00000360645:Q169K	.|.|.	A|C|Q	+|+|+	2|3|1	0|2|0	MAN1B1|MAN1B1|MAN1B1	139110549|139110549|139110549	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.222000|0.222000|0.222000	0.24845|0.24845|0.24845	3.896000|3.896000|3.896000	0.56266|0.56266|0.56266	2.212000|2.212000|2.212000	0.71576|0.71576|0.71576	0.491000|0.491000|0.491000	0.48974|0.48974|0.48974	GCA|TGC|CAG		0.572	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219		10	23	1	0	6.42651e-13	0.010729	9.85847e-13	10	23				
GRIN1	2902	broad.mit.edu	37	9	140040201	140040201	+	Silent	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr9:140040201C>A	ENST00000371561.3	+	3	1514	c.417C>A	c.(415-417)cgC>cgA	p.R139R	GRIN1_ENST00000371560.3_Silent_p.R139R|GRIN1_ENST00000350902.5_Silent_p.R139R|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371553.3_Silent_p.R139R|GRIN1_ENST00000371555.4_Silent_p.R139R|GRIN1_ENST00000315048.3_Silent_p.R139R|GRIN1_ENST00000371546.4_Silent_p.R139R|GRIN1_ENST00000371559.4_Silent_p.R139R|GRIN1_ENST00000371550.4_Silent_p.R139R	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	139					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTTCCTGCGCACCGTGCCGC	0.682																																					NSCLC(113;717 1653 2089 20474 37618)	NSCLC(113;717 1653 2089 20474 37618)	uc004clk.2		NA																	0				skin(1)	1						c.(415-417)CGC>CGA		NMDA receptor 1 isoform NR1-3 precursor	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)						65.0	44.0	52.0					9																	140040201		2203	4300	6503	SO:0001819	synonymous_variant	2902				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding	g.chr9:140040201C>A		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.417C>A	9.37:g.140040201C>A			Somatic				GRIN1_uc004cli.1_5'UTR|GRIN1_uc004clj.1_Silent_p.R136R|GRIN1_uc004cll.2_Silent_p.R139R|GRIN1_uc004clm.2_Silent_p.R139R|GRIN1_uc004cln.2_Silent_p.R136R|GRIN1_uc004clo.2_Silent_p.R136R	p.R139R	NM_007327	NP_015566	WXS	Illumina HiSeq	Unspecified	Q05586	NMDZ1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	3	747	+	all_cancers(76;0.0926)		139			Extracellular (Potential).		A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Silent	SNP	ENST00000371561.3	37	c.417C>A	CCDS7031.1																																																																																				0.682	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327		8	40	1	0	1.49906e-05	0.00245	1.7891e-05	8	40				
MAGEB18	286514	broad.mit.edu	37	X	26157186	26157186	+	Silent	SNP	G	G	T	rs369037642		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:26157186G>T	ENST00000325250.1	+	2	271	c.84G>T	c.(82-84)acG>acT	p.T28T		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	28						cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						TGGGAGCTACGCAGGCCACTG	0.557																																							uc004dbq.1		NA																	0				central_nervous_system(1)	1						c.(82-84)ACG>ACT		melanoma antigen family B, 18							49.0	44.0	46.0					X																	26157186		2202	4300	6502	SO:0001819	synonymous_variant	286514						protein binding	g.chrX:26157186G>T	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.84G>T	X.37:g.26157186G>T			Somatic					p.T28T	NM_173699	NP_775970	WXS	Illumina HiSeq	Unspecified	Q96M61	MAGBI_HUMAN			2	271	+			28						Silent	SNP	ENST00000325250.1	37	c.84G>T	CCDS14216.1																																																																																				0.557	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699		9	5	1	0	3.09899e-07	0.004482	3.96508e-07	9	5				
DMD	1756	broad.mit.edu	37	X	32466621	32466621	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:32466621G>C	ENST00000357033.4	-	27	3944	c.3738C>G	c.(3736-3738)aaC>aaG	p.N1246K	DMD_ENST00000378677.2_Missense_Mutation_p.N1242K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1246					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCCACTGGTAGTTGGTGGTTA	0.413																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(3736-3738)AAC>AAG		dystrophin Dp427m isoform							198.0	153.0	169.0					X																	32466621		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32466621G>C	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3738C>G	X.37:g.32466621G>C	ENSP00000354923:p.Asn1246Lys		Somatic				DMD_uc004dcz.2_Missense_Mutation_p.N1123K|DMD_uc004dcy.1_Missense_Mutation_p.N1242K|DMD_uc004ddb.1_Missense_Mutation_p.N1238K|DMD_uc010ngo.1_Intron	p.N1246K	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			27	3982	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1246			Spectrin 8.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.3738C>G	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602233	0.46423	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.32515	1.45;1.45	4.94	3.17	0.36434	.	0.391976	0.17686	U	0.165445	T	0.28067	0.0692	L	0.32530	0.975	0.80722	D	1	B;D;B	0.53462	0.16;0.96;0.192	B;P;B	0.51550	0.128;0.673;0.202	T	0.03008	-1.1083	10	0.07644	T	0.81	.	10.7311	0.46098	0.1606:0.0:0.8394:0.0	.	1238;1246;1242	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	K	1238;1242;1246;1246;1123	ENSP00000367948:N1242K;ENSP00000354923:N1246K	ENSP00000354923:N1246K	N	-	3	2	DMD	32376542	1.000000	0.71417	0.998000	0.56505	0.503000	0.33858	5.129000	0.64739	0.430000	0.26230	-0.296000	0.09543	AAC		0.413	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		11	8	0	0	0	0.001855	0	11	8				
FTSJ1	24140	broad.mit.edu	37	X	48336506	48336506	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:48336506G>T	ENST00000348411.2	+	2	394	c.71G>T	c.(70-72)cGc>cTc	p.R24L	FTSJ1_ENST00000396894.4_Intron|FTSJ1_ENST00000019019.2_Missense_Mutation_p.R24L|FTSJ1_ENST00000456787.1_Missense_Mutation_p.R24L	NM_012280.2	NP_036412.1			FtsJ RNA methyltransferase homolog 1 (E. coli)											breast(1)|central_nervous_system(1)|lung(4)|skin(1)	7						TGGCGTGCTCGCAGCGCCTTC	0.582																																							uc004djo.1		NA																	0					0						c.(70-72)CGC>CTC		FtsJ homolog 1 isoform a							69.0	51.0	57.0					X																	48336506		2203	4300	6503	SO:0001583	missense	24140				RNA methylation|rRNA processing		methyltransferase activity|nucleic acid binding	g.chrX:48336506G>T	AJ005892	CCDS14294.1, CCDS14295.1, CCDS75972.1	Xp11.23	2012-06-12	2012-06-12		ENSG00000068438	ENSG00000068438			13254	protein-coding gene	gene with protein product	"""tRNA methyltransferase 7 homolog (S. cerevisiae)"""	300499	"""mental retardation, X-linked 9"", ""mental retardation, X-linked 44"""	MRX9, MRX44		15342698, 15162322	Standard	XR_246715		Approved	JM23, CDLIV, SPB1, TRM7, TRMT7	uc004djo.1	Q9UET6	OTTHUMG00000024118	ENST00000348411.2:c.71G>T	X.37:g.48336506G>T	ENSP00000326948:p.Arg24Leu		Somatic				FTSJ1_uc004djl.2_Missense_Mutation_p.R24L|FTSJ1_uc004djm.2_Missense_Mutation_p.R24L|FTSJ1_uc004djn.1_Missense_Mutation_p.R24L|FTSJ1_uc004djp.1_Missense_Mutation_p.R24L|FTSJ1_uc011mlw.1_Intron	p.R24L	NM_012280	NP_036412	WXS	Illumina HiSeq	Unspecified	Q9UET6	RRMJ1_HUMAN			2	394	+			24						Missense_Mutation	SNP	ENST00000348411.2	37	c.71G>T	CCDS14294.1	.	.	.	.	.	.	.	.	.	.	g	23.5	4.421774	0.83559	.	.	ENSG00000068438	ENST00000019019;ENST00000348411;ENST00000456787	T;T;T	0.63744	-0.06;-0.06;-0.06	5.25	2.52	0.30459	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.108387	0.64402	D	0.000012	D	0.86548	0.5959	H	0.99752	4.75	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.992;0.996;0.998	D	0.85672	0.1295	10	0.87932	D	0	-38.5528	8.6243	0.33879	0.2544:0.0:0.7456:0.0	.	24;24;24	Q9UET6;Q9UET6-2;B3KN91	RRMJ1_HUMAN;.;.	L	24	ENSP00000019019:R24L;ENSP00000326948:R24L;ENSP00000415457:R24L	ENSP00000019019:R24L	R	+	2	0	FTSJ1	48221450	1.000000	0.71417	0.996000	0.52242	0.923000	0.55619	7.034000	0.76511	0.183000	0.20059	0.476000	0.43555	CGC		0.582	FTSJ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060726.1			6	4	1	0	2.7689e-08	0.001984	3.73865e-08	6	4				
PFKFB1	5207	broad.mit.edu	37	X	54978518	54978518	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:54978518G>T	ENST00000375006.3	-	8	736	c.666C>A	c.(664-666)gaC>gaA	p.D222E	PFKFB1_ENST00000374992.2_Intron|PFKFB1_ENST00000545676.1_Missense_Mutation_p.D157E	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	222	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						GTGTGCCCACGTCGAAGATCT	0.567																																							uc004dty.1		NA																	0				ovary(1)	1						c.(664-666)GAC>GAA		6-phosphofructo-2-kinase/fructose-2,							137.0	90.0	106.0					X																	54978518		2203	4300	6503	SO:0001583	missense	5207				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding	g.chrX:54978518G>T		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.666C>A	X.37:g.54978518G>T	ENSP00000364145:p.Asp222Glu		Somatic				PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Missense_Mutation_p.D157E	p.D222E	NM_002625	NP_002616	WXS	Illumina HiSeq	Unspecified	P16118	F261_HUMAN			8	737	-			222			6-phosphofructo-2-kinase.		B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	37	c.666C>A	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686762	0.68157	.	.	ENSG00000158571	ENST00000375006;ENST00000545676	.	.	.	4.75	-1.04	0.10068	6-phosphofructo-2-kinase (1);	0.089678	0.85682	D	0.000000	T	0.78622	0.4312	H	0.96175	3.78	0.80722	D	1	B;P	0.40032	0.428;0.699	B;P	0.47891	0.388;0.56	T	0.77300	-0.2639	9	0.87932	D	0	-24.1785	8.7568	0.34650	0.5278:0.0:0.4722:0.0	.	157;222	B4DUN5;P16118	.;F261_HUMAN	E	222;157	.	ENSP00000364145:D222E	D	-	3	2	PFKFB1	54995243	0.377000	0.25106	0.976000	0.42696	0.957000	0.61999	-0.347000	0.07750	-0.625000	0.05604	0.525000	0.51046	GAC		0.567	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1			8	7	1	0	6.40141e-05	0.010729	7.41349e-05	8	7				
