#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_filter	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MEGF6	1953	broad.mit.edu	37	1	3427347	3427347	+	Splice_Site	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:3427347C>G	ENST00000356575.4	-	10	1460	c.1234G>C	c.(1234-1236)Gat>Cat	p.D412H	MEGF6_ENST00000294599.4_Splice_Site_p.D307H	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	412	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D412H(1)		cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CAGTGCTCACCCTCACAGCCG	0.687																																					Ovarian(73;978 3658)	uc001akl.2																			1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1234-1236)GAT>CAT		EGF-like-domain, multiple 3 precursor							19.0	26.0	23.0					1																	3427347		2122	4221	6343	SO:0001630	splice_region_variant	1953					extracellular region	calcium ion binding	g.chr1:3427347C>G	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1234+1G>C	1.37:g.3427347C>G			Somatic				MEGF6_uc001akk.2_Missense_Mutation_p.D307H	p.D412H	NM_001409	NP_001400	Capture	Illumina GAIIx	Phase_I	O75095	MEGF6_HUMAN		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)	10	1461	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	412			EGF-like 8; calcium-binding (Potential).		Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	c.1234G>C	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241192	0.58995	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	D;D	0.89270	-2.49;-2.49	4.36	4.36	0.52297	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96288	0.8789	H	0.95982	3.75	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97955	1.0334	9	.	.	.	.	16.4774	0.84136	0.0:1.0:0.0:0.0	.	412;307	O75095;O75095-2	MEGF6_HUMAN;.	H	307;412	ENSP00000294599:D307H;ENSP00000348982:D412H	.	D	-	1	0	MEGF6	3417207	1.000000	0.71417	0.998000	0.56505	0.074000	0.17049	5.793000	0.69060	1.948000	0.56530	0.462000	0.41574	GAT		PASS	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	Missense_Mutation	5	13	---	---	---	---
CLSTN1	22883	broad.mit.edu	37	1	9791327	9791327	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:9791327G>A	ENST00000377298.4	-	18	3477	c.2685C>T	c.(2683-2685)acC>acT	p.T895T	CLSTN1_ENST00000477264.1_5'UTR|CLSTN1_ENST00000377288.3_Silent_p.T876T|CLSTN1_ENST00000361311.4_Silent_p.T885T	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	895					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)	p.T895T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCTCCTTCCCGGTGTCCTGAT	0.607																																						uc001aqh.2																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2683-2685)ACC>ACT		calsyntenin 1 isoform 1							152.0	125.0	134.0					1																	9791327		2203	4300	6503	SO:0001819	synonymous_variant	22883				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding	g.chr1:9791327G>A	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.2685C>T	1.37:g.9791327G>A			Somatic				CLSTN1_uc001aqi.2_Silent_p.T885T|CLSTN1_uc010oag.1_Silent_p.T876T|CLSTN1_uc001aqf.2_Silent_p.T131T	p.T895T	NM_001009566	NP_001009566	Capture	Illumina GAIIx	Phase_I	O94985	CSTN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)	18	3444	-	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	895			Cytoplasmic (Potential).		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	37	c.2685C>T	CCDS30580.1																																																																																				PASS	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1			40	155	---	---	---	---
PRDM2	7799	broad.mit.edu	37	1	14106310	14106310	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:14106310A>G	ENST00000235372.7	+	8	2876	c.2020A>G	c.(2020-2022)Aca>Gca	p.T674A	PRDM2_ENST00000343137.4_Missense_Mutation_p.T473A|PRDM2_ENST00000413440.1_Missense_Mutation_p.T473A|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.T674A|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	674					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T674A(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CATATCAACAACAGAGGCAGT	0.443																																						uc001avi.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2020-2022)ACA>GCA		retinoblastoma protein-binding zinc finger							108.0	103.0	105.0					1																	14106310		2203	4300	6503	SO:0001583	missense	7799					Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:14106310A>G	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.2020A>G	1.37:g.14106310A>G	ENSP00000235372:p.Thr674Ala		Somatic				PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.T674A|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Missense_Mutation_p.T431A|PRDM2_uc001avk.2_Missense_Mutation_p.T473A|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	p.T674A	NM_012231	NP_036363	Capture	Illumina GAIIx	Phase_I	Q13029	PRDM2_HUMAN	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)	8	2876	+	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	674					B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	c.2020A>G	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	8.529	0.870567	0.17322	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01629	4.84;4.72;4.73;4.73	5.37	-1.32	0.09201	.	0.610969	0.17904	N	0.158085	T	0.01124	0.0037	N	0.21448	0.665	0.09310	N	1	B;B;B;B	0.25169	0.073;0.0;0.073;0.119	B;B;B;B	0.20184	0.012;0.001;0.012;0.028	T	0.46190	-0.9209	10	0.46703	T	0.11	.	1.4983	0.02471	0.4648:0.2529:0.1496:0.1328	.	674;532;674;674	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	A	674;674;674;473;473	ENSP00000235372:T674A;ENSP00000312352:T674A;ENSP00000411103:T473A;ENSP00000341621:T473A	ENSP00000235372:T674A	T	+	1	0	PRDM2	13978897	0.000000	0.05858	0.001000	0.08648	0.773000	0.43773	0.135000	0.15952	-0.173000	0.10761	0.533000	0.62120	ACA		PASS	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231		86	110	---	---	---	---
PADI6	353238	broad.mit.edu	37	1	17699703	17699703	+	RNA	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:17699703C>A	ENST00000434762.2	+	0	319							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.P90H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	ATGACATCGCCCAGCCCTTCC	0.607																																						uc001bak.1																			1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(268-270)CCC>CAC		peptidylarginine deiminase type 6	L-Citrulline(DB00155)						53.0	55.0	55.0					1																	17699703		2152	4263	6415			353238				peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity	g.chr1:17699703C>A	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17699703C>A			Somatic					p.P90H	NM_207421	NP_997304	Capture	Illumina GAIIx	Phase_I	Q6TGC4	PADI6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	2	269	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	82					Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37	c.269C>A																																																																																					PASS	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421		11	76	---	---	---	---
RHD	6007	broad.mit.edu	37	1	25627554	25627554	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:25627554G>A	ENST00000328664.4	+	4	759	c.604G>A	c.(604-606)Gca>Aca	p.A202T	RHD_ENST00000568195.1_Missense_Mutation_p.A202T|RHD_ENST00000357542.4_Missense_Mutation_p.A202T|RHD_ENST00000417538.2_Missense_Mutation_p.A202T|RHD_ENST00000454452.2_Missense_Mutation_p.A202T|RHD_ENST00000423253.1_3'UTR|RHD_ENST00000423810.2_Missense_Mutation_p.A202T|RHD_ENST00000342055.5_Missense_Mutation_p.A202T	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	202						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)	p.A202T(1)		breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGATCAGACAGCAACGATACC	0.547																																						uc001bjz.2																			1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(604-606)GCA>ACA		Rh blood group D antigen isoform 1							225.0	155.0	180.0					1																	25627554		2123	3739	5862	SO:0001583	missense	6007					integral to plasma membrane		g.chr1:25627554G>A	AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.604G>A	1.37:g.25627554G>A	ENSP00000331871:p.Ala202Thr		Somatic				RHD_uc010oep.1_Missense_Mutation_p.A202T|RHD_uc001bkc.2_Missense_Mutation_p.A202T|RHD_uc009vrm.2_Missense_Mutation_p.A34T|RHD_uc001bka.2_Missense_Mutation_p.A202T|RHD_uc001bkb.2_Missense_Mutation_p.A202T|RHD_uc009vrn.2_Missense_Mutation_p.A202T|RHD_uc009vro.2_Missense_Mutation_p.A202T|RHD_uc009vrp.2_Missense_Mutation_p.A202T	p.A202T	NM_016124	NP_057208	Capture	Illumina GAIIx	Phase_I	Q02161	RHD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	4	662	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	202					Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	ENST00000328664.4	37	c.604G>A	CCDS262.1	.	.	.	.	.	.	.	.	.	.	.	12.90	2.075140	0.36566	.	.	ENSG00000187010	ENST00000328664;ENST00000419831;ENST00000454452;ENST00000342055;ENST00000357542;ENST00000417538;ENST00000423810	T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0	3.95	-0.384	0.12474	Ammonium transporter AmtB-like (3);	0.508271	0.20116	N	0.098908	T	0.22898	0.0553	N	0.17922	0.545	0.09310	N	1	B;B;D;B;B;B;B;B	0.76494	0.035;0.072;0.999;0.035;0.008;0.181;0.106;0.01	B;B;D;B;B;B;B;B	0.81914	0.1;0.1;0.995;0.074;0.052;0.082;0.163;0.1	T	0.20338	-1.0278	10	0.23891	T	0.37	-0.6906	7.7611	0.28953	0.3974:0.0:0.6026:0.0	.	202;202;202;202;202;202;202;202	B4DLT8;Q5XLT1;Q5XLS9;Q5XLT2;Q5XLT3;E7EVW1;Q5XLT0;Q02161	.;.;.;.;.;.;.;RHD_HUMAN	T	202	ENSP00000331871:A202T;ENSP00000413849:A202T;ENSP00000339577:A202T;ENSP00000350150:A202T;ENSP00000396420:A202T;ENSP00000399640:A202T	ENSP00000331871:A202T	A	+	1	0	RHD	25500141	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.027000	0.12371	-0.388000	0.07797	-1.161000	0.01788	GCA		PASS	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009660.5	NM_016124		112	31	---	---	---	---
TMEM57	55219	broad.mit.edu	37	1	25785216	25785216	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:25785216G>A	ENST00000374343.4	+	6	1166	c.987G>A	c.(985-987)gtG>gtA	p.V329V	TMEM57_ENST00000399766.3_Intron|TMEM57_ENST00000399763.3_Intron|TMEM57_ENST00000470035.1_3'UTR	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	329					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)		p.V329V(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		GTGGAGTTGTGAACTCTTCAC	0.398																																						uc001bkk.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(985-987)GTG>GTA		transmembrane protein 57							121.0	125.0	123.0					1																	25785216		2203	4300	6503	SO:0001819	synonymous_variant	55219					axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part		g.chr1:25785216G>A	AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.987G>A	1.37:g.25785216G>A			Somatic				TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron|TMEM57_uc009vrt.2_RNA	p.V329V	NM_018202	NP_060672	Capture	Illumina GAIIx	Phase_I	Q8N5G2	MACOI_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)	6	1189	+		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)	329					B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Silent	SNP	ENST00000374343.4	37	c.987G>A	CCDS30638.1																																																																																				PASS	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009659.2	NM_018202		28	278	---	---	---	---
EXTL1	2134	broad.mit.edu	37	1	26360264	26360264	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:26360264C>T	ENST00000374280.3	+	9	2463	c.1596C>T	c.(1594-1596)gaC>gaT	p.D532D		NM_004455.2	NP_004446.2	Q92935	EXTL1_HUMAN	exostosin-like glycosyltransferase 1	532					protein glycosylation (GO:0006486)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)	p.D532D(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|stomach(1)|urinary_tract(1)	23		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		ATTTCTGGGACGAGGCCCATG	0.587																																						uc001blf.2																			1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1594-1596)GAC>GAT		exostoses-like 1							115.0	108.0	110.0					1																	26360264		2203	4300	6503	SO:0001819	synonymous_variant	2134				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding	g.chr1:26360264C>T	U67191	CCDS271.1	1p36.1	2013-03-01	2013-03-01		ENSG00000158008	ENSG00000158008	2.4.1.224	"""Exostosin glycosyltransferase family"""	3515	protein-coding gene	gene with protein product	"""glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""alpha-N-acetylglucosaminyltransferase II"", ""glucuronyl-N-acetylglucosaminylproteoglycan alpha-1,4-N- acetylglucosaminyltransferase"", ""exostosin-L"""	601738	"""exostoses (multiple)-like 1"""			9037597	Standard	NM_004455		Approved	EXTL, MGC70794	uc001blf.3	Q92935	OTTHUMG00000007509	ENST00000374280.3:c.1596C>T	1.37:g.26360264C>T			Somatic					p.D532D	NM_004455	NP_004446	Capture	Illumina GAIIx	Phase_I	Q92935	EXTL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)	9	2463	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	532			Lumenal (Potential).		Q6GSC1	Silent	SNP	ENST00000374280.3	37	c.1596C>T	CCDS271.1																																																																																				PASS	EXTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019749.1	NM_004455		45	132	---	---	---	---
INPP5B	3633	broad.mit.edu	37	1	38409540	38409540	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:38409540T>C	ENST00000373026.1	-	3	178	c.178A>G	c.(178-180)Atg>Gtg	p.M60V	INPP5B_ENST00000373021.1_Missense_Mutation_p.M60V|INPP5B_ENST00000373023.2_Missense_Mutation_p.M60V|INPP5B_ENST00000373024.3_Missense_Mutation_p.M60V			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	60	PH.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)	p.M97V(1)|p.M60V(1)		breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GTAATGGCCATCCTCCGGTGC	0.597																																						uc001ccg.1																			2	Substitution - Missense(2)		lung(2)	urinary_tract(1)	1						c.(178-180)ATG>GTG		inositol polyphosphate-5-phosphatase, 75kDa							79.0	77.0	78.0					1																	38409540		1976	4152	6128	SO:0001583	missense	3633				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding	g.chr1:38409540T>C	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.178A>G	1.37:g.38409540T>C	ENSP00000362117:p.Met60Val		Somatic				INPP5B_uc009vvk.1_Missense_Mutation_p.M1V|INPP5B_uc001cch.2_Missense_Mutation_p.M1V	p.M60V	NM_005540	NP_005531	Capture	Illumina GAIIx	Phase_I	P32019	I5P2_HUMAN			4	272	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	60					C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	37	c.178A>G		.	.	.	.	.	.	.	.	.	.	T	20.5	3.995421	0.74703	.	.	ENSG00000204084	ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024;ENST00000373021	D;D;D;T	0.92911	-3.08;-3.08;-3.13;0.27	5.1	5.1	0.69264	.	0.108809	0.64402	D	0.000019	D	0.94473	0.8221	M	0.66939	2.045	0.80722	D	1	P;P;P	0.47484	0.896;0.764;0.764	D;P;P	0.63283	0.913;0.896;0.896	D	0.94125	0.7383	10	0.49607	T	0.09	.	11.5601	0.50772	0.0:0.0:0.0:1.0	.	60;60;60	P32019;B1ARF3;P32019-2	I5P2_HUMAN;.;.	V	60	ENSP00000362114:M60V;ENSP00000362117:M60V;ENSP00000362115:M60V;ENSP00000362112:M60V	ENSP00000362112:M60V	M	-	1	0	INPP5B	38182127	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.832000	0.62759	2.038000	0.60285	0.379000	0.24179	ATG		PASS	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540		58	79	---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39800990	39800990	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:39800990G>C	ENST00000372915.3	+	36	8832	c.8745G>C	c.(8743-8745)caG>caC	p.Q2915H	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.Q2910H|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.Q2947H|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.Q1350H|MACF1_ENST00000539005.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2915					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.Q1350H(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGAAGAGCAGGAAAAAGCAG	0.353																																						uc010oiu.1																			1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(4048-4050)CAG>CAC		microfilament and actin filament cross-linker							48.0	53.0	51.0					1																	39800990		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39800990G>C	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8745G>C	1.37:g.39800990G>C	ENSP00000362006:p.Gln2915His		Somatic				MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	p.Q1350H	NM_033044	NP_149033	Capture	Illumina GAIIx	Phase_I	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		1	4181	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	2915					B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.4050G>C		.	.	.	.	.	.	.	.	.	.	G	12.37	1.918289	0.33908	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.63913	-0.07;0.97	4.96	-1.22	0.09494	.	0.726004	0.12250	N	0.485734	T	0.47820	0.1466	N	0.14661	0.345	0.26948	N	0.966096	P	0.40731	0.728	P	0.49301	0.606	T	0.44003	-0.9356	10	0.66056	D	0.02	.	3.6318	0.08134	0.4745:0.0:0.3477:0.1778	.	2915	Q9UPN3	MACF1_HUMAN	H	2915;1350	ENSP00000362006:Q2915H;ENSP00000289893:Q1350H	ENSP00000289893:Q1350H	Q	+	3	2	MACF1	39573577	0.000000	0.05858	0.699000	0.30290	0.758000	0.43043	-0.521000	0.06245	-0.041000	0.13558	0.467000	0.42956	CAG		PASS	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		71	87	---	---	---	---
HOOK1	51361	broad.mit.edu	37	1	60330309	60330309	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:60330309C>A	ENST00000371208.3	+	17	1889	c.1632C>A	c.(1630-1632)agC>agA	p.S544R	HOOK1_ENST00000465876.1_Intron|HOOK1_ENST00000395561.2_Missense_Mutation_p.S502R	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	544	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)	p.S544R(1)		biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TATAGTCCAGCAAATTAAAGC	0.328																																						uc009wad.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1630-1632)AGC>AGA		hook homolog 1							58.0	70.0	66.0					1																	60330309		2203	4297	6500	SO:0001583	missense	51361				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding	g.chr1:60330309C>A	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1632C>A	1.37:g.60330309C>A	ENSP00000360252:p.Ser544Arg		Somatic				HOOK1_uc001czo.2_Missense_Mutation_p.S544R|HOOK1_uc001czp.2_Intron|HOOK1_uc010oor.1_Missense_Mutation_p.S502R	p.S544R	NM_015888	NP_056972	Capture	Illumina GAIIx	Phase_I	Q9UJC3	HOOK1_HUMAN			18	1734	+	all_cancers(7;0.000129)		544			Sufficient for interaction with microtubules.|Potential.		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	37	c.1632C>A	CCDS612.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679236	0.47886	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.19394	2.15;2.15	5.64	4.69	0.59074	.	0.091073	0.85682	D	0.000000	T	0.42698	0.1214	M	0.71581	2.175	0.53005	D	0.99996	D	0.63046	0.992	D	0.69142	0.962	T	0.13255	-1.0516	10	0.16896	T	0.51	.	16.6542	0.85224	0.0:0.8708:0.1292:0.0	.	544	Q9UJC3	HOOK1_HUMAN	R	544;502	ENSP00000360252:S544R;ENSP00000378928:S502R	ENSP00000360252:S544R	S	+	3	2	HOOK1	60102897	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.422000	0.44696	2.664000	0.90586	0.655000	0.94253	AGC		PASS	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888		42	77	---	---	---	---
ERICH3	127254	broad.mit.edu	37	1	75114930	75114930	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:75114930C>T	ENST00000326665.5	-	2	311	c.93G>A	c.(91-93)agG>agA	p.R31R		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		31								p.R31R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AGAGATGACGCCTTATCCTTG	0.353																																						uc001dgg.2																			1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(91-93)AGG>AGA		hypothetical protein LOC127254							120.0	115.0	116.0					1																	75114930		2203	4300	6503	SO:0001819	synonymous_variant	127254							g.chr1:75114930C>T																												ENST00000326665.5:c.93G>A	1.37:g.75114930C>T			Somatic					p.R31R	NM_001002912	NP_001002912	Capture	Illumina GAIIx	Phase_I	Q5RHP9	CA173_HUMAN			2	312	-			31					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	c.93G>A	CCDS30755.1																																																																																				PASS	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			69	104	---	---	---	---
LHX8	431707	broad.mit.edu	37	1	75606791	75606791	+	Splice_Site	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:75606791G>T	ENST00000294638.5	+	5	1053	c.389G>T	c.(388-390)aGa>aTa	p.R130I	LHX8_ENST00000356261.3_Splice_Site_p.R120I|LHX8_ENST00000559413.1_3'UTR	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	130	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R130I(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GATTATTTCAGGTATGCTGTG	0.358																																						uc001dgo.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(388-390)AGA>ATA		LIM homeobox 8							73.0	71.0	72.0					1																	75606791		2203	4299	6502	SO:0001630	splice_region_variant	431707					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:75606791G>T	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.389+1G>T	1.37:g.75606791G>T			Somatic				LHX8_uc001dgq.2_Missense_Mutation_p.R69I	p.R130I	NM_001001933	NP_001001933	Capture	Illumina GAIIx	Phase_I	Q68G74	LHX8_HUMAN			5	1053	+			130			LIM zinc-binding 1.		E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	c.389G>T	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834965	0.91036	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.88277	-2.36;-2.36	5.55	5.55	0.83447	Zinc finger, LIM-type (3);	0.042646	0.85682	D	0.000000	D	0.94886	0.8347	M	0.89478	3.035	0.80722	D	1	D	0.63046	0.992	D	0.65987	0.94	D	0.95154	0.8275	10	0.72032	D	0.01	.	19.4996	0.95089	0.0:0.0:1.0:0.0	.	130	Q68G74	LHX8_HUMAN	I	130;120	ENSP00000294638:R130I;ENSP00000348597:R120I	ENSP00000294638:R130I	R	+	2	0	LHX8	75379379	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	9.476000	0.97823	2.606000	0.88127	0.650000	0.86243	AGA		PASS	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	Missense_Mutation	31	141	---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79404919	79404919	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:79404919A>G	ENST00000370742.3	-	4	413	c.350T>C	c.(349-351)tTa>tCa	p.L117S		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	117					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.L117S(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GACATTATCTAAATGGCAGTT	0.244																																						uc001diq.3																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(349-351)TTA>TCA		EGF, latrophilin and seven transmembrane domain							39.0	40.0	39.0					1																	79404919		1779	4030	5809	SO:0001583	missense	64123				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr1:79404919A>G	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.350T>C	1.37:g.79404919A>G	ENSP00000359778:p.Leu117Ser		Somatic					p.L117S	NM_022159	NP_071442	Capture	Illumina GAIIx	Phase_I	Q9HBW9	ELTD1_HUMAN		COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	4	506	-			117			Extracellular (Potential).		B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	c.350T>C	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.580435	0.46006	.	.	ENSG00000162618	ENST00000370742	T	0.35973	1.28	6.07	6.07	0.98685	.	0.368199	0.28349	N	0.015669	T	0.20740	0.0499	M	0.61703	1.905	0.33616	D	0.60421	B	0.32717	0.381	B	0.31751	0.135	T	0.16748	-1.0392	9	.	.	.	.	11.1333	0.48360	0.9288:0.0:0.0712:0.0	.	117	Q9HBW9	ELTD1_HUMAN	S	117	ENSP00000359778:L117S	.	L	-	2	0	ELTD1	79177507	1.000000	0.71417	0.981000	0.43875	0.883000	0.51084	2.003000	0.40844	2.330000	0.79161	0.477000	0.44152	TTA		PASS	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159		10	10	---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94564446	94564446	+	Silent	SNP	C	C	A	rs61751417|rs63749080|rs63749081|rs63749082|rs140972064|rs63749056|rs63749055	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:94564446C>A	ENST00000370225.3	-	6	758	c.672G>T	c.(670-672)acG>acT	p.T224T	ABCA4_ENST00000535735.1_Silent_p.T224T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	224			T -> M (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.T224T(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATAGCGCACCGTCTTTGCCC	0.597																																						uc001dqh.2																			1	Substitution - coding silent(1)	p.T224M(1)	lung(1)	ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12						c.(670-672)ACG>ACT		ATP-binding cassette, sub-family A member 4							82.0	78.0	80.0					1																	94564446		2203	4300	6503	SO:0001819	synonymous_variant	24				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr1:94564446C>A	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.672G>T	1.37:g.94564446C>A			Somatic				ABCA4_uc010otn.1_Silent_p.T224T	p.T224T	NM_000350	NP_000341	Capture	Illumina GAIIx	Phase_I	P78363	ABCA4_HUMAN		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)	6	776	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	224		T -> M (in a breast cancer sample; somatic mutation).	Extracellular.		O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	c.672G>T	CCDS747.1																																																																																				PASS	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		22	84	---	---	---	---
ARHGAP29	9411	broad.mit.edu	37	1	94685905	94685905	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:94685905G>T	ENST00000260526.6	-	3	431	c.249C>A	c.(247-249)ctC>ctA	p.L83L	ARHGAP29_ENST00000370217.3_Silent_p.L83L	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	83					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)	p.L83L(1)		NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTAAAACACGGAGCAGTTCCT	0.313																																						uc001dqj.3																			1	Substitution - coding silent(1)		lung(1)	breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11						c.(247-249)CTC>CTA		PTPL1-associated RhoGAP 1							85.0	85.0	85.0					1																	94685905		2202	4297	6499	SO:0001819	synonymous_variant	9411				Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity	g.chr1:94685905G>T		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.249C>A	1.37:g.94685905G>T			Somatic				ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dql.2_Silent_p.L83L	p.L83L	NM_004815	NP_004806	Capture	Illumina GAIIx	Phase_I	Q52LW3	RHG29_HUMAN		all cancers(265;0.0187)|Epithelial(280;0.159)	3	618	-		all_lung(203;0.000732)|Lung NSC(277;0.00328)	83					O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Silent	SNP	ENST00000260526.6	37	c.249C>A	CCDS748.1																																																																																				PASS	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815		95	92	---	---	---	---
SLC25A24	29957	broad.mit.edu	37	1	108681680	108681680	+	Splice_Site	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:108681680C>A	ENST00000565488.1	-	9	1468	c.1249G>T	c.(1249-1251)Gcc>Tcc	p.A417S	SLC25A24_ENST00000370041.4_Splice_Site_p.A398S	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	417					ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)	p.A398S(1)|p.A417S(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		AAAAATTCACCTTGAGCCTGC	0.473																																						uc001dvn.3																			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1249-1251)GCC>TCC		solute carrier family 25 member 24 isoform 1							64.0	60.0	62.0					1																	108681680		2203	4300	6503	SO:0001630	splice_region_variant	29957				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding	g.chr1:108681680C>A	AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.1249+1G>T	1.37:g.108681680C>A			Somatic				SLC25A24_uc001dvm.2_Missense_Mutation_p.A398S	p.A417S	NM_013386	NP_037518	Capture	Illumina GAIIx	Phase_I	Q6NUK1	SCMC1_HUMAN		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)	9	1463	-		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)	417			Mitochondrial matrix (Potential).|Solcar 3.		B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Missense_Mutation	SNP	ENST00000565488.1	37	c.1249G>T	CCDS41361.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268979	0.80469	.	.	ENSG00000085491	ENST00000264128;ENST00000370041	T	0.79653	-1.29	5.5	5.5	0.81552	Mitochondrial carrier domain (2);	0.047499	0.85682	N	0.000000	T	0.74473	0.3721	L	0.49126	1.545	0.80722	D	1	P;P	0.38148	0.62;0.566	B;B	0.42692	0.395;0.274	T	0.72734	-0.4204	9	.	.	.	-13.3638	18.5685	0.91126	0.0:1.0:0.0:0.0	.	417;398	Q6NUK1;Q6NUK1-2	SCMC1_HUMAN;.	S	417;398	ENSP00000359058:A398S	.	A	-	1	0	SLC25A24	108483203	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.580000	0.82523	2.861000	0.98227	0.655000	0.94253	GCC		PASS	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	Missense_Mutation	17	95	---	---	---	---
CSDE1	7812	broad.mit.edu	37	1	115275301	115275301	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:115275301C>T	ENST00000358528.4	-	10	1400	c.974G>A	c.(973-975)cGt>cAt	p.R325H	CSDE1_ENST00000530886.1_Missense_Mutation_p.R195H|CSDE1_ENST00000369530.1_Missense_Mutation_p.R340H|CSDE1_ENST00000438362.2_Missense_Mutation_p.R371H|CSDE1_ENST00000339438.6_Missense_Mutation_p.R294H|CSDE1_ENST00000261443.5_Missense_Mutation_p.R294H|CSDE1_ENST00000534699.1_Missense_Mutation_p.R325H	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	325	CSD 4; truncated.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R325H(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAATTTGTCACGTCGGTCTGT	0.403																																						uc001efk.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(973-975)CGT>CAT		upstream of NRAS isoform 1							189.0	186.0	187.0					1																	115275301		2203	4300	6503	SO:0001583	missense	7812				male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding	g.chr1:115275301C>T		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.974G>A	1.37:g.115275301C>T	ENSP00000351329:p.Arg325His		Somatic				CSDE1_uc001efi.2_Missense_Mutation_p.R371H|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.R294H|CSDE1_uc001efm.2_Missense_Mutation_p.R340H|CSDE1_uc009wgv.2_Missense_Mutation_p.R325H|CSDE1_uc001efn.2_Missense_Mutation_p.R294H	p.R325H	NM_001007553	NP_001007554	Capture	Illumina GAIIx	Phase_I	O75534	CSDE1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	10	1440	-	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	325			CSD 4; truncated.		A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	c.974G>A	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	C	35	5.460528	0.96240	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	5.89	5.89	0.94794	.	0.047973	0.85682	D	0.000000	T	0.74129	0.3676	L	0.57536	1.79	0.80722	D	1	D;D;D	0.76494	0.986;0.999;0.999	B;D;D	0.78314	0.425;0.98;0.991	T	0.74228	-0.3733	9	0.66056	D	0.02	-0.0611	20.2374	0.98362	0.0:1.0:0.0:0.0	.	340;325;371	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	H	294;371;325;294;195;340;325	.	ENSP00000261443:R294H	R	-	2	0	CSDE1	115076824	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.787000	0.95880	0.591000	0.81541	CGT		PASS	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158		22	328	---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115537564	115537564	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:115537564G>A	ENST00000369522.3	+	32	3095	c.2855G>A	c.(2854-2856)cGg>cAg	p.R952Q	SYCP1_ENST00000369518.1_Missense_Mutation_p.R952Q|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	952					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.R952Q(1)|p.R952P(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAAAAATGCGGGAGGACCGT	0.333																																						uc001efr.2																			2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2854-2856)CGG>CAG		synaptonemal complex protein 1							64.0	70.0	68.0					1																	115537564		2203	4299	6502	SO:0001583	missense	6847				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding	g.chr1:115537564G>A	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2855G>A	1.37:g.115537564G>A	ENSP00000358535:p.Arg952Gln		Somatic				SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.R952Q|SYCP1_uc009wgw.2_Missense_Mutation_p.R927Q	p.R952Q	NM_003176	NP_003167	Capture	Illumina GAIIx	Phase_I	Q15431	SYCP1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	32	3064	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	952					O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	c.2855G>A	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	8.106	0.777786	0.16120	.	.	ENSG00000198765	ENST00000369522;ENST00000369518	T;T	0.48836	0.8;0.8	4.89	-4.82	0.03171	.	0.548707	0.17277	N	0.180141	T	0.11239	0.0274	N	0.20401	0.57	0.09310	N	1	B;B	0.16166	0.016;0.016	B;B	0.08055	0.003;0.003	T	0.22695	-1.0209	10	0.49607	T	0.09	2.5077	10.3325	0.43831	0.253:0.125:0.6219:0.0	.	952;952	B7ZLS9;Q15431	.;SYCP1_HUMAN	Q	952	ENSP00000358535:R952Q;ENSP00000358531:R952Q	ENSP00000358531:R952Q	R	+	2	0	SYCP1	115339087	0.000000	0.05858	0.001000	0.08648	0.155000	0.21991	-0.042000	0.12063	-1.005000	0.03417	-0.391000	0.06502	CGG		PASS	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176		7	214	---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152084302	152084302	+	Missense_Mutation	SNP	G	G	C	rs371113568	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:152084302G>C	ENST00000368804.1	-	2	1390	c.1391C>G	c.(1390-1392)aCg>aGg	p.T464R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	464	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.T464R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			gtgcctctccgtctcctcctc	0.672																																						uc001ezp.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(1390-1392)ACG>AGG		trichohyalin							56.0	62.0	60.0					1																	152084302		2129	4243	6372	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152084302G>C	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1391C>G	1.37:g.152084302G>C	ENSP00000357794:p.Thr464Arg		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.T464R	p.T464R	NM_007113	NP_009044	Capture	Illumina GAIIx	Phase_I	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1391	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		464			9 X 28 AA approximate tandem repeats.		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.1391C>G	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	g	0.016	-1.534896	0.00942	.	.	ENSG00000159450	ENST00000368804	T	0.05786	3.39	.	.	.	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.32800	0.385	B	0.16289	0.015	T	0.46219	-0.9207	7	0.16420	T	0.52	.	.	.	.	.	464	Q07283	TRHY_HUMAN	R	464	ENSP00000357794:T464R	ENSP00000357794:T464R	T	-	2	0	TCHH	150350926	0.000000	0.05858	0.006000	0.13384	0.017000	0.09413	-2.179000	0.01259	-1.386000	0.02098	-1.411000	0.01122	ACG		PASS	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		22	158	---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152193243	152193243	+	Missense_Mutation	SNP	A	A	T	rs150800529	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:152193243A>T	ENST00000368801.2	-	3	937	c.862T>A	c.(862-864)Tct>Act	p.S288T	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	288					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S288T(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGGAACCAGACCCATGCTGA	0.597													A|||	2	0.000399361	0.0	0.0014	5008	,	,		21065	0.0		0.001	False		,,,				2504	0.0					uc001ezt.1																			1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(862-864)TCT>ACT		hornerin		A	THR/SER	0,4406		0,0,2203	232.0	216.0	222.0		862	2.0	0.0	1	dbSNP_134	222	3,8597	3.0+/-9.4	0,3,4297	no	missense	HRNR	NM_001009931.1	58	0,3,6500	TT,TA,AA		0.0349,0.0,0.0231	probably-damaging	288/2851	152193243	3,13003	2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152193243A>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.862T>A	1.37:g.152193243A>T	ENSP00000357791:p.Ser288Thr		Somatic					p.S288T	NM_001009931	NP_001009931	Capture	Illumina GAIIx	Phase_I	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	938	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		288			3.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.862T>A	CCDS30859.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	8.636	0.894802	0.17613	0.0	3.49E-4	ENSG00000197915	ENST00000368801	T	0.01572	4.76	4.36	2.04	0.26737	.	.	.	.	.	T	0.00815	0.0027	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	P	0.59948	0.866	T	0.49978	-0.8881	9	0.13470	T	0.59	.	7.045	0.25040	0.8053:0.0:0.1947:0.0	.	288	Q86YZ3	HORN_HUMAN	T	288	ENSP00000357791:S288T	ENSP00000357791:S288T	S	-	1	0	HRNR	150459867	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.147000	0.10234	0.238000	0.21222	-0.262000	0.10625	TCT		PASS	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		77	733	---	---	---	---
LENEP	55891	broad.mit.edu	37	1	154966181	154966181	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:154966181G>A	ENST00000392487.1	+	1	118	c.98G>A	c.(97-99)gGc>gAc	p.G33D				Q9Y5L5	LENEP_HUMAN	lens epithelial protein	33					multicellular organismal development (GO:0007275)		DNA binding (GO:0003677)	p.G33D(1)		lung(2)	2	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATTAAGATGGGCACAGGGTGG	0.607																																						uc001fgi.2																			1	Substitution - Missense(1)		lung(1)		0						c.(97-99)GGC>GAC		lens epithelial protein							76.0	74.0	75.0					1																	154966181		2203	4300	6503	SO:0001583	missense	55891				multicellular organismal development		DNA binding	g.chr1:154966181G>A	AF268478	CCDS1080.1	1q22.2	2008-02-05			ENSG00000163352	ENSG00000163352			14429	protein-coding gene	gene with protein product		607377				10655141, 11376938	Standard	NM_018655		Approved	LEP503	uc001fgi.3	Q9Y5L5	OTTHUMG00000037417	ENST00000392487.1:c.98G>A	1.37:g.154966181G>A	ENSP00000376278:p.Gly33Asp		Somatic					p.G33D	NM_018655	NP_061125	Capture	Illumina GAIIx	Phase_I	Q9Y5L5	LENEP_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		1	120	+	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		33					B5BUM1|Q5T1A4	Missense_Mutation	SNP	ENST00000392487.1	37	c.98G>A	CCDS1080.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929257	0.34096	.	.	ENSG00000163352	ENST00000392487	.	.	.	5.17	4.23	0.50019	.	0.000000	0.39687	N	0.001291	T	0.33000	0.0848	.	.	.	0.33884	D	0.636521	P	0.50272	0.933	P	0.44811	0.461	T	0.38542	-0.9656	8	0.72032	D	0.01	-11.4898	11.8583	0.52451	0.0:0.3407:0.6593:0.0	.	33	Q9Y5L5	LENEP_HUMAN	D	33	.	ENSP00000357412:G33D	G	+	2	0	LENEP	153232805	1.000000	0.71417	0.946000	0.38457	0.997000	0.91878	1.596000	0.36718	1.369000	0.46134	0.563000	0.77884	GGC		PASS	LENEP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385609.2	NM_018655		9	210	---	---	---	---
MUC1	4582	broad.mit.edu	37	1	155162052	155162052	+	Silent	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:155162052T>A	ENST00000368395.1	-	2	152	c.81A>T	c.(79-81)gcA>gcT	p.A27A	MUC1_ENST00000338684.5_Silent_p.A36A|MUC1_ENST00000368392.3_Silent_p.A36A|RP11-201K10.3_ENST00000473363.2_5'Flank|MIR92B_ENST00000607575.1_RNA|MUC1_ENST00000342482.4_Silent_p.A36A|MUC1_ENST00000462215.1_5'UTR|MUC1_ENST00000368398.3_Silent_p.A27A|MUC1_ENST00000368390.3_Silent_p.A27A|MUC1_ENST00000457295.2_Silent_p.A36A|MUC1_ENST00000438413.1_Silent_p.A27A|MUC1_ENST00000368396.4_Silent_p.A36A|MUC1_ENST00000337604.5_Silent_p.A27A|MUC1_ENST00000343256.5_Silent_p.A27A|MUC1_ENST00000368393.3_Silent_p.A27A|MUC1_ENST00000368389.2_Silent_p.A27A	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	27					cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)	p.A27A(2)|p.A36A(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGTAGAGCTTGCATGACCAG	0.483			T	IGH@	B-NHL																																	uc010pft.1				Dom	yes		1	1q21	4582	T	"""mucin 1, transmembrane"""			L	IGH@		B-NHL		3	Substitution - coding silent(3)		lung(3)	large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						c.(79-81)GCA>GCT		SubName: Full=MUC1 isoform M13;							134.0	139.0	137.0					1																	155162052		2203	4299	6502	SO:0001819	synonymous_variant	4582					apical plasma membrane|cell surface|cytoplasm|extracellular region|integral to plasma membrane|nucleus	protein binding	g.chr1:155162052T>A	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.81A>T	1.37:g.155162052T>A			Somatic				RAG1AP1_uc010pey.1_Intron|MUC1_uc001fhy.2_5'Flank|MUC1_uc001fhz.2_5'Flank|MUC1_uc010pfb.1_5'UTR|MUC1_uc010pfc.1_RNA|MUC1_uc009wph.2_5'UTR|MUC1_uc010pfd.1_Missense_Mutation_p.Q2L|MUC1_uc010pfe.1_RNA|MUC1_uc010pff.1_Missense_Mutation_p.Q76L|MUC1_uc009wpi.2_5'UTR|MUC1_uc010pfg.1_RNA|MUC1_uc010pfh.1_Missense_Mutation_p.Q76L|MUC1_uc010pfi.1_Missense_Mutation_p.Q76L|MUC1_uc010pfj.1_Missense_Mutation_p.Q76L|MUC1_uc010pfk.1_RNA|MUC1_uc010pfl.1_RNA|MUC1_uc001fin.2_Silent_p.A36A|MUC1_uc009wpk.2_Intron|MUC1_uc001fip.2_Missense_Mutation_p.Q2L|MUC1_uc009wqg.2_Missense_Mutation_p.Q2L|MUC1_uc009wpo.2_Intron|MUC1_uc009wps.2_Silent_p.A36A|MUC1_uc009wpt.2_Silent_p.A36A|MUC1_uc001fic.2_Silent_p.A27A|MUC1_uc009wpu.2_RNA|MUC1_uc009wpq.2_Intron|MUC1_uc009wpv.2_Missense_Mutation_p.Q2L|MUC1_uc001fim.2_Silent_p.A27A|MUC1_uc001fib.2_Missense_Mutation_p.Q2L|MUC1_uc009wpw.2_Silent_p.A36A|MUC1_uc001fie.2_Silent_p.A27A|MUC1_uc009wpr.2_Intron|MUC1_uc001fig.2_Silent_p.A36A|MUC1_uc001fif.2_Silent_p.A27A|MUC1_uc009wpx.2_Silent_p.A36A|MUC1_uc001fid.2_Silent_p.A27A|MUC1_uc009wpj.2_RNA|MUC1_uc001fij.2_Silent_p.A36A|MUC1_uc009wpy.2_RNA|MUC1_uc010pfm.1_5'UTR|MUC1_uc001fiq.2_5'UTR|MUC1_uc009wpz.2_Silent_p.A36A|MUC1_uc010pfn.1_Silent_p.A27A|MUC1_uc009wqa.2_Missense_Mutation_p.Q2L|MUC1_uc010pfo.1_Missense_Mutation_p.Q2L|MUC1_uc010pfp.1_Missense_Mutation_p.Q2L|MUC1_uc001fii.2_RNA|MUC1_uc001fih.2_RNA|MUC1_uc001fia.2_Silent_p.A27A|MUC1_uc009wqc.2_Missense_Mutation_p.Q2L|MUC1_uc009wqd.2_Missense_Mutation_p.Q2L|MUC1_uc009wqb.2_5'UTR|MUC1_uc010pfq.1_Missense_Mutation_p.Q2L|MUC1_uc010pfr.1_Silent_p.A36A|MUC1_uc001fit.2_5'UTR|MUC1_uc009wqe.2_Silent_p.A36A|MUC1_uc001fil.2_Silent_p.A27A|MUC1_uc009wpm.2_Silent_p.A27A|MUC1_uc009wpp.2_Silent_p.A27A|MUC1_uc010pfs.1_RNA|MUC1_uc001fik.2_Silent_p.A27A|MUC1_uc001fio.2_Silent_p.A27A|MUC1_uc009wqf.2_Missense_Mutation_p.Q2L|MUC1_uc009wpl.2_Silent_p.A36A|MUC1_uc009wpn.2_Silent_p.A36A|MUC1_uc001fis.1_Silent_p.A27A|uc009wqh.2_5'Flank|MUC1_uc001fiv.1_Silent_p.A36A|MUC1_uc001fiw.1_Silent_p.A27A|MIR92B_hsa-mir-92b|MI0003560_5'Flank	p.A27A			Capture	Illumina GAIIx	Phase_I	P15941	MUC1_HUMAN	Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		2	147	-	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		27			Extracellular (Potential).		A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Silent	SNP	ENST00000368395.1	37	c.81A>T	CCDS55640.1																																																																																				PASS	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086735.1	NM_002456		10	424	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158613124	158613124	+	Missense_Mutation	SNP	C	C	T	rs370469842		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:158613124C>T	ENST00000368147.4	-	31	4610	c.4430G>A	c.(4429-4431)cGt>cAt	p.R1477H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1477					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1477H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTCTAGTACACGTTGGAGCCG	0.443																																						uc001fst.1																			1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4429-4431)CGT>CAT		spectrin, alpha, erythrocytic 1		C	HIS/ARG	0,3878		0,0,1939	130.0	129.0	129.0		4430	-0.9	0.0	1		129	2,8288		0,2,4143	no	missense	SPTA1	NM_003126.2	29	0,2,6082	TT,TC,CC		0.0241,0.0,0.0164	benign	1477/2420	158613124	2,12166	1939	4145	6084	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158613124C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4430G>A	1.37:g.158613124C>T	ENSP00000357129:p.Arg1477His		Somatic					p.R1477H	NM_003126	NP_003117	Capture	Illumina GAIIx	Phase_I	P02549	SPTA1_HUMAN			31	4629	-	all_hematologic(112;0.0378)		1477			Spectrin 14.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.4430G>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731230	0.30684	0.0	2.41E-4	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34472	1.36;1.36	5.22	-0.928	0.10448	.	0.780519	0.10162	N	0.708223	T	0.11750	0.0286	L	0.37561	1.115	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.39292	-0.9621	10	0.45353	T	0.12	.	10.5949	0.45331	0.0:0.3456:0.0:0.6544	.	1477	P02549	SPTA1_HUMAN	H	1477	ENSP00000357130:R1477H;ENSP00000357129:R1477H	ENSP00000357129:R1477H	R	-	2	0	SPTA1	156879748	0.250000	0.23951	0.003000	0.11579	0.949000	0.60115	0.992000	0.29667	-0.065000	0.13021	0.655000	0.94253	CGT		PASS	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		27	223	---	---	---	---
PYHIN1	149628	broad.mit.edu	37	1	158908901	158908901	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:158908901G>C	ENST00000368140.1	+	4	688	c.443G>C	c.(442-444)gGa>gCa	p.G148A	PYHIN1_ENST00000392252.3_Missense_Mutation_p.G139A|PYHIN1_ENST00000392254.2_Missense_Mutation_p.G148A|PYHIN1_ENST00000368135.4_Missense_Mutation_p.G148A|PYHIN1_ENST00000368138.3_Missense_Mutation_p.G139A	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	148					cell cycle (GO:0007049)	nucleus (GO:0005634)		p.G148A(2)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					GAAGAGACTGGAACCAAAAGG	0.453																																						uc001ftb.2																			2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(1)	4						c.(442-444)GGA>GCA		pyrin and HIN domain family, member 1 alpha 1							75.0	72.0	73.0					1																	158908901		2203	4300	6503	SO:0001583	missense	149628				cell cycle	nuclear speck		g.chr1:158908901G>C	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.443G>C	1.37:g.158908901G>C	ENSP00000357122:p.Gly148Ala		Somatic				PYHIN1_uc001fta.3_Missense_Mutation_p.G148A|PYHIN1_uc001ftc.2_Missense_Mutation_p.G139A|PYHIN1_uc001ftd.2_Missense_Mutation_p.G148A|PYHIN1_uc001fte.2_Missense_Mutation_p.G139A	p.G148A	NM_152501	NP_689714	Capture	Illumina GAIIx	Phase_I	Q6K0P9	IFIX_HUMAN			4	688	+	all_hematologic(112;0.0378)		148					Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	c.443G>C	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332588	0.24167	.	.	ENSG00000163564	ENST00000458222;ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252;ENST00000368135	T;T;T;T;T;T	0.32515	1.45;3.51;3.53;3.54;3.55;1.71	2.27	-1.86	0.07760	.	.	.	.	.	T	0.11367	0.0277	L	0.51422	1.61	0.09310	N	1	B;B;B;B;P	0.45715	0.162;0.162;0.36;0.245;0.865	B;B;B;B;P	0.47673	0.102;0.102;0.102;0.032;0.554	T	0.12734	-1.0536	9	0.21014	T	0.42	.	3.092	0.06297	0.3903:0.2235:0.3862:0.0	.	139;148;139;148;148	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9;Q6K0P9-5	.;.;.;IFIX_HUMAN;.	A	148;148;139;148;139;148	ENSP00000407616:G148A;ENSP00000357122:G148A;ENSP00000357120:G139A;ENSP00000376083:G148A;ENSP00000376082:G139A;ENSP00000357117:G148A	ENSP00000357117:G148A	G	+	2	0	PYHIN1	157175525	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.205000	0.03014	-0.473000	0.06871	0.557000	0.71058	GGA		PASS	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		22	177	---	---	---	---
TNN	63923	broad.mit.edu	37	1	175086168	175086168	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:175086168A>G	ENST00000239462.4	+	10	2326	c.2213A>G	c.(2212-2214)tAt>tGt	p.Y738C		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	738	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.Y738C(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATTGACAGGTATGTGGTGCGC	0.612																																						uc001gkl.1																			1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2212-2214)TAT>TGT		tenascin N precursor							75.0	75.0	75.0					1																	175086168		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086168A>G	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2213A>G	1.37:g.175086168A>G	ENSP00000239462:p.Tyr738Cys		Somatic					p.Y738C	NM_022093	NP_071376	Capture	Illumina GAIIx	Phase_I	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2326	+		Breast(1374;0.000962)	738			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2213A>G	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.138850	0.56936	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.78481	-1.18	5.37	5.37	0.77165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.159055	0.43919	D	0.000518	D	0.92303	0.7558	H	0.97874	4.095	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.94757	0.7932	10	0.87932	D	0	.	13.9036	0.63821	1.0:0.0:0.0:0.0	.	738	Q9UQP3	TENN_HUMAN	C	738;561	ENSP00000239462:Y738C	ENSP00000239462:Y738C	Y	+	2	0	TNN	173352791	1.000000	0.71417	0.978000	0.43139	0.242000	0.25591	7.882000	0.87258	2.164000	0.68074	0.533000	0.62120	TAT		PASS	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		189	82	---	---	---	---
PAPPA2	60676	broad.mit.edu	37	1	176563832	176563832	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:176563832G>T	ENST00000367662.3	+	3	2256	c.1092G>T	c.(1090-1092)tgG>tgT	p.W364C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.W364C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	364					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.W364C(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CAGGCACATGGACCCATGTGG	0.577																																						uc001gkz.2																			2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1090-1092)TGG>TGT		pappalysin 2 isoform 1							63.0	65.0	65.0					1																	176563832		2116	4228	6344	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176563832G>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1092G>T	1.37:g.176563832G>T	ENSP00000356634:p.Trp364Cys		Somatic				PAPPA2_uc001gky.1_Missense_Mutation_p.W364C|PAPPA2_uc009www.2_RNA	p.W364C	NM_020318	NP_064714	Capture	Illumina GAIIx	Phase_I	Q9BXP8	PAPP2_HUMAN			3	2256	+			364					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1092G>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914229	0.52546	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	D;D	0.86865	-2.18;-2.18	5.45	5.45	0.79879	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.94935	0.8362	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95607	0.8668	10	0.87932	D	0	-12.9858	18.8948	0.92419	0.0:0.0:1.0:0.0	.	364;364	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	364	ENSP00000356634:W364C;ENSP00000356633:W364C	ENSP00000356633:W364C	W	+	3	0	PAPPA2	174830455	1.000000	0.71417	0.997000	0.53966	0.184000	0.23303	9.689000	0.98673	2.555000	0.86185	0.650000	0.86243	TGG		PASS	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			24	150	---	---	---	---
CEP350	9857	broad.mit.edu	37	1	179993629	179993629	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:179993629C>T	ENST00000367607.3	+	14	3880	c.3462C>T	c.(3460-3462)tcC>tcT	p.S1154S		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1154	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S1154S(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ATGTTACCTCCCAGCATTCAT	0.413																																						uc001gnt.2																			2	Substitution - coding silent(2)		lung(2)	ovary(4)	4						c.(3460-3462)TCC>TCT		centrosome-associated protein 350							107.0	91.0	97.0					1																	179993629		2203	4300	6503	SO:0001819	synonymous_variant	9857					centrosome|nucleus|spindle		g.chr1:179993629C>T	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3462C>T	1.37:g.179993629C>T			Somatic				CEP350_uc009wxl.2_Silent_p.S1153S|CEP350_uc001gnu.2_Silent_p.S987S	p.S1154S	NM_014810	NP_055625	Capture	Illumina GAIIx	Phase_I	Q5VT06	CE350_HUMAN			14	3845	+			1154			Ser-rich.		O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	37	c.3462C>T	CCDS1336.1																																																																																				PASS	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		36	232	---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183086726	183086726	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:183086726G>T	ENST00000258341.4	+	10	2002	c.1745G>T	c.(1744-1746)cGa>cTa	p.R582L		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	582	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.R582L(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TTCTCCTTTCGAGTGGACAGG	0.498																																						uc001gpy.3																			1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|kidney(1)	5						c.(1744-1746)CGA>CTA		laminin, gamma 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						140.0	126.0	131.0					1																	183086726		2203	4300	6503	SO:0001583	missense	3915				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent	g.chr1:183086726G>T	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1745G>T	1.37:g.183086726G>T	ENSP00000258341:p.Arg582Leu		Somatic					p.R582L	NM_002293	NP_002284	Capture	Illumina GAIIx	Phase_I	P11047	LAMC1_HUMAN			10	2002	+			582			Laminin IV type A.		Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	c.1745G>T	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	34	5.357527	0.95854	.	.	ENSG00000135862	ENST00000258341	T	0.36878	1.23	5.14	5.14	0.70334	Laminin B type IV (2);Laminin B, subgroup (1);	0.060741	0.64402	D	0.000004	T	0.53562	0.1804	M	0.71581	2.175	0.80722	D	1	P	0.38223	0.623	P	0.48704	0.587	T	0.57266	-0.7841	10	0.66056	D	0.02	.	18.6006	0.91247	0.0:0.0:1.0:0.0	.	582	P11047	LAMC1_HUMAN	L	582	ENSP00000258341:R582L	ENSP00000258341:R582L	R	+	2	0	LAMC1	181353349	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	5.159000	0.64923	2.386000	0.81285	0.655000	0.94253	CGA		PASS	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293		214	104	---	---	---	---
CFH	3075	broad.mit.edu	37	1	196695983	196695983	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:196695983T>A	ENST00000367429.4	+	14	2389	c.2149T>A	c.(2149-2151)Ttc>Atc	p.F717I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	717	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.F717I(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TTCAGTGGAATTCAATTGCTC	0.438																																						uc001gtj.3																			1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)|breast(1)	6						c.(2149-2151)TTC>ATC		complement factor H isoform a precursor							114.0	112.0	113.0					1																	196695983		2203	4300	6503	SO:0001583	missense	3075				complement activation, alternative pathway	extracellular space		g.chr1:196695983T>A	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2149T>A	1.37:g.196695983T>A	ENSP00000356399:p.Phe717Ile		Somatic					p.F717I	NM_000186	NP_000177	Capture	Illumina GAIIx	Phase_I	P08603	CFAH_HUMAN			14	2389	+			717			Sushi 12.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	c.2149T>A	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	T	10.12	1.264355	0.23136	.	.	ENSG00000000971	ENST00000367429	T	0.68624	-0.34	5.6	4.48	0.54585	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.73613	0.3609	M	0.83223	2.63	0.23351	N	0.997858	D	0.55605	0.972	P	0.50109	0.631	T	0.66232	-0.5975	9	0.54805	T	0.06	.	8.2852	0.31924	0.0:0.0898:0.0:0.9102	.	717	P08603	CFAH_HUMAN	I	717	ENSP00000356399:F717I	ENSP00000356399:F717I	F	+	1	0	CFH	194962606	0.999000	0.42202	0.215000	0.23724	0.063000	0.16089	1.109000	0.31135	0.959000	0.37980	0.533000	0.62120	TTC		PASS	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186		59	314	---	---	---	---
KISS1	3814	broad.mit.edu	37	1	204159850	204159850	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:204159850G>T	ENST00000367194.4	-	3	327	c.179C>A	c.(178-180)gCt>gAt	p.A60D		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	60					cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.A60D(1)		large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		CCTGGCAGTAGCAGCTGGCTT	0.721																																						uc001har.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(178-180)GCT>GAT		KiSS-1 metastasis-suppressor							8.0	10.0	9.0					1																	204159850		1465	3426	4891	SO:0001583	missense	3814				cytoskeleton organization	extracellular region	protein binding	g.chr1:204159850G>T	U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.179C>A	1.37:g.204159850G>T	ENSP00000356162:p.Ala60Asp		Somatic					p.A60D	NM_002256	NP_002247	Capture	Illumina GAIIx	Phase_I	Q15726	KISS1_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)	3	333	-	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	60					A8K6N0|Q9HBP1	Missense_Mutation	SNP	ENST00000367194.4	37	c.179C>A	CCDS41454.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264073	0.39995	.	.	ENSG00000170498	ENST00000367194	T	0.80653	-1.4	3.9	-0.357	0.12579	.	1.891590	0.03415	N	0.205415	D	0.84561	0.5499	L	0.50333	1.59	0.09310	N	1	D	0.69078	0.997	D	0.68483	0.958	T	0.66826	-0.5825	10	0.49607	T	0.09	1.4388	4.1047	0.10032	0.3218:0.175:0.5032:0.0	.	60	Q15726	KISS1_HUMAN	D	60	ENSP00000356162:A60D	ENSP00000356162:A60D	A	-	2	0	KISS1	202426473	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.118000	0.03280	-0.187000	0.10516	0.655000	0.94253	GCT		PASS	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087892.1	NM_002256		12	11	---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204951102	204951102	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:204951102G>A	ENST00000401399.1	+	20	2623	c.2424G>A	c.(2422-2424)ggG>ggA	p.G808G	NFASC_ENST00000367169.4_Silent_p.G808G|NFASC_ENST00000404076.1_Silent_p.G787G|NFASC_ENST00000338586.6_Silent_p.G808G|NFASC_ENST00000404907.1_Silent_p.G804G|NFASC_ENST00000339876.6_Silent_p.G808G|NFASC_ENST00000367171.4_Silent_p.G793G|NFASC_ENST00000367172.4_Silent_p.G808G|NFASC_ENST00000360049.4_Silent_p.G804G|NFASC_ENST00000367170.4_Silent_p.G808G|NFASC_ENST00000539706.1_Silent_p.G804G|NFASC_ENST00000338515.6_Silent_p.G808G|NFASC_ENST00000513543.1_Silent_p.G804G			O94856	NFASC_HUMAN	neurofascin	808	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.G804G(1)|p.G808G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATGACTTCGGGAAGGGCCCTG	0.602																																						uc001hbj.2																			2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(2422-2424)GGG>GGA		neurofascin isoform 1 precursor							65.0	58.0	60.0					1																	204951102		2203	4300	6503	SO:0001819	synonymous_variant	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204951102G>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2424G>A	1.37:g.204951102G>A			Somatic				NFASC_uc010pra.1_Silent_p.G804G|NFASC_uc001hbi.2_Silent_p.G804G|NFASC_uc010prb.1_Silent_p.G819G|NFASC_uc010prc.1_Silent_p.G375G|NFASC_uc001hbk.1_Silent_p.G614G|NFASC_uc001hbl.1_Silent_p.G58G	p.G808G	NM_001005388	NP_001005388	Capture	Illumina GAIIx	Phase_I	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		21	2752	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		808			Extracellular (Potential).|Fibronectin type-III 2.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Silent	SNP	ENST00000401399.1	37	c.2424G>A	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	G	9.710	1.156904	0.21454	.	.	ENSG00000163531	ENST00000367173;ENST00000425360	T;T	0.68624	-0.34;-0.11	5.55	5.55	0.83447	.	0.000000	0.52532	D	0.000076	T	0.72946	0.3524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75642	-0.3247	7	0.87932	D	0	.	8.6467	0.34009	0.0773:0.0:0.7701:0.1526	.	.	.	.	E	778;40	ENSP00000356141:G778E;ENSP00000395664:G40E	ENSP00000356141:G778E	G	+	2	0	NFASC	203217725	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	0.720000	0.25896	2.614000	0.88457	0.563000	0.77884	GGA		PASS	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		5	80	---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216166470	216166470	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:216166470C>T	ENST00000307340.3	-	35	7083	c.6697G>A	c.(6697-6699)Gag>Aag	p.E2233K	USH2A_ENST00000366943.2_Missense_Mutation_p.E2233K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2233	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.E2233K(1)|p.E2233*(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTAGGGCCTCACTGGCCTCA	0.502										HNSCC(13;0.011)	OREG0014251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001hku.1																			2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(6697-6699)GAG>AAG		usherin isoform B							171.0	151.0	158.0					1																	216166470		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216166470C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6697G>A	1.37:g.216166470C>T	ENSP00000305941:p.Glu2233Lys	HNSCC(13;0.011)	Somatic	OREG0014251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2234		p.E2233K	NM_206933	NP_996816	Capture	Illumina GAIIx	Phase_I	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	35	7084	-			2233			Extracellular (Potential).|Fibronectin type-III 8.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.6697G>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	8.839	0.941776	0.18281	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53857	0.6;0.6	6.17	-2.51	0.06365	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.171350	0.06505	N	0.737011	T	0.33381	0.0861	L	0.40543	1.245	0.09310	N	1	B	0.20887	0.049	B	0.19666	0.026	T	0.22626	-1.0211	10	0.06365	T	0.9	.	3.1375	0.06443	0.1865:0.2356:0.4188:0.1592	.	2233	O75445	USH2A_HUMAN	K	2233	ENSP00000305941:E2233K;ENSP00000355910:E2233K	ENSP00000305941:E2233K	E	-	1	0	USH2A	214233093	0.000000	0.05858	0.275000	0.24674	0.931000	0.56810	-0.876000	0.04201	-0.069000	0.12931	0.655000	0.94253	GAG		PASS	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		82	368	---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216737638	216737638	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:216737638A>G	ENST00000408911.3	-	5	938	c.785T>C	c.(784-786)aTc>aCc	p.I262T	ESRRG_ENST00000366940.2_Missense_Mutation_p.I239T|ESRRG_ENST00000493603.1_Missense_Mutation_p.I239T|ESRRG_ENST00000493748.1_Missense_Mutation_p.I239T|ESRRG_ENST00000366937.1_Missense_Mutation_p.I274T|ESRRG_ENST00000361525.3_Missense_Mutation_p.I239T|ESRRG_ENST00000391890.3_Missense_Mutation_p.I246T|ESRRG_ENST00000366938.2_Missense_Mutation_p.I239T|ESRRG_ENST00000361395.2_Missense_Mutation_p.I239T|ESRRG_ENST00000463665.1_Missense_Mutation_p.I200T|ESRRG_ENST00000359162.2_Missense_Mutation_p.I239T|ESRRG_ENST00000487276.1_Missense_Mutation_p.I239T|ESRRG_ENST00000360012.3_Missense_Mutation_p.I239T	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	262					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.I262T(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	GAGGGCTTTGATGTCACTGTC	0.478																																						uc001hkw.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(784-786)ATC>ACC		estrogen-related receptor gamma isoform 1	Diethylstilbestrol(DB00255)						179.0	154.0	162.0					1																	216737638		2203	4300	6503	SO:0001583	missense	2104				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr1:216737638A>G	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.785T>C	1.37:g.216737638A>G	ENSP00000386171:p.Ile262Thr		Somatic				ESRRG_uc001hky.1_Missense_Mutation_p.I239T|ESRRG_uc009xdp.1_Missense_Mutation_p.I239T|ESRRG_uc001hkz.1_Missense_Mutation_p.I200T|ESRRG_uc010puc.1_Missense_Mutation_p.I239T|ESRRG_uc001hla.1_Missense_Mutation_p.I239T|ESRRG_uc001hlb.1_Missense_Mutation_p.I239T|ESRRG_uc010pud.1_Missense_Mutation_p.I70T|ESRRG_uc001hlc.1_Missense_Mutation_p.I239T|ESRRG_uc001hld.1_Missense_Mutation_p.I239T|ESRRG_uc001hkx.1_Missense_Mutation_p.I274T|ESRRG_uc009xdo.1_Missense_Mutation_p.I239T|ESRRG_uc001hle.1_Missense_Mutation_p.I239T	p.I262T	NM_001438	NP_001429	Capture	Illumina GAIIx	Phase_I	P62508	ERR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	5	951	-			262					A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	c.785T>C	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.172934	0.78452	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05	5.56	5.56	0.83823	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	D	0.96009	0.8700	L	0.46157	1.445	0.80722	D	1	P;P;P	0.50943	0.839;0.914;0.94	P;P;P	0.53912	0.547;0.472;0.737	D	0.94927	0.8079	10	0.27082	T	0.32	.	15.7078	0.77598	1.0:0.0:0.0:0.0	.	200;274;262	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	T	239;239;274;262;239;239;239;239;239;246;200;239;239;239;239	ENSP00000355225:I239T;ENSP00000355907:I239T;ENSP00000355904:I274T;ENSP00000386171:I262T;ENSP00000352077:I239T;ENSP00000354584:I239T;ENSP00000355905:I239T;ENSP00000353108:I239T;ENSP00000419594:I239T;ENSP00000375761:I246T;ENSP00000418629:I200T;ENSP00000419155:I239T;ENSP00000417374:I239T;ENSP00000419514:I239T	ENSP00000346386:I239T	I	-	2	0	ESRRG	214804261	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.105000	0.64084	0.533000	0.62120	ATC		PASS	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		54	265	---	---	---	---
IRF2BP2	359948	broad.mit.edu	37	1	234743448	234743448	+	Missense_Mutation	SNP	G	G	A	rs370061689		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:234743448G>A	ENST00000366609.3	-	2	1229	c.1199C>T	c.(1198-1200)cCg>cTg	p.P400L	IRF2BP2_ENST00000491430.1_5'UTR|IRF2BP2_ENST00000366610.3_Missense_Mutation_p.P384L|RP4-781K5.2_ENST00000436039.1_RNA	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.P400L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GGGTGGTGGCGGAGACACAAA	0.612																																						uc001hwg.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1198-1200)CCG>CTG		interferon regulatory factor 2 binding protein 2		G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	105.0	117.0	113.0		1151,1199	5.5	1.0	1		113	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IRF2BP2	NM_001077397.1,NM_182972.2	98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	384/572,400/588	234743448	1,13005	2203	4300	6503	SO:0001583	missense	359948				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr1:234743448G>A	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1199C>T	1.37:g.234743448G>A	ENSP00000355568:p.Pro400Leu		Somatic				IRF2BP2_uc009xfw.2_Missense_Mutation_p.P10L|IRF2BP2_uc001hwf.2_Missense_Mutation_p.P384L	p.P400L	NM_182972	NP_892017	Capture	Illumina GAIIx	Phase_I	Q7Z5L9	I2BP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)		2	1230	-	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	400					B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	ENST00000366609.3	37	c.1199C>T	CCDS1602.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872466	0.72180	0.0	1.16E-4	ENSG00000168264	ENST00000366610;ENST00000366609	T;T	0.35789	1.33;1.29	5.49	5.49	0.81192	.	0.000000	0.49305	D	0.000154	T	0.48352	0.1495	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.64687	0.849;0.928	T	0.50575	-0.8812	10	0.72032	D	0.01	-3.5927	19.3462	0.94363	0.0:0.0:1.0:0.0	.	400;384	Q7Z5L9;Q7Z5L9-2	I2BP2_HUMAN;.	L	384;400	ENSP00000355569:P384L;ENSP00000355568:P400L	ENSP00000355568:P400L	P	-	2	0	IRF2BP2	232810071	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	6.922000	0.75811	2.593000	0.87608	0.655000	0.94253	CCG		PASS	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972		24	148	---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237905620	237905620	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:237905620G>A	ENST00000366574.2	+	80	11433	c.11116G>A	c.(11116-11118)Gat>Aat	p.D3706N	RYR2_ENST00000542537.1_Missense_Mutation_p.D3690N|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.D3704N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3706					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.D3704N(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAAGATGACGATGGTGAAGA	0.318																																						uc001hyl.1																			1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(11116-11118)GAT>AAT		cardiac muscle ryanodine receptor							215.0	218.0	217.0					1																	237905620		1874	4092	5966	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237905620G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11116G>A	1.37:g.237905620G>A	ENSP00000355533:p.Asp3706Asn		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.D102N	p.D3706N	NM_001035	NP_001026	Capture	Illumina GAIIx	Phase_I	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		80	11236	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3706					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.11116G>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872069	0.33069	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97066	-4.21;-4.23;-4.2	5.89	4.97	0.65823	.	0.159434	0.38005	N	0.001857	D	0.91878	0.7429	L	0.27053	0.805	0.80722	D	1	P;P	0.51240	0.943;0.934	B;B	0.34652	0.173;0.187	D	0.91823	0.5469	10	0.51188	T	0.08	-13.4837	11.8207	0.52237	0.0796:0.0:0.9204:0.0	.	661;3706	B4DGV4;Q92736	.;RYR2_HUMAN	N	3706;3704;3690;661	ENSP00000355533:D3706N;ENSP00000353174:D3704N;ENSP00000443798:D3690N	ENSP00000353174:D3704N	D	+	1	0	RYR2	235972243	1.000000	0.71417	0.997000	0.53966	0.217000	0.24651	4.802000	0.62539	2.788000	0.95919	0.585000	0.79938	GAT		PASS	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		4	25	---	---	---	---
RGS7	6000	broad.mit.edu	37	1	240975293	240975293	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:240975293T>A	ENST00000407727.1	-	13	1006	c.1007A>T	c.(1006-1008)gAg>gTg	p.E336V	RGS7_ENST00000331110.7_Missense_Mutation_p.E310V|RGS7_ENST00000348120.2_Missense_Mutation_p.E283V|RGS7_ENST00000366563.1_Missense_Mutation_p.E336V|RGS7_ENST00000366565.1_Missense_Mutation_p.E336V|RGS7_ENST00000401882.1_Missense_Mutation_p.E283V|RGS7_ENST00000446183.2_Missense_Mutation_p.E252V|RGS7_ENST00000366562.4_Missense_Mutation_p.E336V|RGS7_ENST00000366564.1_Missense_Mutation_p.E336V			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	336	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.E336V(2)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TTTCAATGCCTCGTCCATGCC	0.398																																						uc001hyv.2																			2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|kidney(1)	7						c.(1006-1008)GAG>GTG		regulator of G-protein signaling 7							103.0	106.0	105.0					1																	240975293		2203	4300	6503	SO:0001583	missense	6000				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity	g.chr1:240975293T>A	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1007A>T	1.37:g.240975293T>A	ENSP00000384428:p.Glu336Val		Somatic				RGS7_uc010pyh.1_Missense_Mutation_p.E310V|RGS7_uc010pyj.1_Missense_Mutation_p.E252V|RGS7_uc001hyu.2_Missense_Mutation_p.E336V|RGS7_uc009xgn.1_Missense_Mutation_p.E283V|RGS7_uc001hyw.2_Missense_Mutation_p.E336V|RGS7_uc001hyt.2_Missense_Mutation_p.E168V	p.E336V	NM_002924	NP_002915	Capture	Illumina GAIIx	Phase_I	P49802	RGS7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.027)		14	1337	-		all_cancers(173;0.0131)	336			RGS.		Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37	c.1007A>T		.	.	.	.	.	.	.	.	.	.	T	28.0	4.883611	0.91740	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.02103	4.45;4.45;4.45;4.45;4.45;4.45;4.45;4.45;4.45;4.45	5.8	5.8	0.92144	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.13114	0.0318	M	0.77486	2.375	0.80722	D	1	D;P;D;D;D;D;D	0.89917	0.995;0.941;0.998;0.993;0.984;1.0;0.976	D;P;D;D;P;D;P	0.75484	0.973;0.811;0.94;0.955;0.857;0.986;0.785	T	0.00083	-1.2101	10	0.87932	D	0	.	15.3296	0.74196	0.0:0.0:0.0:1.0	.	252;310;283;336;336;336;336	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	V	310;336;336;336;167;283;252;336;336;283	ENSP00000331485:E310V;ENSP00000355523:E336V;ENSP00000355522:E336V;ENSP00000355521:E336V;ENSP00000404399:E167V;ENSP00000341242:E283V;ENSP00000390138:E252V;ENSP00000355520:E336V;ENSP00000384428:E336V;ENSP00000385508:E283V	ENSP00000331485:E310V	E	-	2	0	RGS7	239041916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.226000	0.72624	0.459000	0.35465	GAG		PASS	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		13	470	---	---	---	---
RGS7	6000	broad.mit.edu	37	1	241262037	241262037	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:241262037T>C	ENST00000407727.1	-	2	103	c.104A>G	c.(103-105)cAa>cGa	p.Q35R	RGS7_ENST00000331110.7_Missense_Mutation_p.Q9R|RGS7_ENST00000348120.2_Missense_Mutation_p.Q35R|RGS7_ENST00000366563.1_Missense_Mutation_p.Q35R|RGS7_ENST00000366565.1_Missense_Mutation_p.Q35R|RGS7_ENST00000401882.1_Missense_Mutation_p.Q35R|RGS7_ENST00000446183.2_5'UTR|RGS7_ENST00000366562.4_Missense_Mutation_p.Q35R|RGS7_ENST00000366564.1_Missense_Mutation_p.Q35R			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	35					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.Q35R(2)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TTTTTCATCTTGCATCCGTGC	0.338																																						uc001hyv.2																			2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|kidney(1)	7						c.(103-105)CAA>CGA		regulator of G-protein signaling 7							174.0	153.0	160.0					1																	241262037		2203	4300	6503	SO:0001583	missense	6000				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity	g.chr1:241262037T>C	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.104A>G	1.37:g.241262037T>C	ENSP00000384428:p.Gln35Arg		Somatic				RGS7_uc010pyh.1_Missense_Mutation_p.Q9R|RGS7_uc010pyj.1_5'UTR|RGS7_uc001hyu.2_Missense_Mutation_p.Q35R|RGS7_uc009xgn.1_Missense_Mutation_p.Q35R|RGS7_uc001hyw.2_Missense_Mutation_p.Q35R	p.Q35R	NM_002924	NP_002915	Capture	Illumina GAIIx	Phase_I	P49802	RGS7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.027)		3	434	-		all_cancers(173;0.0131)	35					Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37	c.104A>G		.	.	.	.	.	.	.	.	.	.	T	23.7	4.445930	0.84101	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000348120;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T	0.38560	1.35;1.34;1.34;1.35;1.13;1.34;1.33;1.13	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.71674	0.995;0.997;0.998;0.997;0.997	D;D;D;D;D	0.81914	0.989;0.995;0.962;0.995;0.964	T	0.61407	-0.7069	10	0.66056	D	0.02	-16.1073	11.7412	0.51794	0.0:0.0:0.0:1.0	.	9;35;35;35;35	B7Z257;P49802-4;P49802-2;P49802-5;P49802-3	.;.;.;.;.	R	9;35;35;35;35;35;35;35	ENSP00000331485:Q9R;ENSP00000355523:Q35R;ENSP00000355522:Q35R;ENSP00000355521:Q35R;ENSP00000341242:Q35R;ENSP00000355520:Q35R;ENSP00000384428:Q35R;ENSP00000385508:Q35R	ENSP00000331485:Q9R	Q	-	2	0	RGS7	239328660	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.776000	0.75023	2.081000	0.62600	0.533000	0.62120	CAA		PASS	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		28	231	---	---	---	---
OPN3	23596	broad.mit.edu	37	1	241757787	241757787	+	Silent	SNP	G	G	A	rs151169647		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:241757787G>A	ENST00000366554.2	-	4	1258	c.1152C>T	c.(1150-1152)gaC>gaT	p.D384D	KMO_ENST00000366557.4_3'UTR|KMO_ENST00000366559.4_3'UTR|OPN3_ENST00000469376.1_5'UTR|OPN3_ENST00000331838.5_Silent_p.D305D	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3	384					detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.D384D(1)		endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TGTCGCTGTCGTCAACTGACA	0.418													g|||	1	0.000199681	0.0008	0.0	5008	,	,		21288	0.0		0.0	False		,,,				2504	0.0					uc001hza.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(1150-1152)GAC>GAT		opsin 3		A	,	1,4405	2.1+/-5.4	0,1,2202	151.0	139.0	143.0		,1152	-8.1	0.0	1	dbSNP_134	143	2,8598	2.2+/-6.3	0,2,4298	no	utr-3,coding-synonymous	KMO,OPN3	NM_003679.3,NM_014322.2	,	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,	,384/403	241757787	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	23596				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity	g.chr1:241757787G>A	AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691	ENST00000366554.2:c.1152C>T	1.37:g.241757787G>A			Somatic				KMO_uc009xgp.2_3'UTR|OPN3_uc001hzb.2_RNA|OPN3_uc001hzc.2_RNA	p.D384D	NM_014322	NP_055137	Capture	Illumina GAIIx	Phase_I	Q9H1Y3	OPN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0125)		4	1297	-	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	384			Cytoplasmic (Potential).		Q8IX08|Q9Y344	Silent	SNP	ENST00000366554.2	37	c.1152C>T	CCDS31072.1																																																																																				PASS	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095713.1	NM_014322		16	533	---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242035439	242035439	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:242035439T>C	ENST00000366548.3	+	12	1966	c.1373T>C	c.(1372-1374)gTg>gCg	p.V458A	EXO1_ENST00000348581.5_Missense_Mutation_p.V458A|EXO1_ENST00000518483.1_Missense_Mutation_p.V458A	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	458	Interaction with MLH1.		V -> M (in dbSNP:rs4149965). {ECO:0000269|Ref.5}.		DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)	p.V458A(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTTTCTGAAGTGTTTGTGCCT	0.368								Editing and processing nucleases																														uc001hzh.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|skin(1)	5						c.(1372-1374)GTG>GCG	Direct_reversal_of_damage|Editing_and_processing_nucleases	exonuclease 1 isoform b							66.0	65.0	66.0					1																	242035439		2203	4300	6503	SO:0001583	missense	9156				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity	g.chr1:242035439T>C	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1373T>C	1.37:g.242035439T>C	ENSP00000355506:p.Val458Ala		Somatic				EXO1_uc001hzi.2_Missense_Mutation_p.V458A|EXO1_uc001hzj.2_Missense_Mutation_p.V458A|EXO1_uc009xgq.2_Missense_Mutation_p.V457A	p.V458A	NM_130398	NP_569082	Capture	Illumina GAIIx	Phase_I	Q9UQ84	EXO1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0107)		12	1913	+	Ovarian(103;0.103)	all_cancers(173;0.0555)	458			Interaction with MLH1.		O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	37	c.1373T>C	CCDS1620.1	.	.	.	.	.	.	.	.	.	.	T	3.073	-0.190741	0.06299	.	.	ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483	T;T;T	0.33216	1.42;1.42;1.42	5.3	-2.6	0.06190	.	1.150810	0.06104	N	0.665867	T	0.11367	0.0277	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.30765	-0.9967	10	0.07325	T	0.83	-12.247	6.4307	0.21794	0.0:0.3509:0.2358:0.4134	.	458;458	Q9UQ84-4;Q9UQ84	.;EXO1_HUMAN	A	458	ENSP00000355506:V458A;ENSP00000311873:V458A;ENSP00000430251:V458A	ENSP00000311873:V458A	V	+	2	0	EXO1	240102062	0.005000	0.15991	0.001000	0.08648	0.231000	0.25187	0.466000	0.22019	-0.339000	0.08401	0.528000	0.53228	GTG		PASS	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027		5	257	---	---	---	---
