#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF1	65121	broad.mit.edu	37	1	12855993	12855993	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:12855993G>A	ENST00000332296.7	+	4	1376	c.1273G>A	c.(1273-1275)Gtc>Atc	p.V425I	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.V180I	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	425					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTTGGTTCGTGTCAATTGGGA	0.577																																							uc001auj.1		NA																	0					0						c.(1273-1275)GTC>ATC		PRAME family member 1							95.0	95.0	95.0					1																	12855993		2203	4294	6497	SO:0001583	missense	65121							g.chr1:12855993G>A	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1273G>A	1.37:g.12855993G>A	ENSP00000332134:p.Val425Ile		Somatic					p.V425I	NM_023013	NP_075389	WXS	Illumina HiSeq	Unspecified	O95521	PRAM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	1376	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	425					Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	c.1273G>A	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	11.66	1.704009	0.30232	.	.	ENSG00000116721	ENST00000332296;ENST00000400814	T;T	0.46819	0.86;5.62	1.56	-3.12	0.05282	.	1.033320	0.07732	N	0.945469	T	0.32496	0.0831	L	0.42487	1.325	0.09310	N	1	P	0.35242	0.492	B	0.37198	0.243	T	0.21724	-1.0237	10	0.30854	T	0.27	.	0.6228	0.00781	0.2281:0.3492:0.24:0.1827	.	425	O95521	PRAM1_HUMAN	I	425;180	ENSP00000332134:V425I;ENSP00000383616:V180I	ENSP00000332134:V425I	V	+	1	0	PRAMEF1	12778580	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.470000	0.02346	-0.807000	0.04393	0.205000	0.17691	GTC		0.577	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013		27	198	0	0	0	0.01441	0	27	198				
SPEN	23013	broad.mit.edu	37	1	16258564	16258564	+	Silent	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:16258564G>A	ENST00000375759.3	+	11	6033	c.5829G>A	c.(5827-5829)gcG>gcA	p.A1943A		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1943					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AGGCTGCAGCGGTTCCCACCA	0.587																																							uc001axk.1		NA																	0				ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(5827-5829)GCG>GCA		spen homolog, transcriptional regulator							42.0	47.0	45.0					1																	16258564		2203	4300	6503	SO:0001819	synonymous_variant	23013				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:16258564G>A		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5829G>A	1.37:g.16258564G>A			Somatic				SPEN_uc010obp.1_Silent_p.A1902A	p.A1943A	NM_015001	NP_055816	WXS	Illumina HiSeq	Unspecified	Q96T58	MINT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)	11	6033	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	1943			Potential.		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	c.5829G>A	CCDS164.1																																																																																				0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		10	57	0	0	0	0.001855	0	10	57				
CPT2	1376	broad.mit.edu	37	1	53668099	53668099	+	Missense_Mutation	SNP	C	C	T	rs74315294	byFrequency	TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:53668099C>T	ENST00000371486.3	+	3	853	c.338C>T	c.(337-339)tCg>tTg	p.S113L	CPT2_ENST00000468572.1_3'UTR	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	113			S -> L (in CPT2D; muscular form; frequent mutation; dbSNP:rs74315294). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15622536, ECO:0000269|PubMed:8358442, ECO:0000269|PubMed:9758712}.		carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	AGCTACATTTCGGGTAGGTAG	0.418													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		20386	0.0		0.001	False		,,,				2504	0.0						uc001cvb.3		NA																	0					0	GRCh37	CM930171	CPT2	M	rs74315294	c.(337-339)TCG>TTG		carnitine O-palmitoyltransferase precursor	L-Carnitine(DB00583)|Perhexiline(DB01074)	C	LEU/SER	2,4404	4.2+/-10.8	0,2,2201	92.0	89.0	90.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	338	5.9	1.0	1	dbSNP_131	90	16,8584	11.9+/-42.8	0,16,4284	yes	missense	CPT2	NM_000098.2	145	0,18,6485	TT,TC,CC		0.186,0.0454,0.1384	probably-damaging	113/659	53668099	18,12988	2203	4300	6503	SO:0001583	missense	1376				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	mitochondrial inner membrane	carnitine O-palmitoyltransferase activity	g.chr1:53668099C>T	BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.338C>T	1.37:g.53668099C>T	ENSP00000360541:p.Ser113Leu		Somatic					p.S113L	NM_000098	NP_000089	WXS	Illumina HiSeq	Unspecified	P23786	CPT2_HUMAN			3	853	+			113		S -> L (in CPT2D; muscular form. Frequent mutation, may be a polymorphism as it found in some 'normal' cDNA seqeuences).	Mitochondrial matrix (By similarity).		B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	ENST00000371486.3	37	c.338C>T	CCDS575.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	33	5.265643	0.95399	4.54E-4	0.00186	ENSG00000157184	ENST00000371486	D	0.90676	-2.71	5.88	5.88	0.94601	.	0.064942	0.64402	D	0.000004	D	0.96889	0.8984	H	0.94306	3.52	0.80722	A	1	D	0.76494	0.999	D	0.73708	0.981	D	0.97157	0.9835	9	0.66056	D	0.02	-1.9784	19.8509	0.96740	0.0:1.0:0.0:0.0	.	113	P23786	CPT2_HUMAN	L	113	ENSP00000360541:S113L	ENSP00000360541:S113L	S	+	2	0	CPT2	53440687	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	6.952000	0.75989	2.797000	0.96272	0.561000	0.74099	TCG		0.418	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024757.1	NM_000098		5	63	0	0	0	0.001168	0	5	63				
LEPROT	54741	broad.mit.edu	37	1	65895546	65895546	+	Splice_Site	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:65895546G>T	ENST00000371065.4	+	3	232	c.94G>T	c.(94-96)Gtt>Ttt	p.V32F	LEPR_ENST00000349533.6_Intron|LEPROT_ENST00000484243.1_3'UTR|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371059.3_Intron|LEPR_ENST00000344610.8_Intron|LEPR_ENST00000371060.3_Intron	NM_001198681.1|NM_017526.4	NP_001185610.1|NP_059996.1	O15243	OBRG_HUMAN	leptin receptor overlapping transcript	32					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			kidney(1)|large_intestine(1)|lung(5)	7				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AACTGACAGCGTTTACTGGCC	0.398																																							uc001dcf.2		NA																	0					0						c.(94-96)GTT>TTT		leptin receptor gene-related protein							182.0	175.0	178.0					1																	65895546		2203	4300	6503	SO:0001630	splice_region_variant	54741					endosome membrane|Golgi membrane|integral to plasma membrane		g.chr1:65895546G>T	Y12670	CCDS630.1, CCDS72801.1	1p31.2	2008-02-05			ENSG00000213625	ENSG00000213625			29477	protein-coding gene	gene with protein product	"""leptin receptor gene related protein"""	613461				9207021	Standard	NM_001198681		Approved	OBRGRP, OB-RGRP, VPS55, FLJ90360	uc001dcf.3	O15243	OTTHUMG00000009065	ENST00000371065.4:c.93-1G>T	1.37:g.65895546G>T			Somatic				LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc001dci.2_Intron|LEPR_uc009waq.2_Intron|LEPROT_uc009wap.2_Missense_Mutation_p.V41F	p.V32F	NM_017526	NP_059996	WXS	Illumina HiSeq	Unspecified	O15243	OBRG_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)	3	183	+			32			Helical; (Potential).		Q6FHL5	Missense_Mutation	SNP	ENST00000371065.4	37	c.94G>T	CCDS630.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.552246	0.45487	.	.	ENSG00000213625	ENST00000371065	.	.	.	5.75	4.84	0.62591	.	0.247197	0.32204	U	0.006440	T	0.62804	0.2458	M	0.77820	2.39	0.49483	D	0.999792	P	0.50272	0.933	P	0.48982	0.597	T	0.71108	-0.4688	9	0.87932	D	0	-9.0784	14.8756	0.70491	0.069:0.0:0.931:0.0	.	32	O15243	OBRG_HUMAN	F	32	.	ENSP00000360104:V32F	V	+	1	0	LEPROT	65668134	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.502000	0.60400	1.425000	0.47237	0.557000	0.71058	GTT		0.398	LEPROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025132.4	NM_017526	Missense_Mutation	28	131	1	0	9.04072e-19	0.003271	1.39985e-18	28	131				
MAB21L3	126868	broad.mit.edu	37	1	116675911	116675911	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:116675911C>A	ENST00000369500.3	+	7	1279	c.1014C>A	c.(1012-1014)acC>acA	p.T338T		NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	338				T -> A (in Ref. 1; BAC04682 and 3; AAI28150). {ECO:0000305}.						breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						TTCAGTGCACCAACCCGACTG	0.582																																							uc001egc.1		NA																	0					0						c.(1012-1014)GCC>GCA		hypothetical protein LOC126868							94.0	82.0	86.0					1																	116675911		2203	4300	6503	SO:0001819	synonymous_variant	126868							g.chr1:116675911C>A	AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.1014C>A	1.37:g.116675911C>A			Somatic					p.A338A	NM_152367	NP_689580	WXS	Illumina HiSeq	Unspecified	Q8N8X9	MB213_HUMAN		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)	7	1279	+	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)	338	T -> A (in Ref. 1; BAC04682 and 3; AAI28150).				Q5TDL7	Silent	SNP	ENST00000369500.3	37	c.1014C>A	CCDS886.1																																																																																				0.582	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033486.1	NM_152367		6	130	1	0	8.12818e-05	0.001984	9.21621e-05	6	130				
PKLR	5313	broad.mit.edu	37	1	155264336	155264336	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:155264336A>G	ENST00000342741.4	-	6	940	c.902T>C	c.(901-903)cTg>cCg	p.L301P	PKLR_ENST00000392414.3_Missense_Mutation_p.L270P	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	301					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TTCCGGACCCAGAGCAGCCCT	0.612																																							uc001fkb.3		NA																	0				skin(4)|ovary(1)	5						c.(901-903)CTG>CCG		pyruvate kinase, liver and RBC isoform 1	Pyruvic acid(DB00119)						101.0	86.0	92.0					1																	155264336		2203	4300	6503	SO:0001583	missense	5313				endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity	g.chr1:155264336A>G	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.902T>C	1.37:g.155264336A>G	ENSP00000339933:p.Leu301Pro		Somatic				RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Missense_Mutation_p.L270P	p.L301P	NM_000298	NP_000289	WXS	Illumina HiSeq	Unspecified	P30613	KPYR_HUMAN	Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		6	941	-	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		301					O75758|P11973	Missense_Mutation	SNP	ENST00000342741.4	37	c.902T>C	CCDS1109.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125412	0.77436	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99865	-7.29;-7.29	4.89	4.89	0.63831	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.000000	0.64402	D	0.000001	D	0.99928	0.9967	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96091	0.9061	10	0.87932	D	0	-22.6928	12.7612	0.57365	1.0:0.0:0.0:0.0	.	301;292	P30613;B1AVT1	KPYR_HUMAN;.	P	326;270;301;215	ENSP00000376214:L270P;ENSP00000339933:L301P	ENSP00000271946:L215P	L	-	2	0	PKLR	153530960	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	8.955000	0.93058	2.178000	0.69098	0.482000	0.46254	CTG		0.612	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298		7	37	0	0	0	0.00308	0	7	37				
CD244	51744	broad.mit.edu	37	1	160802351	160802351	+	Silent	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:160802351C>T	ENST00000368033.3	-	8	1072	c.990G>A	c.(988-990)aaG>aaA	p.K330K	CD244_ENST00000481677.1_5'UTR|CD244_ENST00000368034.4_Silent_p.K325K|CD244_ENST00000322302.7_Silent_p.K233K			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	330					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TGTGGTTCCTCTTCCTGGATC	0.433																																							uc009wtq.2		NA																	0				ovary(1)	1						c.(988-990)AAG>AAA		CD244 natural killer cell receptor 2B4							152.0	139.0	143.0					1																	160802351		2203	4300	6503	SO:0001819	synonymous_variant	51744				blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity	g.chr1:160802351C>T	AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.990G>A	1.37:g.160802351C>T			Somatic				CD244_uc001fxa.2_Silent_p.K325K|CD244_uc009wtp.2_RNA|CD244_uc009wtr.2_Silent_p.K233K	p.K330K	NM_016382	NP_057466	WXS	Illumina HiSeq	Unspecified	Q9BZW8	CD244_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)		8	1168	-	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		330			Cytoplasmic (Potential).		Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Silent	SNP	ENST00000368033.3	37	c.990G>A	CCDS53399.1																																																																																				0.433	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071469.1	NM_016382		11	70	0	0	0	0.008291	0	11	70				
CR2	1380	broad.mit.edu	37	1	207642509	207642509	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:207642509G>A	ENST00000367058.3	+	5	938	c.749G>A	c.(748-750)gGc>gAc	p.G250D	CR2_ENST00000367057.3_Missense_Mutation_p.G250D|CR2_ENST00000458541.2_Missense_Mutation_p.G250D|CR2_ENST00000367059.3_Missense_Mutation_p.G250D|CR2_ENST00000485707.1_3'UTR	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	250	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CGACTGCAAGGCCCACCTTCT	0.473																																							uc001hfw.2		NA																	0				upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						c.(748-750)GGC>GAC		complement component (3d/Epstein Barr virus)							220.0	198.0	206.0					1																	207642509		2203	4300	6503	SO:0001583	missense	1380				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity	g.chr1:207642509G>A	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.749G>A	1.37:g.207642509G>A	ENSP00000356025:p.Gly250Asp		Somatic				CR2_uc001hfv.2_Missense_Mutation_p.G250D|CR2_uc009xch.2_Missense_Mutation_p.G250D|CR2_uc009xci.1_5'Flank	p.G250D	NM_001877	NP_001868	WXS	Illumina HiSeq	Unspecified	P20023	CR2_HUMAN			5	843	+			250			Sushi 4.|Extracellular (Potential).		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	c.749G>A	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784640	0.31593	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.19	4.27	0.50696	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.87466	0.6184	H	0.94222	3.51	0.20307	N	0.999919	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.991	T	0.79429	-0.1807	9	0.72032	D	0.01	.	11.111	0.48232	0.0:0.0:0.8151:0.1849	.	250;250;250	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	D	250	ENSP00000356025:G250D;ENSP00000356024:G250D;ENSP00000356026:G250D;ENSP00000404222:G250D	ENSP00000356024:G250D	G	+	2	0	CR2	205709132	0.996000	0.38824	0.127000	0.21898	0.016000	0.09150	4.622000	0.61240	1.149000	0.42402	-0.182000	0.12963	GGC		0.473	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877		34	173	0	0	0	0.011902	0	34	173				
SLC30A10	55532	broad.mit.edu	37	1	220088985	220088985	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:220088985G>T	ENST00000366926.3	-	4	1425	c.1264C>A	c.(1264-1266)Ctg>Atg	p.L422M	SLC30A10_ENST00000484079.1_5'UTR|SLC30A10_ENST00000536446.1_Missense_Mutation_p.L177M	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	422					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		ACGTGAGCCAGAGGCAGTGCC	0.567																																					Colon(76;360 1614 43677 51136)	Colon(76;360 1614 43677 51136)	uc001hlw.2		NA																	0					0						c.(1264-1266)CTG>ATG		solute carrier family 30 (zinc transporter),							94.0	91.0	92.0					1																	220088985		2203	4300	6503	SO:0001583	missense	55532				zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr1:220088985G>T	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1264C>A	1.37:g.220088985G>T	ENSP00000355893:p.Leu422Met		Somatic				SLC30A10_uc001hlu.1_Intron|SLC30A10_uc001hlv.2_Missense_Mutation_p.L177M|SLC30A10_uc001hlx.2_Missense_Mutation_p.L197M	p.L422M	NM_018713	NP_061183	WXS	Illumina HiSeq	Unspecified	Q6XR72	ZNT10_HUMAN		GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)	4	1475	-			422			Cytoplasmic (Potential).		Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	c.1264C>A	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802683	0.31869	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.69175	-0.38;0.21	6.02	3.13	0.36017	.	0.368243	0.23338	N	0.049266	T	0.58495	0.2126	L	0.34521	1.04	0.19575	N	0.999966	D	0.54047	0.964	P	0.49752	0.621	T	0.48875	-0.8996	9	.	.	.	-13.2069	7.0659	0.25151	0.1975:0.124:0.6784:0.0	.	422	Q6XR72	ZNT10_HUMAN	M	422;177	ENSP00000355893:L422M;ENSP00000439489:L177M	.	L	-	1	2	SLC30A10	218155608	0.990000	0.36364	0.488000	0.27440	0.162000	0.22319	2.158000	0.42329	0.425000	0.26087	0.650000	0.86243	CTG		0.567	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713		13	53	1	0	1.49906e-05	0.00245	1.755e-05	13	53				
AIDA	64853	broad.mit.edu	37	1	222860943	222860943	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:222860943G>A	ENST00000340020.6	-	5	553	c.347C>T	c.(346-348)cCa>cTa	p.P116L	AIDA_ENST00000355727.2_Missense_Mutation_p.P116L|AIDA_ENST00000541237.1_Missense_Mutation_p.P92L|AIDA_ENST00000474863.1_5'UTR	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	116					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TTACCTTAATGGGACAGGCTG	0.269																																							uc001hnn.2		NA																	0					0						c.(346-348)CCA>CTA		axin interactor, dorsalization associated							43.0	50.0	47.0					1																	222860943		2124	4182	6306	SO:0001583	missense	64853				dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity			g.chr1:222860943G>A	BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.347C>T	1.37:g.222860943G>A	ENSP00000339161:p.Pro116Leu		Somatic				AIDA_uc001hno.2_RNA|AIDA_uc010pus.1_Missense_Mutation_p.P92L	p.P116L	NM_022831	NP_073742	WXS	Illumina HiSeq	Unspecified	Q96BJ3	AIDA_HUMAN			5	552	-			116					A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Missense_Mutation	SNP	ENST00000340020.6	37	c.347C>T	CCDS1533.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357485	0.61293	.	.	ENSG00000186063	ENST00000340020;ENST00000355727;ENST00000541237	.	.	.	6.07	6.07	0.98685	Axin interactor, dorsalization-associated protein, N-terminal (2);	0.045603	0.85682	D	0.000000	T	0.63438	0.2511	N	0.12746	0.255	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.78314	0.991;0.981	T	0.67833	-0.5568	9	0.56958	D	0.05	.	20.239	0.98366	0.0:0.0:1.0:0.0	.	92;116	F5H715;Q96BJ3	.;AIDA_HUMAN	L	116;116;92	.	ENSP00000339161:P116L	P	-	2	0	AIDA	220927566	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.023000	0.88764	2.884000	0.98904	0.655000	0.94253	CCA		0.269	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091818.1	NM_022831		9	70	0	0	0	0.008291	0	9	70				
AHCTF1	25909	broad.mit.edu	37	1	247014516	247014516	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr1:247014516C>A	ENST00000391829.2	-	33	4915	c.4792G>T	c.(4792-4794)Ggt>Tgt	p.G1598C	AHCTF1_ENST00000366508.1_Missense_Mutation_p.G1633C|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.G1607C			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1598	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCTTCTTCACCTTCCAATATC	0.413																																					Colon(145;197 1800 4745 15099 26333)	Colon(145;197 1800 4745 15099 26333)	uc001ibu.1		NA																	0				ovary(5)|skin(2)	7						c.(4792-4794)GGT>TGT		transcription factor ELYS							88.0	82.0	84.0					1																	247014516		2203	4300	6503	SO:0001583	missense	25909				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding	g.chr1:247014516C>A		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4792G>T	1.37:g.247014516C>A	ENSP00000375705:p.Gly1598Cys		Somatic				AHCTF1_uc001ibv.1_Missense_Mutation_p.G1607C|AHCTF1_uc009xgs.1_Missense_Mutation_p.G459C|AHCTF1_uc001ibw.1_RNA	p.G1598C	NM_015446	NP_056261	WXS	Illumina HiSeq	Unspecified	Q8WYP5	ELYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00271)		32	4799	-	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	1598			Mediates transcriptional activity (By similarity).|Necessary for nuclear localization (By similarity).		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37	c.4792G>T		.	.	.	.	.	.	.	.	.	.	C	17.99	3.523411	0.64747	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.70045	-0.45;-0.44;-0.43	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.82121	0.4968	M	0.70275	2.135	0.49213	D	0.999762	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.81468	-0.0919	10	0.59425	D	0.04	-23.4749	19.0599	0.93085	0.0:1.0:0.0:0.0	.	459;1633;1598	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	C	1633;1607;1598	ENSP00000355464:G1633C;ENSP00000355465:G1607C;ENSP00000375705:G1598C	ENSP00000355465:G1607C	G	-	1	0	AHCTF1	245081139	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.310000	0.65780	2.941000	0.99782	0.655000	0.94253	GGT		0.413	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446		15	43	1	0	6.94344e-10	0.006122	9.614e-10	15	43				
SPAG6	9576	broad.mit.edu	37	10	22675764	22675764	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr10:22675764G>T	ENST00000376624.3	+	5	696	c.554G>T	c.(553-555)aGg>aTg	p.R185M	SPAG6_ENST00000376603.2_Missense_Mutation_p.R261M|SPAG6_ENST00000313311.6_Missense_Mutation_p.R185M|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Missense_Mutation_p.R160M|SPAG6_ENST00000376601.1_Intron	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	185				R -> G (in Ref. 7; AAH30585). {ECO:0000305}.	cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GCTTTGAAAAGGATTGCTGCT	0.473																																							uc001iri.2		NA																	0				breast(1)	1						c.(553-555)AGG>ATG		sperm associated antigen 6 isoform 1							121.0	113.0	116.0					10																	22675764		2203	4300	6503	SO:0001583	missense	9576				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding	g.chr10:22675764G>T	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.554G>T	10.37:g.22675764G>T	ENSP00000365811:p.Arg185Met		Somatic				SPAG6_uc001irj.2_Missense_Mutation_p.R185M|SPAG6_uc010qct.1_Missense_Mutation_p.R155M|SPAG6_uc009xkh.2_Missense_Mutation_p.R163M	p.R185M	NM_012443	NP_036575	WXS	Illumina HiSeq	Unspecified	O75602	SPAG6_HUMAN			5	696	+			185	R -> G (in Ref. 7; AAH30585).		ARM 4.		A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	ENST00000376624.3	37	c.554G>T	CCDS7139.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607129	0.66558	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000538630;ENST00000313311	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	5.6	5.6	0.85130	Armadillo-like helical (1);Armadillo-type fold (1);	0.039672	0.85682	D	0.000000	D	0.88912	0.6566	H	0.94222	3.51	0.80722	D	1	D;D;D;P	0.76494	0.968;0.999;0.996;0.954	P;D;P;P	0.68621	0.89;0.959;0.905;0.89	D	0.91274	0.5046	10	0.87932	D	0	-12.6097	19.9756	0.97304	0.0:0.0:1.0:0.0	.	160;261;185;185	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	M	185;261;160;185	ENSP00000365811:R185M;ENSP00000365788:R261M;ENSP00000441325:R160M;ENSP00000323599:R185M	ENSP00000323599:R185M	R	+	2	0	SPAG6	22715770	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	6.703000	0.74633	2.793000	0.96121	0.563000	0.77884	AGG		0.473	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1			19	79	1	0	1.50039e-11	0.012319	2.18239e-11	19	79				
ARMC3	219681	broad.mit.edu	37	10	23235079	23235079	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr10:23235079C>A	ENST00000298032.5	+	3	139	c.55C>A	c.(55-57)Cca>Aca	p.P19T	ARMC3_ENST00000409049.3_Missense_Mutation_p.P19T|ARMC3_ENST00000376528.4_Intron|ARMC3_ENST00000409983.3_Missense_Mutation_p.P19T	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	19						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TCAGTTTGACCCATTAATGAT	0.308																																							uc001irm.3		NA																	0					0						c.(55-57)CCA>ACA		armadillo repeat containing 3							80.0	83.0	82.0					10																	23235079		2202	4300	6502	SO:0001583	missense	219681						binding	g.chr10:23235079C>A	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.55C>A	10.37:g.23235079C>A	ENSP00000298032:p.Pro19Thr		Somatic				ARMC3_uc010qcv.1_Missense_Mutation_p.P19T|ARMC3_uc010qcw.1_Intron	p.P19T	NM_173081	NP_775104	WXS	Illumina HiSeq	Unspecified	Q5W041	ARMC3_HUMAN			3	138	+			19			ARM 1.		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	c.55C>A	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703159	0.68501	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049	T;T;T	0.47528	0.86;0.87;0.84	5.37	5.37	0.77165	.	0.117180	0.64402	D	0.000020	T	0.69405	0.3107	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	0.984;1.0	P;D	0.87578	0.785;0.998	T	0.71059	-0.4702	10	0.56958	D	0.05	-13.9065	18.7129	0.91664	0.0:1.0:0.0:0.0	.	19;19	Q5W041-4;Q5W041	.;ARMC3_HUMAN	T	19	ENSP00000298032:P19T;ENSP00000386943:P19T;ENSP00000387288:P19T	ENSP00000298032:P19T	P	+	1	0	ARMC3	23275085	1.000000	0.71417	0.994000	0.49952	0.654000	0.38779	6.695000	0.74593	2.519000	0.84933	0.650000	0.86243	CCA		0.308	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		5	39	1	0	3.59834e-05	0.001168	4.14528e-05	5	39				
GRID1	2894	broad.mit.edu	37	10	87628808	87628808	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr10:87628808G>C	ENST00000327946.7	-	6	995	c.910C>G	c.(910-912)Ctg>Gtg	p.L304V		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	304					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.L304M(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCGCAGAGCAGGGAGGAGATG	0.577										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	1	Substitution - Missense(1)		prostate(1)	ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(910-912)CTG>GTG		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						191.0	141.0	158.0					10																	87628808		2203	4300	6503	SO:0001583	missense	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87628808G>C	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.910C>G	10.37:g.87628808G>C	ENSP00000330148:p.Leu304Val	Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_RNA	p.L304V	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			6	1011	-			304			Extracellular (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	c.910C>G	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946807	0.53186	.	.	ENSG00000182771	ENST00000327946	D	0.82711	-1.64	5.71	2.39	0.29439	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	L	0.60455	1.87	0.80722	D	1	B	0.33345	0.409	B	0.39379	0.298	T	0.72481	-0.4280	10	0.29301	T	0.29	.	8.8082	0.34952	0.1508:0.0:0.7227:0.1264	.	304	Q9ULK0	GRID1_HUMAN	V	304	ENSP00000330148:L304V	ENSP00000330148:L304V	L	-	1	2	GRID1	87618788	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	3.459000	0.53021	0.753000	0.32945	-0.181000	0.13052	CTG		0.577	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		16	75	0	0	0	0.00499	0	16	75				