DGAT2L6	347516	broad.mit.edu	37	X	69421846	69421846	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:69421846C>A	ENST00000333026.3	+	5	679	c.579C>A	c.(577-579)tgC>tgA	p.C193*		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	193					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						CTCTCTTGTGCCGACCAGGAG	0.537																																							uc004dxx.1		NA																	0				ovary(1)	1						c.(577-579)TGC>TGA		diacylglycerol O-acyltransferase 2-like 6							98.0	75.0	83.0					X																	69421846		2203	4300	6503	SO:0001587	stop_gained	347516				lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity	g.chrX:69421846C>A	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.579C>A	X.37:g.69421846C>A	ENSP00000328036:p.Cys193*		Somatic					p.C193*	NM_198512	NP_940914	WXS	Illumina HiSeq	Unspecified	Q6ZPD8	DG2L6_HUMAN			5	676	+			193					Q6IEE2	Nonsense_Mutation	SNP	ENST00000333026.3	37	c.579C>A	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982618	0.34942	.	.	ENSG00000184210	ENST00000333026	.	.	.	4.51	3.65	0.41850	.	0.467993	0.23110	N	0.051804	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-12.418	9.7752	0.40614	0.0:0.8952:0.0:0.1048	.	.	.	.	X	193	.	ENSP00000328036:C193X	C	+	3	2	DGAT2L6	69338571	0.234000	0.23783	0.041000	0.18516	0.001000	0.01503	0.759000	0.26461	1.035000	0.39972	-0.215000	0.12644	TGC		0.537	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512		4	8	1	0	1.23904e-05	0.000602	1.48786e-05	4	8				
TEX11	56159	broad.mit.edu	37	X	69811632	69811632	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:69811632G>T	ENST00000395889.2	-	26	2309	c.2154C>A	c.(2152-2154)tgC>tgA	p.C718*	TEX11_ENST00000374320.2_Nonsense_Mutation_p.C393*|TEX11_ENST00000344304.3_Nonsense_Mutation_p.C718*|TEX11_ENST00000374333.2_Nonsense_Mutation_p.C703*	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	718					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GGATGTCATTGCATGTCTGGA	0.383																																							uc004dyl.2		NA																	0				ovary(3)|breast(1)|skin(1)	5						c.(2152-2154)TGC>TGA		testis expressed sequence 11 isoform 1							157.0	109.0	125.0					X																	69811632		2203	4300	6503	SO:0001587	stop_gained	56159						protein binding	g.chrX:69811632G>T	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2154C>A	X.37:g.69811632G>T	ENSP00000379226:p.Cys718*		Somatic				TEX11_uc004dyk.2_Nonsense_Mutation_p.C393*|TEX11_uc004dym.2_Nonsense_Mutation_p.C703*	p.C718*	NM_001003811	NP_001003811	WXS	Illumina HiSeq	Unspecified	Q8IYF3	TEX11_HUMAN			26	2316	-	Renal(35;0.156)		718					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Nonsense_Mutation	SNP	ENST00000395889.2	37	c.2154C>A	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558075	0.86231	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	.	.	.	3.71	1.93	0.25924	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.9492	5.3657	0.16113	0.2685:0.0:0.7315:0.0	.	.	.	.	X	703;718;393;718	.	.	C	-	3	2	TEX11	69728357	0.862000	0.29867	0.084000	0.20598	0.006000	0.05464	0.207000	0.17395	0.396000	0.25283	0.594000	0.82650	TGC		0.383	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			9	5	1	0	2.80697e-09	0.010729	3.98278e-09	9	5				
SLC7A3	84889	broad.mit.edu	37	X	70148048	70148048	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:70148048C>A	ENST00000374299.3	-	5	911	c.767G>T	c.(766-768)gGa>gTa	p.G256V	SLC7A3_ENST00000298085.4_Missense_Mutation_p.G256V			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	256					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GGTCGCTGCTCCACGGAGAAT	0.512																																							uc004dyn.2		NA																	0				ovary(1)|kidney(1)	2						c.(766-768)GGA>GTA		solute carrier family 7 (cationic amino acid	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						82.0	67.0	72.0					X																	70148048		2203	4300	6503	SO:0001583	missense	84889				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane		g.chrX:70148048C>A	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.767G>T	X.37:g.70148048C>A	ENSP00000363417:p.Gly256Val		Somatic				SLC7A3_uc004dyo.2_Missense_Mutation_p.G256V	p.G256V	NM_032803	NP_116192	WXS	Illumina HiSeq	Unspecified	Q8WY07	CTR3_HUMAN			5	925	-	Renal(35;0.156)		256			Cytoplasmic (Potential).		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	c.767G>T	CCDS14404.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203043	0.58234	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.91686	-2.89;-2.89	4.77	4.77	0.60923	Amino acid permease domain (1);	0.048979	0.85682	D	0.000000	D	0.97993	0.9339	H	0.99498	4.595	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.99727	1.1011	10	0.87932	D	0	.	15.8813	0.79207	0.0:1.0:0.0:0.0	.	256	Q8WY07	CTR3_HUMAN	V	256	ENSP00000363417:G256V;ENSP00000298085:G256V	ENSP00000298085:G256V	G	-	2	0	SLC7A3	70064773	1.000000	0.71417	0.970000	0.41538	0.424000	0.31475	7.518000	0.81795	2.203000	0.70933	0.529000	0.55759	GGA		0.512	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803		12	7	1	0	0.000308642	0.003163	0.000346483	12	7				
APOOL	139322	broad.mit.edu	37	X	84329295	84329295	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:84329295G>T	ENST00000373173.2	+	8	703	c.616G>T	c.(616-618)Gaa>Taa	p.E206*		NM_198450.5	NP_940852.3	Q6UXV4	MIC27_HUMAN	apolipoprotein O-like	206						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8						ATCCTCTTCCGAAATAGAAGT	0.393																																							uc004eem.2		NA																	0					0						c.(616-618)GAA>TAA		apolipoprotein O-like precursor							87.0	77.0	80.0					X																	84329295		1838	4080	5918	SO:0001587	stop_gained	139322					extracellular region		g.chrX:84329295G>T	AK130506	CCDS48138.1	Xq21.1	2007-01-17	2007-01-17	2007-01-17	ENSG00000155008	ENSG00000155008			24009	protein-coding gene	gene with protein product			"""chromosome X open reading frame 33"", ""family with sequence similarity 121A"""	CXorf33, FAM121A		12975309	Standard	NM_198450		Approved	UNQ8193, AAIR8193	uc004eem.3	Q6UXV4	OTTHUMG00000021930	ENST00000373173.2:c.616G>T	X.37:g.84329295G>T	ENSP00000362268:p.Glu206*		Somatic				APOOL_uc010nmp.2_Intron	p.E206*	NM_198450	NP_940852	WXS	Illumina HiSeq	Unspecified	Q6UXV4	APOOL_HUMAN			8	630	+			206					Q3KNU7|Q5H9D1	Nonsense_Mutation	SNP	ENST00000373173.2	37	c.616G>T	CCDS48138.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750368	0.30955	.	.	ENSG00000155008	ENST00000373173;ENST00000373169	.	.	.	4.43	3.47	0.39725	.	0.803616	0.11976	N	0.511231	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	7.8973	5.518	0.16918	0.1597:0.0:0.8403:0.0	.	.	.	.	X	206;205	.	ENSP00000362264:E205X	E	+	1	0	APOOL	84215951	0.010000	0.17322	0.084000	0.20598	0.002000	0.02628	0.790000	0.26900	2.034000	0.60081	0.600000	0.82982	GAA		0.393	APOOL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057385.2	NM_198450		21	7	1	0	2.89027e-11	0.014323	4.28784e-11	21	7				
ZNF711	7552	broad.mit.edu	37	X	84523327	84523327	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:84523327A>G	ENST00000373165.3	+	7	1250	c.944A>G	c.(943-945)tAt>tGt	p.Y315C	ZNF711_ENST00000276123.3_Missense_Mutation_p.Y315C|ZNF711_ENST00000395402.1_Intron|ZNF711_ENST00000360700.4_Missense_Mutation_p.Y361C|ZNF711_ENST00000542798.1_Missense_Mutation_p.Y157C	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	315					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TCCCGAAGGTATGAAGATTGT	0.303																																							uc004eeo.2		NA																	0				ovary(3)|skin(1)	4						c.(943-945)TAT>TGT		zinc finger protein 711							154.0	148.0	150.0					X																	84523327		2203	4299	6502	SO:0001583	missense	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84523327A>G	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.944A>G	X.37:g.84523327A>G	ENSP00000362260:p.Tyr315Cys		Somatic				ZNF711_uc004eep.2_Missense_Mutation_p.Y315C|ZNF711_uc004eeq.2_Missense_Mutation_p.Y361C|ZNF711_uc011mqy.1_5'UTR	p.Y315C	NM_021998	NP_068838	WXS	Illumina HiSeq	Unspecified	Q9Y462	ZN711_HUMAN			7	1291	+			315					B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	c.944A>G	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	A	14.94	2.686221	0.47991	.	.	ENSG00000147180	ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T	0.44881	0.91;0.91;3.31;3.26	5.0	5.0	0.66597	.	.	.	.	.	T	0.60090	0.2242	M	0.62723	1.935	0.42680	D	0.993548	D;D	0.76494	0.997;0.999	P;D	0.83275	0.847;0.996	T	0.61983	-0.6950	9	0.49607	T	0.09	.	12.4623	0.55738	1.0:0.0:0.0:0.0	.	361;315	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	C	315;315;361;157	ENSP00000362260:Y315C;ENSP00000276123:Y315C;ENSP00000353922:Y361C;ENSP00000442071:Y157C	ENSP00000276123:Y315C	Y	+	2	0	ZNF711	84409983	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	6.215000	0.72206	1.652000	0.50683	0.417000	0.27973	TAT		0.303	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		3	11	0	0	0	0.000602	0	3	11				