HNRNPU	3192	broad.mit.edu	37	1	245027151	245027151	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:245027151G>A	ENST00000283179.9	-	1	622	c.459C>T	c.(457-459)ggC>ggT	p.G153G	HNRNPU_ENST00000444376.2_Silent_p.G153G|RP11-11N7.4_ENST00000610145.1_lincRNA			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	153	Asp/Glu-rich (acidic).				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G153G(2)		NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			CGTTCTCGTCGCCCGCGCCTT	0.692																																					NSCLC(33;911 1010 3329 23631 49995)	uc001iaz.1																			2	Substitution - coding silent(2)		lung(2)		0						c.(457-459)GGC>GGT		heterogeneous nuclear ribonucleoprotein U							20.0	21.0	21.0					1																	245027151		2199	4293	6492	SO:0001819	synonymous_variant	3192				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding	g.chr1:245027151G>A	X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.459C>T	1.37:g.245027151G>A			Somatic				HNRNPU_uc001iay.1_5'Flank|HNRNPU_uc001iba.1_Silent_p.G153G|HNRNPU_uc001ibb.1_Intron	p.G153G	NM_031844	NP_114032	Capture	Illumina GAIIx	Phase_I	Q00839	HNRPU_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00868)		1	677	-	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		153			Asp/Glu-rich (acidic).		O75507|Q8N174|Q96HY9|Q9BQ09	Silent	SNP	ENST00000283179.9	37	c.459C>T	CCDS41479.1																																																																																				PASS	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097163.3	NM_031844		30	7	---	---	---	---
OR2G2	81470	broad.mit.edu	37	1	247752207	247752207	+	Silent	SNP	C	C	T	rs146695930	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:247752207C>T	ENST00000320065.1	+	1	546	c.546C>T	c.(544-546)tgC>tgT	p.C182C	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C182C(2)		endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATTTCATCTGCGAGGTCCCTG	0.537																																						uc010pyy.1																			2	Substitution - coding silent(2)		lung(2)		0						c.(544-546)TGC>TGT		olfactory receptor, family 2, subfamily G,		T		1,4405	826.1+/-416.6	0,1,2202	176.0	169.0	171.0		546	2.0	1.0	1	dbSNP_134	171	2,8598	819.2+/-406.8	0,2,4298	no	coding-synonymous	OR2G2	NM_001001915.1		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		182/318	247752207	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	81470				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247752207C>T	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.546C>T	1.37:g.247752207C>T			Somatic					p.C182C	NM_001001915	NP_001001915	Capture	Illumina GAIIx	Phase_I	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	546	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		182			Extracellular (Potential).		Q5JQT2|Q6IEZ0	Silent	SNP	ENST00000320065.1	37	c.546C>T	CCDS31092.1																																																																																				PASS	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1			329	131	---	---	---	---
OR2G3	81469	broad.mit.edu	37	1	247769576	247769576	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:247769576C>A	ENST00000320002.2	+	1	721	c.689C>A	c.(688-690)tCa>tAa	p.S230*	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S230*(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGGATCAAATCAGTAGAGGCA	0.453																																						uc010pyz.1																			2	Substitution - Nonsense(2)		lung(1)|liver(1)	central_nervous_system(1)	1						c.(688-690)TCA>TAA		olfactory receptor, family 2, subfamily G,							184.0	159.0	167.0					1																	247769576		2203	4300	6503	SO:0001587	stop_gained	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769576C>A	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.689C>A	1.37:g.247769576C>A	ENSP00000326301:p.Ser230*		Somatic					p.S230*	NM_001001914	NP_001001914	Capture	Illumina GAIIx	Phase_I	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	689	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		230			Cytoplasmic (Potential).		B2RN64|Q5JQT1|Q6IF45	Nonsense_Mutation	SNP	ENST00000320002.2	37	c.689C>A	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145591	0.37923	.	.	ENSG00000177476	ENST00000320002	.	.	.	3.52	3.52	0.40303	.	0.000000	0.31199	U	0.008079	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9801	0.58559	0.0:1.0:0.0:0.0	.	.	.	.	X	230	.	ENSP00000326301:S230X	S	+	2	0	OR2G3	245836199	0.005000	0.15991	0.092000	0.20876	0.139000	0.21198	0.992000	0.29667	1.956000	0.56807	0.386000	0.25728	TCA		PASS	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			165	74	---	---	---	---
OR2T4	127074	broad.mit.edu	37	1	248525719	248525719	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr1:248525719G>T	ENST00000366475.1	+	1	837	c.837G>T	c.(835-837)gtG>gtT	p.V279V		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V279V(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTGACTGTGGTCATCCTCT	0.532																																						uc001ieh.1																			1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(835-837)GTG>GTT		olfactory receptor, family 2, subfamily T,							151.0	146.0	148.0					1																	248525719		2203	4300	6503	SO:0001819	synonymous_variant	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525719G>T	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.837G>T	1.37:g.248525719G>T			Somatic					p.V279V	NM_001004696	NP_001004696	Capture	Illumina GAIIx	Phase_I	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	837	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		279			Helical; Name=6; (Potential).		Q6IEZ8	Silent	SNP	ENST00000366475.1	37	c.837G>T	CCDS31113.1																																																																																				PASS	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		69	416	---	---	---	---
OTOF	9381	broad.mit.edu	37	2	26741909	26741909	+	Missense_Mutation	SNP	G	G	A	rs555829802		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:26741909G>A	ENST00000272371.2	-	4	422	c.296C>T	c.(295-297)aCg>aTg	p.T99M	OTOF_ENST00000403946.3_Missense_Mutation_p.T99M	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	99					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.T99M(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCAATCAGCGTGTCAGTCAC	0.577																																					GBM(102;732 1451 20652 24062 31372)	uc002rhk.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(295-297)ACG>ATG		otoferlin isoform a							148.0	108.0	121.0					2																	26741909		2203	4300	6503	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26741909G>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.296C>T	2.37:g.26741909G>A	ENSP00000272371:p.Thr99Met		Somatic				OTOF_uc010ylb.1_5'Flank	p.T99M	NM_194248	NP_919224	Capture	Illumina GAIIx	Phase_I	Q9HC10	OTOF_HUMAN			4	423	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		99			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.296C>T	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108460	0.77096	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.72051	-0.62;-0.62	5.05	4.18	0.49190	C2 calcium/lipid-binding domain, CaLB (1);	0.050741	0.85682	D	0.000000	T	0.67135	0.2861	M	0.62723	1.935	0.51482	D	0.999924	B	0.19935	0.04	B	0.17098	0.017	T	0.66980	-0.5786	10	0.72032	D	0.01	-12.4287	11.8556	0.52435	0.0861:0.0:0.9139:0.0	.	99	Q9HC10	OTOF_HUMAN	M	99	ENSP00000272371:T99M;ENSP00000385255:T99M	ENSP00000272371:T99M	T	-	2	0	OTOF	26595413	1.000000	0.71417	0.973000	0.42090	0.985000	0.73830	6.844000	0.75390	1.262000	0.44165	0.563000	0.77884	ACG		PASS	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			6	43	---	---	---	---
RASGRP3	25780	broad.mit.edu	37	2	33783884	33783884	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:33783884A>T	ENST00000403687.3	+	17	2591	c.1851A>T	c.(1849-1851)gaA>gaT	p.E617D	RASGRP3_ENST00000402538.3_Missense_Mutation_p.E617D|AC020594.5_ENST00000437680.1_RNA|RASGRP3_ENST00000407811.1_Missense_Mutation_p.E616D	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	617					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.E617D(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					CCCAGACTGAACCTGTCTGGT	0.552																																						uc002rox.2																			1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(1849-1851)GAA>GAT		RAS guanyl releasing protein 3 (calcium and							56.0	57.0	56.0					2																	33783884		1893	4119	6012	SO:0001583	missense	25780				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity	g.chr2:33783884A>T	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1851A>T	2.37:g.33783884A>T	ENSP00000384192:p.Glu617Asp		Somatic				RASGRP3_uc010ync.1_Missense_Mutation_p.E617D|RASGRP3_uc002roy.2_Missense_Mutation_p.E616D	p.E617D	NM_170672	NP_733772	Capture	Illumina GAIIx	Phase_I	Q8IV61	GRP3_HUMAN			18	2478	+	all_hematologic(175;0.115)		617					D6W583|O94931|Q53SD7	Missense_Mutation	SNP	ENST00000403687.3	37	c.1851A>T	CCDS46256.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.305016	0.40795	.	.	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	T;T;T	0.79352	-1.26;-1.26;-1.26	5.45	1.27	0.21489	.	0.210310	0.41938	D	0.000787	T	0.52306	0.1726	N	0.08118	0	0.37248	D	0.906443	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.27536	-1.0071	10	0.33940	T	0.23	-19.8205	5.1267	0.14888	0.4591:0.0:0.4039:0.1369	.	616;617	D6W583;Q8IV61	.;GRP3_HUMAN	D	617;617;616	ENSP00000385886:E617D;ENSP00000384192:E617D;ENSP00000383917:E616D	ENSP00000385886:E617D	E	+	3	2	RASGRP3	33637388	0.522000	0.26266	0.980000	0.43619	0.986000	0.74619	-0.187000	0.09656	-0.068000	0.12953	-0.256000	0.11100	GAA		PASS	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376		15	152	---	---	---	---
PREPL	9581	broad.mit.edu	37	2	44569631	44569631	+	Missense_Mutation	SNP	C	C	T	rs371309095		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:44569631C>T	ENST00000409936.1	-	6	1114	c.677G>A	c.(676-678)cGc>cAc	p.R226H	PREPL_ENST00000540817.1_5'Flank|PREPL_ENST00000378520.3_Missense_Mutation_p.R226H|PREPL_ENST00000378511.3_Missense_Mutation_p.R226H|PREPL_ENST00000409272.1_Missense_Mutation_p.R226H|PREPL_ENST00000409411.1_Missense_Mutation_p.R137H|PREPL_ENST00000260648.6_Missense_Mutation_p.R226H|PREPL_ENST00000541738.1_Missense_Mutation_p.R137H|PREPL_ENST00000410081.1_Missense_Mutation_p.R226H|PREPL_ENST00000409957.1_Missense_Mutation_p.R137H	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	226						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.R226H(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GTCATGACAGCGAAGGTTCCT	0.348																																						uc002ruf.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(676-678)CGC>CAC		prolyl endopeptidase-like isoform C		C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	117.0	128.0	124.0		677,677,677,677,410,410,677	5.6	1.0	2		124	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	PREPL	NM_001042385.2,NM_001042386.2,NM_001171603.1,NM_001171606.1,NM_001171613.1,NM_001171617.1,NM_006036.4	29,29,29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	226/666,226/662,226/728,226/728,137/639,137/639,226/728	44569631	1,13005	2203	4300	6503	SO:0001583	missense	9581				proteolysis	cytosol	serine-type endopeptidase activity	g.chr2:44569631C>T	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.677G>A	2.37:g.44569631C>T	ENSP00000386543:p.Arg226His		Somatic				PREPL_uc002rug.2_Missense_Mutation_p.R226H|PREPL_uc002ruh.2_Missense_Mutation_p.R226H|PREPL_uc010fax.2_Missense_Mutation_p.R226H|PREPL_uc002rui.3_Missense_Mutation_p.R137H|PREPL_uc002ruj.1_Missense_Mutation_p.R137H|PREPL_uc002ruk.1_Missense_Mutation_p.R226H	p.R226H	NM_006036	NP_006027	Capture	Illumina GAIIx	Phase_I	Q4J6C6	PPCEL_HUMAN			5	712	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	226					A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	37	c.677G>A	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346578	0.82022	0.0	1.16E-4	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511	T;T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.61	5.61	0.85477	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.106793	0.64402	D	0.000003	T	0.57844	0.2081	L	0.43152	1.355	0.42602	D	0.993287	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.988;0.997	T	0.60826	-0.7186	10	0.87932	D	0	-13.4101	8.6759	0.34179	0.0:0.8723:0.0:0.1277	.	226;226;226	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	H	137;137;137;226;226;226;226;226;226	ENSP00000439626:R137H;ENSP00000387095:R137H;ENSP00000387241:R137H;ENSP00000386543:R226H;ENSP00000260648:R226H;ENSP00000386909:R226H;ENSP00000386509:R226H;ENSP00000367781:R226H;ENSP00000367772:R226H	ENSP00000260648:R226H	R	-	2	0	PREPL	44423135	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.585000	0.36600	2.629000	0.89072	0.655000	0.94253	CGC		PASS	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036		153	177	---	---	---	---
PSME4	23198	broad.mit.edu	37	2	54146300	54146300	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:54146300G>A	ENST00000404125.1	-	20	2559	c.2504C>T	c.(2503-2505)cCa>cTa	p.P835L	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	835					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.P835L(1)|p.P721L(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTTAGTAACTGGCTCTCCTTT	0.323																																						uc002rxp.2																			2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)|pancreas(1)	5						c.(2503-2505)CCA>CTA		proteasome (prosome, macropain) activator							76.0	77.0	76.0					2																	54146300		2203	4300	6503	SO:0001583	missense	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54146300G>A	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2504C>T	2.37:g.54146300G>A	ENSP00000384211:p.Pro835Leu		Somatic				PSME4_uc010yop.1_Missense_Mutation_p.P721L|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.P210L|PSME4_uc010fbv.1_Intron	p.P835L	NM_014614	NP_055429	Capture	Illumina GAIIx	Phase_I	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		20	2560	-			835					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	c.2504C>T	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472174	0.43942	.	.	ENSG00000068878	ENST00000404125	T	0.25414	1.8	5.56	4.61	0.57282	.	0.368500	0.27613	N	0.018589	T	0.21062	0.0507	L	0.43152	1.355	0.80722	D	1	P;B	0.38922	0.651;0.121	B;B	0.38712	0.28;0.021	T	0.01460	-1.1349	10	0.42905	T	0.14	-28.578	7.7221	0.28738	0.0:0.2959:0.5177:0.1864	.	210;835	Q14997-2;Q14997	.;PSME4_HUMAN	L	835	ENSP00000384211:P835L	ENSP00000384211:P835L	P	-	2	0	PSME4	53999804	0.986000	0.35501	0.998000	0.56505	0.986000	0.74619	2.000000	0.40816	2.606000	0.88127	0.467000	0.42956	CCA		PASS	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		61	21	---	---	---	---
SPTBN1	6711	broad.mit.edu	37	2	54859735	54859735	+	Silent	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:54859735C>A	ENST00000356805.4	+	17	3878	c.3597C>A	c.(3595-3597)acC>acA	p.T1199T	SPTBN1_ENST00000333896.5_Silent_p.T1186T	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1199					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.T1199T(1)|p.T1186T(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AAATGCCTACCACCTTGGAAG	0.433																																						uc002rxu.2																			2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8						c.(3595-3597)ACC>ACA		spectrin, beta, non-erythrocytic 1 isoform 1							97.0	98.0	98.0					2																	54859735		2203	4300	6503	SO:0001819	synonymous_variant	6711				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	g.chr2:54859735C>A		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3597C>A	2.37:g.54859735C>A			Somatic				SPTBN1_uc002rxx.2_Silent_p.T1186T	p.T1199T	NM_003128	NP_003119	Capture	Illumina GAIIx	Phase_I	Q01082	SPTB2_HUMAN	Lung(47;0.24)		17	3846	+			1199			Spectrin 9.		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	c.3597C>A	CCDS33198.1																																																																																				PASS	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			179	91	---	---	---	---
LRRTM4	80059	broad.mit.edu	37	2	77746338	77746338	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:77746338C>T	ENST00000409093.1	-	3	993	c.657G>A	c.(655-657)aaG>aaA	p.K219K	LRRTM4_ENST00000409088.3_Silent_p.K219K|LRRTM4_ENST00000409884.1_Silent_p.K219K|LRRTM4_ENST00000409911.1_Silent_p.K220K|LRRTM4_ENST00000409282.1_Silent_p.K220K			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	219					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.K219K(2)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CAAAGTTGATCTTGGAAAACT	0.453																																						uc002snr.2																			2	Substitution - coding silent(2)		lung(2)	pancreas(3)|ovary(1)	4						c.(655-657)AAG>AAA		leucine rich repeat transmembrane neuronal 4							66.0	65.0	65.0					2																	77746338		1879	4105	5984	SO:0001819	synonymous_variant	80059					integral to membrane		g.chr2:77746338C>T	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.657G>A	2.37:g.77746338C>T			Somatic				LRRTM4_uc002snq.2_Silent_p.K219K|LRRTM4_uc002sns.2_Silent_p.K219K|LRRTM4_uc002snt.2_Silent_p.K220K	p.K219K	NM_001134745	NP_001128217	Capture	Illumina GAIIx	Phase_I	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1072	-			219			LRR 7.|Extracellular (Potential).		Q4FZ98|Q6UXJ7	Silent	SNP	ENST00000409093.1	37	c.657G>A	CCDS46346.1																																																																																				PASS	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		60	51	---	---	---	---
EIF2AK3	9451	broad.mit.edu	37	2	88890344	88890344	+	Missense_Mutation	SNP	C	C	T	rs121908570		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:88890344C>T	ENST00000303236.3	-	5	1295	c.994G>A	c.(994-996)Gag>Aag	p.E332K	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.E181K	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	332					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)	p.E332K(1)		ovary(3)	3						ACCTGGTACTCCCATTCCAGA	0.433																																					GBM(138;671 1851 16235 39058 45249)	uc002stc.3																			1	Substitution - Missense(1)		lung(1)	ovary(3)	3	GRCh37	CM062591	EIF2AK3	M	rs121908570	c.(994-996)GAG>AAG		eukaryotic translation initiation factor 2-alpha							146.0	134.0	138.0					2																	88890344		2203	4300	6503	SO:0001583	missense	9451				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding	g.chr2:88890344C>T	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.994G>A	2.37:g.88890344C>T	ENSP00000307235:p.Glu332Lys		Somatic					p.E332K	NM_004836	NP_004827	Capture	Illumina GAIIx	Phase_I	Q9NZJ5	E2AK3_HUMAN			5	1196	-			332			Lumenal (Potential).		A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	ENST00000303236.3	37	c.994G>A	CCDS33241.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909578	0.72868	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.28454	1.61;1.61;1.61	5.87	5.87	0.94306	Quinonprotein alcohol dehydrogenase-like (2);	0.000000	0.85682	D	0.000000	T	0.45316	0.1336	L	0.35854	1.095	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.08146	-1.0736	10	0.09843	T	0.71	-30.6054	20.2147	0.98293	0.0:1.0:0.0:0.0	.	332	Q9NZJ5	E2AK3_HUMAN	K	181;332;181;211	ENSP00000408325:E181K;ENSP00000307235:E332K;ENSP00000412076:E211K	ENSP00000307235:E332K	E	-	1	0	EIF2AK3	88671459	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.061000	0.76699	2.785000	0.95823	0.591000	0.81541	GAG		PASS	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836		11	441	---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98914457	98914457	+	Missense_Mutation	SNP	C	C	T	rs371022741		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:98914457C>T	ENST00000477737.1	+	24	3449	c.3245C>T	c.(3244-3246)aCg>aTg	p.T1082M	AC092675.1_ENST00000401293.1_RNA|VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1082								p.T1082M(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCCTTCATCACGCCTGTGGGG	0.577																																						uc002syo.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|skin(1)	6						c.(3244-3246)ACG>ATG		von Willebrand factor A domain containing 3B		C	MET/THR	0,4180		0,0,2090	70.0	76.0	74.0		3245	1.0	0.4	2		74	1,8381		0,1,4190	no	missense	VWA3B	NM_144992.4	81	0,1,6280	TT,TC,CC		0.0119,0.0,0.0080	benign	1082/1295	98914457	1,12561	2090	4191	6281	SO:0001583	missense	200403							g.chr2:98914457C>T	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3245C>T	2.37:g.98914457C>T	ENSP00000417955:p.Thr1082Met		Somatic				VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.T739M|VWA3B_uc002syp.1_Missense_Mutation_p.T474M|VWA3B_uc002syq.1_Missense_Mutation_p.T358M|VWA3B_uc002syr.1_Missense_Mutation_p.T399M|VWA3B_uc002sys.2_RNA	p.T1082M	NM_144992	NP_659429	Capture	Illumina GAIIx	Phase_I	Q502W6	VWA3B_HUMAN			24	3509	+			1082					B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	c.3245C>T	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	C	6.711	0.499937	0.12762	0.0	1.19E-4	ENSG00000168658	ENST00000477737;ENST00000358269	T	0.21734	1.99	4.93	0.962	0.19643	.	0.708846	0.09952	N	0.734548	T	0.13543	0.0328	N	0.19112	0.55	0.49299	D	0.999779	B;B	0.18310	0.027;0.016	B;B	0.17722	0.019;0.004	T	0.09729	-1.0661	10	0.30854	T	0.27	.	9.7503	0.40473	0.0:0.676:0.0:0.324	.	474;1082	Q502W6-5;Q502W6	.;VWA3B_HUMAN	M	1082;204	ENSP00000417955:T1082M	ENSP00000351009:T204M	T	+	2	0	VWA3B	98280889	0.169000	0.23002	0.406000	0.26421	0.411000	0.31082	0.320000	0.19540	0.068000	0.16574	-1.865000	0.00557	ACG		PASS	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		13	132	---	---	---	---
RNF149	284996	broad.mit.edu	37	2	101893736	101893736	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:101893736G>A	ENST00000295317.3	-	7	1274	c.1167C>T	c.(1165-1167)ggC>ggT	p.G389G		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	389					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G389G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						AGTCACTCCTGCCGGCTTCTG	0.468																																					Colon(25;331 612 6521 7355 31028)	uc002taz.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(1165-1167)GGC>GGT		ring finger protein 149 precursor							45.0	44.0	45.0					2																	101893736		2203	4300	6503	SO:0001819	synonymous_variant	284996					integral to membrane	ligase activity|zinc ion binding	g.chr2:101893736G>A	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.1167C>T	2.37:g.101893736G>A			Somatic				RNF149_uc002tax.1_Intron	p.G389G	NM_173647	NP_775918	Capture	Illumina GAIIx	Phase_I	Q8NC42	RN149_HUMAN			7	1269	-			389					Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Silent	SNP	ENST00000295317.3	37	c.1167C>T	CCDS2051.1																																																																																				PASS	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647		16	42	---	---	---	---
WDR33	55339	broad.mit.edu	37	2	128471314	128471314	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:128471314C>A	ENST00000322313.4	-	18	3309	c.3151G>T	c.(3151-3153)Ggg>Tgg	p.G1051W		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1051					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G1051W(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		AACGGAGGCCCAGGGCCCCCT	0.657																																						uc002tpg.1																			1	Substitution - Missense(1)		lung(1)		0						c.(3151-3153)GGG>TGG		WD repeat domain 33 isoform 1							68.0	72.0	70.0					2																	128471314		2203	4300	6503	SO:0001583	missense	55339				postreplication repair|spermatogenesis	collagen|nucleus	protein binding	g.chr2:128471314C>A		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3151G>T	2.37:g.128471314C>A	ENSP00000325377:p.Gly1051Trp		Somatic					p.G1051W	NM_018383	NP_060853	Capture	Illumina GAIIx	Phase_I	Q9C0J8	WDR33_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0695)	18	3334	-	Colorectal(110;0.1)		1051					Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	c.3151G>T	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690149	0.88735	.	.	ENSG00000136709	ENST00000322313	D	0.97161	-4.27	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.97077	0.9045	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98380	1.0558	10	0.87932	D	0	-4.1984	20.0726	0.97729	0.0:1.0:0.0:0.0	.	1051	Q9C0J8	WDR33_HUMAN	W	1051	ENSP00000325377:G1051W	ENSP00000325377:G1051W	G	-	1	0	WDR33	128187784	0.996000	0.38824	0.980000	0.43619	0.997000	0.91878	5.250000	0.65432	2.738000	0.93877	0.655000	0.94253	GGG		PASS	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383		114	100	---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133539998	133539998	+	Silent	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:133539998C>A	ENST00000409261.1	-	14	4759	c.4386G>T	c.(4384-4386)gtG>gtT	p.V1462V	NCKAP5_ENST00000317721.6_Silent_p.V1462V|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1462								p.V1462V(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTTCTGAACTCACAGCATCAG	0.498																																						uc002ttp.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(4384-4386)GTG>GTT		Nck-associated protein 5 isoform 1							57.0	55.0	56.0					2																	133539998		1915	4119	6034	SO:0001819	synonymous_variant	344148						protein binding	g.chr2:133539998C>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4386G>T	2.37:g.133539998C>A			Somatic				NCKAP5_uc002ttq.2_Intron	p.V1462V	NM_207363	NP_997246	Capture	Illumina GAIIx	Phase_I	O14513	NCKP5_HUMAN			14	4760	-			1462					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	ENST00000409261.1	37	c.4386G>T	CCDS46418.1																																																																																				PASS	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		19	51	---	---	---	---
FIGN	55137	broad.mit.edu	37	2	164467354	164467354	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:164467354C>A	ENST00000333129.3	-	3	1302	c.988G>T	c.(988-990)Gac>Tac	p.D330Y	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	330					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.D330Y(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						TAACTGGAGTCCATATCTCCT	0.468																																						uc002uck.1																			1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(988-990)GAC>TAC		fidgetin							110.0	107.0	108.0					2																	164467354		1933	4139	6072	SO:0001583	missense	55137					nuclear matrix	ATP binding|nucleoside-triphosphatase activity	g.chr2:164467354C>A	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.988G>T	2.37:g.164467354C>A	ENSP00000333836:p.Asp330Tyr		Somatic					p.D330Y	NM_018086	NP_060556	Capture	Illumina GAIIx	Phase_I	Q5HY92	FIGN_HUMAN			3	1299	-			330					B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	c.988G>T	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780462	0.49891	.	.	ENSG00000182263	ENST00000333129	D	0.92911	-3.13	5.94	5.94	0.96194	.	0.199928	0.51477	D	0.000084	D	0.92469	0.7609	L	0.44542	1.39	0.80722	D	1	D	0.59357	0.985	P	0.51297	0.665	D	0.91222	0.5007	10	0.39692	T	0.17	-23.3418	20.3666	0.98879	0.0:1.0:0.0:0.0	.	330	Q5HY92	FIGN_HUMAN	Y	330	ENSP00000333836:D330Y	ENSP00000333836:D330Y	D	-	1	0	FIGN	164175600	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.784000	0.85713	2.814000	0.96858	0.563000	0.77884	GAC		PASS	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086		105	232	---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170029717	170029717	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:170029717A>G	ENST00000263816.3	-	57	11317	c.11032T>C	c.(11032-11034)Tgt>Cgt	p.C3678R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3678	LDL-receptor class A 30. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.C3678R(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAGTTGTCACAGAGATGGGCA	0.473																																						uc002ues.2																			1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(11032-11034)TGT>CGT		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						89.0	87.0	88.0					2																	170029717		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170029717A>G		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11032T>C	2.37:g.170029717A>G	ENSP00000263816:p.Cys3678Arg		Somatic					p.C3678R	NM_004525	NP_004516	Capture	Illumina GAIIx	Phase_I	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	57	11245	-			3678			LDL-receptor class A 30.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.11032T>C	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.105295	0.77096	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.92048	-2.96	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.97102	0.9053	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97729	1.0201	10	0.56958	D	0.05	.	16.2479	0.82454	1.0:0.0:0.0:0.0	.	3678	P98164	LRP2_HUMAN	R	3678;373	ENSP00000263816:C3678R	ENSP00000263816:C3678R	C	-	1	0	LRP2	169737963	1.000000	0.71417	0.997000	0.53966	0.723000	0.41478	8.875000	0.92372	2.241000	0.73720	0.533000	0.62120	TGT		PASS	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		34	83	---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170059405	170059405	+	Silent	SNP	C	C	T	rs144284604	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:170059405C>T	ENST00000263816.3	-	43	8355	c.8070G>A	c.(8068-8070)aaG>aaA	p.K2690K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2690	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.K2690K(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAATGCAGTGCTTCCTGTTGT	0.493													C|||	2	0.000399361	0.0	0.0029	5008	,	,		23355	0.0		0.0	False		,,,				2504	0.0					uc002ues.2																			1	Substitution - coding silent(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(8068-8070)AAG>AAA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	C		1,4405	2.1+/-5.4	0,1,2202	186.0	165.0	172.0		8070	0.2	0.7	2	dbSNP_134	172	0,8600		0,0,4300	no	coding-synonymous	LRP2	NM_004525.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		2690/4656	170059405	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170059405C>T		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8070G>A	2.37:g.170059405C>T			Somatic					p.K2690K	NM_004525	NP_004516	Capture	Illumina GAIIx	Phase_I	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	43	8283	-			2690			EGF-like 10.|Extracellular (Potential).		O00711|Q16215	Silent	SNP	ENST00000263816.3	37	c.8070G>A	CCDS2232.1																																																																																				PASS	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		57	163	---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170936431	170936431	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:170936431C>T	ENST00000272793.5	+	37	5357	c.5307C>T	c.(5305-5307)tgC>tgT	p.C1769C	UBR3_ENST00000418381.1_Silent_p.C1769C|UBR3_ENST00000392631.1_Silent_p.C590C			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1769	Cys-rich.				embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C1769C(1)|p.C622C(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GTAGTGTCTGCACCAAGGTTC	0.403																																						uc010zdi.1																			2	Substitution - coding silent(2)		lung(2)		0						c.(5305-5307)TGC>TGT		E3 ubiquitin-protein ligase UBR3							148.0	135.0	139.0					2																	170936431		2203	4300	6503	SO:0001819	synonymous_variant	130507				sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:170936431C>T	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.5307C>T	2.37:g.170936431C>T			Somatic				UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Silent_p.C590C|UBR3_uc002uft.3_Silent_p.C626C|UBR3_uc010zdj.1_Silent_p.C460C|UBR3_uc002ufu.3_Silent_p.C275C	p.C1769C	NM_172070	NP_742067	Capture	Illumina GAIIx	Phase_I	Q6ZT12	UBR3_HUMAN			37	5307	+			1769			Cys-rich.		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Silent	SNP	ENST00000272793.5	37	c.5307C>T		.	.	.	.	.	.	.	.	.	.	C	9.491	1.100690	0.20552	.	.	ENSG00000144357	ENST00000392632	.	.	.	5.66	3.69	0.42338	.	.	.	.	.	T	0.57213	0.2038	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51156	-0.8741	4	.	.	.	.	7.3938	0.26926	0.0:0.6007:0.0:0.3993	.	.	.	.	V	831	.	.	A	+	2	0	UBR3	170644677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.515000	0.35845	0.615000	0.30124	-0.157000	0.13467	GCA		PASS	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070		143	144	---	---	---	---
KIAA1715	80856	broad.mit.edu	37	2	176794704	176794704	+	Silent	SNP	C	C	T	rs534119002		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:176794704C>T	ENST00000272748.4	-	13	1525	c.1278G>A	c.(1276-1278)acG>acA	p.T426T	KIAA1715_ENST00000544803.1_Silent_p.T457T	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	426					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.T426T(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			ACTACTCTGCCGTCAAAGATT	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		18026	0.0		0.0	False		,,,				2504	0.001					uc002ukc.1																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1276-1278)ACG>ACA		Lunapark							117.0	109.0	112.0					2																	176794704		2203	4300	6503	SO:0001819	synonymous_variant	80856					integral to membrane	protein binding	g.chr2:176794704C>T	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.1278G>A	2.37:g.176794704C>T			Somatic				KIAA1715_uc010zer.1_Silent_p.T457T|KIAA1715_uc010fqw.1_Silent_p.T492T|KIAA1715_uc010zes.1_Silent_p.T428T|KIAA1715_uc002ukd.1_Silent_p.T303T|KIAA1715_uc010zet.1_RNA	p.T426T	NM_030650	NP_085153	Capture	Illumina GAIIx	Phase_I	Q9C0E8	LNP_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0793)		13	1471	-			426			Cytoplasmic (Potential).		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Silent	SNP	ENST00000272748.4	37	c.1278G>A	CCDS33332.1																																																																																				PASS	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834		37	153	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179594173	179594173	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:179594173C>T	ENST00000591111.1	-	62	17983	c.17759G>A	c.(17758-17760)aGg>aAg	p.R5920K	TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.R6237K|TTN_ENST00000342992.6_Missense_Mutation_p.R4993K			Q8WZ42	TITIN_HUMAN	titin	12715	Ig-like 40.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R4993K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCGAATTTCCCTGTTATTCTT	0.458																																						uc010zfg.1																			1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(14977-14979)AGG>AAG		titin isoform N2-A							133.0	126.0	128.0					2																	179594173		1930	4133	6063	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179594173C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17759G>A	2.37:g.179594173C>T	ENSP00000465570:p.Arg5920Lys		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R1654K	p.R4993K	NM_133378	NP_596869	Capture	Illumina GAIIx	Phase_I	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		61	15202	-			5920					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.14978G>A		.	.	.	.	.	.	.	.	.	.	C	13.18	2.160383	0.38119	.	.	ENSG00000155657	ENST00000342992	T	0.64803	-0.12	5.92	-0.56	0.11789	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33381	0.0861	N	0.01779	-0.725	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07252	-1.0782	9	0.87932	D	0	.	11.0607	0.47946	0.0:0.3806:0.0:0.6194	.	5920	Q8WZ42	TITIN_HUMAN	K	4993	ENSP00000343764:R4993K	ENSP00000343764:R4993K	R	-	2	0	TTN	179302418	0.998000	0.40836	0.984000	0.44739	0.970000	0.65996	0.404000	0.20999	-0.303000	0.08856	-0.238000	0.12139	AGG		PASS	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		66	222	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179614216	179614216	+	Intron	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:179614216G>C	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Nonsense_Mutation_p.S4304*|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCCTTACTGAATATTCTTT	0.408																																						uc002unb.2																			0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(12910-12912)TCA>TGA		titin isoform novex-3							60.0	62.0	61.0					2																	179614216		2203	4299	6502	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179614216G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3634C>G	2.37:g.179614216G>C			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.S4304*	NM_133379	NP_596870	Capture	Illumina GAIIx	Phase_I	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13135	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.12911C>G		.	.	.	.	.	.	.	.	.	.	G	52	19.527574	0.99920	.	.	ENSG00000155657	ENST00000360870	.	.	.	6.17	1.24	0.21308	.	.	.	.	.	.	.	.	.	.	.	0.26997	N	0.965006	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	1.8278	0.03124	0.1959:0.1116:0.4411:0.2515	.	.	.	.	X	4304	.	ENSP00000354117:S4304X	S	-	2	0	TTN	179322461	0.016000	0.18221	0.096000	0.21009	0.011000	0.07611	0.289000	0.18957	-0.050000	0.13356	-1.047000	0.02352	TCA		PASS	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		86	99	---	---	---	---
NEUROD1	4760	broad.mit.edu	37	2	182543416	182543416	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:182543416C>G	ENST00000295108.3	-	2	629	c.172G>C	c.(172-174)Gag>Cag	p.E58Q	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	58	Glu-rich (acidic).				amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.E58Q(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			tcctcctcctcTCCCCCGTTC	0.552																																						uc002uof.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(172-174)GAG>CAG		neurogenic differentiation 1							133.0	102.0	112.0					2																	182543416		2203	4300	6503	SO:0001583	missense	4760				amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding	g.chr2:182543416C>G	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.172G>C	2.37:g.182543416C>G	ENSP00000295108:p.Glu58Gln		Somatic				CERKL_uc002uod.1_Intron	p.E58Q	NM_002500	NP_002491	Capture	Illumina GAIIx	Phase_I	Q13562	NDF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		2	408	-			58			Glu-rich (acidic).		B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	ENST00000295108.3	37	c.172G>C	CCDS2283.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331399	0.41297	.	.	ENSG00000162992	ENST00000295108	D	0.95918	-3.85	5.9	5.9	0.94986	.	0.363382	0.27645	N	0.018451	D	0.90277	0.6959	N	0.14661	0.345	0.46185	D	0.998918	B	0.23990	0.095	B	0.13407	0.009	D	0.86075	0.1540	10	0.28530	T	0.3	-20.6804	17.7728	0.88497	0.0:1.0:0.0:0.0	.	58	Q13562	NDF1_HUMAN	Q	58	ENSP00000295108:E58Q	ENSP00000295108:E58Q	E	-	1	0	NEUROD1	182251661	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.748000	0.85085	2.788000	0.95919	0.650000	0.86243	GAG		PASS	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		15	14	---	---	---	---
FAM171B	165215	broad.mit.edu	37	2	187625902	187625902	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:187625902A>G	ENST00000304698.5	+	7	1278	c.1075A>G	c.(1075-1077)Ata>Gta	p.I359V		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	359						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.I359V(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TCTTACAGCCATATTAGGAGG	0.328																																						uc002ups.2																			1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(3)|central_nervous_system(1)	10						c.(1075-1077)ATA>GTA		KIAA1946							166.0	153.0	157.0					2																	187625902		2203	4299	6502	SO:0001583	missense	165215					integral to membrane	DNA binding	g.chr2:187625902A>G	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1075A>G	2.37:g.187625902A>G	ENSP00000304108:p.Ile359Val		Somatic				FAM171B_uc002upr.1_Missense_Mutation_p.I359V|FAM171B_uc002upt.2_5'Flank	p.I359V	NM_177454	NP_803237	Capture	Illumina GAIIx	Phase_I	Q6P995	F171B_HUMAN			7	1187	+			359			Helical; (Potential).		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	c.1075A>G	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.443160	0.63067	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.47177	0.85	5.84	5.84	0.93424	.	0.094657	0.64402	D	0.000002	T	0.63827	0.2544	M	0.71206	2.165	0.44030	D	0.996753	D;D	0.56746	0.977;0.977	P;P	0.56474	0.799;0.799	T	0.68096	-0.5499	10	0.87932	D	0	-25.9927	16.226	0.82293	1.0:0.0:0.0:0.0	.	359;360	Q6P995;A8K122	F171B_HUMAN;.	V	359	ENSP00000304108:I359V	ENSP00000272804:I359V	I	+	1	0	FAM171B	187334147	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.824000	0.75288	2.230000	0.72887	0.528000	0.53228	ATA		PASS	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		37	114	---	---	---	---
GLS	2744	broad.mit.edu	37	2	191795219	191795219	+	Missense_Mutation	SNP	T	T	A	rs3207595		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:191795219T>A	ENST00000320717.3	+	13	1740	c.1482T>A	c.(1480-1482)aaT>aaA	p.N494K	GLS_ENST00000338435.4_Missense_Mutation_p.N494K|GLS_ENST00000409428.1_5'UTR|GLS_ENST00000409215.1_5'UTR|GLS_ENST00000409626.1_Missense_Mutation_p.N65K	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	494					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.N494K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	TTGTCCCCAATGTTATGGGTA	0.373																																						uc002usf.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1480-1482)AAT>AAA		glutaminase precursor	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						138.0	132.0	134.0					2																	191795219		2203	4300	6503	SO:0001583	missense	2744				cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity	g.chr2:191795219T>A	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1482T>A	2.37:g.191795219T>A	ENSP00000317379:p.Asn494Lys		Somatic				GLS_uc002use.2_Missense_Mutation_p.N494K|GLS_uc002usg.1_Missense_Mutation_p.N155K|GLS_uc002ush.2_Missense_Mutation_p.N155K|GLS_uc010zgi.1_Missense_Mutation_p.N65K|GLS_uc010zgj.1_5'UTR	p.N494K	NM_014905	NP_055720	Capture	Illumina GAIIx	Phase_I	O94925	GLSK_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		13	1746	+			494					Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	37	c.1482T>A	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657674	0.67586	.	.	ENSG00000115419	ENST00000320717;ENST00000338435;ENST00000409626;ENST00000457316;ENST00000412247	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.84	0.383	0.16239	Beta-lactamase/transpeptidase-like (1);	0.000000	0.85682	D	0.000000	T	0.62684	0.2448	M	0.85630	2.765	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.998;0.999	D;D;D;D;D	0.77004	0.989;0.975;0.98;0.975;0.982	T	0.64339	-0.6431	10	0.72032	D	0.01	-15.7451	10.0653	0.42299	0.0:0.4062:0.0:0.5938	.	65;494;148;494;494	B7Z2P1;A8K132;Q68D38;O94925;O94925-3	.;.;.;GLSK_HUMAN;.	K	494;494;65;65;15	ENSP00000317379:N494K;ENSP00000340689:N494K;ENSP00000386417:N65K;ENSP00000395596:N65K;ENSP00000403329:N15K	ENSP00000317379:N494K	N	+	3	2	GLS	191503464	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	0.972000	0.29409	0.053000	0.16036	-0.353000	0.07706	AAT		PASS	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2			22	157	---	---	---	---
ZDBF2	57683	broad.mit.edu	37	2	207173840	207173840	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:207173840C>A	ENST00000374423.3	+	5	4974	c.4588C>A	c.(4588-4590)Ctg>Atg	p.L1530M		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1530							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.L1530M(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						ACTTGTGGATCTGGTGCCCGG	0.398																																						uc002vbp.2																			2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(4588-4590)CTG>ATG		zinc finger, DBF-type containing 2							78.0	79.0	79.0					2																	207173840		1874	4094	5968	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207173840C>A	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.4588C>A	2.37:g.207173840C>A	ENSP00000363545:p.Leu1530Met		Somatic					p.L1530M	NM_020923	NP_065974	Capture	Illumina GAIIx	Phase_I	Q9HCK1	ZDBF2_HUMAN			5	4838	+			1530					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.4588C>A	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	6.580	0.475427	0.12521	.	.	ENSG00000204186	ENST00000374423	T	0.55052	0.54	4.01	-1.09	0.09904	.	.	.	.	.	T	0.45337	0.1337	L	0.40543	1.245	0.09310	N	1	P	0.38195	0.622	B	0.41988	0.372	T	0.39981	-0.9587	9	0.42905	T	0.14	.	10.9376	0.47253	0.0:0.2098:0.6916:0.0986	.	1530	Q9HCK1	ZDBF2_HUMAN	M	1530	ENSP00000363545:L1530M	ENSP00000363545:L1530M	L	+	1	2	ZDBF2	206882085	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.825000	0.04433	-0.229000	0.09854	-0.985000	0.02557	CTG		PASS	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		8	65	---	---	---	---
ZDBF2	57683	broad.mit.edu	37	2	207176077	207176077	+	Silent	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:207176077A>T	ENST00000374423.3	+	5	7211	c.6825A>T	c.(6823-6825)ccA>ccT	p.P2275P		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2275							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P2275P(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CTTCAGTTCCACCAGCTGGTG	0.493																																						uc002vbp.2																			2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(6823-6825)CCA>CCT		zinc finger, DBF-type containing 2							32.0	34.0	33.0					2																	207176077		1901	4133	6034	SO:0001819	synonymous_variant	57683						nucleic acid binding|zinc ion binding	g.chr2:207176077A>T	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6825A>T	2.37:g.207176077A>T			Somatic					p.P2275P	NM_020923	NP_065974	Capture	Illumina GAIIx	Phase_I	Q9HCK1	ZDBF2_HUMAN			5	7075	+			2275					Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	c.6825A>T	CCDS46501.1																																																																																				PASS	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		6	21	---	---	---	---
CAB39	51719	broad.mit.edu	37	2	231658041	231658041	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:231658041G>T	ENST00000258418.5	+	4	822	c.393G>T	c.(391-393)ttG>ttT	p.L131F	CAB39_ENST00000410084.3_Missense_Mutation_p.L131F|CAB39_ENST00000409788.3_Missense_Mutation_p.L131F	NM_016289.3	NP_057373.1	Q9Y376	CAB39_HUMAN	calcium binding protein 39	131					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cellular hypotonic response (GO:0071476)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein heterooligomerization (GO:0051291)|signal transduction by phosphorylation (GO:0023014)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activator activity (GO:0043539)	p.L131F(1)		central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		TCATGTTATTGAAAGGGTATG	0.343																																						uc002vqx.2																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(391-393)TTG>TTT		calcium binding protein 39							85.0	84.0	84.0					2																	231658041		2202	4300	6502	SO:0001583	missense	51719				cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding	g.chr2:231658041G>T	AF113536	CCDS2478.1	2q37.1	2008-02-05			ENSG00000135932	ENSG00000135932			20292	protein-coding gene	gene with protein product		612174					Standard	NM_016289		Approved	CGI-66, MO25	uc002vqx.3	Q9Y376	OTTHUMG00000133220	ENST00000258418.5:c.393G>T	2.37:g.231658041G>T	ENSP00000258418:p.Leu131Phe		Somatic				CAB39_uc010fxr.2_Missense_Mutation_p.L131F|CAB39_uc010fxq.2_Missense_Mutation_p.L131F	p.L131F	NM_016289	NP_057373	Capture	Illumina GAIIx	Phase_I	Q9Y376	CAB39_HUMAN		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)	4	825	+		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)	131					A8K8L7	Missense_Mutation	SNP	ENST00000258418.5	37	c.393G>T	CCDS2478.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353343	0.41700	.	.	ENSG00000135932	ENST00000258418;ENST00000409788;ENST00000410084	T;T;T	0.36157	1.27;1.27;1.27	6.04	2.9	0.33743	Armadillo-like helical (1);Armadillo-type fold (1);	0.088739	0.56097	D	0.000040	T	0.27663	0.0680	L	0.49256	1.55	0.54753	D	0.999988	B	0.22800	0.075	B	0.22880	0.042	T	0.15065	-1.0450	10	0.54805	T	0.06	.	3.399	0.07316	0.2943:0.206:0.4997:0.0	.	131	Q9Y376	CAB39_HUMAN	F	131	ENSP00000258418:L131F;ENSP00000386238:L131F;ENSP00000386642:L131F	ENSP00000258418:L131F	L	+	3	2	CAB39	231366285	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.090000	0.30902	0.872000	0.35775	0.563000	0.77884	TTG		PASS	CAB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256955.2	NM_016289		26	81	---	---	---	---
INPP5D	3635	broad.mit.edu	37	2	234112939	234112939	+	Missense_Mutation	SNP	C	C	A	rs537009392	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr2:234112939C>A	ENST00000359570.5	+	28	3107	c.3107C>A	c.(3106-3108)cCg>cAg	p.P1036Q	INPP5D_ENST00000450745.1_Missense_Mutation_p.P800Q|INPP5D_ENST00000455936.2_Missense_Mutation_p.P800Q|RN7SL32P_ENST00000580514.1_RNA			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	1048	Pro-rich.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)	p.P1048Q(1)		central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		AAGGAACCCCCGCCCTGCCCG	0.657																																					NSCLC(82;1215 1426 16163 20348 41018)	uc010zmo.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(3142-3144)CCG>CAG		SH2 containing inositol phosphatase isoform a							33.0	44.0	41.0					2																	234112939		1912	4113	6025	SO:0001583	missense	3635				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding	g.chr2:234112939C>A	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.3107C>A	2.37:g.234112939C>A	ENSP00000352575:p.Pro1036Gln		Somatic				INPP5D_uc010zmp.1_Missense_Mutation_p.P1047Q	p.P1048Q	NM_001017915	NP_001017915	Capture	Illumina GAIIx	Phase_I	Q92835	SHIP1_HUMAN		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)	25	3296	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)	1048			SH3-binding 3.|Pro-rich.		O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	ENST00000359570.5	37	c.3143C>A		.	.	.	.	.	.	.	.	.	.	c	11.86	1.765932	0.31228	.	.	ENSG00000168918	ENST00000359570;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964	D;D;D;D;D;D	0.96459	-3.96;-4.01;-4.01;-4.02;-4.02;-4.02	4.59	2.65	0.31530	.	0.759864	0.12739	N	0.443177	D	0.90577	0.7046	.	.	.	0.09310	N	1	B;B	0.32071	0.308;0.355	B;B	0.27170	0.058;0.077	T	0.83017	-0.0169	9	0.33141	T	0.24	.	5.2987	0.15766	0.163:0.6572:0.0:0.1797	.	1047;1048	Q92835-2;Q92835	.;SHIP1_HUMAN	Q	1036;800;800;669;669;669	ENSP00000352575:P1036Q;ENSP00000407916:P800Q;ENSP00000404610:P800Q;ENSP00000400151:P669Q;ENSP00000397421:P669Q;ENSP00000405338:P669Q	ENSP00000352575:P1036Q	P	+	2	0	INPP5D	233777678	0.000000	0.05858	0.659000	0.29680	0.986000	0.74619	0.051000	0.14141	1.067000	0.40740	-0.119000	0.15052	CCG		PASS	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915		47	40	---	---	---	---
ATG7	10533	broad.mit.edu	37	3	11350508	11350508	+	Silent	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:11350508C>G	ENST00000354449.3	+	5	409	c.384C>G	c.(382-384)ctC>ctG	p.L128L	ATG7_ENST00000446450.2_Silent_p.L128L|ATG7_ENST00000354956.5_Silent_p.L128L	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	128					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)	p.L128L(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CTGTACTCCTCAACAAGTTCC	0.468																																						uc003bwc.2																			1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(382-384)CTC>CTG		APG7 autophagy 7-like isoform a							260.0	228.0	239.0					3																	11350508		2203	4300	6503	SO:0001819	synonymous_variant	10533				autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity	g.chr3:11350508C>G	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.384C>G	3.37:g.11350508C>G			Somatic				ATG7_uc003bwd.2_Silent_p.L128L|ATG7_uc011aum.1_Silent_p.L128L	p.L128L	NM_006395	NP_006386	Capture	Illumina GAIIx	Phase_I	O95352	ATG7_HUMAN			5	501	+			128					B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Silent	SNP	ENST00000354449.3	37	c.384C>G	CCDS2605.1																																																																																				PASS	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395		232	172	---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28566160	28566160	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:28566160C>A	ENST00000383768.2	+	10	1240	c.1052C>A	c.(1051-1053)gCt>gAt	p.A351D	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.A351D			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	351							zinc ion binding (GO:0008270)	p.A351D(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						GAAATAGATGCTTTGATGTCT	0.234																																						uc003ceh.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1051-1053)GCT>GAT		zinc finger, CW type with PWWP domain 2							30.0	34.0	33.0					3																	28566160		2176	4288	6464	SO:0001583	missense	152098						zinc ion binding	g.chr3:28566160C>A	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.1052C>A	3.37:g.28566160C>A	ENSP00000373278:p.Ala351Asp		Somatic				ZCWPW2_uc003cei.2_Missense_Mutation_p.A351D|ZCWPW2_uc010hfo.2_Missense_Mutation_p.A156D	p.A351D	NM_001040432	NP_001035522	Capture	Illumina GAIIx	Phase_I	Q504Y3	ZCPW2_HUMAN			10	1220	+			351						Missense_Mutation	SNP	ENST00000383768.2	37	c.1052C>A	CCDS33723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.01|16.01	3.000813|3.000813	0.54254|0.54254	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000419130	T;T|.	0.32023|.	1.47;1.47|.	6.03|6.03	5.11|5.11	0.69529|0.69529	.|.	0.000000|.	0.52532|.	D|.	0.000073|.	T|.	0.46092|.	0.1375|.	L|L	0.34521|0.34521	1.04|1.04	0.31490|0.31490	N|N	0.666111|0.666111	D|.	0.65815|.	0.995|.	P|.	0.62560|.	0.904|.	T|.	0.47315|.	-0.9127|.	10|.	0.87932|.	D|.	0|.	-15.9253|-15.9253	14.0507|14.0507	0.64734|0.64734	0.0:0.849:0.151:0.0|0.0:0.849:0.151:0.0	.|.	351|.	Q504Y3|.	ZCPW2_HUMAN|.	D|X	351|235	ENSP00000373278:A351D;ENSP00000412386:A351D|.	ENSP00000373278:A351D|.	A|C	+|+	2|3	0|2	ZCWPW2|ZCWPW2	28541164|28541164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.904000|0.904000	0.28491|0.28491	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	GCT|TGC		PASS	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384		37	17	---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48622528	48622528	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:48622528G>T	ENST00000328333.8	-	32	4023	c.3916C>A	c.(3916-3918)Cgt>Agt	p.R1306S	COL7A1_ENST00000454817.1_Missense_Mutation_p.R1306S	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1306	Interrupted collagenous region.|Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1306S(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGCCTGGACGCCCATCTGCT	0.677																																						uc003ctz.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(3916-3918)CGT>AGT		alpha 1 type VII collagen precursor							19.0	24.0	22.0					3																	48622528		2199	4298	6497	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48622528G>T	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.3916C>A	3.37:g.48622528G>T	ENSP00000332371:p.Arg1306Ser		Somatic					p.R1306S	NM_000094	NP_000085	Capture	Illumina GAIIx	Phase_I	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	32	3917	-			1306			Triple-helical region.|Interrupted collagenous region.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.3916C>A	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716097	0.30413	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93712	-3.27;-3.27	5.03	3.06	0.35304	.	0.715263	0.11985	N	0.510351	D	0.85647	0.5745	N	0.17594	0.5	0.21802	N	0.99954	B	0.21821	0.061	B	0.20577	0.03	T	0.73014	-0.4116	10	0.21014	T	0.42	.	9.4411	0.38668	0.0:0.2875:0.5646:0.1479	.	1306	Q02388	CO7A1_HUMAN	S	1306	ENSP00000332371:R1306S;ENSP00000412569:R1306S	ENSP00000332371:R1306S	R	-	1	0	COL7A1	48597532	0.006000	0.16342	1.000000	0.80357	0.902000	0.53008	0.063000	0.14410	1.214000	0.43395	0.655000	0.94253	CGT		PASS	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		6	33	---	---	---	---
CNTN3	5067	broad.mit.edu	37	3	74383978	74383978	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:74383978C>T	ENST00000263665.6	-	12	1603	c.1576G>A	c.(1576-1578)Gac>Aac	p.D526N		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	526	Ig-like C2-type 6.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.D526N(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AACAGCGGGTCATGTTGTACC	0.418																																						uc003dpm.1																			1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|skin(1)	5						c.(1576-1578)GAC>AAC		contactin 3 precursor							125.0	117.0	120.0					3																	74383978		2203	4300	6503	SO:0001583	missense	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74383978C>T	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1576G>A	3.37:g.74383978C>T	ENSP00000263665:p.Asp526Asn		Somatic					p.D526N	NM_020872	NP_065923	Capture	Illumina GAIIx	Phase_I	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	12	1656	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	526			Ig-like C2-type 6.		B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	c.1576G>A	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	33	5.244224	0.95272	.	.	ENSG00000113805	ENST00000263665	T	0.66815	-0.23	5.4	5.4	0.78164	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80737	0.4680	M	0.65320	2	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.82248	-0.0551	10	0.87932	D	0	.	19.1897	0.93660	0.0:1.0:0.0:0.0	.	526	Q9P232	CNTN3_HUMAN	N	526	ENSP00000263665:D526N	ENSP00000263665:D526N	D	-	1	0	CNTN3	74466668	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.200000	0.77838	2.548000	0.85928	0.655000	0.94253	GAC		PASS	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		52	74	---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77571935	77571935	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:77571935C>T	ENST00000461745.1	+	6	1716	c.816C>T	c.(814-816)atC>atT	p.I272I	ROBO2_ENST00000487694.3_Silent_p.I288I|ROBO2_ENST00000332191.8_Silent_p.I272I	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	272	Ig-like C2-type 3.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.I272I(1)|p.I288I(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GGTATGACATCAAAGACGATT	0.328																																						uc003dpy.3																			2	Substitution - coding silent(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(814-816)ATC>ATT		roundabout, axon guidance receptor, homolog 2							116.0	111.0	113.0					3																	77571935		1832	4073	5905	SO:0001819	synonymous_variant	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77571935C>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.816C>T	3.37:g.77571935C>T			Somatic				ROBO2_uc003dpz.2_Silent_p.I272I|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.I272I	p.I272I	NM_002942	NP_002933	Capture	Illumina GAIIx	Phase_I	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	6	1459	+			272			Ig-like C2-type 3.|Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	c.816C>T	CCDS43109.1																																																																																				PASS	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		24	70	---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77637988	77637988	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:77637988G>A	ENST00000461745.1	+	17	3487	c.2587G>A	c.(2587-2589)Gct>Act	p.A863T	ROBO2_ENST00000487694.3_Missense_Mutation_p.A879T|ROBO2_ENST00000332191.8_Missense_Mutation_p.A863T	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	863					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.A879T(1)|p.A863T(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AGCCTTTATAGCTGGTATTGG	0.418																																						uc003dpy.3																			2	Substitution - Missense(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(2587-2589)GCT>ACT		roundabout, axon guidance receptor, homolog 2							163.0	155.0	157.0					3																	77637988		1883	4118	6001	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77637988G>A	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2587G>A	3.37:g.77637988G>A	ENSP00000417164:p.Ala863Thr		Somatic				ROBO2_uc003dpz.2_Missense_Mutation_p.A867T|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.A867T|ROBO2_uc003dqa.2_5'UTR	p.A863T	NM_002942	NP_002933	Capture	Illumina GAIIx	Phase_I	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	17	3230	+			863			Helical; (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.2587G>A	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157955	0.78114	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.67171	-0.25;-0.22;-0.18	5.78	5.78	0.91487	.	0.000000	0.45606	D	0.000349	D	0.83330	0.5231	M	0.76838	2.35	0.32852	D	0.506780	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.84050	0.0369	9	0.66056	D	0.02	.	20.0175	0.97485	0.0:0.0:1.0:0.0	.	879;863;863	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	T	879;879;883;863;863	ENSP00000417335:A879T;ENSP00000417164:A863T;ENSP00000327536:A863T	ENSP00000327536:A863T	A	+	1	0	ROBO2	77720678	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	9.869000	0.99810	2.730000	0.93505	0.650000	0.86243	GCT		PASS	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		39	47	---	---	---	---
VGLL3	389136	broad.mit.edu	37	3	87018024	87018024	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:87018024G>C	ENST00000398399.2	-	3	1016	c.653C>G	c.(652-654)tCc>tGc	p.S218C	VGLL3_ENST00000383698.3_Missense_Mutation_p.S218C	NM_016206.2	NP_057290.2			vestigial-like family member 3									p.S218C(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		ATGGCTGTAGGATGGGCTCAC	0.602																																						uc003dqn.2																			1	Substitution - Missense(1)		lung(1)		0						c.(652-654)TCC>TGC		colon carcinoma related protein							87.0	90.0	89.0					3																	87018024		2165	4273	6438	SO:0001583	missense	389136				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:87018024G>C	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.653C>G	3.37:g.87018024G>C	ENSP00000381436:p.Ser218Cys		Somatic					p.S218C	NM_016206	NP_057290	Capture	Illumina GAIIx	Phase_I	A8MV65	VGLL3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)	3	1017	-	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)	218						Missense_Mutation	SNP	ENST00000398399.2	37	c.653C>G	CCDS43110.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.27|18.27	3.587310|3.587310	0.66105|0.66105	.|.	.|.	ENSG00000206538|ENSG00000206538	ENST00000494229|ENST00000398399;ENST00000383698	.|T;T	.|0.49139	.|0.79;0.8	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.289185	.|0.27917	.|N	.|0.017325	T|T	0.55657|0.55657	0.1934|0.1934	L|L	0.50333|0.50333	1.59|1.59	0.34713|0.34713	D|D	0.727939|0.727939	.|D	.|0.59357	.|0.985	.|P	.|0.49999	.|0.628	T|T	0.65821|0.65821	-0.6075|-0.6075	5|10	.|0.62326	.|D	.|0.03	-6.9328|-6.9328	19.6643|19.6643	0.95887|0.95887	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|218	.|A8MV65	.|VGLL3_HUMAN	M|C	151|218	.|ENSP00000381436:S218C;ENSP00000373199:S218C	.|ENSP00000373199:S218C	I|S	-|-	3|2	3|0	VGLL3|VGLL3	87100714|87100714	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.272000|4.272000	0.58908|0.58908	2.756000|2.756000	0.94617|0.94617	0.511000|0.511000	0.50034|0.50034	ATC|TCC		PASS	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206		3	61	---	---	---	---
ST3GAL6	10402	broad.mit.edu	37	3	98512603	98512603	+	Nonstop_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:98512603T>A	ENST00000483910.1	+	10	1283	c.994T>A	c.(994-996)Tga>Aga	p.*332R	ST3GAL6_ENST00000394162.1_Nonstop_Mutation_p.*332R|ST3GAL6_ENST00000462152.1_3'UTR|ST3GAL6_ENST00000265261.6_Nonstop_Mutation_p.*214R	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	0					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)	p.*332R(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						GACTCAAGATTGACTCTACAG	0.323																																						uc003dsz.2																			1	Nonstop extension(1)		lung(1)	ovary(1)	1						c.(994-996)TGA>AGA		alpha2,3-sialyltransferase VI							87.0	90.0	89.0					3																	98512603		2203	4300	6503	SO:0001578	stop_lost	10402				amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity	g.chr3:98512603T>A	AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.994T>A	3.37:g.98512603T>A	ENSP00000417376:p.*332Argext*7		Somatic				ST3GAL6_uc003dsy.2_Nonstop_Mutation_p.*246R|ST3GAL6_uc003dta.2_Nonstop_Mutation_p.*214R|ST3GAL6_uc003dtb.2_Nonstop_Mutation_p.*188R|ST3GAL6_uc003dtc.2_Nonstop_Mutation_p.*332R|ST3GAL6_uc010hpd.2_Nonstop_Mutation_p.*385R	p.*332R	NM_006100	NP_006091	Capture	Illumina GAIIx	Phase_I	Q9Y274	SIA10_HUMAN			10	1230	+			332					B2RCH2|B3KMI1|D3DN39|F8W6U0	Nonstop_Mutation	SNP	ENST00000483910.1	37	c.994T>A	CCDS2933.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.090067	0.55968	.	.	ENSG00000064225	ENST00000483910;ENST00000265261;ENST00000394162	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7674	0.57399	0.0:0.0:0.0:1.0	.	.	.	.	R	332;214;332	.	.	X	+	1	0	ST3GAL6	99995293	1.000000	0.71417	0.957000	0.39632	0.400000	0.30750	4.689000	0.61723	2.270000	0.75569	0.460000	0.39030	TGA		PASS	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100		239	132	---	---	---	---
MORC1	27136	broad.mit.edu	37	3	108776294	108776294	+	Silent	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:108776294T>A	ENST00000483760.1	-	13	1114	c.1071A>T	c.(1069-1071)ggA>ggT	p.G357G	MORC1_ENST00000232603.5_Silent_p.G357G					MORC family CW-type zinc finger 1									p.G357G(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CTACGTTCACTCCATAGAACA	0.338																																						uc003dxl.2																			1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(3)|breast(2)	8						c.(1069-1071)GGA>GGT		MORC family CW-type zinc finger 1							119.0	113.0	115.0					3																	108776294		2203	4300	6503	SO:0001819	synonymous_variant	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108776294T>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1071A>T	3.37:g.108776294T>A			Somatic				MORC1_uc011bhn.1_Silent_p.G357G	p.G357G	NM_014429	NP_055244	Capture	Illumina GAIIx	Phase_I	Q86VD1	MORC1_HUMAN			13	1158	-			357						Silent	SNP	ENST00000483760.1	37	c.1071A>T																																																																																					PASS	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			42	382	---	---	---	---
BOC	91653	broad.mit.edu	37	3	112969595	112969595	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:112969595C>A	ENST00000495514.1	+	4	995	c.291C>A	c.(289-291)aaC>aaA	p.N97K	BOC_ENST00000484034.1_Missense_Mutation_p.N97K|BOC_ENST00000485230.1_Missense_Mutation_p.N97K|BOC_ENST00000355385.3_Missense_Mutation_p.N97K|BOC_ENST00000273395.4_Missense_Mutation_p.N97K			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	97	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.N97K(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CTGCCCTTAACAACCACACTG	0.597																																						uc003dzx.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(289-291)AAC>AAA		brother of CDO precursor							106.0	100.0	102.0					3																	112969595		2203	4300	6503	SO:0001583	missense	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112969595C>A	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.291C>A	3.37:g.112969595C>A	ENSP00000418663:p.Asn97Lys		Somatic				BOC_uc010hqi.2_Missense_Mutation_p.N97K|BOC_uc003dzy.2_Missense_Mutation_p.N97K|BOC_uc003dzz.2_Missense_Mutation_p.N97K|BOC_uc003dzw.1_Missense_Mutation_p.N97K|BOC_uc003eaa.1_Missense_Mutation_p.N97K	p.N97K	NM_033254	NP_150279	Capture	Illumina GAIIx	Phase_I	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		4	912	+			97			Extracellular (Potential).|Ig-like C2-type 1.		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	c.291C>A	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	c	17.69	3.451503	0.63290	.	.	ENSG00000144857	ENST00000495514;ENST00000485230;ENST00000273395;ENST00000355385;ENST00000484034	T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68	5.67	4.8	0.61643	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.548854	0.20825	N	0.084988	T	0.13756	0.0333	L	0.39566	1.225	0.41585	D	0.988767	B;B;B	0.29136	0.234;0.03;0.098	B;B;B	0.35182	0.197;0.07;0.173	T	0.10337	-1.0634	9	.	.	.	.	10.9132	0.47120	0.0:0.8564:0.0:0.1436	.	97;97;97	Q9BWV1-3;Q9BWV1;Q96DN7	.;BOC_HUMAN;.	K	97	ENSP00000418663:N97K;ENSP00000420154:N97K;ENSP00000273395:N97K;ENSP00000347546:N97K;ENSP00000417337:N97K	.	N	+	3	2	BOC	114452285	0.998000	0.40836	0.999000	0.59377	0.983000	0.72400	1.868000	0.39509	1.410000	0.46936	0.550000	0.68814	AAC		PASS	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		18	173	---	---	---	---
CFAP44	55779	broad.mit.edu	37	3	113145025	113145025	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:113145025G>A	ENST00000295868.2	-	4	515	c.353C>T	c.(352-354)tCg>tTg	p.S118L	WDR52-AS1_ENST00000498480.1_RNA|WDR52_ENST00000393845.2_Missense_Mutation_p.S118L|WDR52-AS1_ENST00000473329.1_RNA	NM_018338.3	NP_060808.2												p.S118L(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						AAAAGGCATCGAAGCAAGCTC	0.413																																						uc003eae.1																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(352-354)TCG>TTG		WD repeat domain 52 isoform 2							226.0	230.0	229.0					3																	113145025		2203	4300	6503	SO:0001583	missense	55779							g.chr3:113145025G>A																												ENST00000295868.2:c.353C>T	3.37:g.113145025G>A	ENSP00000295868:p.Ser118Leu		Somatic					p.S118L	NM_018338	NP_060808	Capture	Illumina GAIIx	Phase_I	Q96MT7	WDR52_HUMAN			4	399	-			118						Missense_Mutation	SNP	ENST00000295868.2	37	c.353C>T	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.862232	0.51482	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.51817	2.59;0.69	6.16	5.29	0.74685	.	.	.	.	.	T	0.43743	0.1261	L	0.49778	1.585	0.80722	D	1	B	0.23128	0.08	B	0.13407	0.009	T	0.38866	-0.9641	9	0.72032	D	0.01	.	13.6862	0.62517	0.0716:0.0:0.9284:0.0	.	118	Q96MT7	WDR52_HUMAN	L	118	ENSP00000377428:S118L;ENSP00000295868:S118L	ENSP00000295868:S118L	S	-	2	0	WDR52	114627715	1.000000	0.71417	0.042000	0.18584	0.580000	0.36256	5.498000	0.66931	1.623000	0.50342	0.650000	0.86243	TCG		PASS	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3			79	821	---	---	---	---
KIAA1407	57577	broad.mit.edu	37	3	113755617	113755617	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:113755617C>T	ENST00000295878.3	-	5	578	c.432G>A	c.(430-432)ttG>ttA	p.L144L	KIAA1407_ENST00000545063.1_5'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	144								p.L144L(1)		endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CTTCTTCCTCCAAATAGCCAC	0.318																																						uc003eax.2																			1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(430-432)TTG>TTA		hypothetical protein LOC57577							84.0	78.0	80.0					3																	113755617		2203	4300	6503	SO:0001819	synonymous_variant	57577							g.chr3:113755617C>T	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.432G>A	3.37:g.113755617C>T			Somatic				KIAA1407_uc011bin.1_RNA|KIAA1407_uc011bio.1_Silent_p.L122L|KIAA1407_uc011bip.1_Silent_p.L131L	p.L144L	NM_020817	NP_065868	Capture	Illumina GAIIx	Phase_I	Q8NCU4	K1407_HUMAN			5	579	-			144					B4DYL1|Q9P2E0	Silent	SNP	ENST00000295878.3	37	c.432G>A	CCDS2977.1																																																																																				PASS	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817		37	244	---	---	---	---
ZBTB20	26137	broad.mit.edu	37	3	114070037	114070037	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:114070037C>T	ENST00000474710.1	-	4	1066	c.888G>A	c.(886-888)caG>caA	p.Q296Q	ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000464560.1_Silent_p.Q223Q|ZBTB20_ENST00000471418.1_Silent_p.Q223Q|ZBTB20_ENST00000393785.2_Silent_p.Q223Q|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000462705.1_Silent_p.Q223Q|ZBTB20_ENST00000481632.1_Silent_p.Q223Q|ZBTB20_ENST00000357258.3_Silent_p.Q223Q	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	296						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.Q223Q(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCTCCATCTGCTGCGAGCGCT	0.667																																					NSCLC(69;748 1344 9802 11203 30933)	uc003ebi.2																			1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(886-888)CAG>CAA		zinc finger and BTB domain containing 20 isoform							74.0	71.0	72.0					3																	114070037		2203	4300	6503	SO:0001819	synonymous_variant	26137				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:114070037C>T	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.888G>A	3.37:g.114070037C>T			Somatic				ZBTB20_uc003ebj.2_Silent_p.Q223Q|ZBTB20_uc010hqp.2_Silent_p.Q223Q|ZBTB20_uc003ebk.2_Silent_p.Q223Q|ZBTB20_uc003ebl.2_Silent_p.Q223Q|ZBTB20_uc003ebm.2_Silent_p.Q223Q|ZBTB20_uc003ebn.2_Silent_p.Q223Q|uc003ebo.1_5'Flank	p.Q296Q	NM_015642	NP_056457	Capture	Illumina GAIIx	Phase_I	Q9HC78	ZBT20_HUMAN		LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)	4	1068	-			296					Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	ENST00000474710.1	37	c.888G>A	CCDS54626.1																																																																																				PASS	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		49	336	---	---	---	---
POGLUT1	56983	broad.mit.edu	37	3	119211230	119211230	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:119211230C>T	ENST00000295588.4	+	11	1208	c.1124C>T	c.(1123-1125)aCg>aTg	p.T375M		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	375					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)	p.T375M(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						TATAATGTAACGAGAAGGAAA	0.383																																						uc003ecm.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1123-1125)ACG>ATG		KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor							103.0	101.0	102.0					3																	119211230		2203	4300	6503	SO:0001583	missense	56983					endoplasmic reticulum lumen	UDP-glucosyltransferase activity	g.chr3:119211230C>T	BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.1124C>T	3.37:g.119211230C>T	ENSP00000295588:p.Thr375Met		Somatic				KTELC1_uc011bja.1_Missense_Mutation_p.T216M	p.T375M	NM_152305	NP_689518	Capture	Illumina GAIIx	Phase_I	Q8NBL1	PGLT1_HUMAN		GBM - Glioblastoma multiforme(114;0.233)	11	1208	+			375					B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	ENST00000295588.4	37	c.1124C>T	CCDS2988.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501218	0.64298	.	.	ENSG00000163389	ENST00000295588	T	0.24723	1.84	5.97	5.03	0.67393	.	0.220831	0.47093	D	0.000243	T	0.29620	0.0739	L	0.39898	1.24	0.31129	N	0.707929	D	0.59357	0.985	P	0.51701	0.677	T	0.14117	-1.0484	10	0.48119	T	0.1	-15.6	10.708	0.45966	0.2332:0.7668:0.0:0.0	.	375	Q8NBL1	PGLT1_HUMAN	M	375	ENSP00000295588:T375M	ENSP00000295588:T375M	T	+	2	0	POGLUT1	120693920	0.999000	0.42202	0.996000	0.52242	0.953000	0.61014	3.246000	0.51414	2.836000	0.97738	0.655000	0.94253	ACG		PASS	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355034.2	NM_152305		84	310	---	---	---	---
HGD	3081	broad.mit.edu	37	3	120394658	120394658	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:120394658C>T	ENST00000283871.5	-	2	527	c.68G>A	c.(67-69)gGt>gAt	p.G23D	HGD_ENST00000488183.1_5'UTR	NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	23					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)	p.G23D(1)		cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		TGGCAGGGAACCTGGGCAGCG	0.468																																						uc003edw.2																			1	Substitution - Missense(1)		lung(1)		0						c.(67-69)GGT>GAT		homogentisate 1,2-dioxygenase							110.0	104.0	106.0					3																	120394658		2203	4296	6499	SO:0001583	missense	3081				L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	homogentisate 1,2-dioxygenase activity|metal ion binding	g.chr3:120394658C>T		CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.68G>A	3.37:g.120394658C>T	ENSP00000283871:p.Gly23Asp		Somatic					p.G23D	NM_000187	NP_000178	Capture	Illumina GAIIx	Phase_I	Q93099	HGD_HUMAN		GBM - Glioblastoma multiforme(114;0.158)	2	438	-			23					A8K417|B2R8Z0	Missense_Mutation	SNP	ENST00000283871.5	37	c.68G>A	CCDS3000.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.57|14.57	2.576282|2.576282	0.45902|0.45902	.|.	.|.	ENSG00000113924|ENSG00000113924	ENST00000283871|ENST00000476082	D|D	0.99722|0.96427	-6.53|-4.01	5.82|5.82	5.82|5.82	0.92795|0.92795	Cupin, RmlC-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.96262|0.96262	0.8781|0.8781	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	P|.	0.47302|.	0.893|.	P|.	0.49192|.	0.602|.	D|D	0.96621|0.96621	0.9459|0.9459	10|7	0.54805|0.87932	T|D	0.06|0	-21.3811|-21.3811	17.5818|17.5818	0.87970|0.87970	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	23|.	Q93099|.	HGD_HUMAN|.	D|I	23|12	ENSP00000283871:G23D|ENSP00000419560:V12I	ENSP00000283871:G23D|ENSP00000419560:V12I	G|V	-|-	2|1	0|0	HGD|HGD	121877348|121877348	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.993000|0.993000	0.82548|0.82548	6.493000|6.493000	0.73658|0.73658	2.739000|2.739000	0.93911|0.93911	0.655000|0.655000	0.94253|0.94253	GGT|GTT		PASS	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355410.1			27	382	---	---	---	---