CCDC172	374355	broad.mit.edu	37	10	118137968	118137968	+	Silent	SNP	T	T	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr10:118137968T>C	ENST00000333254.3	+	8	938	c.687T>C	c.(685-687)gaT>gaC	p.D229D		NM_198515.2	NP_940917.1	P0C7W6	CC172_HUMAN	coiled-coil domain containing 172	229																	ATAAGGAAGATGACATGGAAA	0.274																																							uc001lck.2		NA																	0				ovary(2)	2						c.(685-687)GAT>GAC		hypothetical protein LOC374355							65.0	68.0	67.0					10																	118137968		2203	4297	6500	SO:0001819	synonymous_variant	374355							g.chr10:118137968T>C	BC044830	CCDS31291.1	10q26.11-q26.12	2012-05-31	2012-05-31	2012-05-31	ENSG00000182645	ENSG00000182645			30524	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 96"""	C10orf96		12477932	Standard	NM_198515		Approved	MGC35062	uc001lck.3	P0C7W6	OTTHUMG00000019098	ENST00000333254.3:c.687T>C	10.37:g.118137968T>C			Somatic					p.D229D	NM_198515	NP_940917	WXS	Illumina HiSeq	Unspecified	P0C7W6	CJ096_HUMAN		all cancers(201;0.014)	8	938	+		Lung NSC(174;0.204)|all_lung(145;0.248)	229			Potential.			Silent	SNP	ENST00000333254.3	37	c.687T>C	CCDS31291.1																																																																																				0.274	CCDC172-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050516.2	NM_198515		8	51	0	0	0	0.006214	0	8	51				
C10orf90	118611	broad.mit.edu	37	10	128153375	128153375	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr10:128153375C>G	ENST00000284694.7	-	4	1544	c.1424G>C	c.(1423-1425)aGc>aCc	p.S475T	C10orf90_ENST00000480379.1_5'Flank|C10orf90_ENST00000544758.1_Missense_Mutation_p.S572T|C10orf90_ENST00000356858.3_Missense_Mutation_p.S428T|C10orf90_ENST00000454341.1_Intron	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	475					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TTTCAGGAAGCTTTGATGTCG	0.473																																							uc001ljq.2		NA																	0				ovary(1)|skin(1)	2						c.(1423-1425)AGC>ACC		hypothetical protein LOC118611							108.0	109.0	109.0					10																	128153375		2203	4300	6503	SO:0001583	missense	118611							g.chr10:128153375C>G	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1424G>C	10.37:g.128153375C>G	ENSP00000284694:p.Ser475Thr		Somatic				C10orf90_uc001ljp.2_Intron|C10orf90_uc010qum.1_Missense_Mutation_p.S572T|C10orf90_uc009yao.2_3'UTR|C10orf90_uc001ljo.2_5'Flank	p.S475T	NM_001004298	NP_001004298	WXS	Illumina HiSeq	Unspecified	Q96M02	CJ090_HUMAN		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)	4	1545	-		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)	475					B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	c.1424G>C	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	C	7.938	0.742109	0.15642	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000544758;ENST00000432642	T;T;T	0.18960	2.18;2.19;2.18	4.44	0.138	0.14793	.	1.149140	0.06424	N	0.722923	T	0.16514	0.0397	L	0.43152	1.355	0.09310	N	1	B;B	0.31290	0.007;0.318	B;B	0.32762	0.005;0.152	T	0.35101	-0.9802	10	0.16420	T	0.52	-0.3718	5.5331	0.16995	0.0:0.4552:0.343:0.2019	.	572;475	F5GZL2;Q96M02	.;CJ090_HUMAN	T	428;475;572;475	ENSP00000284694:S475T;ENSP00000444369:S572T;ENSP00000405995:S475T	ENSP00000284694:S475T	S	-	2	0	C10orf90	128143365	0.000000	0.05858	0.001000	0.08648	0.854000	0.48673	0.052000	0.14163	0.457000	0.26962	0.637000	0.83480	AGC		0.473	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298		6	39	0	0	0	0.001168	0	6	39				
CDHR5	53841	broad.mit.edu	37	11	619514	619514	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr11:619514G>A	ENST00000358353.3	-	12	1575	c.1253C>T	c.(1252-1254)aCc>aTc	p.T418I	CDHR5_ENST00000349570.7_Missense_Mutation_p.T418I|CDHR5_ENST00000397542.2_Missense_Mutation_p.T418I			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	418	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						TGTGGTGGTGGTCAGCACAAC	0.597																																							uc001lqj.2		NA																	0					0						c.(1252-1254)ACC>ATC		mucin and cadherin-like isoform 1							134.0	123.0	127.0					11																	619514		2203	4300	6503	SO:0001583	missense	53841				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:619514G>A	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1253C>T	11.37:g.619514G>A	ENSP00000351118:p.Thr418Ile		Somatic				CDHR5_uc001lqk.2_Missense_Mutation_p.T418I|CDHR5_uc009ycc.2_Missense_Mutation_p.T252I|CDHR5_uc009ycd.2_Missense_Mutation_p.T418I|CDHR5_uc001lql.2_Missense_Mutation_p.T418I|CDHR5_uc001lqm.2_Missense_Mutation_p.T252I|CDHR5_uc009yce.1_Missense_Mutation_p.T387I	p.T418I	NM_021924	NP_068743	WXS	Illumina HiSeq	Unspecified	Q9HBB8	CDHR5_HUMAN			11	1358	-			418			Cadherin 4.|Extracellular (Potential).		C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	c.1253C>T	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026347	0.54683	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000326366;ENST00000349570	T;T;T	0.15834	2.39;2.39;2.39	3.52	2.61	0.31194	Cadherin (2);	.	.	.	.	T	0.21022	0.0506	L	0.32530	0.975	0.09310	N	0.999998	D;D;D;D;D	0.61697	0.959;0.973;0.973;0.99;0.99	P;P;P;P;P	0.59546	0.449;0.791;0.73;0.859;0.859	T	0.11470	-1.0586	9	0.20519	T	0.43	-14.9834	6.9242	0.24405	0.1296:0.0:0.8704:0.0	.	418;418;411;418;418	Q58EZ6;Q9HBB8-4;B4DV98;Q9HBB8-2;Q9HBB8	.;.;.;.;CDHR5_HUMAN	I	418	ENSP00000380676:T418I;ENSP00000351118:T418I;ENSP00000345726:T418I	ENSP00000326527:T418I	T	-	2	0	CDHR5	609514	0.541000	0.26417	0.103000	0.21229	0.256000	0.26092	1.183000	0.32041	0.843000	0.35070	0.462000	0.41574	ACC		0.597	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924		25	144	0	0	0	0.004289	0	25	144				
LDHA	3939	broad.mit.edu	37	11	18418443	18418443	+	Silent	SNP	C	C	A	rs11553865		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr11:18418443C>A	ENST00000422447.3	+	2	327	c.54C>A	c.(52-54)acC>acA	p.T18T	LDHA_ENST00000430553.2_Silent_p.T18T|LDHA_ENST00000227157.4_Silent_p.T18T|LDHA_ENST00000540430.1_Silent_p.T47T|LDHA_ENST00000379412.5_Silent_p.T18T|LDHA_ENST00000542179.1_Silent_p.T18T|LDHA_ENST00000396222.2_Silent_p.T18T	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	18					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						AAGAACAGACCCCCCAGAATA	0.418																																							uc001mok.3		NA																	0				central_nervous_system(3)	3						c.(52-54)ACC>ACA		lactate dehydrogenase A isoform 1	NADH(DB00157)						88.0	87.0	87.0					11																	18418443		2199	4293	6492	SO:0001819	synonymous_variant	3939				glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity|protein binding	g.chr11:18418443C>A	X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.54C>A	11.37:g.18418443C>A			Somatic				LDHA_uc010rdc.1_Silent_p.T18T|LDHA_uc009yhn.2_Silent_p.T18T|LDHA_uc009yho.2_5'UTR|LDHA_uc001mol.3_Silent_p.T18T|LDHA_uc010rdd.1_Silent_p.T47T	p.T18T	NM_005566	NP_005557	WXS	Illumina HiSeq	Unspecified	P00338	LDHA_HUMAN			2	326	+			18					B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Silent	SNP	ENST00000422447.3	37	c.54C>A	CCDS7839.1																																																																																				0.418	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2	NM_005566		11	79	1	0	2.27111e-07	0.013537	2.92e-07	11	79				
PCNXL3	399909	broad.mit.edu	37	11	65393401	65393401	+	Silent	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr11:65393401A>G	ENST00000355703.3	+	20	3794	c.3255A>G	c.(3253-3255)gcA>gcG	p.A1085A		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1085						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						TGTTGTACGCACTGGCTGGGG	0.632											OREG0021084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oey.2		NA																	0					0						c.(3253-3255)GCA>GCG		pecanex-like 3							52.0	61.0	58.0					11																	65393401		2153	4254	6407	SO:0001819	synonymous_variant	399909					integral to membrane		g.chr11:65393401A>G	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.3255A>G	11.37:g.65393401A>G			Somatic	OREG0021084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1083	PCNXL3_uc009yqn.2_Silent_p.A45A|PCNXL3_uc001oez.2_5'Flank	p.A1085A	NM_032223	NP_115599	WXS	Illumina HiSeq	Unspecified	Q9H6A9	PCX3_HUMAN			20	3255	+			1085			Helical; (Potential).		Q6MZN8	Silent	SNP	ENST00000355703.3	37	c.3255A>G	CCDS44650.1																																																																																				0.632	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223		11	50	0	0	0	0.00245	0	11	50				
Unknown	0	broad.mit.edu	37	11	89819380	89819380	+	IGR	SNP	A	A	G	rs75726606		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr11:89819380A>G								TRIM49C (12822 upstream) : SNORD56 (32178 downstream)																							AAAAAGATGAACAAAAGCCAA	0.413																																							uc010rub.1		NA																	0					0						c.(262-264)AAC>AGC		upstream binding transcription factor, RNA							95.0	72.0	79.0					11																	89819380		686	1564	2250	SO:0001628	intergenic_variant	642623				multicellular organismal development	cytoplasm|nucleus	DNA binding	g.chr11:89819380A>G																													11.37:g.89819380A>G			Somatic					p.N88S	NM_001143975	NP_001137447	WXS	Illumina HiSeq	Unspecified	P0CB47	UBFL1_HUMAN			1	263	+			88						Missense_Mutation	SNP		37	c.263A>G																																																																																				0	0.413									3	19	0	0	0	0.001168	0	3	19				
SIDT2	51092	broad.mit.edu	37	11	117063023	117063023	+	Silent	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr11:117063023C>T	ENST00000324225.4	+	20	2457	c.1926C>T	c.(1924-1926)atC>atT	p.I642I	SIDT2_ENST00000532062.1_5'Flank|SIDT2_ENST00000431081.2_Silent_p.I639I	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	642					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TCATTCACATCATCGCCACCC	0.637																																							uc001pqh.1		NA																	0					0						c.(1924-1926)ATC>ATT		SID1 transmembrane family, member 2 precursor							120.0	101.0	107.0					11																	117063023		2201	4296	6497	SO:0001819	synonymous_variant	51092					integral to membrane|lysosomal membrane		g.chr11:117063023C>T	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1926C>T	11.37:g.117063023C>T			Somatic				SIDT2_uc010rxe.1_Silent_p.I642I|SIDT2_uc001pqg.2_Silent_p.I663I|SIDT2_uc001pqi.1_Silent_p.I639I|SIDT2_uc001pqj.1_5'Flank	p.I642I	NM_001040455	NP_001035545	WXS	Illumina HiSeq	Unspecified	Q8NBJ9	SIDT2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)	20	1967	+	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	642			Helical; (Potential).		Q8NBY7|Q9Y357	Silent	SNP	ENST00000324225.4	37	c.1926C>T	CCDS31682.1																																																																																				0.637	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996		7	99	0	0	0	0.004482	0	7	99				
OR8D4	338662	broad.mit.edu	37	11	123777516	123777516	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr11:123777516C>A	ENST00000321355.2	+	1	408	c.378C>A	c.(376-378)atC>atA	p.I126I		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		ACGTGGCCATCTGCAGCCCAC	0.502																																							uc010saa.1		NA																	0				skin(1)	1						c.(376-378)ATC>ATA		olfactory receptor, family 8, subfamily D,							199.0	181.0	187.0					11																	123777516		2202	4299	6501	SO:0001819	synonymous_variant	338662				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123777516C>A	AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.378C>A	11.37:g.123777516C>A			Somatic					p.I126I	NM_001005197	NP_001005197	WXS	Illumina HiSeq	Unspecified	Q8NGM9	OR8D4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)	1	378	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	126			Cytoplasmic (Potential).		Q6IFE9	Silent	SNP	ENST00000321355.2	37	c.378C>A	CCDS31698.1																																																																																				0.502	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387262.1	NM_001005197		16	69	1	0	3.41278e-10	0.00499	4.81805e-10	16	69				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	G	rs121913529		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr12:25398284C>G	ENST00000256078.4	-	2	98	c.35G>C	c.(34-36)gGt>gCt	p.G12A	KRAS_ENST00000556131.1_Missense_Mutation_p.G12A|KRAS_ENST00000311936.3_Missense_Mutation_p.G12A|KRAS_ENST00000557334.1_Missense_Mutation_p.G12A	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GCT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>C	12.37:g.25398284C>G	ENSP00000256078:p.Gly12Ala	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12A|KRAS_uc001rgr.2_RNA	p.G12A	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>C	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996285	0.93167	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.74546	2.27	0.80722	D	1	P;P	0.52842	0.898;0.956	P;P	0.55303	0.658;0.773	D	0.87064	0.2155	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	A	12	ENSP00000308495:G12A;ENSP00000452512:G12A;ENSP00000256078:G12A;ENSP00000451856:G12A	ENSP00000256078:G12A	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		9	19	0	0	0	0.010729	0	9	19				
ALG10	84920	broad.mit.edu	37	12	34179154	34179154	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr12:34179154G>T	ENST00000266483.2	+	3	1045	c.726G>T	c.(724-726)atG>atT	p.M242I	ALG10_ENST00000538927.1_Intron|RP11-847H18.2_ENST00000501954.2_RNA|AC046130.1_ENST00000401300.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	242					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				CTTATTCCATGTCCTTTAAAA	0.368																																							uc001rlm.2		NA																	0				skin(1)	1						c.(724-726)ATG>ATT		asparagine-linked glycosylation 10 homolog							183.0	190.0	187.0					12																	34179154		2203	4300	6503	SO:0001583	missense	84920				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:34179154G>T	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.726G>T	12.37:g.34179154G>T	ENSP00000266483:p.Met242Ile		Somatic					p.M242I	NM_032834	NP_116223	WXS	Illumina HiSeq	Unspecified	Q5BKT4	AG10A_HUMAN			3	1045	+	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)	242			Cytoplasmic (Potential).		Q6NS98|Q96DU0|Q96SM6	Missense_Mutation	SNP	ENST00000266483.2	37	c.726G>T	CCDS41769.1	.	.	.	.	.	.	.	.	.	.	g	1.110	-0.658583	0.03454	.	.	ENSG00000139133	ENST00000266483	T	0.53423	0.62	3.11	3.11	0.35812	.	0.619699	0.17727	N	0.164029	T	0.24275	0.0588	N	0.04090	-0.28	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.05451	-1.0884	10	0.21014	T	0.42	.	12.1074	0.53820	0.0:0.0:1.0:0.0	.	242	Q5BKT4	AG10A_HUMAN	I	242	ENSP00000266483:M242I	ENSP00000266483:M242I	M	+	3	0	ALG10	34070421	0.585000	0.26774	0.280000	0.24747	0.382000	0.30200	0.855000	0.27805	1.488000	0.48433	0.175000	0.17021	ATG		0.368	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403309.1	NM_032834		25	139	1	0	7.38237e-10	0.00632	1.01244e-09	25	139				
KDM2B	84678	broad.mit.edu	37	12	121947779	121947779	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr12:121947779T>A	ENST00000377071.4	-	11	1310	c.1238A>T	c.(1237-1239)gAg>gTg	p.E413V	KDM2B_ENST00000377069.4_Missense_Mutation_p.E382V|KDM2B_ENST00000536437.1_Missense_Mutation_p.E296V|KDM2B_ENST00000538046.2_Missense_Mutation_p.E323V|KDM2B_ENST00000542973.1_5'Flank	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	413	Glu-rich.				embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						ATCACAGGCCTCCTCCTCCAT	0.627																																							uc001uat.2		NA																	0				ovary(1)|skin(1)	2						c.(1237-1239)GAG>GTG		F-box and leucine-rich repeat protein 10 isoform							34.0	40.0	38.0					12																	121947779		2027	4164	6191	SO:0001583	missense	84678				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding	g.chr12:121947779T>A	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1238A>T	12.37:g.121947779T>A	ENSP00000366271:p.Glu413Val		Somatic				KDM2B_uc001uar.2_Missense_Mutation_p.E4V|KDM2B_uc001uas.2_Missense_Mutation_p.E382V|KDM2B_uc001uau.2_Missense_Mutation_p.E296V|KDM2B_uc001uav.3_Missense_Mutation_p.E323V	p.E413V	NM_032590	NP_115979	WXS	Illumina HiSeq	Unspecified	Q8NHM5	KDM2B_HUMAN			11	1342	-			413			Glu-rich.		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	c.1238A>T	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.230925	0.79688	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000261824;ENST00000446152;ENST00000542030	T;T;T;T;T	0.52526	2.2;1.61;0.66;0.66;0.69	5.14	3.96	0.45880	.	0.104827	0.41294	D	0.000917	T	0.43389	0.1245	L	0.60455	1.87	0.49915	D	0.999839	P;B;B;B	0.39282	0.666;0.164;0.437;0.267	B;B;B;B	0.35859	0.212;0.04;0.154;0.058	T	0.45556	-0.9253	10	0.87932	D	0	-21.8603	12.1751	0.54180	0.0:0.0:0.143:0.857	.	413;296;413;382	E7EML5;Q1RLM7;Q8NHM5;A8MRS1	.;.;KDM2B_HUMAN;.	V	413;382;413;296;413;413;376;115	ENSP00000366269:E382V;ENSP00000366271:E413V;ENSP00000445196:E296V;ENSP00000398279:E376V;ENSP00000444846:E115V	ENSP00000261824:E413V	E	-	2	0	KDM2B	120432162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.162000	0.64942	0.870000	0.35726	0.533000	0.62120	GAG		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590		10	40	0	0	0	0.010729	0	10	40				
IFT88	8100	broad.mit.edu	37	13	21166516	21166516	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr13:21166516C>T	ENST00000319980.6	+	9	725	c.398C>T	c.(397-399)tCc>tTc	p.S133F	IFT88_ENST00000351808.5_Missense_Mutation_p.S124F|IFT88_ENST00000382778.4_Missense_Mutation_p.S133F|IFT88_ENST00000537103.1_Missense_Mutation_p.S105F	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	133					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		GGCCCTGCTTCCCCTTTGGAA	0.358																																							uc001unh.2		NA																	0				ovary(1)	1						c.(397-399)TCC>TTC		intraflagellar transport 88 homolog isoform 1							58.0	57.0	57.0					13																	21166516		2203	4300	6503	SO:0001583	missense	8100				cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding	g.chr13:21166516C>T	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.398C>T	13.37:g.21166516C>T	ENSP00000323580:p.Ser133Phe		Somatic				IFT88_uc001uni.2_Missense_Mutation_p.S124F|IFT88_uc001unj.2_Missense_Mutation_p.S123F|IFT88_uc010tcq.1_Missense_Mutation_p.S104F	p.S133F	NM_175605	NP_783195	WXS	Illumina HiSeq	Unspecified	Q13099	IFT88_HUMAN		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)	9	794	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	133					A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	c.398C>T	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292268	0.59976	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.8	5.8	0.92144	.	0.107597	0.64402	D	0.000004	T	0.67002	0.2847	N	0.24115	0.695	0.33612	D	0.603678	B;P	0.39624	0.071;0.681	B;B	0.34536	0.082;0.185	T	0.78420	-0.2211	10	0.87932	D	0	-10.0326	17.849	0.88739	0.0:1.0:0.0:0.0	.	105;133	F5H6C2;Q13099	.;IFT88_HUMAN	F	133;30;124;133;105	ENSP00000372228:S133F;ENSP00000261632:S124F;ENSP00000323580:S133F;ENSP00000437719:S105F	ENSP00000323580:S133F	S	+	2	0	IFT88	20064516	1.000000	0.71417	0.993000	0.49108	0.738000	0.42128	6.393000	0.73217	2.733000	0.93635	0.650000	0.86243	TCC		0.358	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		3	45	0	0	0	0.009096	0	3	45				
TEP1	7011	broad.mit.edu	37	14	20876303	20876303	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr14:20876303G>C	ENST00000262715.5	-	2	336	c.296C>G	c.(295-297)tCt>tGt	p.S99C	TEP1_ENST00000556935.1_Missense_Mutation_p.S99C	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	99					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGGGTGGGCAGAAACATGTCC	0.552																																							uc001vxe.2		NA																	0				ovary(5)	5						c.(295-297)TCT>TGT		telomerase-associated protein 1							113.0	112.0	112.0					14																	20876303		2203	4300	6503	SO:0001583	missense	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20876303G>C		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.296C>G	14.37:g.20876303G>C	ENSP00000262715:p.Ser99Cys		Somatic				TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.S99C	p.S99C	NM_007110	NP_009041	WXS	Illumina HiSeq	Unspecified	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	2	336	-	all_cancers(95;0.00123)	all_lung(585;0.235)	99			TEP1 N-terminal 4.		A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	c.296C>G	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251987	0.39797	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000556549	T;T;T	0.69435	-0.4;-0.4;-0.4	5.08	3.2	0.36748	.	0.353602	0.24871	N	0.034937	T	0.64461	0.2600	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.61697	0.99;0.977	P;P	0.57548	0.729;0.823	T	0.63972	-0.6516	10	0.66056	D	0.02	-2.5176	6.2623	0.20907	0.0935:0.0:0.7242:0.1823	.	99;99	G3V5X7;Q99973	.;TEP1_HUMAN	C	99	ENSP00000262715:S99C;ENSP00000452574:S99C;ENSP00000452240:S99C	ENSP00000262715:S99C	S	-	2	0	TEP1	19946143	0.110000	0.22057	0.676000	0.29932	0.213000	0.24496	1.553000	0.36255	0.787000	0.33731	0.650000	0.86243	TCT		0.552	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		5	122	0	0	0	0.000602	0	5	122				
PLEKHG3	26030	broad.mit.edu	37	14	65208308	65208308	+	Silent	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr14:65208308A>G	ENST00000394691.1	+	16	2220	c.2073A>G	c.(2071-2073)ccA>ccG	p.P691P	PLEKHG3_ENST00000484731.2_Silent_p.P196P|PLEKHG3_ENST00000247226.7_Silent_p.P635P|PLEKHG3_ENST00000471182.2_Silent_p.P224P			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	691							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CCCCAAGCCCAGGCTGCCCAG	0.577																																							uc001xho.1		NA																	0				skin(1)	1						c.(2071-2073)CCA>CCG		pleckstrin homology domain containing, family G,							41.0	45.0	44.0					14																	65208308		2201	4296	6497	SO:0001819	synonymous_variant	26030				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr14:65208308A>G	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.2073A>G	14.37:g.65208308A>G			Somatic				PLEKHG3_uc001xhn.1_Silent_p.P635P|PLEKHG3_uc001xhp.2_Silent_p.P812P|PLEKHG3_uc010aqh.1_Silent_p.P233P|PLEKHG3_uc001xhq.1_Silent_p.P196P	p.P691P	NM_015549	NP_056364	WXS	Illumina HiSeq	Unspecified	A1L390	PKHG3_HUMAN		all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)	16	2342	+			691					A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	ENST00000394691.1	37	c.2073A>G																																																																																					0.577	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549		3	58	0	0	0	0.000602	0	3	58				
ADAM21P1	145241	broad.mit.edu	37	14	70713834	70713834	+	RNA	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr14:70713834G>A	ENST00000530196.1	-	0	684					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AACTGTTGGCGTGCTACTTCC	0.453																																							uc010ttg.1		NA																	0					0						c.(34-36)CGC>TGC		SubName: Full=ADAM21-like protein;																																						145241							g.chr14:70713834G>A			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713834G>A			Somatic					p.R12C	NR_003951		WXS	Illumina HiSeq	Unspecified					1	685	-									Missense_Mutation	SNP	ENST00000530196.1	37	c.34C>T																																																																																					0.453	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467		6	60	0	0	0	0.001168	0	6	60				
CDCA4	55038	broad.mit.edu	37	14	105477868	105477868	+	Silent	SNP	G	G	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr14:105477868G>C	ENST00000336219.3	-	2	554	c.399C>G	c.(397-399)acC>acG	p.T133T	CDCA4_ENST00000392590.3_Silent_p.T133T	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	133						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		CCTGTGCTGAGGTGACTGGGC	0.592																																							uc001yqa.2		NA																	0				ovary(1)	1						c.(397-399)ACC>ACG		cell division cycle associated 4							89.0	75.0	80.0					14																	105477868		2203	4300	6503	SO:0001819	synonymous_variant	55038					nucleus		g.chr14:105477868G>C	BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.399C>G	14.37:g.105477868G>C			Somatic				CDCA4_uc001yqb.2_Silent_p.T133T	p.T133T	NM_145701	NP_663747	WXS	Illumina HiSeq	Unspecified	Q9BXL8	CDCA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)	2	495	-		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	133					Q8TB18|Q9NWK7	Silent	SNP	ENST00000336219.3	37	c.399C>G	CCDS9996.1																																																																																				0.592	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410311.1	NM_145701		3	53	0	0	0	0.009096	0	3	53				
TPSD1	23430	broad.mit.edu	37	16	1306674	1306674	+	Silent	SNP	G	G	T	rs569303909		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:1306674G>T	ENST00000211076.3	+	2	388	c.240G>T	c.(238-240)gcG>gcT	p.A80A	RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Silent_p.A73A	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	80	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				TAACCGCGGCGCACTGCGTGG	0.701																																							uc002clb.1		NA																	0					0						c.(238-240)GCG>GCT		tryptase delta 1 precursor							41.0	50.0	47.0					16																	1306674		2199	4298	6497	SO:0001819	synonymous_variant	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1306674G>T	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.240G>T	16.37:g.1306674G>T			Somatic				TPSD1_uc010brm.1_Silent_p.A18A	p.A80A	NM_012217	NP_036349	WXS	Illumina HiSeq	Unspecified	Q9BZJ3	TRYD_HUMAN			2	249	+		Hepatocellular(780;0.00369)	80			Peptidase S1.		O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Silent	SNP	ENST00000211076.3	37	c.240G>T	CCDS10432.1																																																																																				0.701	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2			7	55	1	0	7.48243e-07	0.006214	9.3693e-07	7	55				