KLHL4	56062	broad.mit.edu	37	X	86887407	86887407	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:86887407C>G	ENST00000373119.4	+	7	1667	c.1522C>G	c.(1522-1524)Ccc>Gcc	p.P508A	KLHL4_ENST00000373114.4_Missense_Mutation_p.P508A	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	508						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TGTGATGCCTCCCATGTCAAC	0.368																																							uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1522-1524)CCC>GCC		kelch-like 4 isoform 1							99.0	87.0	91.0					X																	86887407		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86887407C>G	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1522C>G	X.37:g.86887407C>G	ENSP00000362211:p.Pro508Ala		Somatic				KLHL4_uc004efa.2_Missense_Mutation_p.P508A	p.P508A	NM_019117	NP_061990	WXS	Illumina HiSeq	Unspecified	Q9C0H6	KLHL4_HUMAN			7	1704	+			508			Kelch 2.		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.1522C>G	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462827	0.84425	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.79940	-1.32;-1.32	5.33	5.33	0.75918	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.87830	0.6276	M	0.74546	2.27	0.80722	D	1	D;P	0.59357	0.985;0.84	P;P	0.59012	0.85;0.779	D	0.88611	0.3156	10	0.52906	T	0.07	.	16.9719	0.86302	0.0:1.0:0.0:0.0	.	508;508	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	A	508	ENSP00000362211:P508A;ENSP00000362206:P508A	ENSP00000362206:P508A	P	+	1	0	KLHL4	86774063	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.323000	0.79105	2.215000	0.71742	0.513000	0.50165	CCC		0.368	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			14	6	0	0	0	0.007413	0	14	6				
GPC3	2719	broad.mit.edu	37	X	132887815	132887815	+	Silent	SNP	T	T	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:132887815T>C	ENST00000370818.3	-	3	1171	c.726A>G	c.(724-726)acA>acG	p.T242T	GPC3_ENST00000394299.2_Silent_p.T242T|GPC3_ENST00000543339.1_Silent_p.T188T	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	242					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					GGTGATCAGTTGTGTTGATCA	0.473			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																														uc004exe.1		NA	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	T|D|Mis|N|F|S	glypican 3			O		Wilms tumour			0				lung(2)|prostate(1)|breast(1)|skin(1)	5						c.(724-726)ACA>ACG		glypican 3 isoform 2 precursor							525.0	343.0	405.0					X																	132887815		2203	4300	6503	SO:0001819	synonymous_variant	2719	Simpson-Golabi-Behmel_syndrome	Familial Cancer Database	SGBS		extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity	g.chrX:132887815T>C	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.726A>G	X.37:g.132887815T>C			Somatic				GPC3_uc004exd.1_Silent_p.T114T|GPC3_uc010nrn.1_Silent_p.T242T|GPC3_uc011mvh.1_Silent_p.T226T|GPC3_uc010nro.1_Silent_p.T188T|GPC3_uc010nrp.1_Silent_p.T114T	p.T242T	NM_004484	NP_004475	WXS	Illumina HiSeq	Unspecified	P51654	GPC3_HUMAN			3	916	-	Acute lymphoblastic leukemia(192;0.000127)		242					C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	c.726A>G	CCDS14638.1																																																																																				0.473	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484		62	13	0	0	0	0.01441	0	62	13				
CXorf66	347487	broad.mit.edu	37	X	139038483	139038483	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:139038483G>T	ENST00000370540.1	-	3	681	c.658C>A	c.(658-660)Cat>Aat	p.H220N		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	220						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						TTTTGTGGATGAGATGAATAA	0.438																																							uc004fbb.2		NA																	0					0						c.(658-660)CAT>AAT		hypothetical protein LOC347487 precursor							158.0	142.0	147.0					X																	139038483		2203	4300	6503	SO:0001583	missense	347487					integral to membrane		g.chrX:139038483G>T		CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.658C>A	X.37:g.139038483G>T	ENSP00000359571:p.His220Asn		Somatic					p.H220N	NM_001013403	NP_001013421	WXS	Illumina HiSeq	Unspecified	Q5JRM2	CX066_HUMAN			3	680	-			220			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000370540.1	37	c.658C>A	CCDS35411.1	.	.	.	.	.	.	.	.	.	.	G	7.673	0.687456	0.14973	.	.	ENSG00000203933	ENST00000370540	T	0.42513	0.97	2.78	-5.18	0.02840	.	4.979470	0.00166	N	0.000008	T	0.22166	0.0534	N	0.19112	0.55	0.09310	N	1	B	0.20550	0.046	B	0.19666	0.026	T	0.06197	-1.0840	9	.	.	.	4.5297	0.2333	0.00183	0.3574:0.1464:0.1986:0.2977	.	220	Q5JRM2	CX066_HUMAN	N	220	ENSP00000359571:H220N	.	H	-	1	0	CXorf66	138866149	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.747000	0.04823	-1.766000	0.01302	-1.062000	0.02293	CAT		0.438	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058572.1	NM_001013403		86	30	1	0	6.84326e-50	0.01441	1.2853e-49	86	30				
PNMA3	29944	broad.mit.edu	37	X	152225685	152225685	+	Silent	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:152225685G>T	ENST00000370264.4	+	1	299	c.273G>T	c.(271-273)gtG>gtT	p.V91V	PNMA3_ENST00000370265.4_Silent_p.V91V|PNMA3_ENST00000447306.1_Silent_p.V91V			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	91					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					cctgggaagtgattgtaaaac	0.537																																							uc004fhc.2		NA																	0				skin(2)|large_intestine(1)	3						c.(271-273)GTG>GTT		paraneoplastic cancer-testis-brain antigen							46.0	50.0	49.0					X																	152225685		2203	4300	6503	SO:0001819	synonymous_variant	29944				apoptosis	nucleolus	nucleic acid binding|zinc ion binding	g.chrX:152225685G>T	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.273G>T	X.37:g.152225685G>T			Somatic				PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	p.V91V	NM_013364	NP_037496	WXS	Illumina HiSeq	Unspecified	Q9UL41	PNMA3_HUMAN			2	609	+	Acute lymphoblastic leukemia(192;6.56e-05)		91					D3DWT7|Q9H0A4	Silent	SNP	ENST00000370264.4	37	c.273G>T	CCDS35435.2																																																																																				0.537	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364		35	11	1	0	2.2871e-25	0.007835	4.06133e-25	35	11				
ATP2B3	492	broad.mit.edu	37	X	152807167	152807167	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:152807167G>T	ENST00000349466.2	+	4	773	c.447G>T	c.(445-447)gaG>gaT	p.E149D	ATP2B3_ENST00000370181.2_Missense_Mutation_p.E149D|ATP2B3_ENST00000393842.1_Missense_Mutation_p.E149D|ATP2B3_ENST00000359149.3_Missense_Mutation_p.E149D|ATP2B3_ENST00000263519.4_Missense_Mutation_p.E149D|ATP2B3_ENST00000370186.1_Missense_Mutation_p.E149D			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	149					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGAGGGCGAGGCCGAAGCTG	0.612																																							uc004fht.1		NA																	0				pancreas(1)	1						c.(445-447)GAG>GAT		plasma membrane calcium ATPase 3 isoform 3b							102.0	82.0	89.0					X																	152807167		2203	4300	6503	SO:0001583	missense	492				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding	g.chrX:152807167G>T	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.447G>T	X.37:g.152807167G>T	ENSP00000343886:p.Glu149Asp		Somatic				ATP2B3_uc004fhs.1_Missense_Mutation_p.E149D	p.E149D	NM_001001344	NP_001001344	WXS	Illumina HiSeq	Unspecified	Q16720	AT2B3_HUMAN			3	573	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		149			Extracellular (Potential).		B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	c.447G>T	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556268	0.45487	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	5.68	3.92	0.45320	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.87849	0.6281	M	0.82630	2.6	0.35355	D	0.787747	B;B	0.21147	0.031;0.052	B;B	0.24848	0.025;0.056	D	0.84016	0.0351	10	0.33940	T	0.23	-23.8923	7.1222	0.25450	0.3518:0.0:0.6482:0.0	.	149;149	Q16720;Q16720-2	AT2B3_HUMAN;.	D	149	ENSP00000359205:E149D;ENSP00000343886:E149D;ENSP00000377425:E149D;ENSP00000352062:E149D;ENSP00000263519:E149D;ENSP00000359200:E149D	ENSP00000263519:E149D	E	+	3	2	ATP2B3	152460361	1.000000	0.71417	0.935000	0.37517	0.052000	0.14988	2.028000	0.41088	0.566000	0.29273	0.600000	0.82982	GAG		0.612	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		39	15	1	0	6.5261e-18	0.00874	1.09579e-17	39	15				