PARP15	165631	broad.mit.edu	37	3	122354820	122354820	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:122354820C>T	ENST00000464300.2	+	12	1976	c.1910C>T	c.(1909-1911)cCc>cTc	p.P637L	PARP15_ENST00000483793.1_Missense_Mutation_p.P442L|PARP15_ENST00000493645.1_Missense_Mutation_p.P334L|PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000310366.4_Missense_Mutation_p.P403L	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	637	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.P403L(1)|p.P637L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		ACCCCTCCACCCAAGAATCCT	0.458																																						uc003efm.2																			2	Substitution - Missense(2)		lung(2)	lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5						c.(1909-1911)CCC>CTC		poly (ADP-ribose) polymerase family, member 15							141.0	115.0	124.0					3																	122354820		2203	4300	6503	SO:0001583	missense	165631				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity	g.chr3:122354820C>T	AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.1910C>T	3.37:g.122354820C>T	ENSP00000417214:p.Pro637Leu		Somatic				PARP15_uc003efn.2_Missense_Mutation_p.P442L|PARP15_uc003efo.1_Missense_Mutation_p.P384L|PARP15_uc003efp.1_Missense_Mutation_p.P403L|PARP15_uc011bjt.1_Missense_Mutation_p.P334L	p.P637L	NM_001113523	NP_001106995	Capture	Illumina GAIIx	Phase_I	Q460N3	PAR15_HUMAN		GBM - Glioblastoma multiforme(114;0.0531)	12	1976	+			615			PARP catalytic.		J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	c.1910C>T	CCDS46893.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047420	0.55110	.	.	ENSG00000173200	ENST00000464300;ENST00000483793;ENST00000542823;ENST00000310366;ENST00000493645	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	3.8	2.87	0.33458	Poly(ADP-ribose) polymerase, catalytic domain (2);	.	.	.	.	T	0.26955	0.0660	L	0.53729	1.69	0.09310	N	0.999997	P;P;D;D;P	0.67145	0.637;0.572;0.996;0.993;0.884	B;B;P;P;P	0.53006	0.319;0.173;0.715;0.664;0.533	T	0.05716	-1.0868	9	0.54805	T	0.06	.	12.0701	0.53611	0.0:0.8261:0.1739:0.0	.	334;403;384;442;615	B7ZL48;Q460N3-2;F5H8I1;C9J7L3;Q460N3	.;.;.;.;PAR15_HUMAN	L	637;442;384;403;334	ENSP00000417214:P637L;ENSP00000417785:P442L;ENSP00000308436:P403L;ENSP00000419488:P334L	ENSP00000308436:P403L	P	+	2	0	PARP15	123837510	0.001000	0.12720	0.003000	0.11579	0.070000	0.16714	1.526000	0.35964	1.953000	0.56701	0.650000	0.86243	CCC		PASS	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615		32	258	---	---	---	---
SEMA5B	54437	broad.mit.edu	37	3	122645393	122645393	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:122645393C>T	ENST00000357599.3	-	9	1368	c.982G>A	c.(982-984)Ggc>Agc	p.G328S	SEMA5B_ENST00000451055.2_Missense_Mutation_p.G382S|AC078794.1_ENST00000408284.1_RNA|SEMA5B_ENST00000195173.4_Missense_Mutation_p.G328S	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	328	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G328S(1)|p.G382S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		AGGAATCGGCCCCCCACGTCA	0.612																																						uc003efz.1																			2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7						c.(982-984)GGC>AGC		semaphorin 5B isoform 1							50.0	44.0	46.0					3																	122645393		2203	4300	6503	SO:0001583	missense	54437				cell differentiation|nervous system development	integral to membrane	receptor activity	g.chr3:122645393C>T	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.982G>A	3.37:g.122645393C>T	ENSP00000350215:p.Gly328Ser		Somatic				SEMA5B_uc011bju.1_Missense_Mutation_p.G270S|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.G328S|SEMA5B_uc010hro.1_Missense_Mutation_p.G270S|SEMA5B_uc010hrp.1_RNA	p.G328S	NM_001031702	NP_001026872	Capture	Illumina GAIIx	Phase_I	Q9P283	SEM5B_HUMAN		GBM - Glioblastoma multiforme(114;0.0367)	9	1286	-			328			Extracellular (Potential).|Sema.		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	c.982G>A	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	35	5.508094	0.96386	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	4.69	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	D	0.87273	0.6136	H	0.96080	3.765	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.72982	0.965;0.979;0.979	D	0.91543	0.5251	10	0.87932	D	0	.	16.8049	0.85623	0.0:1.0:0.0:0.0	.	270;328;328	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	S	328;328;270;382;328	ENSP00000350215:G328S;ENSP00000195173:G328S;ENSP00000389588:G382S;ENSP00000377208:G328S	ENSP00000195173:G328S	G	-	1	0	SEMA5B	124128083	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	7.580000	0.82523	2.433000	0.82419	0.650000	0.86243	GGC		PASS	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702		18	97	---	---	---	---
IFT122	55764	broad.mit.edu	37	3	129183505	129183505	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:129183505G>A	ENST00000348417.2	+	7	521	c.444G>A	c.(442-444)gcG>gcA	p.A148A	IFT122_ENST00000349441.2_Silent_p.A96A|IFT122_ENST00000507564.1_Silent_p.A199A|IFT122_ENST00000440957.2_De_novo_Start_InFrame|IFT122_ENST00000347300.2_Silent_p.A148A|IFT122_ENST00000296266.3_Silent_p.A199A|IFT122_ENST00000431818.2_De_novo_Start_InFrame|IFT122_ENST00000504021.1_Silent_p.A101A	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	148					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.A199A(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						AGTACCTGGCGCTGGGGATGT	0.517																																						uc003emm.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(442-444)GCG>GCA		WD repeat domain 10 isoform 2							135.0	131.0	132.0					3																	129183505		2203	4300	6503	SO:0001819	synonymous_variant	55764				camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium		g.chr3:129183505G>A	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.444G>A	3.37:g.129183505G>A			Somatic				IFT122_uc003eml.2_Silent_p.A199A|IFT122_uc003emn.2_Silent_p.A148A|IFT122_uc003emo.2_Silent_p.A96A|IFT122_uc003emp.2_5'UTR|IFT122_uc010htc.2_Silent_p.A199A|IFT122_uc011bky.1_5'UTR|IFT122_uc003emq.2_Intron|IFT122_uc003emr.2_5'UTR|IFT122_uc011bla.1_5'UTR|IFT122_uc011bkx.1_Intron|IFT122_uc011bkz.1_RNA	p.A148A	NM_052989	NP_443715	Capture	Illumina GAIIx	Phase_I	Q9HBG6	IF122_HUMAN			7	650	+			148			WD 4.		B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	ENST00000348417.2	37	c.444G>A	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	G	5.663	0.306866	0.10733	.	.	ENSG00000163913	ENST00000508826	T	0.40225	1.04	5.44	0.104	0.14531	.	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37314	-0.9711	7	0.87932	D	0	-12.3021	6.4406	0.21847	0.0:0.1351:0.2568:0.6081	.	.	.	.	T	100	ENSP00000421140:A100T	ENSP00000421140:A100T	A	+	1	0	IFT122	130666195	0.999000	0.42202	0.996000	0.52242	0.359000	0.29487	0.510000	0.22723	-0.208000	0.10171	-0.518000	0.04402	GCT		PASS	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262		60	536	---	---	---	---
ACAD11	84129	broad.mit.edu	37	3	132294745	132294745	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:132294745G>A	ENST00000264990.6	-	17	2843	c.1872C>T	c.(1870-1872)tcC>tcT	p.S624S	ACAD11_ENST00000545291.1_Silent_p.S149S|ACAD11_ENST00000355458.3_Intron	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	624					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.S624S(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						GGCGGCCTTGGGAAATTTCAA	0.478																																						uc003eov.3																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1870-1872)TCC>TCT		putative acyl-CoA dehydrogenase							77.0	75.0	76.0					3																	132294745		2203	4300	6503	SO:0001819	synonymous_variant	84129					peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups	g.chr3:132294745G>A	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.1872C>T	3.37:g.132294745G>A			Somatic					p.S624S	NM_032169	NP_115545	Capture	Illumina GAIIx	Phase_I	Q709F0	ACD11_HUMAN			17	2252	-			624					Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Silent	SNP	ENST00000264990.6	37	c.1872C>T	CCDS3074.1																																																																																				PASS	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169		106	252	---	---	---	---
ZIC1	7545	broad.mit.edu	37	3	147127973	147127973	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:147127973C>T	ENST00000282928.4	+	1	803	c.74C>T	c.(73-75)gCg>gTg	p.A25V		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	25					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A25V(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CACCACTCCGCGGGCGACGTG	0.716																																						uc003ewe.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(73-75)GCG>GTG		zinc finger protein of the cerebellum 1							24.0	26.0	25.0					3																	147127973		2177	4272	6449	SO:0001583	missense	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147127973C>T	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.74C>T	3.37:g.147127973C>T	ENSP00000282928:p.Ala25Val		Somatic					p.A25V	NM_003412	NP_003403	Capture	Illumina GAIIx	Phase_I	Q15915	ZIC1_HUMAN			1	793	+			25					Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	c.74C>T	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824104	0.50739	.	.	ENSG00000152977	ENST00000282928	T	0.12039	2.72	3.36	3.36	0.38483	.	0.060441	0.64402	D	0.000003	T	0.10937	0.0267	L	0.27053	0.805	0.36028	D	0.839203	B	0.20780	0.048	B	0.23018	0.043	T	0.16512	-1.0400	10	0.30078	T	0.28	.	14.8963	0.70646	0.0:1.0:0.0:0.0	.	25	Q15915	ZIC1_HUMAN	V	25	ENSP00000282928:A25V	ENSP00000282928:A25V	A	+	2	0	ZIC1	148610663	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.736000	0.68597	1.712000	0.51347	0.442000	0.29010	GCG		PASS	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		35	96	---	---	---	---
AADACL2	344752	broad.mit.edu	37	3	151458463	151458463	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:151458463G>A	ENST00000356517.3	+	2	277	c.168G>A	c.(166-168)atG>atA	p.M56I		NM_207365.3	NP_997248.2	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2	56						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.M34I(1)|p.M56I(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(13)|skin(2)	24			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TGCGTATTATGAGATATGAAG	0.279																																						uc003ezc.2																			2	Substitution - Missense(2)		lung(2)		0						c.(166-168)ATG>ATA		arylacetamide deacetylase-like 2 precursor							64.0	64.0	64.0					3																	151458463		2203	4300	6503	SO:0001583	missense	344752					extracellular region|integral to membrane	carboxylesterase activity	g.chr3:151458463G>A	BC065724	CCDS3161.2	3q25.1	2010-12-14			ENSG00000197953	ENSG00000197953			24427	protein-coding gene	gene with protein product							Standard	NM_207365		Approved	MGC72001	uc003ezc.3	Q6P093	OTTHUMG00000155914	ENST00000356517.3:c.168G>A	3.37:g.151458463G>A	ENSP00000348911:p.Met56Ile		Somatic				AADACL2_uc010hvn.2_Intron	p.M56I	NM_207365	NP_997248	Capture	Illumina GAIIx	Phase_I	Q6P093	ADCL2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		2	288	+			56					Q5HYJ4	Missense_Mutation	SNP	ENST00000356517.3	37	c.168G>A	CCDS3161.2	.	.	.	.	.	.	.	.	.	.	G	7.826	0.718784	0.15372	.	.	ENSG00000197953	ENST00000356517	T	0.04119	3.7	5.49	1.72	0.24424	.	0.305675	0.38663	N	0.001620	T	0.03915	0.0110	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40646	-0.9552	10	0.32370	T	0.25	-19.95	5.8538	0.18708	0.295:0.1311:0.574:0.0	.	56	Q6P093	ADCL2_HUMAN	I	56	ENSP00000348911:M56I	ENSP00000348911:M56I	M	+	3	0	AADACL2	152941153	1.000000	0.71417	0.071000	0.20095	0.123000	0.20343	0.824000	0.27379	0.141000	0.18875	0.591000	0.81541	ATG		PASS	AADACL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342288.3	NM_207365		84	209	---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155199554	155199554	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:155199554T>A	ENST00000340059.7	-	23	4284	c.4285A>T	c.(4285-4287)Act>Tct	p.T1429S	PLCH1_ENST00000460012.1_Missense_Mutation_p.T1391S|PLCH1_ENST00000414191.1_Missense_Mutation_p.T1391S|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.T1391S|PLCH1_ENST00000494598.1_Intron	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1429					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.T1429S(1)|p.T1391S(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ATACTTTGAGTTTTGACATCT	0.418																																						uc011bok.1																			2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(1)	4						c.(4285-4287)ACT>TCT		phospholipase C eta 1 isoform a							91.0	91.0	91.0					3																	155199554		2203	4300	6503	SO:0001583	missense	23007				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:155199554T>A	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4285A>T	3.37:g.155199554T>A	ENSP00000345988:p.Thr1429Ser		Somatic				PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.T1391S	p.T1429S	NM_001130960	NP_001124432	Capture	Illumina GAIIx	Phase_I	Q4KWH8	PLCH1_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		23	4562	-			1429					Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	c.4285A>T	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	T	3.425	-0.117400	0.06838	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	4.98	1.04	0.20106	.	1.474140	0.03953	N	0.288799	T	0.53126	0.1777	N	0.14661	0.345	0.09310	N	1	B;B	0.19200	0.034;0.02	B;B	0.18561	0.022;0.01	T	0.36212	-0.9757	10	0.08179	T	0.78	.	3.4357	0.07445	0.1351:0.0754:0.141:0.6484	.	1391;1429	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	S	1391;1429;1391;1391	ENSP00000417502:T1391S;ENSP00000345988:T1429S;ENSP00000335469:T1391S;ENSP00000412977:T1391S	ENSP00000335469:T1391S	T	-	1	0	PLCH1	156682248	0.001000	0.12720	0.001000	0.08648	0.973000	0.67179	0.603000	0.24149	-0.056000	0.13221	0.477000	0.44152	ACT		PASS	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		44	487	---	---	---	---
SLC7A14	57709	broad.mit.edu	37	3	170198775	170198775	+	Silent	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:170198775T>C	ENST00000231706.5	-	7	1611	c.1296A>G	c.(1294-1296)caA>caG	p.Q432Q	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	432					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.Q432Q(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CACTCTCAGGTTGGTATCGAA	0.498																																						uc003fgz.2																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5						c.(1294-1296)CAA>CAG		solute carrier family 7 (cationic amino acid							132.0	115.0	121.0					3																	170198775		2203	4300	6503	SO:0001819	synonymous_variant	57709					integral to membrane	amino acid transmembrane transporter activity	g.chr3:170198775T>C	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1296A>G	3.37:g.170198775T>C			Somatic				CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	p.Q432Q	NM_020949	NP_066000	Capture	Illumina GAIIx	Phase_I	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)		7	1612	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		432					B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	c.1296A>G	CCDS33892.1																																																																																				PASS	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949		45	458	---	---	---	---
GHSR	2693	broad.mit.edu	37	3	172165997	172165997	+	Silent	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:172165997C>A	ENST00000241256.2	-	1	249	c.207G>T	c.(205-207)tcG>tcT	p.S69S	GHSR_ENST00000427970.1_Silent_p.S69S	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	69					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.S69S(2)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CGCGGAAGCGCGACACCACCA	0.657																																					Esophageal Squamous(93;641 1401 20883 29581 34638)	uc003fib.1																			2	Substitution - coding silent(2)		lung(2)	lung(3)|ovary(1)|central_nervous_system(1)	5						c.(205-207)TCG>TCT		growth hormone secretagogue receptor isoform 1a							69.0	59.0	62.0					3																	172165997		2203	4300	6503	SO:0001819	synonymous_variant	2693				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity	g.chr3:172165997C>A	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.207G>T	3.37:g.172165997C>A			Somatic				GHSR_uc011bpv.1_Silent_p.S69S	p.S69S	NM_198407	NP_940799	Capture	Illumina GAIIx	Phase_I	Q92847	GHSR_HUMAN	Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)		1	207	-	Ovarian(172;0.00143)|Breast(254;0.197)		69			Cytoplasmic (Potential).		Q14D12|Q6ISR8|Q92848|Q96RJ7	Silent	SNP	ENST00000241256.2	37	c.207G>T	CCDS3218.1																																																																																				PASS	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122		163	71	---	---	---	---
USP13	8975	broad.mit.edu	37	3	179460014	179460014	+	Silent	SNP	C	C	T	rs140308745		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:179460014C>T	ENST00000263966.3	+	12	1881	c.1410C>T	c.(1408-1410)agC>agT	p.S470S	USP13_ENST00000496897.1_Silent_p.S405S|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	470	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.S470S(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			AAAACCCAAGCGATGTTTTTC	0.453																																						uc003fkh.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1408-1410)AGC>AGT		ubiquitin thiolesterase 13		C		0,4406		0,0,2203	97.0	82.0	87.0		1410	1.8	1.0	3	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	USP13	NM_003940.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		470/864	179460014	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8975				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr3:179460014C>T	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1410C>T	3.37:g.179460014C>T			Somatic				USP13_uc003fkf.2_Silent_p.S470S	p.S470S	NM_003940	NP_003931	Capture	Illumina GAIIx	Phase_I	Q92995	UBP13_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)		12	1491	+	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		470					A8K2S3|B4DYF3|D3DNS2|Q96B25	Silent	SNP	ENST00000263966.3	37	c.1410C>T	CCDS3235.1																																																																																				PASS	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1			67	192	---	---	---	---
EHHADH	1962	broad.mit.edu	37	3	184910689	184910689	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:184910689G>A	ENST00000231887.3	-	7	1572	c.1497C>T	c.(1495-1497)ggC>ggT	p.G499G	EHHADH_ENST00000456310.1_Silent_p.G403G|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	499	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)	p.G499G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CTGGTTTGCTGCCTTCTTCTA	0.418																																						uc003fpf.2																			1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1495-1497)GGC>GGT		enoyl-Coenzyme A, hydratase/3-hydroxyacyl	NADH(DB00157)						88.0	86.0	87.0					3																	184910689		2203	4300	6503	SO:0001819	synonymous_variant	1962					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity	g.chr3:184910689G>A	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1497C>T	3.37:g.184910689G>A			Somatic				EHHADH_uc011brs.1_Silent_p.G403G	p.G499G	NM_001966	NP_001957	Capture	Illumina GAIIx	Phase_I	Q08426	ECHP_HUMAN	Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		7	1524	-	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		499			3-hydroxyacyl-CoA dehydrogenase.		A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Silent	SNP	ENST00000231887.3	37	c.1497C>T	CCDS33901.1																																																																																				PASS	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1			73	531	---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	188956628	188956628	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:188956628C>T	ENST00000345063.3	+	4	576	c.409C>T	c.(409-411)Cgg>Tgg	p.R137W	TPRG1_ENST00000433971.1_Missense_Mutation_p.R137W|TPRG1-AS2_ENST00000425454.1_RNA	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	137						cytoplasm (GO:0005737)		p.R137W(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		GCAGCTGCAGCGGATTCCTCT	0.478																																						uc003frv.1																			1	Substitution - Missense(1)		lung(1)		0						c.(409-411)CGG>TGG		tumor protein p63 regulated 1							149.0	137.0	141.0					3																	188956628		2203	4300	6503	SO:0001583	missense	285386							g.chr3:188956628C>T	AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.409C>T	3.37:g.188956628C>T	ENSP00000341031:p.Arg137Trp		Somatic				TPRG1_uc003frw.1_Missense_Mutation_p.R137W	p.R137W	NM_198485	NP_940887	Capture	Illumina GAIIx	Phase_I	Q6ZUI0	TPRG1_HUMAN	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)	9	1636	+	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	137						Missense_Mutation	SNP	ENST00000345063.3	37	c.409C>T	CCDS3292.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.61|13.61	2.289389|2.289389	0.40494|0.40494	.|.	.|.	ENSG00000188001|ENSG00000188001	ENST00000425670|ENST00000433971;ENST00000345063	.|.	.|.	.|.	5.74|5.74	0.566|0.566	0.17317|0.17317	.|.	.|0.438072	.|0.25514	.|N	.|0.030157	T|T	0.26991|0.26991	0.0661|0.0661	L|L	0.34521|0.34521	1.04|1.04	0.20821|0.20821	N|N	0.999846|0.999846	.|B	.|0.14012	.|0.009	.|B	.|0.08055	.|0.003	T|T	0.17684|0.17684	-1.0361|-1.0361	5|9	.|0.62326	.|D	.|0.03	-0.1214|-0.1214	5.9549|5.9549	0.19267|0.19267	0.4922:0.3573:0.0:0.1505|0.4922:0.3573:0.0:0.1505	.|.	.|137	.|Q6ZUI0	.|TPRG1_HUMAN	V|W	64|137	.|.	.|ENSP00000341031:R137W	A|R	+|+	2|1	0|2	TPRG1|TPRG1	190439322|190439322	0.312000|0.312000	0.24545|0.24545	0.339000|0.339000	0.25562|0.25562	0.923000|0.923000	0.55619|0.55619	-0.089000|-0.089000	0.11180|0.11180	0.102000|0.102000	0.17638|0.17638	0.563000|0.563000	0.77884|0.77884	GCG|CGG		PASS	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343931.1	NM_198485		16	581	---	---	---	---
FYTTD1	84248	broad.mit.edu	37	3	197505211	197505211	+	Missense_Mutation	SNP	C	C	T	rs374765891		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:197505211C>T	ENST00000241502.4	+	8	956	c.734C>T	c.(733-735)aCt>aTt	p.T245I	FYTTD1_ENST00000428395.2_Missense_Mutation_p.T154I|FYTTD1_ENST00000415708.2_Missense_Mutation_p.T219I|FYTTD1_ENST00000424384.2_Missense_Mutation_p.T178I	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1	245					mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.T245I(1)		kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		TCTAATAGAACTCAGAAACCA	0.343																																						uc003fyi.2																			1	Substitution - Missense(1)		lung(1)		0						c.(733-735)ACT>ATT		forty-two-three domain containing 1 isoform 1							47.0	48.0	47.0					3																	197505211		2203	4300	6503	SO:0001583	missense	84248				mRNA export from nucleus	nuclear speck	mRNA binding|protein binding	g.chr3:197505211C>T	AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.734C>T	3.37:g.197505211C>T	ENSP00000241502:p.Thr245Ile		Somatic				FYTTD1_uc011bui.1_Missense_Mutation_p.T219I|FYTTD1_uc011buj.1_RNA|FYTTD1_uc011buk.1_Missense_Mutation_p.T178I	p.T245I	NM_032288	NP_115664	Capture	Illumina GAIIx	Phase_I	Q96QD9	UIF_HUMAN	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)	8	953	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	245					A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	Missense_Mutation	SNP	ENST00000241502.4	37	c.734C>T	CCDS3329.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.934145	0.52866	.	.	ENSG00000122068	ENST00000415708;ENST00000428395;ENST00000241502;ENST00000424384	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.0	5.0	0.66597	.	0.267137	0.44097	D	0.000498	T	0.48095	0.1481	L	0.47716	1.5	0.35242	D	0.777884	B;B	0.27286	0.062;0.174	B;B	0.34242	0.094;0.178	T	0.60475	-0.7256	10	0.62326	D	0.03	-1.6647	16.91	0.86138	0.0:1.0:0.0:0.0	.	219;245	Q96QD9-2;Q96QD9	.;UIF_HUMAN	I	219;154;245;178	ENSP00000393746:T219I;ENSP00000391157:T154I;ENSP00000241502:T245I;ENSP00000394631:T178I	ENSP00000241502:T245I	T	+	2	0	FYTTD1	198989608	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.375000	0.52410	2.500000	0.84329	0.460000	0.39030	ACT		PASS	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340185.3	NM_032288		22	155	---	---	---	---
MAEA	10296	broad.mit.edu	37	4	1316281	1316281	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:1316281G>A	ENST00000303400.4	+	4	632	c.569G>A	c.(568-570)cGg>cAg	p.R190Q	MAEA_ENST00000264750.6_Intron|MAEA_ENST00000514708.1_Intron|MAEA_ENST00000510794.1_Missense_Mutation_p.R189Q|MAEA_ENST00000452175.2_Missense_Mutation_p.R111Q|MAEA_ENST00000505177.2_Missense_Mutation_p.R190Q|MAEA_ENST00000505839.1_Missense_Mutation_p.R142Q	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	190	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)	p.R190Q(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	TCCCGGCTCCGGAAGATGAAG	0.657																																						uc003gda.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(568-570)CGG>CAG		macrophage erythroblast attacher isoform 1							54.0	54.0	54.0					4																	1316281		2203	4300	6503	SO:0001583	missense	10296				cell adhesion|cell cycle|cell division|erythrocyte maturation|negative regulation of myeloid cell apoptosis|regulation of mitotic cell cycle	actomyosin contractile ring|integral to plasma membrane|membrane fraction|nuclear matrix|spindle	actin binding	g.chr4:1316281G>A	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.569G>A	4.37:g.1316281G>A	ENSP00000302830:p.Arg190Gln		Somatic				MAEA_uc010ibs.1_Intron|MAEA_uc003gdb.2_Intron|MAEA_uc011bvb.1_Missense_Mutation_p.R122Q|MAEA_uc003gdc.2_Intron|MAEA_uc003gdd.2_Intron|MAEA_uc011bvc.1_Missense_Mutation_p.R189Q|MAEA_uc011bvd.1_Missense_Mutation_p.R142Q|MAEA_uc010ibt.2_Intron	p.R190Q	NM_001017405	NP_001017405	Capture	Illumina GAIIx	Phase_I	Q7L5Y9	MAEA_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0201)		4	599	+			190			CTLH.		O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	c.569G>A	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	G	36	5.661707	0.96734	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000510794;ENST00000505839	T;T;T;T;T;T	0.59224	0.78;0.58;0.28;0.82;0.82;0.77	5.94	5.1	0.69264	CTLH, C-terminal LisH motif (2);	0.000000	0.85682	D	0.000000	T	0.74253	0.3692	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.80764	0.994;0.994;0.99	T	0.75657	-0.3242	10	0.46703	T	0.11	-18.2625	15.0982	0.72253	0.0678:0.0:0.9322:0.0	.	189;190;190	B4DVN3;E7ESC7;Q7L5Y9	.;.;MAEA_HUMAN	Q	190;190;190;169;122;111;189;142	ENSP00000302830:R190Q;ENSP00000422215:R190Q;ENSP00000421644:R190Q;ENSP00000426903:R122Q;ENSP00000411415:R111Q;ENSP00000426807:R189Q	ENSP00000302830:R190Q	R	+	2	0	MAEA	1306281	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.298000	0.96132	1.527000	0.49086	0.655000	0.94253	CGG		PASS	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882		38	31	---	---	---	---
CEP135	9662	broad.mit.edu	37	4	56823455	56823455	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:56823455C>G	ENST00000257287.4	+	5	663	c.539C>G	c.(538-540)tCt>tGt	p.S180C	CEP135_ENST00000422247.2_Missense_Mutation_p.S180C	NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	180					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.S180C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GTTCCTCCCTCTGAAGTCAGT	0.418																																						uc003hbi.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(538-540)TCT>TGT		centrosome protein 4							132.0	130.0	131.0					4																	56823455		2203	4300	6503	SO:0001583	missense	9662				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding	g.chr4:56823455C>G	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.539C>G	4.37:g.56823455C>G	ENSP00000257287:p.Ser180Cys		Somatic				CEP135_uc003hbh.1_Missense_Mutation_p.S180C|CEP135_uc010igz.1_Missense_Mutation_p.S10C	p.S180C	NM_025009	NP_079285	Capture	Illumina GAIIx	Phase_I	Q66GS9	CP135_HUMAN			5	773	+	Glioma(25;0.08)|all_neural(26;0.101)		180					B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	c.539C>G	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259446	0.80246	.	.	ENSG00000174799	ENST00000422247;ENST00000257287	T	0.52295	0.67	5.34	5.34	0.76211	.	0.058484	0.64402	D	0.000001	T	0.70020	0.3176	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.974	T	0.71646	-0.4530	10	0.56958	D	0.05	.	19.408	0.94656	0.0:1.0:0.0:0.0	.	180;180	Q66GS9;Q66GS9-2	CP135_HUMAN;.	C	180	ENSP00000257287:S180C	ENSP00000257287:S180C	S	+	2	0	CEP135	56518212	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.767000	0.85331	2.643000	0.89663	0.650000	0.86243	TCT		PASS	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009		55	177	---	---	---	---
WDFY3	23001	broad.mit.edu	37	4	85598453	85598453	+	Silent	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:85598453C>G	ENST00000295888.4	-	67	10763	c.10356G>C	c.(10354-10356)gtG>gtC	p.V3452V	WDFY3_ENST00000322366.6_Silent_p.V3435V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	3452	Interaction with ATG5.|Interaction with SQSTM1.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.V3452V(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTTCATCCTTCACCCAGTGAT	0.557																																						uc003hpd.2																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(10354-10356)GTG>GTC		WD repeat and FYVE domain containing 3 isoform							75.0	67.0	70.0					4																	85598453		2203	4300	6503	SO:0001819	synonymous_variant	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85598453C>G	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.10356G>C	4.37:g.85598453C>G			Somatic				WDFY3_uc003hpc.2_Silent_p.V207V	p.V3452V	NM_014991	NP_055806	Capture	Illumina GAIIx	Phase_I	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	67	10764	-		Hepatocellular(203;0.114)	3452					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	c.10356G>C	CCDS3609.1																																																																																				PASS	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		27	55	---	---	---	---
PDHA2	5161	broad.mit.edu	37	4	96762125	96762125	+	Missense_Mutation	SNP	A	A	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:96762125A>C	ENST00000295266.4	+	1	887	c.824A>C	c.(823-825)aAg>aCg	p.K275T		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	275					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.K275T(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		AGATCTGGAAAGGGGCCCATA	0.453																																						uc003htr.3																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(823-825)AAG>ACG		pyruvate dehydrogenase E1 alpha 2 precursor	NADH(DB00157)						119.0	120.0	120.0					4																	96762125		2203	4300	6503	SO:0001583	missense	5161				glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity	g.chr4:96762125A>C		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.824A>C	4.37:g.96762125A>C	ENSP00000295266:p.Lys275Thr		Somatic					p.K275T	NM_005390	NP_005381	Capture	Illumina GAIIx	Phase_I	P29803	ODPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	1	887	+		Hepatocellular(203;0.114)	275					B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	c.824A>C	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485940	0.63962	.	.	ENSG00000163114	ENST00000295266	D	0.97455	-4.39	4.91	4.91	0.64330	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98295	0.9435	M	0.87456	2.885	0.80722	D	1	D	0.55800	0.973	D	0.66497	0.944	D	0.98994	1.0809	10	0.72032	D	0.01	-9.1654	12.8348	0.57767	1.0:0.0:0.0:0.0	.	275	P29803	ODPAT_HUMAN	T	275	ENSP00000295266:K275T	ENSP00000295266:K275T	K	+	2	0	PDHA2	96981148	1.000000	0.71417	0.991000	0.47740	0.531000	0.34715	6.632000	0.74281	2.206000	0.71126	0.383000	0.25322	AAG		PASS	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1			10	110	---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115997955	115997955	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:115997955C>A	ENST00000264363.2	-	2	916	c.238G>T	c.(238-240)Gtc>Ttc	p.V80F		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	80	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.V80F(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAGAGAAGGACAGTAGGGTCC	0.443																																						uc003ibu.2																			1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(238-240)GTC>TTC		heparan sulfate N-deacetylase/N-sulfotransferase							169.0	187.0	181.0					4																	115997955		2203	4300	6503	SO:0001583	missense	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115997955C>A	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.238G>T	4.37:g.115997955C>A	ENSP00000264363:p.Val80Phe		Somatic				NDST4_uc010imw.2_Intron	p.V80F	NM_022569	NP_072091	Capture	Illumina GAIIx	Phase_I	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	2	917	-		Ovarian(17;0.156)	80			Lumenal (Potential).|Heparan sulfate N-deacetylase 4.		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	c.238G>T	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401962	0.42613	.	.	ENSG00000138653	ENST00000264363	T	0.52754	0.65	5.41	4.57	0.56435	.	0.112785	0.64402	D	0.000011	T	0.69548	0.3123	M	0.88310	2.945	0.47441	D	0.999421	P	0.50066	0.931	D	0.64506	0.926	T	0.73764	-0.3880	10	0.87932	D	0	.	9.5966	0.39578	0.0:0.7804:0.0:0.2196	.	80	Q9H3R1	NDST4_HUMAN	F	80	ENSP00000264363:V80F	ENSP00000264363:V80F	V	-	1	0	NDST4	116217404	0.653000	0.27358	0.749000	0.31150	0.341000	0.28922	1.368000	0.34216	1.279000	0.44446	-0.373000	0.07131	GTC		PASS	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		47	108	---	---	---	---
LRBA	987	broad.mit.edu	37	4	151749383	151749383	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:151749383G>A	ENST00000357115.3	-	30	5363	c.5120C>T	c.(5119-5121)gCc>gTc	p.A1707V	LRBA_ENST00000510413.1_Missense_Mutation_p.A1707V|LRBA_ENST00000507224.1_Missense_Mutation_p.A1707V|LRBA_ENST00000535741.1_Missense_Mutation_p.A1707V	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1707						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A1707V(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					ATCACCAAGGGCTCCAAGGCA	0.458																																						uc010ipj.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|skin(1)	7						c.(5119-5121)GCC>GTC		LPS-responsive vesicle trafficking, beach and							131.0	117.0	122.0					4																	151749383		2203	4300	6503	SO:0001583	missense	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151749383G>A	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5120C>T	4.37:g.151749383G>A	ENSP00000349629:p.Ala1707Val		Somatic				LRBA_uc003ilt.3_Missense_Mutation_p.A366V|LRBA_uc003ilu.3_Missense_Mutation_p.A1707V	p.A1707V	NM_006726	NP_006717	Capture	Illumina GAIIx	Phase_I	P50851	LRBA_HUMAN			30	5594	-	all_hematologic(180;0.151)		1707					Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	c.5120C>T	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.46|11.46	1.645016|1.645016	0.29246|0.29246	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.55588|.	0.93;1.08;0.93;0.51|.	5.72|5.72	4.87|4.87	0.63330|0.63330	.|.	0.684498|.	0.14058|.	N|.	0.344240|.	T|T	0.38983|0.38983	0.1061|0.1061	L|L	0.40543|0.40543	1.245|1.245	0.19300|0.19300	N|N	0.999971|0.999971	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.09377|.	0.002;0.004|.	T|T	0.21449|0.21449	-1.0245|-1.0245	10|5	0.25106|.	T|.	0.35|.	.|.	8.7499|8.7499	0.34609|0.34609	0.1676:0.0:0.8324:0.0|0.1676:0.0:0.8324:0.0	.|.	1707;1707|.	P50851;P50851-2|.	LRBA_HUMAN;.|.	V|S	1707|360	ENSP00000446299:A1707V;ENSP00000421552:A1707V;ENSP00000349629:A1707V;ENSP00000422180:A1707V|.	ENSP00000349629:A1707V|.	A|P	-|-	2|1	0|0	LRBA|LRBA	151968833|151968833	0.840000|0.840000	0.29493|0.29493	0.993000|0.993000	0.49108|0.49108	0.938000|0.938000	0.57974|0.57974	1.764000|1.764000	0.38471|0.38471	2.704000|2.704000	0.92352|0.92352	0.484000|0.484000	0.47621|0.47621	GCC|CCC		PASS	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			73	70	---	---	---	---
GUCY1A3	2982	broad.mit.edu	37	4	156631983	156631983	+	Silent	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:156631983T>C	ENST00000296518.7	+	6	875	c.666T>C	c.(664-666)gcT>gcC	p.A222A	GUCY1A3_ENST00000511108.1_Silent_p.A222A|GUCY1A3_ENST00000393832.3_5'UTR|GUCY1A3_ENST00000455639.2_Silent_p.A222A|GUCY1A3_ENST00000513574.1_Silent_p.A222A|GUCY1A3_ENST00000511507.1_Silent_p.A222A|GUCY1A3_ENST00000506455.1_Silent_p.A222A			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	222					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.A222A(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TAAAGGCAGCTGCTCACGTAT	0.443																																						uc003iov.2																			1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(664-666)GCT>GCC		guanylate cyclase 1, soluble, alpha 3 isoform A							106.0	106.0	106.0					4																	156631983		2203	4300	6503	SO:0001819	synonymous_variant	2982				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity	g.chr4:156631983T>C		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.666T>C	4.37:g.156631983T>C			Somatic				GUCY1A3_uc003iou.2_Silent_p.A222A|GUCY1A3_uc010iqc.2_Silent_p.A222A|GUCY1A3_uc003iow.2_Silent_p.A222A|GUCY1A3_uc010iqd.2_Silent_p.A221A|GUCY1A3_uc003iox.2_Silent_p.A222A|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Silent_p.A222A|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Silent_p.A222A	p.A222A	NM_000856	NP_000847	Capture	Illumina GAIIx	Phase_I	Q02108	GCYA3_HUMAN		COAD - Colon adenocarcinoma(41;0.17)	7	1202	+	all_hematologic(180;0.24)	Renal(120;0.0854)	222					D3DP19|D6RDW3|O43843|Q8TAH3	Silent	SNP	ENST00000296518.7	37	c.666T>C	CCDS34085.1																																																																																				PASS	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			42	66	---	---	---	---
TRIM60	166655	broad.mit.edu	37	4	165961430	165961430	+	Missense_Mutation	SNP	C	C	T	rs148893149		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr4:165961430C>T	ENST00000512596.1	+	3	422	c.206C>T	c.(205-207)cCc>cTc	p.P69L	TRIM60_ENST00000341062.5_Missense_Mutation_p.P69L|TRIM60_ENST00000508504.1_Missense_Mutation_p.P69L	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	69						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.P69L(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AGGAGGAACCCCCAGCTCCGT	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		21407	0.0		0.0	False		,,,				2504	0.001					uc003iqy.1																			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(205-207)CCC>CTC		ring finger protein 129		C	LEU/PRO	0,4406		0,0,2203	114.0	110.0	111.0		206	-1.1	0.0	4	dbSNP_134	111	4,8596	3.7+/-12.6	0,4,4296	yes	missense	TRIM60	NM_152620.2	98	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign	69/472	165961430	4,13002	2203	4300	6503	SO:0001583	missense	166655					intracellular	zinc ion binding	g.chr4:165961430C>T	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.206C>T	4.37:g.165961430C>T	ENSP00000421142:p.Pro69Leu		Somatic				TRIM60_uc010iqx.1_Missense_Mutation_p.P69L	p.P69L	NM_152620	NP_689833	Capture	Illumina GAIIx	Phase_I	Q495X7	TRI60_HUMAN		GBM - Glioblastoma multiforme(119;0.0844)	3	376	+	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)	69					Q8NA35	Missense_Mutation	SNP	ENST00000512596.1	37	c.206C>T	CCDS3808.1	.	.	.	.	.	.	.	.	.	.	C	1.615	-0.522912	0.04141	0.0	4.65E-4	ENSG00000176979	ENST00000512596;ENST00000507119;ENST00000508504;ENST00000341062	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	2.21	-1.13	0.09775	Zinc finger, RING/FYVE/PHD-type (1);	1.361220	0.06076	N	0.660913	T	0.64405	0.2595	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44236	-0.9341	10	0.11794	T	0.64	.	1.0877	0.01656	0.4097:0.2687:0.1866:0.135	.	69	Q495X7	TRI60_HUMAN	L	69	ENSP00000421142:P69L;ENSP00000421784:P69L;ENSP00000426496:P69L;ENSP00000343765:P69L	ENSP00000343765:P69L	P	+	2	0	TRIM60	166180880	0.000000	0.05858	0.000000	0.03702	0.282000	0.26991	-0.570000	0.05895	-0.341000	0.08376	-0.268000	0.10319	CCC		PASS	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620		50	52	---	---	---	---
FLJ33360	401172	broad.mit.edu	37	5	6312634	6312634	+	lincRNA	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:6312634A>G	ENST00000507444.1	-	0	338					NR_028351.1																						GAGGAACCCCAGGAGAGGGGA	0.557																																						uc003jdn.1																			0					0						c.(241-243)CTG>CCG		SubName: Full=FLJ33360 protein; SubName: Full=cDNA FLJ33360 fis, clone BRACE2005253;							82.0	86.0	85.0					5																	6312634		1979	4157	6136			401172							g.chr5:6312634A>G																													5.37:g.6312634A>G			Somatic					p.L81P	NM_001001702	NP_001001702	Capture	Illumina GAIIx	Phase_I					2	339	-									Missense_Mutation	SNP	ENST00000507444.1	37	c.242T>C																																																																																					PASS	CTD-2324F15.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000365707.1			11	19	---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13864617	13864617	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:13864617G>T	ENST00000265104.4	-	28	4589	c.4485C>A	c.(4483-4485)caC>caA	p.H1495Q	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1495	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H1495Q(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCCTTTCCCAGTGCCGCTCCA	0.473									Kartagener syndrome																													uc003jfd.2																			1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(4483-4485)CAC>CAA		dynein, axonemal, heavy chain 5							62.0	61.0	61.0					5																	13864617		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13864617G>T	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4485C>A	5.37:g.13864617G>T	ENSP00000265104:p.His1495Gln		Somatic					p.H1495Q	NM_001369	NP_001360	Capture	Illumina GAIIx	Phase_I	Q8TE73	DYH5_HUMAN			28	4527	-	Lung NSC(4;0.00476)		1495			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.4485C>A	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757064	0.69648	.	.	ENSG00000039139	ENST00000265104	T	0.75589	-0.95	5.32	5.32	0.75619	Dynein heavy chain, domain-2 (1);	0.100735	0.64402	D	0.000002	D	0.92371	0.7579	H	0.99026	4.405	0.58432	D	0.999998	D	0.71674	0.998	D	0.80764	0.994	D	0.95433	0.8518	10	0.87932	D	0	.	19.0581	0.93074	0.0:0.0:1.0:0.0	.	1495	Q8TE73	DYH5_HUMAN	Q	1495	ENSP00000265104:H1495Q	ENSP00000265104:H1495Q	H	-	3	2	DNAH5	13917617	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	4.088000	0.57678	2.488000	0.83962	0.632000	0.83419	CAC		PASS	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		68	111	---	---	---	---
CDH10	1008	broad.mit.edu	37	5	24491937	24491937	+	Splice_Site	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:24491937C>A	ENST00000264463.4	-	11	2132		c.e11-1		CDH10_ENST00000502921.1_Splice_Site	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GCAGTATTATCTAAAACAAAT	0.284										HNSCC(23;0.051)																												uc003jgr.1																			1	Unknown(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.e11-1		cadherin 10, type 2 preproprotein							44.0	44.0	44.0					5																	24491937		2203	4300	6503	SO:0001630	splice_region_variant	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24491937C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1625-1G>T	5.37:g.24491937C>A		HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_Splice_Site	p.D542_splice	NM_006727	NP_006718	Capture	Illumina GAIIx	Phase_I	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	11	1957	-								Q9ULB3	Splice_Site	SNP	ENST00000264463.4	37	c.1625_splice	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146331	0.77888	.	.	ENSG00000040731	ENST00000264463	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2127	0.93763	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDH10	24527694	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.773000	0.85462	2.770000	0.95276	0.650000	0.86243	.		PASS	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	Intron	14	41	---	---	---	---
CDH10	1008	broad.mit.edu	37	5	24498596	24498596	+	Missense_Mutation	SNP	A	A	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:24498596A>C	ENST00000264463.4	-	9	1933	c.1426T>G	c.(1426-1428)Ttt>Gtt	p.F476V	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	476	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F476V(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		ATTCTCACAAAAACAGCCACG	0.393										HNSCC(23;0.051)																												uc003jgr.1																			1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1426-1428)TTT>GTT		cadherin 10, type 2 preproprotein							83.0	82.0	82.0					5																	24498596		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24498596A>C	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1426T>G	5.37:g.24498596A>C	ENSP00000264463:p.Phe476Val	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.F476V	NM_006727	NP_006718	Capture	Illumina GAIIx	Phase_I	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	9	1758	-			476			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1426T>G	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.862353	0.51482	.	.	ENSG00000040731	ENST00000264463	T	0.49139	0.79	5.53	5.53	0.82687	Cadherin (5);Cadherin-like (1);	0.218702	0.47455	D	0.000237	T	0.40448	0.1117	L	0.43598	1.365	0.41203	D	0.98638	B	0.06786	0.001	B	0.10450	0.005	T	0.24799	-1.0150	10	0.17832	T	0.49	.	14.8416	0.70230	1.0:0.0:0.0:0.0	.	476	Q9Y6N8	CAD10_HUMAN	V	476	ENSP00000264463:F476V	ENSP00000264463:F476V	F	-	1	0	CDH10	24534353	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.905000	0.92613	2.112000	0.64535	0.533000	0.62120	TTT		PASS	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		81	149	---	---	---	---
PTGER4	5734	broad.mit.edu	37	5	40692343	40692343	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:40692343C>G	ENST00000302472.3	+	3	2354	c.1330C>G	c.(1330-1332)Cag>Gag	p.Q444E		NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	444					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)	p.Q444E(1)		breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	AGACTCTTCACAGGGTCAGGA	0.587																																						uc003jlz.2																			1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1330-1332)CAG>GAG		prostaglandin E receptor 4, subtype EP4							47.0	42.0	44.0					5																	40692343		2203	4300	6503	SO:0001583	missense	5734				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity	g.chr5:40692343C>G	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.1330C>G	5.37:g.40692343C>G	ENSP00000302846:p.Gln444Glu		Somatic					p.Q444E	NM_000958	NP_000949	Capture	Illumina GAIIx	Phase_I	P35408	PE2R4_HUMAN			3	1922	+			444			Cytoplasmic (Potential).		Q3MJ87	Missense_Mutation	SNP	ENST00000302472.3	37	c.1330C>G	CCDS3930.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.525580	0.44969	.	.	ENSG00000171522	ENST00000302472	T	0.52057	0.68	5.81	5.81	0.92471	.	0.205402	0.40554	N	0.001073	T	0.65333	0.2681	L	0.57536	1.79	0.47183	D	0.999346	D	0.58268	0.982	D	0.67548	0.952	T	0.56637	-0.7946	10	0.25751	T	0.34	-16.8427	20.0826	0.97783	0.0:1.0:0.0:0.0	.	444	P35408	PE2R4_HUMAN	E	444	ENSP00000302846:Q444E	ENSP00000302846:Q444E	Q	+	1	0	PTGER4	40728100	0.999000	0.42202	0.980000	0.43619	0.998000	0.95712	4.103000	0.57783	2.746000	0.94184	0.655000	0.94253	CAG		PASS	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958		45	68	---	---	---	---
MROH2B	133558	broad.mit.edu	37	5	41004483	41004483	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:41004483C>A	ENST00000399564.4	-	37	4609	c.4159G>T	c.(4159-4161)Gaa>Taa	p.E1387*	MROH2B_ENST00000506092.2_Nonsense_Mutation_p.E942*	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1387								p.E1387*(1)|p.E1387K(1)									AGCACTATTTCCTTGAAGTAG	0.458																																						uc003jmj.3																			2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(2)	ovary(6)|central_nervous_system(2)	8						c.(4159-4161)GAA>TAA		HEAT repeat family member 7B2							152.0	143.0	146.0					5																	41004483		1912	4125	6037	SO:0001587	stop_gained	133558						binding	g.chr5:41004483C>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4159G>T	5.37:g.41004483C>A	ENSP00000382476:p.Glu1387*		Somatic				HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.E942*	p.E1387*	NM_173489	NP_775760	Capture	Illumina GAIIx	Phase_I	Q7Z745	HTRB2_HUMAN			37	4649	-			1387			HEAT 15.		Q68DM1|Q7Z4U4|Q8N7X3	Nonsense_Mutation	SNP	ENST00000399564.4	37	c.4159G>T	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	43	9.984038	0.99310	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	.	.	.	5.85	5.85	0.93711	.	0.091277	0.47455	D	0.000221	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	15.6775	0.77338	0.0:1.0:0.0:0.0	.	.	.	.	X	942;1092;1387	.	ENSP00000296803:E1092X	E	-	1	0	HEATR7B2	41040240	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.837000	0.55820	2.776000	0.95493	0.643000	0.83706	GAA		PASS	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		133	235	---	---	---	---
HCN1	348980	broad.mit.edu	37	5	45396630	45396630	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:45396630C>T	ENST00000303230.4	-	4	1251	c.1194G>A	c.(1192-1194)caG>caA	p.Q398Q		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	398					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.Q398Q(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AATCCAGAGACTGGATTAAAG	0.473																																						uc003jok.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1192-1194)CAG>CAA		hyperpolarization activated cyclic							59.0	56.0	57.0					5																	45396630		2203	4300	6503	SO:0001819	synonymous_variant	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45396630C>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1194G>A	5.37:g.45396630C>T			Somatic					p.Q398Q	NM_021072	NP_066550	Capture	Illumina GAIIx	Phase_I	O60741	HCN1_HUMAN			4	1219	-			398			Cytoplasmic (Potential).			Silent	SNP	ENST00000303230.4	37	c.1194G>A	CCDS3952.1																																																																																				PASS	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		46	65	---	---	---	---
MAN2A1	4124	broad.mit.edu	37	5	109190950	109190950	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:109190950T>C	ENST00000261483.4	+	20	4138	c.3086T>C	c.(3085-3087)cTt>cCt	p.L1029P	MAN2A1_ENST00000505313.1_3'UTR	NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	1029					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.L1029P(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TCACCTACCCTTGAGCTGCAA	0.398																																						uc003kou.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(3085-3087)CTT>CCT		mannosidase, alpha, class 2A, member 1							169.0	137.0	148.0					5																	109190950		2202	4300	6502	SO:0001583	missense	4124				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding	g.chr5:109190950T>C		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.3086T>C	5.37:g.109190950T>C	ENSP00000261483:p.Leu1029Pro		Somatic					p.L1029P	NM_002372	NP_002363	Capture	Illumina GAIIx	Phase_I	Q16706	MA2A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)	20	4049	+		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)	1029			Lumenal (Potential).		Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	c.3086T>C	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	T	1.055	-0.674627	0.03378	.	.	ENSG00000112893	ENST00000261483	T	0.77358	-1.09	5.0	2.69	0.31865	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.870227	0.10275	N	0.694206	T	0.59197	0.2176	N	0.13043	0.29	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.44636	-0.9315	10	0.29301	T	0.29	-0.944	6.1663	0.20392	0.0:0.5003:0.0:0.4997	.	1029	Q16706	MA2A1_HUMAN	P	1029	ENSP00000261483:L1029P	ENSP00000261483:L1029P	L	+	2	0	MAN2A1	109218849	0.001000	0.12720	0.009000	0.14445	0.026000	0.11368	1.242000	0.32755	0.453000	0.26858	0.533000	0.62120	CTT		PASS	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1			3	102	---	---	---	---
PRR16	51334	broad.mit.edu	37	5	120021815	120021815	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:120021815A>T	ENST00000407149.2	+	2	535	c.326A>T	c.(325-327)cAc>cTc	p.H109L	PRR16_ENST00000446965.1_Missense_Mutation_p.H39L|PRR16_ENST00000505123.1_Missense_Mutation_p.H39L|PRR16_ENST00000379551.2_Missense_Mutation_p.H86L			Q569H4	LARGN_HUMAN	proline rich 16	109	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.H86L(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CCCCCAGCACACCCGTCTGCT	0.527																																						uc003ksq.2																			1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(325-327)CAC>CTC		proline rich 16							144.0	128.0	133.0					5																	120021815		2203	4300	6503	SO:0001583	missense	51334							g.chr5:120021815A>T	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.326A>T	5.37:g.120021815A>T	ENSP00000385118:p.His109Leu		Somatic				PRR16_uc003ksp.2_Missense_Mutation_p.H86L|PRR16_uc003ksr.2_Missense_Mutation_p.H39L	p.H109L	NM_016644	NP_057728	Capture	Illumina GAIIx	Phase_I	Q569H4	PRR16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)	2	489	+		all_cancers(142;0.0464)|Prostate(80;0.00446)	109			Pro-rich.		D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37	c.326A>T		.	.	.	.	.	.	.	.	.	.	A	14.77	2.635599	0.47049	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.46063	0.88;0.9;0.92;0.92;0.92	5.58	5.58	0.84498	.	0.279229	0.39759	N	0.001280	T	0.36799	0.0980	L	0.43152	1.355	0.45183	D	0.998194	B;B	0.34015	0.277;0.435	B;B	0.33620	0.079;0.167	T	0.13469	-1.0508	9	.	.	.	-3.567	14.7777	0.69743	1.0:0.0:0.0:0.0	.	109;86	Q569H4;Q569H4-3	PRR16_HUMAN;.	L	109;86;39;39;39	ENSP00000385118:H109L;ENSP00000368869:H86L;ENSP00000421256:H39L;ENSP00000423446:H39L;ENSP00000405491:H39L	.	H	+	2	0	PRR16	120049714	0.993000	0.37304	0.684000	0.30055	0.925000	0.55904	6.483000	0.73617	2.133000	0.65898	0.449000	0.29647	CAC		PASS	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644		135	56	---	---	---	---
PCDHA6	56142	broad.mit.edu	37	5	140209305	140209305	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:140209305G>A	ENST00000529310.1	+	1	1743	c.1629G>A	c.(1627-1629)ccG>ccA	p.P543P	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	543	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P543P(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCGTGCCGCCTCTGGGCA	0.692																																						uc003lho.2																			2	Substitution - coding silent(2)		lung(2)	haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(1627-1629)CCG>CCA		protocadherin alpha 6 isoform 1 precursor							60.0	69.0	66.0					5																	140209305		2201	4298	6499	SO:0001819	synonymous_variant	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140209305G>A	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1629G>A	5.37:g.140209305G>A			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.P543P	p.P543P	NM_018909	NP_061732	Capture	Illumina GAIIx	Phase_I	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1656	+			543			Cadherin 5.|Extracellular (Potential).		O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	c.1629G>A	CCDS47281.1																																																																																				PASS	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		16	144	---	---	---	---
PCDHB10	56126	broad.mit.edu	37	5	140574310	140574310	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:140574310G>T	ENST00000239446.4	+	1	2369	c.2185G>T	c.(2185-2187)Gtg>Ttg	p.V729L		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	729					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V729L(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGCTGCTCGGTGCCCGAGGG	0.672																																						uc003lix.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2185-2187)GTG>TTG		protocadherin beta 10 precursor							51.0	61.0	57.0					5																	140574310		2203	4298	6501	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140574310G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2185G>T	5.37:g.140574310G>T	ENSP00000239446:p.Val729Leu		Somatic					p.V729L	NM_018930	NP_061753	Capture	Illumina GAIIx	Phase_I	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2359	+			729			Cytoplasmic (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.2185G>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	g	6.948	0.544678	0.13312	.	.	ENSG00000120324	ENST00000239446	T	0.49139	0.79	3.28	1.39	0.22231	.	.	.	.	.	T	0.40979	0.1139	M	0.65975	2.015	0.09310	N	1	B	0.28378	0.209	B	0.31245	0.126	T	0.33394	-0.9870	9	0.15952	T	0.53	.	5.5775	0.17231	0.1173:0.3906:0.4921:0.0	.	729	Q9UN67	PCDBA_HUMAN	L	729	ENSP00000239446:V729L	ENSP00000239446:V729L	V	+	1	0	PCDHB10	140554494	0.000000	0.05858	0.008000	0.14137	0.028000	0.11728	-0.085000	0.11250	0.201000	0.20466	-0.708000	0.03648	GTG		PASS	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		88	48	---	---	---	---
PCDHGA1	56114	broad.mit.edu	37	5	140711925	140711925	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:140711925C>T	ENST00000517417.1	+	1	1674	c.1674C>T	c.(1672-1674)aaC>aaT	p.N558N	PCDHGA1_ENST00000378105.3_Silent_p.N558N	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N558N(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACGACAACGCGCCCGAGA	0.647																																						uc003lji.1																			2	Substitution - coding silent(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(1672-1674)AAC>AAT		protocadherin gamma subfamily A, 1 isoform 1							140.0	153.0	149.0					5																	140711925		2203	4300	6503	SO:0001819	synonymous_variant	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140711925C>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1674C>T	5.37:g.140711925C>T			Somatic				PCDHGA1_uc011dan.1_Silent_p.N558N	p.N558N	NM_018912	NP_061735	Capture	Illumina GAIIx	Phase_I	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1674	+			558			Extracellular (Potential).|Cadherin 5.		Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	c.1674C>T	CCDS54922.1																																																																																				PASS	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		10	254	---	---	---	---
PCDH1	5097	broad.mit.edu	37	5	141244788	141244788	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:141244788G>A	ENST00000394536.3	-	3	1247	c.1108C>T	c.(1108-1110)Cgt>Tgt	p.R370C	PCDH1_ENST00000456271.1_Missense_Mutation_p.R358C|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000287008.3_Missense_Mutation_p.R370C|PCDH1_ENST00000536585.1_Missense_Mutation_p.R348C	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R370C(2)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		ACCTGGGCACGGGCACTCTTG	0.572																																					Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2																			2	Substitution - Missense(2)	p.R370C(1)	ovary(1)|lung(1)	ovary(5)	5						c.(1108-1110)CGT>TGT		protocadherin 1 isoform 1 precursor							130.0	121.0	124.0					5																	141244788		2203	4300	6503	SO:0001583	missense	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141244788G>A	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1108C>T	5.37:g.141244788G>A	ENSP00000378043:p.Arg370Cys		Somatic				PCDH1_uc003llp.2_Missense_Mutation_p.R370C|PCDH1_uc011dbf.1_Missense_Mutation_p.R348C	p.R370C	NM_002587	NP_002578	Capture	Illumina GAIIx	Phase_I	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	3	1225	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	370			Extracellular (Potential).|Cadherin 3.		Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	c.1108C>T	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	g	23.6	4.438930	0.83885	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.35	5.35	0.76521	Cadherin (4);Cadherin-like (1);	0.000000	0.49916	D	0.000129	T	0.67192	0.2867	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.969	T	0.69117	-0.5230	10	0.87932	D	0	.	16.645	0.85174	0.0:0.0:1.0:0.0	.	370;370	Q08174;Q08174-2	PCDH1_HUMAN;.	C	370;370;358;381;348	ENSP00000287008:R370C;ENSP00000378043:R370C;ENSP00000403497:R358C;ENSP00000350122:R381C;ENSP00000438825:R348C	ENSP00000287008:R370C	R	-	1	0	PCDH1	141224972	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.832000	0.55783	2.804000	0.96469	0.645000	0.84053	CGT		PASS	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		13	134	---	---	---	---
CYFIP2	26999	broad.mit.edu	37	5	156757807	156757807	+	Silent	SNP	G	G	A	rs141399379		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr5:156757807G>A	ENST00000521420.1	+	19	2227	c.2136G>A	c.(2134-2136)ccG>ccA	p.P712P	CYFIP2_ENST00000522463.1_Silent_p.P542P|CYFIP2_ENST00000347377.6_Silent_p.P738P|CYFIP2_ENST00000377576.3_Silent_p.P738P|CYFIP2_ENST00000442283.2_Silent_p.P23P|CYFIP2_ENST00000318218.6_Silent_p.P763P|CYFIP2_ENST00000435847.2_Silent_p.P437P|CYFIP2_ENST00000541131.1_Silent_p.P663P					cytoplasmic FMR1 interacting protein 2									p.P763P(2)|p.P738P(1)		breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCATCATTCCGTATCCACCGT	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		21488	0.001		0.0	False		,,,				2504	0.0					uc003lwq.2																			3	Substitution - coding silent(3)		lung(3)		0						c.(2212-2214)CCG>CCA		cytoplasmic FMR1 interacting protein 2							172.0	157.0	162.0					5																	156757807		2035	4209	6244	SO:0001819	synonymous_variant	26999				apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding	g.chr5:156757807G>A	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.2136G>A	5.37:g.156757807G>A			Somatic				CYFIP2_uc011ddn.1_Silent_p.P712P|CYFIP2_uc011ddo.1_Silent_p.P542P|CYFIP2_uc003lwr.2_Silent_p.P738P|CYFIP2_uc003lws.2_Silent_p.P738P|CYFIP2_uc003lwt.2_Silent_p.P641P|CYFIP2_uc011ddp.1_Silent_p.P472P	p.P738P	NM_001037333	NP_001032410	Capture	Illumina GAIIx	Phase_I	Q96F07	CYFP2_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		22	2352	+	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	763						Silent	SNP	ENST00000521420.1	37	c.2214G>A																																																																																					PASS	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332		28	82	---	---	---	---
HIVEP1	3096	broad.mit.edu	37	6	12120635	12120635	+	Missense_Mutation	SNP	A	A	G	rs140801617	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:12120635A>G	ENST00000379388.2	+	4	939	c.607A>G	c.(607-609)Atg>Gtg	p.M203V		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	203					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M203V(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACTGAAAGCAATGGAGCCAGA	0.448													A|||	4	0.000798722	0.0008	0.0	5008	,	,		22282	0.0		0.003	False		,,,				2504	0.0					uc003nac.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(607-609)ATG>GTG		human immunodeficiency virus type I enhancer		A	VAL/MET	0,3950		0,0,1975	86.0	80.0	82.0		607	5.7	1.0	6	dbSNP_134	82	4,8358		0,4,4177	yes	missense	HIVEP1	NM_002114.2	21	0,4,6152	GG,GA,AA		0.0478,0.0,0.0325	probably-damaging	203/2719	12120635	4,12308	1975	4181	6156	SO:0001583	missense	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12120635A>G	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.607A>G	6.37:g.12120635A>G	ENSP00000368698:p.Met203Val		Somatic				HIVEP1_uc011diq.1_RNA	p.M203V	NM_002114	NP_002105	Capture	Illumina GAIIx	Phase_I	P15822	ZEP1_HUMAN			4	786	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	203					B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	c.607A>G	CCDS43426.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	21.1	4.104418	0.76983	0.0	4.78E-4	ENSG00000095951	ENST00000379388	T	0.11930	2.73	5.69	5.69	0.88448	.	0.000000	0.44097	D	0.000498	T	0.28830	0.0715	M	0.76002	2.32	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.02371	-1.1169	9	.	.	.	-31.3397	15.942	0.79763	1.0:0.0:0.0:0.0	.	203	P15822	ZEP1_HUMAN	V	203	ENSP00000368698:M203V	.	M	+	1	0	HIVEP1	12228621	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.900000	0.92551	2.162000	0.67917	0.533000	0.62120	ATG		PASS	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		122	94	---	---	---	---
HIST1H4I	8294	broad.mit.edu	37	6	27107122	27107122	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:27107122G>A	ENST00000354348.2	+	1	47	c.35G>A	c.(34-36)gGg>gAg	p.G12E	HIST1H2BK_ENST00000396891.4_Intron	NM_003495.2	NP_003486.1	P62805	H4_HUMAN	histone cluster 1, H4i	12					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.G12E(1)		lung(1)	1						AAGGGCCTGGGGAAAGGGGGT	0.592			T	BCL6	NHL																																	uc003niy.1				Dom	yes		6	6p21.3	8294	T	"""histone 1, H4i (H4FM)"""			L	BCL6		NHL		1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(34-36)GGG>GAG		histone cluster 1, H4i							42.0	44.0	43.0					6																	27107122		2203	4300	6503	SO:0001583	missense	8294				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:27107122G>A	AB000905	CCDS4620.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198339	ENSG00000276180		"""Histones / Replication-dependent"""	4793	protein-coding gene	gene with protein product		602833	"""H4 histone family, member M"", ""histone 1, H4i"""	H4FM		8988030, 9439656, 12408966	Standard	NM_003495		Approved	H4/m	uc003niy.1	P62805	OTTHUMG00000014471	ENST00000354348.2:c.35G>A	6.37:g.27107122G>A	ENSP00000346316:p.Gly12Glu		Somatic				HIST1H2BK_uc003nix.1_Intron	p.G12E	NM_003495	NP_003486	Capture	Illumina GAIIx	Phase_I	P62805	H4_HUMAN			1	35	+			12					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000354348.2	37	c.35G>A	CCDS4620.1	.	.	.	.	.	.	.	.	.	.	.	17.21	3.332458	0.60853	.	.	ENSG00000198339	ENST00000354348	.	.	.	3.95	3.95	0.45737	.	0.000000	0.41712	U	0.000821	T	0.81004	0.4733	M	0.92923	3.36	0.54753	D	0.999981	.	.	.	.	.	.	D	0.84792	0.0779	7	0.52906	T	0.07	.	14.3124	0.66424	0.0:0.0:1.0:0.0	.	.	.	.	E	12	.	ENSP00000346316:G12E	G	+	2	0	HIST1H4I	27215101	1.000000	0.71417	0.044000	0.18714	0.011000	0.07611	8.868000	0.92320	2.158000	0.67659	0.655000	0.94253	GGG		PASS	HIST1H4I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040139.1	NM_003495		20	115	---	---	---	---
OR2J3	442186	broad.mit.edu	37	6	29079672	29079672	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:29079672A>T	ENST00000377169.1	+	1	5	c.5A>T	c.(4-6)aAt>aTt	p.N2I		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N2I(1)		endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TAGGAAATGAATGATGATGGA	0.323																																						uc011dll.1																			1	Substitution - Missense(1)		lung(1)		0						c.(4-6)AAT>ATT		olfactory receptor, family 2, subfamily J,							161.0	162.0	162.0					6																	29079672		1125	2480	3605	SO:0001583	missense	442186				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29079672A>T		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.5A>T	6.37:g.29079672A>T	ENSP00000366374:p.Asn2Ile		Somatic					p.N2I	NM_001005216	NP_001005216	Capture	Illumina GAIIx	Phase_I	O76001	OR2J3_HUMAN			1	5	+			2			Extracellular (Potential).		B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	c.5A>T	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	A	7.453	0.642994	0.14451	.	.	ENSG00000204701	ENST00000377169	T	0.00593	6.34	3.08	0.666	0.17901	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.09310	N	1	B	0.26002	0.139	B	0.19666	0.026	T	0.22661	-1.0210	9	0.41790	T	0.15	.	3.3853	0.07269	0.3524:0.0:0.1193:0.5283	.	2	O76001	OR2J3_HUMAN	I	2	ENSP00000366374:N2I	ENSP00000366374:N2I	N	+	2	0	OR2J3	29187651	0.001000	0.12720	0.571000	0.28486	0.436000	0.31835	-0.936000	0.03946	0.386000	0.24997	-0.415000	0.06103	AAT		PASS	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2			291	229	---	---	---	---
MOG	4340	broad.mit.edu	37	6	29640930	29640930	+	IGR	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:29640930C>T	ENST00000376917.3	+	0	2160				ZFP57_ENST00000488757.1_Missense_Mutation_p.D320N|ZFP57_ENST00000376883.1_Missense_Mutation_p.D300N|ZFP57_ENST00000376881.3_Missense_Mutation_p.D300N	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D300N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						TGGTTCACATCCAAAAGCCCC	0.537																																						uc011dlw.1																			1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(958-960)GAT>AAT		zinc finger protein 57 homolog							123.0	132.0	129.0					6																	29640930		1203	2509	3712	SO:0001628	intergenic_variant	346171				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding	g.chr6:29640930C>T		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640930C>T			Somatic				ZFP57_uc003nnl.3_Missense_Mutation_p.D300N	p.D320N	NM_001109809	NP_001103279	Capture	Illumina GAIIx	Phase_I	Q9NU63	ZFP57_HUMAN			4	1109	-			236					A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	ENST00000376917.3	37	c.958G>A	CCDS34370.1	.	.	.	.	.	.	.	.	.	.	C	8.549	0.875168	0.17395	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.05649	3.41;3.64;3.64	4.17	-4.93	0.03066	.	1.926350	0.02475	N	0.087921	T	0.00784	0.0026	N	0.14661	0.345	0.09310	N	1	B;B	0.14805	0.011;0.011	B;B	0.09377	0.004;0.004	T	0.44528	-0.9322	10	0.12766	T	0.61	0.0743	3.2428	0.06787	0.1139:0.2553:0.1127:0.5181	.	320;300	Q9NU63-3;Q9NU63-2	.;.	N	320;300;300	ENSP00000418259:D320N;ENSP00000366078:D300N;ENSP00000366080:D300N	ENSP00000366078:D300N	D	-	1	0	ZFP57	29748909	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-1.902000	0.01596	-1.175000	0.02751	0.563000	0.77884	GAT		PASS	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		236	173	---	---	---	---
CFB	629	broad.mit.edu	37	6	31914821	31914821	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:31914821G>T	ENST00000425368.2	+	3	849	c.336G>T	c.(334-336)ggG>ggT	p.G112G	CFB_ENST00000456570.1_Silent_p.G614G|CFB_ENST00000556679.1_Silent_p.G614G|CFB_ENST00000477310.1_Silent_p.G463G	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	112	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)	p.G112G(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						TCGAGAACGGGGAATACTGGC	0.537																																						uc003nyj.3																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(334-336)GGG>GGT		complement factor B preproprotein							108.0	97.0	101.0					6																	31914821		1511	2709	4220	SO:0001819	synonymous_variant	629				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity	g.chr6:31914821G>T	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.336G>T	6.37:g.31914821G>T			Somatic				CFB_uc011dor.1_Silent_p.G614G|CFB_uc011dos.1_3'UTR|CFB_uc003nyi.2_Silent_p.G112G	p.G112G	NM_001710	NP_001701	Capture	Illumina GAIIx	Phase_I	P00751	CFAB_HUMAN			3	614	+			112			Sushi 2.		B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Silent	SNP	ENST00000425368.2	37	c.336G>T	CCDS4729.1																																																																																				PASS	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710		37	185	---	---	---	---
GLP1R	2740	broad.mit.edu	37	6	39046732	39046732	+	Splice_Site	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:39046732G>A	ENST00000373256.4	+	9	927		c.e9-1			NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor						activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)	p.?(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	TCCCTCCCCAGCTGCTGGACC	0.582																																						uc003ooj.3																			1	Unknown(1)		lung(1)	lung(3)|breast(1)|pancreas(1)	5						c.e9-1		glucagon-like peptide 1 receptor precursor	Exenatide(DB01276)|Glucagon recombinant(DB00040)						209.0	188.0	195.0					6																	39046732		2203	4300	6503	SO:0001630	splice_region_variant	2740				activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled	g.chr6:39046732G>A		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.885-1G>A	6.37:g.39046732G>A			Somatic				GLP1R_uc003ooh.2_Splice_Site|GLP1R_uc003ooi.2_Splice_Site	p.G295_splice	NM_002062	NP_002053	Capture	Illumina GAIIx	Phase_I	P43220	GLP1R_HUMAN			9	945	+								Q2M229|Q99669	Splice_Site	SNP	ENST00000373256.4	37	c.885_splice	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375122	0.82682	.	.	ENSG00000112164	ENST00000373256	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3613	0.90375	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GLP1R	39154710	1.000000	0.71417	0.997000	0.53966	0.953000	0.61014	9.088000	0.94132	2.336000	0.79503	0.561000	0.74099	.		PASS	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		Intron	80	348	---	---	---	---
GCM1	8521	broad.mit.edu	37	6	52993720	52993720	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:52993720G>T	ENST00000259803.7	-	6	806	c.595C>A	c.(595-597)Cag>Aag	p.Q199K	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	199					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q199K(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					AAACTCCCCTGACTTTGTGTT	0.433																																						uc003pbp.2																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(595-597)CAG>AAG		glial cells missing homolog a							78.0	81.0	80.0					6																	52993720		2203	4300	6503	SO:0001583	missense	8521					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr6:52993720G>T	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.595C>A	6.37:g.52993720G>T	ENSP00000259803:p.Gln199Lys		Somatic					p.Q199K	NM_003643	NP_003634	Capture	Illumina GAIIx	Phase_I	Q9NP62	GCM1_HUMAN			6	804	-	Lung NSC(77;0.0755)		199					Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	37	c.595C>A	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	G	7.880	0.730087	0.15507	.	.	ENSG00000137270	ENST00000259803	T	0.74526	-0.85	5.71	2.76	0.32466	.	0.678711	0.14669	N	0.305466	T	0.28764	0.0713	N	0.24115	0.695	0.09310	N	1	B	0.31680	0.335	B	0.24394	0.053	T	0.27226	-1.0080	10	0.07175	T	0.84	-20.6112	8.456	0.32899	0.1714:0.0:0.8286:0.0	.	199	Q9NP62	GCM1_HUMAN	K	199	ENSP00000259803:Q199K	ENSP00000259803:Q199K	Q	-	1	0	GCM1	53101679	0.293000	0.24371	0.012000	0.15200	0.919000	0.55068	2.280000	0.43443	0.393000	0.25203	0.655000	0.94253	CAG		PASS	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			175	132	---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57472417	57472417	+	3'UTR	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:57472417G>T	ENST00000389488.2	+	0	1293				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.K402N(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGTCATACAAGATCTCTCCTG	0.433																																						uc003pdx.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1204-1206)AAG>AAT		DNA primase polypeptide 2							190.0	177.0	181.0					6																	57472417		2014	4197	6211	SO:0001624	3_prime_UTR_variant	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57472417G>T		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1290G>T	6.37:g.57472417G>T			Somatic					p.K402N	NM_000947	NP_000938	Capture	Illumina GAIIx	Phase_I	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	13	1293	+			402					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000389488.2	37	c.1206G>T																																																																																					PASS	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947		9	112	---	---	---	---
IBTK	25998	broad.mit.edu	37	6	82924287	82924287	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:82924287C>A	ENST00000306270.7	-	12	2410	c.1861G>T	c.(1861-1863)Gag>Tag	p.E621*	IBTK_ENST00000503631.1_Intron|IBTK_ENST00000510291.1_Nonsense_Mutation_p.E621*	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	621	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.E621*(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TGAACCTTCTCTACCACAAAG	0.323																																						uc003pjl.1																			1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(1861-1863)GAG>TAG		inhibitor of Bruton's tyrosine kinase							48.0	47.0	48.0					6																	82924287		2203	4300	6503	SO:0001587	stop_gained	25998				negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity	g.chr6:82924287C>A	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1861G>T	6.37:g.82924287C>A	ENSP00000305721:p.Glu621*		Somatic				IBTK_uc011dyv.1_Nonsense_Mutation_p.E621*|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Nonsense_Mutation_p.E315*|IBTK_uc003pjm.2_Nonsense_Mutation_p.E621*	p.E621*	NM_015525	NP_056340	Capture	Illumina GAIIx	Phase_I	Q9P2D0	IBTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0901)	12	2388	-		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)	621			BTB 1.		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Nonsense_Mutation	SNP	ENST00000306270.7	37	c.1861G>T	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	C	39	7.723278	0.98453	.	.	ENSG00000005700	ENST00000306270;ENST00000510291	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-19.0506	19.8632	0.96793	0.0:1.0:0.0:0.0	.	.	.	.	X	621	.	ENSP00000305721:E621X	E	-	1	0	IBTK	82981006	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.699000	0.92147	0.655000	0.94253	GAG		PASS	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525		19	140	---	---	---	---
TBX18	9096	broad.mit.edu	37	6	85446865	85446865	+	Silent	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:85446865A>G	ENST00000369663.5	-	8	1699	c.1362T>C	c.(1360-1362)acT>acC	p.T454T	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	454					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.T454T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CATAGGAGGGAGTCCTGGGCG	0.602																																						uc003pkl.1																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(2)|lung(1)	5						c.(1360-1362)ACT>ACC		T-box 18							100.0	91.0	94.0					6																	85446865		2203	4300	6503	SO:0001819	synonymous_variant	9096				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:85446865A>G	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1362T>C	6.37:g.85446865A>G			Somatic				TBX18_uc010kbq.1_Intron	p.T454T	NM_001080508	NP_001073977	Capture	Illumina GAIIx	Phase_I	O95935	TBX18_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0267)	8	1362	-		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)	454					A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	ENST00000369663.5	37	c.1362T>C	CCDS34495.1																																																																																				PASS	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508		42	287	---	---	---	---