FAM86A	196483	broad.mit.edu	37	16	5140288	5140288	+	Missense_Mutation	SNP	C	C	T	rs144582297	byFrequency	TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:5140288C>T	ENST00000427587.4	-	6	607	c.539G>A	c.(538-540)cGc>cAc	p.R180H	FAM86A_ENST00000587133.1_Missense_Mutation_p.R119H|FAM86A_ENST00000458008.4_Missense_Mutation_p.R146H	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	180						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TGCCCGGGGGCGGCACATCTT	0.607													c|||	6	0.00119808	0.0038	0.0	5008	,	,		20050	0.0		0.001	False		,,,				2504	0.0						uc002cyo.2		NA																	0					0						c.(538-540)CGC>CAC		hypothetical protein LOC196483 isoform 1		T	HIS/ARG,HIS/ARG	9,2997		0,9,1494	33.0	39.0	37.0		539,437	-9.5	0.0	16	dbSNP_134	37	0,5412		0,0,2706	no	missense,missense	FAM86A	NM_201400.2,NM_201598.2	29,29	0,9,4200	TT,TC,CC		0.0,0.2994,0.1069	benign,benign	180/331,146/297	5140288	9,8409	1503	2706	4209	SO:0001583	missense	196483							g.chr16:5140288C>T	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.539G>A	16.37:g.5140288C>T	ENSP00000398502:p.Arg180His		Somatic				FAM86A_uc002cyp.2_Missense_Mutation_p.R146H	p.R180H	NM_201400	NP_958802	WXS	Illumina HiSeq	Unspecified	Q96G04	FA86A_HUMAN			6	588	-			180					D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	37	c.539G>A	CCDS10529.1	.	.	.	.	.	.	.	.	.	.	c	1.267	-0.614145	0.03690	0.002994	0.0	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.18502	2.21;2.21	5.02	-9.53	0.00575	.	1.146510	0.06409	N	0.720178	T	0.10380	0.0254	.	.	.	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.31971	-0.9924	9	0.34782	T	0.22	.	12.3908	0.55358	0.0:0.1619:0.1262:0.7118	.	146;180	Q96G04-2;Q96G04	.;FA86A_HUMAN	H	146;180	ENSP00000389710:R146H;ENSP00000398502:R180H	ENSP00000398502:R180H	R	-	2	0	FAM86A	5080289	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.352000	0.07701	-1.624000	0.01556	-0.476000	0.04901	CGC		0.607	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400		12	51	0	0	0	0.013537	0	12	51				
TAOK2	9344	broad.mit.edu	37	16	29994190	29994190	+	Missense_Mutation	SNP	G	G	T	rs575152450		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:29994190G>T	ENST00000308893.4	+	11	2010	c.967G>T	c.(967-969)Ggc>Tgc	p.G323C	TAOK2_ENST00000279394.3_Missense_Mutation_p.G323C|TAOK2_ENST00000416441.2_Missense_Mutation_p.G150C|TAOK2_ENST00000543033.1_Missense_Mutation_p.G323C	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	323					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						GGCACCCAACGGCCCTGGTGC	0.602																																							uc002dva.1		NA																	0				ovary(1)	1						c.(967-969)GGC>TGC		TAO kinase 2 isoform 2							96.0	88.0	91.0					16																	29994190		2197	4300	6497	SO:0001583	missense	9344				actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity	g.chr16:29994190G>T	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.967G>T	16.37:g.29994190G>T	ENSP00000310094:p.Gly323Cys		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Missense_Mutation_p.G323C|TAOK2_uc002dvc.1_Missense_Mutation_p.G323C|TAOK2_uc010bzm.1_Missense_Mutation_p.G323C|TAOK2_uc002dvd.1_Missense_Mutation_p.G150C	p.G323C	NM_016151	NP_057235	WXS	Illumina HiSeq	Unspecified	Q9UL54	TAOK2_HUMAN			11	1750	+			323					A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	ENST00000308893.4	37	c.967G>T	CCDS10663.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198940	0.79015	.	.	ENSG00000149930	ENST00000416441;ENST00000308893;ENST00000543033;ENST00000279394	D;D;D	0.85013	-1.93;-1.93;-1.93	5.51	4.55	0.56014	Protein kinase-like domain (1);	0.054522	0.64402	D	0.000001	D	0.92156	0.7513	M	0.81239	2.535	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.989;1.0;1.0;1.0;1.0	D	0.92501	0.6008	9	.	.	.	.	15.2095	0.73209	0.0:0.1418:0.8582:0.0	.	507;150;323;323;323	Q86V37;Q9UL54-3;Q9UL54-2;A0PJ48;Q9UL54	.;.;.;.;TAOK2_HUMAN	C	323	ENSP00000310094:G323C;ENSP00000440336:G323C;ENSP00000279394:G323C	.	G	+	1	0	TAOK2	29901691	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.869000	0.99810	1.308000	0.44962	0.563000	0.77884	GGC		0.602	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151		15	69	1	0	8.34094e-07	0.008871	1.03543e-06	15	69				
SLC6A10P	386757	broad.mit.edu	37	16	32890622	32890622	+	RNA	SNP	T	T	G	rs200656321		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:32890622T>G	ENST00000330048.5	-	0	3176					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		CGTTGGTGTTTTTGTAGACCA	0.617																																							uc002edh.1		NA																	0					0						c.(262-264)AAA>AAC		RecName: Full=Transporter;																																						386757							g.chr16:32890622T>G	U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890622T>G			Somatic				SLC6A10P_uc002edi.1_RNA	p.K88N			WXS	Illumina HiSeq	Unspecified					5	440	-									Missense_Mutation	SNP	ENST00000330048.5	37	c.264A>C																																																																																					0.617	SLC6A10P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000432081.2			3	32	0	0	0	0.000602	0	3	32				
ZNF423	23090	broad.mit.edu	37	16	49669967	49669967	+	Silent	SNP	C	C	A	rs145829157		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:49669967C>A	ENST00000561648.1	-	4	3149	c.3096G>T	c.(3094-3096)acG>acT	p.T1032T	ZNF423_ENST00000563137.2_Silent_p.T972T|ZNF423_ENST00000262383.2_Silent_p.T1032T|ZNF423_ENST00000562871.1_Silent_p.T972T|ZNF423_ENST00000562520.1_Silent_p.T972T|ZNF423_ENST00000535559.1_Silent_p.T915T|ZNF423_ENST00000567169.1_Silent_p.T915T	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1032					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TGAGCTCAAGCGTGGAAGTGA	0.597																																							uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(3094-3096)ACG>ACT		zinc finger protein 423							84.0	78.0	80.0					16																	49669967		2199	4300	6499	SO:0001819	synonymous_variant	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49669967C>A	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3096G>T	16.37:g.49669967C>A			Somatic				ZNF423_uc010vgn.1_Silent_p.T915T	p.T1032T	NM_015069	NP_055884	WXS	Illumina HiSeq	Unspecified	Q2M1K9	ZN423_HUMAN			5	3394	-		all_cancers(37;0.0155)	1032			C2H2-type 24.		O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	c.3096G>T	CCDS32445.1																																																																																				0.597	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		4	35	1	0	4.096e-09	0.001168	5.56438e-09	4	35				
TMEM208	29100	broad.mit.edu	37	16	67262440	67262440	+	Missense_Mutation	SNP	C	C	T	rs367799210		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:67262440C>T	ENST00000304800.9	+	4	311	c.205C>T	c.(205-207)Cac>Tac	p.H69Y	LRRC29_ENST00000393992.1_5'Flank|TMEM208_ENST00000565201.1_Missense_Mutation_p.H69Y|LRRC29_ENST00000462169.1_5'Flank|AC040160.1_ENST00000454102.2_5'Flank|LRRC29_ENST00000341546.3_5'Flank|TMEM208_ENST00000563426.1_3'UTR|TMEM208_ENST00000563953.1_5'UTR|LRRC29_ENST00000409509.1_5'Flank	NM_014187.3	NP_054906.2	Q9BTX3	TM208_HUMAN	transmembrane protein 208	69					autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(2)|lung(1)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GGCCAGCTACCACTCTATGAG	0.577																																							uc002esi.2		NA																	0					0						c.(205-207)CAC>TAC		HSPC171 protein		C	TYR/HIS	1,4273		0,1,2136	56.0	60.0	59.0		205	5.4	1.0	16		59	0,8476		0,0,4238	no	missense	TMEM208	NM_014187.3	83	0,1,6374	TT,TC,CC		0.0,0.0234,0.0078	benign	69/174	67262440	1,12749	2137	4238	6375	SO:0001583	missense	29100					integral to membrane		g.chr16:67262440C>T		CCDS45511.1	16q22.1	2008-05-02			ENSG00000168701	ENSG00000168701			25015	protein-coding gene	gene with protein product						11042152	Standard	NM_014187		Approved	HSPC171	uc002esi.2	Q9BTX3		ENST00000304800.9:c.205C>T	16.37:g.67262440C>T	ENSP00000305892:p.His69Tyr		Somatic				LRRC29_uc002ese.2_5'Flank|LRRC29_uc002esf.2_5'Flank|LRRC29_uc002esg.2_5'Flank|LRRC29_uc010vjg.1_5'Flank|TMEM208_uc002esj.2_RNA	p.H69Y	NM_014187	NP_054906	WXS	Illumina HiSeq	Unspecified	Q9BTX3	TM208_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)	4	311	+		Ovarian(137;0.0563)	69					Q05CT0|Q96D25|Q9NZZ7	Missense_Mutation	SNP	ENST00000304800.9	37	c.205C>T	CCDS45511.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922531	0.52653	2.34E-4	0.0	ENSG00000168701	ENST00000304800	T	0.25085	1.82	5.39	5.39	0.77823	.	0.052738	0.85682	D	0.000000	T	0.09379	0.0231	N	0.01352	-0.895	0.35430	D	0.793978	B	0.16396	0.017	B	0.15870	0.014	T	0.15521	-1.0434	10	0.02654	T	1	.	17.7334	0.88386	0.0:1.0:0.0:0.0	.	69	Q9BTX3	TM208_HUMAN	Y	69	ENSP00000305892:H69Y	ENSP00000305892:H69Y	H	+	1	0	TMEM208	65819941	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.038000	0.64177	2.528000	0.85240	0.655000	0.94253	CAC		0.577	TMEM208-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421976.2	NM_014187		6	15	0	0	0	0.001984	0	6	15				
MYH8	4626	broad.mit.edu	37	17	10295215	10295215	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr17:10295215C>A	ENST00000403437.2	-	39	5742	c.5648G>T	c.(5647-5649)aGa>aTa	p.R1883I	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1883					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTCAGCTTGTCTCTTGTATGA	0.378									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	0				skin(6)|ovary(3)|breast(2)	11						c.(5647-5649)AGA>ATA		myosin, heavy chain 8, skeletal muscle,							189.0	179.0	182.0					17																	10295215		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10295215C>A		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5648G>T	17.37:g.10295215C>A	ENSP00000384330:p.Arg1883Ile		Somatic				uc002gml.1_Intron	p.R1883I	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			39	5743	-			1883			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.5648G>T	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994304	0.93167	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.83163	-1.69	4.97	4.97	0.65823	Myosin tail (1);	0.000000	0.45606	U	0.000344	D	0.94155	0.8125	H	0.97103	3.94	0.80722	D	1	D	0.58970	0.984	D	0.67900	0.954	D	0.95964	0.8964	10	0.87932	D	0	.	18.4282	0.90615	0.0:1.0:0.0:0.0	.	1883	P13535	MYH8_HUMAN	I	1883	ENSP00000384330:R1883I	ENSP00000252173:R1883I	R	-	2	0	MYH8	10235940	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.566000	0.45948	2.575000	0.86900	0.650000	0.86243	AGA		0.378	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		43	136	1	0	1.54886e-18	0.01441	2.37272e-18	43	136				
MYOCD	93649	broad.mit.edu	37	17	12620700	12620700	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr17:12620700G>T	ENST00000343344.4	+	4	215	c.215G>T	c.(214-216)tGc>tTc	p.C72F	MYOCD_ENST00000425538.1_Missense_Mutation_p.C72F			Q8IZQ8	MYCD_HUMAN	myocardin	72					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AGAAACAGGTGCAACAGTGCC	0.428																																							uc002gnn.2		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)	5						c.(214-216)TGC>TTC		myocardin isoform 2							68.0	67.0	67.0					17																	12620700		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12620700G>T	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.215G>T	17.37:g.12620700G>T	ENSP00000341835:p.Cys72Phe		Somatic				MYOCD_uc002gno.2_Missense_Mutation_p.C72F|MYOCD_uc002gnp.1_5'Flank	p.C72F	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	4	514	+			72			RPEL 2.		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.215G>T	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	7.596	0.671823	0.14776	.	.	ENSG00000141052	ENST00000425538;ENST00000343344	T	0.41758	0.99	5.65	2.55	0.30701	.	0.842709	0.11013	N	0.609188	T	0.25827	0.0629	N	0.08118	0	0.42909	D	0.994255	B;B	0.20671	0.047;0.022	B;B	0.19666	0.014;0.026	T	0.05818	-1.0862	10	0.87932	D	0	-5.5143	11.542	0.50672	0.1275:0.6088:0.2637:0.0	.	72;72	Q8IZQ8-3;Q8IZQ8	.;MYCD_HUMAN	F	72	ENSP00000341835:C72F	ENSP00000341835:C72F	C	+	2	0	MYOCD	12561425	0.998000	0.40836	0.000000	0.03702	0.017000	0.09413	5.729000	0.68538	0.465000	0.27167	-0.165000	0.13383	TGC		0.428	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		6	29	1	0	3.09899e-07	0.004482	3.94915e-07	6	29				
RNF213	57674	broad.mit.edu	37	17	78319618	78319618	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr17:78319618A>G	ENST00000582970.1	+	29	7626	c.7483A>G	c.(7483-7485)Ata>Gta	p.I2495V	RNF213_ENST00000336301.6_Missense_Mutation_p.I568V|RNF213_ENST00000508628.2_Missense_Mutation_p.I2544V	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2495					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I568L(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AACGGAAGCTATAAGCTGTAT	0.488																																							uc002jyh.1		NA																	1	Substitution - Missense(1)	p.I568L(1)	ovary(1)	ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(1702-1704)ATA>GTA		ring finger protein 213							118.0	105.0	109.0					17																	78319618		2203	4300	6503	SO:0001583	missense	57674							g.chr17:78319618A>G	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7483A>G	17.37:g.78319618A>G	ENSP00000464087:p.Ile2495Val		Somatic					p.I568V	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	1925	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	c.1702A>G	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	1.486	-0.556050	0.03967	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.44482	0.92;1.03	5.42	-3.78	0.04333	ATPase, AAA+ type, core (1);	0.754197	0.12618	N	0.453260	T	0.25680	0.0625	N	0.17594	0.5	0.09310	N	0.999998	B	0.09022	0.002	B	0.12156	0.007	T	0.10941	-1.0608	10	0.23891	T	0.37	.	16.4445	0.83913	0.479:0.0:0.521:0.0	.	568	Q63HN8	RN213_HUMAN	V	2495;2544;568	ENSP00000425956:I2495V;ENSP00000338218:I568V	ENSP00000338218:I568V	I	+	1	0	RNF213	75934213	0.013000	0.17824	0.000000	0.03702	0.009000	0.06853	0.254000	0.18314	-1.027000	0.03325	-2.200000	0.00306	ATA		0.488	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		16	84	0	0	0	0.007413	0	16	84				
SMAD4	4089	broad.mit.edu	37	18	48593406	48593406	+	Missense_Mutation	SNP	G	G	T	rs121912580		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr18:48593406G>T	ENST00000342988.3	+	10	1695	c.1157G>T	c.(1156-1158)gGt>gTt	p.G386V	SMAD4_ENST00000588745.1_Missense_Mutation_p.G290V|SMAD4_ENST00000398417.2_Missense_Mutation_p.G386V	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	386	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		G -> D (in JP/HHT; dbSNP:rs28936393). {ECO:0000269|PubMed:15031030}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ATAGGCAAAGGTGTGCAGTTG	0.368																																							uc010xdp.1		NA																	38	Whole gene deletion(36)|Unknown(2)	p.0?(35)|p.G386R(5)|p.?(2)|p.G386C(1)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369	GRCh37	CM021284	SMAD4	M	rs121912580	c.(1156-1158)GGT>GTT		mothers against decapentaplegic homolog 4							202.0	166.0	178.0					18																	48593406		2203	4300	6503	SO:0001583	missense	4089	Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia			BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	g.chr18:48593406G>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1157G>T	18.37:g.48593406G>T	ENSP00000341551:p.Gly386Val		Somatic				SMAD4_uc002lfb.3_Missense_Mutation_p.G231V	p.G386V	NM_005359	NP_005350	WXS	Illumina HiSeq	Unspecified	Q13485	SMAD4_HUMAN		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)	10	1695	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	386			MH2.		A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	c.1157G>T	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723725	0.89298	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.99873	-7.38;-7.38	5.65	5.65	0.86999	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.046058	0.85682	D	0.000000	D	0.99910	0.9957	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96369	0.9272	10	0.87932	D	0	.	18.5072	0.90901	0.0:0.0:1.0:0.0	.	386	Q13485	SMAD4_HUMAN	V	386	ENSP00000341551:G386V;ENSP00000381452:G386V	ENSP00000341551:G386V	G	+	2	0	SMAD4	46847404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.759000	0.98931	2.662000	0.90505	0.563000	0.77884	GGT		0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359		18	68	1	0	1.55469e-16	0.00333	2.33204e-16	18	68				
TIMM44	10469	broad.mit.edu	37	19	8002966	8002966	+	Silent	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:8002966G>A	ENST00000270538.3	-	3	526	c.258C>T	c.(256-258)gaC>gaT	p.D86D		NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	86					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						TTCTGGCCTCGTCACGGAATT	0.428																																							uc002miz.2		NA																	0				ovary(1)	1						c.(256-258)GAC>GAT		translocase of inner mitochondrial membrane 44							276.0	270.0	272.0					19																	8002966		2203	4300	6503	SO:0001819	synonymous_variant	10469				protein targeting to mitochondrion	mitochondrial inner membrane presequence translocase complex|mitochondrial matrix	ATP binding|P-P-bond-hydrolysis-driven protein transmembrane transporter activity	g.chr19:8002966G>A	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.258C>T	19.37:g.8002966G>A			Somatic				TIMM44_uc002mja.2_Translation_Start_Site|TIMM44_uc010dvx.1_RNA	p.D86D	NM_006351	NP_006342	WXS	Illumina HiSeq	Unspecified	O43615	TIM44_HUMAN			3	260	-			86					A8K0R9|D6W664|Q8N193	Silent	SNP	ENST00000270538.3	37	c.258C>T	CCDS12192.1																																																																																				0.428	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3			7	174	0	0	0	0.00308	0	7	174				
CYP2A6	1548	broad.mit.edu	37	19	41349784	41349784	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:41349784G>T	ENST00000301141.5	-	9	1422	c.1402C>A	c.(1402-1404)Cct>Act	p.P468T	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	468					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ATGTCCTTAGGTGACTGGGAG	0.572																																							uc002opl.3		NA																	0				ovary(2)	2						c.(1402-1404)CCT>ACT		cytochrome P450, family 2, subfamily A,	Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)						171.0	129.0	143.0					19																	41349784		2202	4300	6502	SO:0001583	missense	1548				coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding	g.chr19:41349784G>T	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.1402C>A	19.37:g.41349784G>T	ENSP00000301141:p.Pro468Thr		Somatic					p.P468T	NM_000762	NP_000753	WXS	Illumina HiSeq	Unspecified	P11509	CP2A6_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		9	1423	-			468					A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	c.1402C>A	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	8.138	0.784609	0.16189	.	.	ENSG00000255974	ENST00000301141	T	0.69561	-0.41	2.87	1.54	0.23209	.	0.211102	0.39544	U	0.001324	T	0.46889	0.1416	N	0.17278	0.47	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.48293	-0.9048	10	0.52906	T	0.07	.	10.1031	0.42517	0.0:0.0:0.7438:0.2562	.	468	P11509	CP2A6_HUMAN	T	468	ENSP00000301141:P468T	ENSP00000301141:P468T	P	-	1	0	CYP2A6	46041624	0.199000	0.23386	0.002000	0.10522	0.094000	0.18550	2.397000	0.44477	1.327000	0.45338	0.386000	0.25728	CCT		0.572	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762		8	88	1	0	2.68362e-12	0.013537	3.98393e-12	8	88				
TEX101	83639	broad.mit.edu	37	19	43920682	43920682	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:43920682G>T	ENST00000598265.1	+	4	532	c.366G>T	c.(364-366)caG>caT	p.Q122H	TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000602198.1_Missense_Mutation_p.Q140H|TEX101_ENST00000253435.7_Missense_Mutation_p.Q140H	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	122						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				GCCTGTCTCAGTTTTGGGAGT	0.483																																							uc010xwo.1		NA																	0				ovary(1)	1						c.(364-366)CAG>CAT		testis expressed 101 isoform 2							185.0	175.0	179.0					19																	43920682		2203	4300	6503	SO:0001583	missense	83639					anchored to membrane|plasma membrane		g.chr19:43920682G>T	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.366G>T	19.37:g.43920682G>T	ENSP00000472769:p.Gln122His		Somatic				TEX101_uc002owk.2_Missense_Mutation_p.Q140H	p.Q122H	NM_001130011	NP_001123483	WXS	Illumina HiSeq	Unspecified	Q9BY14	TX101_HUMAN			4	561	+		Prostate(69;0.0199)	122					Q7L5R2|Q9BPY7	Missense_Mutation	SNP	ENST00000598265.1	37	c.366G>T	CCDS59393.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152177	0.38021	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.09817	2.94	4.26	-8.52	0.00920	.	3.393290	0.00550	N	0.000243	T	0.12944	0.0314	L	0.44542	1.39	0.09310	N	1	D;D	0.59767	0.976;0.986	P;P	0.53266	0.531;0.722	T	0.43653	-0.9378	10	0.45353	T	0.12	4.2795	3.0663	0.06215	0.5536:0.1007:0.1429:0.2028	.	122;140	Q9BY14;Q9BY14-2	TX101_HUMAN;.	H	140;135	ENSP00000253435:Q140H	ENSP00000253435:Q140H	Q	+	3	2	TEX101	48612522	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.808000	0.01732	-2.384000	0.00591	0.561000	0.74099	CAG		0.483	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451		39	181	1	0	2.54354e-34	0.009718	4.06966e-34	39	181				
SYMPK	8189	broad.mit.edu	37	19	46319250	46319250	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:46319250C>A	ENST00000245934.7	-	26	3790	c.3546G>T	c.(3544-3546)ccG>ccT	p.P1182P	RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR|RSPH6A_ENST00000221538.3_5'Flank	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1182					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAGACGGGGGCGGGCCTGGCC	0.672																																							uc002pdn.2		NA																	0				ovary(1)	1						c.(3544-3546)CCG>CCT		symplekin							7.0	9.0	8.0					19																	46319250		2118	4134	6252	SO:0001819	synonymous_variant	8189				cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding	g.chr19:46319250C>A	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3546G>T	19.37:g.46319250C>A			Somatic				RSPH6A_uc002pdm.2_5'Flank	p.P1182P	NM_004819	NP_004810	WXS	Illumina HiSeq	Unspecified	Q92797	SYMPK_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)	26	3791	-		all_neural(266;0.0299)|Ovarian(192;0.0308)	1182					O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	c.3546G>T	CCDS12676.2																																																																																				0.672	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819		4	15	1	0	2.0095e-06	0.001984	2.43166e-06	4	15				
CRX	1406	broad.mit.edu	37	19	48342874	48342874	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:48342874C>A	ENST00000221996.7	+	4	756	c.550C>A	c.(550-552)Ccg>Acg	p.P184T	CRX_ENST00000539067.1_Missense_Mutation_p.P184T|TPRX2P_ENST00000535362.1_Intron	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	184					circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		GGCCTCAGGGCCGTCTCTGAC	0.672																																					Pancreas(57;461 1196 22201 40716 47188)	Pancreas(57;461 1196 22201 40716 47188)	uc002phq.3		NA																	0				breast(1)|central_nervous_system(1)	2						c.(550-552)CCG>ACG		cone-rod homeobox protein							45.0	45.0	45.0					19																	48342874		2203	4300	6503	SO:0001583	missense	1406				organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:48342874C>A	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.550C>A	19.37:g.48342874C>A	ENSP00000221996:p.Pro184Thr		Somatic					p.P184T	NM_000554	NP_000545	WXS	Illumina HiSeq	Unspecified	O43186	CRX_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)	4	754	+		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)	184					Q0QD45	Missense_Mutation	SNP	ENST00000221996.7	37	c.550C>A	CCDS12706.1	.	.	.	.	.	.	.	.	.	.	C	5.665	0.307240	0.10733	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.85556	-2.0;-2.0	3.93	0.322	0.15888	Transcription factor Otx, C-terminal (1);	0.520751	0.14751	N	0.300606	T	0.61937	0.2387	N	0.03608	-0.345	0.09310	N	0.999992	B	0.29862	0.259	B	0.28916	0.096	T	0.53774	-0.8391	10	0.20519	T	0.43	-0.7769	5.5415	0.17041	0.0:0.6389:0.1631:0.198	.	184	O43186	CRX_HUMAN	T	184	ENSP00000221996:P184T;ENSP00000445565:P184T	ENSP00000221996:P184T	P	+	1	0	CRX	53034686	0.000000	0.05858	0.009000	0.14445	0.008000	0.06430	0.577000	0.23758	0.338000	0.23692	0.467000	0.42956	CCG		0.672	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409812.4	NM_000554		6	34	1	0	1.06961e-07	0.00308	1.40022e-07	6	34				
ZNF578	147660	broad.mit.edu	37	19	53014565	53014565	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:53014565G>A	ENST00000421239.2	+	6	1175	c.931G>A	c.(931-933)Ggt>Agt	p.G311S	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ATGTCACACTGGTGAGAAACC	0.418																																							uc002pzp.3		NA																	0					0						c.(931-933)GGT>AGT		zinc finger protein 578							104.0	107.0	106.0					19																	53014565		2203	4300	6503	SO:0001583	missense	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53014565G>A	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.931G>A	19.37:g.53014565G>A	ENSP00000459216:p.Gly311Ser		Somatic					p.G311S	NM_001099694	NP_001093164	WXS	Illumina HiSeq	Unspecified	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	6	1175	+			86					B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	c.931G>A	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	16.30	3.084506	0.55861	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.37	1.37	0.22104	.	.	.	.	.	T	0.26048	0.0635	L	0.41492	1.28	0.22827	N	0.998689	P	0.37708	0.606	B	0.37833	0.259	T	0.12218	-1.0556	7	.	.	.	.	5.0884	0.14694	0.2005:0.0:0.7995:0.0	.	311	G3V4F6	.	S	311	.	.	G	+	1	0	ZNF578	57706377	0.608000	0.26966	0.249000	0.24280	0.125000	0.20455	3.734000	0.55037	0.767000	0.33267	0.297000	0.19635	GGT		0.418	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472		3	96	0	0	0	0.004672	0	3	96				