AVPR2	554	broad.mit.edu	37	X	153172069	153172069	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:153172069G>C	ENST00000358927.2	+	4	1212	c.1003G>C	c.(1003-1005)Gag>Cag	p.E335Q	AVPR2_ENST00000337474.5_Missense_Mutation_p.E335Q|AVPR2_ENST00000370049.1_3'UTR|ARHGAP4_ENST00000467421.1_5'Flank			P30518	V2R_HUMAN	arginine vasopressin receptor 2	335					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CGTGTCCTCAGAGCTGCGAAG	0.632																																							uc004fjh.3		NA																	0				breast(1)	1						c.(1003-1005)GAG>CAG		arginine vasopressin receptor 2 isoform 1	Conivaptan(DB00872)|Terlipressin(DB02638)|Vasopressin(DB00067)						111.0	96.0	101.0					X																	153172069		2203	4300	6503	SO:0001583	missense	554				activation of adenylate cyclase activity|excretion|G-protein signaling, coupled to cAMP nucleotide second messenger|hemostasis|positive regulation of gene expression|transmembrane transport|water transport	endoplasmic reticulum|endosome|Golgi apparatus|integral to plasma membrane	vasopressin receptor activity	g.chrX:153172069G>C	Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.1003G>C	X.37:g.153172069G>C	ENSP00000351805:p.Glu335Gln		Somatic				AVPR2_uc004fjg.3_Missense_Mutation_p.E124Q|AVPR2_uc004fji.2_3'UTR	p.E335Q	NM_000054	NP_000045	WXS	Illumina HiSeq	Unspecified	P30518	V2R_HUMAN			3	1074	+	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		335			Cytoplasmic (Potential).		C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	ENST00000358927.2	37	c.1003G>C	CCDS14735.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.36|13.36	2.212559|2.212559	0.39102|0.39102	.|.	.|.	ENSG00000126895|ENSG00000126895	ENST00000358927;ENST00000337474|ENST00000430697	T;T|T	0.37235|0.74842	1.21;1.21|-0.88	4.19|4.19	4.19|4.19	0.49359|0.49359	.|.	0.111158|.	0.64402|.	D|.	0.000014|.	T|T	0.81640|0.81640	0.4865|0.4865	M|M	0.68952|0.68952	2.095|2.095	0.43598|0.43598	D|D	0.995953|0.995953	D|.	0.76494|.	0.999|.	D|.	0.65987|.	0.94|.	D|D	0.84368|0.84368	0.0542|0.0542	10|7	0.48119|0.72032	T|D	0.1|0.01	-3.6342|-3.6342	14.8514|14.8514	0.70300|0.70300	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	335|.	P30518|.	V2R_HUMAN|.	Q|H	335|305	ENSP00000351805:E335Q;ENSP00000338072:E335Q|ENSP00000393513:Q305H	ENSP00000338072:E335Q|ENSP00000393513:Q305H	E|Q	+|+	1|3	0|2	AVPR2|AVPR2	152825263|152825263	0.994000|0.994000	0.37717|0.37717	0.964000|0.964000	0.40570|0.40570	0.102000|0.102000	0.19082|0.19082	2.806000|2.806000	0.47947|0.47947	1.820000|1.820000	0.53075|0.53075	0.418000|0.418000	0.28097|0.28097	GAG|CAG		0.632	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2			3	71	0	0	0	0.000602	0	3	71				
KDM5D	8284	broad.mit.edu	37	Y	21883061	21883061	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrY:21883061C>A	ENST00000317961.4	-	12	1779	c.1508G>T	c.(1507-1509)tGg>tTg	p.W503L	KDM5D_ENST00000541639.1_Missense_Mutation_p.W534L|KDM5D_ENST00000382806.2_Missense_Mutation_p.W446L	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	503	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	CTCAATATGCCAACAAAATGC	0.473																																							uc004fug.2		NA																	0				skin(1)	1						c.(1507-1509)TGG>TTG		jumonji, AT rich interactive domain 1D isoform	Vitamin C(DB00126)						97.0	102.0	101.0					Y																	21883061		617	1948	2565	SO:0001583	missense	8284				chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrY:21883061C>A	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.1508G>T	Y.37:g.21883061C>A	ENSP00000322408:p.Trp503Leu		Somatic				KDM5D_uc011naz.1_Missense_Mutation_p.W534L|KDM5D_uc010nwy.2_Missense_Mutation_p.W446L|KDM5D_uc011nba.1_Missense_Mutation_p.W503L|KDM5D_uc004fuh.2_Missense_Mutation_p.W458L	p.W503L	NM_004653	NP_004644	WXS	Illumina HiSeq	Unspecified	Q9BY66	KDM5D_HUMAN			12	1796	-			503			JmjC.		A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	ENST00000317961.4	37	c.1508G>T	CCDS14794.1																																																																																				0.473	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653		15	10	1	0	1.52009e-12	0.003163	2.31972e-12	15	10				
MEX3A	92312	broad.mit.edu	37	1	156046687	156046689	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GAG	GAG	-	-	GAG	GAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:156046687_156046689delGAG	ENST00000532414.2	-	2	1238_1240	c.1239_1241delCTC	c.(1237-1242)tcctct>tct	p.413_414SS>S	AL355388.1_ENST00000410679.1_RNA|MEX3A_ENST00000442784.1_5'Flank	NM_001093725.1	NP_001087194.1	A1L020	MEX3A_HUMAN	mex-3 RNA binding family member A	413	Poly-Ser.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	Hepatocellular(266;0.158)|all_neural(408;0.195)					CTTGGCggaagaggaggaggagg	0.744																																							uc001fnd.3		NA																	0					0						c.(1237-1242)TCCTCT>TCT		MEX3A protein				33,3511		2,29,1741						-6.7	0.3			7	102,7534		2,98,3718	no	coding	MEX3A	NM_001093725.1		4,127,5459	A1A1,A1R,RR		1.3358,0.9312,1.2075				135,11045				SO:0001651	inframe_deletion	92312					cytoplasmic mRNA processing body|nucleus	RNA binding|zinc ion binding	g.chr1:156046687_156046689delGAG	AK024097	CCDS53377.1	1q22	2013-09-24	2013-08-21	2007-07-18	ENSG00000254726	ENSG00000254726		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	33482	protein-coding gene	gene with protein product		611007	"""ring finger and KH domain containing 4"", ""mex-3 homolog A (C. elegans)"""	RKHD4		17267406	Standard	NM_001093725		Approved		uc001fnd.4	A1L020	OTTHUMG00000017465	ENST00000532414.2:c.1239_1241delCTC	1.37:g.156046696_156046698delGAG	ENSP00000432845:p.Ser415del		Somatic					p.413_414SS>S	NM_001093725	NP_001087194	WXS	Illumina HiSeq	Unspecified	A1L020	MEX3A_HUMAN			2	1239_1241	-	Hepatocellular(266;0.158)|all_neural(408;0.195)		413_414			Poly-Ser.			In_Frame_Del	DEL	ENST00000532414.2	37	c.1239_1241delCTC	CCDS53377.1																																																																																				0.744	MEX3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046218.3	NM_001093725		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
ANKRD45	339416	broad.mit.edu	37	1	173616018	173616019	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:173616018_173616019delGA	ENST00000333279.2	-	3	522_523	c.462_463delTC	c.(460-465)tctcagfs	p.Q155fs		NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45	171										NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						CACTCAGTCTGAGAATATCTAG	0.446																																							uc001gja.1		NA																	0					0						c.(460-465)TCTCAGfs		ankyrin repeat domain 45																																				SO:0001589	frameshift_variant	339416							g.chr1:173616018_173616019delGA		CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.462_463delTC	1.37:g.173616020_173616021delGA	ENSP00000331268:p.Gln155fs		Somatic					p.S154fs	NM_198493	NP_940895	WXS	Illumina HiSeq	Unspecified	Q5TZF3	ANR45_HUMAN			3	523_524	-			170_171					A1A4G2|Q6ZST1	Frame_Shift_Del	DEL	ENST00000333279.2	37	c.462_463delTC	CCDS1309.1																																																																																				0.446	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097580.2	NM_198493		106	155	NA	NA	NA	NA	NA	106	155	---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204913465	204913466	+	Frame_Shift_Ins	INS	-	-	T	rs375852982	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr1:204913465_204913466insT	ENST00000401399.1	+	2	221_222	c.22_23insT	c.(22-24)cccfs	p.P8fs	NFASC_ENST00000404076.1_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000367170.4_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000404907.1_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000513543.1_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000339876.6_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000539706.1_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000338586.6_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000367169.4_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000367172.4_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000403080.1_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000360049.4_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000338515.6_Frame_Shift_Ins_p.P8fs|NFASC_ENST00000367171.4_Frame_Shift_Ins_p.P8fs			O94856	NFASC_HUMAN	neurofascin	8					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCCACCGCCGCCCTGGGTCCAT	0.619																																							uc001hbj.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(22-24)CCCfs		neurofascin isoform 1 precursor																																				SO:0001589	frameshift_variant	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204913465_204913466insT	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	Exception_encountered	1.37:g.204913465_204913466insT	ENSP00000385637:p.Pro8fs		Somatic				NFASC_uc001hbh.2_Frame_Shift_Ins_p.P8fs|NFASC_uc010pqz.1_Frame_Shift_Ins_p.P8fs|NFASC_uc010pra.1_Frame_Shift_Ins_p.P8fs|NFASC_uc001hbi.2_Frame_Shift_Ins_p.P8fs|NFASC_uc009xbg.1_Frame_Shift_Ins_p.P81fs|NFASC_uc010prb.1_Frame_Shift_Ins_p.P8fs|NFASC_uc010prc.1_5'UTR	p.P8fs	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		3	350_351	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		8					B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Frame_Shift_Ins	INS	ENST00000401399.1	37	c.22_23insT	CCDS53460.1																																																																																				0.619	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		14	28	NA	NA	NA	NA	NA	14	28	---	---	---	---