SNX14	57231	broad.mit.edu	37	6	86253440	86253440	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:86253440T>C	ENST00000314673.3	-	13	1323	c.1147A>G	c.(1147-1149)Aat>Gat	p.N383D	SNX14_ENST00000369627.2_Missense_Mutation_p.N383D|SNX14_ENST00000513865.1_Missense_Mutation_p.N383D|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000505648.1_Missense_Mutation_p.N331D|SNX14_ENST00000346348.3_Missense_Mutation_p.N339D	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	383	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)	p.N383D(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		ATTTCATCATTTGATAATTCT	0.254																																						uc003pkr.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1147-1149)AAT>GAT		sorting nexin 14 isoform a							37.0	40.0	39.0					6																	86253440		2201	4283	6484	SO:0001583	missense	57231				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity	g.chr6:86253440T>C	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.1147A>G	6.37:g.86253440T>C	ENSP00000313121:p.Asn383Asp		Somatic				SNX14_uc003pkp.2_Missense_Mutation_p.N246D|SNX14_uc003pkq.2_5'UTR|SNX14_uc011dzg.1_Missense_Mutation_p.N331D|SNX14_uc003pks.2_Missense_Mutation_p.N339D|SNX14_uc003pkt.2_Missense_Mutation_p.N383D	p.N383D	NM_153816	NP_722523	Capture	Illumina GAIIx	Phase_I	Q9Y5W7	SNX14_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0423)	13	1340	-		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)	383			RGS.		B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	ENST00000314673.3	37	c.1147A>G	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	T	6.440	0.449386	0.12223	.	.	ENSG00000135317	ENST00000346348;ENST00000314673;ENST00000513865;ENST00000505648;ENST00000369627;ENST00000515216	T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08	5.72	3.37	0.38596	Regulator of G protein signalling (2);Regulator of G protein signalling superfamily (1);	0.143618	0.64402	D	0.000008	T	0.01189	0.0039	N	0.00436	-1.5	0.39567	D	0.969225	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.42498	-0.9448	10	0.07813	T	0.8	-8.883	5.3677	0.16123	0.0:0.3768:0.0:0.6232	.	383;339;383;331	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7;Q9Y5W7-3	.;.;SNX14_HUMAN;.	D	339;383;383;331;383;310	ENSP00000257769:N339D;ENSP00000313121:N383D;ENSP00000420938:N383D;ENSP00000427380:N331D;ENSP00000358641:N383D;ENSP00000425630:N310D	ENSP00000313121:N383D	N	-	1	0	SNX14	86310159	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.526000	0.53509	1.005000	0.39183	0.383000	0.25322	AAT		PASS	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816		9	59	---	---	---	---
ZNF292	23036	broad.mit.edu	37	6	87965905	87965905	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:87965905A>T	ENST00000369577.3	+	8	2601	c.2558A>T	c.(2557-2559)cAg>cTg	p.Q853L	ZNF292_ENST00000339907.4_Missense_Mutation_p.Q848L	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	853						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q853L(1)|p.Q708L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GATTCCATTCAGCCTTCTGAA	0.413																																						uc003plm.3																			2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(2557-2559)CAG>CTG		zinc finger protein 292							47.0	46.0	46.0					6																	87965905		1912	4133	6045	SO:0001583	missense	23036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:87965905A>T	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2558A>T	6.37:g.87965905A>T	ENSP00000358590:p.Gln853Leu		Somatic					p.Q853L	NM_015021	NP_055836	Capture	Illumina GAIIx	Phase_I	O60281	ZN292_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0199)	8	2599	+		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)	853					Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	c.2558A>T	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.737226	0.49045	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07444	3.19;3.2	5.46	5.46	0.80206	.	0.716055	0.14731	N	0.301767	T	0.04452	0.0122	N	0.08118	0	0.39816	D	0.972774	D	0.59357	0.985	P	0.50314	0.637	T	0.51044	-0.8755	10	0.59425	D	0.04	.	15.5285	0.75932	1.0:0.0:0.0:0.0	.	853	O60281	ZN292_HUMAN	L	853;848	ENSP00000358590:Q853L;ENSP00000342847:Q848L	ENSP00000342847:Q848L	Q	+	2	0	ZNF292	88022624	1.000000	0.71417	0.960000	0.40013	0.821000	0.46438	5.698000	0.68302	2.069000	0.61940	0.533000	0.62120	CAG		PASS	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		19	154	---	---	---	---
CDC40	51362	broad.mit.edu	37	6	110541048	110541048	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:110541048A>T	ENST00000368932.1	+	13	1417	c.1316A>T	c.(1315-1317)gAt>gTt	p.D439V	CDC40_ENST00000368930.1_Missense_Mutation_p.D439V|CDC40_ENST00000307731.1_Missense_Mutation_p.D439V			O60508	PRP17_HUMAN	cell division cycle 40	439					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.D439V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ACATCTGATGATAAAAGCCTA	0.378																																						uc003pua.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1315-1317)GAT>GTT		cell division cycle 40 homolog							177.0	163.0	168.0					6																	110541048		2203	4300	6503	SO:0001583	missense	51362				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm		g.chr6:110541048A>T	AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.1316A>T	6.37:g.110541048A>T	ENSP00000357928:p.Asp439Val		Somatic					p.D439V	NM_015891	NP_056975	Capture	Illumina GAIIx	Phase_I	O60508	PRP17_HUMAN		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)	12	1340	+		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)	439			WD 4.		B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	ENST00000368932.1	37	c.1316A>T	CCDS5081.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.475803	0.84640	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	5.37	5.37	0.77165	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.97096	0.9051	H	0.99609	4.655	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99029	1.0820	10	0.87932	D	0	-8.2423	15.3789	0.74637	1.0:0.0:0.0:0.0	.	439	O60508	PRP17_HUMAN	V	439	ENSP00000357928:D439V;ENSP00000357929:D439V;ENSP00000357926:D439V;ENSP00000304370:D439V	ENSP00000304370:D439V	D	+	2	0	CDC40	110647741	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.024000	0.59613	0.482000	0.46254	GAT		PASS	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891		45	91	---	---	---	---
KIAA1244	57221	broad.mit.edu	37	6	138635047	138635047	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:138635047C>T	ENST00000251691.4	+	26	4482	c.4316C>T	c.(4315-4317)tCa>tTa	p.S1439L		NM_020340.4	NP_065073.3			KIAA1244									p.S1368L(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GGAATTGAATCAGTCCTGTCT	0.428																																						uc003qhu.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(4315-4317)TCA>TTA		brefeldin A-inhibited guanine							122.0	105.0	111.0					6																	138635047		2203	4300	6503	SO:0001583	missense	57221				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr6:138635047C>T	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.4316C>T	6.37:g.138635047C>T	ENSP00000251691:p.Ser1439Leu		Somatic					p.S1439L	NM_020340	NP_065073	Capture	Illumina GAIIx	Phase_I	Q5TH69	BIG3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)	26	4316	+	Breast(32;0.135)		1439						Missense_Mutation	SNP	ENST00000251691.4	37	c.4316C>T	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064111	0.55432	.	.	ENSG00000112379	ENST00000251691	T	0.05081	3.5	5.03	5.03	0.67393	.	0.147727	0.44285	D	0.000463	T	0.01976	0.0062	N	0.14661	0.345	0.33811	D	0.627926	B	0.17465	0.022	B	0.16722	0.016	T	0.43442	-0.9391	10	0.42905	T	0.14	-27.8661	14.3821	0.66919	0.0:0.8065:0.1935:0.0	.	1439	Q5TH69	BIG3_HUMAN	L	1439	ENSP00000251691:S1439L	ENSP00000251691:S1439L	S	+	2	0	KIAA1244	138676740	1.000000	0.71417	0.967000	0.41034	0.980000	0.70556	4.182000	0.58310	2.342000	0.79632	0.655000	0.94253	TCA		PASS	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340		18	29	---	---	---	---
TFB1M	51106	broad.mit.edu	37	6	155635434	155635434	+	Silent	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:155635434C>G	ENST00000367166.4	-	1	184	c.129G>C	c.(127-129)ctG>ctC	p.L43L	TFB1M_ENST00000480390.1_5'UTR	NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)	p.L43L(1)		lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		ATCCACCTGTCAGCCTCAAGT	0.612																																						uc003qqj.3																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(127-129)CTG>CTC		transcription factor B1, mitochondrial							103.0	78.0	86.0					6																	155635434		2203	4300	6503	SO:0001819	synonymous_variant	51106				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity	g.chr6:155635434C>G	AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.129G>C	6.37:g.155635434C>G			Somatic				TFB1M_uc003qqk.2_RNA	p.L43L	NM_016020	NP_057104	Capture	Illumina GAIIx	Phase_I	Q8WVM0	TFB1M_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)	1	193	-		Ovarian(120;0.196)	43					Q05DR0|Q9Y384	Silent	SNP	ENST00000367166.4	37	c.129G>C	CCDS5248.1																																																																																				PASS	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042809.1			9	30	---	---	---	---
QKI	9444	broad.mit.edu	37	6	163956076	163956076	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:163956076C>T	ENST00000361752.3	+	4	1016	c.465C>T	c.(463-465)atC>atT	p.I155I	QKI_ENST00000275262.7_Silent_p.I155I|QKI_ENST00000424802.3_Silent_p.I155I|QKI_ENST00000392127.2_Silent_p.I155I|QKI_ENST00000361195.2_Silent_p.I155I|QKI_ENST00000453779.2_Silent_p.I155I	NM_006775.2|NM_206853.2|NM_206854.2|NM_206855.2	NP_006766.1|NP_996735.1|NP_996736.1|NP_996737.1	Q96PU8	QKI_HUMAN	QKI, KH domain containing, RNA binding	155					long-chain fatty acid biosynthetic process (GO:0042759)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|muscle cell differentiation (GO:0042692)|myelination (GO:0042552)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|spermatid development (GO:0007286)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I155I(2)		central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(5)|ovary(1)|prostate(3)|urinary_tract(2)	27		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		ATGTACTAATCACTGTGGAAG	0.348																																						uc003qui.2																			2	Substitution - coding silent(2)		lung(2)	large_intestine(1)|ovary(1)	2						c.(463-465)ATC>ATT		quaking homolog, KH domain RNA binding isoform							90.0	94.0	93.0					6																	163956076		2203	4300	6503	SO:0001819	synonymous_variant	9444				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding	g.chr6:163956076C>T	AB067798	CCDS5285.1, CCDS5286.1, CCDS5287.1, CCDS43525.1, CCDS75546.1	6q26	2011-09-12	2011-09-12		ENSG00000112531	ENSG00000112531			21100	protein-coding gene	gene with protein product		609590	"""quaking homolog, KH domain RNA binding (mouse)"""			10535969	Standard	NM_006775		Approved	QK3	uc003qui.3	Q96PU8	OTTHUMG00000015977	ENST00000361752.3:c.465C>T	6.37:g.163956076C>T			Somatic				QKI_uc003que.2_Silent_p.I155I|QKI_uc003quf.2_Silent_p.I155I|QKI_uc003qug.2_Silent_p.I155I|QKI_uc003quh.2_Silent_p.I155I|QKI_uc003quj.2_Silent_p.I155I	p.I155I	NM_006775	NP_006766	Capture	Illumina GAIIx	Phase_I	Q96PU8	QKI_HUMAN		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)	4	1016	+		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)	155					Q2I375|Q5MJQ1|Q969L9|Q96EJ3|Q96KA3|Q96PU6|Q96PU7|Q9P0X6|Q9P0X7|Q9P0X8|Q9P0X9|Q9P0Y0|Q9P0Y1	Silent	SNP	ENST00000361752.3	37	c.465C>T	CCDS5285.1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255238	0.22965	.	.	ENSG00000112531	ENST00000537883	.	.	.	5.56	4.7	0.59300	.	.	.	.	.	T	0.47021	0.1423	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48854	-0.8998	4	.	.	.	-2.1103	9.2389	0.37484	0.1446:0.7825:0.0:0.0729	.	.	.	.	Y	52	.	.	H	+	1	0	QKI	163876066	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.486000	0.60286	1.344000	0.45657	0.591000	0.81541	CAC		PASS	QKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043016.2	NM_006775		13	128	---	---	---	---
ERMARD	55780	broad.mit.edu	37	6	170175438	170175438	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr6:170175438G>T	ENST00000366773.3	+	14	1423	c.1390G>T	c.(1390-1392)Gtc>Ttc	p.V464F	ERMARD_ENST00000366772.2_Missense_Mutation_p.V464F|ERMARD_ENST00000392095.4_Missense_Mutation_p.V338F|ERMARD_ENST00000588451.1_Missense_Mutation_p.V328F|ERMARD_ENST00000418781.3_Missense_Mutation_p.V464F	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	464					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.V464F(1)									TCGGCAAGCCGTCAGGTGCGT	0.512																																						uc003qxg.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1390-1392)GTC>TTC		hypothetical protein LOC55780							66.0	57.0	60.0					6																	170175438		2203	4300	6503	SO:0001583	missense	55780					integral to membrane		g.chr6:170175438G>T	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1390G>T	6.37:g.170175438G>T	ENSP00000355735:p.Val464Phe		Somatic				C6orf70_uc011ehb.1_Missense_Mutation_p.V338F|C6orf70_uc003qxh.1_Missense_Mutation_p.V464F|C6orf70_uc010kky.1_Missense_Mutation_p.V338F|C6orf70_uc003qxi.1_Missense_Mutation_p.V112F	p.V464F	NM_018341	NP_060811	Capture	Illumina GAIIx	Phase_I	Q5T6L9	CF070_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)	14	1423	+		Breast(66;5.08e-05)|Ovarian(120;0.208)	464					B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	37	c.1390G>T	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	.	11.43	1.637461	0.29157	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095;ENST00000366771	T;T	0.43688	0.94;0.94	4.75	-1.73	0.08081	.	0.920645	0.09172	N	0.838725	T	0.19167	0.0460	L	0.47716	1.5	0.09310	N	1	D;D;P	0.61080	0.989;0.968;0.89	P;P;B	0.49528	0.614;0.614;0.225	T	0.07177	-1.0786	10	0.56958	D	0.05	.	1.1272	0.01737	0.3471:0.1466:0.357:0.1494	.	464;464;464	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	F	464;464;464;338;112	ENSP00000355735:V464F;ENSP00000375945:V338F	ENSP00000355733:V112F	V	+	1	0	C6orf70	169917363	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.492000	0.06467	-0.164000	0.10927	0.454000	0.30748	GTC		PASS	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341		13	32	---	---	---	---
THSD7A	221981	broad.mit.edu	37	7	11422150	11422150	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:11422150G>A	ENST00000423059.4	-	24	4756	c.4505C>T	c.(4504-4506)aCa>aTa	p.T1502I	AC004538.3_ENST00000445839.1_RNA|AC004538.3_ENST00000595972.1_RNA|AC004538.3_ENST00000421121.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1502					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T1502I(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		AGGTTTACCTGTTACATTTAT	0.403										HNSCC(18;0.044)																												uc003ssf.3																			1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(4504-4506)ACA>ATA		thrombospondin, type I, domain containing 7A							103.0	101.0	101.0					7																	11422150		1899	4104	6003	SO:0001583	missense	221981					integral to membrane		g.chr7:11422150G>A		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4505C>T	7.37:g.11422150G>A	ENSP00000406482:p.Thr1502Ile	HNSCC(18;0.044)	Somatic				uc003ssb.2_Intron|THSD7A_uc003ssd.3_5'Flank	p.T1502I	NM_015204	NP_056019	Capture	Illumina GAIIx	Phase_I	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	23	4757	-			1502			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000423059.4	37	c.4505C>T	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006232	0.93287	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.62941	-0.01	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.79464	0.4450	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.79242	-0.1884	10	0.62326	D	0.03	.	20.1322	0.98003	0.0:0.0:1.0:0.0	.	1502	Q9UPZ6	THS7A_HUMAN	I	1502	ENSP00000406482:T1502I	ENSP00000262042:T1502I	T	-	2	0	THSD7A	11388675	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.452000	0.97615	2.765000	0.95021	0.484000	0.47621	ACA		PASS	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		12	49	---	---	---	---
DPY19L1	23333	broad.mit.edu	37	7	34971211	34971211	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:34971211T>C	ENST00000310974.4	-	22	2146	c.2002A>G	c.(2002-2004)Aaa>Gaa	p.K668E		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	668						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)	p.K668E(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						TCTAGGACTTTGTAAACACTG	0.408																																						uc003tem.3																			1	Substitution - Missense(1)		lung(1)		0						c.(2002-2004)AAA>GAA		dpy-19-like 1							74.0	66.0	68.0					7																	34971211		1815	4058	5873	SO:0001583	missense	23333					integral to membrane		g.chr7:34971211T>C	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.2002A>G	7.37:g.34971211T>C	ENSP00000308695:p.Lys668Glu		Somatic				DPY19L1_uc003tel.1_RNA	p.K668E	NM_015283	NP_056098	Capture	Illumina GAIIx	Phase_I	Q2PZI1	D19L1_HUMAN			22	2147	-			668					O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	c.2002A>G	CCDS43567.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.19|14.19	2.462103|2.462103	0.43736|0.43736	.|.	.|.	ENSG00000173852|ENSG00000173852	ENST00000389292;ENST00000310974|ENST00000428054	T|.	0.55052|.	0.54|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.045187|.	0.85682|.	D|.	0.000000|.	T|T	0.69378|0.69378	0.3104|0.3104	L|L	0.60455|0.60455	1.87|1.87	0.49389|0.49389	D|D	0.999783|0.999783	D|.	0.61080|.	0.989|.	P|.	0.62298|.	0.9|.	T|T	0.68534|0.68534	-0.5383|-0.5383	10|5	0.30078|.	T|.	0.28|.	-19.5667|-19.5667	14.3424|14.3424	0.66636|0.66636	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	668|.	Q2PZI1|.	D19L1_HUMAN|.	E|R	78;668|75	ENSP00000308695:K668E|.	ENSP00000308695:K668E|.	K|Q	-|-	1|2	0|0	DPY19L1|DPY19L1	34937736|34937736	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.008000|8.008000	0.88588|0.88588	1.992000|1.992000	0.58205|0.58205	0.523000|0.523000	0.50628|0.50628	AAA|CAA		PASS	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1			23	137	---	---	---	---
NME8	51314	broad.mit.edu	37	7	37907413	37907413	+	Missense_Mutation	SNP	C	C	T	rs369365068		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:37907413C>T	ENST00000199447.4	+	11	1103	c.731C>T	c.(730-732)aCt>aTt	p.T244I	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.T244I	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	244	NDK 1.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.T244I(1)									GAACCACAGACTGACACCGAA	0.433																																						uc003tfn.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(730-732)ACT>ATT		thioredoxin domain containing 3							137.0	117.0	124.0					7																	37907413		2203	4300	6503	SO:0001583	missense	51314	Kartagener_syndrome			cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity	g.chr7:37907413C>T	AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.731C>T	7.37:g.37907413C>T	ENSP00000199447:p.Thr244Ile		Somatic					p.T244I	NM_016616	NP_057700	Capture	Illumina GAIIx	Phase_I	Q8N427	TXND3_HUMAN			11	1103	+			244			NDK 1.		Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	c.731C>T	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	C	7.784	0.710128	0.15239	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.42900	0.96;0.96	3.59	0.777	0.18538	.	1.798570	0.02699	N	0.111501	T	0.25644	0.0624	N	0.08118	0	0.09310	N	1	B	0.23806	0.091	B	0.27262	0.078	T	0.21109	-1.0255	10	0.35671	T	0.21	1.0721	5.7427	0.18102	0.0:0.6563:0.0:0.3437	.	244	Q8N427	TXND3_HUMAN	I	244	ENSP00000199447:T244I;ENSP00000397063:T244I	ENSP00000199447:T244I	T	+	2	0	TXNDC3	37873938	0.000000	0.05858	0.015000	0.15790	0.059000	0.15707	-0.331000	0.07914	0.172000	0.19760	0.563000	0.77884	ACT		PASS	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616		24	84	---	---	---	---
GTF2IRD1	9569	broad.mit.edu	37	7	73969796	73969796	+	Silent	SNP	C	C	T	rs145914970	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:73969796C>T	ENST00000265755.3	+	19	2433	c.2040C>T	c.(2038-2040)gaC>gaT	p.D680D	GTF2IRD1_ENST00000476977.1_Silent_p.D665D|GTF2IRD1_ENST00000489094.1_Intron|GTF2IRD1_ENST00000455841.2_Silent_p.D697D|GTF2IRD1_ENST00000424337.2_Silent_p.D665D	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	680					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D680D(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTCTGGTGGACGAGAGCCTGA	0.607													C|||	19	0.00379393	0.0144	0.0	5008	,	,		17536	0.0		0.0	False		,,,				2504	0.0					uc003uaq.2																			1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(2038-2040)GAC>GAT		GTF2I repeat domain containing 1 isoform 1		C	,,	46,4360	48.2+/-83.0	1,44,2158	77.0	66.0	70.0		2091,1995,2040	1.6	1.0	7	dbSNP_134	70	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	GTF2IRD1	NM_001199207.1,NM_005685.3,NM_016328.2	,,	1,44,6458	TT,TC,CC		0.0,1.044,0.3537	,,	697/977,665/945,680/960	73969796	46,12960	2203	4300	6503	SO:0001819	synonymous_variant	9569					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr7:73969796C>T	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2040C>T	7.37:g.73969796C>T			Somatic				GTF2IRD1_uc010lbq.2_Silent_p.D697D|GTF2IRD1_uc003uap.2_Silent_p.D665D|GTF2IRD1_uc003uar.1_Silent_p.D665D	p.D680D	NM_016328	NP_057412	Capture	Illumina GAIIx	Phase_I	Q9UHL9	GT2D1_HUMAN			19	2433	+			680					O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	c.2040C>T	CCDS5571.1	7	0.003205128205128205	7	0.014227642276422764	0	0.0	0	0.0	0	0.0	C	6.426	0.446649	0.12223	0.01044	0.0	ENSG00000006704	ENST00000470715	.	.	.	4.0	1.64	0.23874	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.199	4.4264	0.11505	0.0:0.5341:0.1856:0.2803	.	.	.	.	X	43	.	.	R	+	1	2	GTF2IRD1	73607732	0.938000	0.31826	1.000000	0.80357	0.491000	0.33493	-0.279000	0.08479	0.802000	0.34089	0.655000	0.94253	CGA		PASS	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		19	97	---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81695831	81695831	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:81695831C>A	ENST00000356253.5	-	8	923	c.668G>T	c.(667-669)tGg>tTg	p.W223L	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.W223L|CACNA2D1_ENST00000423588.1_Missense_Mutation_p.W223L			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	223					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.W223L(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	ATTATCAACCCATGGTGAAGC	0.279																																						uc003uhr.1																			1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)	6						c.(667-669)TGG>TTG		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						41.0	42.0	42.0					7																	81695831		2203	4288	6491	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81695831C>A	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.668G>T	7.37:g.81695831C>A	ENSP00000348589:p.Trp223Leu		Somatic					p.W223L	NM_000722	NP_000713	Capture	Illumina GAIIx	Phase_I	P54289	CA2D1_HUMAN			8	924	-			223			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.668G>T		.	.	.	.	.	.	.	.	.	.	C	25.2	4.615722	0.87359	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.33438	2.79;2.76;1.41	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	M	0.89414	3.03	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.71167	-0.4672	10	0.87932	D	0	-5.7356	17.8043	0.88597	0.0:1.0:0.0:0.0	.	223	P54289-2	.	L	223	ENSP00000349320:W223L;ENSP00000348589:W223L;ENSP00000405395:W223L	ENSP00000284088:W223L	W	-	2	0	CACNA2D1	81533767	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.694000	0.74587	2.506000	0.84524	0.467000	0.42956	TGG		PASS	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				14	33	---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84649630	84649630	+	Silent	SNP	T	T	A	rs111882229		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:84649630T>A	ENST00000284136.6	-	12	1465	c.1422A>T	c.(1420-1422)ggA>ggT	p.G474G	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	474	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.G474G(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TGAGGACAGTTCCAATGTCTG	0.403																																					Ovarian(63;442 1191 17318 29975 31528)	uc003uic.2																			1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)	5						c.(1420-1422)GGA>GGT		semaphorin 3D precursor							93.0	81.0	85.0					7																	84649630		2203	4300	6503	SO:0001819	synonymous_variant	223117				cell differentiation|nervous system development	extracellular region|membrane	receptor activity	g.chr7:84649630T>A	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1422A>T	7.37:g.84649630T>A			Somatic				SEMA3D_uc010led.2_Silent_p.G474G|SEMA3D_uc003uib.2_Silent_p.G113G	p.G474G	NM_152754	NP_689967	Capture	Illumina GAIIx	Phase_I	O95025	SEM3D_HUMAN			12	1462	-			474			Sema.		A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	ENST00000284136.6	37	c.1422A>T	CCDS34676.1																																																																																				PASS	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754		75	56	---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95657515	95657515	+	Missense_Mutation	SNP	G	G	A	rs376275541		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:95657515G>A	ENST00000324972.6	+	11	1242	c.1049G>A	c.(1048-1050)cGt>cAt	p.R350H	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.R330H|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.R333H|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.R313H|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.R333H|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.R313H	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	350					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.R350H(2)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGCTTCGCCCGTTTCCATCCT	0.512																																						uc003uoc.3																			2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(3)|kidney(1)	4						c.(1048-1050)CGT>CAT		dynein, cytoplasmic 1, intermediate chain 1		G	HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	241.0	212.0	222.0		998,938,1049	5.0	1.0	7		222	0,8600		0,0,4300	no	missense,missense,missense	DYNC1I1	NM_001135556.1,NM_001135557.1,NM_004411.4	29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	333/629,313/609,350/646	95657515	1,13005	2203	4300	6503	SO:0001583	missense	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95657515G>A	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1049G>A	7.37:g.95657515G>A	ENSP00000320130:p.Arg350His		Somatic				DYNC1I1_uc003uod.3_Missense_Mutation_p.R333H|DYNC1I1_uc003uob.2_Missense_Mutation_p.R313H|DYNC1I1_uc003uoe.3_Missense_Mutation_p.R330H|DYNC1I1_uc010lfl.2_Missense_Mutation_p.R339H	p.R350H	NM_004411	NP_004402	Capture	Illumina GAIIx	Phase_I	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		11	1326	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		350			WD 2.		B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	c.1049G>A	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611195	0.87258	2.27E-4	0.0	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32	5.04	5.04	0.67666	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.057497	0.64402	D	0.000002	T	0.19127	0.0459	L	0.55990	1.75	0.50813	D	0.999896	D;D;D;D;D	0.61080	0.962;0.978;0.978;0.962;0.989	P;P;P;P;P	0.59056	0.628;0.851;0.795;0.714;0.541	T	0.00062	-1.2156	10	0.72032	D	0.01	-10.2341	18.9501	0.92638	0.0:0.0:1.0:0.0	.	333;330;333;350;313	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	H	333;350;313;330;313;333	ENSP00000392337:R333H;ENSP00000320130:R350H;ENSP00000438377:R313H;ENSP00000398118:R330H;ENSP00000352348:R313H;ENSP00000412444:R333H	ENSP00000320130:R350H	R	+	2	0	DYNC1I1	95495451	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.128000	0.50492	2.788000	0.95919	0.585000	0.79938	CGT		PASS	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		377	282	---	---	---	---
ORC5	5001	broad.mit.edu	37	7	103801611	103801611	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:103801611C>A	ENST00000297431.4	-	12	1200	c.1058G>T	c.(1057-1059)gGg>gTg	p.G353V	ORC5_ENST00000545943.1_Missense_Mutation_p.G221V	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	353					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.G353V(1)		kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						TGGTTTTGGCCCAAGGAGATG	0.363																																						uc003vcb.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1057-1059)GGG>GTG		origin recognition complex subunit 5 isoform 1							120.0	123.0	122.0					7																	103801611		2203	4300	6503	SO:0001583	missense	5001				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding	g.chr7:103801611C>A		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.1058G>T	7.37:g.103801611C>A	ENSP00000297431:p.Gly353Val		Somatic				ORC5L_uc011klp.1_Missense_Mutation_p.G221V	p.G353V	NM_002553	NP_002544	Capture	Illumina GAIIx	Phase_I	O43913	ORC5_HUMAN			12	1169	-			353					A4D0P8|O60590|O95268	Missense_Mutation	SNP	ENST00000297431.4	37	c.1058G>T	CCDS5734.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382552	0.82792	.	.	ENSG00000164815	ENST00000297431;ENST00000545943	T;T	0.59083	1.31;0.29	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.78855	0.4349	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80799	-0.1221	10	0.72032	D	0.01	.	19.3047	0.94157	0.0:1.0:0.0:0.0	.	353	O43913	ORC5_HUMAN	V	353;221	ENSP00000297431:G353V;ENSP00000438018:G221V	ENSP00000297431:G353V	G	-	2	0	ORC5	103588847	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.017000	0.76399	2.652000	0.90054	0.655000	0.94253	GGG		PASS	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553		136	122	---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	103969662	103969662	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:103969662G>T	ENST00000401970.2	+	1	515	c.393G>T	c.(391-393)caG>caT	p.Q131H	LHFPL3_ENST00000535008.1_Missense_Mutation_p.Q145H|LHFPL3_ENST00000543266.1_Missense_Mutation_p.Q145H|LHFPL3_ENST00000424859.1_Missense_Mutation_p.Q131H			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	145						integral component of membrane (GO:0016021)		p.Q145H(1)		kidney(1)|large_intestine(2)|lung(6)	9						CCTGGATGCAGCTCACCTCCG	0.642																																						uc003vce.2																			1	Substitution - Missense(1)		lung(1)		0						c.(433-435)CAG>CAT		lipoma HMGIC fusion partner-like 3							59.0	59.0	59.0					7																	103969662		2008	4195	6203	SO:0001583	missense	375612					integral to membrane		g.chr7:103969662G>T	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.393G>T	7.37:g.103969662G>T	ENSP00000385374:p.Gln131His		Somatic				LHFPL3_uc003vcf.2_Missense_Mutation_p.Q145H	p.Q145H	NM_199000	NP_945351	Capture	Illumina GAIIx	Phase_I	Q86UP9	LHPL3_HUMAN			1	559	+			131			Helical; (Potential).		A1L383|A4D0Q5	Missense_Mutation	SNP	ENST00000401970.2	37	c.435G>T		.	.	.	.	.	.	.	.	.	.	G	19.15	3.771424	0.69992	.	.	ENSG00000187416	ENST00000424859;ENST00000535008;ENST00000401970;ENST00000543266	T;T;T;T	0.79940	-1.11;-1.32;-1.11;-1.32	5.18	5.18	0.71444	.	0.461144	0.25030	N	0.033686	D	0.87853	0.6282	M	0.89478	3.035	0.58432	D	0.999999	B;B	0.26147	0.143;0.143	B;B	0.39419	0.299;0.299	D	0.87128	0.2195	10	0.52906	T	0.07	-23.9974	18.7395	0.91768	0.0:0.0:1.0:0.0	.	145;145	A1L384;A4D0Q5	.;.	H	131;145;131;145	ENSP00000393128:Q131H;ENSP00000444350:Q145H;ENSP00000385374:Q131H;ENSP00000445976:Q145H	ENSP00000385374:Q131H	Q	+	3	2	LHFPL3	103756898	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	7.634000	0.83273	2.408000	0.81797	0.650000	0.86243	CAG		PASS	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000348284.1	NM_199000		35	131	---	---	---	---
RINT1	60561	broad.mit.edu	37	7	105204390	105204390	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:105204390G>C	ENST00000257700.2	+	12	2113	c.1882G>C	c.(1882-1884)Gaa>Caa	p.E628Q		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	628	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.E628Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GTATAAAAAAGAAAGGTATGT	0.353																																						uc003vda.1																			1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1882-1884)GAA>CAA		RAD50 interactor 1							56.0	52.0	53.0					7																	105204390		2202	4300	6502	SO:0001583	missense	60561				cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding	g.chr7:105204390G>C	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.1882G>C	7.37:g.105204390G>C	ENSP00000257700:p.Glu628Gln		Somatic				RINT1_uc010ljj.1_Missense_Mutation_p.E203Q	p.E628Q	NM_021930	NP_068749	Capture	Illumina GAIIx	Phase_I	Q6NUQ1	RINT1_HUMAN			12	2113	+			628			RINT1/TIP20.		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	37	c.1882G>C	CCDS34726.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352852	0.82132	.	.	ENSG00000135249	ENST00000257700	T	0.31247	1.5	6.17	5.29	0.74685	.	0.179437	0.64402	D	0.000015	T	0.39911	0.1096	L	0.47716	1.5	0.54753	D	0.99998	P	0.49185	0.92	P	0.53006	0.715	T	0.08391	-1.0724	10	0.23302	T	0.38	-10.5152	15.7894	0.78343	0.065:0.0:0.935:0.0	.	628	Q6NUQ1	RINT1_HUMAN	Q	628	ENSP00000257700:E628Q	ENSP00000257700:E628Q	E	+	1	0	RINT1	104991626	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.732000	0.91534	1.626000	0.50381	0.655000	0.94253	GAA		PASS	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930		83	57	---	---	---	---
FAM71F2	346653	broad.mit.edu	37	7	128317840	128317840	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:128317840G>T	ENST00000480462.1	+	3	694	c.588G>T	c.(586-588)aaG>aaT	p.K196N	FAM71F2_ENST00000477515.1_Intron|FAM71F2_ENST00000460349.1_3'UTR|FAM71F2_ENST00000378704.3_Missense_Mutation_p.K187N			Q6NXP2	F71F2_HUMAN	family with sequence similarity 71, member F2	196								p.K196N(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(2)	7						TGGTGCCCAAGATGCCCACCA	0.453																																						uc003vnk.3																			1	Substitution - Missense(1)		lung(1)		0						c.(586-588)AAG>AAT		hypothetical protein LOC346653 isoform a							44.0	46.0	45.0					7																	128317840		2011	4224	6235	SO:0001583	missense	346653							g.chr7:128317840G>T	BC047310	CCDS47701.1, CCDS47702.1	7q32.1	2009-04-17	2007-11-20	2007-11-20	ENSG00000205085	ENSG00000205085			27998	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member B"""	FAM137B		12477932	Standard	XM_006715964		Approved		uc003vnk.4	Q6NXP2	OTTHUMG00000158275	ENST00000480462.1:c.588G>T	7.37:g.128317840G>T	ENSP00000420140:p.Lys196Asn		Somatic				FAM71F2_uc010llm.1_Missense_Mutation_p.K187N|FAM71F2_uc003vnl.2_RNA|FAM71F2_uc010lln.1_RNA	p.K196N	NM_001012454	NP_001012457	Capture	Illumina GAIIx	Phase_I	Q6NXP2	F71F2_HUMAN			3	694	+			196					Q0VGF6|Q0VGF7|Q86X39	Missense_Mutation	SNP	ENST00000480462.1	37	c.588G>T	CCDS47701.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859327	0.71834	.	.	ENSG00000205085	ENST00000474069;ENST00000480462;ENST00000378704;ENST00000434001	T;T;T;T	0.11277	2.81;2.79;2.81;2.81	5.7	3.59	0.41128	.	0.000000	0.51477	D	0.000090	T	0.24928	0.0605	M	0.72894	2.215	0.30127	N	0.8052	D;D	0.76494	0.999;0.999	D;D	0.68943	0.961;0.915	T	0.07404	-1.0774	10	0.62326	D	0.03	-8.3269	5.3225	0.15889	0.2983:0.0:0.7017:0.0	.	187;196	Q6NXP2-2;Q6NXP2	.;F71F2_HUMAN	N	187;196;187;187	ENSP00000418907:K187N;ENSP00000420140:K196N;ENSP00000367976:K187N;ENSP00000401654:K187N	ENSP00000367976:K187N	K	+	3	2	FAM71F2	128105076	0.810000	0.29049	0.951000	0.38953	0.941000	0.58515	0.985000	0.29578	1.342000	0.45619	0.650000	0.86243	AAG		PASS	FAM71F2-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350537.1			12	45	---	---	---	---
WDR91	29062	broad.mit.edu	37	7	134878009	134878009	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:134878009A>G	ENST00000354475.4	-	11	1664	c.1633T>C	c.(1633-1635)Tgg>Cgg	p.W545R	WDR91_ENST00000344400.5_Missense_Mutation_p.W545R|WDR91_ENST00000423565.1_Missense_Mutation_p.W510R	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	545								p.W545R(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						TTCGTGTCCCACAGCAGCAGC	0.607																																						uc003vsp.2																			1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(1633-1635)TGG>CGG		WD repeat domain 91							61.0	54.0	56.0					7																	134878009		2203	4300	6503	SO:0001583	missense	29062							g.chr7:134878009A>G	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1633T>C	7.37:g.134878009A>G	ENSP00000346466:p.Trp545Arg		Somatic				WDR91_uc010lmq.2_Missense_Mutation_p.W134R|WDR91_uc010lmr.2_RNA	p.W545R	NM_014149	NP_054868	Capture	Illumina GAIIx	Phase_I	A4D1P6	WDR91_HUMAN			11	1695	-			545			WD 3.		A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	c.1633T>C	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656262	0.88056	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	T;T;T	0.39592	1.07;4.36;4.36	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67221	0.2870	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72440	-0.4293	10	0.87932	D	0	-14.0226	15.7455	0.77936	1.0:0.0:0.0:0.0	.	545	A4D1P6	WDR91_HUMAN	R	545;545;510	ENSP00000340877:W545R;ENSP00000346466:W545R;ENSP00000392555:W510R	ENSP00000340877:W545R	W	-	1	0	WDR91	134528549	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.297000	0.96120	2.107000	0.64212	0.533000	0.62120	TGG		PASS	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149		30	80	---	---	---	---
KLRG2	346689	broad.mit.edu	37	7	139164406	139164406	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:139164406G>A	ENST00000340940.4	-	3	1041	c.972C>T	c.(970-972)taC>taT	p.Y324Y	KLRG2_ENST00000393039.2_Intron	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	324	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.Y324Y(1)		central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					GGGTAGCGTGGTAGGCTGAGC	0.582																																						uc003vvb.2																			1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(970-972)TAC>TAT		killer cell lectin-like receptor subfamily G,							93.0	91.0	92.0					7																	139164406		2203	4300	6503	SO:0001819	synonymous_variant	346689					integral to membrane	sugar binding	g.chr7:139164406G>A	AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.972C>T	7.37:g.139164406G>A			Somatic				KLRG2_uc010lnc.2_Intron	p.Y324Y	NM_198508	NP_940910	Capture	Illumina GAIIx	Phase_I	A4D1S0	KLRG2_HUMAN			3	1041	-	Melanoma(164;0.233)		324			C-type lectin.		Q2NL79|Q6ZTV6	Silent	SNP	ENST00000340940.4	37	c.972C>T	CCDS5854.1																																																																																				PASS	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349433.1	NM_198508		159	151	---	---	---	---
SLC35G5	83650	broad.mit.edu	37	8	11189091	11189091	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:11189091G>T	ENST00000382435.4	+	1	695	c.476G>T	c.(475-477)tGg>tTg	p.W159L		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	159	EamA 1.					integral component of membrane (GO:0016021)		p.W159L(1)									GGCTACGAGTGGTGTGGACTG	0.597																																						uc003wtp.1																			1	Substitution - Missense(1)		lung(1)		0						c.(475-477)TGG>TTG		acyl-malonyl condensing enzyme							177.0	165.0	169.0					8																	11189091		2203	4300	6503	SO:0001583	missense	83650					integral to membrane		g.chr8:11189091G>T	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.476G>T	8.37:g.11189091G>T	ENSP00000371872:p.Trp159Leu		Somatic					p.W159L	NM_054028	NP_473369	Capture	Illumina GAIIx	Phase_I	Q96KT7	AMCL2_HUMAN	STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)	1	597	+			159			DUF6 1.		A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	c.476G>T	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	G	5.434	0.265162	0.10294	.	.	ENSG00000177710	ENST00000382435	T	0.46451	0.87	0.34	0.34	0.15985	.	0.000000	0.45361	D	0.000370	T	0.37839	0.1018	L	0.27053	0.805	0.30566	N	0.764017	D	0.89917	1.0	D	0.87578	0.998	T	0.41088	-0.9528	10	0.05525	T	0.97	-3.4721	6.5344	0.22344	2.0E-4:0.0:0.9998:0.0	.	159	Q96KT7	S35G5_HUMAN	L	159	ENSP00000371872:W159L	ENSP00000371872:W159L	W	+	2	0	SLC35G5	11226501	1.000000	0.71417	0.757000	0.31301	0.108000	0.19459	1.120000	0.31271	0.426000	0.26116	0.089000	0.15464	TGG		PASS	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028		297	103	---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15508305	15508305	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:15508305G>T	ENST00000503731.1	+	3	556	c.408G>T	c.(406-408)ggG>ggT	p.G136G	TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000506802.1_Silent_p.G136G|TUSC3_ENST00000382020.4_Silent_p.G136G|TUSC3_ENST00000509380.1_Silent_p.G136G	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	136	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.G136G(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		ATGATGAGGGGACAGACGTTT	0.358																																						uc003wwt.2																			2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(406-408)GGG>GGT		tumor suppressor candidate 3 isoform a							246.0	243.0	244.0					8																	15508305		2203	4300	6503	SO:0001819	synonymous_variant	7991				cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex		g.chr8:15508305G>T	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.408G>T	8.37:g.15508305G>T			Somatic				TUSC3_uc003wwr.2_Silent_p.G136G|TUSC3_uc003wws.2_Silent_p.G136G|TUSC3_uc003wwu.2_Silent_p.G136G|TUSC3_uc003wwv.2_Silent_p.G136G|TUSC3_uc003www.2_Silent_p.G136G|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Silent_p.G136G	p.G136G	NM_006765	NP_006756	Capture	Illumina GAIIx	Phase_I	Q13454	TUSC3_HUMAN		Colorectal(111;0.113)	3	618	+			136					A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Silent	SNP	ENST00000503731.1	37	c.408G>T	CCDS5994.1																																																																																				PASS	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765		12	490	---	---	---	---
MSR1	4481	broad.mit.edu	37	8	16001066	16001066	+	Splice_Site	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:16001066C>T	ENST00000262101.5	-	8	1155		c.e8+1		MSR1_ENST00000350896.3_Splice_Site|MSR1_ENST00000445506.2_Splice_Site|MSR1_ENST00000536385.1_Splice_Site|MSR1_ENST00000381998.4_Splice_Site|MSR1_ENST00000355282.2_Splice_Site			P21757	MSRE_HUMAN	macrophage scavenger receptor 1						cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)	p.?(3)		haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TATATACTTACTTAATGTGTT	0.363																																						uc003wwz.2																			3	Unknown(3)		lung(2)|upper_aerodigestive_tract(1)	ovary(1)	1						c.e8+1		macrophage scavenger receptor 1 isoform type 1							107.0	101.0	103.0					8																	16001066		2203	4300	6503	SO:0001630	splice_region_variant	4481				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity	g.chr8:16001066C>T	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.1033+1G>A	8.37:g.16001066C>T			Somatic				MSR1_uc010lsu.2_Splice_Site_p.T363_splice|MSR1_uc003wxa.2_Splice_Site_p.S345_splice|MSR1_uc003wxb.2_Splice_Site_p.R345_splice|MSR1_uc011kxz.1_Splice_Site_p.R119_splice	p.T345_splice	NM_138715	NP_619729	Capture	Illumina GAIIx	Phase_I	P21757	MSRE_HUMAN		Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)	8	1231	-								D3DSP3|O60505|P21759|Q45F10	Splice_Site	SNP	ENST00000262101.5	37	c.1033_splice	CCDS5995.1	.	.	.	.	.	.	.	.	.	.	c	13.54	2.269054	0.40095	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000522672;ENST00000381998;ENST00000536385	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9469	0.64091	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MSR1	16045437	0.951000	0.32395	0.911000	0.35937	0.470000	0.32858	2.064000	0.41432	2.553000	0.86117	0.645000	0.84053	.		PASS	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		Intron	33	10	---	---	---	---
SCARA5	286133	broad.mit.edu	37	8	27729452	27729452	+	Nonstop_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:27729452C>A	ENST00000354914.3	-	9	1972	c.1487G>T	c.(1486-1488)tGa>tTa	p.*496L	SCARA5_ENST00000380385.2_Nonstop_Mutation_p.*271L	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	0					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.*496L(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TGCCCACTTTCAGTGTCTGTT	0.602																																						uc003xgj.2																			1	Nonstop extension(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1486-1488)TGA>TTA		scavenger receptor class A, member 5							122.0	97.0	105.0					8																	27729452		2203	4300	6503	SO:0001578	stop_lost	286133				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity	g.chr8:27729452C>A	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1487G>T	8.37:g.27729452C>A			Somatic				SCARA5_uc010luz.2_Nonstop_Mutation_p.*271L	p.*496L	NM_173833	NP_776194	Capture	Illumina GAIIx	Phase_I	Q6ZMJ2	SCAR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)	9	1927	-		Ovarian(32;0.0218)	496					Q6UXZ1|Q7Z4A1|Q8N4Z7	Nonstop_Mutation	SNP	ENST00000354914.3	37	c.1487G>T	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482046	0.26598	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	.	.	.	5.93	3.21	0.36854	.	.	.	.	.	.	.	.	.	.	.	0.49798	D	0.999827	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2724	0.31853	0.0:0.7638:0.0:0.2362	.	.	.	.	L	496;271	.	.	X	-	2	2	SCARA5	27785371	0.167000	0.22975	0.129000	0.21949	0.501000	0.33797	0.878000	0.28126	0.428000	0.26173	0.561000	0.74099	TGA		PASS	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833		169	55	---	---	---	---
PDP1	54704	broad.mit.edu	37	8	94935238	94935238	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:94935238A>T	ENST00000297598.4	+	2	1220	c.951A>T	c.(949-951)caA>caT	p.Q317H	PDP1_ENST00000396200.3_Missense_Mutation_p.Q342H|PDP1_ENST00000517764.1_Missense_Mutation_p.Q317H|PDP1_ENST00000520728.1_Missense_Mutation_p.Q317H	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	317					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.Q317H(1)|p.Q342H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						ACAATGCTCAAAATGAAAGAG	0.498																																						uc003yge.2																			2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						c.(949-951)CAA>CAT		pyruvate dehyrogenase phosphatase catalytic							78.0	72.0	74.0					8																	94935238		2203	4300	6503	SO:0001583	missense	54704				pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity	g.chr8:94935238A>T	AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.951A>T	8.37:g.94935238A>T	ENSP00000297598:p.Gln317His		Somatic				PDP1_uc003ygf.2_Missense_Mutation_p.Q342H|PDP1_uc010max.2_Missense_Mutation_p.Q342H|PDP1_uc011lgm.1_Missense_Mutation_p.Q317H|PDP1_uc011lgn.1_Missense_Mutation_p.Q376H	p.Q317H	NM_018444	NP_060914	Capture	Illumina GAIIx	Phase_I	Q9P0J1	PDP1_HUMAN			2	1220	+			317					B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	ENST00000297598.4	37	c.951A>T	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	A	3.795	-0.042920	0.07452	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.9	4.12	0.48240	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.12646	0.0307	L	0.35854	1.095	0.53688	D	0.999976	B;B	0.19073	0.033;0.012	B;B	0.19946	0.027;0.016	T	0.09930	-1.0652	10	0.15499	T	0.54	-13.5395	9.5728	0.39438	0.2712:0.0:0.7288:0.0	.	368;317	B4DYX8;Q9P0J1	.;PDP1_HUMAN	H	317;317;342;317	ENSP00000297598:Q317H;ENSP00000428317:Q317H;ENSP00000379503:Q342H;ENSP00000430380:Q317H	ENSP00000297598:Q317H	Q	+	3	2	PDP1	95004414	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.417000	0.44653	0.848000	0.35191	-0.137000	0.14449	CAA		PASS	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444		136	80	---	---	---	---
KCNV1	27012	broad.mit.edu	37	8	110984722	110984722	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:110984722C>A	ENST00000524391.1	-	3	1788	c.756G>T	c.(754-756)tgG>tgT	p.W252C	KCNV1_ENST00000297404.1_Missense_Mutation_p.W252C|RP11-696P8.2_ENST00000530667.1_RNA			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	252					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)	p.W252C(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CCCCGGTGAACCAGCTAATGC	0.537																																						uc003ynr.3																			1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(754-756)TGG>TGT		potassium channel, subfamily V, member 1							78.0	69.0	72.0					8																	110984722		2203	4300	6503	SO:0001583	missense	27012					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr8:110984722C>A	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.756G>T	8.37:g.110984722C>A	ENSP00000435954:p.Trp252Cys		Somatic				KCNV1_uc010mcw.2_Missense_Mutation_p.W252C	p.W252C	NM_014379	NP_055194	Capture	Illumina GAIIx	Phase_I	Q6PIU1	KCNV1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)		2	1098	-	all_neural(195;0.219)		252			Helical; Name=Segment S2; (Potential).		Q9UHJ4	Missense_Mutation	SNP	ENST00000524391.1	37	c.756G>T	CCDS6314.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190094	0.78789	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.98512	-4.97;-4.97	5.7	5.7	0.88788	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98865	0.9616	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99876	1.1104	10	0.87932	D	0	.	18.8179	0.92085	0.0:1.0:0.0:0.0	.	252	Q6PIU1	KCNV1_HUMAN	C	252;252;128	ENSP00000435954:W252C;ENSP00000297404:W252C	ENSP00000297404:W252C	W	-	3	0	KCNV1	111053898	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.091000	0.71406	2.697000	0.92050	0.557000	0.71058	TGG		PASS	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385525.1	NM_014379		108	67	---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113702181	113702181	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:113702181G>T	ENST00000297405.5	-	14	2315	c.2071C>A	c.(2071-2073)Cag>Aag	p.Q691K	CSMD3_ENST00000343508.3_Missense_Mutation_p.Q651K|CSMD3_ENST00000455883.2_Missense_Mutation_p.Q587K|CSMD3_ENST00000352409.3_Missense_Mutation_p.Q691K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	691	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q691K(2)|p.Q651K(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACCCAAACTGGCATTCAAAC	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2																			4	Substitution - Missense(4)		lung(4)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2071-2073)CAG>AAG		CUB and Sushi multiple domains 3 isoform 1							167.0	171.0	169.0					8																	113702181		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113702181G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2071C>A	8.37:g.113702181G>T	ENSP00000297405:p.Gln691Lys	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_5'UTR|CSMD3_uc003ynt.2_Missense_Mutation_p.Q651K|CSMD3_uc011lhx.1_Missense_Mutation_p.Q587K	p.Q691K	NM_198123	NP_937756	Capture	Illumina GAIIx	Phase_I	Q7Z407	CSMD3_HUMAN			14	2230	-			691			Extracellular (Potential).|Sushi 3.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.2071C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393978	0.42410	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09	4.96	4.96	0.65561	Complement control module (2);Sushi/SCR/CCP (3);	0.085059	0.49305	D	0.000150	T	0.52837	0.1759	L	0.39633	1.23	0.43385	D	0.995494	B;B;B	0.28783	0.222;0.144;0.02	B;B;B	0.35413	0.138;0.202;0.025	T	0.46721	-0.9171	10	0.15066	T	0.55	.	18.5566	0.91088	0.0:0.0:1.0:0.0	.	587;691;651	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	651;691;31;587;691	ENSP00000345799:Q651K;ENSP00000297405:Q691K;ENSP00000341558:Q31K;ENSP00000412263:Q587K;ENSP00000343124:Q691K	ENSP00000297405:Q691K	Q	-	1	0	CSMD3	113771357	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.813000	0.99286	2.456000	0.83038	0.484000	0.47621	CAG		PASS	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		72	395	---	---	---	---
HAS2	3037	broad.mit.edu	37	8	122641416	122641416	+	Silent	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:122641416T>C	ENST00000303924.4	-	2	702	c.165A>G	c.(163-165)tcA>tcG	p.S55S		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	55					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.S55S(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGATGAGGTGTGATGCCAAAA	0.408																																						uc003yph.2																		HAS2/PLAG1(10)	1	Substitution - coding silent(1)		lung(1)	soft_tissue(10)|ovary(5)	15						c.(163-165)TCA>TCG		hyaluronan synthase 2							161.0	162.0	162.0					8																	122641416		2203	4300	6503	SO:0001819	synonymous_variant	3037					integral to plasma membrane	hyaluronan synthase activity	g.chr8:122641416T>C	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.165A>G	8.37:g.122641416T>C			Somatic					p.S55S	NM_005328	NP_005319	Capture	Illumina GAIIx	Phase_I	Q92819	HAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		2	703	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		55			Helical; Name=2; (Potential).		Q32MM3	Silent	SNP	ENST00000303924.4	37	c.165A>G	CCDS6335.1																																																																																				PASS	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		7	601	---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139155320	139155320	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:139155320C>T	ENST00000395297.1	-	16	3743	c.3573G>A	c.(3571-3573)acG>acA	p.T1191T		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1191								p.T1191T(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATAACCGATCCGTCATAGTAT	0.463										HNSCC(54;0.14)																												uc003yuy.2																			2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(2)	9						c.(3571-3573)ACG>ACA		hypothetical protein LOC51059							126.0	121.0	123.0					8																	139155320		1920	4131	6051	SO:0001819	synonymous_variant	51059							g.chr8:139155320C>T	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3573G>A	8.37:g.139155320C>T		HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Silent_p.T1092T|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.T753T|FAM135B_uc003yvb.2_3'UTR	p.T1191T	NM_015912	NP_056996	Capture	Illumina GAIIx	Phase_I	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		16	3744	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1191					B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	c.3573G>A	CCDS6375.2																																																																																				PASS	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		6	215	---	---	---	---
MAPK15	225689	broad.mit.edu	37	8	144803720	144803720	+	Splice_Site	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:144803720G>A	ENST00000338033.4	+	12	1325	c.1206G>A	c.(1204-1206)gaG>gaA	p.E402E	RP11-429J17.5_ENST00000527908.1_RNA	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	402					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)	p.E421E(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACCCCACAGAGTCCCCCCGTG	0.647																																						uc003yzj.2																			1	Substitution - coding silent(1)		lung(1)	lung(2)	2						c.(1204-1206)GAG>GAA		mitogen-activated protein kinase 15							61.0	74.0	70.0					8																	144803720		1939	4135	6074	SO:0001630	splice_region_variant	225689				protein autophosphorylation	extracellular region	ATP binding|MAP kinase activity|SH3 domain binding	g.chr8:144803720G>A	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1205-1G>A	8.37:g.144803720G>A			Somatic					p.E402E	NM_139021	NP_620590	Capture	Illumina GAIIx	Phase_I	Q8TD08	MK15_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		12	1247	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		402					Q2TCF9|Q8N362	Silent	SNP	ENST00000338033.4	37	c.1206G>A	CCDS6409.2																																																																																				PASS	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1	NM_139021	Silent	28	147	---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2081898	2081898	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:2081898A>G	ENST00000382203.1	+	15	2460	c.2251A>G	c.(2251-2253)Atg>Gtg	p.M751V	SMARCA2_ENST00000382194.1_Missense_Mutation_p.M751V|SMARCA2_ENST00000349721.2_Missense_Mutation_p.M751V|SMARCA2_ENST00000357248.2_Missense_Mutation_p.M751V			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	751	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.M751V(1)|p.M747V(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AGCCGATGAAATGGGGCTTGG	0.433																																						uc003zhc.2																			2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(2251-2253)ATG>GTG		SWI/SNF-related matrix-associated							216.0	180.0	192.0					9																	2081898		2203	4300	6503	SO:0001583	missense	6595				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding	g.chr9:2081898A>G	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2251A>G	9.37:g.2081898A>G	ENSP00000371638:p.Met751Val		Somatic				SMARCA2_uc003zhd.2_Missense_Mutation_p.M751V|SMARCA2_uc010mha.2_Missense_Mutation_p.M742V	p.M751V	NM_003070	NP_003061	Capture	Illumina GAIIx	Phase_I	P51531	SMCA2_HUMAN		GBM - Glioblastoma multiforme(50;0.0475)	15	2350	+		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)	751			ATP (Potential).|Helicase ATP-binding.		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	c.2251A>G	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.114088	0.56398	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.41	5.41	0.78517	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	H	0.98754	4.32	0.80722	D	1	D;P;P	0.71674	0.998;0.811;0.843	D;P;D	0.91635	0.999;0.879;0.926	D	0.99751	1.1018	10	0.87932	D	0	-33.1543	15.4431	0.75204	1.0:0.0:0.0:0.0	.	352;751;751	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	V	751	ENSP00000265773:M751V;ENSP00000349788:M751V;ENSP00000371638:M751V;ENSP00000371629:M751V	ENSP00000265773:M751V	M	+	1	0	SMARCA2	2071898	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.064000	0.61679	0.482000	0.46254	ATG		PASS	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070		438	105	---	---	---	---
SPATA31A2	642265	broad.mit.edu	37	9	39887386	39887386	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:39887386G>A	ENST00000456183.2	+	4	402	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K		NM_001040065.1	NP_001035154.1	Q5RGS2	S31A2_HUMAN	SPATA31 subfamily A, member 2	125	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E125K(1)									CCCCCCAGGTGAAGTGGGCGA	0.602																																						uc004abp.2																			1	Substitution - Missense(1)		lung(1)		0						c.(373-375)GAA>AAA		hypothetical protein LOC642265							2.0	1.0	1.0					9																	39887386		113	271	384	SO:0001583	missense	642265					integral to membrane		g.chr9:39887386G>A			9p13.1	2012-10-15	2012-10-12	2012-10-12	ENSG00000204848				32002	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A2"""	FAM75A2		20850414	Standard			Approved	OTTHUMG00000013563	uc004abm.3	Q5RGS2	OTTHUMG00000013563	ENST00000456183.2:c.373G>A	9.37:g.39887386G>A	ENSP00000406957:p.Glu125Lys		Somatic					p.E125K	NM_001040065	NP_001035154	Capture	Illumina GAIIx	Phase_I	Q5RGS2	F75A2_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	4	402	+			125			Pro-rich.			Missense_Mutation	SNP	ENST00000456183.2	37	c.373G>A	CCDS43809.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.778000	0.31502	.	.	ENSG00000204848	ENST00000456183	T	0.04758	3.56	1.33	0.407	0.16371	.	0.360060	0.20308	N	0.094886	T	0.07818	0.0196	L	0.59436	1.845	0.09310	N	1	D	0.57571	0.98	P	0.52514	0.701	T	0.21314	-1.0249	10	0.36615	T	0.2	-7.6805	3.7104	0.08417	0.2526:0.0:0.7474:0.0	.	125	Q5RGS2	F75A2_HUMAN	K	125	ENSP00000406957:E125K	ENSP00000406957:E125K	E	+	1	0	FAM75A2	39877386	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-0.057000	0.11768	0.164000	0.19529	0.184000	0.17185	GAA		PASS	SPATA31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037739.1	NM_001040065		30	139	---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77435287	77435287	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:77435287T>C	ENST00000360774.1	-	9	1304	c.1067A>G	c.(1066-1068)aAc>aGc	p.N356S	TRPM6_ENST00000449912.2_Missense_Mutation_p.N351S|TRPM6_ENST00000376871.3_Missense_Mutation_p.N356S|TRPM6_ENST00000376872.3_Missense_Mutation_p.N356S|TRPM6_ENST00000376864.4_Missense_Mutation_p.N356S|TRPM6_ENST00000483186.1_5'UTR|TRPM6_ENST00000451710.3_Missense_Mutation_p.N356S|TRPM6_ENST00000361255.3_Missense_Mutation_p.N351S	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	356					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.N356S(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AAGACTAAAGTTGAAAGTGTT	0.423																																						uc004ajl.1																			1	Substitution - Missense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(1066-1068)AAC>AGC		transient receptor potential cation channel,							145.0	133.0	137.0					9																	77435287		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77435287T>C	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1067A>G	9.37:g.77435287T>C	ENSP00000354006:p.Asn356Ser		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.N351S|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.N356S|TRPM6_uc010mpd.1_Missense_Mutation_p.N356S|TRPM6_uc010mpe.1_Intron	p.N356S	NM_017662	NP_060132	Capture	Illumina GAIIx	Phase_I	Q9BX84	TRPM6_HUMAN			9	1305	-			356			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.1067A>G	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	12.25	1.883104	0.33255	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.37	4.22	0.49857	.	0.240015	0.49305	N	0.000143	T	0.34629	0.0904	M	0.68317	2.08	0.34316	D	0.686063	B;B;B;B	0.16603	0.01;0.018;0.012;0.004	B;B;B;B	0.15484	0.007;0.011;0.009;0.013	T	0.43032	-0.9416	10	0.59425	D	0.04	.	7.4748	0.27369	0.0:0.2155:0.0:0.7845	.	356;356;356;351	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	S	356;356;356;356;351;351;356;19;19	ENSP00000354006:N356S;ENSP00000407341:N356S;ENSP00000366068:N356S;ENSP00000366067:N356S;ENSP00000396672:N351S;ENSP00000354962:N351S;ENSP00000366060:N356S	ENSP00000309693:N19S	N	-	2	0	TRPM6	76625107	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.780000	0.26760	0.868000	0.35678	0.533000	0.62120	AAC		PASS	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		29	126	---	---	---	---
SPATA31D1	389763	broad.mit.edu	37	9	84609543	84609543	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:84609543G>C	ENST00000344803.2	+	4	4205	c.4158G>C	c.(4156-4158)caG>caC	p.Q1386H		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1386					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.Q1386H(2)									CATGTGTGCAGAATATTGGTC	0.433																																						uc004amn.2																			2	Substitution - Missense(2)		lung(2)		0						c.(4156-4158)CAG>CAC		hypothetical protein LOC389763							28.0	25.0	26.0					9																	84609543		1868	4093	5961	SO:0001583	missense	389763					integral to membrane		g.chr9:84609543G>C		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.4158G>C	9.37:g.84609543G>C	ENSP00000341988:p.Gln1386His		Somatic					p.Q1386H	NM_001001670	NP_001001670	Capture	Illumina GAIIx	Phase_I	Q6ZQQ2	F75D1_HUMAN			4	4205	+			1386						Missense_Mutation	SNP	ENST00000344803.2	37	c.4158G>C	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711814	0.30322	.	.	ENSG00000214929	ENST00000344803	T	0.06371	3.31	3.23	-0.334	0.12666	.	.	.	.	.	T	0.10078	0.0247	L	0.27053	0.805	0.09310	N	1	D	0.89917	1.0	D	0.68353	0.957	T	0.32640	-0.9899	9	0.33940	T	0.23	-2.0241	6.0421	0.19740	0.3562:0.0:0.6438:0.0	.	1386	Q6ZQQ2	F75D1_HUMAN	H	1386	ENSP00000341988:Q1386H	ENSP00000341988:Q1386H	Q	+	3	2	FAM75D1	83799363	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.257000	0.08745	-0.068000	0.12953	0.655000	0.94253	CAG		PASS	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		11	42	---	---	---	---
NR4A3	8013	broad.mit.edu	37	9	102590726	102590726	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:102590726C>A	ENST00000395097.2	+	3	1131	c.402C>A	c.(400-402)taC>taA	p.Y134*	NR4A3_ENST00000338488.4_Nonsense_Mutation_p.Y134*|NR4A3_ENST00000330847.1_Nonsense_Mutation_p.Y145*	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	134					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)	p.Y134*(1)|p.Y145*(1)	TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CCTCCATGTACTTCAAGCAGT	0.687			T	EWSR1	extraskeletal myxoid chondrosarcoma																																	uc004baf.1				Dom	yes		9	9q22	8013	T	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""			M	EWSR1		extraskeletal myxoid chondrosarcoma	EWSR1/NR4A3(140)|TAF15/NR4A3(33)	2	Substitution - Nonsense(2)		lung(2)	bone(173)	173						c.(400-402)TAC>TAA		nuclear receptor subfamily 4, group A, member 3							38.0	43.0	41.0					9																	102590726		2202	4295	6497	SO:0001587	stop_gained	8013				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding	g.chr9:102590726C>A	U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.402C>A	9.37:g.102590726C>A	ENSP00000378531:p.Tyr134*		Somatic				NR4A3_uc004bae.2_Nonsense_Mutation_p.Y134*|NR4A3_uc004bag.1_Nonsense_Mutation_p.Y134*|NR4A3_uc004bai.2_Nonsense_Mutation_p.Y145*	p.Y134*	NM_006981	NP_008912	Capture	Illumina GAIIx	Phase_I	Q92570	NR4A3_HUMAN			3	1131	+		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)	134					A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Nonsense_Mutation	SNP	ENST00000395097.2	37	c.402C>A	CCDS6743.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024604	0.93518	.	.	ENSG00000119508	ENST00000395097;ENST00000338488;ENST00000330847	.	.	.	5.21	4.32	0.51571	.	1.436370	0.03423	N	0.206572	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4235	0.49996	0.0:0.8534:0.0:0.1466	.	.	.	.	X	134;134;145	.	ENSP00000333122:Y145X	Y	+	3	2	NR4A3	101630547	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.651000	0.46674	1.330000	0.45394	-0.252000	0.11476	TAC		PASS	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055482.1			37	86	---	---	---	---
ZNF189	7743	broad.mit.edu	37	9	104171502	104171502	+	Silent	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:104171502T>C	ENST00000339664.2	+	3	1581	c.1452T>C	c.(1450-1452)taT>taC	p.Y484Y	ZNF189_ENST00000374861.3_Silent_p.Y470Y|ZNF189_ENST00000259395.4_Silent_p.Y442Y	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	484					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y484Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AAAAGCCCTATCTATGTACTG	0.413																																						uc004bbh.1																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6						c.(1450-1452)TAT>TAC		zinc finger protein 189 isoform 1							86.0	92.0	90.0					9																	104171502		2203	4300	6503	SO:0001819	synonymous_variant	7743				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:104171502T>C	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.1452T>C	9.37:g.104171502T>C			Somatic				ZNF189_uc004bbg.1_Silent_p.Y442Y|ZNF189_uc004bbi.1_Silent_p.Y470Y|ZNF189_uc011lvk.1_Silent_p.Y469Y	p.Y484Y	NM_003452	NP_003443	Capture	Illumina GAIIx	Phase_I	O75820	ZN189_HUMAN			3	1728	+		Acute lymphoblastic leukemia(62;0.0559)	484			C2H2-type 12.		O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Silent	SNP	ENST00000339664.2	37	c.1452T>C	CCDS6754.1																																																																																				PASS	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452		11	256	---	---	---	---
RNF20	56254	broad.mit.edu	37	9	104324201	104324201	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:104324201T>C	ENST00000389120.3	+	19	2749	c.2659T>C	c.(2659-2661)Tct>Cct	p.S887P		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	887					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S887P(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GGAGGACATCTCTAGACTTCG	0.393																																						uc004bbn.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8						c.(2659-2661)TCT>CCT		ring finger protein 20							201.0	208.0	206.0					9																	104324201		2203	4300	6503	SO:0001583	missense	56254				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:104324201T>C	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.2659T>C	9.37:g.104324201T>C	ENSP00000373772:p.Ser887Pro		Somatic					p.S887P	NM_019592	NP_062538	Capture	Illumina GAIIx	Phase_I	Q5VTR2	BRE1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)	19	2749	+		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)	887			Potential.		A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	c.2659T>C	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.364464	0.61513	.	.	ENSG00000155827	ENST00000389120	T	0.33438	1.41	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.37046	0.0989	M	0.72118	2.19	0.80722	D	1	B	0.32526	0.374	B	0.33454	0.164	T	0.25847	-1.0120	10	0.52906	T	0.07	-8.8549	15.5218	0.75871	0.0:0.0:0.0:1.0	.	887	Q5VTR2	BRE1A_HUMAN	P	887	ENSP00000373772:S887P	ENSP00000373772:S887P	S	+	1	0	RNF20	103364022	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.698000	0.84413	2.197000	0.70478	0.533000	0.62120	TCT		PASS	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592		107	468	---	---	---	---
DFNB31	25861	broad.mit.edu	37	9	117188639	117188639	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:117188639C>A	ENST00000362057.3	-	4	1186	c.1018G>T	c.(1018-1020)Gac>Tac	p.D340Y	DFNB31_ENST00000265134.6_5'UTR|DFNB31_ENST00000374059.3_5'Flank	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	340	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.D340Y(1)|p.D340N(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACAGCCTCGTCGTGTAGGATG	0.567																																						uc004biz.3																			2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(1018-1020)GAC>TAC		CASK-interacting protein CIP98 isoform 1							106.0	92.0	97.0					9																	117188639		2203	4300	6503	SO:0001583	missense	25861				inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium		g.chr9:117188639C>A	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1018G>T	9.37:g.117188639C>A	ENSP00000354623:p.Asp340Tyr		Somatic				DFNB31_uc004bix.2_5'Flank|DFNB31_uc004biy.3_5'UTR|DFNB31_uc004bja.3_Missense_Mutation_p.D340Y	p.D340Y	NM_015404	NP_056219	Capture	Illumina GAIIx	Phase_I	Q9P202	WHRN_HUMAN			4	1667	-			340			PDZ 2.		A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	c.1018G>T	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488510	0.84854	.	.	ENSG00000095397	ENST00000362057	T	0.33654	1.4	5.05	5.05	0.67936	PDZ/DHR/GLGF (4);	0.149852	0.56097	D	0.000021	T	0.53546	0.1803	L	0.41710	1.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.57051	-0.7877	10	0.87932	D	0	-28.4029	18.3926	0.90489	0.0:1.0:0.0:0.0	.	340;340	B9EGE6;Q9P202	.;WHRN_HUMAN	Y	340	ENSP00000354623:D340Y	ENSP00000354623:D340Y	D	-	1	0	DFNB31	116228460	1.000000	0.71417	0.990000	0.47175	0.921000	0.55340	7.376000	0.79658	2.361000	0.80049	0.561000	0.74099	GAC		PASS	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404		25	128	---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	118997639	118997639	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:118997639T>A	ENST00000328252.3	+	7	2824	c.2455T>A	c.(2455-2457)Ttg>Atg	p.L819M	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	819					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L819M(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CATCAAACTGTTGGCTGTCAG	0.537																																						uc004bjn.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|pancreas(1)	9						c.(2455-2457)TTG>ATG		pregnancy-associated plasma protein A							88.0	71.0	77.0					9																	118997639		2203	4300	6503	SO:0001583	missense	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:118997639T>A		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2455T>A	9.37:g.118997639T>A	ENSP00000330658:p.Leu819Met		Somatic				PAPPA_uc011lxp.1_Missense_Mutation_p.L514M|PAPPA_uc011lxq.1_Intron	p.L819M	NM_002581	NP_002572	Capture	Illumina GAIIx	Phase_I	Q13219	PAPP1_HUMAN			7	2836	+			819					B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	c.2455T>A	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711499	0.68730	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.02177	4.41	6.04	2.47	0.30058	.	0.063203	0.64402	N	0.000005	T	0.08537	0.0212	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.03993	-1.0986	10	0.72032	D	0.01	-7.1662	2.4907	0.04609	0.2081:0.2487:0.0:0.5432	.	263;819	E7EMD3;Q13219	.;PAPP1_HUMAN	M	819;263	ENSP00000330658:L819M	ENSP00000330658:L819M	L	+	1	2	PAPPA	118037460	0.943000	0.32029	0.950000	0.38849	0.958000	0.62258	1.864000	0.39469	1.069000	0.40788	0.460000	0.39030	TTG		PASS	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		51	81	---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	119033690	119033690	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:119033690G>A	ENST00000328252.3	+	9	3317	c.2948G>A	c.(2947-2949)tGt>tAt	p.C983Y	PAPPA_ENST00000534838.1_Missense_Mutation_p.C21Y	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	983					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C983Y(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCCTTCAATTGTATTGGTACG	0.413																																						uc004bjn.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|pancreas(1)	9						c.(2947-2949)TGT>TAT		pregnancy-associated plasma protein A							228.0	195.0	206.0					9																	119033690		2203	4300	6503	SO:0001583	missense	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:119033690G>A		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2948G>A	9.37:g.119033690G>A	ENSP00000330658:p.Cys983Tyr		Somatic				PAPPA_uc011lxp.1_Missense_Mutation_p.C678Y|PAPPA_uc011lxq.1_Missense_Mutation_p.C358Y	p.C983Y	NM_002581	NP_002572	Capture	Illumina GAIIx	Phase_I	Q13219	PAPP1_HUMAN			9	3329	+			983					B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	c.2948G>A	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311516	0.60414	.	.	ENSG00000182752	ENST00000328252;ENST00000443904;ENST00000534838	T;T	0.52057	0.68;0.68	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.76912	0.4054	M	0.93594	3.435	0.58432	D	0.999997	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.998	D	0.83560	0.0106	10	0.87932	D	0	-21.7353	17.1261	0.86714	0.0:0.0:1.0:0.0	.	21;427;983	F5GZ19;E7EMD3;Q13219	.;.;PAPP1_HUMAN	Y	983;427;21	ENSP00000330658:C983Y;ENSP00000441461:C21Y	ENSP00000330658:C983Y	C	+	2	0	PAPPA	118073511	1.000000	0.71417	0.998000	0.56505	0.574000	0.36063	6.255000	0.72466	2.644000	0.89710	0.563000	0.77884	TGT		PASS	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		79	290	---	---	---	---
OR1B1	347169	broad.mit.edu	37	9	125391441	125391441	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:125391441T>A	ENST00000304833.3	-	1	411	c.374A>T	c.(373-375)tAt>tTt	p.Y125F	RP11-64P14.7_ENST00000431442.1_RNA|RP11-64P14.7_ENST00000419604.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y125F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						GATGGCCACATAGCGATCCAG	0.512																																						uc011lyz.1																			1	Substitution - Missense(1)		lung(1)		0						c.(373-375)TAT>TTT		olfactory receptor, family 1, subfamily B,							106.0	88.0	94.0					9																	125391441		2203	4300	6503	SO:0001583	missense	347169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125391441T>A	AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.374A>T	9.37:g.125391441T>A	ENSP00000303151:p.Tyr125Phe		Somatic					p.Y125F	NM_001004450	NP_001004450	Capture	Illumina GAIIx	Phase_I	Q8NGR6	OR1B1_HUMAN			1	374	-			125			Cytoplasmic (Potential).		Q6IFN3	Missense_Mutation	SNP	ENST00000304833.3	37	c.374A>T	CCDS35126.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.987636	0.35036	.	.	ENSG00000171484	ENST00000304833	T	0.54675	0.56	4.26	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37530	N	0.002057	T	0.36468	0.0968	L	0.52364	1.645	0.32210	N	0.576617	P	0.41475	0.751	B	0.39531	0.302	T	0.49143	-0.8970	10	0.02654	T	1	-11.1631	6.6573	0.22994	0.1529:0.0:0.1597:0.6874	.	125	Q8NGR6	OR1B1_HUMAN	F	125	ENSP00000303151:Y125F	ENSP00000303151:Y125F	Y	-	2	0	OR1B1	124431262	1.000000	0.71417	0.984000	0.44739	0.970000	0.65996	3.596000	0.54024	0.230000	0.21059	0.524000	0.50904	TAT		PASS	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053947.2	NM_001004450		39	80	---	---	---	---
CACNA1B	774	broad.mit.edu	37	9	140772528	140772528	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr9:140772528C>A	ENST00000371372.1	+	1	288	c.143C>A	c.(142-144)tCg>tAg	p.S48*	CACNA1B_ENST00000371363.1_Nonsense_Mutation_p.S48*|CACNA1B_ENST00000371355.4_Nonsense_Mutation_p.S48*|RP11-188C12.3_ENST00000371390.1_RNA|CACNA1B_ENST00000371357.1_Nonsense_Mutation_p.S48*|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000277551.2_Nonsense_Mutation_p.S48*	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	48					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.S48*(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TACAAGCAATCGATCGCGCAG	0.746																																						uc004cog.2																			1	Substitution - Nonsense(1)		lung(1)	breast(3)|large_intestine(2)|ovary(1)	6						c.(142-144)TCG>TAG		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						21.0	24.0	23.0					9																	140772528		1959	4153	6112	SO:0001587	stop_gained	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140772528C>A	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.143C>A	9.37:g.140772528C>A	ENSP00000360423:p.Ser48*		Somatic				uc004cof.1_Intron	p.S48*	NM_000718	NP_000709	Capture	Illumina GAIIx	Phase_I	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	1	288	+	all_cancers(76;0.166)		48			Cytoplasmic (Potential).		B1AQK5	Nonsense_Mutation	SNP	ENST00000371372.1	37	c.143C>A	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	C	37	6.294381	0.97449	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	.	.	.	3.46	3.46	0.39613	.	0.207503	0.33005	U	0.005383	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.975	0.64268	0.0:1.0:0.0:0.0	.	.	.	.	X	48	.	ENSP00000277551:S48X	S	+	2	0	CACNA1B	139892349	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	3.961000	0.56759	1.497000	0.48584	0.298000	0.19748	TCG		PASS	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		7	15	---	---	---	---