ZNF761	388561	broad.mit.edu	37	19	53958910	53958910	+	RNA	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:53958910A>G	ENST00000454407.1	+	0	1602							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K329K(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AACCCTACAAATGTAATGAGT	0.413																																							uc010eqp.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(1)	1						c.(1147-1149)AAA>AAG		zinc finger protein 761							156.0	156.0	156.0					19																	53958910		2203	4300	6503			388561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53958910A>G	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958910A>G			Somatic				ZNF761_uc010ydy.1_Silent_p.K329K|ZNF761_uc002qbt.1_Silent_p.K329K	p.K383K	NM_001008401	NP_001008401	WXS	Illumina HiSeq	Unspecified	Q86XN6	ZN761_HUMAN		GBM - Glioblastoma multiforme(134;0.00786)	7	1607	+			383			C2H2-type 7.		Q6ZNB9	Silent	SNP	ENST00000454407.1	37	c.1149A>G																																																																																					0.413	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		5	273	0	0	0	0.001984	0	5	273				
VN1R1	57191	broad.mit.edu	37	19	57967782	57967782	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr19:57967782C>T	ENST00000321039.3	-	1	72	c.73G>A	c.(73-75)Gat>Aat	p.D25N	AC004076.9_ENST00000596831.1_Intron|AC004076.9_ENST00000415705.3_Intron	NM_020633.3	NP_065684.1	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	25					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		TCTGAAGAATCAGTAGAATAA	0.343																																							uc002qos.1		NA																	0				ovary(1)	1						c.(73-75)GAT>AAT		vomeronasal 1 receptor 1							60.0	62.0	61.0					19																	57967782		2203	4300	6503	SO:0001583	missense	57191				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr19:57967782C>T	AF255342	CCDS12951.1	19q13.4	2012-08-22	2003-01-15		ENSG00000178201	ENSG00000178201		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	13548	protein-coding gene	gene with protein product		605234	"""vomeronasal olfactory receptor, (chromosome 19) subtype I, member 1"""	VNR19I1		10973240	Standard	NM_020633		Approved	V1RL1, ZVNR1, ZVNH1	uc002qos.2	Q9GZP7		ENST00000321039.3:c.73G>A	19.37:g.57967782C>T	ENSP00000322339:p.Asp25Asn		Somatic				ZNF547_uc002qpm.3_Intron	p.D25N	NM_020633	NP_065684	WXS	Illumina HiSeq	Unspecified	Q9GZP7	VN1R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)	1	73	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)	25			Extracellular (Potential).		B3KSV5|Q7Z5H8|Q7Z5H9	Missense_Mutation	SNP	ENST00000321039.3	37	c.73G>A	CCDS12951.1	.	.	.	.	.	.	.	.	.	.	C	5.109	0.205693	0.09704	.	.	ENSG00000178201	ENST00000321039	T	0.10192	2.9	2.9	0.452	0.16634	.	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	P	0.43477	0.808	B	0.41412	0.356	T	0.24657	-1.0154	9	0.23302	T	0.38	.	1.3974	0.02264	0.2144:0.4341:0.2104:0.1411	.	25	Q9GZP7	VN1R1_HUMAN	N	25	ENSP00000322339:D25N	ENSP00000322339:D25N	D	-	1	0	VN1R1	62659594	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-1.902000	0.01596	0.063000	0.16370	0.596000	0.82720	GAT		0.343	VN1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466464.1	NM_020633		4	38	0	0	0	0.000602	0	4	38				
APOB	338	broad.mit.edu	37	2	21234526	21234526	+	Silent	SNP	G	G	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:21234526G>C	ENST00000233242.1	-	26	5341	c.5214C>G	c.(5212-5214)ctC>ctG	p.L1738L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1738					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTCATTTGAGAGCTTAAGTC	0.418																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(5212-5214)CTC>CTG		apolipoprotein B precursor	Atorvastatin(DB01076)						205.0	195.0	198.0					2																	21234526		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21234526G>C	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5214C>G	2.37:g.21234526G>C			Somatic					p.L1738L	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	5342	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1738					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.5214C>G	CCDS1703.1																																																																																				0.418	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			6	243	0	0	0	0.001984	0	6	243				
IFT172	26160	broad.mit.edu	37	2	27704107	27704107	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:27704107C>A	ENST00000260570.3	-	8	694	c.591G>T	c.(589-591)ccG>ccT	p.P197P	IFT172_ENST00000359466.6_Silent_p.P197P|IFT172_ENST00000416524.2_Silent_p.P176P	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	197					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					AGGGTGGACACGGGTGGTTAA	0.483																																							uc002rku.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(589-591)CCG>CCT		selective LIM binding factor homolog							49.0	45.0	47.0					2																	27704107		2203	4300	6503	SO:0001819	synonymous_variant	26160				cilium assembly	cilium	binding	g.chr2:27704107C>A	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.591G>T	2.37:g.27704107C>A			Somatic				IFT172_uc002rkw.2_Silent_p.P197P|IFT172_uc010yls.1_Silent_p.P176P|IFT172_uc010ezc.2_Silent_p.P197P|IFT172_uc002rkv.2_Silent_p.P197P	p.P197P	NM_015662	NP_056477	WXS	Illumina HiSeq	Unspecified	Q9UG01	IF172_HUMAN			8	642	-	Acute lymphoblastic leukemia(172;0.155)		197			WD 5.		A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	ENST00000260570.3	37	c.591G>T	CCDS1755.1																																																																																				0.483	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662		5	27	1	0	1.06961e-07	0.00308	1.40022e-07	5	27				
SRBD1	55133	broad.mit.edu	37	2	45774718	45774718	+	Missense_Mutation	SNP	T	T	A	rs35369160		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:45774718T>A	ENST00000263736.4	-	13	1771	c.1709A>T	c.(1708-1710)cAt>cTt	p.H570L	SRBD1_ENST00000535761.1_Missense_Mutation_p.H89L	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	570					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TTGTCCACAATGCAAGTAAAC	0.323																																							uc002rus.2		NA																	0				central_nervous_system(1)	1						c.(1708-1710)CAT>CTT		S1 RNA binding domain 1							65.0	64.0	64.0					2																	45774718		2203	4299	6502	SO:0001583	missense	55133				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding	g.chr2:45774718T>A	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1709A>T	2.37:g.45774718T>A	ENSP00000263736:p.His570Leu		Somatic				SRBD1_uc010yoc.1_Missense_Mutation_p.H89L	p.H570L	NM_018079	NP_060549	WXS	Illumina HiSeq	Unspecified	Q8N5C6	SRBD1_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)		13	1785	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	570					Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	c.1709A>T	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779555	0.90195	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.47177	0.85;0.85	5.54	5.54	0.83059	YqgF/RNase H-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	M	0.85462	2.755	0.58432	D	0.999995	D	0.59767	0.986	P	0.53649	0.731	T	0.72969	-0.4130	10	0.66056	D	0.02	.	15.6822	0.77381	0.0:0.0:0.0:1.0	.	570	Q8N5C6	SRBD1_HUMAN	L	570;89	ENSP00000263736:H570L;ENSP00000441272:H89L	ENSP00000263736:H570L	H	-	2	0	SRBD1	45628222	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.573000	0.67417	2.091000	0.63221	0.533000	0.62120	CAT		0.323	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079		7	36	0	0	0	0.010729	0	7	36				
SRBD1	55133	broad.mit.edu	37	2	45774723	45774723	+	Silent	SNP	G	G	A	rs369289728		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:45774723G>A	ENST00000263736.4	-	13	1766	c.1704C>T	c.(1702-1704)taC>taT	p.Y568Y	SRBD1_ENST00000535761.1_Silent_p.Y87Y	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	568					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CACAATGCAAGTAAACCACAT	0.313																																							uc002rus.2		NA																	0				central_nervous_system(1)	1						c.(1702-1704)TAC>TAT		S1 RNA binding domain 1							64.0	63.0	63.0					2																	45774723		2203	4299	6502	SO:0001819	synonymous_variant	55133				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding	g.chr2:45774723G>A	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1704C>T	2.37:g.45774723G>A			Somatic				SRBD1_uc010yoc.1_Silent_p.Y87Y	p.Y568Y	NM_018079	NP_060549	WXS	Illumina HiSeq	Unspecified	Q8N5C6	SRBD1_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)		13	1780	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	568					Q53T56|Q96TA4|Q9NW11	Silent	SNP	ENST00000263736.4	37	c.1704C>T	CCDS1823.1																																																																																				0.313	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079		7	33	0	0	0	0.010729	0	7	33				
ANTXR1	84168	broad.mit.edu	37	2	69330019	69330019	+	Missense_Mutation	SNP	G	G	A	rs373792226		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:69330019G>A	ENST00000303714.4	+	10	1071	c.749G>A	c.(748-750)cGc>cAc	p.R250H	ANTXR1_ENST00000409349.3_Missense_Mutation_p.R250H|ANTXR1_ENST00000409829.3_Missense_Mutation_p.R250H|MIR3126_ENST00000577443.1_RNA	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	250					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						CGACATGCCCGCAACGTGGAC	0.478									Familial Infantile Hemangioma																														uc002sfg.2		NA																	0				ovary(2)|skin(2)	4						c.(748-750)CGC>CAC		anthrax toxin receptor 1 isoform 1 precursor							229.0	227.0	228.0					2																	69330019		2203	4300	6503	SO:0001583	missense	84168	Familial_Infantile_Hemangioma	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity	g.chr2:69330019G>A	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.749G>A	2.37:g.69330019G>A	ENSP00000301945:p.Arg250His		Somatic				ANTXR1_uc002sfe.2_Missense_Mutation_p.R250H|ANTXR1_uc002sff.2_Missense_Mutation_p.R250H|ANTXR1_uc002sfd.2_Missense_Mutation_p.R250H|hsa-mir-3126|MI0014143_5'Flank	p.R250H	NM_032208	NP_115584	WXS	Illumina HiSeq	Unspecified	Q9H6X2	ANTR1_HUMAN			10	1105	+			250			Extracellular (Potential).		A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Missense_Mutation	SNP	ENST00000303714.4	37	c.749G>A	CCDS1892.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.432093|5.432093	0.96150|0.96150	.|.	.|.	ENSG00000169604|ENSG00000169604	ENST00000482235|ENST00000303714;ENST00000409829;ENST00000409349	.|D;D;D	.|0.87571	.|-2.27;-2.27;-2.27	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Anthrax toxin receptor, extracellular (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93324|0.93324	0.7872|0.7872	M|M	0.76574|0.76574	2.34|2.34	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D;D	.|0.89917	.|1.0;0.967;1.0;1.0	.|D;B;D;D	.|0.91635	.|0.998;0.399;0.999;0.999	D|D	0.92857|0.92857	0.6302|0.6302	5|10	.|0.56958	.|D	.|0.05	-18.6334|-18.6334	18.0718|18.0718	0.89410|0.89410	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|250;250;250;250	.|Q9H6X2;Q9H6X2-2;Q9H6X2-4;Q9H6X2-3	.|ANTR1_HUMAN;.;.;.	T|H	82|250	.|ENSP00000301945:R250H;ENSP00000387058:R250H;ENSP00000386494:R250H	.|ENSP00000301945:R250H	A|R	+|+	1|2	0|0	ANTXR1|ANTXR1	69183523|69183523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.992000|8.992000	0.93519|0.93519	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|CGC		0.478	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208		6	239	0	0	0	0.001984	0	6	239				
MRPL53	116540	broad.mit.edu	37	2	74699360	74699360	+	Silent	SNP	A	A	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:74699360A>T	ENST00000258105.7	-	3	886	c.225T>A	c.(223-225)atT>atA	p.I75I	MRPL53_ENST00000409710.1_Missense_Mutation_p.Y38N	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	75						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						CGCCGCGCATAATCAGGCGAT	0.682																																							uc002sln.2		NA																	0					0						c.(223-225)ATT>ATA		mitochondrial ribosomal protein L53 precursor							31.0	33.0	32.0					2																	74699360		2203	4299	6502	SO:0001819	synonymous_variant	116540					mitochondrion|ribosome		g.chr2:74699360A>T	BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.225T>A	2.37:g.74699360A>T			Somatic				CCDC142_uc002slo.2_RNA	p.I75I	NM_053050	NP_444278	WXS	Illumina HiSeq	Unspecified	Q96EL3	RM53_HUMAN			3	365	-			75						Silent	SNP	ENST00000258105.7	37	c.225T>A	CCDS1944.1	.	.	.	.	.	.	.	.	.	.	A	10.96	1.499559	0.26861	.	.	ENSG00000204822	ENST00000409710	T	0.58797	0.31	4.92	-9.84	0.00479	.	.	.	.	.	T	0.44393	0.1291	.	.	.	0.20307	N	0.999916	.	.	.	.	.	.	T	0.53837	-0.8382	6	0.87932	D	0	-6.361	4.4443	0.11589	0.1067:0.3609:0.3535:0.179	.	.	.	.	N	38	ENSP00000386920:Y38N	ENSP00000386920:Y38N	Y	-	1	0	MRPL53	74552868	0.018000	0.18449	0.000000	0.03702	0.939000	0.58152	-1.711000	0.01886	-3.276000	0.00198	-0.434000	0.05882	TAT		0.682	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252225.2	NM_053050		5	24	0	0	0	0.000602	0	5	24				
MRPS5	64969	broad.mit.edu	37	2	95766248	95766248	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:95766248G>A	ENST00000272418.2	-	10	1110	c.902C>T	c.(901-903)aCg>aTg	p.T301M		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	301					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						CTTGATATGCGTCCTTTTAAA	0.328																																							uc002sub.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(901-903)ACG>ATG		mitochondrial ribosomal protein S5							153.0	160.0	158.0					2																	95766248		2203	4300	6503	SO:0001583	missense	64969				translation	mitochondrion|ribosome	protein binding|RNA binding|structural constituent of ribosome	g.chr2:95766248G>A	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.902C>T	2.37:g.95766248G>A	ENSP00000272418:p.Thr301Met		Somatic				MRPS5_uc002suc.2_RNA	p.T301M	NM_031902	NP_114108	WXS	Illumina HiSeq	Unspecified	P82675	RT05_HUMAN			10	1120	-			301					Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Missense_Mutation	SNP	ENST00000272418.2	37	c.902C>T	CCDS2010.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748836	0.69533	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.89	5.89	0.94794	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5, C-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.80287	0.4595	M	0.84511	2.7	0.80722	D	1	D	0.67145	0.996	P	0.61477	0.889	T	0.82859	-0.0249	9	0.87932	D	0	-13.8301	17.7299	0.88374	0.0:0.0:1.0:0.0	.	301	P82675	RT05_HUMAN	M	301	.	ENSP00000272418:T301M	T	-	2	0	MRPS5	95129975	1.000000	0.71417	0.991000	0.47740	0.876000	0.50452	5.434000	0.66526	2.791000	0.96007	0.591000	0.81541	ACG		0.328	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902		3	46	0	0	0	0.004672	0	3	46				
SCN1A	6323	broad.mit.edu	37	2	166900521	166900521	+	Silent	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:166900521C>T	ENST00000303395.4	-	11	1700	c.1701G>A	c.(1699-1701)agG>agA	p.R567R	SCN1A_ENST00000409050.1_Silent_p.R567R|SCN1A_ENST00000423058.2_Silent_p.R567R|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000375405.3_Silent_p.R567R|AC010127.3_ENST00000595268.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	567					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTATTTCGCCTTGGTGAAA	0.418																																							uc010zcz.1		NA																	0				ovary(6)|skin(6)|large_intestine(1)	13						c.(1699-1701)AGG>AGA		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						67.0	67.0	67.0					2																	166900521		2203	4300	6503	SO:0001819	synonymous_variant	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166900521C>T	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1701G>A	2.37:g.166900521C>T			Somatic				SCN1A_uc002udo.3_Silent_p.R436R|SCN1A_uc010fpk.2_Silent_p.R436R	p.R567R	NM_006920	NP_008851	WXS	Illumina HiSeq	Unspecified	P35498	SCN1A_HUMAN			11	1719	-			567					E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	c.1701G>A	CCDS54413.1																																																																																				0.418	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		12	48	0	0	0	0.004007	0	12	48				
HAT1	8520	broad.mit.edu	37	2	172809485	172809485	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:172809485C>T	ENST00000264108.4	+	4	311	c.275C>T	c.(274-276)gCa>gTa	p.A92V	HAT1_ENST00000392584.1_Missense_Mutation_p.A7V|SLC25A12_ENST00000472748.1_Intron	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1	92					chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)			breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GTTGAATATGCATCTAAAGTT	0.323																																							uc002uhi.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(274-276)GCA>GTA		histone acetyltransferase 1							114.0	110.0	111.0					2																	172809485		2203	4300	6503	SO:0001583	missense	8520				chromatin silencing at telomere|DNA packaging	cytoplasm|nuclear matrix|nucleoplasm	histone acetyltransferase activity|protein binding	g.chr2:172809485C>T	AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.275C>T	2.37:g.172809485C>T	ENSP00000264108:p.Ala92Val		Somatic				HAT1_uc010fqi.2_Intron|HAT1_uc002uhj.2_Missense_Mutation_p.A7V	p.A92V	NM_003642	NP_003633	WXS	Illumina HiSeq	Unspecified	O14929	HAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		4	351	+			92					Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Missense_Mutation	SNP	ENST00000264108.4	37	c.275C>T	CCDS2245.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141212	0.56936	.	.	ENSG00000128708	ENST00000392584;ENST00000264108	.	.	.	4.93	4.93	0.64822	Histone acetyl transferase HAT1 N-terminal (2);Acyl-CoA N-acyltransferase (1);	0.368502	0.30781	N	0.008888	T	0.44519	0.1297	L	0.38175	1.15	0.32088	N	0.592196	B	0.12630	0.006	B	0.12837	0.008	T	0.55573	-0.8120	9	0.87932	D	0	-16.5172	13.8169	0.63297	0.0:0.8463:0.1537:0.0	.	92	O14929	HAT1_HUMAN	V	7;92	.	ENSP00000264108:A92V	A	+	2	0	HAT1	172517731	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.342000	0.65970	2.439000	0.82584	0.462000	0.41574	GCA		0.323	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255377.1	NM_003642		4	79	0	0	0	0.000602	0	4	79				
NFE2L2	4780	broad.mit.edu	37	2	178098809	178098809	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:178098809T>A	ENST00000397062.3	-	2	790	c.236A>T	c.(235-237)gAg>gTg	p.E79V	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E63V|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E63V|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E63V|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E63V	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	79					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E79G(1)|p.E79_T80insE(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTCACCTGTCTCTTCATCTAG	0.438			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																													uc002ulh.3		NA		Dom	yes		2	2q31	4780	Mis	nuclear factor (erythroid-derived 2)-like 2 (NRF2)			E			NSCLC|HNSCC		2	Insertion - In frame(1)|Substitution - Missense(1)		upper_aerodigestive_tract(1)|oesophagus(1)	central_nervous_system(1)	1						c.(235-237)GAG>GTG		nuclear factor erythroid 2-like 2 isoform 1							146.0	145.0	145.0					2																	178098809		1902	4109	6011	SO:0001583	missense	4780				transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:178098809T>A		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.236A>T	2.37:g.178098809T>A	ENSP00000380252:p.Glu79Val	HNSCC(56;0.16)	Somatic				NFE2L2_uc002ulg.3_Missense_Mutation_p.E63V|NFE2L2_uc010zfa.1_Missense_Mutation_p.E63V|NFE2L2_uc002uli.3_Missense_Mutation_p.E63V|NFE2L2_uc010fra.2_Missense_Mutation_p.E63V|NFE2L2_uc010frb.2_Missense_Mutation_p.E63V	p.E79V	NM_006164	NP_006155	WXS	Illumina HiSeq	Unspecified	Q16236	NF2L2_HUMAN	Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)		2	791	-			79					B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	c.236A>T	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	17.48	3.400109	0.62177	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.62258	0.2413	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.996;0.999;0.997	T	0.69461	-0.5139	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	63;63;63;79	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	V	63;79;63;63;63;63;63	ENSP00000380253:E63V;ENSP00000380252:E79V;ENSP00000411575:E63V;ENSP00000391590:E63V;ENSP00000400073:E63V;ENSP00000412191:E63V;ENSP00000410015:E63V	ENSP00000380252:E79V	E	-	2	0	NFE2L2	177807055	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.503000	0.81632	2.210000	0.71456	0.460000	0.39030	GAG		0.438	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164		11	50	0	0	0	0.00245	0	11	50				
TTN	7273	broad.mit.edu	37	2	179456035	179456035	+	Silent	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:179456035C>T	ENST00000591111.1	-	254	55718	c.55494G>A	c.(55492-55494)aaG>aaA	p.K18498K	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Silent_p.K11199K|TTN_ENST00000460472.2_Silent_p.K11074K|TTN_ENST00000342992.6_Silent_p.K17571K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.K11266K|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.K20139K|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18498	Ig-like 106.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAAGCAGTTCTTAATGGTAA	0.433																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(52711-52713)AAG>AAA		titin isoform N2-A							325.0	321.0	322.0					2																	179456035		1918	4134	6052	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179456035C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55494G>A	2.37:g.179456035C>T			Somatic				uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.K11266K|TTN_uc010zfi.1_Silent_p.K11199K|TTN_uc010zfj.1_Silent_p.K11074K	p.K17571K	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		253	52937	-			18498					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.52713G>A																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	402	0	0	0	0.001855	0	13	402				
FN1	2335	broad.mit.edu	37	2	216296671	216296671	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:216296671C>A	ENST00000359671.1	-	4	697	c.432G>T	c.(430-432)ggG>ggT	p.G144G	FN1_ENST00000356005.4_Silent_p.G144G|FN1_ENST00000354785.4_Silent_p.G144G|FN1_ENST00000323926.6_Silent_p.G144G|FN1_ENST00000336916.4_Silent_p.G144G|FN1_ENST00000357009.2_Silent_p.G144G|FN1_ENST00000421182.1_Silent_p.G144G|FN1_ENST00000357867.4_Silent_p.G144G|FN1_ENST00000446046.1_Silent_p.G144G|FN1_ENST00000443816.1_Silent_p.G144G|FN1_ENST00000432072.2_Silent_p.G144G|FN1_ENST00000345488.5_Silent_p.G144G|FN1_ENST00000346544.3_Silent_p.G144G|FN1_ENST00000426059.1_Silent_p.G144G			P02751	FINC_HUMAN	fibronectin 1	144	Fibrin- and heparin-binding 1.|Fibronectin type-I 3. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	AGGACTGACCCCCTTCATGGC	0.448																																							uc002vfa.2		NA																	0				central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13						c.(430-432)GGG>GGT		fibronectin 1 isoform 1 preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						185.0	162.0	170.0					2																	216296671		2203	4300	6503	SO:0001819	synonymous_variant	2335				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding	g.chr2:216296671C>A		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.432G>T	2.37:g.216296671C>A			Somatic				FN1_uc002vfb.2_Silent_p.G144G|FN1_uc002vfc.2_Silent_p.G144G|FN1_uc002vfd.2_Silent_p.G144G|FN1_uc002vfe.2_Silent_p.G144G|FN1_uc002vff.2_Silent_p.G144G|FN1_uc002vfg.2_Silent_p.G144G|FN1_uc002vfh.2_Silent_p.G144G|FN1_uc002vfi.2_Silent_p.G144G|FN1_uc002vfj.2_Silent_p.G144G|FN1_uc002vfl.2_Silent_p.G144G	p.G144G	NM_212482	NP_997647	WXS	Illumina HiSeq	Unspecified	P02751	FINC_HUMAN		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	4	698	-		Renal(323;0.127)	144			Fibrin- and heparin-binding 1.|Fibronectin type-I 3.		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37	c.432G>T																																																																																					0.448	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476		19	86	1	0	1.50039e-11	0.012319	2.18239e-11	19	86				
SPHKAP	80309	broad.mit.edu	37	2	228856017	228856017	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr2:228856017G>A	ENST00000392056.3	-	10	4793	c.4747C>T	c.(4747-4749)Ctt>Ttt	p.L1583F	SPHKAP_ENST00000344657.5_Missense_Mutation_p.L1554F	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1583						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGTCCTTTAAGAATCTTCTTT	0.413																																							uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(4747-4749)CTT>TTT		sphingosine kinase type 1-interacting protein							172.0	167.0	169.0					2																	228856017		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228856017G>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4747C>T	2.37:g.228856017G>A	ENSP00000375909:p.Leu1583Phe		Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.L1554F|SPHKAP_uc010zlx.1_Intron	p.L1583F	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	10	4794	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	1583					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.4747C>T	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385604	0.61956	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.13420	2.59;2.71	6.17	4.29	0.51040	.	0.374619	0.26582	N	0.023567	T	0.26991	0.0661	L	0.57536	1.79	0.30891	N	0.730294	B;D	0.65815	0.203;0.995	B;P	0.61800	0.148;0.894	T	0.12041	-1.0563	10	0.59425	D	0.04	.	9.012	0.36146	0.0737:0.0:0.7802:0.146	.	1583;1554	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	F	1583;1554	ENSP00000375909:L1583F;ENSP00000339886:L1554F	ENSP00000339886:L1554F	L	-	1	0	SPHKAP	228564261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.200000	0.42724	1.626000	0.50381	0.655000	0.94253	CTT		0.413	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		8	84	0	0	0	0.004482	0	8	84				