OR5L2	26338	broad.mit.edu	37	11	55594697	55594697	+	Start_Codon_Del	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:55594697delG	ENST00000378397.1	+	0	3					NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TTGGAGACATGGGCAAGGAAA	0.398										HNSCC(27;0.073)																													uc001nhy.1		NA																	0				ovary(1)	1						c.(1-3)ATGfs		olfactory receptor, family 5, subfamily L,							172.0	164.0	167.0					11																	55594697		2200	4296	6496	SO:0001582	initiator_codon_variant	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55594697delG	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812		11.37:g.55594697delG		HNSCC(27;0.073)	Somatic					p.M1fs	NM_001004739	NP_001004739	WXS	Illumina HiSeq	Unspecified	Q8NGL0	OR5L2_HUMAN			1	3	+		all_epithelial(135;0.208)	1			Extracellular (Potential).		Q6IF66|Q96RB2	Frame_Shift_Del	DEL	ENST00000378397.1	37	c.3delG	CCDS31511.1																																																																																				0.398	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		49	118	NA	NA	NA	NA	NA	49	118	---	---	---	---
MS4A6A	64231	broad.mit.edu	37	11	59943069	59943069	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr11:59943069delC	ENST00000530839.1	-	6	847	c.355delG	c.(355-357)gttfs	p.V119fs	MS4A6A_ENST00000529054.1_Frame_Shift_Del_p.V147fs|MS4A6A_ENST00000528851.1_Frame_Shift_Del_p.V119fs|MS4A6A_ENST00000412309.2_Frame_Shift_Del_p.V147fs|MS4A6A_ENST00000529906.1_5'Flank|MS4A6A_ENST00000323961.3_Frame_Shift_Del_p.V119fs|MS4A6A_ENST00000533023.1_Frame_Shift_Del_p.V55fs|MS4A6A_ENST00000420732.2_Frame_Shift_Del_p.V119fs|MS4A6A_ENST00000426738.2_Frame_Shift_Del_p.V74fs	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	119						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATGCTTCCAACCAGGCTGCTA	0.443																																							uc001nor.2		NA																	0					0						c.(355-357)GTTfs		membrane-spanning 4-domains, subfamily A, member							106.0	94.0	98.0					11																	59943069		2201	4295	6496	SO:0001589	frameshift_variant	64231					integral to membrane	receptor activity	g.chr11:59943069delC	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.355delG	11.37:g.59943069delC	ENSP00000436979:p.Val119fs		Somatic				MS4A6A_uc001noq.2_Frame_Shift_Del_p.V119fs|MS4A6A_uc001nos.3_Frame_Shift_Del_p.V147fs|MS4A6A_uc009ymv.2_Frame_Shift_Del_p.V119fs|MS4A6A_uc001not.2_Frame_Shift_Del_p.V119fs|MS4A6A_uc010rla.1_Frame_Shift_Del_p.V147fs|MS4A6A_uc010rlb.1_Frame_Shift_Del_p.V74fs	p.V119fs	NM_152852	NP_690591	WXS	Illumina HiSeq	Unspecified	Q9H2W1	M4A6A_HUMAN			5	593	-			119			Helical; (Potential).		A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Frame_Shift_Del	DEL	ENST00000530839.1	37	c.355delG	CCDS7981.1																																																																																				0.443	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1			31	53	NA	NA	NA	NA	NA	31	53	---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58299356	58299356	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr13:58299356delG	ENST00000377918.3	+	4	3434	c.3408delG	c.(3406-3408)gagfs	p.E1137fs		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1137					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGGATGCAGAGGAAGTTGTGA	0.493																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(3406-3408)GAGfs		protocadherin 17 precursor							159.0	171.0	167.0					13																	58299356		2203	4300	6503	SO:0001589	frameshift_variant	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58299356delG	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3408delG	13.37:g.58299356delG	ENSP00000367151:p.Glu1137fs		Somatic				PCDH17_uc010aec.1_Frame_Shift_Del_p.E1135fs|PCDH17_uc001vhr.1_Frame_Shift_Del_p.E225fs	p.E1136fs	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	4	4300	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	1136			Cytoplasmic (Potential).		A8K1R5|Q5VVW9|Q5VVX0	Frame_Shift_Del	DEL	ENST00000377918.3	37	c.3408delG	CCDS31986.1																																																																																				0.493	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		40	296	NA	NA	NA	NA	NA	40	296	---	---	---	---
SERPINB7	8710	broad.mit.edu	37	18	61471695	61471695	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr18:61471695delC	ENST00000398019.2	+	8	1294	c.969delC	c.(967-969)cacfs	p.H323fs	SERPINB7_ENST00000546027.1_Frame_Shift_Del_p.H323fs|SERPINB7_ENST00000336429.2_Frame_Shift_Del_p.H323fs|SERPINB7_ENST00000540675.1_Frame_Shift_Del_p.H306fs	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	323					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				GGATGATGCACAAATCTTACA	0.468																																							uc002ljl.2		NA																	0				lung(2)|central_nervous_system(1)	3						c.(967-969)CACfs		serine (or cysteine) proteinase inhibitor, clade							52.0	50.0	51.0					18																	61471695		2203	4300	6503	SO:0001589	frameshift_variant	8710				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61471695delC	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.969delC	18.37:g.61471695delC	ENSP00000381101:p.His323fs		Somatic				SERPINB7_uc002ljm.2_Frame_Shift_Del_p.H323fs|SERPINB7_uc010xet.1_Frame_Shift_Del_p.H306fs|SERPINB7_uc010dqg.2_Frame_Shift_Del_p.H323fs	p.H323fs	NM_001040147	NP_001035237	WXS	Illumina HiSeq	Unspecified	O75635	SPB7_HUMAN			8	1065	+		Esophageal squamous(42;0.129)	323					B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Frame_Shift_Del	DEL	ENST00000398019.2	37	c.969delC	CCDS11988.1																																																																																				0.468	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784		12	8	NA	NA	NA	NA	NA	12	8	---	---	---	---
DNMT1	1786	broad.mit.edu	37	19	10254626	10254626	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:10254626delC	ENST00000340748.4	-	28	3119	c.2884delG	c.(2884-2886)gagfs	p.E962fs	DNMT1_ENST00000359526.4_Frame_Shift_Del_p.E978fs|DNMT1_ENST00000589538.1_5'Flank|DNMT1_ENST00000540357.1_Frame_Shift_Del_p.E962fs			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	962					cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	TCCACGGGCTCCTTCCGTGGG	0.567																																							uc002mng.2		NA																	0				ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6						c.(2884-2886)GAGfs		DNA (cytosine-5-)-methyltransferase 1 isoform b	Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)						178.0	162.0	167.0					19																	10254626		2203	4300	6503	SO:0001589	frameshift_variant	1786				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding	g.chr19:10254626delC	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2884delG	19.37:g.10254626delC	ENSP00000345739:p.Glu962fs		Somatic				DNMT1_uc002mnf.2_5'UTR|DNMT1_uc010xlc.1_Frame_Shift_Del_p.E978fs|DNMT1_uc002mnh.2_Frame_Shift_Del_p.E857fs|DNMT1_uc010xld.1_Frame_Shift_Del_p.E962fs	p.E962fs	NM_001379	NP_001370	WXS	Illumina HiSeq	Unspecified	P26358	DNMT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		28	3064	-			962					A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Frame_Shift_Del	DEL	ENST00000340748.4	37	c.2884delG	CCDS12228.1																																																																																				0.567	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379		14	183	NA	NA	NA	NA	NA	14	183	---	---	---	---
CLEC17A	388512	broad.mit.edu	37	19	14694175	14694176	+	In_Frame_Ins	INS	-	-	GGA	rs138602183|rs34295949|rs548360441	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:14694175_14694176insGGA	ENST00000417570.1	+	2	88_89	c.50_51insGGA	c.(49-54)atggag>atGGAggag	p.22_23insE	CLEC17A_ENST00000547437.1_In_Frame_Ins_p.22_23insE|RN7SL337P_ENST00000462468.2_RNA|CLEC17A_ENST00000397439.2_In_Frame_Ins_p.22_23insE	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	22	Poly-Glu.					cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										GAAGGGACCATGGAGGAGGAGG	0.579														414	0.0826677	0.174	0.0346	5008	,	,		19484	0.004		0.0656	False		,,,				2504	0.092						uc010dzn.1		NA																	0					0						c.(49-51)ATG>ATGGAG		SubName: Full=CLEC17A protein;																																				SO:0001652	inframe_insertion	388512					cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity	g.chr19:14694175_14694176insGGA	AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.66_68dupGGA	19.37:g.14694182_14694184dupGGA	ENSP00000393719:p.Glu22_Glu22dup		Somatic				CLEC17A_uc002mzh.1_In_Frame_Ins_p.22_23insE|CLEC17A_uc010xnt.1_RNA|CLEC17A_uc010xnu.1_In_Frame_Ins_p.22_23insE|CLEC17A_uc010dzo.1_In_Frame_Ins_p.22_23insE	p.22_23insE			WXS	Illumina HiSeq	Unspecified	Q6ZS10	CL17A_HUMAN			2	127_128	+			22_23			Cytoplasmic (Potential).		A8MX68|B2RTX0|B7ZMM4	In_Frame_Ins	INS	ENST00000417570.1	37	c.50_51insGGA	CCDS56087.1																																																																																				0.579	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403400.1	NM_207390		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