RSU1	6251	broad.mit.edu	37	10	16858988	16858988	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:16858988C>T	ENST00000377921.3	-	1	394	c.93G>A	c.(91-93)ctG>ctA	p.L31L	RSU1_ENST00000345264.5_Silent_p.L31L|RSU1_ENST00000464074.2_Intron|RSU1_ENST00000602389.1_Intron			Q15404	RSU1_HUMAN	Ras suppressor protein 1	31					cell junction assembly (GO:0034329)|positive regulation of neural precursor cell proliferation (GO:2000179)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)		p.L31L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(1;7.54e-08)		CGTTGACATCCAGCATGTTGG	0.567																																						uc001iok.2																			1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(91-93)CTG>CTA		ras suppressor protein 1 isoform 2							119.0	102.0	107.0					10																	16858988		2203	4300	6503	SO:0001819	synonymous_variant	6251				cell junction assembly|signal transduction	cytosol	protein binding	g.chr10:16858988C>T	AK055596	CCDS7112.1, CCDS31157.1	10p13	2012-09-20			ENSG00000148484	ENSG00000148484			10464	protein-coding gene	gene with protein product		179555				8288261	Standard	NM_152724		Approved	RSP-1, FLJ31034	uc001iol.3	Q15404	OTTHUMG00000017740	ENST00000377921.3:c.93G>A	10.37:g.16858988C>T			Somatic				RSU1_uc001iol.2_Silent_p.L31L|RSU1_uc001iom.2_Intron|RSU1_uc001ion.2_Silent_p.L31L	p.L31L	NM_152724	NP_689937	Capture	Illumina GAIIx	Phase_I	Q15404	RSU1_HUMAN		GBM - Glioblastoma multiforme(1;7.54e-08)	1	395	-			31					A8KA46|D3DRU3|Q6FI17	Silent	SNP	ENST00000377921.3	37	c.93G>A	CCDS7112.1																																																																																				PASS	RSU1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047006.1	NM_012425, NM_152724		43	76	---	---	---	---
PTCHD3	374308	broad.mit.edu	37	10	27702960	27702960	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:27702960C>A	ENST00000438700.3	-	1	337	c.220G>T	c.(220-222)Gca>Tca	p.A74S		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	74					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.A74S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						CGGGGGGGTGCATCGTCCCCC	0.716																																						uc001itu.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(220-222)GCA>TCA		patched domain containing 3							25.0	31.0	29.0					10																	27702960		2195	4284	6479	SO:0001583	missense	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27702960C>A	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.220G>T	10.37:g.27702960C>A	ENSP00000417658:p.Ala74Ser		Somatic					p.A74S	NM_001034842	NP_001030014	Capture	Illumina GAIIx	Phase_I	Q3KNS1	PTHD3_HUMAN			1	338	-			74					I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	c.220G>T	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004781	0.35320	.	.	ENSG00000182077	ENST00000438700	D	0.88277	-2.36	1.6	0.561	0.17285	.	.	.	.	.	T	0.78278	0.4258	L	0.36672	1.1	0.09310	N	1	B	0.24963	0.115	B	0.15484	0.013	T	0.59752	-0.7395	9	0.16896	T	0.51	.	3.6411	0.08168	0.2857:0.4334:0.2808:0.0	.	74	Q3KNS1	PTHD3_HUMAN	S	74	ENSP00000417658:A74S	ENSP00000417658:A74S	A	-	1	0	PTCHD3	27742966	0.006000	0.16342	0.000000	0.03702	0.000000	0.00434	0.000000	0.12993	-0.042000	0.13535	-0.416000	0.06073	GCA		PASS	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		38	47	---	---	---	---
SAMD8	142891	broad.mit.edu	37	10	76910296	76910296	+	Missense_Mutation	SNP	C	C	G	rs567483236	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:76910296C>G	ENST00000542569.1	+	2	113	c.10C>G	c.(10-12)Cct>Gct	p.P4A	SAMD8_ENST00000372690.3_Missense_Mutation_p.P67A|SAMD8_ENST00000372687.4_Missense_Mutation_p.P4A	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	4					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.P4A(1)|p.P67A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					AATGGCAGGTCCTAATCAACT	0.418													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18353	0.0		0.001	False		,,,				2504	0.0					uc001jwx.1																			2	Substitution - Missense(2)		lung(2)		0						c.(10-12)CCT>GCT		sterile alpha motif domain containing 8							77.0	74.0	75.0					10																	76910296		2203	4300	6503	SO:0001583	missense	142891				sphingomyelin biosynthetic process	integral to membrane		g.chr10:76910296C>G	AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.10C>G	10.37:g.76910296C>G	ENSP00000438042:p.Pro4Ala		Somatic				SAMD8_uc001jwy.1_Missense_Mutation_p.P4A	p.P4A	NM_144660	NP_653261	Capture	Illumina GAIIx	Phase_I	Q96LT4	SAMD8_HUMAN			2	113	+	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)		4					Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	37	c.10C>G	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829203	0.32329	.	.	ENSG00000156671	ENST00000447533;ENST00000372690;ENST00000542569;ENST00000372687	.	.	.	5.6	4.69	0.59074	.	0.310671	0.37809	N	0.001929	T	0.11623	0.0283	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.10823	-1.0613	9	0.36615	T	0.2	-19.6776	7.9839	0.30200	0.1949:0.7225:0.0:0.0826	.	4;4	Q96LT4-2;Q96LT4	.;SAMD8_HUMAN	A	4;67;4;4	.	ENSP00000361772:P4A	P	+	1	0	SAMD8	76580302	0.944000	0.32072	1.000000	0.80357	0.977000	0.68977	1.984000	0.40658	2.652000	0.90054	0.591000	0.81541	CCT		PASS	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660		4	72	---	---	---	---
CYP2C18	1562	broad.mit.edu	37	10	96466684	96466684	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:96466684C>G	ENST00000285979.6	+	5	985	c.786C>G	c.(784-786)gaC>gaG	p.D262E	CYP2C19_ENST00000464755.1_3'UTR|CYP2C18_ENST00000339022.5_Intron	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	262					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.D262E(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GTGCTCGGGACTTTATTGATT	0.318																																						uc001kjv.3																			1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(784-786)GAC>GAG		cytochrome P450 family 2 subfamily C polypeptide							94.0	93.0	93.0					10																	96466684		2203	4299	6502	SO:0001583	missense	1562				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr10:96466684C>G	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.786C>G	10.37:g.96466684C>G	ENSP00000285979:p.Asp262Glu		Somatic				CYP2C18_uc001kjw.3_Intron|CYP2C19_uc009xus.1_Intron|CYP2C19_uc010qny.1_5'UTR	p.D262E	NM_000772	NP_000763	Capture	Illumina GAIIx	Phase_I	P33260	CP2CI_HUMAN		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	5	1112	+		Colorectal(252;0.09)	262					B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	ENST00000285979.6	37	c.786C>G	CCDS7435.1	.	.	.	.	.	.	.	.	.	.	c	14.35	2.508036	0.44558	.	.	ENSG00000108242	ENST00000285979	T	0.23950	1.88	3.65	1.71	0.24356	.	0.064046	0.64402	U	0.000011	T	0.62600	0.2441	H	0.99211	4.47	0.80722	D	1	D	0.76494	0.999	D	0.66351	0.943	T	0.68116	-0.5494	10	0.87932	D	0	.	8.1792	0.31300	0.0:0.7895:0.0:0.2105	.	262	P33260	CP2CI_HUMAN	E	262	ENSP00000285979:D262E	ENSP00000285979:D262E	D	+	3	2	CYP2C18	96456674	0.998000	0.40836	0.946000	0.38457	0.524000	0.34500	0.285000	0.18883	0.311000	0.23014	0.306000	0.20318	GAC		PASS	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772		3	162	---	---	---	---
TECTB	6975	broad.mit.edu	37	10	114061861	114061861	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:114061861A>T	ENST00000369422.3	+	9	910	c.910A>T	c.(910-912)Agg>Tgg	p.R304W	TECTB_ENST00000494328.1_3'UTR	NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	304						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R304W(1)		kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		CACTACAGGCAGGGGATTTTC	0.428																																						uc001kzr.1																			1	Substitution - Missense(1)		lung(1)		0						c.(910-912)AGG>TGG		tectorin beta precursor							181.0	177.0	178.0					10																	114061861		2203	4300	6503	SO:0001583	missense	6975					anchored to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr10:114061861A>T	AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.910A>T	10.37:g.114061861A>T	ENSP00000358430:p.Arg304Trp		Somatic					p.R304W	NM_058222	NP_478129	Capture	Illumina GAIIx	Phase_I	Q96PL2	TECTB_HUMAN		Epithelial(162;0.0143)|all cancers(201;0.0242)	9	910	+		Colorectal(252;0.198)	304					Q5VW53	Missense_Mutation	SNP	ENST00000369422.3	37	c.910A>T	CCDS7571.1	.	.	.	.	.	.	.	.	.	.	A	16.36	3.100651	0.56183	.	.	ENSG00000119913	ENST00000369422	T	0.75938	-0.98	5.88	3.4	0.38934	.	0.567788	0.20250	N	0.096108	T	0.54919	0.1888	N	0.19112	0.55	0.80722	D	1	P	0.38788	0.647	B	0.32289	0.143	T	0.58375	-0.7647	10	0.87932	D	0	.	8.8336	0.35098	0.7904:0.1372:0.0724:0.0	.	304	Q96PL2	TECTB_HUMAN	W	304	ENSP00000358430:R304W	ENSP00000358430:R304W	R	+	1	2	TECTB	114051851	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.080000	0.41586	1.045000	0.40225	0.533000	0.62120	AGG		PASS	TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1	NM_058222		110	158	---	---	---	---
PNLIP	5406	broad.mit.edu	37	10	118307905	118307905	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:118307905T>A	ENST00000369221.2	+	4	263	c.235T>A	c.(235-237)Tcc>Acc	p.S79T	PNLIP_ENST00000470562.1_3'UTR	NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	79					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)	p.S79T(2)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	CATCAGTGGCTCCAATTTCAA	0.398																																						uc001lcm.2																			2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(235-237)TCC>ACC		pancreatic lipase precursor	Bentiromide(DB00522)|Orlistat(DB01083)						122.0	128.0	126.0					10																	118307905		2203	4300	6503	SO:0001583	missense	5406				lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity	g.chr10:118307905T>A	BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.235T>A	10.37:g.118307905T>A	ENSP00000358223:p.Ser79Thr		Somatic					p.S79T	NM_000936	NP_000927	Capture	Illumina GAIIx	Phase_I	P16233	LIPP_HUMAN		all cancers(201;0.0131)	4	278	+			79					Q5VSQ2	Missense_Mutation	SNP	ENST00000369221.2	37	c.235T>A	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.068010	0.55539	.	.	ENSG00000175535	ENST00000369221	D	0.91577	-2.87	5.39	5.39	0.77823	Lipase, N-terminal (1);	0.000000	0.64402	D	0.000002	D	0.91734	0.7386	M	0.74881	2.28	0.49798	D	0.999822	P	0.44659	0.84	P	0.46940	0.532	D	0.91444	0.5176	10	0.41790	T	0.15	.	14.5283	0.67905	0.0:0.0:0.0:1.0	.	79	P16233	LIPP_HUMAN	T	79	ENSP00000358223:S79T	ENSP00000358223:S79T	S	+	1	0	PNLIP	118297895	1.000000	0.71417	0.993000	0.49108	0.308000	0.27856	5.968000	0.70413	2.270000	0.75569	0.477000	0.44152	TCC		PASS	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936		98	243	---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123845190	123845190	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:123845190T>C	ENST00000369005.1	+	4	3515	c.3175T>C	c.(3175-3177)Tgc>Cgc	p.C1059R	TACC2_ENST00000515603.1_Missense_Mutation_p.C1059R|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.C1059R|TACC2_ENST00000334433.3_Missense_Mutation_p.C1059R|TACC2_ENST00000515273.1_Missense_Mutation_p.C1059R	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1059					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.C1059R(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TGCAGTTCCCTGCCTGCCAGC	0.632																																						uc001lfv.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(3175-3177)TGC>CGC		transforming, acidic coiled-coil containing							36.0	41.0	39.0					10																	123845190		2203	4300	6503	SO:0001583	missense	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123845190T>C	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.3175T>C	10.37:g.123845190T>C	ENSP00000358001:p.Cys1059Arg		Somatic				TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Missense_Mutation_p.C1059R|TACC2_uc010qtv.1_Missense_Mutation_p.C1059R	p.C1059R	NM_206862	NP_996744	Capture	Illumina GAIIx	Phase_I	O95359	TACC2_HUMAN			4	3535	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	1059					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	c.3175T>C	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.288388	0.40494	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.04015	3.8;3.73;3.75;3.8;3.73	5.17	-5.96	0.02234	.	0.632282	0.13203	N	0.405831	T	0.02119	0.0066	N	0.24115	0.695	0.09310	N	1	P;P;P	0.45283	0.855;0.855;0.744	B;B;B	0.35859	0.212;0.212;0.212	T	0.40478	-0.9561	10	0.46703	T	0.11	0.1851	3.7687	0.08633	0.3071:0.0721:0.4444:0.1764	.	1059;1059;1059	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	R	1059;1059;1059;1059;1059;1049	ENSP00000358001:C1059R;ENSP00000424467:C1059R;ENSP00000427618:C1059R;ENSP00000334280:C1059R;ENSP00000395048:C1059R	ENSP00000334280:C1059R	C	+	1	0	TACC2	123835180	0.000000	0.05858	0.000000	0.03702	0.281000	0.26958	-0.509000	0.06336	-0.516000	0.06470	0.448000	0.29417	TGC		PASS	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			13	59	---	---	---	---
TRIM68	55128	broad.mit.edu	37	11	4626667	4626667	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:4626667A>T	ENST00000300747.5	-	2	357	c.68T>A	c.(67-69)cTg>cAg	p.L23Q		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	23					protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L23Q(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGGCTCCCTCAGGAAGGTCAT	0.547																																						uc001lzf.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(67-69)CTG>CAG		ring finger protein 137							95.0	84.0	88.0					11																	4626667		2201	4298	6499	SO:0001583	missense	55128				protein autoubiquitination|regulation of androgen receptor signaling pathway	Golgi apparatus|nucleolus|perinuclear region of cytoplasm	androgen receptor binding|histone acetyltransferase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:4626667A>T	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.68T>A	11.37:g.4626667A>T	ENSP00000300747:p.Leu23Gln		Somatic				TRIM68_uc001lzg.1_5'UTR|TRIM68_uc010qyj.1_Intron|TRIM68_uc009yek.1_Missense_Mutation_p.L23Q	p.L23Q	NM_018073	NP_060543	Capture	Illumina GAIIx	Phase_I	Q6AZZ1	TRI68_HUMAN		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)	2	306	-		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	23			RING-type.		A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	37	c.68T>A	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	A	19.08	3.757446	0.69648	.	.	ENSG00000167333	ENST00000300747;ENST00000533021	T;T	0.21361	2.01;2.01	4.41	4.41	0.53225	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.34555	N	0.003880	T	0.46151	0.1378	M	0.79343	2.45	0.40986	D	0.984813	D;D	0.89917	1.0;0.992	D;D	0.97110	1.0;0.954	T	0.52426	-0.8577	10	0.87932	D	0	.	12.2073	0.54358	1.0:0.0:0.0:0.0	.	23;23	E9PR29;Q6AZZ1	.;TRI68_HUMAN	Q	23	ENSP00000300747:L23Q;ENSP00000436112:L23Q	ENSP00000300747:L23Q	L	-	2	0	TRIM68	4583243	0.808000	0.29022	1.000000	0.80357	0.760000	0.43138	6.060000	0.71141	1.932000	0.55993	0.448000	0.29417	CTG		PASS	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073		40	96	---	---	---	---
NLRP14	338323	broad.mit.edu	37	11	7083729	7083729	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:7083729G>T	ENST00000299481.4	+	10	3316	c.2970G>T	c.(2968-2970)agG>agT	p.R990S		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	990					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.R990S(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ACATTCAGAGGCTCGGGTGAG	0.398																																						uc001mfb.1																			1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2968-2970)AGG>AGT		NLR family, pyrin domain containing 14							124.0	116.0	119.0					11																	7083729		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7083729G>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2970G>T	11.37:g.7083729G>T	ENSP00000299481:p.Arg990Ser		Somatic					p.R990S	NM_176822	NP_789792	Capture	Illumina GAIIx	Phase_I	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	10	3293	+			990			LRR 10.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.2970G>T	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733499	0.30684	.	.	ENSG00000158077	ENST00000299481	T	0.38560	1.13	4.84	-0.851	0.10716	.	0.144445	0.32301	N	0.006282	T	0.18882	0.0453	L	0.33093	0.98	0.30460	N	0.774355	P	0.40144	0.704	B	0.30251	0.113	T	0.14755	-1.0461	10	0.44086	T	0.13	.	0.8847	0.01242	0.2944:0.1577:0.386:0.1618	.	990	Q86W24	NAL14_HUMAN	S	990	ENSP00000299481:R990S	ENSP00000299481:R990S	R	+	3	2	NLRP14	7040305	0.000000	0.05858	0.929000	0.37066	0.717000	0.41224	-0.218000	0.09240	-0.211000	0.10124	-0.136000	0.14681	AGG		PASS	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		55	144	---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16340072	16340072	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:16340072C>T	ENST00000352083.6	-	3	442	c.365G>A	c.(364-366)cGc>cAc	p.R122H	SOX6_ENST00000316399.6_Missense_Mutation_p.R122H|SOX6_ENST00000528429.1_Missense_Mutation_p.R122H|SOX6_ENST00000396356.3_Missense_Mutation_p.R122H|SOX6_ENST00000533658.1_5'UTR|SOX6_ENST00000528252.1_Missense_Mutation_p.R122H|SOX6_ENST00000527619.1_Missense_Mutation_p.R125H			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	122					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R122H(1)|p.R125H(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						CCCTTTGCGGCGCTCTGGGGT	0.498																																						uc001mme.2																			2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(403-405)CGC>CAC		SRY (sex determining region Y)-box 6 isoform 4							200.0	185.0	190.0					11																	16340072		2200	4294	6494	SO:0001583	missense	55553				muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity	g.chr11:16340072C>T	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.365G>A	11.37:g.16340072C>T	ENSP00000339876:p.Arg122His		Somatic				SOX6_uc001mmd.2_Missense_Mutation_p.R125H|SOX6_uc001mmf.2_Missense_Mutation_p.R122H|SOX6_uc001mmg.2_Missense_Mutation_p.R122H|SOX6_uc001mmh.1_RNA|SOX6_uc009ygs.2_RNA|SOX6_uc001mmi.3_Missense_Mutation_p.R122H|SOX6_uc001mmj.2_Missense_Mutation_p.R122H	p.R135H	NM_001145819	NP_001139291	Capture	Illumina GAIIx	Phase_I	P35712	SOX6_HUMAN			3	437	-			122					Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37	c.404G>A		.	.	.	.	.	.	.	.	.	.	C	34	5.402244	0.96030	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429;ENST00000533411;ENST00000526673	D;D;D;D;D;D	0.98926	-5.24;-5.2;-5.24;-4.92;-4.92;-5.2	5.28	5.28	0.74379	.	0.063248	0.64402	D	0.000006	D	0.99064	0.9679	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.999;0.993	D	0.99865	1.1088	10	0.72032	D	0.01	.	19.2735	0.94021	0.0:1.0:0.0:0.0	.	122;122;122;122;125	E9PQ78;E9PQL4;P35712-3;P35712;P35712-2	.;.;.;SOX6_HUMAN;.	H	122;122;122;122;125;122;122;122	ENSP00000324948:R122H;ENSP00000339876:R122H;ENSP00000379644:R122H;ENSP00000432134:R122H;ENSP00000434455:R125H;ENSP00000433233:R122H	ENSP00000324948:R122H	R	-	2	0	SOX6	16296648	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.384000	0.79751	2.632000	0.89209	0.591000	0.81541	CGC		PASS	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326		18	335	---	---	---	---
GTF2H1	2965	broad.mit.edu	37	11	18380126	18380126	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:18380126G>C	ENST00000265963.4	+	13	1566	c.1406G>C	c.(1405-1407)gGa>gCa	p.G469A	GTF2H1_ENST00000534641.1_Missense_Mutation_p.G353A|GTF2H1_ENST00000453096.2_Missense_Mutation_p.G469A|GTF2H1_ENST00000526630.2_Missense_Mutation_p.G59A|GTF2H1_ENST00000530496.2_Missense_Mutation_p.G157A	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	469					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G469A(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						GTAGCTGTTGGAGAACTTCTA	0.383								Nucleotide excision repair (NER)																														uc001moi.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1405-1407)GGA>GCA	NER	general transcription factor IIH, polypeptide 1,							204.0	194.0	198.0					11																	18380126		2199	4293	6492	SO:0001583	missense	2965				mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding	g.chr11:18380126G>C		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.1406G>C	11.37:g.18380126G>C	ENSP00000265963:p.Gly469Ala		Somatic				GTF2H1_uc001moh.2_Missense_Mutation_p.G469A|GTF2H1_uc009yhm.2_Missense_Mutation_p.G353A|GTF2H1_uc001moj.2_Missense_Mutation_p.G157A	p.G469A	NM_001142307	NP_001135779	Capture	Illumina GAIIx	Phase_I	P32780	TF2H1_HUMAN			14	2100	+			469					B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	ENST00000265963.4	37	c.1406G>C	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148901	0.37923	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963;ENST00000530496;ENST00000526630	T;T;T;T;T	0.42513	2.02;2.01;2.02;0.97;0.97	6.04	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.25901	0.0631	N	0.12569	0.235	0.80722	D	1	B	0.17038	0.02	B	0.10450	0.005	T	0.06391	-1.0829	10	0.15499	T	0.54	-16.4853	15.3023	0.73962	0.0666:0.0:0.9334:0.0	.	469	P32780	TF2H1_HUMAN	A	469;353;469;157;59	ENSP00000393638:G469A;ENSP00000435375:G353A;ENSP00000265963:G469A;ENSP00000433133:G157A;ENSP00000439774:G59A	ENSP00000265963:G469A	G	+	2	0	GTF2H1	18336702	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.431000	0.97494	1.576000	0.49790	0.563000	0.77884	GGA		PASS	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2	NM_005316		127	185	---	---	---	---
FIBIN	387758	broad.mit.edu	37	11	27016253	27016253	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:27016253C>A	ENST00000318627.2	+	1	626	c.180C>A	c.(178-180)gaC>gaA	p.D60E		NM_203371.1	NP_976249.1	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog (zebrafish)	60						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)		p.D60E(1)		breast(1)|endometrium(2)|lung(7)|upper_aerodigestive_tract(1)	11						GGGTGAGTGACCACAGGCGCT	0.637																																						uc001mrd.2																			1	Substitution - Missense(1)		lung(1)		0						c.(178-180)GAC>GAA		fin bud initiation factor homolog precursor							42.0	39.0	40.0					11																	27016253		2203	4299	6502	SO:0001583	missense	387758					extracellular region|Golgi apparatus		g.chr11:27016253C>A	BC026873	CCDS7861.1	11p14.2	2008-12-03				ENSG00000176971			33747	protein-coding gene	gene with protein product						17196583	Standard	NM_203371		Approved	MGC24932	uc001mrd.3	Q8TAL6		ENST00000318627.2:c.180C>A	11.37:g.27016253C>A	ENSP00000321962:p.Asp60Glu		Somatic					p.D60E	NM_203371	NP_976249	Capture	Illumina GAIIx	Phase_I	Q8TAL6	FIBIN_HUMAN			1	626	+			60						Missense_Mutation	SNP	ENST00000318627.2	37	c.180C>A	CCDS7861.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.349715	0.41599	.	.	ENSG00000176971	ENST00000318627	.	.	.	5.83	2.85	0.33270	.	0.281504	0.38164	N	0.001781	T	0.37517	0.1006	N	0.19112	0.55	0.49299	D	0.999777	B	0.15141	0.012	B	0.12156	0.007	T	0.08576	-1.0715	9	0.35671	T	0.21	-9.6504	6.9862	0.24729	0.0:0.4253:0.4197:0.155	.	60	Q8TAL6	FIBIN_HUMAN	E	60	.	ENSP00000321962:D60E	D	+	3	2	FIBIN	26972829	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	2.437000	0.44828	0.342000	0.23796	0.650000	0.86243	GAC		PASS	FIBIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387945.1	NM_203371		11	46	---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40136054	40136054	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:40136054G>T	ENST00000278198.2	-	2	3752	c.1789C>A	c.(1789-1791)Cac>Aac	p.H597N	LRRC4C_ENST00000527150.1_Missense_Mutation_p.H597N|LRRC4C_ENST00000528697.1_Missense_Mutation_p.H597N|LRRC4C_ENST00000530763.1_Missense_Mutation_p.H597N			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	597					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.H597N(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GAGTTATAGTGATTTAGGTGC	0.408																																						uc001mxa.1																			1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1789-1791)CAC>AAC		netrin-G1 ligand precursor							231.0	224.0	226.0					11																	40136054		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136054G>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1789C>A	11.37:g.40136054G>T	ENSP00000278198:p.His597Asn		Somatic				LRRC4C_uc001mxc.1_Missense_Mutation_p.H593N|LRRC4C_uc001mxd.1_Missense_Mutation_p.H593N|LRRC4C_uc001mxb.1_Missense_Mutation_p.H593N	p.H597N	NM_020929	NP_065980	Capture	Illumina GAIIx	Phase_I	Q9HCJ2	LRC4C_HUMAN			2	3753	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	597					A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.1789C>A	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055909	0.36277	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	6.17	6.17	0.99709	.	0.050804	0.85682	D	0.000000	T	0.59142	0.2172	L	0.58101	1.795	0.80722	D	1	B	0.13145	0.007	B	0.10450	0.005	T	0.53056	-0.8492	10	0.56958	D	0.05	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	597	Q9HCJ2	LRC4C_HUMAN	N	597	ENSP00000278198:H597N;ENSP00000436976:H597N;ENSP00000437132:H597N;ENSP00000434761:H597N	ENSP00000278198:H597N	H	-	1	0	LRRC4C	40092630	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	CAC		PASS	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		65	231	---	---	---	---
KBTBD4	55709	broad.mit.edu	37	11	47597189	47597189	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:47597189C>T	ENST00000526005.1	-	3	805	c.652G>A	c.(652-654)Gag>Aag	p.E218K	KBTBD4_ENST00000525720.1_Missense_Mutation_p.E267K|KBTBD4_ENST00000533290.1_Missense_Mutation_p.E243K|KBTBD4_ENST00000430070.2_Missense_Mutation_p.E234K|RNU5E-10P_ENST00000363506.1_RNA|KBTBD4_ENST00000395288.2_Missense_Mutation_p.E218K|KBTBD4_ENST00000450908.1_5'Flank|NDUFS3_ENST00000533507.1_Intron			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	218	BACK.							p.E218K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						TCTCTTTCCTCTTTATTAAAG	0.448																																						uc001nfx.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(652-654)GAG>AAG		kelch repeat and BTB (POZ) domain containing 4							157.0	152.0	154.0					11																	47597189		2201	4298	6499	SO:0001583	missense	55709							g.chr11:47597189C>T	AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.652G>A	11.37:g.47597189C>T	ENSP00000433340:p.Glu218Lys		Somatic				NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Missense_Mutation_p.E243K|KBTBD4_uc001nfz.2_Missense_Mutation_p.E234K|KBTBD4_uc001nfy.2_Missense_Mutation_p.E218K	p.E218K	NM_016506	NP_057590	Capture	Illumina GAIIx	Phase_I	Q9NVX7	KBTB4_HUMAN			3	823	-			218			BACK.		D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	ENST00000526005.1	37	c.652G>A	CCDS7940.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.074660	0.36566	.	.	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000359900;ENST00000430070;ENST00000525720	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	5.62	4.72	0.59763	BTB/Kelch-associated (2);	0.107095	0.64402	D	0.000007	T	0.55257	0.1909	L	0.35854	1.095	0.41250	D	0.986702	B;B;B	0.29481	0.122;0.149;0.245	B;B;B	0.29176	0.06;0.099;0.099	T	0.56282	-0.8005	10	0.46703	T	0.11	-21.999	10.3722	0.44060	0.0:0.7956:0.1341:0.0703	.	234;218;243	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	K	218;243;218;227;234;267	ENSP00000433340:E218K;ENSP00000436713:E243K;ENSP00000378703:E218K;ENSP00000415106:E234K;ENSP00000434477:E267K	ENSP00000352971:E227K	E	-	1	0	KBTBD4	47553765	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	5.577000	0.67444	1.532000	0.49169	0.650000	0.86243	GAG		PASS	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000391763.1	NM_016506		65	200	---	---	---	---
OR4C6	219432	broad.mit.edu	37	11	55433570	55433570	+	Nonstop_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:55433570T>A	ENST00000314259.3	+	1	957	c.928T>A	c.(928-930)Taa>Aaa	p.*310K		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.*310K(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						GGCTGGGAAATAACTGCAATG	0.423																																						uc001nht.3																			1	Nonstop extension(1)		lung(1)	skin(2)	2						c.(928-930)TAA>AAA		olfactory receptor, family 4, subfamily C,							63.0	64.0	64.0					11																	55433570		2200	4296	6496	SO:0001578	stop_lost	219432				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55433570T>A	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.928T>A	11.37:g.55433570T>A	ENSP00000324769:p.*310Lysext*4		Somatic				OR4C6_uc010rik.1_3'UTR	p.*310K	NM_001004704	NP_001004704	Capture	Illumina GAIIx	Phase_I	Q8NH72	OR4C6_HUMAN			3	1193	+			310					B2RP11|Q6IFD2	Nonstop_Mutation	SNP	ENST00000314259.3	37	c.928T>A	CCDS31506.1	.	.	.	.	.	.	.	.	.	.	T	6.731	0.503658	0.12822	.	.	ENSG00000181903	ENST00000314259	.	.	.	3.56	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.9459	0.19219	0.0:0.1371:0.0:0.8629	.	.	.	.	K	310	.	.	X	+	1	0	OR4C6	55190146	0.000000	0.05858	0.006000	0.13384	0.011000	0.07611	0.573000	0.23699	1.413000	0.46997	0.433000	0.28618	TAA		PASS	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704		4	137	---	---	---	---
OR5M3	219482	broad.mit.edu	37	11	56237459	56237459	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:56237459A>T	ENST00000312240.2	-	1	555	c.515T>A	c.(514-516)aTc>aAc	p.I172N		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I172N(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GAAATGGTTGATCTCAATTTT	0.403																																						uc010rjk.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(514-516)ATC>AAC		olfactory receptor, family 5, subfamily M,							118.0	106.0	110.0					11																	56237459		2201	4296	6497	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237459A>T	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.515T>A	11.37:g.56237459A>T	ENSP00000312208:p.Ile172Asn		Somatic					p.I172N	NM_001004742	NP_001004742	Capture	Illumina GAIIx	Phase_I	Q8NGP4	OR5M3_HUMAN			1	515	-	Esophageal squamous(21;0.00448)		172			Extracellular (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.515T>A	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731872	0.69189	.	.	ENSG00000174937	ENST00000312240	T	0.00220	8.52	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000193	T	0.01254	0.0041	H	0.99444	4.57	0.31612	N	0.651348	D	0.89917	1.0	D	0.76575	0.988	T	0.02132	-1.1208	10	0.87932	D	0	-23.7105	13.9306	0.63994	1.0:0.0:0.0:0.0	.	172	Q8NGP4	OR5M3_HUMAN	N	172	ENSP00000312208:I172N	ENSP00000312208:I172N	I	-	2	0	OR5M3	55994035	0.753000	0.28349	1.000000	0.80357	0.935000	0.57460	4.594000	0.61041	1.967000	0.57214	0.448000	0.29417	ATC		PASS	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		74	252	---	---	---	---
FERMT3	83706	broad.mit.edu	37	11	63990580	63990580	+	Silent	SNP	C	C	T	rs184609471		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:63990580C>T	ENST00000279227.5	+	14	1838	c.1743C>T	c.(1741-1743)atC>atT	p.I581I	FERMT3_ENST00000345728.5_Silent_p.I577I|TRPT1_ENST00000540472.1_5'Flank	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	581					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)	p.I581I(1)|p.I577I(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						TGATCCGCATCGACTTGGCCG	0.627													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19287	0.0		0.0	False		,,,				2504	0.0					uc001nyl.2																			2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1741-1743)ATC>ATT		fermitin family homolog 3 long form							111.0	84.0	93.0					11																	63990580		2201	4296	6497	SO:0001819	synonymous_variant	83706				integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding	g.chr11:63990580C>T	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1743C>T	11.37:g.63990580C>T			Somatic				FERMT3_uc001nym.2_Silent_p.I577I	p.I581I	NM_178443	NP_848537	Capture	Illumina GAIIx	Phase_I	Q86UX7	URP2_HUMAN			14	1892	+			581					Q8IUA1|Q8N207|Q9BT48	Silent	SNP	ENST00000279227.5	37	c.1743C>T	CCDS8060.1																																																																																				PASS	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471		30	118	---	---	---	---
FOSL1	8061	broad.mit.edu	37	11	65660434	65660434	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:65660434C>T	ENST00000312562.2	-	4	925	c.739G>A	c.(739-741)Gct>Act	p.A247T	FOSL1_ENST00000448083.2_Missense_Mutation_p.A145T|FOSL1_ENST00000531493.1_Missense_Mutation_p.A211T|FOSL1_ENST00000532401.1_3'UTR	NM_005438.3	NP_005429.1	P15407	FOSL1_HUMAN	FOS-like antigen 1	247					cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|chemotaxis (GO:0006935)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)|vitellogenesis (GO:0007296)	cytosol (GO:0005829)|neuron projection (GO:0043005)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A247T(1)		breast(1)|endometrium(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	10				READ - Rectum adenocarcinoma(159;0.168)		TTGCGATGAGCTGAGGCACAA	0.622																																						uc001ogg.1																			1	Substitution - Missense(1)		lung(1)		0						c.(739-741)GCT>ACT		FOS-like antigen 1							51.0	53.0	53.0					11																	65660434		2201	4296	6497	SO:0001583	missense	8061				cellular defense response|chemotaxis|positive regulation of cell proliferation|response to virus|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:65660434C>T	BC016648	CCDS8121.1, CCDS73324.1	11q13	2013-01-10			ENSG00000175592	ENSG00000175592		"""basic leucine zipper proteins"""	13718	protein-coding gene	gene with protein product		136515				2107490	Standard	XM_005274311		Approved	fra-1	uc001ogg.1	P15407	OTTHUMG00000166715	ENST00000312562.2:c.739G>A	11.37:g.65660434C>T	ENSP00000310170:p.Ala247Thr		Somatic				FOSL1_uc010ros.1_Missense_Mutation_p.A145T	p.A247T	NM_005438	NP_005429	Capture	Illumina GAIIx	Phase_I	P15407	FOSL1_HUMAN		READ - Rectum adenocarcinoma(159;0.168)	4	926	-			247					B4DR11|Q6FG51	Missense_Mutation	SNP	ENST00000312562.2	37	c.739G>A	CCDS8121.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234758	0.95207	.	.	ENSG00000175592	ENST00000448083;ENST00000312562;ENST00000531493	D	0.82526	-1.62	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.89856	0.6836	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.90578	0.4527	10	0.59425	D	0.04	-16.4535	15.7373	0.77856	0.0:1.0:0.0:0.0	.	145;247	B4DR11;P15407	.;FOSL1_HUMAN	T	145;247;211	ENSP00000310170:A247T	ENSP00000310170:A247T	A	-	1	0	FOSL1	65417010	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.433000	0.66520	2.287000	0.76781	0.561000	0.74099	GCT		PASS	FOSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391168.2	NM_005438		11	107	---	---	---	---
SUV420H1	51111	broad.mit.edu	37	11	67926107	67926107	+	Missense_Mutation	SNP	G	G	T	rs144521985	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:67926107G>T	ENST00000304363.4	-	11	2059	c.1706C>A	c.(1705-1707)aCg>aAg	p.T569K		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	569					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)	p.T569K(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						GCAAGGTTCCGTCACACTGCT	0.507																																						uc001onm.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(1705-1707)ACG>AAG		suppressor of variegation 4-20 homolog 1 isoform							139.0	131.0	134.0					11																	67926107		2200	4294	6494	SO:0001583	missense	51111				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr11:67926107G>T	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1706C>A	11.37:g.67926107G>T	ENSP00000305899:p.Thr569Lys		Somatic				SUV420H1_uc009yse.1_Missense_Mutation_p.T155K|SUV420H1_uc001onn.1_Missense_Mutation_p.T397K|SUV420H1_uc009ysf.2_Missense_Mutation_p.T329K	p.T569K	NM_017635	NP_060105	Capture	Illumina GAIIx	Phase_I	Q4FZB7	SV421_HUMAN			11	1962	-			569					B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	c.1706C>A	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102523	0.37145	.	.	ENSG00000110066	ENST00000304363	T	0.47177	0.85	5.07	-1.84	0.07809	.	1.137320	0.06137	N	0.671683	T	0.28928	0.0718	N	0.19112	0.55	0.09310	N	1	B	0.28082	0.2	B	0.22753	0.041	T	0.18808	-1.0325	10	0.30854	T	0.27	1.362	7.3298	0.26575	0.4775:0.1139:0.4086:0.0	.	569	Q4FZB7	SV421_HUMAN	K	569	ENSP00000305899:T569K	ENSP00000305899:T569K	T	-	2	0	SUV420H1	67682683	0.007000	0.16637	0.000000	0.03702	0.056000	0.15407	1.182000	0.32029	-0.218000	0.10018	0.491000	0.48974	ACG		PASS	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635		143	141	---	---	---	---
MRPL21	219927	broad.mit.edu	37	11	68664068	68664068	+	Missense_Mutation	SNP	C	C	T	rs148535951	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:68664068C>T	ENST00000362034.2	-	4	320	c.311G>A	c.(310-312)cGc>cAc	p.R104H	MRPL21_ENST00000567045.1_Missense_Mutation_p.R19H|MRPL21_ENST00000450904.2_Missense_Mutation_p.R19H	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21	104					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R104H(2)		large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTTCCACTGGCGGCTGGCAAA	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		19024	0.0		0.002	False		,,,				2504	0.0					uc001ooi.2																			2	Substitution - Missense(2)		lung(1)|prostate(1)		0						c.(310-312)CGC>CAC		mitochondrial ribosomal protein L21 isoform d		C	HIS/ARG,HIS/ARG	2,4398	4.2+/-10.8	0,2,2198	152.0	142.0	146.0		311,56	-0.6	1.0	11	dbSNP_134	146	21,8567	15.3+/-51.7	0,21,4273	yes	missense,missense	MRPL21	NM_181514.1,NM_181515.1	29,29	0,23,6471	TT,TC,CC		0.2445,0.0455,0.1771	benign,benign	104/206,19/121	68664068	23,12965	2200	4294	6494	SO:0001583	missense	219927				translation	mitochondrion|ribosome	RNA binding|structural constituent of ribosome	g.chr11:68664068C>T	AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.311G>A	11.37:g.68664068C>T	ENSP00000354580:p.Arg104His		Somatic				MRPL21_uc001ooh.2_Missense_Mutation_p.R19H|MRPL21_uc010rqe.1_Missense_Mutation_p.R104H	p.R104H	NM_181514	NP_852615	Capture	Illumina GAIIx	Phase_I	Q7Z2W9	RM21_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		4	336	-			104					A6NKU0|C9JPR2	Missense_Mutation	SNP	ENST00000362034.2	37	c.311G>A	CCDS8186.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	7.730	0.699045	0.15106	4.55E-4	0.002445	ENSG00000197345	ENST00000450904;ENST00000362034;ENST00000447977	.	.	.	5.26	-0.626	0.11544	.	0.442829	0.26719	N	0.022841	T	0.24005	0.0581	N	0.10809	0.05	0.34078	D	0.659299	B;B	0.17038	0.02;0.002	B;B	0.16722	0.016;0.003	T	0.13629	-1.0502	9	0.30854	T	0.27	-8.8217	9.4348	0.38632	0.0:0.5039:0.0:0.4961	.	104;104	B4DXI4;Q7Z2W9	.;RM21_HUMAN	H	19;104;104	.	ENSP00000354580:R104H	R	-	2	0	MRPL21	68420644	1.000000	0.71417	0.999000	0.59377	0.230000	0.25150	1.297000	0.33400	0.016000	0.14998	-1.202000	0.01658	CGC		PASS	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396856.1	NM_181512		132	91	---	---	---	---
PPFIA1	8500	broad.mit.edu	37	11	70178186	70178186	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:70178186G>C	ENST00000253925.7	+	9	1413	c.1198G>C	c.(1198-1200)Gca>Cca	p.A400P	PPFIA1_ENST00000389547.3_Missense_Mutation_p.A400P|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	400					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.A400P(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CCAGAGGGTGGCAGCGCTTTC	0.562																																						uc001opo.2																			1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1198-1200)GCA>CCA		PTPRF interacting protein alpha 1 isoform b							108.0	97.0	101.0					11																	70178186		2200	4294	6494	SO:0001583	missense	8500				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	g.chr11:70178186G>C	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.1198G>C	11.37:g.70178186G>C	ENSP00000253925:p.Ala400Pro		Somatic				PPFIA1_uc001opn.1_Missense_Mutation_p.A400P|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	p.A400P	NM_003626	NP_003617	Capture	Illumina GAIIx	Phase_I	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		9	1396	+			400			Potential.		A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	c.1198G>C	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704949	0.88924	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	T;T	0.80033	-1.33;-1.33	5.13	5.13	0.70059	.	0.000000	0.85682	U	0.000000	D	0.90566	0.7043	M	0.85197	2.74	0.80722	D	1	D;D	0.67145	0.992;0.996	D;D	0.68192	0.934;0.956	D	0.91916	0.5543	10	0.66056	D	0.02	.	18.615	0.91299	0.0:0.0:1.0:0.0	.	400;400	Q13136;Q13136-2	LIPA1_HUMAN;.	P	400	ENSP00000253925:A400P;ENSP00000374198:A400P	ENSP00000253925:A400P	A	+	1	0	PPFIA1	69855834	1.000000	0.71417	0.634000	0.29324	0.615000	0.37417	9.638000	0.98445	2.381000	0.81170	0.655000	0.94253	GCA		PASS	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626		122	157	---	---	---	---
PRSS23	11098	broad.mit.edu	37	11	86519229	86519229	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:86519229A>T	ENST00000280258.5	+	2	969	c.544A>T	c.(544-546)Acc>Tcc	p.T182S	PRSS23_ENST00000533902.2_Intron|PRSS23_ENST00000441050.1_Missense_Mutation_p.T150S	NM_007173.4	NP_009104.1	O95084	PRS23_HUMAN	protease, serine, 23	182						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)	p.I177fs*17(1)|p.T182S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CGATGGAAAAACCTATGTGAA	0.542																																						uc001pcb.2																			2	Substitution - Missense(1)|Deletion - Frameshift(1)	p.I177fs*17(1)	lung(1)|pancreas(1)	central_nervous_system(1)|pancreas(1)	2						c.(544-546)ACC>TCC		protease, serine, 23 precursor							48.0	49.0	48.0					11																	86519229		2201	4299	6500	SO:0001583	missense	11098				proteolysis	extracellular region|nucleus	serine-type endopeptidase activity	g.chr11:86519229A>T	AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000280258.5:c.544A>T	11.37:g.86519229A>T	ENSP00000280258:p.Thr182Ser		Somatic				PRSS23_uc001pcc.1_Intron|PRSS23_uc010rts.1_Missense_Mutation_p.T150S	p.T182S	NM_007173	NP_009104	Capture	Illumina GAIIx	Phase_I	O95084	PRS23_HUMAN			2	760	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	182					B2RDJ1|B4E2J3|Q6IBI0	Missense_Mutation	SNP	ENST00000280258.5	37	c.544A>T	CCDS8278.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.116756	0.37339	.	.	ENSG00000150687	ENST00000280258;ENST00000441050	T;T	0.39787	1.06;1.06	6.06	6.06	0.98353	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.155041	0.64402	D	0.000014	T	0.27313	0.0670	N	0.12569	0.235	0.28143	N	0.929716	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.09207	-1.0685	9	.	.	.	-27.6973	16.6154	0.84909	1.0:0.0:0.0:0.0	.	150;182	B4E2J3;O95084	.;PRS23_HUMAN	S	182;150	ENSP00000280258:T182S;ENSP00000393015:T150S	.	T	+	1	0	PRSS23	86196877	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.841000	0.69409	2.315000	0.78130	0.533000	0.62120	ACC		PASS	PRSS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393805.2	NM_007173		23	86	---	---	---	---
NAALAD2	10003	broad.mit.edu	37	11	89896501	89896501	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:89896501C>A	ENST00000534061.1	+	10	1329	c.1099C>A	c.(1099-1101)Cac>Aac	p.H367N	NAALAD2_ENST00000525171.1_Missense_Mutation_p.H274N|NAALAD2_ENST00000321955.4_Missense_Mutation_p.H334N|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	367	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)	p.H367N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TCTGGGAGGTCACCGGGACTC	0.363																																						uc001pdf.3																			1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(1099-1101)CAC>AAC		N-acetylated alpha-linked acidic dipeptidase 2							114.0	124.0	121.0					11																	89896501		2201	4299	6500	SO:0001583	missense	10003				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity	g.chr11:89896501C>A	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1099C>A	11.37:g.89896501C>A	ENSP00000432481:p.His367Asn		Somatic				NAALAD2_uc009yvx.2_Missense_Mutation_p.H334N|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pde.2_Missense_Mutation_p.H274N	p.H367N	NM_005467	NP_005458	Capture	Illumina GAIIx	Phase_I	Q9Y3Q0	NALD2_HUMAN			10	1208	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	367			Extracellular (Potential).|NAALADase.	Zinc 2; catalytic.	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	c.1099C>A	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659968	0.67586	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171	D;D;D	0.92911	-3.13;-3.13;-3.13	5.51	5.51	0.81932	Peptidase M28 (1);	0.000000	0.85682	D	0.000000	D	0.97782	0.9272	H	0.97758	4.07	0.80722	D	1	D;D	0.89917	1.0;0.978	D;P	0.97110	1.0;0.871	D	0.98740	1.0716	9	.	.	.	-16.5165	19.3895	0.94574	0.0:1.0:0.0:0.0	.	367;274	Q9Y3Q0;E9PKX5	NALD2_HUMAN;.	N	367;334;274	ENSP00000432481:H367N;ENSP00000320083:H334N;ENSP00000435249:H274N	.	H	+	1	0	NAALAD2	89536149	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.000000	0.76290	2.746000	0.94184	0.591000	0.81541	CAC		PASS	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467		93	287	---	---	---	---
MMP8	4317	broad.mit.edu	37	11	102595586	102595586	+	Start_Codon_SNP	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:102595586T>G	ENST00000236826.3	-	1	99	c.1A>C	c.(1-3)Atg>Ctg	p.M1L		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	1					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.M1L(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	AGGGAGAACATGATCTTCTCT	0.473																																						uc001phe.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1-3)ATG>CTG		matrix metalloproteinase 8 preproprotein							141.0	146.0	145.0					11																	102595586		2203	4299	6502	SO:0001582	initiator_codon_variant	4317				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding	g.chr11:102595586T>G	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.1A>C	11.37:g.102595586T>G	ENSP00000236826:p.Met1Leu		Somatic				MMP8_uc010rut.1_5'Flank|MMP8_uc010ruu.1_5'UTR	p.M1L	NM_002424	NP_002415	Capture	Illumina GAIIx	Phase_I	P22894	MMP8_HUMAN	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	1	100	-	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	1					Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	c.1A>C	CCDS8320.1	.	.	.	.	.	.	.	.	.	.	T	11.29	1.593721	0.28445	.	.	ENSG00000118113	ENST00000236826	T	0.11495	2.77	4.73	4.73	0.59995	.	2.490530	0.02283	N	0.069528	T	0.13970	0.0338	.	.	.	0.80722	D	1	B	0.21905	0.062	B	0.16289	0.015	T	0.16041	-1.0416	9	0.87932	D	0	.	11.9856	0.53145	0.0:0.0:0.0:1.0	.	1	P22894	MMP8_HUMAN	L	1	ENSP00000236826:M1L	ENSP00000236826:M1L	M	-	1	0	MMP8	102100796	0.969000	0.33509	0.222000	0.23844	0.074000	0.17049	2.366000	0.44204	2.102000	0.63906	0.533000	0.62120	ATG		PASS	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	Missense_Mutation	10	262	---	---	---	---
GUCY1A2	2977	broad.mit.edu	37	11	106810256	106810256	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:106810256A>G	ENST00000526355.2	-	4	1604	c.1136T>C	c.(1135-1137)cTg>cCg	p.L379P	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.L379P|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.L379P	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	379					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)	p.L379P(1)		breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CAGTCGCAGCAGGACCCTTTC	0.468																																						uc001pjg.1																			1	Substitution - Missense(1)		lung(1)	large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8						c.(1135-1137)CTG>CCG		guanylate cyclase 1, soluble, alpha 2							91.0	92.0	92.0					11																	106810256		2201	4298	6499	SO:0001583	missense	2977				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding	g.chr11:106810256A>G	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1136T>C	11.37:g.106810256A>G	ENSP00000431245:p.Leu379Pro		Somatic				GUCY1A2_uc010rvo.1_Missense_Mutation_p.L379P|GUCY1A2_uc009yxn.1_Missense_Mutation_p.L379P	p.L379P	NM_000855	NP_000846	Capture	Illumina GAIIx	Phase_I	P33402	GCYA2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	4	1526	-		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)	379					A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	c.1136T>C	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	A	19.71	3.877890	0.72294	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.90069	-2.61;-2.61;-2.61	5.77	5.77	0.91146	Haem NO binding associated (1);	0.000000	0.35903	U	0.002916	D	0.95010	0.8385	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	D	0.95486	0.8565	10	0.62326	D	0.03	.	15.2545	0.73573	1.0:0.0:0.0:0.0	.	379;379;379	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	P	379	ENSP00000431245:L379P;ENSP00000282249:L379P;ENSP00000344874:L379P	ENSP00000282249:L379P	L	-	2	0	GUCY1A2	106315466	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	9.339000	0.96797	2.200000	0.70718	0.482000	0.46254	CTG		PASS	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			9	234	---	---	---	---
HTR3A	3359	broad.mit.edu	37	11	113848605	113848605	+	Silent	SNP	C	C	A	rs369239075		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:113848605C>A	ENST00000504030.2	+	2	625	c.180C>A	c.(178-180)acC>acA	p.T60T	HTR3A_ENST00000299961.5_Silent_p.T45T|HTR3A_ENST00000375498.2_Silent_p.T66T|HTR3A_ENST00000506841.2_Silent_p.T60T|HTR3A_ENST00000535865.1_5'UTR|HTR3A_ENST00000355556.2_Silent_p.T66T			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	60					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)	p.T60T(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	AGCCAACCACCGTATCCATTG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		19778	0.0		0.0	False		,,,				2504	0.001					uc010rxb.1																			1	Substitution - coding silent(1)		lung(1)		0						c.(196-198)ACC>ACA		5-hydroxytryptamine (serotonin) receptor 3A	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)						135.0	102.0	114.0					11																	113848605		2201	4296	6497	SO:0001819	synonymous_variant	3359				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity	g.chr11:113848605C>A	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.180C>A	11.37:g.113848605C>A			Somatic				HTR3A_uc010rxa.1_Silent_p.T66T|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.T45T	p.T66T	NM_213621	NP_998786	Capture	Illumina GAIIx	Phase_I	P46098	5HT3A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	2	431	+		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)	60			Extracellular (Potential).		B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Silent	SNP	ENST00000504030.2	37	c.198C>A																																																																																					PASS	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869		28	102	---	---	---	---
SIK3	23387	broad.mit.edu	37	11	116734532	116734532	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:116734532G>C	ENST00000292055.4	-	15	1672	c.1637C>G	c.(1636-1638)tCt>tGt	p.S546C	SIK3_ENST00000542607.1_Missense_Mutation_p.S546C|SIK3_ENST00000434315.2_Missense_Mutation_p.S445C|SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375300.1_Missense_Mutation_p.S604C|SIK3_ENST00000446921.2_Missense_Mutation_p.S604C|SIK3_ENST00000375288.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	546					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.S652C(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						CTTGTAGGTAGAGCTGAATAT	0.542																																						uc001ppy.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						c.(1636-1638)TCT>TGT		serine/threonine-protein kinase QSK							99.0	100.0	100.0					11																	116734532		2201	4296	6497	SO:0001583	missense	23387					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:116734532G>C	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1637C>G	11.37:g.116734532G>C	ENSP00000292055:p.Ser546Cys		Somatic				SIK3_uc001ppz.2_Missense_Mutation_p.S445C|SIK3_uc001pqa.2_Missense_Mutation_p.S546C|SIK3_uc001ppw.2_5'UTR|SIK3_uc001ppx.2_Missense_Mutation_p.L21V|SIK3_uc001pqb.2_5'Flank	p.S546C	NM_025164	NP_079440	Capture	Illumina GAIIx	Phase_I	Q9Y2K2	SIK3_HUMAN			15	1673	-			546					A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	c.1637C>G	CCDS8379.1	.	.	.	.	.	.	.	.	.	.	g	21.1	4.095384	0.76870	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	T;T;T;T	0.74002	-0.76;-0.8;-0.74;-0.37	5.53	5.53	0.82687	Protein kinase-like domain (1);	0.000000	0.41294	U	0.000914	T	0.81621	0.4861	L	0.44542	1.39	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;P	0.80764	0.935;0.994;0.844	T	0.82864	-0.0246	10	0.72032	D	0.01	.	15.1076	0.72332	0.0:0.0:0.8578:0.1422	.	546;445;546	A1A5A8;A1A5A9;Q9Y2K2	.;.;SIK3_HUMAN	C	604;546;546;445	ENSP00000364449:S604C;ENSP00000292055:S546C;ENSP00000438108:S546C;ENSP00000415873:S445C	ENSP00000292055:S546C	S	-	2	0	SIK3	116239742	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.546000	0.82137	2.592000	0.87571	0.561000	0.74099	TCT		PASS	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164		55	205	---	---	---	---
UBASH3B	84959	broad.mit.edu	37	11	122650303	122650303	+	Nonsense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:122650303T>A	ENST00000284273.5	+	4	876	c.501T>A	c.(499-501)taT>taA	p.Y167*		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	167					negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.Y167*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TGGAGCTCTATACGTCGTCCA	0.572																																						uc001pyi.3																			1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(499-501)TAT>TAA		ubiquitin associated and SH3 domain containing,							99.0	94.0	96.0					11																	122650303		2202	4299	6501	SO:0001587	stop_gained	84959					cytoplasm|nucleus	protein tyrosine phosphatase activity	g.chr11:122650303T>A	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.501T>A	11.37:g.122650303T>A	ENSP00000284273:p.Tyr167*		Somatic					p.Y167*	NM_032873	NP_116262	Capture	Illumina GAIIx	Phase_I	Q8TF42	UBS3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)	4	861	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)	167					Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Nonsense_Mutation	SNP	ENST00000284273.5	37	c.501T>A	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	T	37	6.165513	0.97338	.	.	ENSG00000154127	ENST00000284273	.	.	.	5.17	-9.44	0.00603	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9206	23.0531	0.99979	0.0:0.8026:0.0:0.1974	.	.	.	.	X	167	.	ENSP00000284273:Y167X	Y	+	3	2	UBASH3B	122155513	0.509000	0.26163	0.649000	0.29536	0.947000	0.59692	-0.139000	0.10358	-2.062000	0.00891	-1.017000	0.02453	TAT		PASS	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873		40	135	---	---	---	---
OR6T1	219874	broad.mit.edu	37	11	123814150	123814150	+	Silent	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:123814150A>G	ENST00000321252.2	-	1	430	c.396T>C	c.(394-396)taT>taC	p.Y132Y		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y132Y(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCAGGGTCTCATAGCGGAGTG	0.557																																						uc010sab.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(394-396)TAT>TAC		olfactory receptor, family 6, subfamily T,							73.0	65.0	68.0					11																	123814150		2202	4299	6501	SO:0001819	synonymous_variant	219874				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123814150A>G	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.396T>C	11.37:g.123814150A>G			Somatic					p.Y132Y	NM_001005187	NP_001005187	Capture	Illumina GAIIx	Phase_I	Q8NGN1	OR6T1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	396	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	132			Cytoplasmic (Potential).		Q6IFE7	Silent	SNP	ENST00000321252.2	37	c.396T>C	CCDS31700.1																																																																																				PASS	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187		15	59	---	---	---	---
OR10G4	390264	broad.mit.edu	37	11	123886690	123886690	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:123886690G>T	ENST00000320891.4	+	1	409	c.409G>T	c.(409-411)Ggg>Tgg	p.G137W		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G137W(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CATGATGAGTGGGAGCAGGTG	0.562																																						uc010sac.1																			1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(409-411)GGG>TGG		olfactory receptor, family 10, subfamily G,							216.0	201.0	206.0					11																	123886690		2202	4299	6501	SO:0001583	missense	390264				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123886690G>T	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.409G>T	11.37:g.123886690G>T	ENSP00000325076:p.Gly137Trp		Somatic					p.G137W	NM_001004462	NP_001004462	Capture	Illumina GAIIx	Phase_I	Q8NGN3	O10G4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	409	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	137			Cytoplasmic (Potential).		Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	c.409G>T	CCDS31702.1	.	.	.	.	.	.	.	.	.	.	g	3.659	-0.069825	0.07228	.	.	ENSG00000254737	ENST00000320891	T	0.37915	1.17	3.01	3.01	0.34805	GPCR, rhodopsin-like superfamily (1);	0.295501	0.24056	N	0.041956	T	0.32912	0.0845	N	0.05259	-0.085	0.09310	N	1	D	0.71674	0.998	D	0.75484	0.986	T	0.04811	-1.0925	10	0.51188	T	0.08	.	7.8577	0.29491	0.1253:0.0:0.8747:0.0	.	137	Q8NGN3	O10G4_HUMAN	W	137	ENSP00000325076:G137W	ENSP00000325076:G137W	G	+	1	0	OR10G4	123391900	0.000000	0.05858	0.578000	0.28575	0.046000	0.14306	-0.259000	0.08721	1.698000	0.51180	0.580000	0.79431	GGG		PASS	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		212	281	---	---	---	---
OR10G9	219870	broad.mit.edu	37	11	123893724	123893724	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:123893724C>T	ENST00000375024.1	+	1	5	c.5C>T	c.(4-6)tCc>tTc	p.S2F		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S2F(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GAAGAAATGTCCAAGACCAGC	0.512																																						uc010sad.1																			1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(4-6)TCC>TTC		olfactory receptor, family 10, subfamily G,							133.0	125.0	128.0					11																	123893724		2201	4299	6500	SO:0001583	missense	219870				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123893724C>T	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.5C>T	11.37:g.123893724C>T	ENSP00000364164:p.Ser2Phe		Somatic					p.S2F	NM_001001953	NP_001001953	Capture	Illumina GAIIx	Phase_I	Q8NGN4	O10G9_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	5	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	2			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000375024.1	37	c.5C>T	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	C	9.694	1.152734	0.21371	.	.	ENSG00000236981	ENST00000375024	T	0.05258	3.47	3.31	-1.07	0.09968	.	2.517140	0.02033	N	0.048712	T	0.06962	0.0177	L	0.42529	1.33	0.09310	N	1	B	0.30236	0.274	B	0.28638	0.092	T	0.36504	-0.9745	10	0.66056	D	0.02	.	3.9719	0.09457	0.0:0.3597:0.3929:0.2474	.	2	Q8NGN4	O10G9_HUMAN	F	2	ENSP00000364164:S2F	ENSP00000364164:S2F	S	+	2	0	OR10G9	123398934	0.000000	0.05858	0.001000	0.08648	0.056000	0.15407	-1.835000	0.01692	-0.076000	0.12775	0.655000	0.94253	TCC		PASS	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953		7	237	---	---	---	---
ESAM	90952	broad.mit.edu	37	11	124623856	124623856	+	Splice_Site	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:124623856C>A	ENST00000278927.5	-	7	988	c.859G>T	c.(859-861)Gag>Tag	p.E287*	VSIG2_ENST00000326621.5_5'Flank|VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	287					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E287*(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		ATGGCATCCTCCCTAGTCATC	0.552																																						uc001qav.3																			1	Substitution - Nonsense(1)		lung(1)		0						c.(859-861)GAG>TAG		endothelial cell adhesion molecule precursor							40.0	48.0	45.0					11																	124623856		2201	4299	6500	SO:0001630	splice_region_variant	90952				blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction		g.chr11:124623856C>A	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.858-1G>T	11.37:g.124623856C>A			Somatic				VSIG2_uc001qas.2_5'Flank|VSIG2_uc001qat.2_5'Flank|ESAM_uc010sao.1_Intron|ESAM_uc001qau.3_Nonsense_Mutation_p.E214*|ESAM_uc001qaw.3_RNA|ESAM_uc001qax.3_RNA|ESAM_uc009zbi.2_Intron	p.E287*	NM_138961	NP_620411	Capture	Illumina GAIIx	Phase_I	Q96AP7	ESAM_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)	7	1032	-	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	287			Cytoplasmic (Potential).		B4DVN8|Q96T50	Nonsense_Mutation	SNP	ENST00000278927.5	37	c.859G>T	CCDS8453.1	.	.	.	.	.	.	.	.	.	.	C	36	5.700985	0.96812	.	.	ENSG00000149564	ENST00000278927	.	.	.	4.49	4.49	0.54785	.	0.059008	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	14.543	0.68008	0.0:1.0:0.0:0.0	.	.	.	.	X	287	.	ENSP00000278927:E287X	E	-	1	0	ESAM	124129066	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.892000	0.63193	2.462000	0.83206	0.655000	0.94253	GAG		PASS	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	Nonsense_Mutation	14	35	---	---	---	---
ROBO4	54538	broad.mit.edu	37	11	124765379	124765379	+	Missense_Mutation	SNP	A	A	T	rs566542242		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:124765379A>T	ENST00000306534.3	-	6	1495	c.1010T>A	c.(1009-1011)gTg>gAg	p.V337E	ROBO4_ENST00000526899.1_5'Flank|ROBO4_ENST00000533054.1_Missense_Mutation_p.V192E	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	337	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V337E(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CAGGAGCAGCACGTTGCTGTC	0.602																																						uc001qbg.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1009-1011)GTG>GAG		roundabout homolog 4, magic roundabout							49.0	55.0	53.0					11																	124765379		2197	4288	6485	SO:0001583	missense	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124765379A>T	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1010T>A	11.37:g.124765379A>T	ENSP00000304945:p.Val337Glu		Somatic				ROBO4_uc010sas.1_Missense_Mutation_p.V192E|ROBO4_uc001qbh.2_Missense_Mutation_p.V227E|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	p.V337E	NM_019055	NP_061928	Capture	Illumina GAIIx	Phase_I	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	6	1150	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	337			Fibronectin type-III 1.		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	c.1010T>A	CCDS8455.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.941960	0.73557	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.54279	0.58;0.58	4.72	4.72	0.59763	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.35495	N	0.003176	T	0.65831	0.2729	M	0.64997	1.995	0.35649	D	0.811636	D;D	0.76494	0.999;0.998	D;P	0.71656	0.974;0.878	T	0.74497	-0.3646	10	0.56958	D	0.05	.	9.7513	0.40477	0.8269:0.1731:0.0:0.0	.	227;337	Q8WZ75-3;Q8WZ75	.;ROBO4_HUMAN	E	337;227;192	ENSP00000304945:V337E;ENSP00000437129:V192E	ENSP00000304945:V337E	V	-	2	0	ROBO4	124270589	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	2.574000	0.46016	1.991000	0.58162	0.459000	0.35465	GTG		PASS	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		30	106	---	---	---	---
SNX19	399979	broad.mit.edu	37	11	130784449	130784449	+	Silent	SNP	G	G	A	rs146738120		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr11:130784449G>A	ENST00000265909.4	-	1	1955	c.1386C>T	c.(1384-1386)acC>acT	p.T462T	SNX19_ENST00000530356.1_Intron|SNX19_ENST00000533214.1_Silent_p.T462T|SNX19_ENST00000539184.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000533318.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	462					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.T462T(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TAACAGAGGCGGTAACATCTC	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20485	0.0		0.0	False		,,,				2504	0.0					uc001qgk.3																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(2)	4						c.(1384-1386)ACC>ACT		sorting nexin 19		G		0,4402		0,0,2201	108.0	105.0	106.0		1386	-2.8	0.0	11	dbSNP_134	106	7,8587	5.7+/-21.5	0,7,4290	no	coding-synonymous	SNX19	NM_014758.2		0,7,6491	AA,AG,GG		0.0815,0.0,0.0539		462/993	130784449	7,12989	2201	4297	6498	SO:0001819	synonymous_variant	399979				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding	g.chr11:130784449G>A	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.1386C>T	11.37:g.130784449G>A			Somatic				SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_Intron|SNX19_uc010scg.1_Intron|SNX19_uc001qgl.3_Silent_p.T462T|SNX19_uc009zcx.1_Intron	p.T462T	NM_014758	NP_055573	Capture	Illumina GAIIx	Phase_I	Q92543	SNX19_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)	1	1934	-	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)	462					E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	37	c.1386C>T	CCDS31721.1																																																																																				PASS	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758		43	114	---	---	---	---
C12orf4	57102	broad.mit.edu	37	12	4627411	4627411	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:4627411C>A	ENST00000261250.3	-	8	933	c.846G>T	c.(844-846)ttG>ttT	p.L282F	C12orf4_ENST00000545746.1_Missense_Mutation_p.L282F	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	282								p.L282F(1)		NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		GCATGGTCTTCAACTGGGCTC	0.428																																						uc001qms.2																			1	Substitution - Missense(1)		lung(1)		0						c.(844-846)TTG>TTT		hypothetical protein LOC57102							108.0	111.0	110.0					12																	4627411		2203	4300	6503	SO:0001583	missense	57102							g.chr12:4627411C>A	AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.846G>T	12.37:g.4627411C>A	ENSP00000261250:p.Leu282Phe		Somatic				C12orf4_uc001qmt.2_Missense_Mutation_p.L282F	p.L282F	NM_020374	NP_065107	Capture	Illumina GAIIx	Phase_I	Q9NQ89	CL004_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)	8	934	-			282					D3DUQ8|Q6MZH5	Missense_Mutation	SNP	ENST00000261250.3	37	c.846G>T	CCDS8528.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870110	0.91587	.	.	ENSG00000047621	ENST00000261250;ENST00000545746;ENST00000541014	.	.	.	5.22	2.4	0.29515	.	0.000000	0.85682	D	0.000000	T	0.76047	0.3933	M	0.82716	2.605	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.74497	-0.3646	9	0.72032	D	0.01	.	8.8291	0.35074	0.1094:0.6967:0.0:0.194	.	282	Q9NQ89	CL004_HUMAN	F	282;282;109	.	ENSP00000261250:L282F	L	-	3	2	C12orf4	4497672	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	1.640000	0.37186	0.051000	0.15978	-1.128000	0.01989	TTG		PASS	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398992.1	NM_020374		139	138	---	---	---	---
VWF	7450	broad.mit.edu	37	12	6131144	6131144	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:6131144C>T	ENST00000261405.5	-	27	3850	c.3596G>A	c.(3595-3597)tGt>tAt	p.C1199Y		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1199					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.C1199Y(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AGCCACCTCACACACTGGACA	0.502																																						uc001qnn.1																			1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(3595-3597)TGT>TAT		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						141.0	148.0	146.0					12																	6131144		2203	4300	6503	SO:0001583	missense	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6131144C>T		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3596G>A	12.37:g.6131144C>T	ENSP00000261405:p.Cys1199Tyr		Somatic				VWF_uc010set.1_Intron	p.C1199Y	NM_000552	NP_000543	Capture	Illumina GAIIx	Phase_I	P04275	VWF_HUMAN			27	3846	-			1199					Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	c.3596G>A	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	15.52	2.858823	0.51376	.	.	ENSG00000110799	ENST00000261405	T	0.36878	1.23	4.74	4.74	0.60224	.	0.000000	0.44097	D	0.000493	T	0.64843	0.2635	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69187	-0.5211	10	0.52906	T	0.07	.	17.2455	0.87027	0.0:1.0:0.0:0.0	.	1199	P04275	VWF_HUMAN	Y	1199	ENSP00000261405:C1199Y	ENSP00000261405:C1199Y	C	-	2	0	VWF	6001405	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	7.006000	0.76329	2.624000	0.88883	0.484000	0.47621	TGT		PASS	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		88	326	---	---	---	---
SLCO1B1	10599	broad.mit.edu	37	12	21391925	21391925	+	Missense_Mutation	SNP	G	G	C	rs200526972		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:21391925G>C	ENST00000256958.2	+	15	1974	c.1878G>C	c.(1876-1878)ttG>ttC	p.L626F		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	626					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.L626F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	GGGTCTACTTGGGCTTGTCTT	0.284																																						uc001req.3																			1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1876-1878)TTG>TTC		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						45.0	50.0	48.0					12																	21391925		2175	4285	6460	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21391925G>C		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1878G>C	12.37:g.21391925G>C	ENSP00000256958:p.Leu626Phe		Somatic					p.L626F	NM_006446	NP_006437	Capture	Illumina GAIIx	Phase_I	Q9Y6L6	SO1B1_HUMAN			15	1982	+			626			Extracellular (Potential).		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.1878G>C	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	G	1.661	-0.511405	0.04231	.	.	ENSG00000134538	ENST00000256958	T	0.61158	0.13	3.17	0.0353	0.14187	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.557624	0.16541	N	0.209937	T	0.34774	0.0909	N	0.16478	0.41	0.09310	N	1	B	0.16396	0.017	B	0.23852	0.049	T	0.15867	-1.0422	10	0.33141	T	0.24	.	5.0231	0.14370	0.0:0.2317:0.3561:0.4122	.	626	Q9Y6L6	SO1B1_HUMAN	F	626	ENSP00000256958:L626F	ENSP00000256958:L626F	L	+	3	2	SLCO1B1	21283192	0.000000	0.05858	0.002000	0.10522	0.052000	0.14988	-0.786000	0.04623	-0.006000	0.14370	0.313000	0.20887	TTG		PASS	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		33	52	---	---	---	---
KCNJ8	3764	broad.mit.edu	37	12	21919054	21919054	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:21919054A>G	ENST00000240662.2	-	3	1223	c.878T>C	c.(877-879)aTa>aCa	p.I293T	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	293					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)	p.I293T(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	CAGAATAACTATGACCTCCAA	0.517																																						uc001rff.2																			1	Substitution - Missense(1)		lung(1)		0						c.(877-879)ATA>ACA		potassium inwardly-rectifying channel J8	Levosimendan(DB00922)						87.0	71.0	76.0					12																	21919054		2203	4300	6503	SO:0001583	missense	3764					voltage-gated potassium channel complex		g.chr12:21919054A>G	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.878T>C	12.37:g.21919054A>G	ENSP00000240662:p.Ile293Thr		Somatic					p.I293T	NM_004982	NP_004973	Capture	Illumina GAIIx	Phase_I	Q15842	IRK8_HUMAN			3	1216	-			293			Cytoplasmic (By similarity).		O00657	Missense_Mutation	SNP	ENST00000240662.2	37	c.878T>C	CCDS8692.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055146	0.75960	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.95035	-3.59	5.35	5.35	0.76521	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97359	0.9136	M	0.89601	3.045	0.80722	D	1	D	0.56287	0.975	P	0.61275	0.886	D	0.98206	1.0470	10	0.87932	D	0	.	15.5045	0.75728	1.0:0.0:0.0:0.0	.	293	Q15842	IRK8_HUMAN	T	293	ENSP00000240662:I293T	ENSP00000240662:I293T	I	-	2	0	KCNJ8	21810321	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	9.123000	0.94387	2.244000	0.73946	0.460000	0.39030	ATA		PASS	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982		79	79	---	---	---	---
OVOS2	144203	broad.mit.edu	37	12	31298407	31298407	+	IGR	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:31298407G>A								RP11-551L14.1 (28002 upstream) : FAM60A (135110 downstream)														p.H526H(1)									CCCCACTGGGGTGAAGGGTGT	0.498																																						uc010sjy.1																			1	Substitution - coding silent(1)		lung(1)								c.(1576-1578)CAC>CAT		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							69.0	69.0	69.0					12																	31298407		1952	4171	6123	SO:0001628	intergenic_variant	0							g.chr12:31298407G>A																													12.37:g.31298407G>A			Somatic					p.H526H			Capture	Illumina GAIIx	Phase_I					12	1578	-									Silent	SNP		37	c.1578C>T																																																																																				0	PASS									18	31	---	---	---	---
KMT2D	8085	broad.mit.edu	37	12	49420841	49420841	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:49420841C>A	ENST00000301067.7	-	48	14907	c.14908G>T	c.(14908-14910)Gaa>Taa	p.E4970*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4970	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E4970*(1)|p.E4700*(1)									TCTTCACCTTCTTCAGGGGGC	0.647																																						uc001rta.3										N|F|Mis							medulloblastoma|renal		2	Substitution - Nonsense(2)		lung(2)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(14908-14910)GAA>TAA		myeloid/lymphoid or mixed-lineage leukemia 2							62.0	69.0	67.0					12																	49420841		1930	4136	6066	SO:0001587	stop_gained	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49420841C>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14908G>T	12.37:g.49420841C>A	ENSP00000301067:p.Glu4970*	HNSCC(34;0.089)	Somatic					p.E4970*	NM_003482	NP_003473	Capture	Illumina GAIIx	Phase_I	O14686	MLL2_HUMAN			48	14908	-			4970			Pro-rich.		O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	c.14908G>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	55	24.155685	0.99959	.	.	ENSG00000167548	ENST00000301067	.	.	.	3.89	3.89	0.44902	.	0.000000	0.35677	N	0.003048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.1821	0.72968	0.0:1.0:0.0:0.0	.	.	.	.	X	4970	.	ENSP00000301067:E4970X	E	-	1	0	MLL2	47707108	0.174000	0.23070	0.993000	0.49108	0.986000	0.74619	4.153000	0.58118	2.181000	0.69327	0.563000	0.77884	GAA		PASS	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			75	77	---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	51079640	51079640	+	Missense_Mutation	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:51079640T>G	ENST00000301180.5	+	11	1376	c.1342T>G	c.(1342-1344)Ttc>Gtc	p.F448V		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	448						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.F448V(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GCAGATTGGCTTCTTGCTAGG	0.438																																						uc001rwv.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(1)|pancreas(1)	6						c.(1342-1344)TTC>GTC		DIP2 disco-interacting protein 2 homolog B							181.0	137.0	152.0					12																	51079640		2203	4300	6503	SO:0001583	missense	57609					nucleus	catalytic activity|transcription factor binding	g.chr12:51079640T>G	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.1342T>G	12.37:g.51079640T>G	ENSP00000301180:p.Phe448Val		Somatic				DIP2B_uc009zlt.2_5'UTR	p.F448V	NM_173602	NP_775873	Capture	Illumina GAIIx	Phase_I	Q9P265	DIP2B_HUMAN			11	1498	+			448					Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	c.1342T>G	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.874780	0.91664	.	.	ENSG00000066084	ENST00000301180	T	0.42513	0.97	5.42	5.42	0.78866	AMP-dependent synthetase/ligase (1);	0.043476	0.85682	D	0.000000	T	0.48607	0.1509	M	0.84326	2.69	0.80722	D	1	B	0.32382	0.368	B	0.33121	0.158	T	0.48906	-0.8993	10	0.27082	T	0.32	-14.7099	15.6465	0.77061	0.0:0.0:0.0:1.0	.	448	Q9P265	DIP2B_HUMAN	V	448	ENSP00000301180:F448V	ENSP00000301180:F448V	F	+	1	0	DIP2B	49365907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.794000	0.85869	2.282000	0.76494	0.533000	0.62120	TTC		PASS	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		19	61	---	---	---	---
KRT83	3889	broad.mit.edu	37	12	52715021	52715021	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:52715021G>T	ENST00000293670.3	-	1	161	c.99C>A	c.(97-99)acC>acA	p.T33T		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	33	Head.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.T33T(1)		NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGGGGCGGCGGTGATGCAGC	0.692																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	uc001saf.2																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(97-99)ACC>ACA		keratin 83							28.0	35.0	33.0					12																	52715021		2183	4263	6446	SO:0001819	synonymous_variant	3889				epidermis development	keratin filament	structural molecule activity	g.chr12:52715021G>T	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.99C>A	12.37:g.52715021G>T			Somatic					p.T33T	NM_002282	NP_002273	Capture	Illumina GAIIx	Phase_I	P78385	KRT83_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	1	162	-	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)		33			Head.		A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	ENST00000293670.3	37	c.99C>A	CCDS8823.1																																																																																				PASS	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282		6	27	---	---	---	---
TPH2	121278	broad.mit.edu	37	12	72388230	72388230	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:72388230A>G	ENST00000333850.3	+	8	1094	c.953A>G	c.(952-954)cAt>cGt	p.H318R		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	318					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.H318R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GACACATGCCATGAACTCTTG	0.393																																						uc009zrw.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(952-954)CAT>CGT		tryptophan hydroxylase 2	L-Tryptophan(DB00150)						153.0	149.0	150.0					12																	72388230		2203	4300	6503	SO:0001583	missense	121278				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr12:72388230A>G	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.953A>G	12.37:g.72388230A>G	ENSP00000329093:p.His318Arg		Somatic				TPH2_uc001swy.2_Missense_Mutation_p.H228R	p.H318R	NM_173353	NP_775489	Capture	Illumina GAIIx	Phase_I	Q8IWU9	TPH2_HUMAN			8	1094	+			318				Iron (By similarity).	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	c.953A>G	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.459222	0.84317	.	.	ENSG00000139287	ENST00000333850	D	0.99956	-8.92	5.91	5.91	0.95273	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99967	0.9988	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96576	0.9427	10	0.87932	D	0	-12.4695	16.3483	0.83171	1.0:0.0:0.0:0.0	.	318	Q8IWU9	TPH2_HUMAN	R	318	ENSP00000329093:H318R	ENSP00000329093:H318R	H	+	2	0	TPH2	70674497	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.339000	0.96797	2.254000	0.74563	0.533000	0.62120	CAT		PASS	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353		86	222	---	---	---	---