ADAM33	80332	broad.mit.edu	37	20	3651739	3651739	+	Silent	SNP	G	G	A	rs535922941		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr20:3651739G>A	ENST00000356518.2	-	19	2395	c.2154C>T	c.(2152-2154)gcC>gcT	p.A718A	ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000379861.4_Silent_p.A718A|ADAM33_ENST00000350009.2_Silent_p.A692A	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	718					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						AGGCCAGGCCGGCCCCTGGGA	0.677													G|||	1	0.000199681	0.0	0.0	5008	,	,		19003	0.0		0.001	False		,,,				2504	0.0						uc002wit.2		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(2152-2154)GCC>GCT		ADAM metallopeptidase domain 33 isoform alpha							20.0	24.0	22.0					20																	3651739		2194	4295	6489	SO:0001819	synonymous_variant	80332				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr20:3651739G>A	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.2154C>T	20.37:g.3651739G>A			Somatic				ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Silent_p.A718A|ADAM33_uc002wis.2_Silent_p.A214A|ADAM33_uc002wiu.2_Silent_p.A692A|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_RNA	p.A718A	NM_025220	NP_079496	WXS	Illumina HiSeq	Unspecified	Q9BZ11	ADA33_HUMAN			19	2241	-			718			Helical; (Potential).		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	37	c.2154C>T	CCDS13058.1																																																																																				0.677	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		3	7	0	0	0	0.004672	0	3	7				
CFAP61	26074	broad.mit.edu	37	20	20172016	20172016	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr20:20172016G>A	ENST00000245957.5	+	15	1619	c.1543G>A	c.(1543-1545)Gaa>Aaa	p.E515K	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		515										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		ATTTGTAGCTGAAGTTGCAGA	0.343																																							uc002wru.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1543-1545)GAA>AAA		hypothetical protein LOC26074							124.0	117.0	120.0					20																	20172016		2203	4300	6503	SO:0001583	missense	26074							g.chr20:20172016G>A																												ENST00000245957.5:c.1543G>A	20.37:g.20172016G>A	ENSP00000245957:p.Glu515Lys		Somatic				C20orf26_uc010zse.1_Missense_Mutation_p.E495K	p.E515K	NM_015585	NP_056400	WXS	Illumina HiSeq	Unspecified	Q8NHU2	CT026_HUMAN		READ - Rectum adenocarcinoma(2;0.171)	15	1619	+			515					A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	c.1543G>A	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985311	0.74474	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.50277	0.75	5.81	4.74	0.60224	.	0.461775	0.22658	N	0.057227	T	0.45377	0.1339	M	0.72894	2.215	0.80722	D	1	P;P	0.47762	0.9;0.763	B;B	0.42112	0.376;0.311	T	0.40213	-0.9575	10	0.14252	T	0.57	.	10.9055	0.47078	0.106:0.0:0.894:0.0	.	495;515	F8W6K4;Q8NHU2	.;CT026_HUMAN	K	455;495;515	ENSP00000245957:E515K	ENSP00000245957:E515K	E	+	1	0	C20orf26	20120016	0.999000	0.42202	0.695000	0.30226	0.977000	0.68977	2.947000	0.49058	1.201000	0.43203	0.650000	0.86243	GAA		0.343	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			14	78	0	0	0	0.008871	0	14	78				
MROH8	140699	broad.mit.edu	37	20	35769666	35769666	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr20:35769666T>C	ENST00000400441.3	-	12	1386	c.1387A>G	c.(1387-1389)Aca>Gca	p.T463A	MROH8_ENST00000441008.2_Missense_Mutation_p.T449A|MROH8_ENST00000217333.8_Intron			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	348								p.T463A(1)									GTATCAAATGTAGTCATTATA	0.378																																							uc010zvu.1		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(1417-1419)ACA>GCA		hypothetical protein LOC140699 isoform 1							90.0	78.0	82.0					20																	35769666		1851	4090	5941	SO:0001583	missense	140699							g.chr20:35769666T>C	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1387A>G	20.37:g.35769666T>C	ENSP00000383291:p.Thr463Ala		Somatic				C20orf132_uc002xgk.2_Intron|C20orf132_uc002xgm.2_Missense_Mutation_p.T473A|C20orf132_uc002xgn.2_Missense_Mutation_p.T438A	p.T473A	NM_152503	NP_689716	WXS	Illumina HiSeq	Unspecified	Q9H579	CT132_HUMAN			14	1508	-		Myeloproliferative disorder(115;0.00878)	348					Q5JYQ6	Missense_Mutation	SNP	ENST00000400441.3	37	c.1417A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.049|0.049	-1.256731|-1.256731	0.01457|0.01457	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441|ENST00000421643	T;T|.	0.65732|.	-0.17;3.45|.	6.01|6.01	3.5|3.5	0.40072|0.40072	.|.	0.909402|.	0.09506|.	N|.	0.792969|.	T|T	0.33294|0.33294	0.0858|0.0858	L|L	0.35414|0.35414	1.06|1.06	0.09310|0.09310	N|N	1|1	B;P;P|.	0.37207|.	0.131;0.587;0.587|.	B;B;B|.	0.36464|.	0.058;0.225;0.225|.	T|T	0.20405|0.20405	-1.0276|-1.0276	10|5	0.10636|.	T|.	0.68|.	-8.7897|-8.7897	7.0144|7.0144	0.24881|0.24881	0.0:0.2169:0.0:0.7831|0.0:0.2169:0.0:0.7831	.|.	463;348;473|.	E7ETR9;Q9H579;Q6PF12|.	.;CT132_HUMAN;.|.	A|C	449;463|464	ENSP00000392144:T449A;ENSP00000383291:T463A|.	ENSP00000383291:T463A|.	T|Y	-|-	1|2	0|0	C20orf132|C20orf132	35203080|35203080	0.011000|0.011000	0.17503|0.17503	0.026000|0.026000	0.17262|0.17262	0.223000|0.223000	0.24884|0.24884	0.233000|0.233000	0.17911|0.17911	0.388000|0.388000	0.25054|0.25054	0.533000|0.533000	0.62120|0.62120	ACA|TAC		0.378	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503		4	5	0	0	0	0.000602	0	4	5				
CDH4	1002	broad.mit.edu	37	20	60504878	60504878	+	Silent	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr20:60504878C>T	ENST00000360469.5	+	13	2305	c.2217C>T	c.(2215-2217)ctC>ctT	p.L739L	CDH4_ENST00000543233.1_Silent_p.L665L	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	739					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TGGCCATCCTCATCTGCATCC	0.622																																							uc002ybn.1		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(2215-2217)CTC>CTT		cadherin 4, type 1 preproprotein							90.0	72.0	78.0					20																	60504878		2203	4300	6503	SO:0001819	synonymous_variant	1002				adherens junction organization|cell junction assembly		calcium ion binding	g.chr20:60504878C>T	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.2217C>T	20.37:g.60504878C>T			Somatic				CDH4_uc002ybp.1_Silent_p.L665L	p.L739L	NM_001794	NP_001785	WXS	Illumina HiSeq	Unspecified	P55283	CADH4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.36e-08)		13	2231	+			739			Helical; (Potential).		B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	ENST00000360469.5	37	c.2217C>T	CCDS13488.1																																																																																				0.622	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794		18	62	0	0	0	0.012319	0	18	62				
MRAP	56246	broad.mit.edu	37	21	33684278	33684278	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr21:33684278G>A	ENST00000399784.2	+	5	677	c.490G>A	c.(490-492)Gga>Aga	p.G164R	MRAP_ENST00000303645.5_Missense_Mutation_p.G164R|MRAP_ENST00000497833.1_3'UTR|MRAP_ENST00000399786.3_Intron|MRAP_ENST00000339944.4_Intron|URB1_ENST00000382751.3_3'UTR	NM_178817.3	NP_848932.1	Q8TCY5	MRAP_HUMAN	melanocortin 2 receptor accessory protein	164					brown fat cell differentiation (GO:0050873)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			endometrium(1)|large_intestine(2)|lung(3)	6						GCCTCCCCCTGGAGACAGGAC	0.582																																							uc002ypj.2		NA																	0					0						c.(490-492)GGA>AGA		melanocortin 2 receptor accessory protein							49.0	47.0	48.0					21																	33684278		2203	4289	6492	SO:0001583	missense	56246				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding	g.chr21:33684278G>A	AF454915	CCDS13612.1, CCDS13613.1	21q22.1	2005-10-30	2005-02-01	2005-02-07	ENSG00000170262	ENSG00000170262			1304	protein-coding gene	gene with protein product		609196	"""chromosome 21 open reading frame 61"""	C21orf61		12036298, 15654338	Standard	NM_178817		Approved	B27, FALP	uc002ypj.3	Q8TCY5	OTTHUMG00000085309	ENST00000399784.2:c.490G>A	21.37:g.33684278G>A	ENSP00000382684:p.Gly164Arg		Somatic				MRAP_uc002ypk.2_Intron|URB1_uc002ypn.2_3'UTR|MRAP_uc011ado.1_Missense_Mutation_p.G105R|MRAP_uc002ypl.2_Missense_Mutation_p.G164R	p.G164R	NM_178817	NP_848932	WXS	Illumina HiSeq	Unspecified	Q8TCY5	MRAP_HUMAN			5	677	+			164			Extracellular (Potential).		Q5EBR3|Q8TDB7|Q8WXC1|Q8WXC2	Missense_Mutation	SNP	ENST00000399784.2	37	c.490G>A	CCDS13613.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.555749	0.45487	.	.	ENSG00000170262	ENST00000399784;ENST00000303645	D;D	0.85484	-1.99;-1.99	4.22	-0.887	0.10587	.	1.564480	0.04758	N	0.425759	T	0.74566	0.3733	N	0.22421	0.69	0.09310	N	1	B	0.13594	0.008	B	0.16289	0.015	T	0.60326	-0.7285	10	0.87932	D	0	3.3088	4.2926	0.10886	0.3907:0.1645:0.4448:0.0	.	164	Q8TCY5	MRAP_HUMAN	R	164	ENSP00000382684:G164R;ENSP00000306697:G164R	ENSP00000306697:G164R	G	+	1	0	MRAP	32606149	0.005000	0.15991	0.000000	0.03702	0.003000	0.03518	1.632000	0.37102	-0.301000	0.08882	-0.258000	0.10820	GGA		0.582	MRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000193092.1	NM_178817		15	59	0	0	0	0.007413	0	15	59				
SCN10A	6336	broad.mit.edu	37	3	38763897	38763897	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:38763897A>T	ENST00000449082.2	-	19	3358	c.3359T>A	c.(3358-3360)aTt>aAt	p.I1120N		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1120					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	ACAGTGGCGAATGCATCCTGT	0.562																																							uc003ciq.2		NA																	0				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(3358-3360)ATT>AAT		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						150.0	133.0	138.0					3																	38763897		2203	4300	6503	SO:0001583	missense	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38763897A>T	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3359T>A	3.37:g.38763897A>T	ENSP00000390600:p.Ile1120Asn		Somatic					p.I1120N	NM_006514	NP_006505	WXS	Illumina HiSeq	Unspecified	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	19	3359	-			1120					A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	c.3359T>A	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	A	14.29	2.491091	0.44249	.	.	ENSG00000185313	ENST00000449082	D	0.84070	-1.8	4.27	3.12	0.35913	Sodium ion transport-associated (1);	0.857811	0.10454	N	0.672767	T	0.80984	0.4729	M	0.64404	1.975	0.09310	N	1	B	0.32467	0.372	B	0.35607	0.206	T	0.71826	-0.4475	10	0.87932	D	0	.	7.5383	0.27723	0.7449:0.0:0.2551:0.0	.	1120	Q9Y5Y9	SCNAA_HUMAN	N	1120	ENSP00000390600:I1120N	ENSP00000390600:I1120N	I	-	2	0	SCN10A	38738901	0.001000	0.12720	0.415000	0.26534	0.897000	0.52465	1.799000	0.38824	0.715000	0.32103	0.459000	0.35465	ATT		0.562	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		29	177	0	0	0	0.00623	0	29	177				
LTF	4057	broad.mit.edu	37	3	46486797	46486797	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:46486797G>T	ENST00000231751.4	-	12	1783	c.1488C>A	c.(1486-1488)ttC>ttA	p.F496L	LTF_ENST00000417439.1_Missense_Mutation_p.F494L|LTF_ENST00000426532.2_Missense_Mutation_p.F452L	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	496	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		CCGTCTGGTTGAAGAGCAGGC	0.567																																							uc003cpq.2		NA																	0				central_nervous_system(2)|ovary(1)|lung(1)	4						c.(1486-1488)TTC>TTA		lactotransferrin precursor	Pefloxacin(DB00487)						70.0	70.0	70.0					3																	46486797		2203	4296	6499	SO:0001583	missense	4057				cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity	g.chr3:46486797G>T		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1488C>A	3.37:g.46486797G>T	ENSP00000231751:p.Phe496Leu		Somatic				LTF_uc003fzr.2_Missense_Mutation_p.F452L|LTF_uc010hjh.2_Missense_Mutation_p.F494L|LTF_uc003cpr.2_Missense_Mutation_p.F483L	p.F496L	NM_002343	NP_002334	WXS	Illumina HiSeq	Unspecified	P02788	TRFL_HUMAN		all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	12	1526	-			496			Transferrin-like 2.		A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	c.1488C>A	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.286033	0.40394	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	4.95	3.08	0.35506	.	0.859052	0.10824	N	0.630165	T	0.12561	0.0305	N	0.04373	-0.215	0.25582	N	0.986782	B;B;B	0.11235	0.0;0.004;0.002	B;B;B	0.12837	0.007;0.008;0.007	T	0.29761	-1.0001	10	0.33940	T	0.23	0.2587	8.8968	0.35470	0.0848:0.1499:0.7653:0.0	.	494;483;496	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	L	496;452;494;483	ENSP00000231751:F496L;ENSP00000405719:F452L;ENSP00000405546:F494L;ENSP00000397427:F483L	ENSP00000231751:F496L	F	-	3	2	LTF	46461801	0.970000	0.33590	0.520000	0.27837	0.931000	0.56810	2.135000	0.42112	0.567000	0.29293	0.655000	0.94253	TTC		0.567	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343		6	96	1	0	0.000157383	0.00308	0.000177056	6	96				
SETD2	29072	broad.mit.edu	37	3	47103738	47103738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:47103738G>A	ENST00000409792.3	-	14	6250	c.6208C>T	c.(6208-6210)Caa>Taa	p.Q2070*	SETD2_ENST00000492397.1_5'UTR	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2070					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTTTATTTTGAGTTTGCTTG	0.493			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(6208-6210)CAA>TAA		SET domain containing 2							312.0	306.0	308.0					3																	47103738		2203	4300	6503	SO:0001587	stop_gained	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47103738G>A	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6208C>T	3.37:g.47103738G>A	ENSP00000386759:p.Gln2070*		Somatic				SETD2_uc003cqv.2_Nonsense_Mutation_p.Q2137*|SETD2_uc003cqt.1_RNA	p.Q2070*	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	14	6261	-		Acute lymphoblastic leukemia(5;0.0169)	2070					O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	c.6208C>T	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	45	11.332138	0.99547	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	4.58	4.58	0.56647	.	0.312393	0.23025	N	0.052819	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	17.9089	0.88928	0.0:0.0:1.0:0.0	.	.	.	.	X	2070	.	ENSP00000386759:Q2070X	Q	-	1	0	SETD2	47078742	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.630000	0.61297	2.532000	0.85374	0.455000	0.32223	CAA		0.493	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		29	168	0	0	0	0.010818	0	29	168				
SETD2	29072	broad.mit.edu	37	3	47158197	47158197	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:47158197C>G	ENST00000409792.3	-	4	4544	c.4502G>C	c.(4501-4503)tGt>tCt	p.C1501S		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1501	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAGAGGTGTACACTCACACTG	0.318			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(4501-4503)TGT>TCT		SET domain containing 2							114.0	110.0	111.0					3																	47158197		2203	4300	6503	SO:0001583	missense	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47158197C>G	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4502G>C	3.37:g.47158197C>G	ENSP00000386759:p.Cys1501Ser		Somatic				SETD2_uc003cqv.2_Missense_Mutation_p.C1490S	p.C1501S	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	4	4555	-		Acute lymphoblastic leukemia(5;0.0169)	1501			AWS.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	c.4502G>C	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973314	0.92919	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.85411	-1.98	5.93	5.93	0.95920	AWS (2);	0.000000	0.64402	D	0.000007	D	0.95538	0.8550	H	0.96691	3.865	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	D	0.96291	0.9214	10	0.87932	D	0	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	1501;1501	F2Z317;Q9BYW2	.;SETD2_HUMAN	S	1501	ENSP00000386759:C1501S	ENSP00000386759:C1501S	C	-	2	0	SETD2	47133201	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.794000	0.85869	2.814000	0.96858	0.591000	0.81541	TGT		0.318	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		16	71	0	0	0	0.00499	0	16	71				
MAP4	4134	broad.mit.edu	37	3	47958225	47958225	+	Silent	SNP	T	T	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:47958225T>C	ENST00000360240.6	-	7	1610	c.1092A>G	c.(1090-1092)ttA>ttG	p.L364L	MAP4_ENST00000383737.4_Intron|MAP4_ENST00000426837.2_Silent_p.L381L|MAP4_ENST00000395734.3_Silent_p.L364L	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	364	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.L364L(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TGGAAGGGGCTAAGTCCATTT	0.478																																							uc003csb.2		NA																	2	Substitution - coding silent(2)		kidney(2)	ovary(2)|pancreas(1)	3						c.(1090-1092)TTA>TTG		microtubule-associated protein 4 isoform 1							179.0	179.0	179.0					3																	47958225		2203	4300	6503	SO:0001819	synonymous_variant	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47958225T>C		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1092A>G	3.37:g.47958225T>C			Somatic				MAP4_uc003csc.3_Silent_p.L364L|MAP4_uc011bbf.1_Silent_p.L341L|MAP4_uc003csf.3_Silent_p.L381L	p.L364L	NM_002375	NP_002366	WXS	Illumina HiSeq	Unspecified	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	1618	-			364			26 residues 1.|17 X 14 AA tandem repeats.		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	37	c.1092A>G	CCDS33750.1																																																																																				0.478	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		3	155	0	0	0	0.004672	0	3	155				
HYAL3	8372	broad.mit.edu	37	3	50332964	50332964	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:50332964G>T	ENST00000336307.1	-	2	342	c.70C>A	c.(70-72)Cca>Aca	p.P24T	HYAL3_ENST00000415204.1_Intron|IFRD2_ENST00000336089.4_5'Flank|HYAL3_ENST00000359051.3_Missense_Mutation_p.P24T|HYAL3_ENST00000450982.1_Missense_Mutation_p.P24T|IFRD2_ENST00000436390.1_5'Flank|HYAL3_ENST00000513170.1_Intron|IFRD2_ENST00000417626.2_5'Flank	NM_001200029.1|NM_003549.3	NP_001186958.1|NP_003540.2	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3	24					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)|response to virus (GO:0009615)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|lysosome (GO:0005764)	hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(5)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGGACCTGTGGTAGGGGCTGG	0.627																																							uc003czd.1		NA																	0				ovary(1)	1						c.(70-72)CCA>ACA		hyaluronoglucosaminidase 3 precursor							36.0	36.0	36.0					3																	50332964		2168	4204	6372	SO:0001583	missense	8372				carbohydrate metabolic process	extracellular region|lysosome	hyalurononglucosaminidase activity	g.chr3:50332964G>T	AF040710	CCDS2815.1, CCDS56259.1, CCDS56260.1, CCDS56257.1	3p21.3	2004-03-12			ENSG00000186792	ENSG00000186792			5322	protein-coding gene	gene with protein product		604038				10493834	Standard	NM_003549		Approved	LUCA-3, LUCA14, Minna14	uc021wyn.1	O43820	OTTHUMG00000156936	ENST00000336307.1:c.70C>A	3.37:g.50332964G>T	ENSP00000337425:p.Pro24Thr		Somatic				HYAL3_uc003czc.1_Missense_Mutation_p.P24T|HYAL3_uc003cze.1_Intron|HYAL3_uc003czf.1_Intron|HYAL3_uc003czg.1_Missense_Mutation_p.P24T	p.P24T	NM_003549	NP_003540	WXS	Illumina HiSeq	Unspecified	O43820	HYAL3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	2	343	-			24					O60540|Q8NFK2|Q8NFK3|Q8NFK4|Q96E56|Q9BRW9	Missense_Mutation	SNP	ENST00000336307.1	37	c.70C>A	CCDS2815.1	.	.	.	.	.	.	.	.	.	.	G	4.729	0.135557	0.09032	.	.	ENSG00000186792	ENST00000359051;ENST00000336307;ENST00000450982;ENST00000435141	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	4.67	1.6	0.23607	Aldolase-type TIM barrel (1);	0.399650	0.24695	U	0.036349	T	0.21022	0.0506	M	0.64676	1.99	0.09310	N	1	B;B	0.31413	0.322;0.275	B;B	0.28553	0.091;0.055	T	0.17471	-1.0368	10	0.56958	D	0.05	0.0074	4.3989	0.11376	0.2128:0.3665:0.4206:0.0	.	24;24	O43820;O43820-2	HYAL3_HUMAN;.	T	24	ENSP00000351946:P24T;ENSP00000337425:P24T;ENSP00000391922:P24T;ENSP00000391663:P24T	ENSP00000337425:P24T	P	-	1	0	HYAL3	50307968	0.002000	0.14202	0.001000	0.08648	0.012000	0.07955	1.223000	0.32527	0.575000	0.29434	0.650000	0.86243	CCA		0.627	HYAL3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000346664.1	NM_003549		9	40	1	0	0.000274275	0.004482	0.000306168	9	40				
TEX264	51368	broad.mit.edu	37	3	51718507	51718507	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:51718507G>T	ENST00000415259.1	+	3	1418	c.337G>T	c.(337-339)Gac>Tac	p.D113Y	TEX264_ENST00000457573.1_Missense_Mutation_p.D113Y|TEX264_ENST00000395057.1_Missense_Mutation_p.D113Y|TEX264_ENST00000463857.1_3'UTR|TEX264_ENST00000416589.1_Missense_Mutation_p.D113Y|TEX264_ENST00000341333.5_Missense_Mutation_p.D113Y			Q9Y6I9	TX264_HUMAN	testis expressed 264	113						extracellular vesicular exosome (GO:0070062)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		TGAGCTCATCGACCTCTACCA	0.582																																							uc010hls.2		NA																	0					0						c.(337-339)GAC>TAC		testis expressed 264 precursor							71.0	58.0	63.0					3																	51718507		2203	4300	6503	SO:0001583	missense	51368					extracellular region		g.chr3:51718507G>T	AF072733	CCDS2833.1, CCDS74945.1	3p21	2007-03-13	2007-03-13		ENSG00000164081	ENSG00000164081			30247	protein-coding gene	gene with protein product			"""testis expressed gene 264"", ""testis expressed sequence 264"""			12975309	Standard	NM_001243725		Approved	ZSIG11, FLJ13935	uc003dbm.4	Q9Y6I9	OTTHUMG00000156901	ENST00000415259.1:c.337G>T	3.37:g.51718507G>T	ENSP00000396628:p.Asp113Tyr		Somatic				TEX264_uc003dbk.3_Missense_Mutation_p.D113Y|TEX264_uc010hlt.2_5'UTR|TEX264_uc003dbl.3_Missense_Mutation_p.D113Y|TEX264_uc003dbm.3_Missense_Mutation_p.D152Y	p.D113Y	NM_001129884	NP_001123356	WXS	Illumina HiSeq	Unspecified	Q9Y6I9	TX264_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)	4	506	+			113					B3KN87|Q9UKD7	Missense_Mutation	SNP	ENST00000415259.1	37	c.337G>T	CCDS2833.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817507	0.32145	.	.	ENSG00000164081	ENST00000457573;ENST00000341333;ENST00000412249;ENST00000425781;ENST00000415259;ENST00000395057;ENST00000416589;ENST00000457927;ENST00000444233	T;T;T;T;T;T;T;T;T	0.02472	4.28;4.28;4.28;4.28;4.28;4.28;4.28;4.28;4.28	4.45	2.61	0.31194	Regulatory factor, effector, bacterial (1);	1.191870	0.05851	N	0.621161	T	0.02767	0.0083	N	0.22421	0.69	0.19575	N	0.999968	B;B	0.25850	0.136;0.058	B;B	0.30179	0.112;0.071	T	0.46652	-0.9176	10	0.62326	D	0.03	-11.2531	2.2693	0.04086	0.3125:0.4238:0.1613:0.1024	.	113;113	Q53GI2;Q9Y6I9	.;TX264_HUMAN	Y	113	ENSP00000408186:D113Y;ENSP00000340969:D113Y;ENSP00000393736:D113Y;ENSP00000405783:D113Y;ENSP00000396628:D113Y;ENSP00000378497:D113Y;ENSP00000398802:D113Y;ENSP00000407151:D113Y;ENSP00000415957:D113Y	ENSP00000340969:D113Y	D	+	1	0	TEX264	51693547	0.515000	0.26210	0.963000	0.40424	0.741000	0.42261	1.076000	0.30729	0.831000	0.34780	0.305000	0.20034	GAC		0.582	TEX264-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346530.1	NM_015926		11	47	1	0	7.03913e-09	0.013537	9.47322e-09	11	47				
CACNA2D3	55799	broad.mit.edu	37	3	54919551	54919551	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr3:54919551G>A	ENST00000474759.1	+	23	2042	c.1994G>A	c.(1993-1995)cGc>cAc	p.R665H	CACNA2D3-AS1_ENST00000471265.1_RNA|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.R665H|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.R571H|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.R665H	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	665						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	CCTGAGCACCGCCATCTGTCT	0.473																																							uc003dhf.2		NA																	0				large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7						c.(1993-1995)CGC>CAC		calcium channel, voltage-dependent, alpha							101.0	97.0	98.0					3																	54919551		2079	4233	6312	SO:0001583	missense	55799					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr3:54919551G>A	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1994G>A	3.37:g.54919551G>A	ENSP00000419101:p.Arg665His		Somatic				CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Missense_Mutation_p.R571H|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_Missense_Mutation_p.R399H|uc003dhk.1_Intron	p.R665H	NM_018398	NP_060868	WXS	Illumina HiSeq	Unspecified	Q8IZS8	CA2D3_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	23	2042	+			665			Extracellular (Potential).		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	37	c.1994G>A	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351068	0.95830	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.7	5.7	0.88788	.	0.057793	0.64402	D	0.000001	T	0.64811	0.2632	M	0.85630	2.765	0.58432	D	0.999999	D	0.89917	1.0	D	0.67725	0.953	T	0.69105	-0.5233	10	0.66056	D	0.02	-2.0293	18.0149	0.89236	0.0:0.0:1.0:0.0	.	665	Q8IZS8	CA2D3_HUMAN	H	665;665;665;571;571	ENSP00000389506:R665H;ENSP00000419101:R665H;ENSP00000288197:R665H;ENSP00000417279:R571H	ENSP00000288197:R665H	R	+	2	0	CACNA2D3	54894591	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	6.271000	0.72569	2.696000	0.92011	0.561000	0.74099	CGC		0.473	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1			7	25	0	0	0	0.008291	0	7	25				
ZNF595	152687	broad.mit.edu	37	4	86669	86669	+	3'UTR	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:86669G>A	ENST00000339368.6	+	0	1478							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		AACCCTACACGTGCGAAGAAT	0.393																																							uc003fzv.1		NA																	0					0						c.(1273-1275)ACG>ACA		zinc finger protein 595							33.0	36.0	35.0					4																	86669		2135	4274	6409	SO:0001624	3_prime_UTR_variant	152687				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr4:86669G>A	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*1475G>A	4.37:g.86669G>A			Somatic				ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_Silent_p.T193T|ZNF595_uc011but.1_Silent_p.T193T	p.T425T	NM_182524	NP_872330	WXS	Illumina HiSeq	Unspecified	Q7Z3I0	Q7Z3I0_HUMAN		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)	6	1431	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	425						Silent	SNP	ENST00000339368.6	37	c.1275G>A																																																																																					0.393	ZNF595-001	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000357814.2	NM_182524		3	39	0	0	0	0.004672	0	3	39				