LGALS4	3960	broad.mit.edu	37	19	39299514	39299514	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:39299514delC	ENST00000307751.4	-	3	686	c.209delG	c.(208-210)ggcfs	p.G70fs	LGALS4_ENST00000597803.1_Intron	NM_006149.3	NP_006140.1	P56470	LEG4_HUMAN	lectin, galactoside-binding, soluble, 4	70	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				cell adhesion (GO:0007155)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CTTGTCCCAGCCGTCAAACCG	0.592																																							uc002ojg.2		NA																	0				ovary(1)|skin(1)	2						c.(208-210)GGCfs		galectin-4							130.0	101.0	111.0					19																	39299514		2203	4300	6503	SO:0001589	frameshift_variant	3960				cell adhesion	cytosol|plasma membrane	sugar binding	g.chr19:39299514delC		CCDS12521.1	19q13.2	2014-03-19	2008-07-25		ENSG00000171747	ENSG00000171747		"""Lectins, galactoside-binding"""	6565	protein-coding gene	gene with protein product	"""galectin 4"""	602518				8063692	Standard	NM_006149		Approved	GAL4	uc002ojg.3	P56470	OTTHUMG00000182608	ENST00000307751.4:c.209delG	19.37:g.39299514delC	ENSP00000302100:p.Gly70fs		Somatic				LGALS4_uc010xuj.1_Frame_Shift_Del_p.G70fs	p.G70fs	NM_006149	NP_006140	WXS	Illumina HiSeq	Unspecified	P56470	LEG4_HUMAN	Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)		3	423	-	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		70			Galectin 1.			Frame_Shift_Del	DEL	ENST00000307751.4	37	c.209delG	CCDS12521.1																																																																																				0.592	LGALS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462641.1	NM_006149		44	29	NA	NA	NA	NA	NA	44	29	---	---	---	---
GLTSCR1	29998	broad.mit.edu	37	19	48197601	48197601	+	Frame_Shift_Del	DEL	A	A	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:48197601delA	ENST00000396720.3	+	8	2707	c.2513delA	c.(2512-2514)caafs	p.Q838fs	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	838										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		TTTGTCATCCAAAACCAGCTA	0.711																																							uc002phh.3		NA																	0				pancreas(3)	3						c.(2512-2514)CAAfs		glioma tumor suppressor candidate region gene 1							4.0	5.0	5.0					19																	48197601		1705	3834	5539	SO:0001589	frameshift_variant	29998						protein binding	g.chr19:48197601delA	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.2513delA	19.37:g.48197601delA	ENSP00000379946:p.Gln838fs		Somatic				GLTSCR1_uc002phi.3_Frame_Shift_Del_p.Q596fs	p.Q838fs	NM_015711	NP_056526	WXS	Illumina HiSeq	Unspecified	Q9NZM4	GSCR1_HUMAN		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)	8	2707	+		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)	838					A8MW01	Frame_Shift_Del	DEL	ENST00000396720.3	37	c.2513delA	CCDS46134.1																																																																																				0.711	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
SIGLEC5	8778	broad.mit.edu	37	19	52131257	52131257	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:52131257delG	ENST00000534261.2	-	6	1226	c.827delC	c.(826-828)cctfs	p.P276fs	SIGLEC5_ENST00000222107.4_Frame_Shift_Del_p.P276fs|SIGLEC5_ENST00000429354.3_Frame_Shift_Del_p.P276fs|SIGLEC5_ENST00000599649.1_Frame_Shift_Del_p.P276fs|SIGLEC5_ENST00000570106.2_Frame_Shift_Del_p.P276fs			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	276	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		CAGGTGTGCAGGGGGGTTGCT	0.602																																							uc002pxe.2		NA																	0				skin(2)|breast(1)|central_nervous_system(1)	4						c.(826-828)CCTfs		sialic acid binding Ig-like lectin 5 precursor							56.0	64.0	61.0					19																	52131257		2203	4299	6502	SO:0001589	frameshift_variant	8778				cell adhesion	integral to membrane	sugar binding	g.chr19:52131257delG	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.827delC	19.37:g.52131257delG	ENSP00000473238:p.Pro276fs		Somatic					p.P276fs	NM_003830	NP_003821	WXS	Illumina HiSeq	Unspecified	O15389	SIGL5_HUMAN		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)	5	966	-		all_neural(266;0.0726)	276			Extracellular (Potential).|Ig-like C2-type 2.			Frame_Shift_Del	DEL	ENST00000534261.2	37	c.827delC	CCDS33088.1																																																																																				0.602	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830		20	63	NA	NA	NA	NA	NA	20	63	---	---	---	---
TTYH1	57348	broad.mit.edu	37	19	54942294	54942296	+	In_Frame_Del	DEL	GGA	GGA	-	rs201071440		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	GGA	GGA	-	-	GGA	GGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr19:54942294_54942296delGGA	ENST00000376530.3	+	10	1153_1155	c.1050_1052delGGA	c.(1048-1053)ttggag>ttg	p.E352del	TTYH1_ENST00000301194.4_In_Frame_Del_p.E352del|TTYH1_ENST00000391739.3_In_Frame_Del_p.G382del|TTYH1_ENST00000489425.1_3'UTR|TTYH1_ENST00000376531.3_In_Frame_Del_p.E352del|AC008746.3_ENST00000457113.1_RNA	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	352					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		TGCTGTCCTTGGAGGAGACTCTG	0.621																																							uc002qfq.2		NA																	0					0						c.(1048-1053)TTGGAG>TTG		tweety 1 isoform 1																																				SO:0001651	inframe_deletion	57348				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity	g.chr19:54942294_54942296delGGA	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.1050_1052delGGA	19.37:g.54942297_54942299delGGA	ENSP00000365713:p.Glu352del		Somatic				TTYH1_uc010yey.1_In_Frame_Del_p.G382del|TTYH1_uc002qfr.2_In_Frame_Del_p.E352del|TTYH1_uc002qft.2_In_Frame_Del_p.E352del|TTYH1_uc002qfu.1_In_Frame_Del_p.E264del	p.E352del	NM_020659	NP_065710	WXS	Illumina HiSeq	Unspecified	Q9H313	TTYH1_HUMAN		GBM - Glioblastoma multiforme(193;0.0767)	10	1142_1144	+	Ovarian(34;0.19)		352			Extracellular (Potential).		B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	In_Frame_Del	DEL	ENST00000376530.3	37	c.1050_1052delGGA	CCDS12893.1																																																																																				0.621	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1			12	63	NA	NA	NA	NA	NA	12	63	---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33246135	33246135	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:33246135delG	ENST00000404816.2	+	3	1078	c.725delG	c.(724-726)tggfs	p.W242fs	LTBP1_ENST00000354476.3_Frame_Shift_Del_p.W242fs			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	242					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GCTTCCTCGTGGGGCCCTCCT	0.562																																							uc002ros.2		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(724-726)TGGfs		latent transforming growth factor beta binding							108.0	110.0	109.0					2																	33246135		2203	4300	6503	SO:0001589	frameshift_variant	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33246135delG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.725delG	2.37:g.33246135delG	ENSP00000386043:p.Trp242fs		Somatic					p.W242fs	NM_206943	NP_996826	WXS	Illumina HiSeq	Unspecified	Q14766	LTBP1_HUMAN			3	725	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	242					A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Frame_Shift_Del	DEL	ENST00000404816.2	37	c.725delG	CCDS33177.2																																																																																				0.562	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		23	81	NA	NA	NA	NA	NA	23	81	---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185800708	185800708	+	Frame_Shift_Del	DEL	A	A	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr2:185800708delA	ENST00000302277.6	+	4	1179	c.585delA	c.(583-585)gcafs	p.A195fs		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	195							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						ATTATACAGCAAAAAATAACC	0.388																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(583-585)GCAfs		zinc finger protein 804A							62.0	65.0	64.0					2																	185800708		2203	4300	6503	SO:0001589	frameshift_variant	91752					intracellular	zinc ion binding	g.chr2:185800708delA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.585delA	2.37:g.185800708delA	ENSP00000303252:p.Ala195fs		Somatic					p.A195fs	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	1179	+			195					A7E253|Q6ZN26	Frame_Shift_Del	DEL	ENST00000302277.6	37	c.585delA	CCDS2291.1																																																																																				0.388	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		12	40	NA	NA	NA	NA	NA	12	40	---	---	---	---