NTS	4922	broad.mit.edu	37	12	86272219	86272219	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:86272219G>A	ENST00000256010.6	+	3	339	c.232G>A	c.(232-234)Gtt>Att	p.V78I	NTS_ENST00000551529.1_Intron	NM_006183.4	NP_006174.1	P30990	NEUT_HUMAN	neurotensin	78					regulation of blood vessel size (GO:0050880)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)		p.V78I(1)		large_intestine(2)|lung(6)	8						AACAGGAGAAGTTCATGAAGA	0.408																																						uc001tag.2																			1	Substitution - Missense(1)		lung(1)		0						c.(232-234)GTT>ATT		neurotensin/neuromedin N preproprotein							104.0	106.0	105.0					12																	86272219		2203	4300	6503	SO:0001583	missense	4922				regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity	g.chr12:86272219G>A		CCDS9029.1	12q21.31	2013-02-26			ENSG00000133636	ENSG00000133636		"""Endogenous ligands"""	8038	protein-coding gene	gene with protein product	"""neuromedin N"", ""pro-neurotensin/neuromedin"""	162650					Standard	NM_006183		Approved		uc001tag.3	P30990	OTTHUMG00000169832	ENST00000256010.6:c.232G>A	12.37:g.86272219G>A	ENSP00000256010:p.Val78Ile		Somatic					p.V78I	NM_006183	NP_006174	Capture	Illumina GAIIx	Phase_I	P30990	NEUT_HUMAN			3	339	+			78						Missense_Mutation	SNP	ENST00000256010.6	37	c.232G>A	CCDS9029.1	.	.	.	.	.	.	.	.	.	.	G	3.090	-0.187112	0.06299	.	.	ENSG00000133636	ENST00000256010;ENST00000550879	.	.	.	5.22	-2.77	0.05877	.	1.192680	0.05870	N	0.624445	T	0.17746	0.0426	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.18618	-1.0331	9	0.33940	T	0.23	-0.0046	2.3712	0.04331	0.5072:0.1027:0.2472:0.143	.	78	P30990	NEUT_HUMAN	I	78;23	.	ENSP00000256010:V78I	V	+	1	0	NTS	84796350	0.003000	0.15002	0.048000	0.18961	0.345000	0.29048	-0.082000	0.11304	-0.354000	0.08212	0.563000	0.77884	GTT		PASS	NTS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406111.2			92	214	---	---	---	---
SLC25A3	5250	broad.mit.edu	37	12	98987856	98987856	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:98987856C>G	ENST00000228318.3	+	2	220	c.100C>G	c.(100-102)Cca>Gca	p.P34A	SLC25A3_ENST00000188376.5_Missense_Mutation_p.P34A|SLC25A3_ENST00000547534.1_Missense_Mutation_p.P34A|SLC25A3_ENST00000548847.1_Missense_Mutation_p.P34A|SLC25A3_ENST00000551265.1_Missense_Mutation_p.P34A|SLC25A3_ENST00000401722.3_Missense_Mutation_p.P34A|SLC25A3_ENST00000551917.1_Missense_Mutation_p.P34A|SLC25A3_ENST00000552981.1_Missense_Mutation_p.P34A|SLC25A3_ENST00000549338.1_Missense_Mutation_p.P34A	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	34					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)	p.P34A(3)		breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		CAGCAGCTCCCCAGGGCCCAC	0.677																																						uc001tfo.2																			3	Substitution - Missense(3)		lung(3)		0						c.(100-102)CCA>GCA		solute carrier family 25 member 3 isoform a							18.0	18.0	18.0					12																	98987856		2203	4298	6501	SO:0001583	missense	5250				generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity	g.chr12:98987856C>G		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.100C>G	12.37:g.98987856C>G	ENSP00000228318:p.Pro34Ala		Somatic				SLC25A3_uc001tfm.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfn.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfp.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfq.2_5'UTR|SLC25A3_uc001tfr.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfs.2_5'UTR|SLC25A3_uc009ztn.2_Missense_Mutation_p.P34A|SLC25A3_uc001tft.2_Missense_Mutation_p.P34A	p.P34A	NM_005888	NP_005879	Capture	Illumina GAIIx	Phase_I	Q00325	MPCP_HUMAN		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)	2	220	+		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)	34					B3KS34|Q7Z7N7|Q96A03	Missense_Mutation	SNP	ENST00000228318.3	37	c.100C>G	CCDS9066.1	.	.	.	.	.	.	.	.	.	.	C	0.798	-0.756554	0.03019	.	.	ENSG00000075415	ENST00000401722;ENST00000188376;ENST00000228318;ENST00000551917;ENST00000548046;ENST00000552981;ENST00000551265;ENST00000550695;ENST00000547534;ENST00000549338;ENST00000548847	T;T;T;T;D;T;D;D;T;T	0.85339	-0.96;-0.96;-0.72;-0.72;-1.97;-0.96;-1.94;-1.56;-0.96;-0.99	4.38	-2.42	0.06542	.	1.811420	0.02724	N	0.114375	T	0.70141	0.3190	L	0.27053	0.805	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.57057	-0.7876	10	0.07325	T	0.83	3.2583	1.5709	0.02615	0.1523:0.2638:0.3316:0.2524	.	34;34;34	F8VVM2;Q00325;Q00325-2	.;MPCP_HUMAN;.	A	34	ENSP00000383898:P34A;ENSP00000188376:P34A;ENSP00000228318:P34A;ENSP00000447310:P34A;ENSP00000447339:P34A;ENSP00000448708:P34A;ENSP00000449479:P34A;ENSP00000449793:P34A;ENSP00000447740:P34A;ENSP00000449166:P34A	ENSP00000188376:P34A	P	+	1	0	SLC25A3	97511987	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.314000	0.19432	-0.815000	0.04346	-1.099000	0.02127	CCA		PASS	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407989.1	NM_005888		6	12	---	---	---	---
ACTR6	64431	broad.mit.edu	37	12	100617652	100617652	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:100617652G>A	ENST00000188312.2	+	11	1915	c.1150G>A	c.(1150-1152)Gaa>Aaa	p.E384K	ACTR6_ENST00000551617.1_Missense_Mutation_p.E282K|ACTR6_ENST00000552376.1_Missense_Mutation_p.E364K|ACTR6_ENST00000546902.1_Missense_Mutation_p.E302K	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	384						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.E384K(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						AGATTACGAAGAAAATGGACA	0.318																																						uc001thb.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1150-1152)GAA>AAA		ARP6 actin-related protein 6 homolog							119.0	121.0	121.0					12																	100617652		2203	4300	6503	SO:0001583	missense	64431					cytoplasm|cytoskeleton		g.chr12:100617652G>A	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.1150G>A	12.37:g.100617652G>A	ENSP00000188312:p.Glu384Lys		Somatic				ACTR6_uc001thc.1_Missense_Mutation_p.E276K|ACTR6_uc001thd.1_Missense_Mutation_p.E364K|ACTR6_uc009ztu.1_Intron|ACTR6_uc001the.1_Missense_Mutation_p.E302K|ACTR6_uc001thf.1_Missense_Mutation_p.E282K|uc001thg.1_5'Flank	p.E384K	NM_022496	NP_071941	Capture	Illumina GAIIx	Phase_I	Q9GZN1	ARP6_HUMAN			11	1206	+			384					B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	c.1150G>A	CCDS9074.1	.	.	.	.	.	.	.	.	.	.	G	36	5.790057	0.96945	.	.	ENSG00000075089	ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	D;D;T;T	0.97688	-4.49;-4.49;2.36;2.36	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.99077	0.9683	M	0.91196	3.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.99338	1.0911	10	0.87932	D	0	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	282;364;384	F8VSD1;F8W057;Q9GZN1	.;.;ARP6_HUMAN	K	384;302;364;282	ENSP00000188312:E384K;ENSP00000448669:E302K;ENSP00000447237:E364K;ENSP00000448356:E282K	ENSP00000188312:E384K	E	+	1	0	ACTR6	99141783	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.260000	0.95568	2.824000	0.97209	0.655000	0.94253	GAA		PASS	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496		6	243	---	---	---	---
RFX4	5992	broad.mit.edu	37	12	107080755	107080755	+	Silent	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:107080755C>A	ENST00000392842.1	+	6	885	c.471C>A	c.(469-471)ggC>ggA	p.G157G	RFX4_ENST00000357881.4_Silent_p.G166G|RP11-482D24.2_ENST00000547531.1_RNA|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000229387.5_Silent_p.G63G	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	157					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G63G(1)|p.G166G(1)|p.G157G(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						GTGAGACGGGCAAGAAAGAAG	0.473																																						uc001tlr.2																			3	Substitution - coding silent(3)		lung(3)	upper_aerodigestive_tract(1)	1						c.(469-471)GGC>GGA		regulatory factor X4 isoform c							193.0	185.0	188.0					12																	107080755		2203	4300	6503	SO:0001819	synonymous_variant	5992				transcription, DNA-dependent	nucleus	DNA binding	g.chr12:107080755C>A	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.471C>A	12.37:g.107080755C>A			Somatic				RFX4_uc010swv.1_RNA|RFX4_uc001tls.2_Silent_p.G166G|RFX4_uc001tlt.2_Silent_p.G166G|RFX4_uc001tlv.2_Silent_p.G63G|uc001tlu.3_5'Flank	p.G157G	NM_213594	NP_998759	Capture	Illumina GAIIx	Phase_I	Q33E94	RFX4_HUMAN			6	537	+			157					A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Silent	SNP	ENST00000392842.1	37	c.471C>A	CCDS9106.1																																																																																				PASS	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491		162	239	---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111758477	111758477	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:111758477C>T	ENST00000261726.6	+	17	2818	c.2664C>T	c.(2662-2664)taC>taT	p.Y888Y		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	888					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.Y888Y(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCGAGCAGTACGAGCTGTACA	0.682																																						uc001tsa.1																			1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|breast(1)	6						c.(2662-2664)TAC>TAT		cut-like 2							14.0	15.0	15.0					12																	111758477		2196	4291	6487	SO:0001819	synonymous_variant	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111758477C>T	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2664C>T	12.37:g.111758477C>T			Somatic					p.Y888Y	NM_015267	NP_056082	Capture	Illumina GAIIx	Phase_I	O14529	CUX2_HUMAN			17	2817	+			888			CUT 2.		A7E2Y4	Silent	SNP	ENST00000261726.6	37	c.2664C>T	CCDS41837.1																																																																																				PASS	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		15	41	---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120567262	120567262	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:120567262C>T	ENST00000300648.6	-	57	7720	c.7708G>A	c.(7708-7710)Gct>Act	p.A2570T		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2570					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.A2570T(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATCTTCTCAGCCACCAGCCTG	0.522																																						uc001txo.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(7708-7710)GCT>ACT		GCN1 general control of amino-acid synthesis							153.0	156.0	155.0					12																	120567262		1975	4144	6119	SO:0001583	missense	10985				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding	g.chr12:120567262C>T	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7708G>A	12.37:g.120567262C>T	ENSP00000300648:p.Ala2570Thr		Somatic					p.A2570T	NM_006836	NP_006827	Capture	Illumina GAIIx	Phase_I	Q92616	GCN1L_HUMAN			57	7721	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		2570			HEAT 23.		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	c.7708G>A	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950571	0.53186	.	.	ENSG00000089154	ENST00000300648	T	0.50548	0.74	5.63	4.73	0.59995	Armadillo-like helical (1);Armadillo-type fold (1);	0.064020	0.64402	D	0.000011	T	0.47377	0.1442	M	0.67953	2.075	0.80722	D	1	B	0.28378	0.209	B	0.23275	0.045	T	0.45293	-0.9271	10	0.42905	T	0.14	-7.8208	15.8894	0.79279	0.1366:0.8634:0.0:0.0	.	2570	Q92616	GCN1L_HUMAN	T	2570	ENSP00000300648:A2570T	ENSP00000300648:A2570T	A	-	1	0	GCN1L1	119051645	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.631000	0.54280	1.354000	0.45846	-0.181000	0.13052	GCT		PASS	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			122	399	---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120587435	120587435	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:120587435C>T	ENST00000300648.6	-	36	4533	c.4521G>A	c.(4519-4521)gaG>gaA	p.E1507E		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1507					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.E1507E(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACGATTCCTCCTCCAGGGCAG	0.587																																						uc001txo.2																			1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(4519-4521)GAG>GAA		GCN1 general control of amino-acid synthesis							54.0	57.0	56.0					12																	120587435		2120	4245	6365	SO:0001819	synonymous_variant	10985				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding	g.chr12:120587435C>T	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4521G>A	12.37:g.120587435C>T			Somatic					p.E1507E	NM_006836	NP_006827	Capture	Illumina GAIIx	Phase_I	Q92616	GCN1L_HUMAN			36	4534	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		1507			HEAT 8.		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	c.4521G>A	CCDS41847.1																																																																																				PASS	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			22	130	---	---	---	---
MLEC	9761	broad.mit.edu	37	12	121132908	121132908	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:121132908A>G	ENST00000228506.3	+	4	1030	c.602A>G	c.(601-603)gAc>gGc	p.D201G	MLEC_ENST00000412616.2_Intron|RP11-173P15.3_ENST00000541383.1_RNA	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	201					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)	p.D201G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						GGGTACTATGACAATCCCAAG	0.498																																						uc001tyy.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(601-603)GAC>GGC		malectin precursor							381.0	352.0	362.0					12																	121132908		2203	4300	6503	SO:0001583	missense	9761				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding	g.chr12:121132908A>G	BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.602A>G	12.37:g.121132908A>G	ENSP00000228506:p.Asp201Gly		Somatic					p.D201G	NM_014730	NP_055545	Capture	Illumina GAIIx	Phase_I	Q14165	MLEC_HUMAN			4	753	+			201			Lumenal (Potential).	Carbohydrate (By similarity).		Missense_Mutation	SNP	ENST00000228506.3	37	c.602A>G	CCDS9206.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494690	0.85069	.	.	ENSG00000110917	ENST00000228506;ENST00000545525	.	.	.	5.5	5.5	0.81552	Malectin (1);	0.000000	0.85682	D	0.000000	T	0.76737	0.4029	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73275	-0.4034	9	0.13108	T	0.6	.	15.9265	0.79621	1.0:0.0:0.0:0.0	.	201	Q14165	MLEC_HUMAN	G	201;118	.	ENSP00000228506:D201G	D	+	2	0	MLEC	119617291	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.622000	0.90953	2.235000	0.73313	0.533000	0.62120	GAC		PASS	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	NM_014730		18	784	---	---	---	---
DHX37	57647	broad.mit.edu	37	12	125473500	125473500	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:125473500G>T	ENST00000308736.2	-	1	167	c.69C>A	c.(67-69)ggC>ggA	p.G23G		NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	23							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.G23G(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCTCGGGGGGGCCCTTCGAGG	0.721																																						uc001ugy.2																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(67-69)GGC>GGA		DEAH (Asp-Glu-Ala-His) box polypeptide 37							9.0	13.0	12.0					12																	125473500		1826	3868	5694	SO:0001819	synonymous_variant	57647						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr12:125473500G>T	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.69C>A	12.37:g.125473500G>T			Somatic					p.G23G	NM_032656	NP_116045	Capture	Illumina GAIIx	Phase_I	Q8IY37	DHX37_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)	1	168	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		23					Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	37	c.69C>A	CCDS9261.1																																																																																				PASS	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656		11	19	---	---	---	---
PIWIL1	9271	broad.mit.edu	37	12	130831046	130831046	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr12:130831046C>A	ENST00000245255.3	+	5	720	c.448C>A	c.(448-450)Ctt>Att	p.L150I		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	150					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.L150I(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TTCAGCTCTTCTTTTTCAACA	0.413																																						uc001uik.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(448-450)CTT>ATT		piwi-like 1							95.0	90.0	91.0					12																	130831046		2203	4300	6503	SO:0001583	missense	9271				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding	g.chr12:130831046C>A	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.448C>A	12.37:g.130831046C>A	ENSP00000245255:p.Leu150Ile		Somatic				PIWIL1_uc001uij.1_Missense_Mutation_p.L150I	p.L150I	NM_004764	NP_004755	Capture	Illumina GAIIx	Phase_I	Q96J94	PIWL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	5	538	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		150					A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	c.448C>A	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887673	0.91814	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539995;ENST00000542723;ENST00000540672	T;T;T;T;T	0.62639	2.81;2.81;0.01;2.81;2.81	5.73	5.73	0.89815	Argonaute/Dicer protein, PAZ (1);	0.057722	0.64402	D	0.000001	T	0.76040	0.3932	L	0.49455	1.56	0.58432	D	0.999999	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.919	T	0.75388	-0.3335	10	0.52906	T	0.07	-16.8752	18.8981	0.92432	0.0:1.0:0.0:0.0	.	150;150	Q96J94;Q96J94-2	PIWL1_HUMAN;.	I	150;150;150;150;11	ENSP00000245255:L150I;ENSP00000442086:L150I;ENSP00000439096:L150I;ENSP00000438582:L150I;ENSP00000441695:L11I	ENSP00000245255:L150I	L	+	1	0	PIWIL1	129396999	1.000000	0.71417	0.924000	0.36721	0.979000	0.70002	6.064000	0.71169	2.691000	0.91804	0.650000	0.86243	CTT		PASS	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			61	174	---	---	---	---
PARP4	143	broad.mit.edu	37	13	25000673	25000673	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr13:25000673C>T	ENST00000381989.3	-	33	5015	c.4910G>A	c.(4909-4911)cGc>cAc	p.R1637H		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1637	Interaction with the major vault protein.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R1637H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CAACCTGGTGCGAATAAACTG	0.383																																						uc001upl.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(4909-4911)CGC>CAC		poly (ADP-ribose) polymerase family, member 4							84.0	82.0	82.0					13																	25000673		2203	4300	6503	SO:0001583	missense	143				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity	g.chr13:25000673C>T	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.4910G>A	13.37:g.25000673C>T	ENSP00000371419:p.Arg1637His		Somatic					p.R1637H	NM_006437	NP_006428	Capture	Illumina GAIIx	Phase_I	Q9UKK3	PARP4_HUMAN		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)	33	5016	-		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)	1637			Interaction with the major vault protein.		O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	c.4910G>A	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	c	16.78	3.218737	0.58560	.	.	ENSG00000102699	ENST00000381989	D	0.88896	-2.44	4.19	3.34	0.38264	.	0.101850	0.35805	U	0.002973	D	0.88187	0.6369	L	0.57536	1.79	0.28357	N	0.920639	D	0.61080	0.989	P	0.50617	0.646	T	0.82772	-0.0292	10	0.72032	D	0.01	.	7.4291	0.27118	0.0:0.8801:0.0:0.1199	.	1637	Q9UKK3	PARP4_HUMAN	H	1637	ENSP00000371419:R1637H	ENSP00000371419:R1637H	R	-	2	0	PARP4	23898673	0.753000	0.28349	0.633000	0.29310	0.859000	0.49053	1.064000	0.30579	0.983000	0.38602	0.455000	0.32223	CGC		PASS	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437		78	135	---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33223009	33223009	+	Nonsense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr13:33223009C>T	ENST00000315596.10	+	2	286	c.100C>T	c.(100-102)Cga>Tga	p.R34*		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	34					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.R34*(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GATGGTGAGACGATTAAAGGT	0.398																																						uc010abf.2																			1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(1)|pancreas(1)	4						c.(100-102)CGA>TGA		PDS5, regulator of cohesion maintenance, homolog							103.0	102.0	102.0					13																	33223009		1841	4074	5915	SO:0001587	stop_gained	23047				cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding	g.chr13:33223009C>T	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.100C>T	13.37:g.33223009C>T	ENSP00000313851:p.Arg34*		Somatic				PDS5B_uc001uun.2_Nonsense_Mutation_p.R34*|PDS5B_uc001uuo.2_Nonsense_Mutation_p.R34*|PDS5B_uc010abg.2_RNA|PDS5B_uc001uuq.2_RNA	p.R34*	NM_015032	NP_055847	Capture	Illumina GAIIx	Phase_I	Q9NTI5	PDS5B_HUMAN		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)	2	258	+		Lung SC(185;0.0367)	34					Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Nonsense_Mutation	SNP	ENST00000315596.10	37	c.100C>T	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046310	0.75846	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.45	4.59	0.56863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.3479	14.057	0.64776	0.2881:0.7119:0.0:0.0	.	.	.	.	X	34	.	ENSP00000313851:R34X	R	+	1	2	PDS5B	32121009	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	1.417000	0.34770	1.240000	0.43803	0.591000	0.81541	CGA		PASS	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032		27	103	---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93518682	93518682	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr13:93518682G>T	ENST00000377067.3	+	8	2081	c.1709G>T	c.(1708-1710)gGg>gTg	p.G570V		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	570					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.G570V(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTACTTCCCGGGATTTGGTAA	0.433																																						uc010tif.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5						c.(1708-1710)GGG>GTG		glypican 5 precursor							358.0	270.0	299.0					13																	93518682		2203	4300	6503	SO:0001583	missense	2262					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:93518682G>T	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1709G>T	13.37:g.93518682G>T	ENSP00000366267:p.Gly570Val		Somatic					p.G570V	NM_004466	NP_004457	Capture	Illumina GAIIx	Phase_I	P78333	GPC5_HUMAN			8	2075	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	570					B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	c.1709G>T	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	2.592	-0.295058	0.05532	.	.	ENSG00000179399	ENST00000377067	T	0.48522	0.81	5.81	1.92	0.25849	.	1.027370	0.07820	N	0.959580	T	0.24084	0.0583	N	0.08118	0	0.09310	N	0.999996	B	0.09022	0.002	B	0.06405	0.002	T	0.25152	-1.0140	10	0.18276	T	0.48	-27.5687	4.3458	0.11133	0.0754:0.1372:0.5037:0.2837	.	570	P78333	GPC5_HUMAN	V	570	ENSP00000366267:G570V	ENSP00000366267:G570V	G	+	2	0	GPC5	92316683	0.291000	0.24352	0.015000	0.15790	0.034000	0.12701	0.461000	0.21940	0.035000	0.15519	0.650000	0.86243	GGG		PASS	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		87	61	---	---	---	---
OR4K5	79317	broad.mit.edu	37	14	20389500	20389500	+	Silent	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:20389500A>G	ENST00000315915.4	+	1	760	c.735A>G	c.(733-735)gcA>gcG	p.A245A		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A245A(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCATATTGCAGTAGTAATAT	0.398																																						uc010tkw.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(733-735)GCA>GCG		olfactory receptor, family 4, subfamily K,							241.0	254.0	250.0					14																	20389500		2203	4300	6503	SO:0001819	synonymous_variant	79317				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20389500A>G	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.735A>G	14.37:g.20389500A>G			Somatic					p.A245A	NM_001005483	NP_001005483	Capture	Illumina GAIIx	Phase_I	Q8NGD3	OR4K5_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	735	+	all_cancers(95;0.00108)		245			Helical; Name=6; (Potential).		Q6IFA7	Silent	SNP	ENST00000315915.4	37	c.735A>G	CCDS32024.1																																																																																				PASS	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483		287	148	---	---	---	---
RNF31	55072	broad.mit.edu	37	14	24619858	24619858	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:24619858C>A	ENST00000324103.6	+	8	1569	c.1249C>A	c.(1249-1251)Cac>Aac	p.H417N	RP11-468E2.4_ENST00000558468.1_5'Flank|RNF31_ENST00000559275.1_Missense_Mutation_p.H266N|RNF31_ENST00000382687.3_Missense_Mutation_p.H266N	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	417	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H417N(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GTACTGTATTCACTGTACCTT	0.562																																						uc001wmn.1																			1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1249-1251)CAC>AAC		ring finger protein 31							144.0	156.0	152.0					14																	24619858		1997	4167	6164	SO:0001583	missense	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24619858C>A	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1249C>A	14.37:g.24619858C>A	ENSP00000315112:p.His417Asn		Somatic				RNF31_uc001wml.1_Missense_Mutation_p.H266N|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Missense_Mutation_p.H232N|RNF31_uc001wmo.1_5'Flank|RNF31_uc001wmp.2_5'Flank	p.H417N	NM_017999	NP_060469	Capture	Illumina GAIIx	Phase_I	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	8	1498	+			417			Polyubiquitin-binding.|RanBP2-type 3.		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	c.1249C>A	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587318	0.66105	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.42513	0.97;0.97	5.87	5.87	0.94306	Zinc finger, RanBP2-type (2);	0.125717	0.56097	D	0.000028	T	0.63189	0.2490	M	0.62723	1.935	0.45852	D	0.99871	D;D;D	0.71674	0.995;0.997;0.998	P;D;D	0.78314	0.844;0.98;0.991	T	0.63198	-0.6691	10	0.66056	D	0.02	-23.4334	17.1247	0.86711	0.0:1.0:0.0:0.0	.	232;417;266	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	N	417;266	ENSP00000315112:H417N;ENSP00000372134:H266N	ENSP00000315112:H417N	H	+	1	0	RNF31	23689698	0.979000	0.34478	0.966000	0.40874	0.997000	0.91878	2.362000	0.44169	2.781000	0.95711	0.655000	0.94253	CAC		PASS	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		6	335	---	---	---	---
FOXG1	2290	broad.mit.edu	37	14	29237227	29237227	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:29237227G>A	ENST00000313071.4	+	1	941	c.742G>A	c.(742-744)Gac>Aac	p.D248N	RP11-966I7.1_ENST00000549487.1_RNA|RP11-966I7.1_ENST00000546560.1_RNA|FOXG1_ENST00000382535.3_Missense_Mutation_p.D248N|RP11-966I7.1_ENST00000551395.1_RNA	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	248					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D248N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CCACTACGACGACCCGGGCAA	0.642																																						uc001wqe.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)	4						c.(742-744)GAC>AAC		forkhead box G1							45.0	46.0	46.0					14																	29237227		2203	4300	6503	SO:0001583	missense	2290				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr14:29237227G>A		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.742G>A	14.37:g.29237227G>A	ENSP00000339004:p.Asp248Asn		Somatic					p.D248N	NM_005249	NP_005240	Capture	Illumina GAIIx	Phase_I	P55316	FOXG1_HUMAN	LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)	1	941	+			248			Fork-head.		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	c.742G>A	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	g	29.7	5.029873	0.93575	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.95518	-3.73;-3.73	4.0	4.0	0.46444	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.056484	0.64402	U	0.000002	D	0.96253	0.8778	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95932	0.8939	10	0.41790	T	0.15	.	15.749	0.77969	0.0:0.0:1.0:0.0	.	248	P55316	FOXG1_HUMAN	N	248	ENSP00000371975:D248N;ENSP00000339004:D248N	ENSP00000339004:D248N	D	+	1	0	FOXG1	28306978	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.640000	0.67875	1.769000	0.52152	0.299000	0.19835	GAC		PASS	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3			56	18	---	---	---	---
GPR135	64582	broad.mit.edu	37	14	59930635	59930635	+	Missense_Mutation	SNP	C	C	T	rs375515475		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:59930635C>T	ENST00000395116.1	-	1	1425	c.1310G>A	c.(1309-1311)cGg>cAg	p.R437Q		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	437						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R437Q(1)		breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		GGCCCCCAGCCGGTTGGCATA	0.632																																						uc010apj.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1309-1311)CGG>CAG		G protein-coupled receptor 135			GLN/ARG	0,4406		0,0,2203	38.0	33.0	35.0		1310	3.9	0.1	14		35	2,8598	2.2+/-6.3	0,2,4298	no	missense	GPR135	NM_022571.5	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	437/495	59930635	2,13004	2203	4300	6503	SO:0001583	missense	64582					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr14:59930635C>T	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1310G>A	14.37:g.59930635C>T	ENSP00000378548:p.Arg437Gln		Somatic				GPR135_uc001xed.2_RNA	p.R437Q	NM_022571	NP_072093	Capture	Illumina GAIIx	Phase_I	Q8IZ08	GP135_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.134)	1	1425	-			437			Cytoplasmic (Potential).		Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	37	c.1310G>A	CCDS9738.1	.	.	.	.	.	.	.	.	.	.	c	36	5.694413	0.96793	0.0	2.33E-4	ENSG00000181619	ENST00000395116	T	0.62788	-0.0	4.75	3.86	0.44501	.	0.000000	0.64402	U	0.000007	T	0.53786	0.1818	L	0.32530	0.975	0.80722	D	1	D	0.63880	0.993	P	0.50136	0.632	T	0.46965	-0.9153	10	0.13108	T	0.6	-12.6714	10.5447	0.45054	0.0:0.844:0.0:0.156	.	437	Q8IZ08	GP135_HUMAN	Q	437	ENSP00000378548:R437Q	ENSP00000378548:R437Q	R	-	2	0	GPR135	59000388	0.985000	0.35326	0.121000	0.21740	0.889000	0.51656	4.516000	0.60496	1.239000	0.43787	0.651000	0.88453	CGG		PASS	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	NM_022571		18	11	---	---	---	---
PLEKHG3	26030	broad.mit.edu	37	14	65203602	65203602	+	Silent	SNP	C	C	T	rs201048347		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:65203602C>T	ENST00000394691.1	+	13	1524	c.1377C>T	c.(1375-1377)aaC>aaT	p.N459N	PLEKHG3_ENST00000484731.2_5'Flank|PLEKHG3_ENST00000471182.2_5'Flank|PLEKHG3_ENST00000247226.7_Silent_p.N403N			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	459				QGRRQSEPTKHLLRQLNEKARAAGMK -> KGAGPEPPGSE EEEEEQEESLAVAEQ (in Ref. 2; AAH04298). {ECO:0000305}.			Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N403N(1)		endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGCAACTCAACGAGAAAGGTG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17645	0.0		0.001	False		,,,				2504	0.0					uc001xho.1																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1375-1377)AAC>AAT		pleckstrin homology domain containing, family G,		C		0,4406		0,0,2203	55.0	51.0	52.0		1209	-8.1	0.0	14		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PLEKHG3	NM_015549.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		403/1164	65203602	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26030				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr14:65203602C>T	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.1377C>T	14.37:g.65203602C>T			Somatic				PLEKHG3_uc001xhn.1_Silent_p.N403N|PLEKHG3_uc001xhp.2_Silent_p.N459N|PLEKHG3_uc010aqh.1_Translation_Start_Site|PLEKHG3_uc001xhq.1_5'Flank	p.N459N	NM_015549	NP_056364	Capture	Illumina GAIIx	Phase_I	A1L390	PKHG3_HUMAN		all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)	13	1646	+			459	QGRRQSEPTKHLLRQLNEKARAAGMK -> KGAGPEPPGSE EEEEEQEESLAVAEQ (in Ref. 2; AAH04298).				A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	ENST00000394691.1	37	c.1377C>T																																																																																					PASS	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549		24	15	---	---	---	---
STON2	85439	broad.mit.edu	37	14	81743259	81743259	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:81743259G>C	ENST00000267540.2	-	4	2596	c.2396C>G	c.(2395-2397)cCg>cGg	p.P799R	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_Missense_Mutation_p.P799R	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	799	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)		p.P799R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GTTTTTGTCCGGCAGTCGGTT	0.463																																						uc010tvu.1																			1	Substitution - Missense(1)		lung(1)	skin(3)|pancreas(2)	5						c.(2395-2397)CCG>CGG		stonin 2							119.0	117.0	117.0					14																	81743259		2203	4300	6503	SO:0001583	missense	85439				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding	g.chr14:81743259G>C	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2396C>G	14.37:g.81743259G>C	ENSP00000267540:p.Pro799Arg		Somatic				STON2_uc001xvk.1_Missense_Mutation_p.P799R|STON2_uc010tvt.1_Missense_Mutation_p.P596R	p.P799R	NM_033104	NP_149095	Capture	Illumina GAIIx	Phase_I	Q8WXE9	STON2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0348)	4	2597	-			799			MHD.		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	c.2396C>G	CCDS9875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.04|17.04	3.286479|3.286479	0.59867|0.59867	.|.	.|.	ENSG00000140022|ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540|ENST00000553821	T;T|.	0.20738|.	2.05;2.05|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Clathrin adaptor, mu subunit, C-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83362|0.83362	0.5238|0.5238	M|M	0.84082|0.84082	2.675|2.675	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.82902|0.82902	-0.0227|-0.0227	10|5	0.87932|.	D|.	0|.	-18.6252|-18.6252	20.6439|20.6439	0.99570|0.99570	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	799;799|.	Q8WXE9;G3V2T7|.	STON2_HUMAN;.|.	R|G	799;811;799|7	ENSP00000450857:P799R;ENSP00000267540:P799R|.	ENSP00000267540:P799R|.	P|R	-|-	2|1	0|2	STON2|STON2	80813012|80813012	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.768000|0.768000	0.43524|0.43524	9.869000|9.869000	0.99810|0.99810	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	CCG|CGG		PASS	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104		237	62	---	---	---	---
CATSPERB	79820	broad.mit.edu	37	14	92088265	92088265	+	Silent	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:92088265A>G	ENST00000256343.3	-	19	2103	c.1947T>C	c.(1945-1947)ttT>ttC	p.F649F		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	649					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.F649F(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				CTGTATCTTCAAACAAGGCCT	0.383																																						uc001xzs.1																			1	Substitution - coding silent(1)		lung(1)	breast(2)|skin(2)|ovary(1)	5						c.(1945-1947)TTT>TTC		cation channel, sperm-associated, beta							32.0	31.0	32.0					14																	92088265		2203	4300	6503	SO:0001819	synonymous_variant	79820				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr14:92088265A>G	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1947T>C	14.37:g.92088265A>G			Somatic				CATSPERB_uc010aub.1_Silent_p.F171F	p.F649F	NM_024764	NP_079040	Capture	Illumina GAIIx	Phase_I	Q9H7T0	CTSRB_HUMAN			19	2087	-		all_cancers(154;0.0663)|all_epithelial(191;0.236)	649					A0AV51	Silent	SNP	ENST00000256343.3	37	c.1947T>C	CCDS32142.1																																																																																				PASS	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764		28	47	---	---	---	---
SERPINA9	327657	broad.mit.edu	37	14	94935676	94935676	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:94935676G>T	ENST00000380365.3	-	2	580	c.502C>A	c.(502-504)Ccc>Acc	p.P168T	SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000337425.5_Missense_Mutation_p.P186T|SERPINA9_ENST00000424550.2_Missense_Mutation_p.P37T|SERPINA9_ENST00000298845.7_Intron|SERPINA9_ENST00000448305.2_Missense_Mutation_p.P88T|SERPINA9_ENST00000546329.1_Missense_Mutation_p.P150T			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	168					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P186T(2)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GCAATGGAGGGGTTGGAGAAA	0.498																																						uc001ydf.2																			2	Substitution - Missense(2)		lung(2)	lung(1)|central_nervous_system(1)	2						c.(556-558)CCC>ACC		serine (or cysteine) proteinase inhibitor, clade							151.0	148.0	149.0					14																	94935676		1901	4121	6022	SO:0001583	missense	327657				regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity	g.chr14:94935676G>T	AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.502C>A	14.37:g.94935676G>T	ENSP00000369723:p.Pro168Thr		Somatic				SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_Missense_Mutation_p.P37T|SERPINA9_uc001ydg.2_Missense_Mutation_p.P150T|SERPINA9_uc001ydh.1_Missense_Mutation_p.P186T|SERPINA9_uc001ydi.1_Missense_Mutation_p.P150T	p.P186T	NM_175739	NP_783866	Capture	Illumina GAIIx	Phase_I	Q86WD7	SPA9_HUMAN		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)	2	717	-		all_cancers(154;0.0691)|all_epithelial(191;0.233)	168					B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	ENST00000380365.3	37	c.556C>A		.	.	.	.	.	.	.	.	.	.	G	0.044	-1.271350	0.01421	.	.	ENSG00000170054	ENST00000448305;ENST00000424550;ENST00000337425;ENST00000380365;ENST00000546329	D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83	3.97	-7.94	0.01152	Serpin domain (3);	1.160310	0.06639	N	0.760741	T	0.65719	0.2718	N	0.15975	0.35	0.09310	N	1	B;B;B;B	0.19445	0.008;0.036;0.003;0.013	B;B;B;B	0.21360	0.006;0.034;0.006;0.012	T	0.53802	-0.8387	10	0.22109	T	0.4	.	4.4406	0.11572	0.2473:0.2512:0.4155:0.086	.	150;168;88;186	Q86WD7-4;Q86WD7;Q86WD7-6;Q86WD7-7	.;SPA9_HUMAN;.;.	T	88;37;186;168;150	ENSP00000414092:P88T;ENSP00000409012:P37T;ENSP00000337133:P186T;ENSP00000369723:P168T;ENSP00000445476:P150T	ENSP00000337133:P186T	P	-	1	0	SERPINA9	94005429	0.000000	0.05858	0.000000	0.03702	0.188000	0.23474	-2.880000	0.00715	-2.206000	0.00741	-0.521000	0.04368	CCC		PASS	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395803.2	NM_175739		65	415	---	---	---	---
SERPINA3	12	broad.mit.edu	37	14	95081219	95081219	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:95081219C>T	ENST00000467132.1	+	2	1589	c.441C>T	c.(439-441)ctC>ctT	p.L147L	SERPINA3_ENST00000482740.1_5'Flank|SERPINA3_ENST00000393078.3_Silent_p.L147L|SERPINA3_ENST00000393080.4_Silent_p.L147L|RP11-986E7.7_ENST00000553947.1_3'UTR			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	147					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L147L(1)		NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		AAGAGCAACTCAGTCTGCTGG	0.532																																						uc001ydp.2																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6						c.(439-441)CTC>CTT		serpin peptidase inhibitor, clade A, member 3							71.0	64.0	66.0					14																	95081219		2203	4300	6503	SO:0001819	synonymous_variant	12				acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	g.chr14:95081219C>T	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.441C>T	14.37:g.95081219C>T			Somatic				SERPINA3_uc001ydo.3_Silent_p.L172L|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Silent_p.L147L|SERPINA3_uc001yds.2_Silent_p.L147L|SERPINA3_uc010avg.2_Silent_p.L147L	p.L147L	NM_001085	NP_001076	Capture	Illumina GAIIx	Phase_I	P01011	AACT_HUMAN		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)	2	520	+		all_cancers(154;0.0525)|all_epithelial(191;0.179)	147					B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Silent	SNP	ENST00000467132.1	37	c.441C>T	CCDS32150.1																																																																																				PASS	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085		23	114	---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95670677	95670677	+	Missense_Mutation	SNP	T	T	G	rs375477729		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr14:95670677T>G	ENST00000298912.4	-	9	1122	c.1009A>C	c.(1009-1011)Act>Cct	p.T337P		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	337					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.T337P(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		TGGTTAACAGTGTAGGTACGC	0.483																																						uc001yef.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1009-1011)ACT>CCT		calmin							176.0	186.0	183.0					14																	95670677		2203	4300	6503	SO:0001583	missense	79789					integral to membrane	actin binding	g.chr14:95670677T>G	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1009A>C	14.37:g.95670677T>G	ENSP00000298912:p.Thr337Pro		Somatic					p.T337P	NM_024734	NP_079010	Capture	Illumina GAIIx	Phase_I	Q96JQ2	CLMN_HUMAN		Epithelial(152;0.193)	9	1125	-			337					B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	37	c.1009A>C	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.798344	0.50208	.	.	ENSG00000165959	ENST00000298912	D	0.94046	-3.34	5.44	3.03	0.35002	.	0.189531	0.26099	N	0.026345	D	0.93354	0.7881	M	0.61703	1.905	0.80722	D	1	D	0.61697	0.99	P	0.54815	0.761	D	0.91244	0.5024	10	0.72032	D	0.01	.	7.3052	0.26443	0.1292:0.0702:0.0:0.8006	.	337	Q96JQ2	CLMN_HUMAN	P	337	ENSP00000298912:T337P	ENSP00000298912:T337P	T	-	1	0	CLMN	94740430	0.997000	0.39634	0.224000	0.23877	0.215000	0.24574	1.569000	0.36428	0.351000	0.24027	0.533000	0.62120	ACT		PASS	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2			58	309	---	---	---	---
GABRA5	2558	broad.mit.edu	37	15	27188527	27188527	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr15:27188527G>A	ENST00000335625.5	+	10	1931	c.1043G>A	c.(1042-1044)gGc>gAc	p.G348D	GABRA5_ENST00000400081.3_Missense_Mutation_p.G348D|GABRA5_ENST00000355395.5_Missense_Mutation_p.G348D	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	348					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.G348D(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	ACCAAGAGAGGCTGGGCCTGG	0.527																																						uc001zbd.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1042-1044)GGC>GAC		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						33.0	37.0	36.0					15																	27188527		1984	4191	6175	SO:0001583	missense	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27188527G>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1043G>A	15.37:g.27188527G>A	ENSP00000335592:p.Gly348Asp		Somatic				GABRA5_uc001zbe.1_5'Flank	p.G348D	NM_000810	NP_000801	Capture	Illumina GAIIx	Phase_I	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	11	1382	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	348			Cytoplasmic (Potential).		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	c.1043G>A	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	-	27.4	4.827546	0.90955	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	D;D;D	0.85258	-1.96;-1.96;-1.96	5.27	5.27	0.74061	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.083751	0.85682	D	0.000000	T	0.82093	0.4962	N	0.12502	0.225	0.50632	D	0.999887	P	0.40909	0.732	P	0.51550	0.673	T	0.80197	-0.1482	10	0.25106	T	0.35	.	18.2599	0.90031	0.0:0.0:1.0:0.0	.	348	P31644	GBRA5_HUMAN	D	348	ENSP00000335592:G348D;ENSP00000347557:G348D;ENSP00000382953:G348D	ENSP00000335592:G348D	G	+	2	0	GABRA5	24771273	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.592000	0.98245	2.626000	0.88956	0.651000	0.88453	GGC		PASS	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			4	9	---	---	---	---
CASC5	57082	broad.mit.edu	37	15	40933128	40933128	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr15:40933128C>G	ENST00000346991.5	+	15	6169	c.5779C>G	c.(5779-5781)Cct>Gct	p.P1927A	CTD-2339L15.3_ENST00000559841.1_RNA|CASC5_ENST00000399668.2_Missense_Mutation_p.P1901A			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1927	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P1927A(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AAACACACCACCTACTCCAGA	0.373																																						uc010bbs.1																			2	Substitution - Missense(2)		lung(2)	breast(3)|central_nervous_system(1)|skin(1)	5						c.(5779-5781)CCT>GCT		cancer susceptibility candidate 5 isoform 1							145.0	137.0	140.0					15																	40933128		1814	4088	5902	SO:0001583	missense	57082				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding	g.chr15:40933128C>G	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.5779C>G	15.37:g.40933128C>G	ENSP00000335463:p.Pro1927Ala		Somatic				CASC5_uc010bbt.1_Missense_Mutation_p.P1901A	p.P1927A	NM_170589	NP_733468	Capture	Illumina GAIIx	Phase_I	Q8NG31	CASC5_HUMAN		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)	15	5940	+		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	1927			Necessary for kinetochore localization and for interaction with NSL1 and DSN1.		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	37	c.5779C>G	CCDS42023.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.916|8.916	0.960015|0.960015	0.18507|0.18507	.|.	.|.	ENSG00000137812|ENSG00000137812	ENST00000532406|ENST00000346991;ENST00000399668	.|T;T	.|0.04603	.|3.59;3.59	4.85|4.85	2.41|2.41	0.29592|0.29592	.|.	.|0.469202	.|0.20610	.|N	.|0.088981	T|T	0.04907|0.04907	0.0132|0.0132	L|L	0.54323|0.54323	1.7|1.7	0.23820|0.23820	N|N	0.996755|0.996755	.|P;P	.|0.40107	.|0.703;0.703	.|B;B	.|0.38562	.|0.276;0.276	T|T	0.32508|0.32508	-0.9904|-0.9904	5|10	.|0.18710	.|T	.|0.47	.|.	5.9435|5.9435	0.19205|0.19205	0.0:0.6649:0.1903:0.1448|0.0:0.6649:0.1903:0.1448	.|.	.|1901;1927	.|Q8NG31-2;Q8NG31	.|.;CASC5_HUMAN	Q|A	74|1927;1901	.|ENSP00000335463:P1927A;ENSP00000382576:P1901A	.|ENSP00000335463:P1927A	H|P	+|+	3|1	2|0	CASC5|CASC5	38720420|38720420	0.681000|0.681000	0.27614|0.27614	0.858000|0.858000	0.33744|0.33744	0.890000|0.890000	0.51754|0.51754	0.825000|0.825000	0.27393|0.27393	1.101000|1.101000	0.41535|0.41535	0.454000|0.454000	0.30748|0.30748	CAC|CCT		PASS	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508		61	189	---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86284378	86284378	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr15:86284378G>T	ENST00000394518.2	+	35	7805	c.7710G>T	c.(7708-7710)gaG>gaT	p.E2570D	AKAP13_ENST00000394510.2_Missense_Mutation_p.E815D|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.E2574D|RP11-158M2.3_ENST00000558375.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2570	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.E2574D(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CCCTCATTGAGCAGGAGAAGC	0.642																																					Melanoma(94;603 1453 3280 32295 32951)	uc002blv.1																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						c.(7708-7710)GAG>GAT		A-kinase anchor protein 13 isoform 2							33.0	35.0	34.0					15																	86284378		2202	4299	6501	SO:0001583	missense	11214				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr15:86284378G>T	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7710G>T	15.37:g.86284378G>T	ENSP00000378026:p.Glu2570Asp		Somatic				AKAP13_uc002blu.1_Missense_Mutation_p.E2574D|AKAP13_uc002blw.1_Missense_Mutation_p.E1035D|AKAP13_uc002blx.1_Missense_Mutation_p.E815D	p.E2570D	NM_007200	NP_009131	Capture	Illumina GAIIx	Phase_I	Q12802	AKP13_HUMAN			35	7880	+			2570			Interaction with ESR1.|Potential.		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	c.7710G>T	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139312	0.77775	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.49432	0.78;0.78;0.78	5.19	5.19	0.71726	.	.	.	.	.	T	0.65554	0.2702	L	0.59436	1.845	0.50039	D	0.99984	D;D	0.89917	0.999;1.0	D;D	0.83275	0.991;0.996	T	0.62812	-0.6775	9	0.35671	T	0.21	.	17.7343	0.88388	0.0:0.0:1.0:0.0	.	2570;2574	Q12802;Q12802-2	AKP13_HUMAN;.	D	2574;2570;2573;2549;815	ENSP00000354718:E2574D;ENSP00000378026:E2570D;ENSP00000378018:E815D	ENSP00000354718:E2574D	E	+	3	2	AKAP13	84085382	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.871000	0.63042	2.413000	0.81919	0.655000	0.94253	GAG		PASS	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200		13	21	---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92690227	92690227	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr15:92690227G>C	ENST00000318445.6	+	8	1740	c.1526G>C	c.(1525-1527)tGt>tCt	p.C509S	SLCO3A1_ENST00000555549.1_3'UTR|RP11-152L20.3_ENST00000561674.1_RNA|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.C509S	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	509	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.C509S(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CTCACGGGCTGTGCGTGCCTC	0.562																																						uc002bqx.2																			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1525-1527)TGT>TCT		solute carrier organic anion transporter family,							88.0	72.0	77.0					15																	92690227		2198	4298	6496	SO:0001583	missense	28232				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity	g.chr15:92690227G>C	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1526G>C	15.37:g.92690227G>C	ENSP00000320634:p.Cys509Ser		Somatic				SLCO3A1_uc002bqy.2_Missense_Mutation_p.C509S|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Missense_Mutation_p.C451S	p.C509S	NM_013272	NP_037404	Capture	Illumina GAIIx	Phase_I	Q9UIG8	SO3A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0841)		8	1727	+	Lung NSC(78;0.0158)|all_lung(78;0.0255)		509			Extracellular (Potential).|Kazal-like.		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	c.1526G>C	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297916	0.60086	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	T;T	0.54479	0.57;0.59	5.84	5.84	0.93424	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	D	0.82287	0.5004	H	0.95365	3.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;0.996;1.0	D	0.86768	0.1971	10	0.87932	D	0	.	20.1551	0.98106	0.0:0.0:1.0:0.0	.	451;509;509	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	S	509;509;228	ENSP00000320634:C509S;ENSP00000387846:C509S	ENSP00000320634:C509S	C	+	2	0	SLCO3A1	90491231	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.240000	0.95396	2.760000	0.94817	0.655000	0.94253	TGT		PASS	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272		18	48	---	---	---	---
WDR90	197335	broad.mit.edu	37	16	708258	708258	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:708258C>T	ENST00000293879.4	+	22	2680	c.2680C>T	c.(2680-2682)Cct>Tct	p.P894S	WDR90_ENST00000549091.1_Missense_Mutation_p.P894S|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	894								p.P894S(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTGCTTTGGCCCTGCAGCTCT	0.652																																						uc002cii.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2680-2682)CCT>TCT		WD repeat domain 90							53.0	59.0	57.0					16																	708258		2141	4253	6394	SO:0001583	missense	197335							g.chr16:708258C>T	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2680C>T	16.37:g.708258C>T	ENSP00000293879:p.Pro894Ser		Somatic				WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Missense_Mutation_p.P421S|WDR90_uc002cil.1_RNA|WDR90_uc002cim.1_Missense_Mutation_p.P68S|WDR90_uc002cin.1_5'Flank	p.P894S	NM_145294	NP_660337	Capture	Illumina GAIIx	Phase_I	Q96KV7	WDR90_HUMAN			22	2734	+		Hepatocellular(780;0.0218)	894			WD 9.		Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	c.2680C>T	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.172653	0.57584	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.60299	0.2;3.25	5.28	4.33	0.51752	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	U	0.000000	T	0.77143	0.4087	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80555	-0.1330	10	0.66056	D	0.02	.	12.8196	0.57685	0.0:0.921:0.0:0.079	.	894;894	F8VUX9;Q96KV7	.;WDR90_HUMAN	S	894	ENSP00000448122:P894S;ENSP00000293879:P894S	ENSP00000293879:P894S	P	+	1	0	WDR90	648259	1.000000	0.71417	0.031000	0.17742	0.015000	0.08874	5.514000	0.67043	1.229000	0.43630	0.555000	0.69702	CCT		PASS	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294		11	136	---	---	---	---
MSLNL	401827	broad.mit.edu	37	16	819471	819471	+	Nonsense_Mutation	SNP	A	A	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:819471A>C	ENST00000442466.1	-	15	2065	c.2066T>G	c.(2065-2067)tTa>tGa	p.L689*	MSLNL_ENST00000293892.3_Nonsense_Mutation_p.L1040*|MIR662_ENST00000384847.1_RNA			Q96KJ4	MSLNL_HUMAN	mesothelin-like	689					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.L1040*(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						AGCTGAATCTAACACCTCTGT	0.627																																						uc002cjz.1																			1	Substitution - Nonsense(1)		lung(1)	breast(3)|ovary(1)	4						c.(3118-3120)TTA>TGA		mesothelin-like							76.0	87.0	83.0					16																	819471		2047	4205	6252	SO:0001587	stop_gained	401827				cell adhesion	integral to membrane		g.chr16:819471A>C			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.2066T>G	16.37:g.819471A>C	ENSP00000415767:p.Leu689*		Somatic				MIR662_hsa-mir-662|MI0003670_5'Flank	p.L1040*	NM_001025190	NP_001020361	Capture	Illumina GAIIx	Phase_I	Q96KJ4	MSLNL_HUMAN			16	3119	-			689			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000442466.1	37	c.3119T>G		.	.	.	.	.	.	.	.	.	.	A	16.07	3.017584	0.54576	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	.	.	.	3.3	-3.45	0.04781	.	.	.	.	.	.	.	.	.	.	.	0.22330	N	0.9992	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.5342	3.0135	0.06052	0.2965:0.0:0.3474:0.3561	.	.	.	.	X	739;689;1040	.	ENSP00000293892:L1040X	L	-	2	0	MSLNL	759472	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.421000	0.00477	-0.687000	0.05162	-0.752000	0.03492	TTA		PASS	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001025190		52	53	---	---	---	---
TMC7	79905	broad.mit.edu	37	16	19033051	19033051	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:19033051C>T	ENST00000304381.5	+	4	691	c.561C>T	c.(559-561)ctC>ctT	p.L187L	TMC7_ENST00000569532.1_Silent_p.L187L|TMC7_ENST00000421369.3_Silent_p.L77L	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	187					ion transport (GO:0006811)	integral component of membrane (GO:0016021)		p.L187L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						TGGTTTTGCTCCCAGTCTTAC	0.433																																						uc002dfq.2																			1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(559-561)CTC>CTT		transmembrane channel-like 7 isoform a							185.0	154.0	164.0					16																	19033051		2197	4300	6497	SO:0001819	synonymous_variant	79905					integral to membrane		g.chr16:19033051C>T	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.561C>T	16.37:g.19033051C>T			Somatic				TMC7_uc010vao.1_Silent_p.L187L|TMC7_uc002dfp.2_Silent_p.L187L|TMC7_uc010vap.1_Silent_p.L77L	p.L187L	NM_024847	NP_079123	Capture	Illumina GAIIx	Phase_I	Q7Z402	TMC7_HUMAN			4	691	+			187			Helical; (Potential).		E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	ENST00000304381.5	37	c.561C>T	CCDS10573.1																																																																																				PASS	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847		45	144	---	---	---	---
CACNG3	10368	broad.mit.edu	37	16	24373168	24373168	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:24373168G>A	ENST00000005284.3	+	4	2134	c.932G>A	c.(931-933)cGc>cAc	p.R311H		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	311					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.R311H(1)|p.R311P(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		GCCAACAGGCGCACCACGCCC	0.562																																						uc002dmf.2																			2	Substitution - Missense(2)		lung(2)		0						c.(931-933)CGC>CAC		voltage-dependent calcium channel gamma-3							46.0	47.0	47.0					16																	24373168		2197	4300	6497	SO:0001583	missense	10368				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr16:24373168G>A	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.932G>A	16.37:g.24373168G>A	ENSP00000005284:p.Arg311His		Somatic					p.R311H	NM_006539	NP_006530	Capture	Illumina GAIIx	Phase_I	O60359	CCG3_HUMAN		GBM - Glioblastoma multiforme(48;0.0809)	4	2132	+			311						Missense_Mutation	SNP	ENST00000005284.3	37	c.932G>A	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	g	28.3	4.905428	0.92107	.	.	ENSG00000006116	ENST00000005284	T	0.64618	-0.11	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.79604	0.4474	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82643	-0.0356	10	0.87932	D	0	-12.9989	17.8078	0.88607	0.0:0.0:1.0:0.0	.	311	O60359	CCG3_HUMAN	H	311	ENSP00000005284:R311H	ENSP00000005284:R311H	R	+	2	0	CACNG3	24280669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.472000	0.97709	2.266000	0.75297	0.645000	0.84053	CGC		PASS	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539		29	105	---	---	---	---
TMEM219	124446	broad.mit.edu	37	16	29979362	29979362	+	Silent	SNP	A	A	G	rs564179054		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:29979362A>G	ENST00000566848.1	+	3	839	c.372A>G	c.(370-372)caA>caG	p.Q124Q	TMEM219_ENST00000414689.2_Silent_p.Q124Q|TMEM219_ENST00000561899.2_Silent_p.Q124Q|TMEM219_ENST00000279396.6_Silent_p.Q124Q			Q86XT9	TM219_HUMAN	transmembrane protein 219	124					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q124Q(1)		large_intestine(1)|lung(1)|prostate(2)	4						CTGCAGGACAACTGGTCCTTA	0.493													A|||	1	0.000199681	0.0	0.0	5008	,	,		18189	0.001		0.0	False		,,,				2504	0.0					uc002duw.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(370-372)CAA>CAG		transmembrane protein 219							91.0	98.0	96.0					16																	29979362		1906	4121	6027	SO:0001819	synonymous_variant	124446					integral to membrane		g.chr16:29979362A>G		CCDS42145.1	16p11.2	2008-08-08			ENSG00000149932	ENSG00000149932			25201	protein-coding gene	gene with protein product							Standard	NM_194280		Approved		uc010bzk.1	Q86XT9		ENST00000566848.1:c.372A>G	16.37:g.29979362A>G			Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TMEM219_uc002duy.2_Silent_p.Q124Q|TMEM219_uc010bzk.1_Silent_p.Q124Q|TMEM219_uc002duz.2_Silent_p.Q124Q|TMEM219_uc010bzl.1_RNA	p.Q124Q	NM_194280	NP_919256	Capture	Illumina GAIIx	Phase_I	Q86XT9	TM219_HUMAN			4	539	+			124					D5FK14|Q8WVV8	Silent	SNP	ENST00000566848.1	37	c.372A>G	CCDS42145.1																																																																																				PASS	TMEM219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435307.1	NM_001083613		147	179	---	---	---	---
SALL1	6299	broad.mit.edu	37	16	51171083	51171083	+	Missense_Mutation	SNP	G	G	T	rs140524372	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:51171083G>T	ENST00000251020.4	-	3	3948	c.3915C>A	c.(3913-3915)aaC>aaA	p.N1305K	SALL1_ENST00000541611.1_Missense_Mutation_p.N128K|SALL1_ENST00000440970.1_Missense_Mutation_p.N1208K|SALL1_ENST00000566102.1_3'UTR	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1305					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N1305K(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGTTGGTTCCGTTCTCACTGC	0.567																																					GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1																			1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(3913-3915)AAC>AAA		sal-like 1 isoform a							79.0	69.0	72.0					16																	51171083		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51171083G>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3915C>A	16.37:g.51171083G>T	ENSP00000251020:p.Asn1305Lys		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.N1208K|SALL1_uc010cbv.2_Missense_Mutation_p.N157K	p.N1305K	NM_002968	NP_002959	Capture	Illumina GAIIx	Phase_I	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		3	3946	-		all_cancers(37;0.0322)	1305					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.3915C>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950613	0.34377	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559;ENST00000541611	T;T;T	0.55234	0.53;0.53;0.53	5.8	-2.53	0.06326	.	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	L	0.59436	1.845	0.49051	D	0.999748	D;P	0.54601	0.967;0.872	P;B	0.49387	0.609;0.357	T	0.56811	-0.7917	10	0.42905	T	0.14	.	13.4179	0.60979	0.6148:0.0:0.3852:0.0	.	1305;128	Q9NSC2;F5H733	SALL1_HUMAN;.	K	1305;1208;1269;128	ENSP00000251020:N1305K;ENSP00000407914:N1208K;ENSP00000442827:N128K	ENSP00000251020:N1305K	N	-	3	2	SALL1	49728584	0.759000	0.28416	0.954000	0.39281	0.995000	0.86356	-0.064000	0.11636	-0.315000	0.08703	-0.148000	0.13756	AAC		PASS	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		140	100	---	---	---	---
CHD9	80205	broad.mit.edu	37	16	53243469	53243469	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:53243469G>C	ENST00000398510.3	+	2	1615	c.1528G>C	c.(1528-1530)Gag>Cag	p.E510Q	CHD9_ENST00000564845.1_Missense_Mutation_p.E510Q|CHD9_ENST00000447540.1_Missense_Mutation_p.E510Q|CHD9_ENST00000566029.1_Missense_Mutation_p.E510Q			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	510					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.E510Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GGTCATGTCTGAGAAGAAGCA	0.418																																						uc002ehb.2																			1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7						c.(1528-1530)GAG>CAG		chromodomain helicase DNA binding protein 9							73.0	68.0	70.0					16																	53243469		1860	4097	5957	SO:0001583	missense	80205				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr16:53243469G>C	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1528G>C	16.37:g.53243469G>C	ENSP00000381522:p.Glu510Gln		Somatic				CHD9_uc002egy.2_Missense_Mutation_p.E510Q|CHD9_uc002egz.1_Missense_Mutation_p.E510Q|CHD9_uc002eha.1_Missense_Mutation_p.E510Q|CHD9_uc002ehc.2_Missense_Mutation_p.E510Q|CHD9_uc002ehd.2_Missense_Mutation_p.E36Q	p.E510Q	NM_025134	NP_079410	Capture	Illumina GAIIx	Phase_I	Q3L8U1	CHD9_HUMAN			2	1692	+		all_cancers(37;0.0212)	510					B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37	c.1528G>C		.	.	.	.	.	.	.	.	.	.	G	14.65	2.597990	0.46318	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	T;T	0.55234	0.53;0.53	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000019	T	0.64294	0.2585	L	0.41236	1.265	0.46701	D	0.999161	B;B;P;D;P	0.71674	0.18;0.264;0.596;0.998;0.718	B;B;B;D;B	0.65684	0.047;0.055;0.201;0.937;0.366	T	0.57376	-0.7822	10	0.27785	T	0.31	-15.1598	19.7612	0.96319	0.0:0.0:1.0:0.0	.	36;510;510;510;510	B4DR07;Q3L8U1-3;Q3L8U1;Q8NAR9;Q3L8U1-2	.;.;CHD9_HUMAN;.;.	Q	510;510;36	ENSP00000396345:E510Q;ENSP00000381522:E510Q	ENSP00000219084:E36Q	E	+	1	0	CHD9	51800970	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.827000	0.86722	2.670000	0.90874	0.655000	0.94253	GAG		PASS	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		20	138	---	---	---	---
CNGB1	1258	broad.mit.edu	37	16	57991254	57991254	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:57991254C>A	ENST00000251102.8	-	12	925	c.865G>T	c.(865-867)Gtg>Ttg	p.V289L	CNGB1_ENST00000564448.1_Missense_Mutation_p.V283L|CNGB1_ENST00000311183.4_Missense_Mutation_p.V289L	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	289					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.V289L(1)		breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CTGGTCTGCACATCACATATC	0.537																																					Colon(156;1293 1853 16336 28962 38659)	uc002emt.2																			1	Substitution - Missense(1)		lung(1)	breast(3)|pancreas(1)	4						c.(865-867)GTG>TTG		cyclic nucleotide gated channel beta 1 isoform							87.0	97.0	94.0					16																	57991254		2020	4185	6205	SO:0001583	missense	1258				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chr16:57991254C>A	AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.865G>T	16.37:g.57991254C>A	ENSP00000251102:p.Val289Leu		Somatic				CNGB1_uc010cdh.2_Missense_Mutation_p.V283L|CNGB1_uc002emu.2_Missense_Mutation_p.V289L	p.V289L	NM_001297	NP_001288	Capture	Illumina GAIIx	Phase_I	Q14028	CNGB1_HUMAN			12	930	-			289					H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	37	c.865G>T	CCDS42169.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.875320	0.33162	.	.	ENSG00000070729	ENST00000251102;ENST00000311183	D;T	0.97791	-4.54;0.44	3.17	2.21	0.28008	.	0.000000	0.29328	N	0.012474	D	0.94128	0.8117	L	0.50333	1.59	0.21105	N	0.999781	P;P	0.41102	0.738;0.478	B;B	0.35413	0.202;0.056	D	0.89360	0.3667	10	0.59425	D	0.04	.	6.3512	0.21377	0.0:0.8635:0.0:0.1365	.	289;289	Q14028-3;Q14028	.;CNGB1_HUMAN	L	289	ENSP00000251102:V289L;ENSP00000311670:V289L	ENSP00000251102:V289L	V	-	1	0	CNGB1	56548755	0.978000	0.34361	1.000000	0.80357	0.080000	0.17528	0.944000	0.29043	0.909000	0.36697	0.561000	0.74099	GTG		PASS	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297		45	141	---	---	---	---
PLEKHG4	25894	broad.mit.edu	37	16	67318231	67318231	+	Silent	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:67318231G>T	ENST00000360461.5	+	11	4098	c.1563G>T	c.(1561-1563)gcG>gcT	p.A521A	PLEKHG4_ENST00000379344.3_Silent_p.A521A|PLEKHG4_ENST00000450733.1_Silent_p.A440A|PLEKHG4_ENST00000427155.2_Silent_p.A521A	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	521							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A521A(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GCTGGGAGGCGGCTGAACTGG	0.657																																						uc002eso.3																			1	Substitution - coding silent(1)		lung(1)	skin(1)|pancreas(1)	2						c.(1561-1563)GCG>GCT		pleckstrin homology domain containing, family G							19.0	24.0	22.0					16																	67318231		2197	4299	6496	SO:0001819	synonymous_variant	25894				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr16:67318231G>T	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.1563G>T	16.37:g.67318231G>T			Somatic				PLEKHG4_uc002esp.3_Silent_p.A328A|PLEKHG4_uc002esq.3_Silent_p.A521A|PLEKHG4_uc010cef.2_Silent_p.A521A|PLEKHG4_uc002ess.3_Silent_p.A521A|PLEKHG4_uc010ceg.2_Silent_p.A440A	p.A521A	NM_015432	NP_056247	Capture	Illumina GAIIx	Phase_I	Q58EX7	PKHG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)	11	4098	+			521					Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Silent	SNP	ENST00000360461.5	37	c.1563G>T	CCDS32466.1																																																																																				PASS	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432		19	26	---	---	---	---
SF3B3	23450	broad.mit.edu	37	16	70602973	70602973	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:70602973G>A	ENST00000302516.5	+	23	3404	c.3193G>A	c.(3193-3195)Gaa>Aaa	p.E1065K		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	1065					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.E1065K(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CACCAATGATGAAGTAGATGA	0.557																																						uc002ezf.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3193-3195)GAA>AAA		splicing factor 3b, subunit 3							72.0	64.0	67.0					16																	70602973		2198	4300	6498	SO:0001583	missense	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70602973G>A	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.3193G>A	16.37:g.70602973G>A	ENSP00000305790:p.Glu1065Lys		Somatic					p.E1065K	NM_012426	NP_036558	Capture	Illumina GAIIx	Phase_I	Q15393	SF3B3_HUMAN			23	3404	+		Ovarian(137;0.0694)	1065					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	c.3193G>A	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498755	0.85069	.	.	ENSG00000189091	ENST00000302516	T	0.44083	0.93	5.75	5.75	0.90469	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.048916	0.85682	D	0.000000	T	0.44286	0.1286	L	0.49126	1.545	0.80722	D	1	B	0.06786	0.001	B	0.22152	0.038	T	0.22626	-1.0211	10	0.45353	T	0.12	.	19.9434	0.97174	0.0:0.0:1.0:0.0	.	1065	Q15393	SF3B3_HUMAN	K	1065	ENSP00000305790:E1065K	ENSP00000305790:E1065K	E	+	1	0	SF3B3	69160474	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.789000	0.99068	2.710000	0.92621	0.563000	0.77884	GAA		PASS	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		5	35	---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74499645	74499645	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:74499645G>A	ENST00000422840.2	-	19	2595	c.2596C>T	c.(2596-2598)Ctg>Ttg	p.L866L	GLG1_ENST00000205061.5_Silent_p.L866L|GLG1_ENST00000447066.2_Silent_p.L855L|Y_RNA_ENST00000384794.1_RNA	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	866					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.L866L(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						GTCTCCTGCAGCTTAAATACT	0.463																																						uc002fcy.3																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(2596-2598)CTG>TTG		golgi apparatus protein 1 isoform 3							193.0	184.0	187.0					16																	74499645		2198	4300	6498	SO:0001819	synonymous_variant	2734					Golgi membrane|integral to membrane	receptor binding	g.chr16:74499645G>A		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2596C>T	16.37:g.74499645G>A			Somatic				GLG1_uc002fcx.2_Silent_p.L866L|GLG1_uc002fcw.3_Silent_p.L855L|GLG1_uc002fcz.3_Silent_p.L283L	p.L866L	NM_001145667	NP_001139139	Capture	Illumina GAIIx	Phase_I	Q92896	GSLG1_HUMAN			19	2646	-			866			Cys-rich GLG1 13.|Extracellular (Potential).		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	37	c.2596C>T	CCDS45527.1																																																																																				PASS	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		246	356	---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74511410	74511410	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr16:74511410C>T	ENST00000422840.2	-	12	1848	c.1849G>A	c.(1849-1851)Gaa>Aaa	p.E617K	GLG1_ENST00000205061.5_Missense_Mutation_p.E617K|GLG1_ENST00000447066.2_Missense_Mutation_p.E606K	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	617					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.E617K(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CTTTGGACTTCAGCTCGGCAC	0.453																																						uc002fcy.3																			1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1849-1851)GAA>AAA		golgi apparatus protein 1 isoform 3							108.0	87.0	94.0					16																	74511410		2198	4300	6498	SO:0001583	missense	2734					Golgi membrane|integral to membrane	receptor binding	g.chr16:74511410C>T		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1849G>A	16.37:g.74511410C>T	ENSP00000405984:p.Glu617Lys		Somatic				GLG1_uc002fcx.2_Missense_Mutation_p.E617K|GLG1_uc002fcw.3_Missense_Mutation_p.E606K|GLG1_uc002fcz.3_Missense_Mutation_p.E34K	p.E617K	NM_001145667	NP_001139139	Capture	Illumina GAIIx	Phase_I	Q92896	GSLG1_HUMAN			12	1899	-			617			Cys-rich GLG1 9.|Extracellular (Potential).		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	c.1849G>A	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	C	31	5.059782	0.93846	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.77818	0.4187	M	0.70595	2.14	0.80722	D	1	P;P;D	0.54047	0.955;0.858;0.964	P;P;P	0.62184	0.899;0.491;0.831	T	0.80096	-0.1525	9	0.72032	D	0.01	-6.1398	18.8781	0.92346	0.0:1.0:0.0:0.0	.	617;617;606	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	K	617;606;617	.	ENSP00000205061:E617K	E	-	1	0	GLG1	73068911	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	7.811000	0.86092	2.461000	0.83175	0.637000	0.83480	GAA		PASS	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		50	156	---	---	---	---
OR3A4P	390756	broad.mit.edu	37	17	3214467	3214467	+	RNA	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:3214467T>G	ENST00000573491.1	-	0	359																		p.L288R(1)									AGCCCCATGCTGAACCCACTC	0.572																																						uc002fvi.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(862-864)CTG>CGG		RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;							225.0	182.0	197.0					17																	3214467		2203	4300	6503			390756							g.chr17:3214467T>G																													17.37:g.3214467T>G			Somatic					p.L288R	NR_024128		Capture	Illumina GAIIx	Phase_I					1	929	+									Missense_Mutation	SNP	ENST00000573491.1	37	c.863T>G																																																																																					PASS	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000438371.1			201	79	---	---	---	---
SPEM1	374768	broad.mit.edu	37	17	7324849	7324849	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:7324849C>A	ENST00000323675.3	+	3	880	c.855C>A	c.(853-855)taC>taA	p.Y285*	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	285					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.Y285*(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				CCGGCTGCTACCCCCTAGCCT	0.592																																						uc002ggv.2																			1	Substitution - Nonsense(1)		lung(1)		0						c.(853-855)TAC>TAA		spermatid maturation 1							26.0	30.0	29.0					17																	7324849		1954	4139	6093	SO:0001587	stop_gained	374768				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|integral to membrane		g.chr17:7324849C>A	AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.855C>A	17.37:g.7324849C>A	ENSP00000315554:p.Tyr285*		Somatic				FGF11_uc010vtw.1_Nonsense_Mutation_p.Y19*	p.Y285*	NM_199339	NP_955371	Capture	Illumina GAIIx	Phase_I	Q8N4L4	SPEM1_HUMAN			3	880	+		Prostate(122;0.173)	285			Potential.			Nonsense_Mutation	SNP	ENST00000323675.3	37	c.855C>A	CCDS42254.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582559	0.28180	.	.	ENSG00000181323	ENST00000323675	.	.	.	5.65	0.24	0.15489	.	0.162617	0.28482	N	0.015190	.	.	.	.	.	.	0.54753	D	0.999986	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.3607	8.3944	0.32548	0.0:0.5957:0.0:0.4043	.	.	.	.	X	285	.	ENSP00000315554:Y285X	Y	+	3	2	SPEM1	7265573	0.827000	0.29292	0.962000	0.40283	0.022000	0.10575	0.039000	0.13884	0.075000	0.16796	0.655000	0.94253	TAC		PASS	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440932.1	NM_199339		15	34	---	---	---	---
MYH8	4626	broad.mit.edu	37	17	10322230	10322230	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:10322230C>G	ENST00000403437.2	-	4	422	c.328G>C	c.(328-330)Gag>Cag	p.E110Q	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	110	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.E110Q(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GCATAGCGCTCTTTGAGGTTG	0.428									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													uc002gmm.2																			1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(328-330)GAG>CAG		myosin, heavy chain 8, skeletal muscle,							218.0	196.0	204.0					17																	10322230		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10322230C>G		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.328G>C	17.37:g.10322230C>G	ENSP00000384330:p.Glu110Gln		Somatic				uc002gml.1_Intron	p.E110Q	NM_002472	NP_002463	Capture	Illumina GAIIx	Phase_I	P13535	MYH8_HUMAN			4	423	-			110			Myosin head-like.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.328G>C	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253399	0.80135	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.87412	-2.25	3.71	3.71	0.42584	Myosin head, motor domain (2);	0.000000	0.42172	U	0.000755	T	0.81527	0.4841	L	0.35854	1.095	0.58432	D	0.999995	B	0.18310	0.027	B	0.23716	0.048	T	0.76580	-0.2907	10	0.20519	T	0.43	.	15.9995	0.80280	0.0:1.0:0.0:0.0	.	110	P13535	MYH8_HUMAN	Q	110	ENSP00000384330:E110Q	ENSP00000252173:E110Q	E	-	1	0	MYH8	10262955	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.804000	0.69135	2.080000	0.62538	0.460000	0.39030	GAG		PASS	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		223	108	---	---	---	---
MYH1	4619	broad.mit.edu	37	17	10408730	10408730	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:10408730G>T	ENST00000226207.5	-	20	2367	c.2273C>A	c.(2272-2274)aCc>aAc	p.T758N	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	758	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.T758N(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TTTATACTGGGTGTGGTCAAT	0.398																																						uc002gmo.2																			1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(2272-2274)ACC>AAC		myosin, heavy chain 1, skeletal muscle, adult							121.0	119.0	120.0					17																	10408730		2203	4300	6503	SO:0001583	missense	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10408730G>T		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2273C>A	17.37:g.10408730G>T	ENSP00000226207:p.Thr758Asn		Somatic				uc002gml.1_Intron	p.T758N	NM_005963	NP_005954	Capture	Illumina GAIIx	Phase_I	P12882	MYH1_HUMAN			20	2367	-			758			Myosin head-like.		Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	c.2273C>A	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	G	8.498	0.863682	0.17250	.	.	ENSG00000109061	ENST00000226207	D	0.86297	-2.1	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.000000	0.44483	U	0.000453	T	0.78444	0.4284	N	0.16266	0.395	0.46044	D	0.99883	B	0.02656	0.0	B	0.08055	0.003	T	0.72408	-0.4303	10	0.10377	T	0.69	.	19.6961	0.96026	0.0:0.0:1.0:0.0	.	758	P12882	MYH1_HUMAN	N	758	ENSP00000226207:T758N	ENSP00000226207:T758N	T	-	2	0	MYH1	10349455	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.364000	0.34171	2.745000	0.94114	0.650000	0.86243	ACC		PASS	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		182	68	---	---	---	---