ZNF595	152687	broad.mit.edu	37	4	86672	86672	+	3'UTR	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:86672C>T	ENST00000339368.6	+	0	1481							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CCTACACGTGCGAAGAATGTG	0.388																																							uc003fzv.1		NA																	0					0						c.(1276-1278)TGC>TGT		zinc finger protein 595							32.0	35.0	34.0					4																	86672		2133	4273	6406	SO:0001624	3_prime_UTR_variant	152687				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr4:86672C>T	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*1478C>T	4.37:g.86672C>T			Somatic				ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_Silent_p.C194C|ZNF595_uc011but.1_Silent_p.C194C	p.C426C	NM_182524	NP_872330	WXS	Illumina HiSeq	Unspecified	Q7Z3I0	Q7Z3I0_HUMAN		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)	6	1434	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	426						Silent	SNP	ENST00000339368.6	37	c.1278C>T																																																																																					0.388	ZNF595-001	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000357814.2	NM_182524		3	42	0	0	0	0.004672	0	3	42				
ZBTB49	166793	broad.mit.edu	37	4	4322915	4322915	+	Missense_Mutation	SNP	G	G	T	rs145779018		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:4322915G>T	ENST00000337872.4	+	8	2291	c.2170G>T	c.(2170-2172)Ggt>Tgt	p.G724C	ZBTB49_ENST00000355834.3_Missense_Mutation_p.G602C|ZBTB49_ENST00000538529.1_Missense_Mutation_p.G207C|RP11-265O12.1_ENST00000509015.1_lincRNA	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	724					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CAACCACGGCGGTGACCCCCT	0.587																																							uc003ghu.2		NA																	0				ovary(1)|skin(1)	2						c.(2170-2172)GGT>TGT		zinc finger protein 509							54.0	52.0	53.0					4																	4322915		2203	4300	6503	SO:0001583	missense	166793				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:4322915G>T	AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.2170G>T	4.37:g.4322915G>T	ENSP00000338807:p.Gly724Cys		Somatic				uc003ghw.2_5'Flank|ZBTB49_uc003ghv.2_Missense_Mutation_p.G207C|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_Missense_Mutation_p.G302C	p.G724C	NM_145291	NP_660334	WXS	Illumina HiSeq	Unspecified	Q6ZSB9	ZBT49_HUMAN			8	2345	+			724					Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	c.2170G>T	CCDS3375.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861481	0.32884	.	.	ENSG00000168826	ENST00000355834;ENST00000337872;ENST00000538529	T;T;T	0.14516	2.5;2.84;3.16	4.73	-8.0	0.01126	.	1.373470	0.04853	N	0.442701	T	0.12390	0.0301	L	0.44542	1.39	0.09310	N	1	P;P	0.49253	0.921;0.65	B;B	0.44108	0.441;0.256	T	0.40478	-0.9561	10	0.54805	T	0.06	.	8.9818	0.35970	0.4893:0.1695:0.3412:0.0	.	602;724	Q6ZSB9-2;Q6ZSB9	.;ZBT49_HUMAN	C	602;724;207	ENSP00000348091:G602C;ENSP00000338807:G724C;ENSP00000445653:G207C	ENSP00000338807:G724C	G	+	1	0	ZBTB49	4373816	0.000000	0.05858	0.004000	0.12327	0.470000	0.32858	-1.364000	0.02590	-1.096000	0.03046	-0.300000	0.09419	GGT		0.587	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291		6	35	1	0	0.00116845	0.001168	0.00126508	6	35				
MOB1B	92597	broad.mit.edu	37	4	71824700	71824700	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:71824700C>T	ENST00000309395.2	+	2	325	c.124C>T	c.(124-126)Cgg>Tgg	p.R42W	MOB1B_ENST00000511449.1_3'UTR|MOB1B_ENST00000396051.2_Missense_Mutation_p.R47W	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	42					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)										TGGCAACCTTCGGATGGCTGT	0.433																																							uc003hfw.2		NA																	0					0						c.(124-126)CGG>TGG		MOB1, Mps One Binder kinase activator-like 1A							111.0	107.0	108.0					4																	71824700		2203	4300	6503	SO:0001583	missense	92597				hippo signaling cascade|protein autophosphorylation	cytoplasm|nucleus	kinase activator activity|kinase binding|metal ion binding	g.chr4:71824700C>T	BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.124C>T	4.37:g.71824700C>T	ENSP00000310189:p.Arg42Trp		Somatic				MOBKL1A_uc003hfv.1_Missense_Mutation_p.R42W|MOBKL1A_uc011cba.1_Missense_Mutation_p.R47W	p.R42W	NM_173468	NP_775739	WXS	Illumina HiSeq	Unspecified	Q7L9L4	MOL1A_HUMAN	Lung(101;0.235)		2	314	+		all_hematologic(202;0.21)	42					B2R8U6|B4DRY3|Q8IY23	Missense_Mutation	SNP	ENST00000309395.2	37	c.124C>T	CCDS34002.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194287	0.78902	.	.	ENSG00000173542	ENST00000502869;ENST00000309395;ENST00000396051	.	.	.	6.0	3.19	0.36642	.	0.000000	0.85682	D	0.000000	D	0.86247	0.5887	H	0.94423	3.535	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.986;0.979;0.992	D	0.90630	0.4566	9	0.87932	D	0	-45.2562	16.4337	0.83864	0.5123:0.4877:0.0:0.0	.	47;42;42	B4DRY3;Q7L9L4;B3KSH6	.;MOB1B_HUMAN;.	W	47;42;47	.	ENSP00000310189:R42W	R	+	1	2	MOBKL1A	72043564	0.833000	0.29383	1.000000	0.80357	0.992000	0.81027	1.674000	0.37544	0.817000	0.34445	0.650000	0.86243	CGG		0.433	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362634.1	NM_173468		10	28	0	0	0	0.013537	0	10	28				
MFAP3L	9848	broad.mit.edu	37	4	170913125	170913125	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:170913125T>A	ENST00000361618.3	-	3	941	c.634A>T	c.(634-636)Acc>Tcc	p.T212S	MFAP3L_ENST00000393704.3_Missense_Mutation_p.T109S|RP11-6E9.4_ENST00000508955.1_RNA	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		TTGGCGGAGGTGATGATGGGG	0.532																																							uc003isp.3		NA																	0				ovary(1)	1						c.(634-636)ACC>TCC		microfibrillar-associated protein 3-like isoform							120.0	126.0	124.0					4																	170913125		2203	4300	6503	SO:0001583	missense	9848					integral to membrane|plasma membrane		g.chr4:170913125T>A	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.634A>T	4.37:g.170913125T>A	ENSP00000354583:p.Thr212Ser		Somatic				MFAP3L_uc003isn.3_Missense_Mutation_p.T109S	p.T212S	NM_021647	NP_067679	WXS	Illumina HiSeq	Unspecified	O75121	MFA3L_HUMAN		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)	3	812	-		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)	212			Cytoplasmic (Potential).		A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	ENST00000361618.3	37	c.634A>T	CCDS34103.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203784	0.79127	.	.	ENSG00000198948	ENST00000393704;ENST00000361618;ENST00000512698	D;D;D	0.99089	-5.41;-2.59;-5.06	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.98988	0.9655	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99852	1.1073	10	0.33141	T	0.24	-25.3067	15.6799	0.77360	0.0:0.0:0.0:1.0	.	212	O75121	MFA3L_HUMAN	S	109;212;109	ENSP00000377307:T109S;ENSP00000354583:T212S;ENSP00000422791:T109S	ENSP00000354583:T212S	T	-	1	0	MFAP3L	171149700	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	8.040000	0.89188	2.104000	0.64026	0.454000	0.30748	ACC		0.532	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647		11	55	0	0	0	0.010729	0	11	55				
VEGFC	7424	broad.mit.edu	37	4	177648996	177648996	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:177648996C>A	ENST00000280193.2	-	3	903	c.488G>T	c.(487-489)gGg>gTg	p.G163V	VEGFC_ENST00000507638.1_5'UTR	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	163					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		GCAGCAACCCCCACATCTGTA	0.547																																							uc003ius.1		NA																	0				lung(5)	5						c.(487-489)GGG>GTG		vascular endothelial growth factor C							118.0	122.0	121.0					4																	177648996		2027	4186	6213	SO:0001583	missense	7424				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity	g.chr4:177648996C>A	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.488G>T	4.37:g.177648996C>A	ENSP00000280193:p.Gly163Val		Somatic					p.G163V	NM_005429	NP_005420	WXS	Illumina HiSeq	Unspecified	P49767	VEGFC_HUMAN		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)	3	918	-		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)	163					B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	c.488G>T	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893061	0.91889	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.72	5.72	0.89469	Platelet-derived growth factor, conserved site (1);Platelet-derived growth factor (PDGF) (3);	0.000000	0.85682	D	0.000000	D	0.86606	0.5973	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88470	0.3061	9	0.87932	D	0	-15.0544	20.2406	0.98372	0.0:1.0:0.0:0.0	.	163	P49767	VEGFC_HUMAN	V	163	.	ENSP00000280193:G163V	G	-	2	0	VEGFC	177885990	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.857000	0.98124	0.650000	0.86243	GGG		0.547	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429		20	109	1	0	1.87028e-06	0.012319	2.28238e-06	20	109				
SPEF2	79925	broad.mit.edu	37	5	35793372	35793372	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:35793372G>C	ENST00000356031.3	+	32	4820	c.4666G>C	c.(4666-4668)Gag>Cag	p.E1556Q	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Missense_Mutation_p.E353Q|SPEF2_ENST00000440995.2_Missense_Mutation_p.E1551Q	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1556					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGAGCTCCTTGAGACCCTTCA	0.483																																							uc003jjo.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(4666-4668)GAG>CAG		KPL2 protein isoform 1							98.0	95.0	96.0					5																	35793372		1953	4159	6112	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35793372G>C	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4666G>C	5.37:g.35793372G>C	ENSP00000348314:p.Glu1556Gln		Somatic				SPEF2_uc003jjp.1_Missense_Mutation_p.E1042Q|SPEF2_uc003jjr.2_Missense_Mutation_p.E611Q	p.E1556Q	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		32	4777	+	all_lung(31;7.56e-05)		1556					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.4666G>C	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454088	0.43634	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	T;T;T	0.66995	-0.24;-0.24;-0.24	5.88	5.01	0.66863	.	0.830295	0.11369	N	0.571138	T	0.68879	0.3049	L	0.54323	1.7	0.19300	N	0.999978	P;D;P	0.56746	0.675;0.977;0.883	B;P;B	0.51016	0.208;0.656;0.274	T	0.56589	-0.7954	10	0.25106	T	0.35	.	10.8556	0.46798	0.1448:0.0:0.8552:0.0	.	353;1551;1556	Q9C093-4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	Q	1556;1551;353	ENSP00000348314:E1556Q;ENSP00000412125:E1551Q;ENSP00000303843:E353Q	ENSP00000303843:E353Q	E	+	1	0	SPEF2	35829129	0.016000	0.18221	0.849000	0.33467	0.854000	0.48673	0.085000	0.14912	1.497000	0.48584	0.655000	0.94253	GAG		0.483	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		13	77	0	0	0	0.003163	0	13	77				
PRRC1	133619	broad.mit.edu	37	5	126874745	126874745	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:126874745G>A	ENST00000296666.8	+	7	1123	c.935G>A	c.(934-936)cGg>cAg	p.R312Q	PRRC1_ENST00000442138.2_Missense_Mutation_p.R312Q|PRRC1_ENST00000512635.2_Missense_Mutation_p.R312Q	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	312						Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		GCTCAGGAACGGATAGATAGC	0.373																																							uc003kuk.2		NA																	0					0						c.(934-936)CGG>CAG		proline-rich coiled-coil 1							113.0	113.0	113.0					5																	126874745		2203	4299	6502	SO:0001583	missense	133619					Golgi apparatus		g.chr5:126874745G>A	AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.935G>A	5.37:g.126874745G>A	ENSP00000296666:p.Arg312Gln		Somatic				PRRC1_uc003kuj.3_Missense_Mutation_p.R312Q	p.R312Q	NM_130809	NP_570721	WXS	Illumina HiSeq	Unspecified	Q96M27	PRRC1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)	7	1115	+		Prostate(80;0.165)	312					Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	ENST00000296666.8	37	c.935G>A	CCDS4143.1	.	.	.	.	.	.	.	.	.	.	G	35	5.591717	0.96590	.	.	ENSG00000164244	ENST00000296666;ENST00000442138;ENST00000330542;ENST00000512635;ENST00000512535	.	.	.	4.98	4.98	0.66077	.	0.055769	0.64402	D	0.000001	T	0.77363	0.4119	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.68943	0.898;0.961	T	0.79240	-0.1885	9	0.72032	D	0.01	-13.5618	17.7895	0.88547	0.0:0.0:1.0:0.0	.	312;312	Q96M27;Q96M27-5	PRRC1_HUMAN;.	Q	312	.	ENSP00000296666:R312Q	R	+	2	0	PRRC1	126902644	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.486000	0.97944	2.752000	0.94435	0.467000	0.42956	CGG		0.373	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250971.3	NM_130809		6	83	0	0	0	0.001984	0	6	83				
AFF4	27125	broad.mit.edu	37	5	132232334	132232334	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:132232334G>A	ENST00000265343.5	-	11	2367	c.1988C>T	c.(1987-1989)tCa>tTa	p.S663L	AFF4_ENST00000378595.3_Missense_Mutation_p.S663L	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	663					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGAGTTTGTGAGGAAGGAGG	0.428																																					Ovarian(126;889 1733 2942 10745 11605)	Ovarian(126;889 1733 2942 10745 11605)	uc003kyd.2		NA																	0				ovary(2)|kidney(2)|skin(1)	5						c.(1987-1989)TCA>TTA		ALL1 fused gene from 5q31							74.0	73.0	74.0					5																	132232334		2203	4300	6503	SO:0001583	missense	27125				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr5:132232334G>A	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.1988C>T	5.37:g.132232334G>A	ENSP00000265343:p.Ser663Leu		Somatic				AFF4_uc011cxk.1_Missense_Mutation_p.S341L|AFF4_uc003kye.1_Missense_Mutation_p.S663L	p.S663L	NM_014423	NP_055238	WXS	Illumina HiSeq	Unspecified	Q9UHB7	AFF4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		11	2396	-		all_cancers(142;0.145)|Breast(839;0.198)	663					B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	c.1988C>T	CCDS4164.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439003	0.83885	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.66099	-0.19;-0.19	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.78375	0.4273	M	0.66939	2.045	0.80722	D	1	D;D	0.67145	0.996;0.991	D;D	0.78314	0.99;0.991	T	0.78104	-0.2334	10	0.48119	T	0.1	-7.1353	19.1844	0.93637	0.0:0.0:1.0:0.0	.	663;663	Q9UHB7-2;Q9UHB7	.;AFF4_HUMAN	L	663	ENSP00000265343:S663L;ENSP00000367858:S663L	ENSP00000265343:S663L	S	-	2	0	AFF4	132260233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.112000	0.94314	2.580000	0.87095	0.563000	0.77884	TCA		0.428	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423		17	66	0	0	0	0.010504	0	17	66				
PCDHB3	56132	broad.mit.edu	37	5	140480999	140480999	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:140480999C>T	ENST00000231130.2	+	1	766	c.766C>T	c.(766-768)Ccc>Tcc	p.P256S	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	256	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAGAATACCCCCGTTAACTC	0.428																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(766-768)CCC>TCC		protocadherin beta 3 precursor							71.0	78.0	76.0					5																	140480999		2203	4300	6503	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140480999C>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.766C>T	5.37:g.140480999C>T	ENSP00000231130:p.Pro256Ser		Somatic				uc003lin.2_Intron	p.P256S	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	766	+			256			Extracellular (Potential).|Cadherin 3.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.766C>T	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	9.853	1.194179	0.22037	.	.	ENSG00000113205	ENST00000231130	T	0.54279	0.58	4.93	2.03	0.26663	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.49184	0.1542	M	0.72576	2.205	0.36735	D	0.881915	P	0.38535	0.635	B	0.40940	0.344	T	0.52808	-0.8526	9	0.62326	D	0.03	.	3.9398	0.09321	0.1338:0.5881:0.1297:0.1483	.	256	Q9Y5E6	PCDB3_HUMAN	S	256	ENSP00000231130:P256S	ENSP00000231130:P256S	P	+	1	0	PCDHB3	140461183	0.000000	0.05858	0.633000	0.29310	0.076000	0.17211	0.190000	0.17057	0.177000	0.19895	-0.136000	0.14681	CCC		0.428	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		9	99	0	0	0	0.010729	0	9	99				
PCDHB16	57717	broad.mit.edu	37	5	140563505	140563505	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:140563505C>A	ENST00000361016.2	+	1	2526	c.1371C>A	c.(1369-1371)acC>acA	p.T457T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	457	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTCCTACACCCTGTTCGTCC	0.567																																							uc003liv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1369-1371)ACC>ACA		protocadherin beta 16 precursor							111.0	106.0	108.0					5																	140563505		2203	4300	6503	SO:0001819	synonymous_variant	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140563505C>A	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1371C>A	5.37:g.140563505C>A			Somatic				PCDHB16_uc010jfw.1_Silent_p.T129T	p.T457T	NM_020957	NP_066008	WXS	Illumina HiSeq	Unspecified	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2526	+			457			Extracellular (Potential).|Cadherin 5.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	c.1371C>A	CCDS4251.1																																																																																				0.567	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		27	157	1	0	6.97489e-18	0.004878	1.05725e-17	27	157				
PCDHB13	56123	broad.mit.edu	37	5	140594640	140594640	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:140594640C>A	ENST00000341948.4	+	1	1132	c.945C>A	c.(943-945)tcC>tcA	p.S315S		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	315	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACTTCAGTCCTATGAAGTCA	0.388																																							uc003lja.1		NA																	0				skin(2)|ovary(1)	3						c.(943-945)TCC>TCA		protocadherin beta 13 precursor							119.0	122.0	121.0					5																	140594640		2203	4300	6503	SO:0001819	synonymous_variant	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140594640C>A	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.945C>A	5.37:g.140594640C>A			Somatic					p.S315S	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1132	+			315			Cadherin 3.|Extracellular (Potential).		A8K9V6	Silent	SNP	ENST00000341948.4	37	c.945C>A	CCDS4255.1																																																																																				0.388	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		9	100	1	0	2.61681e-11	0.00245	3.76821e-11	9	100				
FAT2	2196	broad.mit.edu	37	5	150920132	150920132	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:150920132G>T	ENST00000261800.5	-	10	9047	c.9035C>A	c.(9034-9036)tCa>tAa	p.S3012*		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3012	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCACCTGTGAACACTGTGG	0.532																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(9034-9036)TCA>TAA		FAT tumor suppressor 2 precursor							69.0	60.0	63.0					5																	150920132		2203	4300	6503	SO:0001587	stop_gained	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150920132G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9035C>A	5.37:g.150920132G>T	ENSP00000261800:p.Ser3012*		Somatic				GM2A_uc011dcs.1_Intron	p.S3012*	NM_001447	NP_001438	WXS	Illumina HiSeq	Unspecified	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		10	9048	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	3012			Extracellular (Potential).|Cadherin 27.		O75091|Q9NSR7	Nonsense_Mutation	SNP	ENST00000261800.5	37	c.9035C>A	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	50	16.968924	0.99876	.	.	ENSG00000086570	ENST00000261800	.	.	.	4.94	4.01	0.46588	.	0.817339	0.10552	N	0.661401	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	7.3734	0.26815	0.0:0.2459:0.4879:0.2662	.	.	.	.	X	3012	.	ENSP00000261800:S3012X	S	-	2	0	FAT2	150900325	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.639000	0.46570	2.286000	0.76751	0.462000	0.41574	TCA		0.532	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		4	26	1	0	0.00909568	0.009096	0.00956042	4	26				
IL12B	3593	broad.mit.edu	37	5	158743806	158743806	+	Missense_Mutation	SNP	C	C	A	rs150030340		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:158743806C>A	ENST00000231228.2	-	7	1329	c.874G>T	c.(874-876)Gac>Tac	p.D292Y	RNU4ATAC2P_ENST00000408674.1_RNA	NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	292	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)			cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAGGTCTTGTCCGTGAAGACT	0.512											OREG0016989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003lxr.1		NA																	0					0						c.(874-876)GAC>TAC		interleukin 12B precursor		C	TYR/ASP	0,4406		0,0,2203	93.0	86.0	88.0		874	6.0	0.2	5	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	no	missense	IL12B	NM_002187.2	160	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging	292/329	158743806	1,13005	2203	4300	6503	SO:0001583	missense	3593				cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity	g.chr5:158743806C>A	M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.874G>T	5.37:g.158743806C>A	ENSP00000231228:p.Asp292Tyr		Somatic	OREG0016989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1796		p.D292Y	NM_002187	NP_002178	WXS	Illumina HiSeq	Unspecified	P29460	IL12B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		7	916	-	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	292			Fibronectin type-III.			Missense_Mutation	SNP	ENST00000231228.2	37	c.874G>T	CCDS4346.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.864809	0.71949	0.0	1.16E-4	ENSG00000113302	ENST00000231228	T	0.48522	0.81	6.03	6.03	0.97812	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.403279	0.30392	N	0.009726	T	0.52709	0.1751	M	0.86028	2.79	0.27706	N	0.945626	P	0.50617	0.937	B	0.38056	0.264	T	0.64833	-0.6314	10	0.72032	D	0.01	-3.5683	16.0569	0.80812	0.0:1.0:0.0:0.0	.	292	P29460	IL12B_HUMAN	Y	292	ENSP00000231228:D292Y	ENSP00000231228:D292Y	D	-	1	0	IL12B	158676384	0.225000	0.23685	0.180000	0.23079	0.205000	0.24178	2.170000	0.42443	2.861000	0.98227	0.655000	0.94253	GAC		0.512	IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	NM_002187		12	65	1	0	2.23348e-06	0.004007	2.68018e-06	12	65				
HIST1H2BG	8339	broad.mit.edu	37	6	26216578	26216578	+	Silent	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr6:26216578G>A	ENST00000244601.3	-	1	294	c.294C>T	c.(292-294)gcC>gcT	p.A98A	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	98					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				GCAGACGCACGGCGGTCTGGA	0.572																																							uc003ngz.2		NA																	0				ovary(1)	1						c.(292-294)GCC>GCT		histone cluster 1, H2bg							92.0	92.0	92.0					6																	26216578		2203	4300	6503	SO:0001819	synonymous_variant	8339				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26216578G>A	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.294C>T	6.37:g.26216578G>A			Somatic				HIST1H2AE_uc003nha.1_5'Flank	p.A98A	NM_003518	NP_003509	WXS	Illumina HiSeq	Unspecified	P62807	H2B1C_HUMAN			1	295	-		all_hematologic(11;0.196)	98					P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000244601.3	37	c.294C>T	CCDS4594.1																																																																																				0.572	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518		4	121	0	0	0	0.001168	0	4	121				
KHDC3L	154288	broad.mit.edu	37	6	74073285	74073285	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr6:74073285G>C	ENST00000370367.3	+	3	409	c.356G>C	c.(355-357)gGa>gCa	p.G119A		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	119							RNA binding (GO:0003723)										CCAGGCTCAGGAAAGGCCCTC	0.617																																							uc003pgt.3		NA																	0				skin(2)	2						c.(355-357)GGA>GCA		hypothetical protein LOC154288							31.0	35.0	33.0					6																	74073285		2202	4298	6500	SO:0001583	missense	154288							g.chr6:74073285G>C	AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.356G>C	6.37:g.74073285G>C	ENSP00000359392:p.Gly119Ala		Somatic					p.G119A	NM_001017361	NP_001017361	WXS	Illumina HiSeq	Unspecified	Q587J8	ECAT1_HUMAN			3	409	+			119					B2RNW7	Missense_Mutation	SNP	ENST00000370367.3	37	c.356G>C	CCDS34484.1	.	.	.	.	.	.	.	.	.	.	G	4.734	0.136495	0.09032	.	.	ENSG00000203908	ENST00000370367	T	0.42900	0.96	3.2	0.687	0.18020	.	2.666020	0.01630	N	0.023471	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	B	0.22346	0.068	B	0.17433	0.018	T	0.10989	-1.0606	10	0.05721	T	0.95	-1.3427	2.2412	0.04020	0.5635:0.0:0.1481:0.2884	.	119	Q587J8	ECAT1_HUMAN	A	119	ENSP00000359392:G119A	ENSP00000359392:G119A	G	+	2	0	C6orf221	74130006	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.044000	0.13992	0.127000	0.18452	-0.302000	0.09304	GGA		0.617	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041202.3	NM_001017361		8	58	0	0	0	0.008291	0	8	58				
FRK	2444	broad.mit.edu	37	6	116264242	116264242	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr6:116264242A>G	ENST00000606080.1	-	7	1693	c.1247T>C	c.(1246-1248)gTa>gCa	p.V416A	FRK_ENST00000538210.1_Missense_Mutation_p.V274A	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	416	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	AAATGACCATACATCGGACTT	0.398																																							uc003pwi.1		NA																	0				ovary(3)|lung(3)	6						c.(1246-1248)GTA>GCA		fyn-related kinase							93.0	83.0	86.0					6																	116264242		2203	4300	6503	SO:0001583	missense	2444				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr6:116264242A>G	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1247T>C	6.37:g.116264242A>G	ENSP00000476145:p.Val416Ala		Somatic					p.V416A	NM_002031	NP_002022	WXS	Illumina HiSeq	Unspecified	P42685	FRK_HUMAN		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	7	1694	-		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)	416			Protein kinase.		B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	c.1247T>C	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221231	0.79464	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	D;D	0.88124	-2.34;-2.34	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000036	D	0.94598	0.8259	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95928	0.8936	10	0.87932	D	0	.	15.8128	0.78578	1.0:0.0:0.0:0.0	.	416	P42685	FRK_HUMAN	A	416;274	ENSP00000357615:V416A;ENSP00000443075:V274A	ENSP00000357615:V416A	V	-	2	0	FRK	116370935	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.339000	0.96797	2.140000	0.66376	0.482000	0.46254	GTA		0.398	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031		5	55	0	0	0	0.001168	0	5	55				