EIF2S2	8894	broad.mit.edu	37	20	32693175	32693175	+	Splice_Site	DEL	T	T	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr20:32693175delT	ENST00000374980.2	-	2	413	c.192delA	c.(190-192)aaa>aa	p.K64fs		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	64					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						ACCACGCACCTTTTTTCCTAG	0.483																																							uc002xaf.2		NA																	0				large_intestine(1)	1						c.(190-192)AAAfs		eukaryotic translation initiation factor 2 beta							229.0	203.0	212.0					20																	32693175		2203	4300	6503	SO:0001630	splice_region_variant	8894					cytosol|eukaryotic translation initiation factor 2 complex	metal ion binding|protein binding|translation initiation factor activity	g.chr20:32693175delT	M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.193+1A>-	20.37:g.32693175delT			Somatic				EIF2S2_uc002xag.2_Frame_Shift_Del_p.K64fs|EIF2S2_uc010ges.2_Frame_Shift_Del_p.K39fs	p.K64fs	NM_003908	NP_003899	WXS	Illumina HiSeq	Unspecified	P20042	IF2B_HUMAN			2	361	-			64					Q9BVU0|Q9UJE4	Frame_Shift_Del	DEL	ENST00000374980.2	37	c.192delA	CCDS13231.1																																																																																				0.483	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078765.2	NM_003908	Frame_Shift_Del	7	185	NA	NA	NA	NA	NA	7	185	---	---	---	---
BACH1	571	broad.mit.edu	37	21	30699067	30699067	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr21:30699067delC	ENST00000399921.1	+	3	1165	c.922delC	c.(922-924)cctfs	p.P308fs	BACH1_ENST00000286800.3_Frame_Shift_Del_p.P308fs	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						AGAAGTGACTCCTTTCCCCCA	0.393																																							uc002ynj.2		NA																	0				ovary(1)|liver(1)	2						c.(922-924)CCTfs		BTB and CNC homology 1 transcription factor							117.0	121.0	119.0					21																	30699067		2203	4299	6502	SO:0001589	frameshift_variant	571					nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr21:30699067delC	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.922delC	21.37:g.30699067delC	ENSP00000382805:p.Pro308fs		Somatic				BACH1_uc002ynk.2_Frame_Shift_Del_p.P308fs|BACH1_uc002ynl.2_RNA	p.P308fs	NM_001186	NP_001177	WXS	Illumina HiSeq	Unspecified	O14867	BACH1_HUMAN			3	1037	+			308					Q3MJE2|Q8NCI5	Frame_Shift_Del	DEL	ENST00000399921.1	37	c.922delC	CCDS13585.1																																																																																				0.393	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866		33	121	NA	NA	NA	NA	NA	33	121	---	---	---	---
HERC5	51191	broad.mit.edu	37	4	89410360	89410363	+	Frame_Shift_Del	DEL	AAGA	AAGA	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	AAGA	AAGA	-	-	AAGA	AAGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:89410360_89410363delAAGA	ENST00000264350.3	+	16	2159_2162	c.2006_2009delAAGA	c.(2005-2010)gaagaafs	p.EE669fs	HERC5_ENST00000508159.1_Frame_Shift_Del_p.EE307fs	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	669					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GCAATTGAGGAAGAAAGAGAGTCT	0.373																																					Esophageal Squamous(39;887 1012 34045 50514)	Esophageal Squamous(39;887 1012 34045 50514)	uc003hrt.2		NA																	0				ovary(4)|lung(3)|skin(2)	9						c.(2005-2010)GAAGAAfs		hect domain and RLD 5																																				SO:0001589	frameshift_variant	51191				innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity	g.chr4:89410360_89410363delAAGA	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.2006_2009delAAGA	4.37:g.89410364_89410367delAAGA	ENSP00000264350:p.Glu669fs		Somatic				HERC5_uc011cdm.1_Frame_Shift_Del_p.E307fs	p.E669fs	NM_016323	NP_057407	WXS	Illumina HiSeq	Unspecified	Q9UII4	HERC5_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000209)	16	2159_2162	+		Hepatocellular(203;0.114)	669_670					B2RTQ1|Q69G20	Frame_Shift_Del	DEL	ENST00000264350.3	37	c.2006_2009delAAGA	CCDS3630.1																																																																																				0.373	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323		9	79	NA	NA	NA	NA	NA	9	79	---	---	---	---
MTTP	4547	broad.mit.edu	37	4	100515986	100515986	+	Frame_Shift_Del	DEL	G	G	-	rs140859988		TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr4:100515986delG	ENST00000265517.5	+	7	1058	c.855delG	c.(853-855)acgfs	p.T285fs	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Frame_Shift_Del_p.T285fs|MTTP_ENST00000511045.1_Frame_Shift_Del_p.T312fs			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	285	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	CAAAGTACACGGCCATTCCCA	0.468																																							uc003hvc.3		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(853-855)ACGfs		microsomal triglyceride transfer protein large	Hesperetin(DB01094)						115.0	105.0	109.0					4																	100515986		2203	4300	6503	SO:0001589	frameshift_variant	4547				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity	g.chr4:100515986delG		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.855delG	4.37:g.100515986delG	ENSP00000265517:p.Thr285fs		Somatic				MTTP_uc011cej.1_Frame_Shift_Del_p.T312fs	p.T285fs	NM_000253	NP_000244	WXS	Illumina HiSeq	Unspecified	P55157	MTP_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	8	1111	+			285			Vitellogenin.		A8K428|Q08AM4|Q6P5T3	Frame_Shift_Del	DEL	ENST00000265517.5	37	c.855delG	CCDS3651.1																																																																																				0.468	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3			22	40	NA	NA	NA	NA	NA	22	40	---	---	---	---
SNX18	112574	broad.mit.edu	37	5	53814025	53814026	+	Frame_Shift_Ins	INS	-	-	C			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:53814025_53814026insC	ENST00000326277.3	+	1	433_434	c.243_244insC	c.(244-246)cccfs	p.P82fs	SNX18_ENST00000381410.4_Frame_Shift_Ins_p.P82fs|SNX18_ENST00000343017.6_Frame_Shift_Ins_p.P82fs	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	82					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				ACGCCAATGTGCCCCCCGGGGG	0.782																																							uc003jpj.3		NA																	0					0						c.(241-246)GTGCCCfs		sorting nexin 18 isoform b																																				SO:0001589	frameshift_variant	112574				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding	g.chr5:53814025_53814026insC	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.249dupC	5.37:g.53814031_53814031dupC	ENSP00000317332:p.Pro82fs		Somatic				SNX18_uc011cqg.1_Frame_Shift_Ins_p.V81fs|SNX18_uc003jpi.3_Frame_Shift_Ins_p.V81fs	p.V81fs	NM_052870	NP_443102	WXS	Illumina HiSeq	Unspecified	Q96RF0	SNX18_HUMAN			1	433_434	+		Lung NSC(810;3.46e-05)|Breast(144;0.102)	81_82					B4E2B3|H7BXX3|Q05BB3|Q0VG02	Frame_Shift_Ins	INS	ENST00000326277.3	37	c.243_244insC	CCDS3962.1																																																																																				0.782	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2			2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
LYRM7	90624	broad.mit.edu	37	5	130515787	130515787	+	Splice_Site	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr5:130515787delG	ENST00000379380.4	+	2	229		c.e2-1		LYRM7_ENST00000507584.1_Splice_Site|LYRM7_ENST00000510516.1_Splice_Site	NM_181705.2	NP_859056.2	Q5U5X0	LYRM7_HUMAN	LYR motif containing 7							mitochondrion (GO:0005739)		p.?(1)		upper_aerodigestive_tract(1)	1		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTCTTAACAGGTTTTACAGC	0.433																																							uc003kvg.1		NA																	1	Unknown(1)		upper_aerodigestive_tract(1)		0						c.e2-1		Lyrm7 homolog							105.0	100.0	102.0					5																	130515787		2203	4300	6503	SO:0001630	splice_region_variant	90624							g.chr5:130515787delG	BC047079	CCDS4148.1	5q31.1	2013-05-24	2012-10-23	2006-10-17	ENSG00000186687	ENSG00000186687		"""LYR motif containing"""	28072	protein-coding gene	gene with protein product		615831	"""chromosome 5 open reading frame 31"", ""Lyrm7 homolog (mouse)"""	C5orf31		23168492	Standard	NM_181705		Approved	FLJ20796, MZM1L	uc003kvg.1	Q5U5X0	OTTHUMG00000128994	ENST00000379380.4:c.19-1G>-	5.37:g.130515787delG			Somatic					p.V7_splice	NM_181705	NP_859056	WXS	Illumina HiSeq	Unspecified	Q5U5X0	LYRM7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		2	92	+		all_cancers(142;0.0377)|Breast(839;0.198)						A8MPQ9|Q86Y68	Splice_Site	DEL	ENST00000379380.4	37	c.19_splice	CCDS4148.1																																																																																				0.433	LYRM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250983.1	NM_181705	Intron	28	26	NA	NA	NA	NA	NA	28	26	---	---	---	---