RAI1	10743	broad.mit.edu	37	17	17696440	17696440	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:17696440G>C	ENST00000353383.1	+	3	647	c.178G>C	c.(178-180)Gag>Cag	p.E60Q	RAI1_ENST00000261641.6_Missense_Mutation_p.E60Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	60					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.E60Q(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCCGAGCTATGAGGGTGGCGC	0.662																																						uc002grm.2																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(178-180)GAG>CAG		retinoic acid induced 1							22.0	24.0	23.0					17																	17696440		2202	4295	6497	SO:0001583	missense	10743					cytoplasm|nucleus	zinc ion binding	g.chr17:17696440G>C	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.178G>C	17.37:g.17696440G>C	ENSP00000323074:p.Glu60Gln		Somatic				RAI1_uc002grn.1_Missense_Mutation_p.E60Q	p.E60Q	NM_030665	NP_109590	Capture	Illumina GAIIx	Phase_I	Q7Z5J4	RAI1_HUMAN		READ - Rectum adenocarcinoma(1115;0.0276)	3	647	+			60					Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	c.178G>C	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769666	0.49680	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	T;T;T	0.67865	-0.29;2.43;0.3	4.55	4.55	0.56014	.	0.089271	0.46145	D	0.000314	T	0.67192	0.2867	L	0.54323	1.7	0.31906	N	0.61528	P	0.45044	0.849	P	0.45377	0.478	T	0.73430	-0.3985	10	0.36615	T	0.2	.	16.9106	0.86139	0.0:0.0:1.0:0.0	.	60	Q7Z5J4	RAI1_HUMAN	Q	60	ENSP00000323074:E60Q;ENSP00000379120:E60Q;ENSP00000261641:E60Q	ENSP00000261641:E60Q	E	+	1	0	RAI1	17637165	1.000000	0.71417	0.803000	0.32268	0.368000	0.29767	3.286000	0.51724	2.074000	0.62210	0.462000	0.41574	GAG		PASS	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665		26	9	---	---	---	---
C17orf53	78995	broad.mit.edu	37	17	42225981	42225981	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:42225981G>A	ENST00000319977.4	+	3	1047	c.810G>A	c.(808-810)ccG>ccA	p.P270P	C17orf53_ENST00000585683.1_Silent_p.P270P|C17orf53_ENST00000245382.6_Silent_p.P270P	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	270								p.P270P(2)		NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AAGTCTGTCCGCAACGCTCCC	0.562																																						uc002ifi.1																			2	Substitution - coding silent(2)		large_intestine(1)|lung(1)		0						c.(808-810)CCG>CCA		hypothetical protein LOC78995							114.0	102.0	106.0					17																	42225981		2203	4300	6503	SO:0001819	synonymous_variant	78995							g.chr17:42225981G>A	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.810G>A	17.37:g.42225981G>A			Somatic				C17orf53_uc010czq.1_Silent_p.P270P|C17orf53_uc002ifj.1_Silent_p.P270P|C17orf53_uc002ifk.1_RNA	p.P270P	NM_024032	NP_076937	Capture	Illumina GAIIx	Phase_I	Q8N3J3	CQ053_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.114)	3	995	+		Breast(137;0.0364)|Prostate(33;0.0376)	270					A8K7A9|Q9BWM9|Q9HAI1	Silent	SNP	ENST00000319977.4	37	c.810G>A	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	A	3.696	-0.062627	0.07273	.	.	ENSG00000125319	ENST00000253405	.	.	.	3.9	-2.33	0.06724	.	.	.	.	.	T	0.19565	0.0470	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.24048	-1.0171	5	0.29301	T	0.29	-3.2336	1.0994	0.01680	0.1794:0.2246:0.1418:0.4542	.	.	.	.	T	124	.	ENSP00000253405:A124T	A	+	1	0	C17orf53	39581507	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.524000	0.02233	-0.601000	0.05783	-0.381000	0.06696	GCA		PASS	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032		80	311	---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54428148	54428148	+	Silent	SNP	G	G	C	rs370848906		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:54428148G>C	ENST00000318698.2	+	4	254	c.219G>C	c.(217-219)acG>acC	p.T73T	ANKFN1_ENST00000566473.2_Silent_p.T73T	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	73								p.T73T(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TGAAAATGACGCAACAAATGC	0.388																																						uc002iun.1																			1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(217-219)ACG>ACC		ankyrin-repeat and fibronectin type III domain							99.0	98.0	98.0					17																	54428148		2203	4300	6503	SO:0001819	synonymous_variant	162282							g.chr17:54428148G>C	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.219G>C	17.37:g.54428148G>C			Somatic					p.T73T	NM_153228	NP_694960	Capture	Illumina GAIIx	Phase_I	Q8N957	ANKF1_HUMAN			4	254	+			73						Silent	SNP	ENST00000318698.2	37	c.219G>C	CCDS32686.1																																																																																				PASS	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		46	243	---	---	---	---
USP32	84669	broad.mit.edu	37	17	58260814	58260814	+	Splice_Site	SNP	T	T	C	rs35400453		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:58260814T>C	ENST00000300896.4	-	31	4029	c.3835A>G	c.(3835-3837)Att>Gtt	p.I1279V	USP32_ENST00000592339.1_Splice_Site_p.I949V	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1279	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.I1279V(1)		NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AGGTGAATAATCTGGAGAAGT	0.323																																						uc002iyo.1																			1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|large_intestine(1)	5						c.(3835-3837)ATT>GTT		ubiquitin specific protease 32							57.0	65.0	62.0					17																	58260814		2201	4299	6500	SO:0001630	splice_region_variant	84669				protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr17:58260814T>C	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3835-1A>G	17.37:g.58260814T>C			Somatic				USP32_uc002iyn.1_Missense_Mutation_p.I949V	p.I1279V	NM_032582	NP_115971	Capture	Illumina GAIIx	Phase_I	Q8NFA0	UBP32_HUMAN	Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)		31	4121	-	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		1279					Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	c.3835A>G	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.217500	0.79352	.	.	ENSG00000170832	ENST00000300896	T	0.32272	1.46	5.81	5.81	0.92471	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.26122	0.0637	N	0.20530	0.585	0.80722	D	1	P	0.48089	0.905	P	0.47376	0.545	T	0.03231	-1.1058	10	0.10902	T	0.67	.	16.1652	0.81750	0.0:0.0:0.0:1.0	.	1279	Q8NFA0	UBP32_HUMAN	V	1279	ENSP00000300896:I1279V	ENSP00000300896:I1279V	I	-	1	0	USP32	55615596	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.566000	0.82347	2.208000	0.71279	0.528000	0.53228	ATT		PASS	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	Missense_Mutation	118	97	---	---	---	---
ABCA8	10351	broad.mit.edu	37	17	66871872	66871872	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:66871872T>C	ENST00000269080.2	-	34	4390	c.4253A>G	c.(4252-4254)cAg>cGg	p.Q1418R	ABCA8_ENST00000586539.1_Missense_Mutation_p.Q1458R|ABCA8_ENST00000430352.2_Missense_Mutation_p.Q1458R	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1418	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.Q1418R(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CCGGATGGCCTGCCTATAATG	0.453																																						uc002jhp.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(4252-4254)CAG>CGG		ATP-binding cassette, sub-family A member 8							56.0	48.0	51.0					17																	66871872		2203	4300	6503	SO:0001583	missense	10351					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr17:66871872T>C	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4253A>G	17.37:g.66871872T>C	ENSP00000269080:p.Gln1418Arg		Somatic				ABCA8_uc002jhq.2_Missense_Mutation_p.Q1458R|ABCA8_uc010wqq.1_Missense_Mutation_p.Q1453R	p.Q1418R	NM_007168	NP_009099	Capture	Illumina GAIIx	Phase_I	O94911	ABCA8_HUMAN			34	4432	-	Breast(10;4.56e-13)		1418			ABC transporter 2.		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	c.4253A>G	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	T	8.283	0.816002	0.16607	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	T;T	0.13420	2.59;2.59	4.36	4.36	0.52297	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.132740	0.34268	N	0.004108	T	0.10337	0.0253	N	0.11364	0.135	0.31052	N	0.71506	P;B;P	0.51933	0.949;0.086;0.502	P;B;B	0.51016	0.656;0.051;0.134	T	0.04635	-1.0937	10	0.30078	T	0.28	.	7.977	0.30161	0.0:0.0923:0.0:0.9077	.	1458;1458;1418	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	R	1418;1458	ENSP00000269080:Q1418R;ENSP00000402814:Q1458R	ENSP00000269080:Q1418R	Q	-	2	0	ABCA8	64383467	0.978000	0.34361	1.000000	0.80357	0.551000	0.35334	1.129000	0.31381	1.976000	0.57569	0.528000	0.53228	CAG		PASS	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168		12	102	---	---	---	---
TSEN54	283989	broad.mit.edu	37	17	73512834	73512834	+	Nonsense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:73512834G>T	ENST00000333213.6	+	2	100	c.64G>T	c.(64-66)Gag>Tag	p.E22*	TSEN54_ENST00000580013.1_3'UTR|CASKIN2_ENST00000581870.1_5'Flank|CASKIN2_ENST00000321617.3_5'Flank	NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	22					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)		p.E22*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGCGCCCGGGAGCTCTTCGC	0.776																																						uc002jof.1																			1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(64-66)GAG>TAG		tRNA splicing endonuclease 54 homolog							6.0	7.0	7.0					17																	73512834		1255	3025	4280	SO:0001587	stop_gained	283989				mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus		g.chr17:73512834G>T	AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.64G>T	17.37:g.73512834G>T	ENSP00000327487:p.Glu22*		Somatic				CASKIN2_uc002joc.2_5'Flank|CASKIN2_uc002jod.2_5'Flank|TSEN54_uc002joe.1_Nonsense_Mutation_p.E22*	p.E22*	NM_207346	NP_997229	Capture	Illumina GAIIx	Phase_I	Q7Z6J9	SEN54_HUMAN	all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)		2	97	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		22					Q86WV3|Q86XE4|Q8N9H2	Nonsense_Mutation	SNP	ENST00000333213.6	37	c.64G>T	CCDS11724.1	.	.	.	.	.	.	.	.	.	.	G	33	5.261685	0.95368	.	.	ENSG00000182173	ENST00000333213;ENST00000545228	.	.	.	3.93	3.93	0.45458	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-8.1309	16.095	0.81114	0.0:0.0:1.0:0.0	.	.	.	.	X	22	.	ENSP00000327487:E22X	E	+	1	0	TSEN54	71024429	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	5.940000	0.70187	2.205000	0.71048	0.448000	0.29417	GAG		PASS	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447618.1	NM_207346		12	9	---	---	---	---
SRSF2	6427	broad.mit.edu	37	17	74732326	74732326	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:74732326C>G	ENST00000392485.2	-	2	755	c.583G>C	c.(583-585)Gtg>Ctg	p.V195L	SRSF2_ENST00000508921.3_Missense_Mutation_p.V183L|MFSD11_ENST00000590514.1_5'Flank|MFSD11_ENST00000593181.1_5'Flank|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000586622.1_5'UTR|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000336509.4_5'Flank|SRSF2_ENST00000359995.5_Missense_Mutation_p.V195L|MFSD11_ENST00000355954.3_5'Flank|MFSD11_ENST00000588460.1_5'Flank|MFSD11_ENST00000591864.1_5'Flank	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	195	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)	p.V175L(1)|p.V195L(1)		haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						CTCTTGGACACTGGGGGAGGA	0.572			Mis		"""MDS, CLL"""																																	uc002jsv.2				Dom	yes		17	17q25	6427		serine/arginine-rich splicing factor 2			L					2	Substitution - Missense(2)		lung(2)		0						c.(583-585)GTG>CTG		splicing factor, arginine/serine-rich 2							92.0	88.0	89.0					17																	74732326		2203	4300	6503	SO:0001583	missense	6427				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity	g.chr17:74732326C>G	M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.583G>C	17.37:g.74732326C>G	ENSP00000376276:p.Val195Leu		Somatic				SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Missense_Mutation_p.V195L|SFRS2_uc010wtg.1_Missense_Mutation_p.V183L|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	p.V195L	NM_003016	NP_003007	Capture	Illumina GAIIx	Phase_I	Q01130	SRSF2_HUMAN			2	753	-			195			Arg/Ser-rich (RS domain).		B3KWD5|B4DN89|H0YG49	Missense_Mutation	SNP	ENST00000392485.2	37	c.583G>C	CCDS11749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.26|13.26	2.185226|2.185226	0.38609|0.38609	.|.	.|.	ENSG00000161547|ENSG00000161547	ENST00000452355|ENST00000392485;ENST00000508921;ENST00000358156;ENST00000359995	.|T	.|0.13901	.|2.55	5.09|5.09	4.12|4.12	0.48240|0.48240	.|.	.|0.458028	.|0.17306	.|N	.|0.179044	T|T	0.10294|0.10294	0.0252|0.0252	L|L	0.36672|0.36672	1.1|1.1	0.58432|0.58432	D|D	0.999998|0.999998	.|B;B	.|0.25105	.|0.063;0.118	.|B;B	.|0.19666	.|0.026;0.026	T|T	0.11084|0.11084	-1.0602|-1.0602	6|10	0.62326|0.14252	D|T	0.03|0.57	.|.	9.9391|9.9391	0.41570|0.41570	0.0:0.8366:0.0:0.1634|0.0:0.8366:0.0:0.1634	.|.	.|183;195	.|B4DN89;Q01130	.|.;SRSF2_HUMAN	H|L	144|195;222;183;175	.|ENSP00000376276:V195L	ENSP00000391278:Q144H|ENSP00000350877:V183L	Q|V	-|-	3|1	2|0	SRSF2|SRSF2	72243921|72243921	0.240000|0.240000	0.23847|0.23847	0.734000|0.734000	0.30879|0.30879	0.736000|0.736000	0.42039|0.42039	1.199000|1.199000	0.32235|0.32235	1.122000|1.122000	0.41944|0.41944	0.655000|0.655000	0.94253|0.94253	CAG|GTG		PASS	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1	NM_003016		6	332	---	---	---	---
USP36	57602	broad.mit.edu	37	17	76795029	76795029	+	Silent	SNP	G	G	A	rs200528045		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:76795029G>A	ENST00000542802.3	-	19	3644	c.3201C>T	c.(3199-3201)acC>acT	p.T1067T	USP36_ENST00000449938.2_Silent_p.T672T|USP36_ENST00000312010.6_Silent_p.T1067T			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1065					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.T1067T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CATCAACCACGGTCTCAGTCC	0.587																																						uc002jvz.1																			1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)|breast(1)|kidney(1)	5						c.(3199-3201)ACC>ACT		ubiquitin specific peptidase 36		G		1,4405	2.1+/-5.4	0,1,2202	318.0	249.0	272.0		3201	-8.0	0.0	17		272	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	USP36	NM_025090.3		0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308		1067/1124	76795029	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	57602				ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr17:76795029G>A	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.3201C>T	17.37:g.76795029G>A			Somatic				USP36_uc002jwa.1_Silent_p.T1067T|USP36_uc002jvy.1_Silent_p.T127T	p.T1067T	NM_025090	NP_079366	Capture	Illumina GAIIx	Phase_I	Q9P275	UBP36_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)		19	3526	-			1065					Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	c.3201C>T	CCDS32755.1																																																																																				PASS	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090		68	343	---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80828207	80828207	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:80828207C>T	ENST00000355528.4	+	14	1556	c.1426C>T	c.(1426-1428)Cgt>Tgt	p.R476C	TBCD_ENST00000539345.2_Missense_Mutation_p.R476C|TBCD_ENST00000397466.2_Missense_Mutation_p.R90C	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	476					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)	p.R476C(2)				Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GGCCTTCGCGCGTGCCTATGA	0.652																																						uc002kfz.2																			2	Substitution - Missense(2)		lung(2)		0						c.(1426-1428)CGT>TGT		beta-tubulin cofactor D							35.0	41.0	39.0					17																	80828207		2158	4255	6413	SO:0001583	missense	6904				'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity	g.chr17:80828207C>T	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1426C>T	17.37:g.80828207C>T	ENSP00000347719:p.Arg476Cys		Somatic				TBCD_uc002kfx.1_Missense_Mutation_p.R459C|TBCD_uc002kfy.1_Missense_Mutation_p.R476C	p.R476C	NM_005993	NP_005984	Capture	Illumina GAIIx	Phase_I	Q9BTW9	TBCD_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)		14	1556	+	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	476					O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	c.1426C>T	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374172	0.82573	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.51817	0.69;0.69	5.53	5.53	0.82687	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	H	0.96970	3.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86301	0.1680	9	.	.	.	.	16.1871	0.81960	0.0:1.0:0.0:0.0	.	476;476;476	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	C	476;227;90;476	ENSP00000347719:R476C;ENSP00000380608:R90C	.	R	+	1	0	TBCD	78421496	0.981000	0.34729	0.829000	0.32907	0.912000	0.54170	2.571000	0.45990	2.591000	0.87537	0.655000	0.94253	CGT		PASS	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993		45	41	---	---	---	---
ASXL3	80816	broad.mit.edu	37	18	31320005	31320005	+	Silent	SNP	A	A	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr18:31320005A>C	ENST00000269197.5	+	11	2637	c.2637A>C	c.(2635-2637)tcA>tcC	p.S879S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	879					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S586S(1)|p.S879S(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGTTACCTTCACCATTGGAAT	0.368																																						uc010dmg.1																			2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(2635-2637)TCA>TCC		additional sex combs like 3							100.0	99.0	99.0					18																	31320005		1852	4091	5943	SO:0001819	synonymous_variant	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31320005A>C	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2637A>C	18.37:g.31320005A>C			Somatic				ASXL3_uc002kxq.2_Silent_p.S586S	p.S879S	NM_030632	NP_085135	Capture	Illumina GAIIx	Phase_I	Q9C0F0	ASXL3_HUMAN			11	2692	+			879					Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	c.2637A>C	CCDS45847.1																																																																																				PASS	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			10	97	---	---	---	---
NOL4	8715	broad.mit.edu	37	18	31673472	31673472	+	Silent	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr18:31673472T>C	ENST00000261592.5	-	5	1026	c.729A>G	c.(727-729)gaA>gaG	p.E243E	NOL4_ENST00000269185.4_Silent_p.E129E|NOL4_ENST00000589544.1_Silent_p.E243E|NOL4_ENST00000538587.1_Silent_p.E169E|NOL4_ENST00000535475.1_Silent_p.E88E	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	243						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.E243E(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GCATTCTTTCTTCAAGATTGG	0.373																																						uc010dmi.2																			1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(727-729)GAA>GAG		nucleolar protein 4							137.0	131.0	133.0					18																	31673472		2203	4300	6503	SO:0001819	synonymous_variant	8715					nucleolus	RNA binding	g.chr18:31673472T>C	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.729A>G	18.37:g.31673472T>C			Somatic				NOL4_uc002kxr.3_Silent_p.E79E|NOL4_uc010xbt.1_Silent_p.E169E|NOL4_uc010dmh.2_Silent_p.E169E|NOL4_uc010xbu.1_Silent_p.E243E|NOL4_uc002kxt.3_Silent_p.E243E|NOL4_uc010xbw.1_Silent_p.E129E	p.E243E	NM_003787	NP_003778	Capture	Illumina GAIIx	Phase_I	O94818	NOL4_HUMAN			5	958	-			243					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Silent	SNP	ENST00000261592.5	37	c.729A>G	CCDS11907.2																																																																																				PASS	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		49	158	---	---	---	---
SLC14A1	6563	broad.mit.edu	37	18	43329865	43329865	+	Silent	SNP	C	C	T	rs371595134		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr18:43329865C>T	ENST00000321925.4	+	10	1351	c.1119C>T	c.(1117-1119)aaC>aaT	p.N373N	SLC14A1_ENST00000502059.2_Silent_p.N265N|SLC14A1_ENST00000436407.3_Silent_p.N429N|SLC14A1_ENST00000415427.3_Silent_p.N429N|SLC14A1_ENST00000535474.1_Silent_p.N241N|SLC14A1_ENST00000591541.1_Silent_p.N77N|SLC14A1_ENST00000402943.2_Silent_p.N268N|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000586142.1_Silent_p.N373N|SLC14A1_ENST00000589700.1_3'UTR	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	373					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)	p.N429N(1)|p.N373N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						CTGAAGAAAACCGCATCTTCT	0.463																																						uc010xcn.1																			2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(1117-1119)AAC>AAT		solute carrier family 14 (urea transporter),							133.0	130.0	131.0					18																	43329865		2203	4300	6503	SO:0001819	synonymous_variant	6563					integral to plasma membrane	urea transmembrane transporter activity	g.chr18:43329865C>T	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.1119C>T	18.37:g.43329865C>T			Somatic				SLC14A1_uc010dnk.2_Silent_p.N429N|SLC14A1_uc002lbf.3_Silent_p.N373N|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Silent_p.N268N|SLC14A1_uc002lbh.3_Silent_p.N265N|SLC14A1_uc002lbi.3_Silent_p.N241N|SLC14A1_uc002lbj.3_Silent_p.N429N|SLC14A1_uc002lbk.3_Silent_p.N373N	p.N373N	NM_001146036	NP_001139508	Capture	Illumina GAIIx	Phase_I	Q13336	UT1_HUMAN			11	1438	+			373					A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	ENST00000321925.4	37	c.1119C>T	CCDS11925.1																																																																																				PASS	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865		83	122	---	---	---	---
MAPK4	5596	broad.mit.edu	37	18	48190555	48190555	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr18:48190555A>G	ENST00000400384.2	+	2	1263	c.227A>G	c.(226-228)aAc>aGc	p.N76S	MAPK4_ENST00000592595.1_Missense_Mutation_p.N76S|MAPK4_ENST00000588540.1_Missense_Mutation_p.N76S|MAPK4_ENST00000540640.1_Intron	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	76	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.N76S(1)		lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		GACCACGACAACATCGTCAAA	0.582																																						uc002lev.2																			1	Substitution - Missense(1)		lung(1)	lung(4)|skin(2)	6						c.(226-228)AAC>AGC		mitogen-activated protein kinase 4							66.0	69.0	68.0					18																	48190555		2185	4278	6463	SO:0001583	missense	5596				cell cycle		ATP binding|MAP kinase activity	g.chr18:48190555A>G	X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.227A>G	18.37:g.48190555A>G	ENSP00000383234:p.Asn76Ser		Somatic				MAPK4_uc010xdm.1_Intron|MAPK4_uc010doz.2_Missense_Mutation_p.N76S	p.N76S	NM_002747	NP_002738	Capture	Illumina GAIIx	Phase_I	P31152	MK04_HUMAN		Colorectal(21;0.156)	2	1227	+		Colorectal(6;0.0297)	76			Protein kinase.		A1A4C4|Q0VG04	Missense_Mutation	SNP	ENST00000400384.2	37	c.227A>G	CCDS42437.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.937669	0.92458	.	.	ENSG00000141639	ENST00000400384	T	0.56103	0.48	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76399	0.3982	M	0.86420	2.815	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80973	-0.1143	10	0.87932	D	0	-1.446	15.2414	0.73474	1.0:0.0:0.0:0.0	.	76;76	Q0VG04;P31152	.;MK04_HUMAN	S	76	ENSP00000383234:N76S	ENSP00000383234:N76S	N	+	2	0	MAPK4	46444553	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.336000	0.96533	2.243000	0.73865	0.459000	0.35465	AAC		PASS	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448631.2	NM_002747		29	75	---	---	---	---
ALPK2	115701	broad.mit.edu	37	18	56196470	56196470	+	Splice_Site	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr18:56196470G>A	ENST00000361673.3	-	6	5567	c.5354C>T	c.(5353-5355)gCt>gTt	p.A1785V		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1785						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A1785V(1)|p.A1146V(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TAATACTGGAGCTAGAAACAA	0.333																																						uc002lhj.3																			2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(5353-5355)GCT>GTT		heart alpha-kinase							79.0	79.0	79.0					18																	56196470		2203	4300	6503	SO:0001630	splice_region_variant	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56196470G>A	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5354-1C>T	18.37:g.56196470G>A			Somatic				ALPK2_uc002lhk.1_Missense_Mutation_p.A1116V	p.A1785V	NM_052947	NP_443179	Capture	Illumina GAIIx	Phase_I	Q86TB3	ALPK2_HUMAN			6	5568	-			1785					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.5354C>T	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285513	0.80803	.	.	ENSG00000198796	ENST00000361673	T	0.57907	0.37	5.59	4.71	0.59529	.	0.101382	0.43747	D	0.000539	T	0.69124	0.3076	M	0.71581	2.175	0.38387	D	0.945294	D;P	0.54772	0.968;0.946	P;P	0.60541	0.876;0.756	T	0.75337	-0.3353	10	0.59425	D	0.04	.	16.2678	0.82600	0.0:0.1328:0.8672:0.0	.	1780;1785	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	V	1785	ENSP00000354991:A1785V	ENSP00000354991:A1785V	A	-	2	0	ALPK2	54347450	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.636000	0.61339	1.344000	0.45657	0.655000	0.94253	GCT		PASS	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	Missense_Mutation	48	132	---	---	---	---
ZNF532	55205	broad.mit.edu	37	18	56620813	56620813	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr18:56620813A>G	ENST00000336078.4	+	8	3708	c.2932A>G	c.(2932-2934)Agc>Ggc	p.S978G	ZNF532_ENST00000591083.1_Missense_Mutation_p.S978G|ZNF532_ENST00000591230.1_Missense_Mutation_p.S978G|ZNF532_ENST00000591808.1_Missense_Mutation_p.S978G|ZNF532_ENST00000589288.1_Missense_Mutation_p.S978G	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	978					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S978G(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CTTGCCTTTGAGCATTAAGCC	0.353																																						uc002lho.2																			1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(2932-2934)AGC>GGC		zinc finger protein 532							38.0	41.0	40.0					18																	56620813		2198	4291	6489	SO:0001583	missense	55205				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:56620813A>G	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2932A>G	18.37:g.56620813A>G	ENSP00000338217:p.Ser978Gly		Somatic				ZNF532_uc002lhp.2_Missense_Mutation_p.S976G|ZNF532_uc010xeg.1_Missense_Mutation_p.S976G|ZNF532_uc002lhr.2_Missense_Mutation_p.S976G|ZNF532_uc002lhs.2_Missense_Mutation_p.S976G|ZNF532_uc010xeh.1_Missense_Mutation_p.S70G	p.S978G	NM_018181	NP_060651	Capture	Illumina GAIIx	Phase_I	Q9HCE3	ZN532_HUMAN			8	3479	+			978					Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	c.2932A>G	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.787962	0.49997	.	.	ENSG00000074657	ENST00000336078	T	0.01665	4.7	4.96	4.96	0.65561	.	0.215664	0.56097	D	0.000038	T	0.02304	0.0071	L	0.44542	1.39	0.49051	D	0.999743	B;B	0.31383	0.006;0.321	B;B	0.22880	0.006;0.042	T	0.58387	-0.7645	10	0.45353	T	0.12	-15.5122	14.5791	0.68274	1.0:0.0:0.0:0.0	.	978;978	B3KXW2;Q9HCE3	.;ZN532_HUMAN	G	978	ENSP00000338217:S978G	ENSP00000338217:S978G	S	+	1	0	ZNF532	54771793	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.763000	0.74955	1.991000	0.58162	0.519000	0.50382	AGC		PASS	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181		30	96	---	---	---	---
GIPC3	126326	broad.mit.edu	37	19	3586840	3586840	+	Missense_Mutation	SNP	G	G	A	rs141293401	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:3586840G>A	ENST00000322315.5	+	3	485	c.440G>A	c.(439-441)cGg>cAg	p.R147Q		NM_133261.2	NP_573568.1	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	147	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.							p.R147Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCATCAACCGGATCGAGGCA	0.622											OREG0025154	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002lyd.3																			1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(439-441)CGG>CAG		GIPC PDZ domain containing family, member 3		G	GLN/ARG	0,4404		0,0,2202	51.0	49.0	50.0		440	4.4	1.0	19	dbSNP_134	50	3,8597	3.0+/-9.4	0,3,4297	yes	missense	GIPC3	NM_133261.2	43	0,3,6499	AA,AG,GG		0.0349,0.0,0.0231	benign	147/313	3586840	3,13001	2202	4300	6502	SO:0001583	missense	126326							g.chr19:3586840G>A	AB073738	CCDS32871.1	19p13.3	2011-11-29				ENSG00000179855			18183	protein-coding gene	gene with protein product		608792	"""chromosome 19 open reading frame 64"", ""deafness, autosomal recessive 72"", ""deafness, autosomal recessive 15"""	C19orf64, DFNB72, DFNB15		11836571, 21326233	Standard	NM_133261		Approved	DFNB95	uc002lyd.4	Q8TF64		ENST00000322315.5:c.440G>A	19.37:g.3586840G>A	ENSP00000319254:p.Arg147Gln		Somatic	OREG0025154	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	612		p.R147Q	NM_133261	NP_573568	Capture	Illumina GAIIx	Phase_I	Q8TF64	GIPC3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)	3	467	+			147			PDZ.		O75227	Missense_Mutation	SNP	ENST00000322315.5	37	c.440G>A	CCDS32871.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932905	0.52866	0.0	3.49E-4	ENSG00000179855	ENST00000322315	T	0.29397	1.57	4.45	4.45	0.53987	PDZ/DHR/GLGF (4);	0.064322	0.64402	D	0.000013	T	0.20861	0.0502	N	0.25031	0.7	0.58432	D	0.999997	B	0.33612	0.419	B	0.27796	0.083	T	0.05699	-1.0869	10	0.37606	T	0.19	-21.8488	15.6785	0.77349	0.0:0.0:1.0:0.0	.	147	Q8TF64	GIPC3_HUMAN	Q	147	ENSP00000319254:R147Q	ENSP00000319254:R147Q	R	+	2	0	GIPC3	3537840	0.949000	0.32298	0.960000	0.40013	0.881000	0.50899	3.078000	0.50096	2.016000	0.59253	0.561000	0.74099	CGG		PASS	GIPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394577.1	NM_133261		26	13	---	---	---	---
ZNF317	57693	broad.mit.edu	37	19	9267288	9267288	+	Splice_Site	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:9267288C>G	ENST00000247956.6	+	3	331	c.26C>G	c.(25-27)gCc>gGc	p.A9G	ZNF317_ENST00000360385.3_Splice_Site_p.A9G	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A9G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						TCTCCTCCAGCCACGTCCACC	0.483																																						uc002mku.2																			1	Substitution - Missense(1)		lung(1)		0						c.(25-27)GCC>GGC		zinc finger protein 317							160.0	160.0	160.0					19																	9267288		2203	4300	6503	SO:0001630	splice_region_variant	57693				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9267288C>G	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.26-1C>G	19.37:g.9267288C>G			Somatic				ZNF317_uc010xkm.1_Silent_p.V50V|ZNF317_uc002mkv.2_5'UTR|ZNF317_uc002mkw.2_Missense_Mutation_p.A9G|ZNF317_uc002mkx.2_5'UTR|ZNF317_uc002mky.2_5'UTR	p.A9G	NM_020933	NP_065984	Capture	Illumina GAIIx	Phase_I	Q96PQ6	ZN317_HUMAN			3	301	+			9					Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	ENST00000247956.6	37	c.26C>G	CCDS12210.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.76|13.76	2.333718|2.333718	0.41297|0.41297	.|.	.|.	ENSG00000130803|ENSG00000130803	ENST00000247956;ENST00000360385|ENST00000419608	T;T|.	0.09817|.	3.36;2.94|.	3.05|3.05	2.01|2.01	0.26516|0.26516	.|.	0.000000|.	0.34828|.	N|.	0.003641|.	T|T	0.16811|0.16811	0.0404|0.0404	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	D;D|.	0.63880|.	0.99;0.993|.	D;D|.	0.70935|.	0.971;0.968|.	T|T	0.24333|0.24333	-1.0163|-1.0163	9|5	.|.	.|.	.|.	.|.	5.9478|5.9478	0.19229|0.19229	0.0:0.8533:0.0:0.1467|0.0:0.8533:0.0:0.1467	.|.	9;9|.	Q96PQ6-2;Q96PQ6|.	.;ZN317_HUMAN|.	G|C	9|23	ENSP00000247956:A9G;ENSP00000353554:A9G|.	.|.	A|S	+|+	2|2	0|0	ZNF317|ZNF317	9128288|9128288	0.001000|0.001000	0.12720|0.12720	0.096000|0.096000	0.21009|0.21009	0.008000|0.008000	0.06430|0.06430	0.154000|0.154000	0.16343|0.16343	0.839000|0.839000	0.34971|0.34971	0.591000|0.591000	0.81541|0.81541	GCC|TCC		PASS	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933	Missense_Mutation	116	171	---	---	---	---
TYK2	7297	broad.mit.edu	37	19	10469918	10469918	+	Missense_Mutation	SNP	C	C	A	rs552478414		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:10469918C>A	ENST00000525621.1	-	15	2589	c.2108G>T	c.(2107-2109)cGg>cTg	p.R703L	TYK2_ENST00000529370.1_Missense_Mutation_p.R703L|TYK2_ENST00000524462.1_Missense_Mutation_p.R518L|TYK2_ENST00000264818.6_Missense_Mutation_p.R703L	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	703	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> W (in dbSNP:rs55882956). {ECO:0000269|PubMed:17344846}.		cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.R703L(1)		breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CACATGGCCCCGCTCCCTCCG	0.637																																						uc002moc.3																			1	Substitution - Missense(1)		lung(1)	lung(5)|large_intestine(2)|ovary(1)|breast(1)	9						c.(2107-2109)CGG>CTG		tyrosine kinase 2							43.0	35.0	38.0					19																	10469918		2203	4300	6503	SO:0001583	missense	7297				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:10469918C>A		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.2108G>T	19.37:g.10469918C>A	ENSP00000431885:p.Arg703Leu		Somatic				TYK2_uc010dxe.2_Missense_Mutation_p.R518L|TYK2_uc002mod.2_Missense_Mutation_p.R703L	p.R703L	NM_003331	NP_003322	Capture	Illumina GAIIx	Phase_I	P29597	TYK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)		15	2486	-			703			Protein kinase 1.		Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	37	c.2108G>T	CCDS12236.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595655	0.28445	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.0	1.59	0.23543	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.229174	0.28828	N	0.014011	T	0.49474	0.1559	L	0.56124	1.755	0.38825	D	0.955725	P;B	0.46859	0.885;0.007	B;B	0.38562	0.276;0.015	T	0.52660	-0.8546	10	0.66056	D	0.02	-25.0746	5.8182	0.18512	0.0:0.5919:0.0:0.4081	.	703;703	E9PPF2;P29597	.;TYK2_HUMAN	L	518;703;703;450;703	ENSP00000433203:R518L;ENSP00000431885:R703L;ENSP00000264818:R703L;ENSP00000432728:R703L	ENSP00000264818:R703L	R	-	2	0	TYK2	10330918	0.008000	0.16893	0.912000	0.35992	0.165000	0.22458	0.407000	0.21049	0.715000	0.32103	0.655000	0.94253	CGG		PASS	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			8	7	---	---	---	---
KEAP1	9817	broad.mit.edu	37	19	10602850	10602850	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:10602850G>C	ENST00000171111.5	-	3	1275	c.728C>G	c.(727-729)tCc>tGc	p.S243C	KEAP1_ENST00000588024.1_5'UTR|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Missense_Mutation_p.S243C	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	243	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.S243C(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GAAGACCTCGGACTCGCAGCG	0.632																																						uc002moq.1																			1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(727-729)TCC>TGC		kelch-like ECH-associated protein 1							71.0	61.0	65.0					19																	10602850		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602850G>C	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.728C>G	19.37:g.10602850G>C	ENSP00000171111:p.Ser243Cys		Somatic				KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.S243C	p.S243C	NM_012289	NP_036421	Capture	Illumina GAIIx	Phase_I	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	884	-			243			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.728C>G	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740676	0.89573	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.69806	-0.43;-0.43	5.84	5.84	0.93424	BTB/Kelch-associated (2);	0.316972	0.35805	N	0.002968	T	0.79764	0.4502	L	0.57536	1.79	0.58432	D	0.999999	D	0.89917	1.0	D	0.72338	0.977	T	0.80542	-0.1336	10	0.87932	D	0	.	17.6518	0.88167	0.0:0.0:1.0:0.0	.	243	Q14145	KEAP1_HUMAN	C	243	ENSP00000171111:S243C;ENSP00000377245:S243C	ENSP00000171111:S243C	S	-	2	0	KEAP1	10463850	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.322000	0.52007	2.767000	0.95098	0.555000	0.69702	TCC		PASS	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		45	24	---	---	---	---
KANK2	25959	broad.mit.edu	37	19	11304076	11304076	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:11304076G>A	ENST00000586659.1	-	4	994	c.680C>T	c.(679-681)aCa>aTa	p.T227I	KANK2_ENST00000589894.1_Missense_Mutation_p.T227I|KANK2_ENST00000432929.2_Missense_Mutation_p.T227I|KANK2_ENST00000589359.1_Missense_Mutation_p.T227I|KANK2_ENST00000355150.5_Missense_Mutation_p.T227I			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	227					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)		p.T227I(1)		endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AAGTTGTACTGTGAGCTGCCG	0.652																																						uc010dxv.2																			1	Substitution - Missense(1)		lung(1)		0						c.(679-681)ACA>ATA		ankyrin repeat domain 25 isoform 1							26.0	27.0	27.0					19																	11304076		2183	4236	6419	SO:0001583	missense	25959							g.chr19:11304076G>A	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.680C>T	19.37:g.11304076G>A	ENSP00000465650:p.Thr227Ile		Somatic				KANK2_uc002mqm.2_Missense_Mutation_p.T227I|KANK2_uc002mqo.3_Missense_Mutation_p.T227I|KANK2_uc002mqp.1_Missense_Mutation_p.T36I|KANK2_uc002mqq.2_Missense_Mutation_p.T227I	p.T227I	NM_015493	NP_056308	Capture	Illumina GAIIx	Phase_I	Q63ZY3	KANK2_HUMAN			6	1238	-			227			Potential.		B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	ENST00000586659.1	37	c.680C>T	CCDS12255.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109570	0.37242	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.37235	1.21;1.23	4.11	3.02	0.34903	.	0.062514	0.64402	D	0.000012	T	0.19644	0.0472	N	0.08118	0	0.31326	N	0.685395	B;B;P	0.36465	0.275;0.041;0.554	B;B;B	0.38712	0.159;0.039;0.28	T	0.14364	-1.0475	10	0.37606	T	0.19	-28.577	10.1279	0.42661	0.0:0.4869:0.5131:0.0	.	227;227;227	Q63ZY3-3;Q63ZY3;Q63ZY3-2	.;KANK2_HUMAN;.	I	227	ENSP00000395650:T227I;ENSP00000347276:T227I	ENSP00000347276:T227I	T	-	2	0	KANK2	11165076	0.989000	0.36119	0.973000	0.42090	0.878000	0.50629	2.526000	0.45607	1.829000	0.53265	0.313000	0.20887	ACA		PASS	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493		9	40	---	---	---	---
C19orf43	79002	broad.mit.edu	37	19	12848341	12848341	+	5'Flank	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:12848341T>G	ENST00000242784.4	-	0	0				C19orf43_ENST00000592273.1_5'Flank|C19orf43_ENST00000588213.1_5'Flank|ASNA1_ENST00000357332.3_Missense_Mutation_p.W8G|ASNA1_ENST00000591090.1_Missense_Mutation_p.W8G	NM_024038.2	NP_076943.1	Q9BQ61	CS043_HUMAN	chromosome 19 open reading frame 43									p.W8G(1)		endometrium(2)|large_intestine(2)	4						GGTGGCCGGGTGGGGGGTTGA	0.567																																						uc002muv.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(22-24)TGG>GGG		arsA arsenite transporter, ATP-binding, homolog	Adenosine triphosphate(DB00171)																																			SO:0001631	upstream_gene_variant	439				response to arsenic-containing substance	endoplasmic reticulum|nucleolus|soluble fraction	arsenite-transporting ATPase activity|ATP binding|metal ion binding	g.chr19:12848341T>G	AK027588	CCDS12279.1	19p13.2	2011-11-24			ENSG00000123144	ENSG00000123144			28424	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 18"""					12477932	Standard	NM_024038		Approved	MGC2803, fSAP18	uc002muu.3	Q9BQ61			19.37:g.12848341T>G	Exception_encountered		Somatic				C19orf43_uc002muu.2_5'Flank|ASNA1_uc002muw.2_Missense_Mutation_p.W8G	p.W8G	NM_004317	NP_004308	Capture	Illumina GAIIx	Phase_I	O43681	ASNA_HUMAN			1	36	+			8						Missense_Mutation	SNP	ENST00000242784.4	37	c.22T>G	CCDS12279.1	.	.	.	.	.	.	.	.	.	.	t	14.77	2.635571	0.47049	.	.	ENSG00000198356	ENST00000357332	T	0.42131	0.98	4.44	4.44	0.53790	.	0.000000	0.64402	D	0.000011	T	0.19446	0.0467	N	0.08118	0	0.30339	N	0.785879	B;B	0.19817	0.039;0.039	B;B	0.14023	0.01;0.01	T	0.06917	-1.0800	10	0.27785	T	0.31	-20.2535	5.7259	0.18013	0.0:0.1895:0.0:0.8105	.	8;8	E7EVN0;O43681	.;ASNA_HUMAN	G	8	ENSP00000349887:W8G	ENSP00000349887:W8G	W	+	1	0	ASNA1	12709341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.095000	0.50235	1.998000	0.58463	0.525000	0.51046	TGG		PASS	C19orf43-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450856.1	NM_024038		4	4	---	---	---	---
NWD1	284434	broad.mit.edu	37	19	16910814	16910814	+	Missense_Mutation	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:16910814T>G	ENST00000552788.1	+	15	3577	c.3577T>G	c.(3577-3579)Tct>Gct	p.S1193A	CTD-2538G9.6_ENST00000601661.1_RNA|NWD1_ENST00000549814.1_Intron|NWD1_ENST00000523826.1_Missense_Mutation_p.S987A|NWD1_ENST00000339803.6_Missense_Mutation_p.S1058A|NWD1_ENST00000379808.3_Missense_Mutation_p.S1193A|NWD1_ENST00000524140.2_Missense_Mutation_p.S1193A			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1193							ATP binding (GO:0005524)	p.S1193A(1)|p.S1058A(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACAGTCCTCATCTTTCAAGGT	0.637																																						uc002neu.3																			2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|pancreas(2)	7						c.(3577-3579)TCT>GCT		RecName: Full=NACHT and WD repeat domain-containing protein 1;							64.0	60.0	62.0					19																	16910814		2203	4300	6503	SO:0001583	missense	284434						ATP binding	g.chr19:16910814T>G	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3577T>G	19.37:g.16910814T>G	ENSP00000447224:p.Ser1193Ala		Somatic				NWD1_uc002net.3_Missense_Mutation_p.S1058A|NWD1_uc002nev.3_Missense_Mutation_p.S987A	p.S1193A			Capture	Illumina GAIIx	Phase_I	Q149M9	NWD1_HUMAN			17	3999	+			1193			WD 9.		C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37	c.3577T>G		.	.	.	.	.	.	.	.	.	.	T	11.93	1.786365	0.31593	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T	0.30448	1.53;1.53;2.16;1.57;2.16	5.06	4.01	0.46588	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.528772	0.18964	N	0.126303	T	0.42426	0.1202	L	0.59436	1.845	0.09310	N	1	P;D;D	0.58970	0.951;0.958;0.984	P;P;D	0.68192	0.525;0.763;0.956	T	0.24835	-1.0149	10	0.23302	T	0.38	-9.7191	4.3199	0.11011	0.1765:0.0941:0.0:0.7294	.	1193;1193;1058	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	A	1058;1193;1193;987;1193;1058	ENSP00000428579:S1193A;ENSP00000369136:S1193A;ENSP00000428955:S987A;ENSP00000447224:S1193A;ENSP00000340159:S1058A	ENSP00000340159:S1058A	S	+	1	0	NWD1	16771814	0.653000	0.27358	0.068000	0.19968	0.214000	0.24535	3.110000	0.50352	0.730000	0.32425	0.533000	0.62120	TCT		PASS	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525		24	182	---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17085976	17085976	+	Silent	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:17085976T>C	ENST00000443236.1	-	17	2173	c.2142A>G	c.(2140-2142)caA>caG	p.Q714Q	CPAMD8_ENST00000388925.4_Silent_p.Q453Q	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	667						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q714Q(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GCCGGCGTCGTTGTGCCGTCA	0.577																																						uc002nfb.2																			1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						c.(2140-2142)CAA>CAG		C3 and PZP-like, alpha-2-macroglobulin domain							37.0	41.0	40.0					19																	17085976		2037	4173	6210	SO:0001819	synonymous_variant	27151					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr19:17085976T>C	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2142A>G	19.37:g.17085976T>C			Somatic					p.Q714Q	NM_015692	NP_056507	Capture	Illumina GAIIx	Phase_I	Q8IZJ3	CPMD8_HUMAN			17	2174	-			667					Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	c.2142A>G	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	T	2.426	-0.331920	0.05314	.	.	ENSG00000160111	ENST00000443236	.	.	.	2.78	0.107	0.14544	.	.	.	.	.	T	0.20577	0.0495	.	.	.	0.20403	N	0.999908	.	.	.	.	.	.	T	0.22906	-1.0203	4	.	.	.	.	1.3105	0.02097	0.1727:0.1102:0.3044:0.4127	.	.	.	.	S	725	.	.	N	-	2	0	CPAMD8	16946976	0.008000	0.16893	0.058000	0.19502	0.490000	0.33462	-0.214000	0.09292	0.121000	0.18284	0.454000	0.30748	AAC		PASS	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		17	31	---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17720816	17720816	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:17720816T>C	ENST00000519716.2	-	43	4743	c.4744A>G	c.(4744-4746)Aaa>Gaa	p.K1582E	UNC13A_ENST00000252773.7_Missense_Mutation_p.K1582E|UNC13A_ENST00000552293.1_Missense_Mutation_p.K1576E|UNC13A_ENST00000551649.1_Missense_Mutation_p.K1601E|UNC13A_ENST00000550896.1_Missense_Mutation_p.K1555E|UNC13A_ENST00000428389.2_Missense_Mutation_p.K1670E	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1582	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.K1670E(1)|p.K1582E(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						AACTTGCGTTTCTTGTCGCTG	0.527																																						uc002nhd.2																			2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(5008-5010)AAA>GAA		unc-13 homolog A							148.0	155.0	153.0					19																	17720816		2087	4239	6326	SO:0001583	missense	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17720816T>C	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.4744A>G	19.37:g.17720816T>C	ENSP00000429562:p.Lys1582Glu		Somatic					p.K1670E	NM_001080421	NP_001073890	Capture	Illumina GAIIx	Phase_I	Q9UPW8	UN13A_HUMAN			42	5008	-			1582			C2 3.		E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	c.5008A>G	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566947	0.86439	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55;2.55	4.13	4.13	0.48395	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	T	0.43853	0.1266	M	0.92555	3.32	0.49687	D	0.99981	D	0.59357	0.985	D	0.71414	0.973	T	0.54357	-0.8306	10	0.87932	D	0	-12.3833	11.1553	0.48484	0.0:0.0:0.0:1.0	.	1582	Q9UPW8	UN13A_HUMAN	E	1582;1670;1582;1601;1576;1555	ENSP00000429562:K1582E;ENSP00000400409:K1670E;ENSP00000252773:K1582E;ENSP00000447236:K1601E;ENSP00000447572:K1576E;ENSP00000446831:K1555E	ENSP00000252773:K1582E	K	-	1	0	UNC13A	17581816	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.108000	0.71522	1.523000	0.49018	0.392000	0.25879	AAA		PASS	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		126	226	---	---	---	---
ZNF626	199777	broad.mit.edu	37	19	20828524	20828524	+	Silent	SNP	G	G	A	rs3209057		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:20828524G>A	ENST00000601440.1	-	3	338	c.192C>T	c.(190-192)acC>acT	p.T64T	ZNF626_ENST00000291750.6_Silent_p.T64T|CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T64T(2)		breast(1)|endometrium(1)|lung(3)|skin(1)	6						TTCTCTTCATGGTCAAAGGTT	0.383																																						uc002npb.1																			2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(190-192)ACC>ACT		zinc finger protein 626 isoform 1							115.0	108.0	110.0					19																	20828524		2203	4300	6503	SO:0001819	synonymous_variant	199777				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:20828524G>A	BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.192C>T	19.37:g.20828524G>A			Somatic				ZNF626_uc002npc.1_Intron|ZNF626_uc002npd.1_Silent_p.T64T	p.T64T	NM_001076675	NP_001070143	Capture	Illumina GAIIx	Phase_I	Q68DY1	ZN626_HUMAN			3	342	-			64			KRAB.		Q8N8T4|Q96QM1	Silent	SNP	ENST00000601440.1	37	c.192C>T	CCDS42535.1																																																																																				PASS	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447845.2	NM_145297		134	121	---	---	---	---
ZNF676	163223	broad.mit.edu	37	19	22375821	22375821	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:22375821G>T	ENST00000397121.2	-	2	444	c.127C>A	c.(127-129)Cca>Aca	p.P43T		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	43	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P43T(2)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CACCTACCTGGGGGTTCTTCC	0.433																																						uc002nqs.1																			2	Substitution - Missense(2)		lung(2)		0						c.(127-129)CCA>ACA		zinc finger protein 676							87.0	102.0	97.0					19																	22375821		1510	2709	4219	SO:0001583	missense	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22375821G>T	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.127C>A	19.37:g.22375821G>T	ENSP00000380310:p.Pro43Thr		Somatic					p.P43T	NM_001001411	NP_001001411	Capture	Illumina GAIIx	Phase_I	Q8N7Q3	ZN676_HUMAN			2	445	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	43			KRAB.		A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	c.127C>A	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	3.955	-0.011492	0.07727	.	.	ENSG00000196109	ENST00000397121	T	0.07800	3.16	0.784	0.784	0.18578	Krueppel-associated box (1);	.	.	.	.	T	0.25382	0.0617	M	0.89214	3.015	0.09310	N	1	D	0.64830	0.994	P	0.62885	0.908	T	0.05971	-1.0853	9	0.52906	T	0.07	.	4.7436	0.13026	0.0:0.0:1.0:0.0	.	43	Q8N7Q3	ZN676_HUMAN	T	43	ENSP00000380310:P43T	ENSP00000380310:P43T	P	-	1	0	ZNF676	22167661	0.002000	0.14202	0.236000	0.24074	0.239000	0.25481	-0.088000	0.11198	0.181000	0.19994	0.184000	0.17185	CCA		PASS	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		109	279	---	---	---	---
ZNF254	9534	broad.mit.edu	37	19	24309055	24309055	+	Splice_Site	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:24309055G>C	ENST00000357002.4	+	4	368		c.e4-1		ZNF254_ENST00000342944.6_Splice_Site	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.?(1)					all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ttttttttCAGGTATGTGTCC	0.303																																						uc002nru.2																			1	Unknown(1)		lung(1)		0						c.e4-1		zinc finger protein 254							20.0	21.0	21.0					19																	24309055		2085	4235	6320	SO:0001630	splice_region_variant	9534				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:24309055G>C	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.254-1G>C	19.37:g.24309055G>C			Somatic				ZNF254_uc010xrk.1_Splice_Site	p.G85_splice	NM_203282	NP_975011	Capture	Illumina GAIIx	Phase_I	O75437	ZN254_HUMAN			4	388	+		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)						A4QPC0|Q86XL7	Splice_Site	SNP	ENST00000357002.4	37	c.254_splice	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	G	0.986	-0.695427	0.03303	.	.	ENSG00000213096	ENST00000357002;ENST00000392281	.	.	.	1.42	0.0395	0.14205	.	.	.	.	.	.	.	.	.	.	.	0.19945	N	0.999948	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8263	0.13417	0.3091:0.0:0.6909:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF254	24100895	0.000000	0.05858	0.014000	0.15608	0.019000	0.09904	-1.214000	0.02988	0.536000	0.28733	0.313000	0.20887	.		PASS	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	Intron	4	68	---	---	---	---
ANKRD27	84079	broad.mit.edu	37	19	33113383	33113383	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:33113383G>A	ENST00000306065.4	-	18	1930	c.1772C>T	c.(1771-1773)aCc>aTc	p.T591I		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	591					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.T591I(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CTGGATCTCGGTGGACGCTCC	0.522																																						uc002ntn.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)	5						c.(1771-1773)ACC>ATC		ankyrin repeat domain 27 (VPS9 domain)							238.0	208.0	218.0					19																	33113383		2203	4300	6503	SO:0001583	missense	84079				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity	g.chr19:33113383G>A	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1772C>T	19.37:g.33113383G>A	ENSP00000304292:p.Thr591Ile		Somatic					p.T591I	NM_032139	NP_115515	Capture	Illumina GAIIx	Phase_I	Q96NW4	ANR27_HUMAN			18	1928	-	Esophageal squamous(110;0.137)		591			ANK 5.		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	c.1772C>T	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585900	0.28268	.	.	ENSG00000105186	ENST00000306065	T	0.61510	0.1	5.31	5.31	0.75309	Ankyrin repeat-containing domain (3);	0.315427	0.27080	N	0.021027	T	0.38931	0.1059	N	0.03281	-0.365	0.80722	D	1	B	0.19331	0.035	B	0.27170	0.077	T	0.23762	-1.0179	10	0.21540	T	0.41	-13.2817	19.3213	0.94240	0.0:0.0:1.0:0.0	.	591	Q96NW4	ANR27_HUMAN	I	591	ENSP00000304292:T591I	ENSP00000304292:T591I	T	-	2	0	ANKRD27	37805223	1.000000	0.71417	0.296000	0.24974	0.134000	0.20937	7.349000	0.79376	2.645000	0.89757	0.655000	0.94253	ACC		PASS	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139		111	343	---	---	---	---
DPF1	8193	broad.mit.edu	37	19	38713068	38713068	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:38713068C>A	ENST00000420980.2	-	3	334	c.308G>T	c.(307-309)cGc>cTc	p.R103L	DPF1_ENST00000414789.1_Missense_Mutation_p.R21L|DPF1_ENST00000412732.1_Missense_Mutation_p.R21L|DPF1_ENST00000416611.1_Missense_Mutation_p.R77L|DPF1_ENST00000355526.4_Missense_Mutation_p.R103L|DPF1_ENST00000456296.1_Missense_Mutation_p.R77L	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1	103					apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)	p.R76L(1)|p.R103L(1)		large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTCCAACAGCGGGCGGGGTA	0.697																																						uc002ohl.2																			2	Substitution - Missense(2)		lung(2)		0						c.(307-309)CGC>CTC		D4, zinc and double PHD fingers family 1 isoform							118.0	116.0	117.0					19																	38713068		2203	4300	6503	SO:0001583	missense	8193				induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding	g.chr19:38713068C>A	U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.308G>T	19.37:g.38713068C>A	ENSP00000397354:p.Arg103Leu		Somatic				DPF1_uc002ohm.2_Missense_Mutation_p.R103L|DPF1_uc002ohn.2_Missense_Mutation_p.R21L|DPF1_uc010xtu.1_Missense_Mutation_p.R77L|DPF1_uc010xtv.1_Missense_Mutation_p.R77L|DPF1_uc010xtw.1_Missense_Mutation_p.R77L	p.R103L	NM_004647	NP_004638	Capture	Illumina GAIIx	Phase_I	Q92782	DPF1_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		3	335	-	all_cancers(60;1.24e-06)		103					B3KSY8|Q08AJ0	Missense_Mutation	SNP	ENST00000420980.2	37	c.308G>T	CCDS33008.2	.	.	.	.	.	.	.	.	.	.	c	24.7	4.559694	0.86335	.	.	ENSG00000011332	ENST00000420980;ENST00000437720;ENST00000412732;ENST00000416611;ENST00000414789;ENST00000456296;ENST00000438060;ENST00000434076;ENST00000438365	D;D;D;D;D;T	0.91792	-2.43;-2.91;-2.36;-2.91;-2.82;1.81	3.36	3.36	0.38483	.	0.000000	0.64402	D	0.000016	D	0.95297	0.8474	M	0.74258	2.255	0.50313	D	0.999867	D;P;D;D;D;D	0.89917	0.997;0.895;0.995;1.0;1.0;0.998	D;P;D;D;D;D	0.83275	0.993;0.633;0.971;0.996;0.989;0.971	D	0.95765	0.8804	10	0.87932	D	0	-6.7709	14.021	0.64555	0.0:1.0:0.0:0.0	.	77;77;76;103;103;103	B4DMQ8;E9PDV3;C8C3P2;Q6PJ73;Q92782-2;Q92782	.;.;.;.;.;DPF1_HUMAN	L	103;103;21;77;21;77;21;77;21	ENSP00000397354:R103L;ENSP00000412098:R21L;ENSP00000390223:R77L;ENSP00000391884:R21L;ENSP00000411569:R77L;ENSP00000416347:R21L	ENSP00000412098:R21L	R	-	2	0	DPF1	43404908	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.918000	0.75788	1.902000	0.55061	0.394000	0.25966	CGC		PASS	DPF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347721.1			126	144	---	---	---	---
EGLN2	112398	broad.mit.edu	37	19	41306706	41306706	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:41306706C>T	ENST00000593726.1	+	1	1257	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	EGLN2_ENST00000406058.2_Missense_Mutation_p.R77W|EGLN2_ENST00000303961.4_Missense_Mutation_p.R77W|EGLN2_ENST00000594140.1_5'Flank|CTC-490E21.12_ENST00000601627.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	77					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.R77W(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	CAGCCCTCTTCGGGACGGTTT	0.672																																						uc010ehd.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(229-231)CGG>TGG		EGL nine (C.elegans) homolog 2	Vitamin C(DB00126)						25.0	27.0	26.0					19																	41306706		2203	4299	6502	SO:0001583	missense	112398				cell redox homeostasis|estrogen receptor signaling pathway|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity	g.chr19:41306706C>T	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.229C>T	19.37:g.41306706C>T	ENSP00000469686:p.Arg77Trp		Somatic				EGLN2_uc002opg.3_Missense_Mutation_p.R77W|EGLN2_uc002oph.2_Missense_Mutation_p.R77W|EGLN2_uc002opi.2_Missense_Mutation_p.R77W	p.R77W	NM_080732	NP_542770	Capture	Illumina GAIIx	Phase_I	Q96KS0	EGLN2_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		8	1230	+			77					A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	c.229C>T	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	C	8.914	0.959403	0.18507	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.31510	1.49;1.49	4.68	-1.56	0.08532	.	1.064700	0.07444	N	0.897797	T	0.13286	0.0322	N	0.14661	0.345	0.09310	N	1	P	0.34892	0.474	B	0.27887	0.084	T	0.19976	-1.0289	10	0.66056	D	0.02	-0.1435	1.6747	0.02819	0.4004:0.3138:0.1212:0.1646	.	77	Q96KS0	EGLN2_HUMAN	W	77	ENSP00000307080:R77W;ENSP00000385253:R77W	ENSP00000307080:R77W	R	+	1	2	EGLN2	45998546	0.000000	0.05858	0.007000	0.13788	0.383000	0.30230	0.445000	0.21677	-0.126000	0.11682	0.491000	0.48974	CGG		PASS	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1			8	19	---	---	---	---
ZNF155	7711	broad.mit.edu	37	19	44500911	44500911	+	Nonsense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:44500911C>G	ENST00000270014.2	+	5	1030	c.902C>G	c.(901-903)tCa>tGa	p.S301*	RP11-15A1.7_ENST00000586860.1_RNA|RP11-15A1.7_ENST00000589021.1_RNA|ZNF155_ENST00000590615.1_Nonsense_Mutation_p.S301*|ZNF155_ENST00000407951.2_Nonsense_Mutation_p.S312*	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	301					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S301*(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				TATTTTAGGTCAAGACTTAAG	0.388																																					NSCLC(61;554 1277 20909 42067 42312)	uc002oxy.1																			1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(901-903)TCA>TGA		zinc finger protein 155							93.0	96.0	95.0					19																	44500911		2203	4300	6503	SO:0001587	stop_gained	7711					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:44500911C>G	U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.902C>G	19.37:g.44500911C>G	ENSP00000270014:p.Ser301*		Somatic				ZNF155_uc002oxz.1_Nonsense_Mutation_p.S301*|ZNF155_uc010xwt.1_Nonsense_Mutation_p.S312*	p.S301*	NM_003445	NP_003436	Capture	Illumina GAIIx	Phase_I	Q12901	ZN155_HUMAN			5	1107	+		Prostate(69;0.0352)	301			C2H2-type 5.		A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Nonsense_Mutation	SNP	ENST00000270014.2	37	c.902C>G	CCDS12634.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.6|26.6	4.752023|4.752023	0.89753|0.89753	.|.	.|.	ENSG00000204920|ENSG00000204920	ENST00000425747|ENST00000407951;ENST00000270014	.|.	.|.	.|.	2.59|2.59	2.59|2.59	0.31030|0.31030	.|.	.|.	.|.	.|.	.|.	T|.	0.62950|.	0.2470|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.64984|.	-0.6278|.	5|.	0.12430|0.62326	T|D	0.62|0.03	.|.	8.645|8.645	0.34000|0.34000	0.2288:0.7712:0.0:0.0|0.2288:0.7712:0.0:0.0	.|.	.|.	.|.	.|.	E|X	175|312;301	.|.	ENSP00000401576:Q175E|ENSP00000270014:S301X	Q|S	+|+	1|2	0|0	ZNF155|ZNF155	49192751|49192751	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.479000|0.479000	0.33129|0.33129	-0.662000|-0.662000	0.05305|0.05305	1.430000|1.430000	0.47334|0.47334	0.462000|0.462000	0.41574|0.41574	CAA|TCA		PASS	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	NM_003445		69	204	---	---	---	---
TBC1D17	79735	broad.mit.edu	37	19	50384664	50384664	+	Silent	SNP	A	A	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:50384664A>C	ENST00000221543.5	+	5	758	c.459A>C	c.(457-459)gcA>gcC	p.A153A	TBC1D17_ENST00000598789.1_3'UTR|TBC1D17_ENST00000535102.2_Silent_p.A120A	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	153					autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)	p.A153A(1)		NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		CCCTGCCCGCACTGCACTTCC	0.672																																						uc002pqo.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(457-459)GCA>GCC		TBC1 domain family, member 17							38.0	39.0	39.0					19																	50384664		2203	4299	6502	SO:0001819	synonymous_variant	79735					intracellular	Rab GTPase activator activity	g.chr19:50384664A>C	AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.459A>C	19.37:g.50384664A>C			Somatic				TBC1D17_uc010enn.1_RNA|TBC1D17_uc010ybg.1_Silent_p.A120A|TBC1D17_uc002pqp.2_5'UTR|TBC1D17_uc002pqq.1_RNA|TBC1D17_uc002pqr.2_5'UTR|TBC1D17_uc002pqs.2_5'Flank	p.A153A	NM_024682	NP_078958	Capture	Illumina GAIIx	Phase_I	Q9HA65	TBC17_HUMAN		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)	5	611	+		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)	153					B4DT12|B9A6L8|F5H1W7	Silent	SNP	ENST00000221543.5	37	c.459A>C	CCDS12785.1																																																																																				PASS	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466404.1	NM_024682		15	75	---	---	---	---
SHANK1	50944	broad.mit.edu	37	19	51169587	51169587	+	Missense_Mutation	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:51169587T>G	ENST00000293441.1	-	22	5648	c.5630A>C	c.(5629-5631)aAg>aCg	p.K1877T	SHANK1_ENST00000391813.1_Missense_Mutation_p.K1264T|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000359082.3_Missense_Mutation_p.K1868T|SHANK1_ENST00000391814.1_Missense_Mutation_p.K1885T	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1877					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.K1877T(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CTGCTGAAGCTTGGAGCTGAG	0.697																																						uc002psx.1																			1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(5629-5631)AAG>ACG		SH3 and multiple ankyrin repeat domains 1							28.0	28.0	28.0					19																	51169587		2202	4300	6502	SO:0001583	missense	50944				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding	g.chr19:51169587T>G	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5630A>C	19.37:g.51169587T>G	ENSP00000293441:p.Lys1877Thr		Somatic				SHANK1_uc002psw.1_Missense_Mutation_p.K1261T	p.K1877T	NM_016148	NP_057232	Capture	Illumina GAIIx	Phase_I	Q9Y566	SHAN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	22	5649	-		all_neural(266;0.057)	1877					A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	c.5630A>C	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	T	8.367	0.834367	0.16820	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.54479	0.7;1.2;0.69;0.57	2.89	2.89	0.33648	.	0.196658	0.29799	U	0.011169	T	0.58538	0.2129	L	0.48642	1.525	0.37405	D	0.913024	P;D	0.71674	0.948;0.998	P;D	0.63703	0.514;0.917	T	0.61734	-0.7002	10	0.41790	T	0.15	.	8.8202	0.35020	0.0:0.0:0.0:1.0	.	1877;1264	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	T	1877;1264;1868;1885	ENSP00000293441:K1877T;ENSP00000375689:K1264T;ENSP00000351984:K1868T;ENSP00000375690:K1885T	ENSP00000293441:K1877T	K	-	2	0	SHANK1	55861399	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	2.747000	0.47475	1.324000	0.45282	0.164000	0.16699	AAG		PASS	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		19	19	---	---	---	---
ZNF175	7728	broad.mit.edu	37	19	52076626	52076626	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:52076626G>T	ENST00000262259.2	+	2	402	c.44G>T	c.(43-45)gGt>gTt	p.G15V	ZNF175_ENST00000545217.1_Missense_Mutation_p.G15V|ZNF175_ENST00000436511.2_Missense_Mutation_p.G15V|ZNF175_ENST00000596504.1_Missense_Mutation_p.G15V	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	15					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G15V(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CAGGTCCTGGGTCCAGAGAAG	0.557																																						uc002pxb.2																			1	Substitution - Missense(1)		lung(1)		0						c.(43-45)GGT>GTT		zinc finger protein 175							109.0	105.0	106.0					19																	52076626		2203	4300	6503	SO:0001583	missense	7728				response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:52076626G>T	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.44G>T	19.37:g.52076626G>T	ENSP00000262259:p.Gly15Val		Somatic					p.G15V	NM_007147	NP_009078	Capture	Illumina GAIIx	Phase_I	Q9Y473	ZN175_HUMAN		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)	2	422	+		all_neural(266;0.0299)	15					A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	37	c.44G>T	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	G	7.142	0.582099	0.13749	.	.	ENSG00000105497	ENST00000545217;ENST00000262259;ENST00000436511	T;T	0.07444	3.19;5.46	3.03	0.901	0.19284	.	.	.	.	.	T	0.06872	0.0175	L	0.38531	1.155	0.09310	N	0.999999	P	0.38827	0.649	B	0.38655	0.278	T	0.32508	-0.9904	9	0.45353	T	0.12	.	4.9206	0.13867	0.2888:0.0:0.7112:0.0	.	15	Q9Y473	ZN175_HUMAN	V	15	ENSP00000262259:G15V;ENSP00000440578:G15V	ENSP00000262259:G15V	G	+	2	0	ZNF175	56768438	0.023000	0.18921	0.002000	0.10522	0.194000	0.23727	0.557000	0.23454	0.319000	0.23209	0.561000	0.74099	GGT		PASS	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147		43	207	---	---	---	---
ZNF836	162962	broad.mit.edu	37	19	52660359	52660359	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:52660359T>C	ENST00000322146.8	-	5	1098	c.577A>G	c.(577-579)Aaa>Gaa	p.K193E	ZNF836_ENST00000597252.1_Missense_Mutation_p.K193E|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K193E(2)		endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TCATATTTTTTAGAAATGTTG	0.363																																						uc010ydi.1																			2	Substitution - Missense(2)		lung(2)		0						c.(577-579)AAA>GAA		zinc finger protein 836							50.0	48.0	48.0					19																	52660359		1844	4099	5943	SO:0001583	missense	162962				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52660359T>C	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.577A>G	19.37:g.52660359T>C	ENSP00000325038:p.Lys193Glu		Somatic				ZNF836_uc010ydj.1_Missense_Mutation_p.K193E	p.K193E	NM_001102657	NP_001096127	Capture	Illumina GAIIx	Phase_I	Q6ZNA1	ZN836_HUMAN			5	951	-			193						Missense_Mutation	SNP	ENST00000322146.8	37	c.577A>G	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	T	8.174	0.792278	0.16258	.	.	ENSG00000196267	ENST00000322146	T	0.07021	3.23	1.95	1.95	0.26073	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.14578	0.011	T	0.46789	-0.9166	9	0.13470	T	0.59	.	4.1845	0.10392	0.3088:0.0:0.0:0.6912	.	193	Q6ZNA1	ZN836_HUMAN	E	193	ENSP00000325038:K193E	ENSP00000325038:K193E	K	-	1	0	ZNF836	57352171	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.662000	0.05305	0.909000	0.36697	0.449000	0.29647	AAA		PASS	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657		53	41	---	---	---	---
ZNF610	162963	broad.mit.edu	37	19	52869896	52869896	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:52869896A>G	ENST00000403906.3	+	6	1721	c.1265A>G	c.(1264-1266)cAt>cGt	p.H422R	ZNF610_ENST00000601151.1_Missense_Mutation_p.H379R|ZNF610_ENST00000321287.8_Missense_Mutation_p.H422R|ZNF610_ENST00000327920.8_Missense_Mutation_p.H422R	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H422R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		CAGAGAATTCATACTGGAGAG	0.403																																						uc002pyx.3																			1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1264-1266)CAT>CGT		zinc finger protein 610 isoform a							63.0	60.0	61.0					19																	52869896		2203	4300	6503	SO:0001583	missense	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52869896A>G	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.1265A>G	19.37:g.52869896A>G	ENSP00000383922:p.His422Arg		Somatic				ZNF610_uc002pyy.3_Missense_Mutation_p.H422R|ZNF610_uc002pyz.3_Missense_Mutation_p.H379R|ZNF610_uc002pza.2_Missense_Mutation_p.H422R	p.H422R	NM_001161426	NP_001154898	Capture	Illumina GAIIx	Phase_I	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	6	1671	+			422			C2H2-type 8.		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	c.1265A>G	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	A	10.95	1.496866	0.26861	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.67523	-0.27;-0.27	1.71	1.71	0.24356	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84406	0.5465	H	0.96048	3.76	0.25947	N	0.982791	D;D	0.71674	0.997;0.998	D;D	0.66716	0.911;0.946	T	0.73075	-0.4097	9	0.87932	D	0	.	8.2022	0.31432	1.0:0.0:0.0:0.0	.	379;422	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	R	422;379;422	ENSP00000383922:H422R;ENSP00000327597:H422R	ENSP00000324441:H379R	H	+	2	0	ZNF610	57561708	0.999000	0.42202	0.099000	0.21106	0.086000	0.17979	5.123000	0.64703	0.762000	0.33152	0.383000	0.25322	CAT		PASS	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		64	104	---	---	---	---
ZNF813	126017	broad.mit.edu	37	19	53994103	53994103	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:53994103A>T	ENST00000396403.4	+	4	745	c.617A>T	c.(616-618)cAg>cTg	p.Q206L	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q206L(1)		large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		ACACAAAAACAGGAGGTACAC	0.348																																						uc002qbu.2																			1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(616-618)CAG>CTG		zinc finger protein 813							79.0	87.0	84.0					19																	53994103		2197	4295	6492	SO:0001583	missense	126017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53994103A>T	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.617A>T	19.37:g.53994103A>T	ENSP00000379684:p.Gln206Leu		Somatic				ZNF813_uc010eqq.1_Intron	p.Q206L	NM_001004301	NP_001004301	Capture	Illumina GAIIx	Phase_I	Q6ZN06	ZN813_HUMAN		GBM - Glioblastoma multiforme(134;0.00619)	4	745	+			206						Missense_Mutation	SNP	ENST00000396403.4	37	c.617A>T	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	a	5.161	0.215329	0.09810	.	.	ENSG00000198346	ENST00000396403	T	0.27256	1.68	0.467	-0.934	0.10428	.	.	.	.	.	T	0.17152	0.0412	L	0.57130	1.785	0.23953	N	0.996369	P	0.46987	0.888	B	0.32805	0.153	T	0.11641	-1.0579	9	0.54805	T	0.06	.	4.4265	0.11505	0.4169:0.0:0.5831:0.0	.	206	Q6ZN06	ZN813_HUMAN	L	206	ENSP00000379684:Q206L	ENSP00000379684:Q206L	Q	+	2	0	ZNF813	58685915	0.000000	0.05858	0.004000	0.12327	0.034000	0.12701	0.513000	0.22770	-0.609000	0.05724	-1.134000	0.01955	CAG		PASS	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301		52	180	---	---	---	---
NCR1	9437	broad.mit.edu	37	19	55418006	55418006	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:55418006C>A	ENST00000291890.4	+	3	234	c.196C>A	c.(196-198)Ctt>Att	p.L66I	NCR1_ENST00000447255.1_Missense_Mutation_p.L66I|NCR1_ENST00000338835.5_Missense_Mutation_p.L66I|NCR1_ENST00000350790.5_Intron|NCR1_ENST00000594765.1_Missense_Mutation_p.L66I|NCR1_ENST00000357397.5_Intron|NCR1_ENST00000598576.1_Missense_Mutation_p.L54I	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	66	Ig-like 1.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)	p.L66I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		TGAAGGAAGCCTTTTTGCCGT	0.502																																						uc002qib.2																			1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(196-198)CTT>ATT		natural cytotoxicity triggering receptor 1							69.0	71.0	71.0					19																	55418006		2203	4300	6503	SO:0001583	missense	9437				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity	g.chr19:55418006C>A	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.196C>A	19.37:g.55418006C>A	ENSP00000291890:p.Leu66Ile		Somatic				NCR1_uc002qic.2_Missense_Mutation_p.L66I|NCR1_uc002qie.2_Missense_Mutation_p.L66I|NCR1_uc002qid.2_Intron|NCR1_uc002qif.2_Intron|NCR1_uc010esj.2_Intron	p.L66I	NM_004829	NP_004820	Capture	Illumina GAIIx	Phase_I	O76036	NCTR1_HUMAN		GBM - Glioblastoma multiforme(193;0.0449)	3	234	+			66			Ig-like 1.|Extracellular (Potential).		B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	ENST00000291890.4	37	c.196C>A	CCDS12911.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.383392	0.25031	.	.	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835	T;T;T	0.12774	2.65;2.65;2.65	3.46	-1.21	0.09524	Immunoglobulin-like fold (1);	1.298050	0.05232	N	0.510610	T	0.18087	0.0434	L	0.52905	1.665	0.09310	N	0.999995	P;B;B	0.45044	0.849;0.223;0.397	P;B;P	0.50231	0.635;0.255;0.474	T	0.26950	-1.0088	10	0.22706	T	0.39	.	3.4191	0.07386	0.0:0.4286:0.2016:0.3698	.	66;66;66	B0V3L5;O76036-6;O76036	.;.;NCTR1_HUMAN	I	66	ENSP00000291890:L66I;ENSP00000404434:L66I;ENSP00000339515:L66I	ENSP00000291890:L66I	L	+	1	0	NCR1	60109818	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.066000	0.03454	-0.124000	0.11724	-0.237000	0.12165	CTT		PASS	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1			45	140	---	---	---	---
NLRP2	55655	broad.mit.edu	37	19	55493679	55493679	+	Missense_Mutation	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr19:55493679T>G	ENST00000543010.1	+	6	756	c.613T>G	c.(613-615)Ttc>Gtc	p.F205V	NLRP2_ENST00000391721.4_Missense_Mutation_p.F181V|NLRP2_ENST00000339757.7_Missense_Mutation_p.F183V|NLRP2_ENST00000427260.2_Missense_Mutation_p.F182V|NLRP2_ENST00000537859.1_Missense_Mutation_p.F183V|NLRP2_ENST00000538819.1_Missense_Mutation_p.F181V|NLRP2_ENST00000263437.6_Missense_Mutation_p.F202V|NLRP2_ENST00000448584.2_Missense_Mutation_p.F205V	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	205					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.F205V(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TCCCGGGCCCTTCTCATACAC	0.552																																						uc002qij.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(613-615)TTC>GTC		NLR family, pyrin domain containing 2							92.0	96.0	94.0					19																	55493679		2203	4300	6503	SO:0001583	missense	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55493679T>G	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.613T>G	19.37:g.55493679T>G	ENSP00000445135:p.Phe205Val		Somatic				NLRP2_uc010yfp.1_Missense_Mutation_p.F182V|NLRP2_uc010esn.2_Missense_Mutation_p.F181V|NLRP2_uc010eso.2_Missense_Mutation_p.F202V|NLRP2_uc010esp.2_Missense_Mutation_p.F183V	p.F205V	NM_017852	NP_060322	Capture	Illumina GAIIx	Phase_I	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	6	699	+			205					B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	c.613T>G	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	T	8.358	0.832430	0.16820	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.75704	-0.92;-0.85;-0.84;-0.92;-0.84;-0.96;-0.85;0.58	1.93	0.883	0.19177	.	1.339880	0.05647	N	0.584474	T	0.65217	0.2670	N	0.24115	0.695	0.09310	N	1	P;P;P;P;P	0.50819	0.807;0.939;0.899;0.939;0.899	B;P;B;P;B	0.49887	0.344;0.625;0.421;0.625;0.421	T	0.54098	-0.8344	10	0.28530	T	0.3	.	3.7189	0.08449	0.0:0.2036:0.0:0.7964	.	182;183;202;181;205	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	V	205;181;183;205;183;182;181;202	ENSP00000445135:F205V;ENSP00000375601:F181V;ENSP00000344074:F183V;ENSP00000409370:F205V;ENSP00000440601:F183V;ENSP00000402474:F182V;ENSP00000441133:F181V;ENSP00000263437:F202V	ENSP00000263437:F202V	F	+	1	0	NLRP2	60185491	0.003000	0.15002	0.008000	0.14137	0.035000	0.12851	0.513000	0.22770	0.199000	0.20427	0.402000	0.26972	TTC		PASS	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		50	196	---	---	---	---
ANGPT4	51378	broad.mit.edu	37	20	896737	896737	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:896737C>T	ENST00000381922.3	-	1	223	c.121G>A	c.(121-123)Ggc>Agc	p.G41S	ANGPT4_ENST00000546022.1_Missense_Mutation_p.G41S	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	41					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.G41S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CTACAGTGGCCGTGCTGGACT	0.617																																					Pancreas(181;481 2077 3259 31286 49856)	uc002wei.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(121-123)GGC>AGC		angiopoietin 4 precursor							111.0	105.0	107.0					20																	896737		2203	4300	6503	SO:0001583	missense	51378				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr20:896737C>T	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.121G>A	20.37:g.896737C>T	ENSP00000371347:p.Gly41Ser		Somatic				ANGPT4_uc010zpn.1_Missense_Mutation_p.G35S	p.G41S	NM_015985	NP_057069	Capture	Illumina GAIIx	Phase_I	Q9Y264	ANGP4_HUMAN			1	224	-			41					B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	c.121G>A	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479043	0.63849	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.14766	2.48;2.48	4.57	3.6	0.41247	.	0.147724	0.31358	N	0.007782	T	0.33847	0.0877	M	0.74647	2.275	0.46167	D	0.998908	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.955	T	0.07558	-1.0766	10	0.72032	D	0.01	.	10.3511	0.43937	0.0:0.8005:0.1994:0.0	.	41;41	B4E3J9;Q9Y264	.;ANGP4_HUMAN	S	41	ENSP00000371347:G41S;ENSP00000439605:G41S	ENSP00000371347:G41S	G	-	1	0	ANGPT4	844737	1.000000	0.71417	0.865000	0.33974	0.457000	0.32468	5.906000	0.69900	1.114000	0.41781	0.305000	0.20034	GGC		PASS	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985		63	78	---	---	---	---
SNPH	9751	broad.mit.edu	37	20	1277791	1277791	+	Missense_Mutation	SNP	G	G	T	rs567531133		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:1277791G>T	ENST00000381873.3	+	4	289	c.53G>T	c.(52-54)cGc>cTc	p.R18L	SNPH_ENST00000381867.1_Missense_Mutation_p.R62L	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	18					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)	p.R62L(1)|p.R18L(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCCTCCAGGCGCACCTCTCCA	0.662																																						uc002wes.2																			2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(52-54)CGC>CTC		syntaphilin							37.0	29.0	32.0					20																	1277791		2203	4300	6503	SO:0001583	missense	9751				synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding	g.chr20:1277791G>T		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.53G>T	20.37:g.1277791G>T	ENSP00000371297:p.Arg18Leu		Somatic				SNPH_uc002wet.2_Missense_Mutation_p.R62L	p.R18L	NM_014723	NP_055538	Capture	Illumina GAIIx	Phase_I	O15079	SNPH_HUMAN			4	289	+			18					Q8IYI3	Missense_Mutation	SNP	ENST00000381873.3	37	c.53G>T	CCDS13012.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909780	0.92107	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	5.03	5.03	0.67393	.	0.159948	0.41500	D	0.000871	T	0.53433	0.1796	N	0.14661	0.345	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.965	T	0.58042	-0.7706	9	0.62326	D	0.03	-29.2438	11.954	0.52970	0.0789:0.0:0.9211:0.0	.	62;18	O15079-2;O15079	.;SNPH_HUMAN	L	18;62	.	ENSP00000371291:R62L	R	+	2	0	SNPH	1225791	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.768000	0.74980	2.608000	0.88229	0.655000	0.94253	CGC		PASS	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723		7	46	---	---	---	---