GRM1	2911	broad.mit.edu	37	6	146351216	146351216	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr6:146351216C>A	ENST00000282753.1	+	1	798	c.563C>A	c.(562-564)aCa>aAa	p.T188K	GRM1_ENST00000492807.2_Missense_Mutation_p.T188K|GRM1_ENST00000355289.4_Missense_Mutation_p.T188K|GRM1_ENST00000392299.2_Missense_Mutation_p.T188K|GRM1_ENST00000507907.1_Missense_Mutation_p.T188K|GRM1_ENST00000361719.2_Missense_Mutation_p.T188K			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	188	Glutamate binding. {ECO:0000305}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TATTCAGCCACAAGCATCGAC	0.522																																							uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(562-564)ACA>AAA		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						90.0	91.0	91.0					6																	146351216		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146351216C>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.563C>A	6.37:g.146351216C>A	ENSP00000282753:p.Thr188Lys		Somatic				GRM1_uc010khu.1_Missense_Mutation_p.T188K|GRM1_uc010khv.1_Missense_Mutation_p.T188K|GRM1_uc003qll.2_Missense_Mutation_p.T188K|GRM1_uc011edz.1_Missense_Mutation_p.T188K|GRM1_uc011eea.1_Missense_Mutation_p.T188K	p.T188K	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	2	1033	+		Ovarian(120;0.0387)	188			Extracellular (Potential).	Glutamate (By similarity).	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.563C>A	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352723	0.82132	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-2.52	5.69	5.69	0.88448	GPCR, family 3, conserved site (1);Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.95875	0.8657	M	0.93197	3.39	0.80722	D	1	D;P;D;D	0.64830	0.993;0.919;0.994;0.993	D;P;D;D	0.71414	0.954;0.686;0.973;0.954	D	0.96369	0.9272	10	0.87932	D	0	.	19.3962	0.94608	0.0:1.0:0.0:0.0	.	188;188;183;188	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	K	188	ENSP00000354896:T188K;ENSP00000376119:T188K;ENSP00000424095:T188K;ENSP00000282753:T188K;ENSP00000347437:T188K;ENSP00000425599:T188K	ENSP00000282753:T188K	T	+	2	0	GRM1	146392909	1.000000	0.71417	0.686000	0.30086	0.782000	0.44232	7.818000	0.86416	2.679000	0.91253	0.561000	0.74099	ACA		0.522	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		6	124	1	0	0.00307968	0.00308	0.00328499	6	124				
KATNA1	11104	broad.mit.edu	37	6	149944338	149944338	+	Silent	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr6:149944338G>A	ENST00000335647.5	-	3	446	c.402C>T	c.(400-402)gtC>gtT	p.V134V	KATNA1_ENST00000335643.8_Silent_p.V134V|KATNA1_ENST00000367411.2_Silent_p.V134V|KATNA1_ENST00000494504.1_5'Flank					katanin p60 (ATPase containing) subunit A 1											endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		GGTGAACTCTGACAGTTGTAC	0.423																																							uc003qmr.1		NA																	0				skin(1)	1						c.(400-402)GTC>GTT		katanin p60 subunit A 1							219.0	168.0	186.0					6																	149944338		2203	4300	6503	SO:0001819	synonymous_variant	11104				cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity	g.chr6:149944338G>A	AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.402C>T	6.37:g.149944338G>A			Somatic				KATNA1_uc003qms.2_Silent_p.V134V|KATNA1_uc003qmt.2_Silent_p.V134V|KATNA1_uc011eed.1_Silent_p.V134V	p.V134V	NM_007044	NP_008975	WXS	Illumina HiSeq	Unspecified	O75449	KTNA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)	3	447	-		Ovarian(120;0.0164)	134			Interaction with microtubule.			Silent	SNP	ENST00000335647.5	37	c.402C>T	CCDS5217.1																																																																																				0.423	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044		6	83	0	0	0	0.00308	0	6	83				
BZW2	28969	broad.mit.edu	37	7	16744259	16744259	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:16744259A>G	ENST00000433922.2	+	11	1374	c.1196A>G	c.(1195-1197)aAg>aGg	p.K399R	BZW2_ENST00000407633.1_Missense_Mutation_p.K205R|BZW2_ENST00000258761.3_Missense_Mutation_p.K399R|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000405202.1_Missense_Mutation_p.K323R	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	399	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		GACCAGATGAAGAAATTTGTT	0.328																																							uc003stl.2		NA																	0				ovary(2)	2						c.(1195-1197)AAG>AGG		basic leucine zipper and W2 domains 2							105.0	108.0	107.0					7																	16744259		2203	4300	6503	SO:0001583	missense	28969				cell differentiation|nervous system development|RNA metabolic process		protein binding	g.chr7:16744259A>G	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.1196A>G	7.37:g.16744259A>G	ENSP00000397249:p.Lys399Arg		Somatic				BZW2_uc003stm.2_Missense_Mutation_p.K205R|BZW2_uc003stj.2_Missense_Mutation_p.K399R|BZW2_uc003stk.2_Missense_Mutation_p.K323R|BZW2_uc003stp.2_Missense_Mutation_p.K247R|BZW2_uc010kua.2_Intron	p.K399R	NM_001159767	NP_001153239	WXS	Illumina HiSeq	Unspecified	Q9Y6E2	BZW2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.199)	11	1374	+	Lung NSC(10;0.0367)|all_lung(11;0.0837)		399			W2.		A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	ENST00000433922.2	37	c.1196A>G	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334560	0.81801	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000405202;ENST00000407633	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	5.92	4.75	0.60458	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	D	0.88865	0.6553	M	0.66506	2.035	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.87228	0.2258	10	0.36615	T	0.2	-19.2748	12.394	0.55374	0.8737:0.0:0.0:0.1263	.	399	Q9Y6E2	BZW2_HUMAN	R	399;399;399;323;205	ENSP00000403481:K399R;ENSP00000258761:K399R;ENSP00000397249:K399R;ENSP00000385577:K323R;ENSP00000384617:K205R	ENSP00000258761:K399R	K	+	2	0	BZW2	16710784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.022000	0.39626	0.528000	0.53228	AAG		0.328	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038		12	40	0	0	0	0.001855	0	12	40				
FZD9	8326	broad.mit.edu	37	7	72849738	72849738	+	Silent	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:72849738C>A	ENST00000344575.3	+	1	1630	c.1401C>A	c.(1399-1401)gtC>gtA	p.V467V		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	467					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTTGCTATGTCTACGAACGCC	0.642																																					Pancreas(144;909 1878 36867 38226 39554)	Pancreas(144;909 1878 36867 38226 39554)	uc003tyb.2		NA																	0				central_nervous_system(1)	1						c.(1399-1401)GTC>GTA		frizzled 9 precursor							62.0	61.0	62.0					7																	72849738		2202	4300	6502	SO:0001819	synonymous_variant	8326				B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding	g.chr7:72849738C>A	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1401C>A	7.37:g.72849738C>A			Somatic					p.V467V	NM_003508	NP_003499	WXS	Illumina HiSeq	Unspecified	O00144	FZD9_HUMAN			1	1630	+		Lung NSC(55;0.0659)|all_lung(88;0.152)	467			Helical; Name=6; (Potential).			Silent	SNP	ENST00000344575.3	37	c.1401C>A	CCDS5548.1																																																																																				0.642	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252120.1			5	20	1	0	8.12818e-05	0.001984	9.21621e-05	5	20				
TBL2	26608	broad.mit.edu	37	7	72988330	72988330	+	Silent	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:72988330G>A	ENST00000305632.5	-	3	625	c.384C>T	c.(382-384)cgC>cgT	p.R128R	TBL2_ENST00000432538.1_Silent_p.R92R|TBL2_ENST00000459913.1_5'UTR|TBL2_ENST00000452475.1_Silent_p.R128R	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	128							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTCTCATGCTGCGGTGCTCTC	0.602																																							uc003tyh.2		NA																	0					0						c.(382-384)CGC>CGT		transducin (beta)-like 2							155.0	114.0	128.0					7																	72988330		2203	4300	6503	SO:0001819	synonymous_variant	26608							g.chr7:72988330G>A	AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638		"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842				9860302, 10575226	Standard	XM_006715923		Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.384C>T	7.37:g.72988330G>A			Somatic				TBL2_uc011kex.1_Silent_p.R92R|TBL2_uc010lbg.2_Silent_p.R33R|TBL2_uc003tyi.2_5'UTR|TBL2_uc011key.1_5'UTR|TBL2_uc010lbh.2_Silent_p.R33R	p.R128R	NM_012453	NP_036585	WXS	Illumina HiSeq	Unspecified	Q9Y4P3	TBL2_HUMAN			3	518	-		Lung NSC(55;0.0659)|all_lung(88;0.152)	128					Q9UQE2	Silent	SNP	ENST00000305632.5	37	c.384C>T	CCDS5551.1																																																																																				0.602	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252233.3	NM_012453		18	79	0	0	0	0.012319	0	18	79				
SEMA3C	10512	broad.mit.edu	37	7	80374432	80374432	+	Silent	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:80374432G>A	ENST00000265361.3	-	18	2595	c.2034C>T	c.(2032-2034)acC>acT	p.T678T	SEMA3C_ENST00000544525.1_Silent_p.T696T|SEMA3C_ENST00000419255.2_Silent_p.T678T	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	678					axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGCTGGCCCAGGTCCATGGGG	0.463																																							uc003uhj.2		NA																	0				ovary(1)	1						c.(2032-2034)ACC>ACT		semaphorin 3C precursor							98.0	88.0	91.0					7																	80374432		2203	4300	6503	SO:0001819	synonymous_variant	10512				immune response|response to drug	membrane	receptor activity	g.chr7:80374432G>A	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.2034C>T	7.37:g.80374432G>A			Somatic				SEMA3C_uc011kgw.1_Silent_p.T696T	p.T678T	NM_006379	NP_006370	WXS	Illumina HiSeq	Unspecified	Q99985	SEM3C_HUMAN			18	2596	-			678					B4DRL8	Silent	SNP	ENST00000265361.3	37	c.2034C>T	CCDS5596.1																																																																																				0.463	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379		16	63	0	0	0	0.00499	0	16	63				
DYNC1I1	1780	broad.mit.edu	37	7	95625311	95625311	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:95625311G>T	ENST00000324972.6	+	10	1139	c.946G>T	c.(946-948)Gaa>Taa	p.E316*	DYNC1I1_ENST00000437599.1_Nonsense_Mutation_p.E296*|DYNC1I1_ENST00000359388.4_Nonsense_Mutation_p.E279*|DYNC1I1_ENST00000457059.1_Nonsense_Mutation_p.E299*|DYNC1I1_ENST00000447467.2_Nonsense_Mutation_p.E299*|DYNC1I1_ENST00000537881.1_Nonsense_Mutation_p.E279*	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	316					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGCTCCCCATGAACCAGATGG	0.428																																							uc003uoc.3		NA																	0				ovary(3)|kidney(1)	4						c.(946-948)GAA>TAA		dynein, cytoplasmic 1, intermediate chain 1							229.0	204.0	213.0					7																	95625311		2203	4300	6503	SO:0001587	stop_gained	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95625311G>T	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.946G>T	7.37:g.95625311G>T	ENSP00000320130:p.Glu316*		Somatic				DYNC1I1_uc003uod.3_Nonsense_Mutation_p.E299*|DYNC1I1_uc003uob.2_Nonsense_Mutation_p.E279*|DYNC1I1_uc003uoe.3_Nonsense_Mutation_p.E296*|DYNC1I1_uc010lfl.2_Nonsense_Mutation_p.E305*	p.E316*	NM_004411	NP_004402	WXS	Illumina HiSeq	Unspecified	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		10	1223	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		316			WD 1.		B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Nonsense_Mutation	SNP	ENST00000324972.6	37	c.946G>T	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	38	6.927179	0.97940	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-24.8338	18.6224	0.91326	0.0:0.0:1.0:0.0	.	.	.	.	X	299;316;279;296;279;299	.	ENSP00000320130:E316X	E	+	1	0	DYNC1I1	95463247	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.657000	0.98554	2.717000	0.92951	0.655000	0.94253	GAA		0.428	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		8	131	1	0	0.00307968	0.00308	0.00328499	8	131				
RELN	5649	broad.mit.edu	37	7	103138348	103138348	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:103138348C>T	ENST00000428762.1	-	55	9028	c.8869G>A	c.(8869-8871)Ggt>Agt	p.G2957S	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.G2957S|RELN_ENST00000343529.5_Missense_Mutation_p.G2957S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2957					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTCTCACTACCGATGCGCCCC	0.468																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(8869-8871)GGT>AGT		reelin isoform a							117.0	90.0	99.0					7																	103138348		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103138348C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.8869G>A	7.37:g.103138348C>T	ENSP00000392423:p.Gly2957Ser		Somatic				RELN_uc010liz.2_Missense_Mutation_p.G2957S	p.G2957S	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	55	9029	-			2957					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.8869G>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	36	5.612826	0.96637	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.31247	1.5;1.5;1.5	5.89	5.89	0.94794	Neuraminidase (3);	0.000000	0.85682	D	0.000000	T	0.60779	0.2295	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.979	T	0.62248	-0.6894	10	0.87932	D	0	.	20.2618	0.98447	0.0:1.0:0.0:0.0	.	2957;2957	P78509-2;P78509	.;RELN_HUMAN	S	2957;2957;2957;474;2957	ENSP00000392423:G2957S;ENSP00000345694:G2957S;ENSP00000388446:G2957S	ENSP00000345694:G2957S	G	-	1	0	RELN	102925584	1.000000	0.71417	0.999000	0.59377	0.903000	0.53119	7.270000	0.78493	2.793000	0.96121	0.655000	0.94253	GGT		0.468	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		5	69	0	0	0	0.000602	0	5	69				
PTK2B	2185	broad.mit.edu	37	8	27289812	27289812	+	Silent	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr8:27289812C>T	ENST00000397501.1	+	15	1729	c.921C>T	c.(919-921)tcC>tcT	p.S307S	PTK2B_ENST00000420218.2_Silent_p.S307S|PTK2B_ENST00000517339.1_Silent_p.S307S|PTK2B_ENST00000338238.4_Silent_p.S307S|PTK2B_ENST00000346049.5_Silent_p.S307S|PTK2B_ENST00000544172.1_Silent_p.S307S|PTK2B_ENST00000397497.4_Silent_p.S53S	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	307	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	AGATCAGGTCCATCAGGTGCC	0.617																																							uc003xfn.1		NA																	0				lung(3)|ovary(1)|skin(1)	5						c.(919-921)TCC>TCT		PTK2B protein tyrosine kinase 2 beta isoform a							48.0	43.0	44.0					8																	27289812		2203	4300	6503	SO:0001819	synonymous_variant	2185				apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity	g.chr8:27289812C>T	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.921C>T	8.37:g.27289812C>T			Somatic				PTK2B_uc003xfo.1_Silent_p.S307S|PTK2B_uc003xfp.1_Silent_p.S307S|PTK2B_uc003xfq.1_Silent_p.S307S|PTK2B_uc010luq.1_Silent_p.S78S|PTK2B_uc003xfr.1_Silent_p.S53S	p.S307S	NM_173174	NP_775266	WXS	Illumina HiSeq	Unspecified	Q14289	FAK2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	15	1729	+		Ovarian(32;2.72e-05)	307			FERM.		D3DST0|Q13475|Q14290|Q16709|Q6PID4	Silent	SNP	ENST00000397501.1	37	c.921C>T	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	C	6.068	0.380949	0.11466	.	.	ENSG00000120899	ENST00000519512	.	.	.	4.64	2.85	0.33270	.	.	.	.	.	T	0.58119	0.2100	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51957	-0.8639	4	.	.	.	.	8.8185	0.35011	0.0:0.8156:0.0:0.1844	.	.	.	.	Y	81	.	.	H	+	1	0	PTK2B	27345729	0.997000	0.39634	1.000000	0.80357	0.486000	0.33341	0.458000	0.21892	0.578000	0.29487	-0.216000	0.12614	CAT		0.617	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103		5	46	0	0	0	0.006214	0	5	46				
SCARA5	286133	broad.mit.edu	37	8	27823930	27823930	+	Splice_Site	SNP	C	C	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr8:27823930C>G	ENST00000354914.3	-	3	727		c.e3+1		SCARA5_ENST00000518030.1_Intron|SCARA5_ENST00000301906.4_Intron|SCARA5_ENST00000380385.2_Splice_Site|SCARA5_ENST00000524352.1_Splice_Site	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5						cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		CCTGCTCTTACCTGCTAAGAT	0.542																																							uc003xgj.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.e3+1		scavenger receptor class A, member 5							62.0	63.0	63.0					8																	27823930		2203	4300	6503	SO:0001630	splice_region_variant	286133				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity	g.chr8:27823930C>G	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.241+1G>C	8.37:g.27823930C>G			Somatic				SCARA5_uc010luz.2_Splice_Site_p.G81_splice|SCARA5_uc003xgk.2_Intron|SCARA5_uc003xgl.2_Splice_Site_p.V81_splice	p.V81_splice	NM_173833	NP_776194	WXS	Illumina HiSeq	Unspecified	Q6ZMJ2	SCAR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)	3	681	-		Ovarian(32;0.0218)						Q6UXZ1|Q7Z4A1|Q8N4Z7	Splice_Site	SNP	ENST00000354914.3	37	c.241_splice	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955661	0.73902	.	.	ENSG00000168079	ENST00000354914;ENST00000380385;ENST00000524352	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6009	0.76626	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCARA5	27879849	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.264000	0.58859	2.756000	0.94617	0.563000	0.77884	.		0.542	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	Intron	11	36	0	0	0	0.010729	0	11	36				
JAK2	3717	broad.mit.edu	37	9	5054630	5054630	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr9:5054630C>T	ENST00000381652.3	+	7	1176	c.682C>T	c.(682-684)Cga>Tga	p.R228*	JAK2_ENST00000544510.1_Nonsense_Mutation_p.R79*|JAK2_ENST00000539801.1_Nonsense_Mutation_p.R228*	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GACAAGGAAGCGAATAAGGTA	0.348		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																														uc010mhm.2		1		Dom	yes		9	9p24	3717	T|Mis|O	Janus kinase 2			L	ETV6|PCM1|BCR		ALL|AML|MPD| CML	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	0				haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641						c.(682-684)CGA>TGA		Janus kinase 2							95.0	99.0	97.0					9																	5054630		2203	4300	6503	SO:0001587	stop_gained	3717	Polycythemia_Vera_Familial	Familial Cancer Database		actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	g.chr9:5054630C>T		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.682C>T	9.37:g.5054630C>T	ENSP00000371067:p.Arg228*		Somatic				JAK2_uc003ziw.2_Nonsense_Mutation_p.R228*	p.R228*	NM_004972	NP_004963	WXS	Illumina HiSeq	Unspecified	O60674	JAK2_HUMAN		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	6	795	+	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)	228			Interaction with cytokine/interferon/growth hormone receptors (By similarity).|FERM.		O14636|O75297	Nonsense_Mutation	SNP	ENST00000381652.3	37	c.682C>T	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	C	37	6.200928	0.97371	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	.	.	.	5.81	-1.05	0.10036	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.367	20.3236	0.98685	0.8176:0.1824:0.0:0.0	.	.	.	.	X	228;228;79	.	ENSP00000371067:R228X	R	+	1	2	JAK2	5044630	0.888000	0.30383	0.469000	0.27204	0.997000	0.91878	0.228000	0.17814	-0.502000	0.06596	0.655000	0.94253	CGA		0.348	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1			12	126	0	0	0	0.00245	0	12	126				
KIAA1045	23349	broad.mit.edu	37	9	34976631	34976631	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr9:34976631C>T	ENST00000242315.3	+	5	825	c.743C>T	c.(742-744)gCg>gTg	p.A248V	KIAA1045_ENST00000476115.2_3'UTR|KIAA1045_ENST00000544237.1_Missense_Mutation_p.A248V	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	248							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			GAAGAGCAGGCGGCCCGCCAG	0.612																																							uc003zvq.2		NA																	0				skin(1)	1						c.(742-744)GCG>GTG		hypothetical protein LOC23349							49.0	56.0	54.0					9																	34976631		2023	4161	6184	SO:0001583	missense	23349						calcium ion binding	g.chr9:34976631C>T	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.743C>T	9.37:g.34976631C>T	ENSP00000242315:p.Ala248Val		Somatic				KIAA1045_uc003zvr.2_Missense_Mutation_p.A248V	p.A248V	NM_015297	NP_056112	WXS	Illumina HiSeq	Unspecified	Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)		5	921	+			248					B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	c.743C>T	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267764	0.59540	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	T;T	0.19938	2.11;2.11	4.92	4.92	0.64577	EF-hand-like domain (1);	0.068511	0.64402	D	0.000015	T	0.21022	0.0506	N	0.14661	0.345	0.42879	D	0.99416	D	0.71674	0.998	P	0.58013	0.831	T	0.02431	-1.1160	10	0.07175	T	0.84	-0.0894	15.2674	0.73672	0.0:1.0:0.0:0.0	.	248	Q9UPV7	K1045_HUMAN	V	248	ENSP00000444138:A248V;ENSP00000242315:A248V	ENSP00000242315:A248V	A	+	2	0	KIAA1045	34966631	0.993000	0.37304	1.000000	0.80357	0.973000	0.67179	2.748000	0.47483	2.282000	0.76494	0.561000	0.74099	GCG		0.612	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592		4	69	0	0	0	0.001168	0	4	69				
TMEM2	23670	broad.mit.edu	37	9	74360430	74360430	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr9:74360430G>T	ENST00000377044.4	-	4	1077	c.538C>A	c.(538-540)Ctg>Atg	p.L180M	TMEM2_ENST00000377066.5_Missense_Mutation_p.L180M	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	180	G8. {ECO:0000255|PROSITE- ProRule:PRU00817}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TCCTGGATCAGGATGTAATGA	0.438																																							uc011lsa.1		NA																	0				ovary(2)	2						c.(538-540)CTG>ATG		transmembrane protein 2 isoform a							88.0	94.0	92.0					9																	74360430		2203	4300	6503	SO:0001583	missense	23670					integral to membrane		g.chr9:74360430G>T		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.538C>A	9.37:g.74360430G>T	ENSP00000366243:p.Leu180Met		Somatic				TMEM2_uc010mos.2_Missense_Mutation_p.L180M|TMEM2_uc011lsb.1_RNA	p.L180M	NM_013390	NP_037522	WXS	Illumina HiSeq	Unspecified	Q9UHN6	TMEM2_HUMAN		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	4	1078	-		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)	180			G8.		A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	c.538C>A	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518656	0.64634	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	D;D	0.90732	-2.72;-2.72	5.87	4.97	0.65823	G8 domain (2);	0.000000	0.85682	D	0.000000	D	0.94561	0.8248	M	0.67517	2.055	0.80722	D	1	D;D	0.71674	0.998;0.994	D;P	0.72075	0.976;0.89	D	0.94736	0.7914	10	0.54805	T	0.06	.	17.4877	0.87693	0.0:0.124:0.876:0.0	.	180;180	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	M	180	ENSP00000366243:L180M;ENSP00000366266:L180M	ENSP00000366243:L180M	L	-	1	2	TMEM2	73550250	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.452000	0.80683	1.616000	0.50265	0.655000	0.94253	CTG		0.438	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		13	91	1	0	2.31682e-05	0.003163	2.6905e-05	13	91				
ZNF510	22869	broad.mit.edu	37	9	99521573	99521573	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr9:99521573C>G	ENST00000375231.1	-	6	2189	c.1539G>C	c.(1537-1539)gaG>gaC	p.E513D	ZNF510_ENST00000223428.4_Missense_Mutation_p.E513D			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	513					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GAAAGGATTTCTCCCCTGTGT	0.408																																							uc004awn.1		NA																	0					0						c.(1537-1539)GAG>GAC		zinc finger protein 510							158.0	157.0	157.0					9																	99521573		2203	4300	6503	SO:0001583	missense	22869				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:99521573C>G	AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.1539G>C	9.37:g.99521573C>G	ENSP00000364379:p.Glu513Asp		Somatic				ZNF510_uc004awo.1_Missense_Mutation_p.E513D	p.E513D	NM_014930	NP_055745	WXS	Illumina HiSeq	Unspecified	Q9Y2H8	ZN510_HUMAN			6	1728	-		Acute lymphoblastic leukemia(62;0.0527)	513					Q5SZP5	Missense_Mutation	SNP	ENST00000375231.1	37	c.1539G>C	CCDS35074.1	.	.	.	.	.	.	.	.	.	.	c	13.91	2.378553	0.42207	.	.	ENSG00000081386	ENST00000375231;ENST00000223428	T;T	0.26810	1.71;1.71	3.02	3.02	0.34903	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35068	0.0919	L	0.31157	0.91	0.31349	N	0.682786	D	0.69078	0.997	D	0.64595	0.927	T	0.31166	-0.9953	9	0.59425	D	0.04	.	12.2932	0.54831	0.0:1.0:0.0:0.0	.	513	Q9Y2H8	ZN510_HUMAN	D	513	ENSP00000364379:E513D;ENSP00000223428:E513D	ENSP00000223428:E513D	E	-	3	2	ZNF510	98561394	1.000000	0.71417	0.982000	0.44146	0.108000	0.19459	1.029000	0.30140	1.980000	0.57719	0.655000	0.94253	GAG		0.408	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053287.1	NM_014930		5	239	0	0	0	0.001168	0	5	239				
BARHL1	56751	broad.mit.edu	37	9	135464783	135464783	+	Silent	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr9:135464783G>T	ENST00000263610.2	+	3	1471	c.858G>T	c.(856-858)ccG>ccT	p.P286P	BARHL1_ENST00000542090.1_Silent_p.P286P	NM_020064.3	NP_064448.1	Q9BZE3	BARH1_HUMAN	BarH-like homeobox 1	286					midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(2)|skin(3)	8				OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)		CCAGCGCGCCGCCGCCTGCTC	0.721																																							uc004cbp.1		NA																	0					0						c.(856-858)CCG>CCT		BarH-like homeobox 1							23.0	30.0	27.0					9																	135464783		2178	4275	6453	SO:0001819	synonymous_variant	56751					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr9:135464783G>T	AJ237816	CCDS6950.1	9q34.13	2011-06-20	2007-07-09		ENSG00000125492	ENSG00000125492		"""Homeoboxes / ANTP class : NKL subclass"""	953	protein-coding gene	gene with protein product		605211	"""BarH (Drosophila)-like 1"""				Standard	NM_020064		Approved		uc004cbp.1	Q9BZE3	OTTHUMG00000020839	ENST00000263610.2:c.858G>T	9.37:g.135464783G>T			Somatic					p.P286P	NM_020064	NP_064448	WXS	Illumina HiSeq	Unspecified	Q9BZE3	BARH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)	3	1050	+			286					Q5T6V2|Q9NY88	Silent	SNP	ENST00000263610.2	37	c.858G>T	CCDS6950.1																																																																																				0.721	BARHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054789.2			4	34	1	0	0.000602214	0.000602	0.000661976	4	34				