CEP162	22832	broad.mit.edu	37	6	84896233	84896233	+	Frame_Shift_Del	DEL	A	A	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:84896233delA	ENST00000403245.3	-	12	1332	c.1218delT	c.(1216-1218)tttfs	p.F406fs	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Frame_Shift_Del_p.F330fs	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		CATTTTTGTCAAAAAAAAGGT	0.358																																							uc010kbp.2		NA																	0				ovary(1)	1						c.(1216-1218)TTTfs		KIAA1009 protein							141.0	150.0	147.0					6																	84896233		2202	4300	6502	SO:0001589	frameshift_variant	22832				cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding	g.chr6:84896233delA																												ENST00000403245.3:c.1218delT	6.37:g.84896233delA	ENSP00000385215:p.Phe406fs		Somatic				KIAA1009_uc003pkj.3_Frame_Shift_Del_p.F330fs|KIAA1009_uc003pkk.2_Frame_Shift_Del_p.F406fs|KIAA1009_uc003pki.3_5'UTR	p.F406fs	NM_014895	NP_055710	WXS	Illumina HiSeq	Unspecified	Q5TB80	QN1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.089)	12	1315	-		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)	406						Frame_Shift_Del	DEL	ENST00000403245.3	37	c.1218delT	CCDS34494.2																																																																																				0.358	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1			8	81	NA	NA	NA	NA	NA	8	81	---	---	---	---
PRDM1	639	broad.mit.edu	37	6	106553457	106553457	+	Frame_Shift_Del	DEL	A	A	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr6:106553457delA	ENST00000369096.4	+	5	1656	c.1422delA	c.(1420-1422)ggafs	p.G474fs	PRDM1_ENST00000369091.2_Frame_Shift_Del_p.G438fs|PRDM1_ENST00000369089.3_Frame_Shift_Del_p.G340fs	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	474					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CCTCAGATGGAGCCCGGAGGT	0.672			"""D, N, Mis, F, S"""		DLBCL																																		uc003prd.2		NA		Rec	yes		6	6q21	639	D|N|Mis|F|S	"""PR domain containing 1, with ZNF domain"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56						c.(1420-1422)GGAfs		PR domain containing 1, with ZNF domain isoform							42.0	51.0	48.0					6																	106553457		2203	4300	6503	SO:0001589	frameshift_variant	639				negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:106553457delA		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1422delA	6.37:g.106553457delA	ENSP00000358092:p.Gly474fs		Somatic				PRDM1_uc003pre.2_Frame_Shift_Del_p.G340fs	p.G474fs	NM_001198	NP_001189	WXS	Illumina HiSeq	Unspecified	O75626	PRDM1_HUMAN		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)	5	1656	+	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)	474					B2REA6|E1P5E0|Q86WM7	Frame_Shift_Del	DEL	ENST00000369096.4	37	c.1422delA	CCDS5054.2																																																																																				0.672	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3			7	73	NA	NA	NA	NA	NA	7	73	---	---	---	---
GET4	51608	broad.mit.edu	37	7	931930	931933	+	Frame_Shift_Del	DEL	AAAC	AAAC	-	rs150124099	byFrequency	TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	AAAC	AAAC	-	-	AAAC	AAAC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:931930_931933delAAAC	ENST00000265857.3	+	6	715_718	c.621_624delAAAC	c.(619-624)aaaaacfs	p.KN207fs	GET4_ENST00000407192.1_Frame_Shift_Del_p.KN154fs	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)	207					tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)				breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TCTGTTTAAAAAACAAAAGTAGCG	0.564																																							uc003sjl.1		NA																	0					0						c.(619-624)AAAAACfs		hypothetical protein LOC51608																																				SO:0001589	frameshift_variant	51608				tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding	g.chr7:931930_931933delAAAC	AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.621_624delAAAC	7.37:g.931930_931933delAAAC	ENSP00000265857:p.Lys207fs		Somatic				GET4_uc003sjj.1_RNA	p.K207fs	NM_015949	NP_057033	WXS	Illumina HiSeq	Unspecified	Q7L5D6	GET4_HUMAN			6	713_716	+			207_208					A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	Frame_Shift_Del	DEL	ENST00000265857.3	37	c.621_624delAAAC	CCDS5317.1																																																																																				0.564	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000231930.1	NM_015949		37	148	NA	NA	NA	NA	NA	37	148	---	---	---	---
NPSR1	387129	broad.mit.edu	37	7	34724296	34724296	+	Splice_Site	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr7:34724296delG	ENST00000360581.1	+	2	408	c.280delG	c.(280-282)gat>at	p.D94fs	NPSR1_ENST00000381553.3_Splice_Site_p.D94fs|NPSR1_ENST00000359791.1_Splice_Site_p.D94fs|NPSR1-AS1_ENST00000419766.1_RNA|NPSR1_ENST00000381539.3_Splice_Site_p.D94fs|NPSR1_ENST00000381542.1_Splice_Site_p.E94fs|NPSR1_ENST00000531252.1_Splice_Site_p.D94fs|NPSR1_ENST00000465305.1_Splice_Site_p.V94fs	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	94						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	GGCCATCACAGGTAAGTAACT	0.383																																							uc003teg.1		NA																	0				skin(3)|pancreas(1)	4						c.(280-282)GATfs		G protein-coupled receptor for asthma	Halothane(DB01159)						98.0	94.0	95.0					7																	34724296		2203	4300	6503	SO:0001630	splice_region_variant	387129					cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity	g.chr7:34724296delG	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.280+1G>-	7.37:g.34724296delG			Somatic				AAA1_uc010kwo.1_Intron|AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron|AAA1_uc003teb.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Frame_Shift_Del_p.D94fs|NPSR1_uc010kwt.1_5'UTR|NPSR1_uc010kwu.1_5'UTR|NPSR1_uc010kwv.1_Frame_Shift_Del_p.E94fs|NPSR1_uc003tei.1_Frame_Shift_Del_p.D94fs|NPSR1_uc010kww.1_Frame_Shift_Del_p.D94fs|NPSR1_uc011kar.1_Frame_Shift_Del_p.E94fs	p.D94fs	NM_207172	NP_997055	WXS	Illumina HiSeq	Unspecified	Q6W5P4	NPSR1_HUMAN			2	408	+			94			Helical; Name=2; (Potential).		A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Frame_Shift_Del	DEL	ENST00000360581.1	37	c.280delG	CCDS5444.1																																																																																				0.383	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	Frame_Shift_Del	14	39	NA	NA	NA	NA	NA	14	39	---	---	---	---
PIWIL2	55124	broad.mit.edu	37	8	22137081	22137081	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chr8:22137081delG	ENST00000454009.2	+	2	691	c.182delG	c.(181-183)aggfs	p.R61fs	PIWIL2_ENST00000356766.6_Frame_Shift_Del_p.R61fs|PIWIL2_ENST00000521356.1_Frame_Shift_Del_p.R61fs	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	61					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		AGCACACAGAGGGGGCCAGCA	0.542																																							uc003xbn.2		NA																	0				skin(1)	1						c.(181-183)AGGfs		piwi-like 2							77.0	80.0	79.0					8																	22137081		2203	4300	6503	SO:0001589	frameshift_variant	55124				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding	g.chr8:22137081delG	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.182delG	8.37:g.22137081delG	ENSP00000406956:p.Arg61fs		Somatic				PIWIL2_uc011kzf.1_Frame_Shift_Del_p.R61fs|PIWIL2_uc010ltv.2_Frame_Shift_Del_p.R61fs	p.R61fs	NM_018068	NP_060538	WXS	Illumina HiSeq	Unspecified	Q8TC59	PIWL2_HUMAN		Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)	2	330	+			61					A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Frame_Shift_Del	DEL	ENST00000454009.2	37	c.182delG	CCDS6029.1																																																																																				0.542	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1			8	61	NA	NA	NA	NA	NA	8	61	---	---	---	---
IRS4	8471	broad.mit.edu	37	X	107977851	107977851	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7937-01A-11D-2167-08	TCGA-97-7937-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9e485f06-af03-4dd7-900d-f1f15293a6a1	ca425b2a-6d19-4c80-ab04-ee76c1d18888	g.chrX:107977851delC	ENST00000372129.2	-	1	1800	c.1724delG	c.(1723-1725)ggafs	p.G575fs	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	575					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						ATCTCCAGGTCCCTGGCCACC	0.617																																							uc004eoc.2		NA																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1723-1725)GGAfs		insulin receptor substrate 4							138.0	141.0	140.0					X																	107977851		2203	4300	6503	SO:0001589	frameshift_variant	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977851delC	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1724delG	X.37:g.107977851delC	ENSP00000361202:p.Gly575fs		Somatic					p.G575fs	NM_003604	NP_003595	WXS	Illumina HiSeq	Unspecified	O14654	IRS4_HUMAN			1	1757	-			575						Frame_Shift_Del	DEL	ENST00000372129.2	37	c.1724delG	CCDS14544.1																																																																																				0.617	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		135	59	NA	NA	NA	NA	NA	135	59	---	---	---	---