SNPH	9751	broad.mit.edu	37	20	1286156	1286156	+	Missense_Mutation	SNP	C	C	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:1286156C>G	ENST00000381873.3	+	6	1179	c.943C>G	c.(943-945)Cag>Gag	p.Q315E	SNPH_ENST00000381867.1_Missense_Mutation_p.Q359E	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	315					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)	p.Q315E(1)|p.Q359E(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCGTGCCATCCAGACAGACTT	0.627																																						uc002wes.2																			2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(943-945)CAG>GAG		syntaphilin							90.0	83.0	86.0					20																	1286156		2203	4300	6503	SO:0001583	missense	9751				synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding	g.chr20:1286156C>G		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.943C>G	20.37:g.1286156C>G	ENSP00000371297:p.Gln315Glu		Somatic				SNPH_uc002wet.2_Missense_Mutation_p.Q359E	p.Q315E	NM_014723	NP_055538	Capture	Illumina GAIIx	Phase_I	O15079	SNPH_HUMAN			6	1179	+			315					Q8IYI3	Missense_Mutation	SNP	ENST00000381873.3	37	c.943C>G	CCDS13012.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224442	0.58668	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	4.6	4.6	0.57074	.	0.261059	0.31404	N	0.007719	T	0.75428	0.3848	M	0.67397	2.05	0.40848	D	0.983724	P;P	0.43578	0.811;0.811	P;P	0.57960	0.83;0.83	T	0.77485	-0.2570	9	0.51188	T	0.08	-22.4917	17.2161	0.86944	0.0:1.0:0.0:0.0	.	359;315	O15079-2;O15079	.;SNPH_HUMAN	E	315;359	.	ENSP00000371291:Q359E	Q	+	1	0	SNPH	1234156	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.441000	0.73439	2.398000	0.81561	0.561000	0.74099	CAG		PASS	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723		63	150	---	---	---	---
SCP2D1	140856	broad.mit.edu	37	20	18794887	18794887	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:18794887G>A	ENST00000377428.2	+	1	518	c.428G>A	c.(427-429)aGc>aAc	p.S143N	C20orf78_ENST00000463425.1_5'Flank|C20orf78_ENST00000278779.4_Intron	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	143	SCP2.							p.S143N(1)									GTTCTGCTTAGCTGGAAGCTG	0.443																																						uc002wrk.2																			1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(427-429)AGC>AAC		hypothetical protein LOC140856							53.0	58.0	57.0					20																	18794887		2196	4292	6488	SO:0001583	missense	140856						sterol binding	g.chr20:18794887G>A	AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.428G>A	20.37:g.18794887G>A	ENSP00000366645:p.Ser143Asn		Somatic				uc002wrj.1_Intron	p.S143N	NM_178483	NP_848578	Capture	Illumina GAIIx	Phase_I	Q9UJQ7	CT079_HUMAN			1	518	+			143			SCP2.		Q548A4	Missense_Mutation	SNP	ENST00000377428.2	37	c.428G>A	CCDS13139.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239448	0.58995	.	.	ENSG00000132631	ENST00000377428	T	0.22336	1.96	5.94	5.94	0.96194	SCP2 sterol-binding domain (2);	0.279883	0.31301	N	0.007883	T	0.43299	0.1241	M	0.72894	2.215	0.46167	D	0.998903	P	0.46064	0.872	P	0.55455	0.776	T	0.15925	-1.0420	10	0.72032	D	0.01	-8.6095	17.8531	0.88754	0.0:0.0:1.0:0.0	.	143	Q9UJQ7	CT079_HUMAN	N	143	ENSP00000366645:S143N	ENSP00000366645:S143N	S	+	2	0	C20orf79	18742887	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	6.521000	0.73778	2.807000	0.96579	0.591000	0.81541	AGC		PASS	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078193.1	NM_178483		6	172	---	---	---	---
RALGAPA2	57186	broad.mit.edu	37	20	20552580	20552580	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:20552580T>C	ENST00000202677.7	-	22	2919	c.2912A>G	c.(2911-2913)aAt>aGt	p.N971S		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	971					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.N971S(2)		endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						TATTGCTAGATTATCCCGTAT	0.403																																						uc002wrz.2																			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2911-2913)AAT>AGT		akt substrate AS250							107.0	106.0	106.0					20																	20552580		1872	4113	5985	SO:0001583	missense	57186				activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:20552580T>C	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2912A>G	20.37:g.20552580T>C	ENSP00000202677:p.Asn971Ser		Somatic				RALGAPA2_uc010gcx.2_Missense_Mutation_p.N675S|RALGAPA2_uc010zsg.1_Missense_Mutation_p.N419S	p.N971S	NM_020343	NP_065076	Capture	Illumina GAIIx	Phase_I	Q2PPJ7	RGPA2_HUMAN			22	3055	-			971					Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	37	c.2912A>G	CCDS46584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.0|21.0	4.077792|4.077792	0.76528|0.76528	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000430436|ENST00000202677	.|T	.|0.65916	.|-0.18	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81744|0.81744	0.4887|0.4887	M|M	0.84585|0.84585	2.705|2.705	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D	.|0.89917	.|0.994;1.0	.|D;D	.|0.91635	.|0.979;0.999	D|D	0.84142|0.84142	0.0418|0.0418	5|10	.|0.62326	.|D	.|0.03	.|.	16.6245|16.6245	0.84952|0.84952	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|809;971	.|A8MSM5;Q2PPJ7	.|.;RGPA2_HUMAN	V|S	788|971	.|ENSP00000202677:N971S	.|ENSP00000202677:N971S	I|N	-|-	1|2	0|0	RALGAPA2|RALGAPA2	20500580|20500580	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.701000|0.701000	0.40568|0.40568	7.797000|7.797000	0.85911|0.85911	2.323000|2.323000	0.78572|0.78572	0.528000|0.528000	0.53228|0.53228	ATC|AAT		PASS	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343		20	16	---	---	---	---
CD93	22918	broad.mit.edu	37	20	23065010	23065010	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:23065010C>T	ENST00000246006.4	-	1	1967	c.1820G>A	c.(1819-1821)cGc>cAc	p.R607H		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	607					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.R607H(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TCTCCGCTTGCGATAGACCAG	0.582																																						uc002wsv.2																			1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(1819-1821)CGC>CAC		CD93 antigen precursor							148.0	145.0	146.0					20																	23065010		2203	4300	6503	SO:0001583	missense	22918				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	g.chr20:23065010C>T	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1820G>A	20.37:g.23065010C>T	ENSP00000246006:p.Arg607His		Somatic					p.R607H	NM_012072	NP_036204	Capture	Illumina GAIIx	Phase_I	Q9NPY3	C1QR1_HUMAN			1	1968	-	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)		607			Cytoplasmic (Potential).		O00274	Missense_Mutation	SNP	ENST00000246006.4	37	c.1820G>A	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.626410	0.28978	.	.	ENSG00000125810	ENST00000246006	D	0.82167	-1.58	6.03	3.06	0.35304	.	0.208155	0.31884	N	0.006904	T	0.70098	0.3185	L	0.35854	1.095	0.30316	N	0.788072	B	0.28850	0.225	B	0.17722	0.019	T	0.64757	-0.6332	10	0.49607	T	0.09	-33.0543	5.5717	0.17200	0.1397:0.6496:0.0:0.2107	.	607	Q9NPY3	C1QR1_HUMAN	H	607	ENSP00000246006:R607H	ENSP00000246006:R607H	R	-	2	0	CD93	23013010	1.000000	0.71417	0.864000	0.33941	0.057000	0.15508	1.680000	0.37607	0.445000	0.26639	0.650000	0.86243	CGC		PASS	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072		101	288	---	---	---	---
NINL	22981	broad.mit.edu	37	20	25434199	25434199	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:25434199G>T	ENST00000278886.6	-	24	4110	c.4037C>A	c.(4036-4038)gCc>gAc	p.A1346D	NINL_ENST00000422516.1_Missense_Mutation_p.A997D|NINL_ENST00000464285.1_5'UTR	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1346					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)	p.A1346D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CTCCTCGGTGGCCTGAAGTGC	0.567																																						uc002wux.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(4036-4038)GCC>GAC		ninein-like							88.0	82.0	84.0					20																	25434199		2203	4300	6503	SO:0001583	missense	22981				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding	g.chr20:25434199G>T		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.4037C>A	20.37:g.25434199G>T	ENSP00000278886:p.Ala1346Asp		Somatic				NINL_uc010gdn.1_Missense_Mutation_p.A997D|NINL_uc002wuw.1_Missense_Mutation_p.A137D	p.A1346D	NM_025176	NP_079452	Capture	Illumina GAIIx	Phase_I	Q9Y2I6	NINL_HUMAN			24	4111	-			1346			Potential.		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	c.4037C>A	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892166	0.33442	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.33438	1.41;1.41	4.89	3.8	0.43715	.	0.705821	0.12821	N	0.436428	T	0.21509	0.0518	L	0.29908	0.895	0.27186	N	0.960544	P;P;B	0.44578	0.838;0.536;0.138	B;B;B	0.37550	0.253;0.198;0.022	T	0.07121	-1.0789	10	0.72032	D	0.01	-13.8557	9.0283	0.36243	0.9093:0.0:0.0907:0.0	.	997;1346;137	Q9Y2I6-2;Q9Y2I6;Q9HAD5	.;NINL_HUMAN;.	D	1346;997	ENSP00000278886:A1346D;ENSP00000410431:A997D	ENSP00000278886:A1346D	A	-	2	0	NINL	25382199	0.999000	0.42202	0.772000	0.31596	0.048000	0.14542	3.991000	0.56973	0.913000	0.36797	-0.302000	0.09304	GCC		PASS	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176		7	118	---	---	---	---
POFUT1	23509	broad.mit.edu	37	20	30822339	30822339	+	Missense_Mutation	SNP	G	G	T	rs35259534	byFrequency	TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:30822339G>T	ENST00000375749.3	+	7	1104	c.1042G>T	c.(1042-1044)Gac>Tac	p.D348Y	POFUT1_ENST00000486717.1_3'UTR|POFUT1_ENST00000539210.1_Missense_Mutation_p.D137Y	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	348			D -> N (in dbSNP:rs35259534).		angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)	p.D348Y(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CGGCCAAGCCGACCACTTTAT	0.592																																						uc002wxp.2																			1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1042-1044)GAC>TAC		protein O-fucosyltransferase 1 isoform 1							120.0	93.0	102.0					20																	30822339		2203	4300	6503	SO:0001583	missense	23509				fucose metabolic process|Notch signaling pathway|O-glycan processing|regulation of transcription, DNA-dependent	endoplasmic reticulum|membrane	peptide-O-fucosyltransferase activity	g.chr20:30822339G>T	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.1042G>T	20.37:g.30822339G>T	ENSP00000364902:p.Asp348Tyr		Somatic				POFUT1_uc010ztt.1_Missense_Mutation_p.D240Y|POFUT1_uc010ztu.1_Missense_Mutation_p.D137Y	p.D348Y	NM_015352	NP_056167	Capture	Illumina GAIIx	Phase_I	Q9H488	OFUT1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		7	1091	+			348					A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	ENST00000375749.3	37	c.1042G>T	CCDS13198.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276516	0.80580	.	.	ENSG00000101346	ENST00000375749;ENST00000539210	T;T	0.36520	1.25;1.25	5.37	3.39	0.38822	.	0.042971	0.85682	D	0.000000	T	0.62539	0.2436	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67381	-0.5685	10	0.87932	D	0	-15.7921	11.4694	0.50259	0.0685:0.1253:0.8062:0.0	.	348	Q9H488	OFUT1_HUMAN	Y	348;137	ENSP00000364902:D348Y;ENSP00000446154:D137Y	ENSP00000364902:D348Y	D	+	1	0	POFUT1	30286000	1.000000	0.71417	0.710000	0.30468	0.965000	0.64279	7.936000	0.87665	0.737000	0.32582	-0.181000	0.13052	GAC		PASS	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078613.1	NM_015352		254	104	---	---	---	---
BPIFB6	128859	broad.mit.edu	37	20	31622902	31622902	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:31622902G>T	ENST00000349552.1	+	5	468	c.468G>T	c.(466-468)atG>atT	p.M156I		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	156						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.M156I(1)									TCCCCAAGATGGTCAACAAGT	0.577																																						uc010zuc.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(466-468)ATG>ATT		bactericidal/permeability-increasing							95.0	78.0	84.0					20																	31622902		2203	4300	6503	SO:0001583	missense	128859					extracellular region	lipid binding	g.chr20:31622902G>T	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.468G>T	20.37:g.31622902G>T	ENSP00000344929:p.Met156Ile		Somatic				BPIL3_uc010zud.1_Missense_Mutation_p.M95I	p.M156I	NM_174897	NP_777557	Capture	Illumina GAIIx	Phase_I	Q8NFQ5	BPIL3_HUMAN			5	468	+			156						Missense_Mutation	SNP	ENST00000349552.1	37	c.468G>T	CCDS13211.1	.	.	.	.	.	.	.	.	.	.	G	6.075	0.382088	0.11524	.	.	ENSG00000167104	ENST00000349552	T	0.04015	3.73	4.55	0.0207	0.14125	.	0.718820	0.12415	N	0.470912	T	0.02727	0.0082	N	0.19112	0.55	0.09310	N	0.999995	B	0.02656	0.0	B	0.08055	0.003	T	0.45818	-0.9235	10	0.28530	T	0.3	-17.2234	2.648	0.04990	0.0951:0.1657:0.4238:0.3154	.	156	Q8NFQ5	BPIB6_HUMAN	I	156	ENSP00000344929:M156I	ENSP00000344929:M156I	M	+	3	0	BPIFB6	31086563	0.995000	0.38212	0.776000	0.31678	0.994000	0.84299	0.330000	0.19715	-0.163000	0.10946	0.561000	0.74099	ATG		PASS	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897		11	253	---	---	---	---
TTI1	9675	broad.mit.edu	37	20	36611922	36611922	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:36611922C>A	ENST00000373448.2	-	9	3444	c.3206G>T	c.(3205-3207)gGg>gTg	p.G1069V	TTI1_ENST00000449821.1_Missense_Mutation_p.G1069V|TTI1_ENST00000373447.3_Missense_Mutation_p.G1069V	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	1069					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.G1069V(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CCCGCTGGCCCCGTGCAGCTG	0.652																																						uc002xhl.2																			1	Substitution - Missense(1)		lung(1)		0						c.(3205-3207)GGG>GTG		hypothetical protein LOC9675							56.0	51.0	53.0					20																	36611922		2203	4300	6503	SO:0001583	missense	9675						binding	g.chr20:36611922C>A	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.3206G>T	20.37:g.36611922C>A	ENSP00000362547:p.Gly1069Val		Somatic				KIAA0406_uc002xhm.2_Missense_Mutation_p.G1069V	p.G1069V	NM_014657	NP_055472	Capture	Illumina GAIIx	Phase_I	O43156	TTI1_HUMAN			9	3415	-		Myeloproliferative disorder(115;0.00874)	1069					D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	c.3206G>T	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.215432	0.39102	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.15017	2.46;2.46;2.46	5.24	3.26	0.37387	.	0.109177	0.64402	D	0.000005	T	0.20941	0.0504	M	0.72894	2.215	0.80722	D	1	P	0.39576	0.679	B	0.42030	0.373	T	0.01739	-1.1284	10	0.33141	T	0.24	-0.4286	8.3597	0.32351	0.0:0.7625:0.1554:0.0821	.	1069	O43156	TTI1_HUMAN	V	1069	ENSP00000362547:G1069V;ENSP00000362546:G1069V;ENSP00000407270:G1069V	ENSP00000362546:G1069V	G	-	2	0	TTI1	36045336	0.675000	0.27558	0.054000	0.19295	0.002000	0.02628	2.244000	0.43124	0.753000	0.32945	-0.136000	0.14681	GGG		PASS	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		12	35	---	---	---	---
ZSWIM3	140831	broad.mit.edu	37	20	44506879	44506879	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:44506879G>A	ENST00000255152.2	+	2	1891	c.1682G>A	c.(1681-1683)tGc>tAc	p.C561Y	ZSWIM1_ENST00000372523.1_5'Flank|ZSWIM3_ENST00000454862.2_Missense_Mutation_p.C555Y	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	561							zinc ion binding (GO:0008270)	p.C561Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				CACCTGCCATGCCGACACATT	0.572																																						uc002xqd.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1681-1683)TGC>TAC		zinc finger, SWIM domain containing 3							71.0	65.0	67.0					20																	44506879		2203	4300	6503	SO:0001583	missense	140831						zinc ion binding	g.chr20:44506879G>A	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1682G>A	20.37:g.44506879G>A	ENSP00000255152:p.Cys561Tyr		Somatic				ZSWIM3_uc010zxg.1_Missense_Mutation_p.C555Y|ZSWIM1_uc010zxh.1_5'Flank|ZSWIM1_uc010ghi.2_5'Flank	p.C561Y	NM_080752	NP_542790	Capture	Illumina GAIIx	Phase_I	Q96MP5	ZSWM3_HUMAN			2	1885	+		Myeloproliferative disorder(115;0.0122)	561			SWIM-type.		Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	c.1682G>A	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490748	0.64074	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	D;D	0.85411	-1.98;-1.98	5.36	5.36	0.76844	Zinc finger, PMZ-type (1);Zinc finger, SWIM-type (2);	0.000000	0.85682	D	0.000000	D	0.89462	0.6722	L	0.36672	1.1	0.46927	D	0.999252	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90213	0.4266	10	0.87932	D	0	-23.3193	18.8841	0.92368	0.0:0.0:1.0:0.0	.	555;561	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	Y	561;555	ENSP00000255152:C561Y;ENSP00000406313:C555Y	ENSP00000255152:C561Y	C	+	2	0	ZSWIM3	43940286	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.048000	0.71046	2.793000	0.96121	0.561000	0.74099	TGC		PASS	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752		20	54	---	---	---	---
SLC12A5	57468	broad.mit.edu	37	20	44685078	44685078	+	Silent	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:44685078G>A	ENST00000454036.2	+	23	3103	c.3054G>A	c.(3052-3054)ggG>ggA	p.G1018G	SLC12A5_ENST00000243964.3_Silent_p.G995G	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1018					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.G995G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	AGCCTGAGGGGGAAGGGGAGA	0.617																																						uc010zxl.1																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(3052-3054)GGG>GGA		solute carrier family 12 (potassium-chloride	Bumetanide(DB00887)|Potassium Chloride(DB00761)						44.0	42.0	42.0					20																	44685078		2203	4300	6503	SO:0001819	synonymous_variant	57468				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity	g.chr20:44685078G>A	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3054G>A	20.37:g.44685078G>A			Somatic				SLC12A5_uc002xrb.2_Silent_p.G995G	p.G1018G	NM_001134771	NP_001128243	Capture	Illumina GAIIx	Phase_I	Q9H2X9	S12A5_HUMAN			23	3130	+		Myeloproliferative disorder(115;0.0122)	1018			Cytoplasmic (Potential).		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	c.3054G>A	CCDS46610.1																																																																																				PASS	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			21	43	---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45228639	45228639	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:45228639C>T	ENST00000279027.4	-	4	597	c.579G>A	c.(577-579)acG>acA	p.T193T	SLC13A3_ENST00000372121.1_Intron|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000396360.1_Silent_p.T146T|SLC13A3_ENST00000290317.5_Silent_p.T146T|SLC13A3_ENST00000495082.1_Silent_p.T146T|SLC13A3_ENST00000413164.2_Intron|SLC13A3_ENST00000472148.1_Silent_p.T146T	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	193					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.T193T(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ACTGCATCTCCGTGGGCACAG	0.468																																						uc002xsf.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(577-579)ACG>ACA		solute carrier family 13 member 3 isoform a	Succinic acid(DB00139)						167.0	151.0	156.0					20																	45228639		2203	4300	6503	SO:0001819	synonymous_variant	64849					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity	g.chr20:45228639C>T	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.579G>A	20.37:g.45228639C>T			Somatic				SLC13A3_uc010ghn.1_Silent_p.T162T|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Silent_p.T146T|SLC13A3_uc010gho.1_Silent_p.T146T|SLC13A3_uc010zxx.1_Silent_p.T95T	p.T193T	NM_022829	NP_073740	Capture	Illumina GAIIx	Phase_I	Q8WWT9	S13A3_HUMAN			4	617	-		Myeloproliferative disorder(115;0.0122)	193			Cytoplasmic (Potential).		B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	ENST00000279027.4	37	c.579G>A	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379723	0.24944	.	.	ENSG00000158296	ENST00000450298	.	.	.	5.34	2.02	0.26589	.	.	.	.	.	T	0.54062	0.1835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45323	-0.9269	4	.	.	.	-2.4833	6.2948	0.21079	0.5236:0.3797:0.0:0.0967	.	.	.	.	R	23	.	.	G	-	1	0	SLC13A3	44662046	1.000000	0.71417	0.974000	0.42286	0.940000	0.58332	0.585000	0.23879	0.601000	0.29879	0.544000	0.68410	GGA		PASS	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2			36	121	---	---	---	---
GNAS	2778	broad.mit.edu	37	20	57415276	57415276	+	Missense_Mutation	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:57415276A>G	ENST00000313949.7	+	1	504	c.115A>G	c.(115-117)Atc>Gtc	p.I39V	GNAS-AS1_ENST00000443966.1_RNA|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000371075.3_Missense_Mutation_p.I39V|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371098.2_Missense_Mutation_p.I39V			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.I39V(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTCCTGCTCCATCGCGCTCCT	0.716			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	uc002xzt.2				Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		1	Substitution - Missense(1)		lung(1)	pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292						c.(115-117)ATC>GTC		GNAS complex locus NESP55							23.0	29.0	27.0					20																	57415276		2199	4292	6491	SO:0001583	missense	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57415276A>G	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.115A>G	20.37:g.57415276A>G	ENSP00000323571:p.Ile39Val	TSP Lung(22;0.16)	Somatic				GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	p.I39V	NM_016592	NP_057676	Capture	Illumina GAIIx	Phase_I	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		1	482	+	all_lung(29;0.0104)		Error:Variant_position_missing_in_P63092_after_alignment					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000313949.7	37	c.115A>G	CCDS13471.1	.	.	.	.	.	.	.	.	.	.	A	15.63	2.889934	0.52014	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075	.	.	.	3.72	3.72	0.42706	.	.	.	.	.	T	0.54951	0.1890	N	0.24115	0.695	0.80722	D	1	D	0.58620	0.983	D	0.71184	0.972	T	0.58086	-0.7698	8	0.87932	D	0	.	9.0937	0.36625	1.0:0.0:0.0:0.0	.	39	O95467	GNAS3_HUMAN	V	39	.	ENSP00000323571:I39V	I	+	1	0	GNAS	56848671	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.123000	0.41996	1.935000	0.56089	0.377000	0.23210	ATC		PASS	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080418.7	NM_000516		22	34	---	---	---	---
CTSZ	1522	broad.mit.edu	37	20	57576578	57576578	+	Nonsense_Mutation	SNP	G	G	T	rs190687716		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:57576578G>T	ENST00000217131.5	-	3	547	c.429C>A	c.(427-429)taC>taA	p.Y143*		NM_001336.3	NP_001327.2	Q9UBR2	CATZ_HUMAN	cathepsin Z	143					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)	p.Y143*(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	10	all_lung(29;0.00711)		Colorectal(105;0.109)			GCTGGTGGGCGTAGTCCCACA	0.652																																						uc002yai.2																			1	Substitution - Nonsense(1)		lung(1)	kidney(1)	1						c.(427-429)TAC>TAA		cathepsin Z preproprotein							222.0	158.0	180.0					20																	57576578		2203	4300	6503	SO:0001587	stop_gained	1522				proteolysis	endoplasmic reticulum|extracellular space|lysosome	cysteine-type endopeptidase activity	g.chr20:57576578G>T	AF032906	CCDS13474.1	20q13.32	2012-02-10			ENSG00000101160	ENSG00000101160		"""Cathepsins"""	2547	protein-coding gene	gene with protein product	"""cathepsin X"", ""carboxypeptidase LB"", ""cathepsin IV"", ""cathepsin B2"", ""cathepsin Y"", ""cathepsin Z1"", ""cysteine-type carboxypeptidase"", ""lysosomal carboxypeptidase B"""	603169				9642240	Standard	NM_001336		Approved	CTSX	uc002yai.2	Q9UBR2	OTTHUMG00000032858	ENST00000217131.5:c.429C>A	20.37:g.57576578G>T	ENSP00000217131:p.Tyr143*		Somatic				CTSZ_uc002yaj.3_Nonsense_Mutation_p.Y143*	p.Y143*	NM_001336	NP_001327	Capture	Illumina GAIIx	Phase_I	Q9UBR2	CATZ_HUMAN	Colorectal(105;0.109)		3	555	-	all_lung(29;0.00711)		143					B2RC40|O75331|Q9UQV5|Q9UQV6	Nonsense_Mutation	SNP	ENST00000217131.5	37	c.429C>A	CCDS13474.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654145	0.29425	.	.	ENSG00000101160	ENST00000217131	.	.	.	5.16	-10.3	0.00346	.	0.122950	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3355	0.98737	0.7577:0.0:0.2423:0.0	.	.	.	.	X	143	.	ENSP00000217131:Y143X	Y	-	3	2	CTSZ	57009973	0.000000	0.05858	0.126000	0.21872	0.060000	0.15804	-1.980000	0.01492	-2.331000	0.00632	-1.319000	0.01295	TAC		PASS	CTSZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079899.1	NM_001336		19	32	---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11097576	11097576	+	RNA	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr21:11097576C>T	ENST00000470054.1	-	0	293							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctccaacctccagctcaccac	0.537																																						uc002yit.1																			0					0						c.(85-87)TGG>TAG		B melanoma antigen family, member 2 precursor							57.0	74.0	68.0					21																	11097576		1411	2552	3963			85319							g.chr21:11097576C>T	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11097576C>T			Somatic				BAGE_uc002yix.2_RNA	p.W29*	NM_182482	NP_872288	Capture	Illumina GAIIx	Phase_I			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	2	294	-								A8K925|Q08ER0	Nonsense_Mutation	SNP	ENST00000470054.1	37	c.86G>A																																																																																					PASS	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482		11	123	---	---	---	---
SCAF4	57466	broad.mit.edu	37	21	33044665	33044665	+	Missense_Mutation	SNP	T	T	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr21:33044665T>A	ENST00000286835.7	-	20	2873	c.2491A>T	c.(2491-2493)Act>Tct	p.T831S	SCAF4_ENST00000399804.1_Missense_Mutation_p.T809S|SCAF4_ENST00000434667.3_Missense_Mutation_p.T816S	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	831						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T831S(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						ACTCCTTGAGTGCCTAAAAGA	0.507																																						uc002ypd.2																			1	Substitution - Missense(1)		lung(1)		0						c.(2491-2493)ACT>TCT		splicing factor, arginine/serine-rich 15 isoform							24.0	26.0	25.0					21																	33044665		2195	4283	6478	SO:0001583	missense	57466					nucleus	nucleotide binding|RNA binding	g.chr21:33044665T>A	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.2491A>T	21.37:g.33044665T>A	ENSP00000286835:p.Thr831Ser		Somatic				SFRS15_uc002ype.2_Missense_Mutation_p.T809S|SFRS15_uc010glu.2_Missense_Mutation_p.T816S	p.T831S	NM_020706	NP_065757	Capture	Illumina GAIIx	Phase_I	O95104	SFR15_HUMAN			20	2917	-			831					C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	37	c.2491A>T	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	T	8.504	0.864974	0.17250	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.44881	0.93;0.92;0.91	5.13	3.97	0.46021	.	0.212746	0.39341	N	0.001397	T	0.21841	0.0526	N	0.14661	0.345	0.37580	D	0.919774	B;B;B	0.20052	0.024;0.041;0.024	B;B;B	0.14578	0.005;0.011;0.005	T	0.10245	-1.0638	10	0.16420	T	0.52	-20.2952	7.544	0.27755	0.1412:0.0:0.1478:0.7111	.	816;809;831	C9JLZ0;O95104-2;O95104	.;.;SFR15_HUMAN	S	816;831;809	ENSP00000402377:T816S;ENSP00000286835:T831S;ENSP00000382703:T809S	ENSP00000286835:T831S	T	-	1	0	SCAF4	31966536	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.859000	0.39418	0.944000	0.37579	0.454000	0.30748	ACT		PASS	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889		51	25	---	---	---	---
BRWD1	54014	broad.mit.edu	37	21	40558971	40558971	+	Missense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr21:40558971C>A	ENST00000333229.2	-	42	7271	c.6944G>T	c.(6943-6945)tGg>tTg	p.W2315L	AF129408.17_ENST00000608767.1_RNA	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	2315					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.W2315L(1)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATTTTCTTTCCAGGATCTGAA	0.343																																					Melanoma(170;988 1986 4794 16843 39731)	uc002yxk.1																			1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(6943-6945)TGG>TTG		bromodomain and WD repeat domain containing 1							83.0	83.0	83.0					21																	40558971		2202	4299	6501	SO:0001583	missense	54014				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chr21:40558971C>A	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.6944G>T	21.37:g.40558971C>A	ENSP00000330753:p.Trp2315Leu		Somatic				BRWD1_uc010goc.1_Missense_Mutation_p.W958L	p.W2315L	NM_018963	NP_061836	Capture	Illumina GAIIx	Phase_I	Q9NSI6	BRWD1_HUMAN			42	7083	-		Prostate(19;8.44e-08)|all_epithelial(19;0.223)	2315					C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	c.6944G>T	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758566	0.31137	.	.	ENSG00000185658	ENST00000333229	T	0.51325	0.71	5.32	4.43	0.53597	.	0.805990	0.11171	N	0.591993	T	0.38825	0.1055	L	0.44542	1.39	0.80722	D	1	B	0.23650	0.089	B	0.16722	0.016	T	0.13176	-1.0519	10	0.31617	T	0.26	0.242	8.5114	0.33220	0.0:0.7511:0.1644:0.0845	.	2315	Q9NSI6	BRWD1_HUMAN	L	2315	ENSP00000330753:W2315L	ENSP00000330753:W2315L	W	-	2	0	BRWD1	39480841	0.158000	0.22850	1.000000	0.80357	0.978000	0.69477	0.406000	0.21032	1.349000	0.45751	0.650000	0.86243	TGG		PASS	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656		5	211	---	---	---	---
TFF1	7031	broad.mit.edu	37	21	43783371	43783371	+	Silent	SNP	A	A	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr21:43783371A>G	ENST00000291527.2	-	2	329	c.231T>C	c.(229-231)ccT>ccC	p.P77P		NM_003225.2	NP_003216.1	P04155	TFF1_HUMAN	trefoil factor 1	77					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|digestion (GO:0007586)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of cell proliferation (GO:0008285)|response to estradiol (GO:0032355)|response to iron ion (GO:0010039)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)		p.P77P(1)		cervix(1)|lung(1)	2						TACCTTCTGGAGGGACGTCGA	0.483																																						uc002zax.1																			1	Substitution - coding silent(1)		lung(1)		0						c.(229-231)CCT>CCC		trefoil factor 1 precursor							85.0	81.0	82.0					21																	43783371		2203	4300	6503	SO:0001819	synonymous_variant	7031				carbohydrate metabolic process|response to estradiol stimulus		growth factor activity	g.chr21:43783371A>G	BC032811	CCDS13685.1	21q22.3	2012-10-02	2007-01-29		ENSG00000160182	ENSG00000160182			11755	protein-coding gene	gene with protein product		113710	"""breast cancer, estrogen-inducible sequence expressed in"""	BCEI		9043862	Standard	NM_003225		Approved	D21S21, HPS2, pS2, pNR-2, HP1.A	uc002zax.1	P04155	OTTHUMG00000086799	ENST00000291527.2:c.231T>C	21.37:g.43783371A>G			Somatic					p.P77P	NM_003225	NP_003216	Capture	Illumina GAIIx	Phase_I	P04155	TFF1_HUMAN			2	271	-			77						Silent	SNP	ENST00000291527.2	37	c.231T>C	CCDS13685.1																																																																																				PASS	TFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195361.1	NM_003225		29	64	---	---	---	---
WDR4	10785	broad.mit.edu	37	21	44273748	44273748	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr21:44273748C>T	ENST00000398208.2	-	9	965	c.906G>A	c.(904-906)ggG>ggA	p.G302G	WDR4_ENST00000330317.2_Silent_p.G302G|WDR4_ENST00000492742.1_5'UTR	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4									p.G302G(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		GCACCCACAGCCCCTGGGTCT	0.632																																						uc002zci.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(904-906)GGG>GGA		WD repeat domain 4 protein							29.0	28.0	28.0					21																	44273748		2202	4300	6502	SO:0001819	synonymous_variant	10785				tRNA modification	cytoplasm|nucleoplasm	protein binding	g.chr21:44273748C>T	AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.906G>A	21.37:g.44273748C>T			Somatic				WDR4_uc002zck.1_Silent_p.G302G|WDR4_uc002zcl.1_Silent_p.G156G|WDR4_uc010gpg.1_Silent_p.G301G|WDR4_uc011aew.1_Silent_p.G156G|WDR4_uc010gph.1_Silent_p.G156G	p.G302G	NM_033661	NP_387510	Capture	Illumina GAIIx	Phase_I	P57081	WDR4_HUMAN		Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)	9	979	-			302			WD 4.			Silent	SNP	ENST00000398208.2	37	c.906G>A	CCDS13691.1																																																																																				PASS	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195479.1			15	7	---	---	---	---
KRTAP10-12	386685	broad.mit.edu	37	21	46117824	46117824	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr21:46117824C>A	ENST00000400365.3	+	1	738	c.708C>A	c.(706-708)tgC>tgA	p.C236*	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	236						keratin filament (GO:0045095)		p.C236*(1)		large_intestine(1)|lung(8)	9						CCCTCCTCTGCCGCCCCACAT	0.716																																						uc002zfw.1																			1	Substitution - Nonsense(1)		lung(1)		0						c.(706-708)TGC>TGA		keratin associated protein 10-12							30.0	40.0	37.0					21																	46117824		2113	4223	6336	SO:0001587	stop_gained	386685					keratin filament		g.chr21:46117824C>A	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.708C>A	21.37:g.46117824C>A	ENSP00000383216:p.Cys236*		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.C236*	NM_198699	NP_941972	Capture	Illumina GAIIx	Phase_I	P60413	KR10C_HUMAN			1	738	+			236					B2RPA3	Nonsense_Mutation	SNP	ENST00000400365.3	37	c.708C>A	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	c	13.37	2.216921	0.39201	.	.	ENSG00000189169	ENST00000400365	.	.	.	3.58	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.27568	N	0.949971	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.078	0.59097	0.0:1.0:0.0:0.0	.	.	.	.	X	236	.	ENSP00000383216:C236X	C	+	3	2	KRTAP10-12	44942252	0.867000	0.29959	0.931000	0.37212	0.012000	0.07955	0.957000	0.29215	1.691000	0.51100	0.449000	0.29647	TGC		PASS	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699		30	29	---	---	---	---
IGLL3P	91353	broad.mit.edu	37	22	25716034	25716034	+	IGR	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr22:25716034C>T								RP3-462D8.2 (37776 upstream) : LRP5L (31353 downstream)														p.A219V(1)									AAGACGGTGGCCCCTGCAGAA	0.637																																						uc003abr.2																			1	Substitution - Missense(1)		lung(1)		0						c.(655-657)GCC>GTC		immunoglobulin lambda-like polypeptide 3							52.0	49.0	50.0					22																	25716034		2200	4300	6500	SO:0001628	intergenic_variant	91353							g.chr22:25716034C>T																													22.37:g.25716034C>T			Somatic					p.A219V	NM_001013618	NP_001013640	Capture	Illumina GAIIx	Phase_I					2	756	+									Missense_Mutation	SNP		37	c.656C>T																																																																																				0	PASS									38	63	---	---	---	---
DEPDC5	9681	broad.mit.edu	37	22	32242824	32242824	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr22:32242824G>A	ENST00000382112.3	+	30	3069	c.2999G>A	c.(2998-3000)gGg>gAg	p.G1000E	DEPDC5_ENST00000400249.2_Missense_Mutation_p.G1000E|DEPDC5_ENST00000400246.1_Missense_Mutation_p.G1009E|DEPDC5_ENST00000382105.2_Missense_Mutation_p.G931E|DEPDC5_ENST00000266091.3_Missense_Mutation_p.G1009E|DEPDC5_ENST00000400248.2_Missense_Mutation_p.G1000E|DEPDC5_ENST00000382111.2_Missense_Mutation_p.G1009E|DEPDC5_ENST00000535622.1_Missense_Mutation_p.G931E	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1009					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.G1000E(1)|p.G931E(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CTTTAGAAAGGGACCGCCATG	0.582																																						uc003als.2																			2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(3)|pancreas(1)	8						c.(2998-3000)GGG>GAG		DEP domain containing 5 isoform 1							71.0	68.0	69.0					22																	32242824		1951	4156	6107	SO:0001583	missense	9681				intracellular signal transduction			g.chr22:32242824G>A	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2999G>A	22.37:g.32242824G>A	ENSP00000371546:p.Gly1000Glu		Somatic				DEPDC5_uc011als.1_Missense_Mutation_p.G931E|DEPDC5_uc011alu.1_Missense_Mutation_p.G1009E|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.G1000E|DEPDC5_uc003alu.2_Missense_Mutation_p.G449E|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Missense_Mutation_p.G330E|DEPDC5_uc003alw.2_Missense_Mutation_p.G298E|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Missense_Mutation_p.G4E	p.G1000E	NM_014662	NP_055477	Capture	Illumina GAIIx	Phase_I	O75140	DEPD5_HUMAN			31	3141	+			1000					A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	c.2999G>A	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242511	0.79912	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T	0.37915	1.27;1.74;1.73;1.7;1.17;1.73;1.7;1.73	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.49406	0.1555	L	0.32530	0.975	0.80722	D	1	D;D;D;P;D;D;D	0.89917	1.0;0.969;0.998;0.889;0.96;0.969;0.961	D;P;D;P;P;P;P	0.97110	1.0;0.559;0.94;0.705;0.56;0.536;0.454	T	0.35919	-0.9769	10	0.30078	T	0.28	.	17.6893	0.88265	0.0:0.0:1.0:0.0	.	330;1009;931;395;1009;1000;1000	B4DSS1;B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;.;DEPD5_HUMAN	E	931;1009;1000;931;1009;931;1000;1009;1000	ENSP00000440210:G931E;ENSP00000266091:G1009E;ENSP00000383108:G1000E;ENSP00000383105:G1009E;ENSP00000371539:G931E;ENSP00000371546:G1000E;ENSP00000371545:G1009E;ENSP00000383107:G1000E	ENSP00000266091:G1009E	G	+	2	0	DEPDC5	30572824	1.000000	0.71417	0.976000	0.42696	0.772000	0.43724	8.520000	0.90566	2.492000	0.84095	0.555000	0.69702	GGG		PASS	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		14	92	---	---	---	---
FOXRED2	80020	broad.mit.edu	37	22	36886290	36886290	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr22:36886290G>A	ENST00000397224.4	-	9	1913	c.1820C>T	c.(1819-1821)aCg>aTg	p.T607M	FOXRED2_ENST00000216187.6_Missense_Mutation_p.T607M|FOXRED2_ENST00000366463.3_Missense_Mutation_p.T159M|FOXRED2_ENST00000397223.4_Missense_Mutation_p.T607M	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	607				T -> A (in Ref. 2; BAB15227). {ECO:0000305}.	ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)	p.T607M(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTTCTGGCGCGTGAGGGCGAA	0.582																																						uc003apn.3																			1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(1819-1821)ACG>ATG		FAD-dependent oxidoreductase domain containing 2							122.0	125.0	124.0					22																	36886290		2203	4300	6503	SO:0001583	missense	80020				ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	g.chr22:36886290G>A	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1820C>T	22.37:g.36886290G>A	ENSP00000380401:p.Thr607Met		Somatic				FOXRED2_uc003apm.3_Missense_Mutation_p.T159M|FOXRED2_uc003apo.3_Missense_Mutation_p.T607M|FOXRED2_uc003app.3_Missense_Mutation_p.T607M	p.T607M	NM_024955	NP_079231	Capture	Illumina GAIIx	Phase_I	Q8IWF2	FXRD2_HUMAN			8	1928	-			607	T -> A (in Ref. 2; BAB15227).				B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	ENST00000397224.4	37	c.1820C>T	CCDS13929.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285547	0.59867	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000366463;ENST00000397223	T;T;T;T	0.53857	2.16;2.16;0.6;2.16	5.64	5.64	0.86602	.	0.045870	0.85682	D	0.000000	T	0.71771	0.3379	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.66847	0.947	T	0.73033	-0.4110	10	0.66056	D	0.02	-11.0278	19.7772	0.96399	0.0:0.0:1.0:0.0	.	607	Q8IWF2	FXRD2_HUMAN	M	607;607;159;607	ENSP00000380401:T607M;ENSP00000216187:T607M;ENSP00000382543:T159M;ENSP00000380400:T607M	ENSP00000216187:T607M	T	-	2	0	FOXRED2	35216236	1.000000	0.71417	0.113000	0.21522	0.053000	0.15095	9.375000	0.97178	2.675000	0.91044	0.644000	0.83932	ACG		PASS	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955		187	280	---	---	---	---
SSTR3	6753	broad.mit.edu	37	22	37603578	37603578	+	Missense_Mutation	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr22:37603578C>T	ENST00000328544.3	-	2	798	c.265G>A	c.(265-267)Gcc>Acc	p.A89T	SSTR3_ENST00000402501.1_Missense_Mutation_p.A89T	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	89					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.A89T(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	AGCTCGTCGGCCAGCGCCAGG	0.652																																						uc003ara.2																			1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(265-267)GCC>ACC		somatostatin receptor 3							75.0	70.0	72.0					22																	37603578		2203	4300	6503	SO:0001583	missense	6753				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity	g.chr22:37603578C>T		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.265G>A	22.37:g.37603578C>T	ENSP00000330138:p.Ala89Thr		Somatic				SSTR3_uc003arb.2_Missense_Mutation_p.A89T	p.A89T	NM_001051	NP_001042	Capture	Illumina GAIIx	Phase_I	P32745	SSR3_HUMAN			2	327	-			89			Helical; Name=2; (Potential).		A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	c.265G>A	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001742	0.93227	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.78003	-1.14;-1.14	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86289	0.5897	L	0.60904	1.88	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	D	0.86048	0.1524	10	0.54805	T	0.06	.	19.6376	0.95740	0.0:1.0:0.0:0.0	.	89	P32745	SSR3_HUMAN	T	89	ENSP00000330138:A89T;ENSP00000384904:A89T	ENSP00000330138:A89T	A	-	1	0	SSTR3	35933524	1.000000	0.71417	0.994000	0.49952	0.795000	0.44927	7.818000	0.86416	2.647000	0.89833	0.557000	0.71058	GCC		PASS	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1			72	89	---	---	---	---
FAM83F	113828	broad.mit.edu	37	22	40417597	40417597	+	Silent	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr22:40417597C>T	ENST00000333407.6	+	4	1177	c.1083C>T	c.(1081-1083)ggC>ggT	p.G361G	FAM83F_ENST00000473717.1_Silent_p.G193G	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	361								p.G361G(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						AGGAGGAGGGCGCCAGCGGTG	0.721																																						uc003ayk.1																			1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1081-1083)GGC>GGT		hypothetical protein LOC113828							17.0	18.0	18.0					22																	40417597		2197	4282	6479	SO:0001819	synonymous_variant	113828							g.chr22:40417597C>T		CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.1083C>T	22.37:g.40417597C>T			Somatic					p.G361G	NM_138435	NP_612444	Capture	Illumina GAIIx	Phase_I	Q8NEG4	FA83F_HUMAN			4	1177	+			361					Q96FD6	Silent	SNP	ENST00000333407.6	37	c.1083C>T	CCDS14000.2																																																																																				PASS	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319624.3	NM_138435		14	25	---	---	---	---
PLCXD1	55344	broad.mit.edu	37	X	205453	205453	+	Nonsense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:205453G>T	ENST00000381657.2	+	3	695	c.181G>T	c.(181-183)Gag>Tag	p.E61*	PLCXD1_ENST00000484611.2_3'UTR|PLCXD1_ENST00000381663.3_Nonsense_Mutation_p.E61*|PLCXD1_ENST00000399012.1_Nonsense_Mutation_p.E61*	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	61	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)	p.E61*(1)		endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CATTTCGCACGAGGAGTCCCG	0.622																																						uc004cpc.2																			1	Substitution - Nonsense(1)		lung(1)		0						c.(181-183)GAG>TAG		phosphatidylinositol-specific phospholipase C, X							328.0	257.0	281.0					X																	205453		2203	4296	6499	SO:0001587	stop_gained	55344				intracellular signal transduction|lipid metabolic process		phospholipase C activity	g.chrX:205453G>T	AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.181G>T	X.37:g.205453G>T	ENSP00000371073:p.Glu61*		Somatic				PLCXD1_uc011mgx.1_RNA	p.E61*	NM_018390	NP_060860	Capture	Illumina GAIIx	Phase_I	Q9NUJ7	PLCX1_HUMAN			3	493	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	61			PI-PLC X-box.		A2BH51|A2BH52	Nonsense_Mutation	SNP	ENST00000381657.2	37	c.181G>T	CCDS14103.1	.	.	.	.	.	.	.	.	.	.	.	10.14	1.268159	0.23136	.	.	ENSG00000182378	ENST00000399012;ENST00000430923;ENST00000445062;ENST00000381657;ENST00000381663;ENST00000443019;ENST00000415337;ENST00000447472;ENST00000448477	.	.	.	1.79	-3.58	0.04597	.	3.771900	0.01383	N	0.012987	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-2.3029	2.1005	0.03678	0.5046:0.0:0.2432:0.2522	.	.	.	.	X	61	.	ENSP00000371073:E61X	E	+	1	0	PLCXD1	145453	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.564000	0.23563	-1.039000	0.03275	0.394000	0.25966	GAG		PASS	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058879.2	NM_018390		100	115	---	---	---	---
CD99	4267	broad.mit.edu	37	X	2637713	2637713	+	Missense_Mutation	SNP	G	G	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:2637713G>C	ENST00000381192.3	+	4	342	c.160G>C	c.(160-162)Gac>Cac	p.D54H	CD99_ENST00000482405.2_3'UTR|CD99_ENST00000381184.1_Missense_Mutation_p.D54H|CD99_ENST00000381187.3_Missense_Mutation_p.D38H	NM_001277710.1|NM_002414.3	NP_001264639.1|NP_002405.1	P14209	CD99_HUMAN	CD99 molecule	54					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.D54H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11						GGATGACTTTGACTTAGGAGA	0.403																																						uc004cqm.2																			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(160-162)GAC>CAC		CD99 antigen isoform a precursor							701.0	688.0	693.0					X																	2637713		2203	4296	6499	SO:0001583	missense	4267				cell adhesion	cytoplasm|integral to plasma membrane		g.chrX:2637713G>C	M16279	CCDS14119.1, CCDS48071.1, CCDS75947.1	Xp22.32 and Yp11.3	2012-10-02	2006-03-28	2003-02-14	ENSG00000002586	ENSG00000002586		"""Pseudoautosomal regions / PAR1"", ""CD molecules"""	7082	protein-coding gene	gene with protein product		313470, 450000	"""antigen identified by monoclonal antibodies 12E7, F21 and O13"", ""CD99 antigen"""	MIC2			Standard	NM_001122898		Approved		uc004cqm.3	P14209	OTTHUMG00000021073	ENST00000381192.3:c.160G>C	X.37:g.2637713G>C	ENSP00000370588:p.Asp54His		Somatic				CD99_uc010nda.2_Missense_Mutation_p.D38H|CD99_uc004cqn.2_RNA|CD99_uc004cqo.2_Missense_Mutation_p.D54H	p.D54H	NM_002414	NP_002405	Capture	Illumina GAIIx	Phase_I	P14209	CD99_HUMAN			4	334	+			54			Extracellular (Potential).		A6NIW1|O00518|Q6ICV7	Missense_Mutation	SNP	ENST00000381192.3	37	c.160G>C	CCDS14119.1	.	.	.	.	.	.	.	.	.	.	g	5.949	0.359043	0.11239	.	.	ENSG00000002586	ENST00000381192;ENST00000381187;ENST00000381184;ENST00000449611	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	1.16	-0.167	0.13347	.	0.160436	0.38436	U	0.001694	T	0.28034	0.0691	L	0.54323	1.7	0.09310	N	1	P;P;P	0.48764	0.915;0.915;0.915	B;B;B	0.44108	0.441;0.441;0.441	T	0.14531	-1.0469	10	0.38643	T	0.18	.	3.2407	0.06779	0.4082:0.0:0.5918:0.0	.	38;54;54	A6NIW1;B2R932;P14209	.;.;CD99_HUMAN	H	54;38;54;97	ENSP00000370588:D54H;ENSP00000370582:D38H;ENSP00000370579:D54H;ENSP00000405544:D97H	ENSP00000370579:D54H	D	+	1	0	CD99	2647713	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	-0.446000	0.06837	-0.091000	0.12440	0.436000	0.28706	GAC		PASS	CD99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055624.1	NM_001122898		9	891	---	---	---	---
CNKSR2	22866	broad.mit.edu	37	X	21450923	21450923	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:21450923G>T	ENST00000379510.3	+	3	458	c.422G>T	c.(421-423)tGg>tTg	p.W141L	CNKSR2_ENST00000543067.1_Missense_Mutation_p.W141L|CNKSR2_ENST00000425654.2_Missense_Mutation_p.W141L|CNKSR2_ENST00000279451.4_Missense_Mutation_p.W141L	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	141	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.W141L(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CTGCTTGCCTGGTTGGACAGG	0.443																																						uc004czx.1																			1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)	2						c.(421-423)TGG>TTG		connector enhancer of kinase suppressor of Ras							104.0	101.0	102.0					X																	21450923		2203	4300	6503	SO:0001583	missense	22866				regulation of signal transduction	cytoplasm|membrane	protein binding	g.chrX:21450923G>T	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.422G>T	X.37:g.21450923G>T	ENSP00000368824:p.Trp141Leu		Somatic				CNKSR2_uc004czw.2_Missense_Mutation_p.W141L|CNKSR2_uc011mjn.1_Missense_Mutation_p.W141L|CNKSR2_uc011mjo.1_Missense_Mutation_p.W141L	p.W141L	NM_014927	NP_055742	Capture	Illumina GAIIx	Phase_I	Q8WXI2	CNKR2_HUMAN			3	458	+			141			CRIC.		B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	c.422G>T	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238794	0.58995	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.29397	2.0;1.63;1.57;1.89	4.98	4.98	0.66077	CRIC domain (1);CRIC domain, Chordata (1);	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	M	0.74647	2.275	0.80722	D	1	D;D;P	0.89917	0.998;1.0;0.774	D;D;P	0.85130	0.975;0.997;0.809	T	0.63853	-0.6543	10	0.87932	D	0	1.4571	17.5455	0.87860	0.0:0.0:1.0:0.0	.	141;141;141	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	L	141	ENSP00000397906:W141L;ENSP00000444633:W141L;ENSP00000279451:W141L;ENSP00000368824:W141L	ENSP00000279451:W141L	W	+	2	0	CNKSR2	21360844	1.000000	0.71417	0.999000	0.59377	0.224000	0.24922	9.290000	0.96065	2.070000	0.61991	0.415000	0.27848	TGG		PASS	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927		109	33	---	---	---	---
MAGEB18	286514	broad.mit.edu	37	X	26158006	26158006	+	Missense_Mutation	SNP	T	T	G			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:26158006T>G	ENST00000325250.1	+	2	1091	c.904T>G	c.(904-906)Tgc>Ggc	p.C302G		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	302	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.C302G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						CTTCCCATCCTGCTATGAAGA	0.522																																						uc004dbq.1																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(904-906)TGC>GGC		melanoma antigen family B, 18							68.0	43.0	51.0					X																	26158006		2202	4300	6502	SO:0001583	missense	286514						protein binding	g.chrX:26158006T>G	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.904T>G	X.37:g.26158006T>G	ENSP00000314543:p.Cys302Gly		Somatic					p.C302G	NM_173699	NP_775970	Capture	Illumina GAIIx	Phase_I	Q96M61	MAGBI_HUMAN			2	1091	+			302			MAGE.			Missense_Mutation	SNP	ENST00000325250.1	37	c.904T>G	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	T	3.900	-0.022193	0.07634	.	.	ENSG00000176774	ENST00000325250	T	0.01767	4.65	4.45	2.09	0.27110	.	0.716549	0.13018	N	0.420302	T	0.01421	0.0046	N	0.22421	0.69	0.09310	N	0.999997	B	0.24963	0.115	B	0.25291	0.059	T	0.49542	-0.8929	10	0.27082	T	0.32	.	5.3083	0.15815	0.0:0.2316:0.0:0.7684	.	302	Q96M61	MAGBI_HUMAN	G	302	ENSP00000314543:C302G	ENSP00000314543:C302G	C	+	1	0	MAGEB18	26067927	0.386000	0.25180	0.376000	0.26042	0.262000	0.26303	0.596000	0.24044	0.329000	0.23460	-0.323000	0.08544	TGC		PASS	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699		26	3	---	---	---	---
FAM47A	158724	broad.mit.edu	37	X	34148451	34148451	+	Nonsense_Mutation	SNP	C	C	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:34148451C>A	ENST00000346193.3	-	1	1996	c.1945G>T	c.(1945-1947)Gag>Tag	p.E649*		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	649								p.E649*(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAGGAACACTCCTTTACTTTC	0.453																																						uc004ddg.2																			1	Substitution - Nonsense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1945-1947)GAG>TAG		hypothetical protein LOC158724							102.0	98.0	100.0					X																	34148451		2178	4276	6454	SO:0001587	stop_gained	158724							g.chrX:34148451C>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1945G>T	X.37:g.34148451C>A	ENSP00000345029:p.Glu649*		Somatic					p.E649*	NM_203408	NP_981953	Capture	Illumina GAIIx	Phase_I	Q5JRC9	FA47A_HUMAN			1	1978	-			649					A8K8I9|Q8TAA0	Nonsense_Mutation	SNP	ENST00000346193.3	37	c.1945G>T	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	15.31	2.795344	0.50208	.	.	ENSG00000185448	ENST00000346193	.	.	.	1.16	-1.17	0.09648	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	6.5157	0.22246	0.0:0.5799:0.4201:0.0	.	.	.	.	X	649	.	ENSP00000345029:E649X	E	-	1	0	FAM47A	34058372	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.068000	0.14531	-0.493000	0.06678	-0.328000	0.08392	GAG		PASS	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		115	33	---	---	---	---
FAM47C	442444	broad.mit.edu	37	X	37029404	37029404	+	Missense_Mutation	SNP	A	A	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:37029404A>T	ENST00000358047.3	+	1	2973	c.2921A>T	c.(2920-2922)gAc>gTc	p.D974V		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	974								p.D974V(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GACATTCTTGACGGTCTTTAT	0.458																																						uc004ddl.1																			2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2920-2922)GAC>GTC		hypothetical protein LOC442444							132.0	128.0	129.0					X																	37029404		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37029404A>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2921A>T	X.37:g.37029404A>T	ENSP00000367913:p.Asp974Val		Somatic					p.D974V	NM_001013736	NP_001013758	Capture	Illumina GAIIx	Phase_I	Q5HY64	FA47C_HUMAN			1	2935	+			974					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2921A>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	A	9.282	1.048440	0.19827	.	.	ENSG00000198173	ENST00000358047	T	0.14144	2.53	0.502	0.502	0.16932	.	.	.	.	.	T	0.26122	0.0637	L	0.52573	1.65	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.07986	-1.0744	8	0.49607	T	0.09	.	.	.	.	.	974	Q5HY64	FA47C_HUMAN	V	974	ENSP00000367913:D974V	ENSP00000367913:D974V	D	+	2	0	FAM47C	36939325	0.723000	0.28027	0.014000	0.15608	0.013000	0.08279	0.737000	0.26144	0.400000	0.25396	0.242000	0.17961	GAC		PASS	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		190	58	---	---	---	---
ZNF81	347344	broad.mit.edu	37	X	47774987	47774987	+	Missense_Mutation	SNP	G	G	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:47774987G>T	ENST00000376954.1	+	6	1310	c.942G>T	c.(940-942)aaG>aaT	p.K314N	ZNF81_ENST00000338637.7_Missense_Mutation_p.K314N			P51508	ZNF81_HUMAN	zinc finger protein 81	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K314N(1)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				TTACACAGAAGCCACTACTCA	0.358																																						uc010nhy.1																			1	Substitution - Missense(1)		lung(1)		0						c.(940-942)AAG>AAT		zinc finger protein 81							30.0	28.0	28.0					X																	47774987		1838	4091	5929	SO:0001583	missense	347344					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47774987G>T	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.942G>T	X.37:g.47774987G>T	ENSP00000366153:p.Lys314Asn		Somatic					p.K314N	NM_007137	NP_009068	Capture	Illumina GAIIx	Phase_I	P51508	ZNF81_HUMAN			6	1310	+		all_lung(315;0.0973)	314					Q6RX22|Q96QH6	Missense_Mutation	SNP	ENST00000376954.1	37	c.942G>T	CCDS43933.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093803	0.36952	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.16597	2.33;2.33	4.16	2.27	0.28462	.	0.000000	0.42964	D	0.000634	T	0.10208	0.0250	N	0.26162	0.8	0.23101	N	0.998292	P	0.47409	0.895	B	0.41236	0.351	T	0.21075	-1.0256	10	0.25106	T	0.35	.	7.2815	0.26314	0.2463:0.0:0.7537:0.0	.	314	P51508	ZNF81_HUMAN	N	314	ENSP00000366153:K314N;ENSP00000341151:K314N	ENSP00000341151:K314N	K	+	3	2	ZNF81	47659931	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	-0.762000	0.04745	0.459000	0.27016	-0.380000	0.06706	AAG		PASS	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056455.2	NM_007137		63	15	---	---	---	---
SSX7	280658	broad.mit.edu	37	X	52679419	52679419	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:52679419T>C	ENST00000298181.5	-	5	472	c.314A>G	c.(313-315)cAg>cGg	p.Q105R		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.Q105R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					GAAGATTCTCTGGAGCCTGCA	0.408																																						uc004dqx.1																			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(313-315)CAG>CGG		synovial sarcoma, X breakpoint 7							135.0	123.0	127.0					X																	52679419		2203	4300	6503	SO:0001583	missense	280658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding	g.chrX:52679419T>C	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.314A>G	X.37:g.52679419T>C	ENSP00000298181:p.Gln105Arg		Somatic					p.Q105R	NM_173358	NP_775494	Capture	Illumina GAIIx	Phase_I	Q7RTT5	SSX7_HUMAN			5	473	-	Ovarian(276;0.236)		105						Missense_Mutation	SNP	ENST00000298181.5	37	c.314A>G	CCDS14343.1	.	.	.	.	.	.	.	.	.	.	N	0.051	-1.251731	0.01469	.	.	ENSG00000187754	ENST00000298181	T	0.09255	3.0	0.56	0.56	0.17279	.	2.530130	0.02701	N	0.111756	T	0.12518	0.0304	L	0.52759	1.655	0.09310	N	1	B	0.20368	0.044	B	0.17433	0.018	T	0.33752	-0.9856	9	0.49607	T	0.09	.	.	.	.	.	105	Q7RTT5	SSX7_HUMAN	R	105	ENSP00000298181:Q105R	ENSP00000298181:Q105R	Q	-	2	0	SSX7	52696144	0.001000	0.12720	0.001000	0.08648	0.009000	0.06853	0.388000	0.20735	0.429000	0.26202	0.146000	0.16034	CAG		PASS	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056671.1	NM_173358		12	172	---	---	---	---
RPS6KA6	27330	broad.mit.edu	37	X	83419352	83419352	+	Missense_Mutation	SNP	T	T	C			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:83419352T>C	ENST00000262752.2	-	2	132	c.125A>G	c.(124-126)gAa>gGa	p.E42G	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.E42G	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	42					axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E42G(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						AGAATCTGCTTCTCCCTCTTC	0.313																																						uc004eej.1																			1	Substitution - Missense(1)		lung(1)	lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						c.(124-126)GAA>GGA		ribosomal protein S6 kinase polypeptide 6							101.0	92.0	95.0					X																	83419352		2203	4296	6499	SO:0001583	missense	27330				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:83419352T>C	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.125A>G	X.37:g.83419352T>C	ENSP00000262752:p.Glu42Gly		Somatic				RPS6KA6_uc011mqt.1_Missense_Mutation_p.E42G|RPS6KA6_uc011mqu.1_5'UTR	p.E42G	NM_014496	NP_055311	Capture	Illumina GAIIx	Phase_I	Q9UK32	KS6A6_HUMAN			2	202	-			42					B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	37	c.125A>G	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.957989	0.34565	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.70516	-0.49;-0.48	4.22	3.06	0.35304	.	0.376195	0.23799	N	0.044456	T	0.57286	0.2043	L	0.39020	1.185	0.41335	D	0.987268	B;B	0.29936	0.262;0.025	B;B	0.32465	0.146;0.045	T	0.48127	-0.9062	10	0.30854	T	0.27	.	7.076	0.25205	0.0:0.1077:0.0:0.8923	.	42;42	B7ZL90;Q9UK32	.;KS6A6_HUMAN	G	42	ENSP00000262752:E42G;ENSP00000440830:E42G	ENSP00000262752:E42G	E	-	2	0	RPS6KA6	83306008	1.000000	0.71417	0.918000	0.36340	0.995000	0.86356	3.131000	0.50515	0.515000	0.28320	0.350000	0.21858	GAA		PASS	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496		4	117	---	---	---	---
TCEAL2	140597	broad.mit.edu	37	X	101382147	101382147	+	Missense_Mutation	SNP	G	G	T	rs372189969		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:101382147G>T	ENST00000372780.1	+	3	564	c.345G>T	c.(343-345)gaG>gaT	p.E115D	TCEAL2_ENST00000329035.2_Missense_Mutation_p.E115D	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E115D(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						cagagagtgagggagagCCAG	0.542																																						uc004eip.2																			1	Substitution - Missense(1)		lung(1)		0						c.(343-345)GAG>GAT		transcription elongation factor A (SII)-like 2							79.0	84.0	82.0					X																	101382147		2203	4300	6503	SO:0001583	missense	140597				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:101382147G>T	AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.345G>T	X.37:g.101382147G>T	ENSP00000361866:p.Glu115Asp		Somatic					p.E115D	NM_080390	NP_525129	Capture	Illumina GAIIx	Phase_I	Q9H3H9	TCAL2_HUMAN			3	564	+			115					B2R5C7	Missense_Mutation	SNP	ENST00000372780.1	37	c.345G>T	CCDS14496.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608209	0.46527	.	.	ENSG00000184905	ENST00000372780;ENST00000329035	T;T	0.26957	1.7;1.7	3.36	1.04	0.20106	.	0.000000	0.36268	N	0.002699	T	0.17704	0.0425	L	0.29908	0.895	0.09310	N	1	P	0.52170	0.951	P	0.47118	0.538	T	0.11348	-1.0591	10	0.29301	T	0.29	.	4.6129	0.12411	0.4577:0.0:0.5423:0.0	.	115	Q9H3H9	TCAL2_HUMAN	D	115	ENSP00000361866:E115D;ENSP00000332359:E115D	ENSP00000332359:E115D	E	+	3	2	TCEAL2	101268803	0.000000	0.05858	0.009000	0.14445	0.534000	0.34807	-1.294000	0.02767	0.101000	0.17610	0.594000	0.82650	GAG		PASS	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057605.1	NM_080390		64	13	---	---	---	---
NRK	203447	broad.mit.edu	37	X	105152720	105152720	+	Splice_Site	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:105152720G>A	ENST00000243300.9	+	13	1390	c.1087G>A	c.(1087-1089)Gga>Aga	p.G363R	NRK_ENST00000428173.2_Splice_Site_p.G364R	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	363					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.G363R(1)|p.G364R(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TTATTTTAGAGGACCCTCTTG	0.443										HNSCC(51;0.14)																												uc004emd.2																			2	Substitution - Missense(2)		lung(2)	breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(1087-1089)GGA>AGA		Nik related kinase							31.0	30.0	31.0					X																	105152720		1894	4121	6015	SO:0001630	splice_region_variant	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105152720G>A	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1086-1G>A	X.37:g.105152720G>A		HNSCC(51;0.14)	Somatic				NRK_uc010npc.1_Missense_Mutation_p.G31R	p.G363R	NM_198465	NP_940867	Capture	Illumina GAIIx	Phase_I	Q7Z2Y5	NRK_HUMAN			13	1390	+			363					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.1087G>A		.	.	.	.	.	.	.	.	.	.	G	16.78	3.217280	0.58560	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.77877	1.87;-1.13	4.35	4.35	0.52113	Protein kinase-like domain (1);	0.321942	0.22718	N	0.056500	T	0.76176	0.3951	N	0.14661	0.345	0.80722	D	1	D;D	0.71674	0.998;0.993	D;P	0.70935	0.971;0.819	T	0.76702	-0.2862	10	0.46703	T	0.11	.	11.2177	0.48835	0.0:0.0:1.0:0.0	.	31;363	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	R	363;364	ENSP00000434830:G363R;ENSP00000438378:G364R	ENSP00000434830:G363R	G	+	1	0	NRK	105039376	1.000000	0.71417	0.993000	0.49108	0.925000	0.55904	3.817000	0.55668	2.417000	0.82017	0.600000	0.82982	GGA		PASS	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	Missense_Mutation	39	16	---	---	---	---
MCF2	4168	broad.mit.edu	37	X	138671994	138671994	+	Splice_Site	SNP	C	C	T			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:138671994C>T	ENST00000370576.4	-	20	2579	c.2370G>A	c.(2368-2370)caG>caA	p.Q790Q	MCF2_ENST00000338585.6_Splice_Site_p.Q806Q|MCF2_ENST00000519895.1_Splice_Site_p.Q866Q|MCF2_ENST00000414978.1_Splice_Site_p.Q850Q|MCF2_ENST00000370573.4_Splice_Site_p.Q790Q|MCF2_ENST00000536274.1_Splice_Site_p.Q751Q|MCF2_ENST00000520602.1_Splice_Site_p.Q850Q|MCF2_ENST00000370578.4_Splice_Site_p.Q935Q	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	790	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q790Q(2)|p.Q866Q(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					AATGACCAACCTGGACAATAT	0.318																																						uc004fau.2																			3	Substitution - coding silent(3)		lung(3)	lung(1)|pleura(1)	2						c.(2368-2370)CAG>CAA		MCF.2 cell line derived transforming sequence							64.0	60.0	61.0					X																	138671994		2203	4296	6499	SO:0001630	splice_region_variant	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138671994C>T		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.2370+1G>A	X.37:g.138671994C>T			Somatic				MCF2_uc004fav.2_Silent_p.Q806Q|MCF2_uc011mwl.1_Silent_p.Q767Q|MCF2_uc010nsh.1_Silent_p.Q790Q|MCF2_uc011mwm.1_Silent_p.Q751Q|MCF2_uc011mwn.1_Silent_p.Q935Q|MCF2_uc004faw.2_Silent_p.Q850Q|MCF2_uc011mwo.1_Silent_p.Q866Q	p.Q790Q	NM_005369	NP_005360	Capture	Illumina GAIIx	Phase_I	P10911	MCF2_HUMAN			20	2664	-	Acute lymphoblastic leukemia(192;0.000127)		790			PH.		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Silent	SNP	ENST00000370576.4	37	c.2370G>A	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606151	0.28623	.	.	ENSG00000101977	ENST00000437564	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	T	0.74816	0.3766	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72972	-0.4129	4	.	.	.	.	18.1417	0.89642	0.0:1.0:0.0:0.0	.	.	.	.	S	294	.	.	G	-	1	0	MCF2	138499660	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	6.030000	0.70903	2.508000	0.84585	0.544000	0.68410	GGC		PASS	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369	Silent	72	19	---	---	---	---
MAGEC1	9947	broad.mit.edu	37	X	140995192	140995192	+	Missense_Mutation	SNP	G	G	A			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chrX:140995192G>A	ENST00000285879.4	+	4	2288	c.2002G>A	c.(2002-2004)Gag>Aag	p.E668K	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	668								p.E668K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCCTCCTGAGGGGATGCA	0.577										HNSCC(15;0.026)																												uc004fbt.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2002-2004)GAG>AAG		melanoma antigen family C, 1							92.0	96.0	95.0					X																	140995192		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140995192G>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2002G>A	X.37:g.140995192G>A	ENSP00000285879:p.Glu668Lys	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.E668K	NM_005462	NP_005453	Capture	Illumina GAIIx	Phase_I	O60732	MAGC1_HUMAN			4	2288	+	Acute lymphoblastic leukemia(192;6.56e-05)		668					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.2002G>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	11.49	1.655132	0.29425	.	.	ENSG00000155495	ENST00000285879	T	0.03580	3.88	0.901	-1.8	0.07907	.	.	.	.	.	T	0.01870	0.0059	N	0.14661	0.345	0.80722	D	1	B	0.33494	0.414	B	0.22386	0.039	T	0.54275	-0.8318	9	0.87932	D	0	.	5.5888	0.17289	1.0E-4:0.3442:0.6557:0.0	.	668	O60732	MAGC1_HUMAN	K	668	ENSP00000285879:E668K	ENSP00000285879:E668K	E	+	1	0	MAGEC1	140822858	0.002000	0.14202	0.038000	0.18304	0.038000	0.13279	-2.563000	0.00919	0.158000	0.19367	0.160000	0.16472	GAG		PASS	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		6	417	---	---	---	---
LOC100128164	100128164	broad.mit.edu	37	3	169664945	169664946	+	RNA	DEL	GT	GT	-	rs151197602|rs57058253|rs149055674|rs57886512		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr3:169664945_169664946delGT	ENST00000487580.1	-	0	263				RP11-379K17.4_ENST00000600502.1_RNA|RP11-379K17.4_ENST00000483289.2_RNA																							AGGTATATTCgtgtgtgtgtgt	0.411																																						uc011bpp.1																			0					0								Homo sapiens cDNA FLJ41016 fis, clone UTERU2018784.																																						100128164							g.chr3:169664945_169664946delGT																													3.37:g.169664955_169664956delGT			Somatic						NR_027622		Capture	Illumina GAIIx	Phase_I					2		-									RNA	DEL	ENST00000487580.1	37	c.2857_2858delAC																																																																																						RP11-379K17.4-003	KNOWN	basic|exp_conf	antisense	antisense	OTTHUMT00000351957.1			4	2	---	---	---	---
CROT	54677	broad.mit.edu	37	7	87027922	87027923	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:87027922_87027923delCA	ENST00000331536.3	+	18	1986_1987	c.1801_1802delCA	c.(1801-1803)catfs	p.H601fs	CROT_ENST00000419147.2_Frame_Shift_Del_p.H629fs	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	601					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TTGTGCTTTTCATGATATGATA	0.396																																						uc003uit.2																			0				ovary(2)|lung(1)	3						c.(1801-1803)CATfs		peroxisomal carnitine O-octanoyltransferase	L-Carnitine(DB00583)																																			SO:0001589	frameshift_variant	54677				fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity	g.chr7:87027922_87027923delCA		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1801_1802delCA	7.37:g.87027922_87027923delCA	ENSP00000331981:p.His601fs		Somatic				CROT_uc003uiu.2_Frame_Shift_Del_p.H629fs	p.H601fs	NM_021151	NP_066974	Capture	Illumina GAIIx	Phase_I	Q9UKG9	OCTC_HUMAN			18	2046_2047	+	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		601					A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Frame_Shift_Del	DEL	ENST00000331536.3	37	c.1801_1802delCA	CCDS5604.1																																																																																					CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151		107	133	---	---	---	---
HEPACAM2	253012	broad.mit.edu	37	7	92848753	92848754	+	Frame_Shift_Ins	INS	-	-	A	rs375176875		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr7:92848753_92848754insA	ENST00000394468.2	-	2	167_168	c.90_91insT	c.(88-93)tcggggfs	p.G31fs	HEPACAM2_ENST00000440868.1_Frame_Shift_Ins_p.G19fs|HEPACAM2_ENST00000341723.4_Frame_Shift_Ins_p.G19fs|HEPACAM2_ENST00000453812.2_Frame_Shift_Ins_p.G54fs	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	31			G -> R (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)		p.S30S(1)|p.G19R(1)|p.S18S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						ACCTTCAGCCCCGAGCAAGCAC	0.515																																						uc003umm.2																			3	Substitution - coding silent(2)|Substitution - Missense(1)	p.G19R(1)	lung(2)|breast(1)	ovary(3)|breast(1)|kidney(1)	5						c.(88-93)TCGGGGfs		HEPACAM family member 2 isoform 1																																				SO:0001589	frameshift_variant	253012					integral to membrane		g.chr7:92848753_92848754insA	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.90_91insT	7.37:g.92848753_92848754insA	ENSP00000377980:p.Gly31fs		Somatic				HEPACAM2_uc003uml.2_Frame_Shift_Ins_p.S18fs|HEPACAM2_uc010lff.2_Frame_Shift_Ins_p.S18fs|HEPACAM2_uc011khy.1_Frame_Shift_Ins_p.S53fs	p.S30fs	NM_001039372	NP_001034461	Capture	Illumina GAIIx	Phase_I	A8MVW5	HECA2_HUMAN			2	113_114	-			30_31		G -> R (in a breast cancer sample; somatic mutation).			B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Frame_Shift_Ins	INS	ENST00000394468.2	37	c.90_91insT	CCDS43616.1																																																																																					HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151		198	190	---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113332151	113332151	+	Frame_Shift_Del	DEL	C	C	-			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr8:113332151delC	ENST00000297405.5	-	46	7469	c.7225delG	c.(7225-7227)gaafs	p.E2409fs	CSMD3_ENST00000343508.3_Frame_Shift_Del_p.E2369fs|CSMD3_ENST00000455883.2_Frame_Shift_Del_p.E2305fs|CSMD3_ENST00000352409.3_Frame_Shift_Del_p.E2339fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2409	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCATCATCTTCCGTCAAAATT	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2																			0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(7225-7227)GAAfs		CUB and Sushi multiple domains 3 isoform 1							124.0	126.0	125.0					8																	113332151		2203	4300	6503	SO:0001589	frameshift_variant	114788					integral to membrane|plasma membrane		g.chr8:113332151delC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7225delG	8.37:g.113332151delC	ENSP00000297405:p.Glu2409fs	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Frame_Shift_Del_p.E1611fs|CSMD3_uc003ynt.2_Frame_Shift_Del_p.E2369fs|CSMD3_uc011lhx.1_Frame_Shift_Del_p.E2305fs|CSMD3_uc003ynw.1_Frame_Shift_Del_p.E120fs	p.E2409fs	NM_198123	NP_937756	Capture	Illumina GAIIx	Phase_I	Q7Z407	CSMD3_HUMAN			46	7384	-			2409			Extracellular (Potential).|Sushi 13.		Q96PZ3	Frame_Shift_Del	DEL	ENST00000297405.5	37	c.7225delG	CCDS6315.1																																																																																					CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		157	195	---	---	---	---
ANKRD30A	91074	broad.mit.edu	37	10	37440998	37440998	+	Frame_Shift_Del	DEL	C	C	-			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr10:37440998delC	ENST00000602533.1	+	12	1587	c.1488delC	c.(1486-1488)ttcfs	p.F496fs	ANKRD30A_ENST00000374660.1_Frame_Shift_Del_p.F496fs|ANKRD30A_ENST00000361713.1_Frame_Shift_Del_p.F496fs			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	552					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F496L(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ATCCGATGTTCCCACCAGAAT	0.284																																						uc001iza.1																			1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(1486-1488)TTCfs		ankyrin repeat domain 30A							116.0	105.0	108.0					10																	37440998		1792	4064	5856	SO:0001589	frameshift_variant	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37440998delC	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1488delC	10.37:g.37440998delC	ENSP00000473551:p.Phe496fs		Somatic					p.F496fs	NM_052997	NP_443723	Capture	Illumina GAIIx	Phase_I	Q9BXX3	AN30A_HUMAN			12	1587	+			552					Q5W025	Frame_Shift_Del	DEL	ENST00000602533.1	37	c.1488delC																																																																																						ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		85	37	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578195	7578197	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr17:7578195_7578197delCAC	ENST00000269305.4	-	6	841_843	c.652_654delGTG	c.(652-654)gtgdel	p.V218del	TP53_ENST00000445888.2_In_Frame_Del_p.V218del|TP53_ENST00000413465.2_In_Frame_Del_p.V218del|TP53_ENST00000455263.2_In_Frame_Del_p.V218del|TP53_ENST00000359597.4_In_Frame_Del_p.V218del|TP53_ENST00000420246.2_In_Frame_Del_p.V218del|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	218	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(11)|p.V218E(8)|p.0?(8)|p.V218M(7)|p.V218G(5)|p.V218del(5)|p.V218A(3)|p.S215fs*27(1)|p.S215fs*29(1)|p.V218_P219insX(1)|p.V218_Y220delVPY(1)|p.V216_Y220delVVVPY(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.V218L(1)|p.V218_E221delVPYE(1)|p.V218V(1)|p.V218fs*26(1)|p.S215_V218>R(1)|p.T211fs*28(1)|p.V218_E224delVPYEPPE(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTCATAGGGCACCACCACACTA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		62	Substitution - Missense(24)|Unknown(11)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(2)|Insertion - In frame(1)|Substitution - coding silent(1)	p.V218E(8)|p.V218M(7)|p.0?(7)|p.V218G(5)|p.V218del(5)|p.V218A(3)|p.K164_P219del(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V218_P219insX(1)|p.V218_Y220delVPY(1)|p.V216_Y220delVVVPY(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.?(1)|p.V218L(1)|p.V218_E221delVPYE(1)|p.V218V(1)|p.V218fs*26(1)|p.S215_V218>R(1)|p.T211fs*28(1)|p.V218_E224delVPYEPPE(1)	oesophagus(9)|endometrium(6)|upper_aerodigestive_tract(5)|biliary_tract(5)|haematopoietic_and_lymphoid_tissue(5)|peritoneum(4)|bone(4)|central_nervous_system(3)|large_intestine(3)|urinary_tract(3)|liver(3)|lung(3)|ovary(3)|stomach(2)|cervix(1)|soft_tissue(1)|skin(1)|breast(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CI084336	TP53	I		c.(652-654)GTGdel	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a																																				SO:0001651	inframe_deletion	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578195_7578197delCAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.652_654delGTG	17.37:g.7578201_7578203delCAC	ENSP00000269305:p.Val218del	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_In_Frame_Del_p.V218del|TP53_uc002gih.2_In_Frame_Del_p.V218del|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_In_Frame_Del_p.V86del|TP53_uc010cng.1_In_Frame_Del_p.V86del|TP53_uc002gii.1_In_Frame_Del_p.V86del|TP53_uc010cnh.1_In_Frame_Del_p.V218del|TP53_uc010cni.1_In_Frame_Del_p.V218del|TP53_uc002gij.2_In_Frame_Del_p.V218del|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_In_Frame_Del_p.V125del|TP53_uc002gio.2_In_Frame_Del_p.V86del|TP53_uc010vug.1_In_Frame_Del_p.V179del	p.V218del	NM_001126112	NP_001119584	Capture	Illumina GAIIx	Phase_I	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	846_848	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	218		V -> A (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	c.652_654delGTG	CCDS11118.1																																																																																					TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		25	45	---	---	---	---
MC3R	4159	broad.mit.edu	37	20	54823995	54823995	+	Frame_Shift_Del	DEL	C	C	-	rs369920230		TCGA-37-4133-01A-01D-1352-08	TCGA-37-4133-10A-01D-1352-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a678cc49-9009-4027-826f-e17f4533538d	843162db-7cdc-45db-b873-ff066eb78fcf	g.chr20:54823995delC	ENST00000243911.2	+	1	208	c.96delC	c.(94-96)agcfs	p.S32fs		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	32					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			AGAGCAGCAGCGCCTTCTGTG	0.562																																						uc002xxb.2																			0				ovary(2)|breast(2)	4						c.(94-96)AGCfs		melanocortin 3 receptor							124.0	115.0	118.0					20																	54823995		2203	4300	6503	SO:0001589	frameshift_variant	4159				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding	g.chr20:54823995delC		CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.96delC	20.37:g.54823995delC	ENSP00000243911:p.Ser32fs		Somatic					p.S32fs	NM_019888	NP_063941	Capture	Illumina GAIIx	Phase_I	P41968	MC3R_HUMAN	Colorectal(105;0.202)		1	208	+			69			Extracellular (Potential).		Q4KN27|Q9H517	Frame_Shift_Del	DEL	ENST00000243911.2	37	c.96delC	CCDS13449.2																																																																																					MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			195	86	---	---	---	---