CACNA1B	774	broad.mit.edu	37	9	140953545	140953545	+	Silent	SNP	C	C	T	rs201657859		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr9:140953545C>T	ENST00000371372.1	+	30	4633	c.4488C>T	c.(4486-4488)ccC>ccT	p.P1496P	CACNA1B_ENST00000277551.2_Silent_p.P1496P|CACNA1B_ENST00000371363.1_Silent_p.P1496P|CACNA1B_ENST00000277549.5_Silent_p.P692P|CACNA1B_ENST00000371355.4_Silent_p.P1497P|CACNA1B_ENST00000371357.1_Silent_p.P1497P	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1496					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGATGCACCCTATGAGTACG	0.542																																							uc004cog.2		NA																	0				breast(3)|large_intestine(2)|ovary(1)	6						c.(4486-4488)CCC>CCT		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						125.0	114.0	118.0					9																	140953545		2110	4229	6339	SO:0001819	synonymous_variant	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140953545C>T	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4488C>T	9.37:g.140953545C>T			Somatic				CACNA1B_uc011mfd.1_Silent_p.P1026P|CACNA1B_uc004coi.2_Silent_p.P710P	p.P1496P	NM_000718	NP_000709	WXS	Illumina HiSeq	Unspecified	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	30	4633	+	all_cancers(76;0.166)		1496			IV.|Extracellular (Potential).		B1AQK5	Silent	SNP	ENST00000371372.1	37	c.4488C>T	CCDS59522.1																																																																																				0.542	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		5	30	0	0	0	0.001984	0	5	30				
SCML2	10389	broad.mit.edu	37	X	18275064	18275064	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:18275064G>A	ENST00000251900.4	-	11	1519	c.1360C>T	c.(1360-1362)Cac>Tac	p.H454Y	SCML2_ENST00000398048.3_Missense_Mutation_p.H190Y	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	454					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					TGCAGACTGTGGCAGAAGTTC	0.468																																					Esophageal Squamous(100;1252 1965 19021 35517)	Esophageal Squamous(100;1252 1965 19021 35517)	uc004cyl.2		NA																	0					0						c.(1360-1362)CAC>TAC		sex comb on midleg-like 2							155.0	137.0	143.0					X																	18275064		2203	4300	6503	SO:0001583	missense	10389				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:18275064G>A	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1360C>T	X.37:g.18275064G>A	ENSP00000251900:p.His454Tyr		Somatic				SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.H454Y|SCML2_uc011miz.1_Missense_Mutation_p.H388Y|SCML2_uc010nfc.2_Missense_Mutation_p.H190Y	p.H454Y	NM_006089	NP_006080	WXS	Illumina HiSeq	Unspecified	Q9UQR0	SCML2_HUMAN			11	1517	-	Hepatocellular(33;0.183)		454					Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	c.1360C>T	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326766	0.81690	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.43294	0.95;0.95	5.27	5.27	0.74061	.	0.307314	0.31685	N	0.007231	T	0.62405	0.2425	M	0.72118	2.19	0.58432	D	0.99999	D;D;D	0.65815	0.993;0.995;0.984	P;P;P	0.62560	0.904;0.874;0.904	T	0.63967	-0.6517	10	0.46703	T	0.11	.	18.0173	0.89245	0.0:0.0:1.0:0.0	.	422;190;454	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	Y	454;190;422	ENSP00000251900:H454Y;ENSP00000381126:H190Y	ENSP00000251900:H454Y	H	-	1	0	SCML2	18184985	1.000000	0.71417	0.075000	0.20258	0.631000	0.37964	9.383000	0.97214	2.188000	0.69820	0.513000	0.50165	CAC		0.468	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089		9	154	0	0	0	0.008291	0	9	154				
FAM47B	170062	broad.mit.edu	37	X	34962077	34962077	+	Missense_Mutation	SNP	C	C	A	rs372229852		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:34962077C>A	ENST00000329357.5	+	1	1165	c.1129C>A	c.(1129-1131)Cct>Act	p.P377T		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	377										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						ACTCACCAAGCCTGGTAAATA	0.537																																							uc004ddi.1		NA																	0				ovary(3)|breast(1)	4						c.(1129-1131)CCT>ACT		hypothetical protein LOC170062		C	THR/PRO	1,3832		0,1,1630,571	45.0	43.0	43.0		1129	0.7	0.0	X		43	0,6728		0,0,2428,1872	no	missense	FAM47B	NM_152631.2	38	0,1,4058,2443	AA,AC,CC,C		0.0,0.0261,0.0095	probably-damaging	377/646	34962077	1,10560	2202	4300	6502	SO:0001583	missense	170062							g.chrX:34962077C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1129C>A	X.37:g.34962077C>A	ENSP00000328307:p.Pro377Thr		Somatic					p.P377T	NM_152631	NP_689844	WXS	Illumina HiSeq	Unspecified	Q8NA70	FA47B_HUMAN			1	1147	+			377					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.1129C>A	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	2.946	-0.217826	0.06101	2.61E-4	0.0	ENSG00000189132	ENST00000329357	T	0.14266	2.52	0.719	0.719	0.18208	.	.	.	.	.	T	0.20047	0.0482	L	0.59436	1.845	0.09310	N	1	D	0.57571	0.98	P	0.53861	0.736	T	0.18681	-1.0329	8	0.20519	T	0.43	.	.	.	.	.	377	Q8NA70	FA47B_HUMAN	T	377	ENSP00000328307:P377T	ENSP00000328307:P377T	P	+	1	0	FAM47B	34871998	0.042000	0.20092	0.002000	0.10522	0.004000	0.04260	1.157000	0.31724	0.622000	0.30249	0.468000	0.43344	CCT		0.537	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		12	39	1	0	1.49906e-05	0.00245	1.755e-05	12	39				
CACNA1F	778	broad.mit.edu	37	X	49066186	49066186	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:49066186G>A	ENST00000376265.2	-	41	4818	c.4757C>T	c.(4756-4758)aCa>aTa	p.T1586I	CACNA1F_ENST00000376251.1_Missense_Mutation_p.T1521I|CACNA1F_ENST00000323022.5_Missense_Mutation_p.T1575I	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1586					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GATCAGAAATGTGGCGTAGAA	0.592																																							uc004dnb.2		NA																	0				breast(3)|ovary(1)|kidney(1)|skin(1)	6						c.(4756-4758)ACA>ATA		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						70.0	59.0	63.0					X																	49066186		2203	4300	6503	SO:0001583	missense	778				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chrX:49066186G>A	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4757C>T	X.37:g.49066186G>A	ENSP00000365441:p.Thr1586Ile		Somatic				CACNA1F_uc010nip.2_Missense_Mutation_p.T1575I	p.T1586I	NM_005183	NP_005174	WXS	Illumina HiSeq	Unspecified	O60840	CAC1F_HUMAN			41	4819	-			1586			Cytoplasmic (Potential).		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	c.4757C>T	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322809	0.81580	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	T;T;T	0.74106	-0.81;-0.81;-0.81	5.19	5.19	0.71726	Voltage-dependent calcium channel, alpha-1 subunit, IQ domain (1);	0.112824	0.56097	D	0.000023	T	0.82093	0.4962	L	0.52364	1.645	0.58432	D	0.999992	D;D	0.67145	0.996;0.988	P;D	0.64687	0.9;0.928	D	0.84121	0.0406	10	0.72032	D	0.01	.	16.5087	0.84278	0.0:0.0:1.0:0.0	.	1575;1586	F5CIQ9;O60840	.;CAC1F_HUMAN	I	1521;1575;1586	ENSP00000365427:T1521I;ENSP00000321618:T1575I;ENSP00000365441:T1586I	ENSP00000321618:T1575I	T	-	2	0	CACNA1F	48953130	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.387000	0.66243	2.154000	0.67381	0.600000	0.82982	ACA		0.592	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		6	31	0	0	0	0.00308	0	6	31				
AKAP4	8852	broad.mit.edu	37	X	49962221	49962221	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:49962221G>T	ENST00000376056.2	-	3	271	c.121C>A	c.(121-123)Ctg>Atg	p.L41M	AKAP4_ENST00000358526.2_Missense_Mutation_p.L50M|AKAP4_ENST00000376058.2_Missense_Mutation_p.L41M|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376064.3_Missense_Mutation_p.L41M					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TCTACATTCAGGGTGGACACA	0.398																																							uc004dow.1		NA																	0				kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8						c.(148-150)CTG>ATG		A-kinase anchor protein 4 isoform 1							90.0	74.0	80.0					X																	49962221		2203	4300	6503	SO:0001583	missense	8852				cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding	g.chrX:49962221G>T	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.121C>A	X.37:g.49962221G>T	ENSP00000365224:p.Leu41Met		Somatic				AKAP4_uc004dov.1_Missense_Mutation_p.L41M|AKAP4_uc010njp.1_Translation_Start_Site|AKAP4_uc004dou.1_Missense_Mutation_p.L41M	p.L50M	NM_003886	NP_003877	WXS	Illumina HiSeq	Unspecified	Q5JQC9	AKAP4_HUMAN			3	272	-	Ovarian(276;0.236)		50						Missense_Mutation	SNP	ENST00000376056.2	37	c.148C>A	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882633	0.33255	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064;ENST00000448865;ENST00000437370	T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27	4.23	-0.53	0.11898	.	0.000000	0.36374	N	0.002630	T	0.29716	0.0742	M	0.63428	1.95	0.19945	N	0.999945	P;P	0.52316	0.952;0.914	B;B	0.43575	0.424;0.424	T	0.20840	-1.0263	9	.	.	.	-7.7806	4.1419	0.10198	0.4047:0.17:0.4253:0.0	.	50;41	Q5JQC9;A6ND82	AKAP4_HUMAN;.	M	41;41;50;41;41;41	ENSP00000365224:L41M;ENSP00000365226:L41M;ENSP00000351327:L50M;ENSP00000365232:L41M;ENSP00000402403:L41M;ENSP00000412279:L41M	.	L	-	1	2	AKAP4	49848961	1.000000	0.71417	0.978000	0.43139	0.969000	0.65631	0.560000	0.23500	-0.359000	0.08150	-0.312000	0.09012	CTG		0.398	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886		5	49	1	0	1.12685e-05	0.004482	1.34105e-05	5	49				
RPS6KA6	27330	broad.mit.edu	37	X	83372087	83372087	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:83372087C>A	ENST00000262752.2	-	11	937	c.930G>T	c.(928-930)agG>agT	p.R310S	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.R310S	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	310	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TTGCTGGATTCCTTTTGAATA	0.323																																							uc004eej.1		NA																	0				lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						c.(928-930)AGG>AGT		ribosomal protein S6 kinase polypeptide 6							52.0	49.0	50.0					X																	83372087		2201	4297	6498	SO:0001583	missense	27330				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:83372087C>A	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.930G>T	X.37:g.83372087C>A	ENSP00000262752:p.Arg310Ser		Somatic				RPS6KA6_uc011mqt.1_Missense_Mutation_p.R310S|RPS6KA6_uc011mqu.1_Missense_Mutation_p.R207S	p.R310S	NM_014496	NP_055311	WXS	Illumina HiSeq	Unspecified	Q9UK32	KS6A6_HUMAN			11	1007	-			310			Protein kinase 1.		B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	37	c.930G>T	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723145	0.48728	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.59224	0.28;0.28	4.79	0.901	0.19284	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62624	0.2443	L	0.37466	1.105	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.988;0.992	T	0.61377	-0.7075	10	0.87932	D	0	.	10.19	0.43021	0.0:0.4744:0.0:0.5256	.	310;310	B7ZL90;Q9UK32	.;KS6A6_HUMAN	S	310	ENSP00000262752:R310S;ENSP00000440830:R310S	ENSP00000262752:R310S	R	-	3	2	RPS6KA6	83258743	0.543000	0.26434	0.999000	0.59377	0.994000	0.84299	-0.181000	0.09740	0.058000	0.16222	0.600000	0.82982	AGG		0.323	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496		13	34	1	0	1.3612e-06	0.003163	1.67533e-06	13	34				
DOCK11	139818	broad.mit.edu	37	X	117707926	117707926	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:117707926C>A	ENST00000276202.7	+	12	1397	c.1334C>A	c.(1333-1335)tCa>tAa	p.S445*	DOCK11_ENST00000276204.6_Nonsense_Mutation_p.S445*	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	445					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						AAGGGCTCTTCACCCGAATCT	0.468																																							uc004eqp.2		NA																	0				ovary(3)	3						c.(1333-1335)TCA>TAA		dedicator of cytokinesis 11							90.0	82.0	85.0					X																	117707926		2203	4300	6503	SO:0001587	stop_gained	139818				blood coagulation	cytosol	GTP binding	g.chrX:117707926C>A	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.1334C>A	X.37:g.117707926C>A	ENSP00000276202:p.Ser445*		Somatic				DOCK11_uc004eqq.2_Nonsense_Mutation_p.S211*	p.S445*	NM_144658	NP_653259	WXS	Illumina HiSeq	Unspecified	Q5JSL3	DOC11_HUMAN			12	1397	+			445					A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Nonsense_Mutation	SNP	ENST00000276202.7	37	c.1334C>A	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793441	0.90453	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	.	.	.	6.02	4.27	0.50696	.	1.142060	0.06332	N	0.706319	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-8.3891	11.1402	0.48398	0.0:0.8463:0.0:0.1537	.	.	.	.	X	445	.	ENSP00000276202:S445X	S	+	2	0	DOCK11	117591954	0.010000	0.17322	0.017000	0.16124	0.170000	0.22686	0.569000	0.23638	0.675000	0.31264	0.600000	0.82982	TCA		0.468	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		19	67	1	0	9.57634e-11	0.00333	1.36534e-10	19	67				
GPR112	139378	broad.mit.edu	37	X	135430454	135430454	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chrX:135430454A>G	ENST00000394143.1	+	6	4880	c.4589A>G	c.(4588-4590)gAc>gGc	p.D1530G	GPR112_ENST00000412101.1_Missense_Mutation_p.D1325G|GPR112_ENST00000370652.1_Missense_Mutation_p.D1530G|GPR112_ENST00000287534.4_Missense_Mutation_p.D1467G|GPR112_ENST00000394141.1_Missense_Mutation_p.D1325G	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1530					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AAAGTTTCTGACACTCCCCCA	0.433																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4588-4590)GAC>GGC		G-protein coupled receptor 112							82.0	79.0	80.0					X																	135430454		2203	4299	6502	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135430454A>G	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4589A>G	X.37:g.135430454A>G	ENSP00000377699:p.Asp1530Gly		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.D1325G|GPR112_uc010nsc.1_Missense_Mutation_p.D1297G	p.D1530G	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	4880	+	Acute lymphoblastic leukemia(192;0.000127)		1530			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.4589A>G	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	4.407	0.075226	0.08485	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.34072	1.41;1.41;1.38;1.51;1.38	3.02	-1.28	0.09318	.	.	.	.	.	T	0.16854	0.0405	N	0.12746	0.255	0.09310	N	1	B;B;B	0.14012	0.009;0.002;0.001	B;B;B	0.09377	0.004;0.004;0.002	T	0.17107	-1.0380	9	0.49607	T	0.09	.	3.2539	0.06824	0.509:0.2137:0.2773:0.0	.	1467;1325;1530	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	G	1530;1530;1325;1467;1325	ENSP00000377699:D1530G;ENSP00000359686:D1530G;ENSP00000416526:D1325G;ENSP00000287534:D1467G;ENSP00000377697:D1325G	ENSP00000287534:D1467G	D	+	2	0	GPR112	135258120	0.147000	0.22687	0.001000	0.08648	0.018000	0.09664	0.125000	0.15749	-0.507000	0.06549	0.378000	0.23410	GAC		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			3	102	0	0	0	0.000602	0	3	102				
FBXO22	26263	broad.mit.edu	37	15	76225419	76225422	+	Frame_Shift_Del	DEL	CATA	CATA	-			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	CATA	CATA	-	-	CATA	CATA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr15:76225419_76225422delCATA	ENST00000308275.3	+	7	1293_1296	c.1188_1191delCATA	c.(1186-1191)ctcatafs	p.LI396fs	FBXO22_ENST00000540507.1_Frame_Shift_Del_p.LI292fs	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	396					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TAATGGCACTCATACATCTGGGGT	0.343																																							uc002bbk.2		NA																	0					0						c.(1186-1191)CTCATAfs		F-box only protein 22 isoform a																																				SO:0001589	frameshift_variant	26263				ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity	g.chr15:76225419_76225422delCATA	AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.1188_1191delCATA	15.37:g.76225419_76225422delCATA	ENSP00000307833:p.Leu396fs		Somatic				FBXO22_uc002bbl.2_Frame_Shift_Del_p.L292fs|FBXO22OS_uc002bbm.1_RNA	p.L396fs	NM_147188	NP_671717	WXS	Illumina HiSeq	Unspecified	Q8NEZ5	FBX22_HUMAN			7	1293_1296	+			396_397					Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Frame_Shift_Del	DEL	ENST00000308275.3	37	c.1188_1191delCATA	CCDS10287.1																																																																																				0.343	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188		8	95	NA	NA	NA	NA	NA	8	95	---	---	---	---
LONP2	83752	broad.mit.edu	37	16	48382016	48382016	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr16:48382016delG	ENST00000285737.4	+	14	2245	c.2152delG	c.(2152-2154)ggafs	p.G718fs	LONP2_ENST00000535754.1_Frame_Shift_Del_p.G674fs|LONP2_ENST00000564259.1_3'UTR	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TAAAGCTTTTGGAAGTTTTGA	0.358																																							uc002efi.1		NA																	0					0						c.(2152-2154)GGAfs		peroxisomal LON protease-like							70.0	74.0	73.0					16																	48382016		2200	4300	6500	SO:0001589	frameshift_variant	83752				misfolded or incompletely synthesized protein catabolic process|protein targeting to peroxisome|signal peptide processing	nucleoid|peroxisomal matrix	ATP binding|ATP-dependent peptidase activity|enzyme binding|sequence-specific DNA binding|serine-type endopeptidase activity	g.chr16:48382016delG	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2152delG	16.37:g.48382016delG	ENSP00000285737:p.Gly718fs		Somatic				LONP2_uc002efj.1_Frame_Shift_Del_p.G674fs	p.G718fs	NM_031490	NP_113678	WXS	Illumina HiSeq	Unspecified	Q86WA8	LONP2_HUMAN			14	2241	+			718						Frame_Shift_Del	DEL	ENST00000285737.4	37	c.2152delG	CCDS10734.1																																																																																				0.358	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490		11	70	NA	NA	NA	NA	NA	11	70	---	---	---	---
CLOCK	9575	broad.mit.edu	37	4	56316293	56316305	+	Frame_Shift_Del	DEL	CTTGAACTCCGAG	CTTGAACTCCGAG	-	rs201298017|rs148913372		TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	CTTGAACTCCGAG	CTTGAACTCCGAG	-	-	CTTGAACTCCGAG	CTTGAACTCCGAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:56316293_56316305delCTTGAACTCCGAG	ENST00000309964.4	-	15	1551_1563	c.1301_1313delCTCGGAGTTCAAG	c.(1300-1314)tctcggagttcaagafs	p.SRSSR434fs	CLOCK_ENST00000381322.1_Frame_Shift_Del_p.SRSSR434fs|CLOCK_ENST00000513440.1_Frame_Shift_Del_p.SRSSR434fs	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	434	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			AGATGATTTTCTTGAACTCCGAGAAGAGGCAGA	0.432																																							uc003haz.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1300-1314)TCTCGGAGTTCAAGAfs		clock																																				SO:0001589	frameshift_variant	9575				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr4:56316293_56316305delCTTGAACTCCGAG	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.1301_1313delCTCGGAGTTCAAG	4.37:g.56316293_56316305delCTTGAACTCCGAG	ENSP00000308741:p.Ser434fs		Somatic				CLOCK_uc003hba.1_Frame_Shift_Del_p.S434fs|CLOCK_uc010igu.1_5'Flank	p.S434fs	NM_004898	NP_004889	WXS	Illumina HiSeq	Unspecified	O15516	CLOCK_HUMAN	LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)		17	2227_2239	-	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		434_438					A0AV01|A2I2N9|O14516|Q9UIT8	Frame_Shift_Del	DEL	ENST00000309964.4	37	c.1301_1313delCTCGGAGTTCAAG	CCDS3500.1																																																																																				0.432	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898		7	71	NA	NA	NA	NA	NA	7	71	---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162376268	162376268	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr4:162376268delC	ENST00000306100.5	-	15	2165	c.1729delG	c.(1729-1731)gccfs	p.A577fs	FSTL5_ENST00000536695.1_Frame_Shift_Del_p.A576fs|FSTL5_ENST00000427802.2_Frame_Shift_Del_p.A567fs|FSTL5_ENST00000379164.4_Frame_Shift_Del_p.A576fs	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	577						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TTCCCACTGGCCAGGGTAATT	0.398																																							uc003iqh.2		NA																	0				ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(1729-1731)GCCfs		follistatin-like 5 isoform a							129.0	102.0	111.0					4																	162376268		2203	4300	6503	SO:0001589	frameshift_variant	56884					extracellular region	calcium ion binding	g.chr4:162376268delC	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1729delG	4.37:g.162376268delC	ENSP00000305334:p.Ala577fs		Somatic				FSTL5_uc003iqi.2_Frame_Shift_Del_p.A576fs|FSTL5_uc010iqv.2_Frame_Shift_Del_p.A567fs	p.A577fs	NM_020116	NP_064501	WXS	Illumina HiSeq	Unspecified	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	15	2165	-	all_hematologic(180;0.24)		577					E9PCP6|Q9NSW7|Q9ULF7	Frame_Shift_Del	DEL	ENST00000306100.5	37	c.1729delG	CCDS3802.1																																																																																				0.398	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		17	82	NA	NA	NA	NA	NA	17	82	---	---	---	---
LSM11	134353	broad.mit.edu	37	5	157171203	157171203	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr5:157171203delC	ENST00000286307.5	+	1	501	c.445delC	c.(445-447)cccfs	p.P149fs		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	149					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)			breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CACGCGAATGCCCTGTGAGTC	0.761																																							uc003lxe.1		NA																	0					0						c.(445-447)CCCfs		LSM11, U7 small nuclear RNA associated							2.0	4.0	3.0					5																	157171203		1592	3376	4968	SO:0001589	frameshift_variant	134353				histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding	g.chr5:157171203delC	AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.445delC	5.37:g.157171203delC	ENSP00000286307:p.Pro149fs		Somatic					p.P149fs	NM_173491	NP_775762	WXS	Illumina HiSeq	Unspecified	P83369	LSM11_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	449	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	149					A0AVQ1|Q7Z7P0|Q8N975	Frame_Shift_Del	DEL	ENST00000286307.5	37	c.445delC	CCDS4342.1																																																																																				0.761	LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252580.2	NM_173491		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
SLC17A2	10246	broad.mit.edu	37	6	25921520	25921520	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr6:25921520delT	ENST00000265425.3	-	3	381	c.361delA	c.(361-363)atgfs	p.M121fs	SLC17A2_ENST00000360488.3_Frame_Shift_Del_p.M121fs|SLC17A2_ENST00000377850.3_Frame_Shift_Del_p.M121fs			O00624	NPT3_HUMAN	solute carrier family 17, member 2	121					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.M121fs*7(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						GCACCAAGCATTTTTTTTGCT	0.453																																							uc011dkb.1		NA																	1	Deletion - Frameshift(1)		ovary(1)	ovary(1)	1						c.(361-363)ATGfs		SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;				26,4238		13,0,2119	136.0	124.0	128.0			5.0	1.0	6		129	35,8219		16,3,4108	no	frameshift	SLC17A2	NM_005835.2		29,3,6227	A1A1,A1R,RR		0.424,0.6098,0.4873			25921520	61,12457	2203	4300	6503	SO:0001589	frameshift_variant	10246				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25921520delT	U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.361delA	6.37:g.25921520delT	ENSP00000265425:p.Met121fs		Somatic				SLC17A2_uc011dkc.1_Frame_Shift_Del_p.M121fs|SLC17A2_uc003nfl.2_Frame_Shift_Del_p.M121fs	p.M121fs			WXS	Illumina HiSeq	Unspecified	O00624	NPT3_HUMAN			3	444	-			121					A6NK81|A6NLD6|Q5TB84|Q76P85	Frame_Shift_Del	DEL	ENST00000265425.3	37	c.361delA																																																																																					0.453	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1			8	120	NA	NA	NA	NA	NA	8	120	---	---	---	---
TRA2A	29896	broad.mit.edu	37	7	23547133	23547135	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	TTC	TTC	-	-	TTC	TTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:23547133_23547135delTTC	ENST00000297071.4	-	5	761_763	c.545_547delGAA	c.(544-549)ggaatg>gtg	p.182_183GM>V	TRA2A_ENST00000392502.4_In_Frame_Del_p.81_82GM>V|TRA2A_ENST00000474586.1_5'UTR|TRA2A_ENST00000538367.1_In_Frame_Del_p.81_82GM>V	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	182	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						TCCAGCTCCATTCCATTTGCCCT	0.404																																					Pancreas(121;2137 2973 46590)	Pancreas(121;2137 2973 46590)	uc003swi.2		NA																	0				ovary(1)	1						c.(544-549)GGAATG>GTG		transformer-2 alpha																																				SO:0001651	inframe_deletion	29896				nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding	g.chr7:23547133_23547135delTTC	U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.545_547delGAA	7.37:g.23547133_23547135delTTC	ENSP00000297071:p.Gly182_Met183delinsVal		Somatic				TRA2A_uc011jzb.1_RNA|TRA2A_uc011jzc.1_In_Frame_Del_p.81_82GM>V|TRA2A_uc011jzd.1_In_Frame_Del_p.81_82GM>V	p.182_183GM>V	NM_013293	NP_037425	WXS	Illumina HiSeq	Unspecified	Q13595	TRA2A_HUMAN			5	759_761	-			182_183			RRM.		B4DUA9	In_Frame_Del	DEL	ENST00000297071.4	37	c.545_547delGAA	CCDS5383.1																																																																																				0.404	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1	NM_013293		7	196	NA	NA	NA	NA	NA	7	196	---	---	---	---
GTF2IRD2P1	401375	broad.mit.edu	37	7	72664019	72664020	+	RNA	INS	-	-	T			TCGA-97-7941-01A-11D-2184-08	TCGA-97-7941-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	61181eca-24b7-4256-bf0b-7902359e4f4b	eb7be5ed-361f-463a-aa9d-6408387ded3a	g.chr7:72664019_72664020insT	ENST00000425256.1	-	0	880_881									GTF2I repeat domain containing 2 pseudogene 1																		CACCCCCGGGGCATGCCATCAA	0.505																																							uc003txs.1		NA																	0					0						c.(-49--44)ATGCCC>ATGACCC		RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;																																						401375							g.chr7:72664019_72664020insT	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664020insT			Somatic				FKBP6_uc003twz.2_Intron		NR_002164		WXS	Illumina HiSeq	Unspecified					11	881_882	-									Translation_Start_Site	INS	ENST00000425256.1	37	c.-47_-46insA																																																																																					0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
